article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
anorectal melanomas comprise approximately 1% of all melanomas and about 0.52% of all anorectal malignancies .
common presentations for anorectal melanoma include rectal bleeding , anorectal pain , change in bowel habits or a rectal mass .
therefore , given the lack of pathognomonic clinical complaints , early diagnosis is difficult to make .
this represents a significant clinical challenge since early diagnosis and treatment are crucial . conventionally ,
therapy for anorectal melanoma consists of a complete surgical resection of the tumor for local control of the disease .
this can be done by means of sphincter- sparing wide local excision ( wle ) or abdominoperineal resection ( apr ) in cases of large tumors or when wle is not feasible .
radiotherapy may be used to enhance regional control but has no impact on overall survival .
the majority of patients progress to metastatic disease , and the use of chemotherapy has been advocated in such cases to improve the overall survival .
in april 2013 , a 71-year - old female with no significant past medical history presented to our institution with painful bowel movements for the last 3 months .
the patient also noticed blood - streaked stools and reported a 16-lb unintentional weight loss over a 1-year period .
the review of her systems was negative otherwise . on examination : the woman was 5 7.5 ( 1.715 m ) tall , weight was 172 lb ( 78.019 kg ) , with a bmi of 26.54 , and her vital signs were normal .
digital examination of the rectum revealed two small hemorrhoids at the 6 o'clock position and a firm , nonobstructing mass near the anal verge .
the patient underwent a colonoscopy in september 2013 which revealed a nonobstructing , ulcerated anal mass , approximately 1 cm from the anal verge .
stains for ck5/6 and p63 were positive , likely suggesting a primary squamous cell carcinoma of the anus .
a ct of the abdomen and pelvis demonstrated an abnormal mass at the anorectal junction , with no evidence of lymph nodes or liver metastases in september 2013 ( fig .
pet combined with a ct scan demonstrated marked metabolic activity in the primary anal mass and a 1-cm perirectal lymph node near the coccyx , suggesting a node - positive disease in october 2013 ( fig .
the patient 's tumor was sent to an outside institution for a second opinion , and the report was concluded as the tumor may in fact be a malignant melanoma .
the patient subsequently underwent an exploratory laparotomy with an apr and left - end colostomy in october 2013 .
the pathologic specimen confirmed a malignant melanoma arising in the anal skin and extending into the rectum , involving the anal and perirectal soft tissue and 6 regional lymph nodes ( fig .
the tumor was classified as grade 3 , poorly differentiated , stage iiia , t2n1m0 according to the tumor - node - metastasis classification of colorectal cancer .
immunohistochemical analysis results were positive for the expression of the s-100 protein , hmb-45 and vimentin , whereas negative for the expression of cytokeratin and sma ( fig .
the patient agreed to the plan of starting chemotherapy with mitomycin and 5-fluorouracil ( for the anorectal melanoma ) .
primary malignant melanoma of the anus and rectum is a rare and highly lethal malignancy of the elderly , which often manifests at an advanced stage .
mucosal melanomas represent approximately 1.2% of all melanomas and anorectal melanomas account for less than 25% of all mucosal melanomas .
in addition , it is the most common primary melanoma of the gastrointestinal tract and accounts for approximately 0.5% of all colorectal and anal cancers .
the tumor commonly affects females in their fifth or sixth decade [ 9 , 10 ] with a 1.7-fold higher prevalence in caucasians than in african americans .
the incidence rate is reported as 0.4% per million with a 1.8-fold increase in incidence in the last 2 decades , suggesting either a true increase in incidence or an improvement in diagnosis .
a melanoma of the anus and rectum was first reported by moore in 1857 .
lesions can affect the anal canal , the rectum or both , with the majority occurring within 6 cm of the anal rim .
common presenting symptoms include rectal bleeding , anorectal pain or discomfort , change in bowel habits , prolapsed tumor mass and hemorrhoids .
primary anorectal malignant melanomas are in almost 80% of the times mostly misdiagnosed as hemorrhoids , polyp , adenocarcinoma or rectal ulcer .
grossly , the majority of lesions appears polypoid , with or without pigmentation , and can be ulcerated as well .
the tumor is amelanotic in about 30% of the cases , and with considerable morphologic variability , misdiagnosis as lymphoma , carcinoma or sarcoma is common [ 14 , 15 ] .
the use of immunohistochemistry panels , including s-100 proteins , melana , hmb-45 and tyrosinase , can help in the diagnosis . in our case ,
chute et al . reported 4 histologic cell types : epithelioid , spindle cell , lymphoma - like and pleomorphic .
the mitotic rate averaged 2.8 mitotic figures per high - power field in 17 cases of a primary anorectal malignant melanoma .
it is presumed that primary anorectal malignant melanoma arises from normal melanocytes in the intestinal epithelium distal to the dentate line and extending proximally into the rectum .
kit expression can be present in anorectal malignant melanomas and , when present in spindle cell subtypes , can lead to confusion with gastrointestinal stromal tumors . as in cutaneous melanomas , loss of c
- kit expression is associated with aggressive clinical behavior , it was postulated that a loss of kit might play a role in the pathogenesis [ 5 , 17 ] , therefore suggesting a role of kinase inhibitors such as imatinib .
the 5-year survival rate has been reported to be less than 20% for anorectal melanomas , with a median survival of 24 months .
prognostic factors include the stage of the disease at the time of diagnosis and the tumor thickness .
as this is a relatively rare entity , we lack randomized control trials regarding appropriate management , and current evidence is mostly based on retrospective studies , reported as a limited number of cases or data collected over prolonged time periods , including patients with an age of up to 64 years [ 21 , 22 ] .
a meta - analysis of 426 patients did not demonstrate any survival advantage with either approach .
studies reported that local disease seems to be more effectively controlled with apr [ 21 , 25 , 26 ] .
recent studies suggested the initial treatment of choice to be wle because radical surgery failed to show any survival advantage and also to avoid the need for colostomy [ 25 , 26 ] .
radiation therapy has reported to provide a better local control after wle and also seems beneficial for sphincter preservation .
most patients die regardless of the chosen therapeutic strategy due to the aggressive nature and the rapid progression of the tumor .
kim et al . conducted a retrospective review on 18 patients with metastatic anorectal melanoma treated with cisplatin - based chemotherapy in combination with interferon alpha-2b or interleukin-2 .
the authors declare that there are no conflicts of interest regarding the publication of this paper . | primary malignant melanoma of the anus and rectum is a rare and aggressive neoplasm that tends to invade locally and metastasize early in the course of the disease .
it is often misdiagnosed as hemorrhoids or as one of the other benign anorectal conditions and is thus linked to an overall poor prognosis and a 5-year survival rate of less than 20% .
optimal treatment is still controversial , and current evidence does not show any preferential survival benefit from abdominoperineal resection over wide local excision .
chemotherapy or radiotherapy may be used for advanced disease .
we report a 71-year - old female presenting with painful bowel movements and blood in stools .
she was eventually found to have a mass arising from the anorectal junction with regional lymph node involvement .
the patient underwent an abdominoperineal resection and is currently scheduled for chemotherapy . |
general accounting office , 1991a ; iglehart , 1991a , 1991b , 1988a , 1988b ) , financing and cost - containment mechanisms ( u.s .
general accounting office , 1991b ) , and levels of health care spending ( schieber , poullier , and greenwald , 1991 ) .
however , little has been written about the comparative differences or similarities of specific services within these systems , such as preventive health services directed at children or pregnant women ( williams and miller , 1991 ; starfield , 1991 ; u.s .
, i examine the health care systems of six industrialized countries ( canada , sweden , france , germany , japan , and the united kingdom ) , compare their basic structures and financing arrangements , and describe how these systems address certain preventive health care needs of children and pregnant women as part of a focus on primary care . despite wide variations in financing mechanisms , levels of health care spending , and cost - containment strategies among these six systems ,
additionally , access and outcome measures such as insurance coverage , prenatal care , high - risk pregnancy outreach , home visiting , immunization , universal periodic screening for children , infant mortality , and low birth weight are better than those of the united states .
the variations in program structure and financing suggest that effective health care programs for this population need not be restricted to any single organizational structure ; this should offer flexibility to health care reformers in this country seeking models for expanding preventive services .
selected health status and health care system characteristics of six industrialized nations described in the 1991 organization for economic cooperation and development ( oecd ) health data file ( schieber , poullier , and greenwald , 1993 ) were analyzed and supplemented with information from several sources that describe services for children and pregnant women .
the oecd data characteristics analyzed included per capita gross domestic product ( gdp ) and percent of gdp spent on health care , public spending as a percent of health care spending , and number of physicians per capita .
other characteristics derived from supplementary sources include percent of physicians in primary care and , for children and pregnant women , measures of health status ( infant mortality rates , percent of low - birth - weight infants , maternal mortality rates , and percent of births delivered by cesarean section ) , preventive services ( rates of pediatric immunization , presence of universal periodic preventive screening , home visitation services , high - risk pregnancy outreach , duration of maternity leave , and level of maternity financial support ) , and access to care ( percent of women of childbearing age and children without health insurance ) . however , methodological problems exist with most comparative international studies .
health outcomes , for example , are determined by a variety of sociocultural factors that lack sufficient descriptive data .
recent analysis of international infant mortality rates finds less disparity between the united states and other industrialized countries when adjusting for definitional differences applied to infant mortality ( liu et al . , 1992 ) . despite these limitations ,
relative , rather than absolute , differences are useful in understanding international health care systems and their services .
the six countries described reflect a wide diversity in organizational structure for the delivery of health care , in cost containment and financing mechanisms . the organizational structure and decision - making process
are represented by single - payer centralized systems ( canada , united kingdom ) and decentralized systems ( sweden ) .
other countries rely on quasi - public , employer - based sickness funds with variable coverage through public insurance ( germany , japan , france ) .
private health insurance plays only a minor , supplementary role in all the foreign countries .
by contrast , in the united states , the health care system is very decentralized and based predominantly on a system of private health insurance .
public programs generally serve the elderly and certain categorical groups of poor women and children .
none of these countries , except the united states , contains any significant percentage of uninsured children or women of childbearing age . in 1991 , per capita spending and percent of gdp spent on health care were all substantially less than in the united states ( figure 1 ) .
the country with the next - highest spending per capita on health care was canada .
the united states spent roughly 50 percent more per capita on health care than canada , and some 175 percent more than the united kingdom .
the percent of gdp spent on health care reflects a similar pattern ( table 1 ) .
the united states spent 13.2 percent of its gdp on health in 1991 , compared with 6.6 - 10.0 percent for the six other countries .
although only 42 percent of health care spending in the united states is publicly funded , well over 70 percent is publicly funded in the six countries .
partially because of the substantial public funding of health care , all six countries implement significant national cost - control measures ( chaulk and bialek , 1993 ) , including systemwide global budgets ( canada , united kingdom ) ( u.s .
general accounting office , 1991a ) , expenditure targets or global budgets for hospitals and/or office - based physicians ( france , sweden , germany ) ( rodwin et al .
general accounting office , 1991b , 1993b ) , provider fee schedules ( germany , japan , sweden , france ) ( ikegami , 1990 ; brenner and rublee , 1992 ) or capitated fees ( united kingdom ) ( ham , 1988 ) , prohibitions on balance billing ( japan , sweden ) , and limitations on medical malpractice ( canada , japan ) ( coyte , dewees , and trebilock , 1991 ; employee benefits research institute , 1990a ) .
by contrast , cost containment in the united states is less comprehensive and generally limited to hospital and provider fees under certain public programs such as medicare and medicaid , patient cost sharing , and varying managed - care arrangements . in terms of physician supply , four of the six countries have 2.2 - 3.1 physicians per capita , and the other two ( japan , united kingdom ) have roughly 1.5 physicians per capita .
however , the specialty distribution of physicians is strikingly different between the united states and the other countries . in the united states ,
only about 33 percent of all physicians declare themselves to be primary care physicians ( politzer et al . , 1991 ) .
this contrasts with the other countries , which have predominantly primary care physicians ( 53 - 63 percent ) ( chaulk and bialek , 1993 ; rodwin et al . , 1990 ; fielding and pierre - jean , 1993 ; mcauley , 1992 ) .
in all six countries , prenatal care is comprehensive , accessible , and either free or accompanied by financial assistance .
public prenatal clinics often coordinate maternity services and prenatal care for women ( goodwin , 1990 ) .
for example , in japan , prenatal care is not a routine health insurance benefit . instead
, comprehensive maternity services are provided through public programs ; however , complications occurring during pregnancy are covered by health insurance .
japan 's focus on prenatal care and children 's health began following world war ii as part of its national reconstruction effort . by the late 1950s ,
national guidelines led to the establishment of maternal and child health clinics throughout the country . by 1965 , when these guidelines were enacted as the maternal and child health law , there were more than 400 such clinics nationwide . during this period of systemic focus on maternal services , japan experienced a progressive lowering of its infant mortality rate per 1,000 live births from 60.1 in 1950 to 30.1 in 1960 , 13.1 in 1970 , 7.5 in 1980 , and finally 4.6 in 1990 ( mother 's and children 's health organization , 1992 ) . in the six countries ,
non - physicians provide varying amounts of prenatal care , although they do so to a greater extent than do non - physicians in the united states .
for example , in some countries prenatal care is provided predominantly by midwives ( sweden , united kingdom ) with obstetricians and family physicians providing specialty care ( kohler and jakobsson , 1987 ; blondel , pusch , and schmidt , 1986 ) . in france , prenatal care
is shared more equally by midwives and physicians ( mostly obstetricians ) . however , in japan , although physicians share the provision of prenatal care with midwives ( of which there were 22,918 in 1990 ) ( mother 's and children 's health organization , 1992 ) , labor and delivery remain the province primarily of physicians .
many of the six countries use outreach programs for high - risk pregnant women and for postpartum care .
home visiting nurses usually provide this service ( sweden , france , germany ) ( blondel , pusch , and schmidt , 1986 ; ierodiaconou , 1986 ) , although community midwives and nurses provide postpartum evaluation to women following delivery ( united kingdom , japan ) ( williams and miller , 1991 ; chaulk and bialek , 1993 ) .
these programs may contribute to the lower infant mortality rates ( 4.59 - 8.42 per 1,000 live births ) and fewer low - birth - weight infants ( 4 - 7 percent ) in these countries than in the united states ( 9.8 and 7 percent , respectively ) ( national commission to prevent infant mortality , 1992 ) .
in addition to lower infant mortality rates , four of the six countries have maternal mortality rates below those of the united states ( abouzahr and royston , 1991 ) ( table 2 ) .
cesarean - section deliveries of infants , generally indicative of pregnancy complications , occur far less frequently in these countries than in the united states ( notzon , 1990 ) . in all six countries , pregnancy benefits ( referred to as maternal disability benefits )
are comprehensive , financially generous , and extend for relatively long periods of time ( employee benefits research institute , 1990b ) . to encourage early prenatal care , pregnant women are offered financial incentives , such as stipends and maternity bonuses or grants , to seek early prenatal care and help defray medical expenses associated with pregnancy ( germany , japan ) ( ierodiaconou , 1986 ) . for high - risk women and women with prenatal complications ,
visiting nurses routinely perform prenatal evaluations and screening and ensure that women obtain full prenatal services ( france , germany , united kingdom , sweden ) ( williams and miller , 1991 ; blondel , pusch , and schmidt , 1986 ; ierodiaconou , 1986 ; miller , 1988 ) .
visiting nurses also provide periodic postpartum visits ( united kingdom ) ( williams and miller , 1991 ) .
other incentives , such as maternal and child health handbooks and prenatal care certificates , entitle pregnant women to a variety of benefits , including free prenatal visits , pharmaceuticals , and home - visiting services when the patient is confined to bed .
family - planning services and free pharmaceuticals are otherwise provided in public prenatal clinics ( united kingdom ) ( goodwin , 1990 ) .
these targeted incentives encourage early and periodic prenatal care and routine infant examinations ( u.s .
because of the accessibility to services and the absence of financial barriers , prenatal care appears to be readily used in all six foreign countries ( blondel , pusch , and schmidt , 1986 ) . in these countries ,
maternal benefits are treated much like disability benefits . however , in the united states , maternity and parental leave were not statutorily protected under federal law until 1993 . during the 102nd congress , the family and medical leave act ( 1993 )
was passed , requiring businesses with more than 50 employees to give 12 weeks unpaid leave for family illness or maternity reasons . in contrast , maternal disability in the other six industrialized countries has been an established benefit , with protected leave ranging from 14 weeks ( germany , japan ) to 25 weeks ( canada ) .
financial support under maternal disability is also more generous than in the united states , which does not guarantee cash maternity benefits . during each pregnancy ,
all six countries provide periodic payments based on existing disability benefit programs ( canada , japan , sweden ) or under distinct cash maternity - disability - benefit plans ( france , germany , united kingdom ) .
japan also provides pregnant women with a maternity grant sufficient to cover most maternity - related expenses ( employee benefits research institute , 1990a ) .
in the six industrialized countries , the approach to children 's health reflects a common theme : accessible , comprehensive , preventive services beginning at birth and extending into preschool and school health programs .
the multiplicity of locations for preventive care is one key feature of this approach ( miller , 1990 ) .
japan , for example , where pediatricians constitute some 4.8 percent of all physicians , relies on a system of more than 850 public health centers and 590 maternal and child health centers to provide a wide range of preventive services to newborns , infants , and older children ( japan research institute on child welfare , inc . ,
services include : ( 1 ) screening for metabolic diseases , hypothyroidism , hepatitis b , and neuroblastoma ; ( 2 ) providing all routine childhood vaccinations ; ( 3 ) conducting hearing , vision , and speech screening ; and ( 4 ) providing special services for low - birth - weight children with disabilities and children with chronic conditions ( approximately 95,000 ) , including malignant neoplasms , diabetes mellitus , and birth defects ( japan international cooperative agency , 1990 ) .
public health nurses also make home visits to provide preventive services to high - risk children . as part of an extensive school program in france for preschool children , a health care team , including a physician , nurse , child psychologist , and social worker ,
provides language and psychomotor skills assessment , hearing and vision screening , and physical examinations ( u.s . house of representatives , 1990 ) .
these children also may receive preventive care from public maternal and child health centers or from a private provider .
when a medical problem is identified , the child is referred to the patient 's physician for further evaluation and treatment .
when children enter the elementary school system , a health care team continues to provide periodic evaluation and screening of students .
school health services are coordinated with other school services to address health education and counseling issues such as nutrition .
sweden employs a system of child health centers throughout the country that performs health and developmental assessments for infants and children
. these centers also provide free immunizations for preschool children and conduct vision , hearing , and speech screening ( kohler and jakobsson , 1991 ) .
school health programs provide continued screening and assessment and also provide health education directed at alcohol and tobacco use ( kohler and jakobsson , 1987 ) .
this screening program involved counseling on oral hygiene , diet , and fluoride supplements , and was associated with a decline in the percent of children with dental caries ( from 65 percent in 1973 to 30 percent in 1983 ) ( kohler and jakobsson , 1991 ) .
most pediatric care in the united kingdom is provided through general practitioners who , under the british national health service , receive annual bonuses for achieving high immunization rates among their pediatric patients .
parents may obtain preventive services for their children from their general practitioner or from 1 of more than 3,000 community clinics .
utilization of well - child examinations is estimated to be greater than 95 percent for infants under 1 year of age and approximately 70 percent for children 1 - 5 years of age ( williams and miller , 1991 ) .
in addition , the home visiting service ( hvs ) provides preventive services and health promotion at home to high - risk children or children without ready access to a physician .
the hvs , which dates back to the late 1800s , has generally focused on maternal and child health , drawing upon the skills of registered nurses who frequently have additional training in public health .
hvs nurses provide screening , counseling , and health education services in order to identify existing or potential problems .
these nurses provide regular home visits to newborns and preventive counseling on breastfeeding , injury prevention , childhood immunizations , and health care .
hvs services for children usually include one prenatal visit and five visits from birth to 5 years of age .
although all british citizens are eligible for hvs services , frequent limitations on resources have focused services on children , especially high - risk children , or children in certain catchment areas ( u.s .
studies evaluating the efficacy of the hvs program suggest that it has been successful in teaching health promotion and disease prevention , increasing rates of immunization , and reducing hospitalizations for infants and children ( select committee on children , youth , and families , 1990 ) .
germany , with roughly 6 percent of all physicians identified as pediatricians ( compared with roughly 7 percent in the united states ) , provides most pediatric care through private , rather than public , health clinics ( williams and miller , 1991 ; federal ministry for youth , family affairs , women and health , 1988 ) .
routine newborn screening includes hypothyroidism , phenylketonuria , and galactosemia ( williams and miller , 1991 ) .
( in the united states , only the first two are routinely screened . ) in germany , infants and preschool children are entitled to a predetermined number of free comprehensive examinations .
public clinics provide limited preventive services , such as immunizations , primarily to poor families or those without insurance ( such as immigrant families ) ( u.s .
canada , although it has not established a governmental agency formally charged with responsibility for maternal and child health issues , provides comprehensive pediatric services under its universal system of health insurance .
many provinces have developed an extensive network of community health centers that deliver a wide range of preventive services , including well - baby care , postpartum care , and immunizations ( pless , 1990 ) .
the canadian task force on the periodic health examination in 1979 released the first national recommendations for periodic preventive services .
these include recommendations on the content and timing of well - baby preventive services ( canadian task force on the periodic health examination , 1979 ; gilbert et al . , 1984 ; rourke and rourke , 1985 ) .
for many provinces , these well - baby services screening , counseling , and immunizations are provided through community health agencies using community health nurses and physicians in addition to office - based care ( hemmelgarn et al . , 1992 ) .
some communities have established regionalized special programs , such as for high - risk perinatal care .
although health insurance benefits may vary somewhat among canada 's provinces , utilization of children 's services does not involve cost sharing .
other measures of preventive health services and access to preventive care for infants and children include rates of childhood immunization and percent of children without health insurance ( table 3 ) .
for all six foreign countries , immunization rates for children under 2 years of age are 70 - 95 percent for the diphtheria - pertussis - tetanus ( dpt ) and oral polio vaccines .
with respect to measles vaccination , three of these countries have achieved immunization rates of greater than 85 percent ( united nations international children 's emergency fund , 1991 ) .
measles immunization rates are lower for children in germany , japan , and france , and appear to be related to timing of vaccine approval and provider concerns over vaccine side effects ( u.s .
this compares with estimated immunization rates over the past decade of roughly 57 percent for this same age group in the united states ( u.s .
however , data from the 1992 national health interview survey suggest that immunization rates may be increasing in the united states ( dpt , 83.0 percent ; oral polio , 72.4 percent ; and measles , 82.5 percent ) , although underimmunization continues to remain a problem for low - income children and children of races other than white ( centers for disease control and prevention , 1994 ) .
by providing comprehensive services using a combination of public clinics , school - based programs , and private office - based care , children in these countries have a broad range of entry points into the health care system .
this compares with the roughly 12.9 percent of children under 19 years of age in the united states who do not have health insurance ( employee benefits research institute , 1993 ) .
the six foreign industrialized countries in this study reflect a wide range of health care systems ( single - payer , multipayer , mixed private and public insurance , centralized and decentralized ) , differing financing arrangements ( employer - based sickness funds , payroll- and personal - income - tax - financed ) , and broad cost - containment strategies ( global budgets , provider fee schedules , and utilization controls ) . despite spending considerably less than the united states , these countries have health outcomes , reflected in rates of infant and maternal mortality , low birth weight , and childhood immunization , that do not appear to be compromised and generally surpass those of the united states . to achieve these outcomes ,
these six countries offer various models of health care programs for children and pregnant women . a recurrent theme among them , however , is the high priority given to preventive services .
prenatal care is comprehensive and readily accessible and does not involve financial barriers such as cost sharing or demonstration of insurance status as a prerequisite to care .
by contrast , some 16.2 percent of all women of childbearing age in the united states are without health insurance ( employee benefits research institute , 1993 ) , a factor that has been associated with more frequent adverse natal outcomes in this country ( braverman et al . , 1989 ) .
in the six countries , when necessary , as in the case of high - risk pregnancies , prenatal care may also include outreach services provided through visiting nurses .
prenatal care and childbirth involve a wide range of providers , frequently including non - physicians . for mothers working outside the home ,
maternity benefits are financially comparable to earned income and extend for periods well beyond the time allotted in the united states .
these focused and comprehensive approaches likely contribute to the improved infant status and pregnancy outcomes seen in the six countries .
with respect to children 's services , all six countries provide accessible and comprehensive infant and pediatric programs beginning at birth .
children receive a full range of preventive services that have been recommended in this country as clinically effective ( u.s .
department of health and human services , 1993 ) , including metabolic screening , vision , hearing and speech evaluation , early childhood immunization , dental care , and preventive counseling ( injury prevention , tobacco and substance abuse , nutrition , and fitness ) .
services are delivered through private providers in office - based settings , as well as through a system of public clinics that are later supplanted by school - based programs . in some countries , providers and parents
are given financial incentives to increase the number of children receiving certain preventive services , such as immunizations .
as a result , the vast majority of infants ( 80 - 97 percent ) in most of these countries ( japan , france , germany , united kingdom ) receive a broad range of recommended preventive services ( u.s .
more than 50 percent of preschoolers appear to receive preventive care , compared with 42 percent or less in the united states ( short and lefkowitz , 1992 ; newacheck and halfon , 1988 ; u.s .
this compares with 14.5 percent of children under 18 years of age without health insurance in the united states .
the international models in this study provide evidence that a wide range of health care systems based on differing financing and delivery mechanisms and cost - containment strategies can avoid creating significant numbers of uninsured , provide a wide range of preventive services , and avoid compromising health outcomes . | international systems are frequently offered as models for health care reform .
this study , focusing on preventive services for children and pregnant women in six industrialized countries , finds that a broad range of preventive services can be provided through health care systems with divergent financing and cost containment , utilizing multiple entry points into the health care system , and employing targeted programs for high - risk patients . despite variability in form and financing , health outcomes
are not compromised , suggesting that health care reformers in this country need not be restricted to any single model to strengthen preventive health care for children and pregnant women . |
microsurgery remains the gold standard for the treatment of intraventricular tumors [ 14 ] , but microsurgical approaches are not without limitations [ 512 ] .
the desire for a less invasive but equally effective surgical approach to intraventricular pathology has directed the attention of many in the neurosurgical community towards neuroendoscopy .
neuroendoscopy was introduced in the early 1900s , adopted initially by dandy and others [ 14 , 15 ] as a novel means of treating hydrocephalus , but the technique was overshadowed midcentury by the advent of the valved ventriculoperitoneal ( vp ) shunt [ 17 , 18 ] .
years later , neuroendoscopy regained popularity due to improvements in optical technology and the introduction of the rigid and flexible neuroendoscopes [ 16 , 19 , 20 ] . today , neuroendoscopic techniques have further evolved , and the spectrum of intracranial pathologies treatable by modern neuro - endoscopic means continues to expand .
early reports have demonstrated endoscopic resection of intraventricular masses to be effective and safe [ 21 , 22 ] . the large majority of data in the neurosurgical literature , however , originate from studies of endoscopic colloid cyst resection [ 11 , 23 , 24 ] .
data regarding endoscopic resection of other intraventricular tumors exist primarily in case reports and small series with insufficient sample size to draw meaningful conclusions . the goal of this report is to review the relevant literature describing the endoscopic resection of intraventricular masses as a whole , both cystic and solid , to provide a better understanding of this technique 's virtues and limitations .
pubmed literature searches were performed using search terms ( endoscop * ) and ventric * , ( endoscop * ) and tumor , ( ( neuro - endoscop * ) or neuroendoscop * ) and tumor , and ( tumor ) and ventric * .
additional articles were located via cross - referencing of articles discovered initially through pubmed searches .
articles included in the study were required to originate from peer - reviewed , english language journals describing the attempted resection ( e.g. , biopsies and cyst fenestrations without attempted resection were excluded ) of an intraventricular tumor ( e.g. , suprasellar neoplasms without intraventricular extension were excluded ) by purely endoscopic means ( e.g. ,
endoscope - assisted microsurgical resections were excluded ) through a single endoscope ( dual - port resections were excluded ) .
care was taken to exclude any redundant patient data from the analysis , and five articles required exclusion from the study due to an inability to definitively distinguish study patients in these five articles from patients in other study articles by the same author . in these five cases , the earlier of the two conflicting publications was omitted .
selected articles were also required to report on one or more of the following variables : ( 1 ) estimated completeness of resection achieved , ( 2 ) radiographic recurrence rates , and/or ( 3 ) complications related to the procedure .
cases involving the use of stereotactic radiosurgery , chemotherapy , or other nonsurgical treatment adjuncts were included .
two hundred and twenty articles were reviewed , and 40 were selected based on the above criteria .
data collected from these 40 studies included tumor type , location within the ventricular system , tumor size , the presence of hydrocephalus preoperatively , operative technique , success of endoscopic resection , rates of intraoperative hemorrhage , and other procedure - related complications , rates of tumor recurrence , and length of clinical and/or radiographic follow - up .
estimates regarding the completeness of endoscopic resection were obtained most commonly by surgeon or observer recollection and self - report , but were also obtained through assessments of postoperative imaging studies and chart review in some cases .
complete endoscopic resection was defined as gross total resection of all visible tumor as confirmed by visual intraoperative assessment or by the absence of any visible tumor residual on postoperative contrast magnetic resonance imaging ( mri ) .
near - complete resection was defined as resection of all but a very small amount of tumor adherent to nearby tissues .
partial resection was defined by a considerable tumor remnant as assessed either intraoperatively or on postoperative contrast mri .
statistical analysis was performed using the student t - test and chi - square analysis using microsoft excel and graphpad instat 3 software . if the sample size was insufficient for chi - square testing ( n < 5 ) , the fisher exact text was used .
the entire patient population consisted of 668 patients with intraventricular tumors who underwent attempted endoscopic resection .
the publication dates of the 40 articles ranged from 1994 to 2012 , and the number of patients ( n ) in each article ranged from 1 to 90 patients ( mean , 16 patients ) .
hydrocephalus was seen preoperatively in 296 of 352 patients ( 84.1% ) for whom relevant data was reported .
colloid cysts were the most frequently encountered tumor by far ( n = 569 , 85.2% of study patients ) followed by hypothalamic hamartomas ( n = 30 , 4.5% of study patients ) , craniopharyngiomas ( n = 8 , 1.2% of study patients ) , and ependymomas ( n = 7 , 1.0% of study patients ) . in 14 patients ( 2.1% of study patients ) from 3 articles , the histological tumor type was either unknown or not reported .
tumor diameter ranged from 0.5 to 4.5 cm in 274 tumors from series where tumor size was reported ( mean diameter , 1.5 cm ) .
the most common tumor location was the third ventricle ( n = 572 , 85.2% of reported locations ) .
various techniques for neuroendoscopic resection of intraventricular tumors have been described in detail elsewhere [ 2 , 12 , 16 , 20 , 2535 ] .
individual techniques differed throughout the included studies between surgeons as well as variances in tumor morphology and patient anatomy .
the patient 's head was most commonly placed on a soft headrest , except where neuronavigation or stereotaxy was used , in which case the patient 's head was placed in a 3-point pin fixation device .
the average operative time was 107.5 minutes and the average hospital stay was 4.8 2.9 days .
ventricular access was most commonly attained through a right - sided approach ( unless asymmetric left - sided ventriculomegaly was present , in which case a left - sided approach was preferred ) . in all cases of hypothalamic hamartoma resection
incision was made over the intended ventricular access site and a standard burr hole was created .
the burr hole was most commonly placed at some variant of kocher 's point , although slightly more lateral ( 57 cm lateral to midline ) on occasion .
[ 3 , 11 , 36 ] several authors make note of the importance of beveling the burr hole into a conical shape to allow for a greater degree of scope manipulation and visualization during the procedure [ 11 , 37 ] . in some cases
, the burr hole was placed more anteriorly ( e.g. , 5 cm anterior to the coronal suture , n = 183 [ 25 , 26 , 30 , 31 , 38 , 39 ] ; or 1.53 cm above the orbital rim in cases where a supraorbital trajectory was used , ( n = 8 [ 27 , 40 ] ) ) to allow for better visualization of more posteriorly located tumors . in two cases ,
ventricular access was obtained via a transcallosal approach , and in the case of two pineal masses , a subtorcular approach was used .
the dura is incised in cruciate fashion and coagulated , followed by ventricular puncture and the introduction of an endoscope .
often a small - diameter peel - away introducer sheath containing a navigation probe and/or small - diameter rigid endoscope is used for initial ventricular puncture , although some authors preferred to perform initial ventricular puncture with a ventricular needle or catheter , followed by the introduction of an endoscope into the needle or catheter tract [ 31 , 33 ] .
after entry into the ventricle , the tumor is inspected and its relationship to the surrounding anatomy is assessed . in some cases , visualization required the use of a 30 rigid endoscope or flexible neuroendoscope . a larger diameter rigid endoscope with multiple working channels
is then introduced , through which tumor manipulation , coagulation , and resection take place . in the case of 59 colloid cysts and a single ependymoma ,
flexible neuroendoscopes were used for the majority of the procedure [ 2 , 42 , 43 ] .
cystic tumors were frequently penetrated and gently aspirated , after which the cyst wall was coagulated and resected piecemeal or en bloc with forceps , scissors , and other tools . in several cases , an adjunctive endoscopic aspiration tool ( cusa (
tyco healthcare radionics , burlington , ma , usa ) ( n = 2 ) , nico myriad aspirator ( nico corporation , indianapolis , in , usa ) ( n = 9 ) [ 41 , 44 , 45 ] , micro enp ultrasonic hand piece ( scoring gmbh , medizintechnik , germany ) ( n = 1 ) , or the suros device ( suros surgical systems , inc . , indianapolis , in ) ( n = 2 ) ) assisted with tumor debulking and removal . navigation and/or stereotactic localization tools were used in 266 procedures ( 45.1% of 581 procedures reporting such data ) [ 12 , 2529 , 31 , 3335 , 38 , 39 , 42 , 4649 ] . in some cases , navigation and/or stereotactic tools
were used only in those patients lacking ventriculomegaly on preoperative imaging , due to the enhanced difficulty associated with endoscopic visualization and maneuverability in the absence of hydrocephalus .
a single author describes the intraventricular insufflation of saline in cases where small ventricles are encountered in attempts to improve operative success in this setting .
complete or near - complete tumor resection was achieved in 487 of 649 patients ( 75.0% ) for whom completeness of endoscopic resection was reported .
complete resections were seen after initial resection attempts in 80.2% of colloid cysts , compared with 45.5% of other tumors ( p < 0.0001 ) .
complete or near - complete resection was more commonly attained amongst tumors with a substantial cystic component ( 79% ) when compared with noncystic tumors ( 38.2% ) ( p < 0.0001 ) . complete or near - complete resection was also significantly more likely for tumors 2 cm in diameter when compared with larger tumors ( p = 0.0146 ) , and for tumors resected with the aid of navigation / stereotaxy ( p = 0.0003 ) compared with those where these tools were not used .
procedures in addition to the tumor resection were attempted during the same operative session in 70 patients ( 12.0% of patients for whom such data was reported ) .
these adjunctive procedures included endoscopic third ventriculostomy ( n = 27 ) [ 12 , 16 , 19 , 29 , 30 , 42 , 49 , 50 ] , septum pellucidostomy ( n = 28 ) [ 12 , 36 , 49 , 51 ] , stent placement within the foramen of monro and/or aqueduct of sylvius ( n = 2 ) [ 12 , 19 ] , placement of a vp - shunt ( n = 2 ) , and postresection fluorescent ventriculography ( n = 11 ) .
perioperative complications were seen in 123 out of 592 patients ( 20.8% ) for whom data regarding complications was reported .
these complications included hemorrhage ( intraventricular , n = 41 ; intraparenchymal or along the introducer tract , n = 2 ; or epidural , n = 2 ) , meningitis and/or ventriculitis ( n = 15 ) , memory disturbance
( n = 14 ) , csf leak ( n = 6 ) , infarct ( n = 5 ) , cranial nerve deficit ( n = 4 ) , and hormonal disturbance ( n = 2 ) .
the presence of a cystic component was associated with a significantly lower complication rate when compared to noncystic tumors ( p < 0.0001 ) .
no significant relationship was observed between tumor size ( p = 0.355 ) or the use of navigation / stereotaxy ( p = 0.196 ) and complication rate .
data regarding procedure - related complications are shown in figure 1 and tables 1 and 2 . in the large majority of study patients ,
there were no deaths reported to have occurred as a result of any of the 668 procedures .
postoperative morbidity increases were seen in 54 patients ( 9.5% of 569 patients for whom the relevant data was supplied ) due to a variety of complications , including post - operative infarct , intraventricular hemorrhage , and meningitis or ventriculitis .
tumor recurrence was seen in 53 of the 533 patients ( 9.9% ) for whom data regarding recurrence was reported throughout an average of 31 months of follow - up .
recurrence was discovered , on average , 39 months after the initial resection in these 53 patients ( range , 679 months ) .
tumor recurrence was seen in 9.8% of colloid cysts ( 49/498 patients reporting ) compared with 11.1% of other tumors ( 4/36 patients reporting ) ( p = 0.805 ) . recurrence was seen most frequently with epidermoid cysts ( n = 1 , 100% recurrence ) , craniopharyngiomas ( n = 5 , 40% recurrence ) , and ependymomas ( n = 1 , 14.3% recurrence ) .
no significant relationship was observed between tumor size ( p = 0.546 ) or the presence of a cystic component ( p = 0.325 ) and recurrence rates .
neuro - endoscopy offers solutions to some of the challenges faced with intraventricular tumor surgery .
endoscopic approaches to intraventricular pathology provide improved illumination and visualization of an anatomically remote and otherwise - difficult - to - reach location without the degree of tissue dissection and retraction often required with microsurgical techniques [ 24 , 52 ] .
early results taken from colloid cyst resection demonstrate a reduction in complication rates , overall morbidity , operative time , and hospital stay [ 2022 , 25 ] .
neuroendoscopic approaches to intraventricular pathology also afford the surgeon an opportunity to treat associated hydrocephalus concomitantly , although tumor resection alone may be sufficient to restore cerebrospinal fluid ( csf ) flow in some cases [ 12 , 24 , 53 , 54 ] . in our study , hydrocephalus was seen on presentation in 84.1% of intraventricular tumors undergoing endoscopic resection , yet adjunctive cerebrospinal fluid ( csf ) diversionary procedures were performed along with tumor resection in only 12.0% .
neuroendoscopic resection appears to be most safe and effective [ 2 , 21 , 25 , 34 ] when applied in a particular patient population and morphology of tumor .
it is often suggested that small tumors , for example , are ideal candidates for neuroendoscopic resection [ 12 , 23 , 24 , 32 , 52 ] .
soft and/or cystic tumors are also preferred , as they lend themselves to rapid debulking via aspiration and/or other endoscopic techniques [ 12 , 32 ] .
rigid tumors , in contrast , must be dissected and removed piecemeal with the fairly rudimentary tools available for endoscopic use .
this may be too time - consuming of an endeavor to warrant the use of endoscopy in such cases .
these principles appear substantiated by our findings that complete or near - complete resection was significantly more common for tumors with a large cystic component and those 2 cm in diameter .
neuroendoscopic resection is also best suited for relatively avascular tumors [ 23 , 24 ] , as endoscopic methods of acquiring timely hemostasis are lacking , and endoscopic visualization is largely compromised in the setting of active , uncontrolled hemorrhage [ 12 , 32 ] . in our study , there was insufficient documentation of tumor vascularity within the included studies to draw meaningful conclusions about any relationship between tumor vascularity and variables such as resection success or complication rate .
small ventricles are thought to be unfavorable for neuroendoscopy because visibility and maneuverability in this setting are greatly reduced [ 12 , 24 , 63 , 64 ] , although several series provide evidence that endoscopic therapies are equally feasible in the absence of hydrocephalus [ 28 , 65 , 66 ] .
several of the limitations of neuroendoscopic tumor resection derive from a fundamental inadequacy of modern neuroendoscopic technology .
as previously noted , solid masses greater than 2 cm in diameter , and those with considerable vascularity , are less amenable to neuroendoscopic resection due to the elementary nature of tools currently available for endoscopic dissection and hemostasis .
the large majority of cases included in this study used forceps , suction catheters , and bipolar cautery as the primary tools for dissection , resection , and hemostasis , respectively .
several series , however , report on the use of assistive devices ( e.g. , cusa , nico myriad aspirator , micro enp ultrasonic hand piece , and the suros device ) designed to allow for rapid tumor dissection and removal through an endoscopic approach .
although surgeons who use these devices frequently report their being helpful , objective data regarding their overall benefit is lacking [ 42 , 44 , 45 ] .
no significant difference in success of resection , complication rate , or clinical outcome was seen in our study with the use of these assistive devices , although their use was likely too infrequent ( n = 8) to draw conclusions .
endoscopic tumor resections are also frequently said to result in inferior rates of gross total resection .
the resection rates demonstrated in our study ( 75.0% ) and others ( 71100% ) [ 12 , 32 , 37 , 65 ] , however , appear comparable to those reported for microsurgical resection ( 80.4%96% ) , particularly when endoscopic resection attempts are limited to tumors 2 cm in diameter ( in which case resection rates in our analysis improve to 87.8% ) [ 2 , 67 ] . some apprehension about the use of endoscopy for tumor resection arises from the perception that tumors resected endoscopically are more likely to recur [ 12 , 21 ] .
there is , in fact , some evidence that the risk of postoperative colloid cyst recurrence is higher with endoscopic resections compared with microsurgery . other series , however , have shown recurrence rates to be equivalent between the two .
the recurrence rate of 9.9% seen in our study is similar to rates reported for microsurgical resections ( 0.0%33% ) [ 32 , 6875 ] , although reported recurrence rates vary widely and depend greatly on such variables as tumor type , completeness of initial resection , and the use of adjuvant therapies .
the use of stereotactic and/or neuronavigational guidance for endoscopic tumor resection is commonly reported in the neurosurgical literature , particularly in cases where ventriculomegaly is absent [ 12 , 33 , 65 , 66 , 7678 ] .
some have adopted these adjunctive tools for assistance with burrhole placement , ventricular cannulation , and intraventricular navigation with the expectation that they will simplify the procedure and perhaps improve radiographic and clinical outcomes .
although incorporation of these tools into the procedure may prolong operative time and/or inflate surgical costs , several authors have declared their use to be of substantial benefit [ 12 , 7779 ] .
neuronavigation and/or stereotactic techniques were used in 44.1% of the cases in our study , and their use was associated with a significantly higher rate of complete or near - complete tumor resection .
the overall complication rate of 20.8% seen in this study is consistent with values reported elsewhere for endoscopic resection ( 025% ) [ 12 , 28 , 32 , 35 , 48 , 76 ] and comparable to rates reported for microsurgical interventions ( 4.329.3% ) [ 72 , 8084 ] , although some reports of complications following microsurgical resection approach 70% [ 5 , 11 ] .
the complications seen most commonly in our study were intraventricular hemorrhage ( which was frequently minor ) and memory disturbance ( which was often transient ) .
many of the complications observed did not translate into increased clinical morbidity , and most of the complication - related clinical morbidity resolved to some degree with time .
. limitations of this study include the following : ( 1 ) all included publications are retrospective and therefore subject to errors of confounding and bias .
a more accurate comparison between surgical and endoscopic resection requires a prospective , randomized trial .
( 2 ) data in our study is collected over an extended period of time .
being that endoscopic techniques have progressed appreciably over the last 25 years , our results may not provide an accurate assessment of the results attainable with modern techniques .
a minor percentage of the data included in the study draws from resections utilizing flexible endoscopes , for example .
although some authors are proficient with flexible neuroendoscopes and have reported good outcomes with their use , modern rigid endoscopes offer a vastly improved image quality and are preferred by many neurosurgeons .
( 3 ) available data in the literature draws largely from series of endoscopic colloid cyst resection and thus , represent a slightly skewed picture of endoscopic tumor resection .
more data are needed regarding endoscopic resection of other tumor histologies if we hope to gain a truly accurate and complete understanding of the advantages and disadvantages of this technique .
( 4 ) finally , the large majority of cases of endoscopic resection of intraventricular tumors in the literature describe tumors in the region of the third ventricle .
the majority of intraventricular tumors , however , are discovered in the body or frontal horn of the lateral ventricle , followed by the atrium , and finally , the foramen of monro and third ventricle [ 80 , 81 , 85 ] . more data may be needed regarding endoscopic resection of tumors in these more common locations before comments regarding the safety , efficacy , and overall usefulness of endoscopy in the treatment of intraventricular masses can be made .
the goal of this study was to better characterize the advantages and disadvantages of the endoscopic approach to intraventricular tumors .
our results indicate that endoscopic tumor resection , when applied in the appropriate setting , is safe and effective .
further improvements in the outcomes of neuroendoscopic tumor resection rely heavily on the development of endoscopic technology
. dissection tools allowing for the rapid and safe removal of large , solid tumors are lacking , as are effective means of acquiring prompt hemostasis through an endoscopic approach . more data is needed on the outcomes of endoscopic resection of tumors other than colloid cysts .
finally , randomized trials comparing surgical and endoscopic tumor resections would provide a better characterization of the virtues and limitations of each technique .
endoscopic tools and techniques are improving , however , and the applications of endoscopy in the treatment of cns pathology continue to expand .
though initial results appear promising , the potential of neuroendoscopy and its role in the management of intraventricular tumors are yet to be defined . | introduction . though traditional microsurgical techniques are the gold standard for intraventricular tumor resection , the morbidity and invasiveness of microsurgical approaches to the ventricular system have galvanized interest in neuroendoscopic resection .
we present a systematic review of the literature to provide a better understanding of the virtues and limitations of endoscopic tumor resection .
materials and methods .
40 articles describing 668 endoscopic tumor resections were selected from the pubmed database and reviewed .
results .
complete or near - complete resection was achieved in 75.0% of the patients .
9.9% of resected tumors recurred during the follow - up period , and procedure - related complications occurred in 20.8% of the procedures .
tumor size 2 cm ( p = 0.00146 ) , the presence of a cystic tumor component ( p < 0.0001 ) , and the use of navigation or stereotactic tools during the procedure ( p = 0.0003 ) were each independently associated with a greater likelihood of complete or near - complete tumor resection .
additionally , the complication rate was significantly higher for noncystic masses than for cystic ones ( p < 0.0001 ) . discussion .
neuroendoscopic outcomes for intraventricular tumor resection are significantly better when performed on small , cystic tumors and when neural navigation or stereotaxy is used . conclusion .
neuroendoscopic resection appears to be a safe and reliable treatment option for patients with intraventricular tumors of a particular morphology . |
one of the widely accepted techniques for restoring pit and fissure caries and prevention of caries development in adjacent pit and fissures is preventive resin restoration ( prr ) [ 14 ] . in this technique ,
decayed tooth tissue is replaced with composite resins and at the same time , intact pit and fissures are sealed with fissure sealants .
this advantage has led to popularity of this technique . however , a six - year follow up of these restorations has revealed a 20% failure .
the main cause for prr failure has been reported to be microleakage [ 1 , 5 , 7 ] .
moreover , it can be performed either conservatively without removing intact fissure sealants or traditionally through class i or class ii cavity preparation .
an important factor influencing decision making on material and technique in these cases is the amount of microleakage in amalgam - composite and composite - composite interfaces [ 1 , 5 , 7 ] .
microleakage in these two interfaces , when reaching the pulpal floor , can raise concerns regarding recurrent caries and adverse effects on the pulp [ 710 ] .
the majority of the studies in this rarely investigated field are in vitro studies . in a study about assessment of marginal leakage of combined amalgam - sealant restorations on the occlusal surface of permanent posterior teeth
, it has been shown that when the occlusal surface had been sealed prior to amalgam filling , dye penetration was significantly less than that in amalgam filling alone . a similar in vivo study about the assessment of marginal leakage of class ii amalgam - sealant restoration on primary molar teeth showed that no statistically significant differences existed in marginal microleakage between class ii amalgam restoration in contact with occlusal fissure sealant and classic class ii amalgam restoration .
another study on microleakage in hybrid amalgam - composite restoration concluded that if amalgam filling had been done before composite filling , microleakage was significantly less than that in the reverse situation .
moreover , amalgam - tooth had most marginal microleakage and composite - tooth had least marginal microleakage . a study assessing the effect of various adhesives and preparation on microleakage in amalgam - resin and resin - tooth interfaces showed that in all cases microleakage in amalgam surfaces was more than that in tooth surface .
the aim of the present study was to investigate microleakage in amalgam - composite and composite - composite interfaces in teeth restored with prr technique .
class i cavities ( 1.5 mm depth , 1.5 mm buccolingual width ) were prepared in mesial sections of the teeth .
the cavity surfaces were etched with etching gel ( ivoclarvivadent ) for 20 seconds and rinsed for 20 seconds .
the teeth were dried and then a bonding agent ( excite , ivoclarvivadent ) was applied and light cured ( arialux light curing system , iran ) for 20 seconds .
all the teeth were then placed in distilled water and were incubated at 37 c for six months .
after this period , two single - box class ii cavities ( 4 mm bucco - lingual width , 1.52 mm mesio - distal width ,
33.5 mm height ) were prepared in both mesial and distal sections of each tooth .
two retention grooves were prepared in axio - pulpal and axio - lingual line angles of each class ii cavity .
these cavities were then restored with spherical high copper amalgam ( faghihi , iran ) using matrix band .
margins of the cavities were burnished with a small burnisher and the amalgam restorations were polished using rubber cap 30 minutes after restoration .
another class i cavity with the same dimension as the first class i cavity was prepared in the buccal section of occlusal surfaces of the teeth
the second class i cavities were restored exactly similar to the first class i cavities ( figure 1 ) .
the teeth were then thermocycled ( 750 , 555c , 25-second dwell time , and 5-second transition time ) .
the whole surfaces of the samples except one mm around the filling margins were covered with nail varnish .
the samples were immersed in 2% basic fuchsin solution for 10 minutes and then rinsed under tap water for 10 minutes .
two 1-mm thick mesio - distal slices ( to examine amalgam - composite and amalgam - tooth interfaces ) and one 1-mm thick bucco - lingual slice ( to examine composite - composite interface ) were obtained per tooth .
the three interfaces were examined with a stereomicroscope ( 10 magnification ) and the amount of dye penetration was recorded as an estimation of microleakage according to iso guideline ( 12 ) : 0 = no penetration ; 1 = penetration into the enamel part of the cavity wall ; 2 = penetration into the dentine part of the cavity wall but not including the pulpal floor of the cavity ; and 3 = penetration including the pulpal floor of the cavity .
friedman test was used for comparison of microleakage among three interfaces and the significance level was defined as 0.05 .
wilcoxon signed - rank test served for two - by - two comparisons ; bonferroni adjustment for multiple comparisons was obtained at 0.017 significance level .
as it can be seen in table 1 , the dye had reached the pulpal wall of the cavity in more than half of the amalgam - composite interfaces . in 31.4% of the amalgam - tooth interfaces
the dye penetration was limited to the enamel layer and in 31.4% the dye reached the pulpal wall .
no dye penetration was observed in 80% of the composite - composite interfaces . in the 20% remainder
, the dye penetration was mostly restricted to the dentinal layer without pulpal involvement ( 85.7% ) .
composite - composite interface represented the least microleakage among the three interfaces ( = 25.327 , p<0.001 , friedman test ) .
two - by - two comparisons ( table 2 ) also confirmed that this interface had the best seal ( ac - cc : p=0.0001 , at - cc : p=0.003 , wilcoxon signed - rank test ) .
although microleakage in amalgam - tooth interface was less than that in amalgam - composite interface , the difference was not statistically significant ( p=0.02 ) .
the present in vitro study compared microleakage in the three interfaces of amalgam - tooth , amalgam - composite , and composite - composite in a sample of premolar human teeth .
according to the results , composite - composite interface showed the least and amalgam - composite represented the highest microleakage .
generalization of the results from in vitro studies to those from in vivo studies has been a matter of concern .
a study investigating the results of in vitro and in vivo studies on microleakage concluded that it seems impossible to directly compare the results of these two types of studies since several factors influence the amount of microleakage . on the other hand , a review study concluded that microleakage findings from these two studies show a high correlation and consequently , the results from an in vitro study can serve as a good estimation of real life situation . in the present study , we tried to increase generalizability of the results through implementation of some strategies .
first , to simulate aging phenomenon and real conditions of the mouth , the samples were first incubated for six months and were then thermocycled .
each of these two strategies can simulate aging according to the current iso standard requirements .
these requirements entail either a six - month incubation period or a 500-cylcle thermocycling to simulate aging .
second , in our study , the three investigated interfaces were produced in the same tooth .
this method is expected to provide more valid results since the teeth differ from each other in characteristics such as mineral contents and arrangement of enamel and dentine tubes .
these differences may have potential effects on microleakage . to deal with such confounding factors ,
the previous studies have mainly focused on the randomization approach [ 14 , 15 ] .
third , to increase reliability of the findings , all the preparations , restorations and observation processes were performed by the same researcher ( sr ) .
intra - examiner calibration was achieved through a pilot study on seven teeth . in our study
, no significant difference was seen in microleakage between amalgam - composite and amalgam - tooth interface .
this finding differs from the results of a previous study by fuks and shey reporting more microleakage in amalgam - tooth compared to amalgam - sealant interface .
this difference may be due to more aging in our sample since we performed 750 cycles of thermocycling compared to 25 cycles in that study .
kossa in a study on combined amalgam - composite restorations concluded that when amalgam restoration was done first , the microleakage was less than the situation in which the composite - restoration precedes amalgam restoration .
this is in line with our findings since we first performed composite and then amalgam restorations .
kossa s results on comparison of microleakage between amalgam - tooth and amalgam - composite interfaces are similar to the study by fuks and shey .
however , we should notice that the samples in kossa s study were restored in a wet place only for two weeks and were thermocycled only for 50 cycles , which does not meet the current minimum standard requirements to simulate aging process in such studies .
for example , restorative composite in kossa s study was self - cured , while we used flowable light - cured composite .
both of the studies mentioned used dispersed phase ( spherical in addition to lathe cut ) amalgam [ 5 , 7 ] whereas we used spherical amalgam .
it has been shown in many previous studies that the type of amalgam and composite and their manipulation manner influence the amount of microleakage [ 9 , 15 , 16 ] .
the other influencing factor is the duration of sample 's immersion in fuchsin solution , which was 24 hours in the mentioned studies [ 5 , 7 ] , but 10 minutes in our study according to iso standard requirements . in a study by cehreli et al . on amalgam repair and quantitative evaluation of amalgam - resin and resin - tooth interfaces with different surface treatments
, they concluded that all the adhesive materials exhibited more microleakage at the amalgam interface than the tooth interface .
this is different from our findings since we found no significant difference between microleakage in amalgam - composite and amalgam - tooth interfaces . in their study
, the samples were thermocycled for 1000 cycles and finally immersed in 0.5% basic fuchsin solution for 24 hours , which may influence the findings .
moreover , in our study the difference in microleakage between these two interfaces was near to significant and with a greater sample size the difference might become significant .
our objective of comparing microleakage in old composite - new composite interface with that in amalgam - tooth and amalgam - composite interfaces was to consider whether aging process in old composite could increase microleakage in composite - composite interface to the same level as that in the other two interfaces .
perhaps unpolymerized monomers of old composite and their reaction to new composite monomers is the reason .
however , based on the results of this study , there are three different restoration techniques to restore the failed prrs :
- single box composite restorations ( composite - composite interfaces)- class ii amalgam restorations ( amalgam - tooth restorations)- single box amalgam restorations ( amalgam - composite restorations ) - single box composite restorations ( composite - composite interfaces ) - class ii amalgam restorations ( amalgam - tooth restorations ) - single box amalgam restorations ( amalgam - composite restorations ) it should be noted that such a decision is subject to many other considerations including pros and cons of each technique , possibility and feasibility of tooth isolation , clinical skills of the operator and the socio - economic status of the patient .
according to the results of the present study regarding microleakage , treatment options to repair prr may be ranked as follows :
removing caries , leaving intact parts of prr and performing a class ii composite restoration . in this case
, we will have composite - composite interface which showed the least microleakage among the three interfaces .
however , gingival microleakage should be taken into account.removing caries and the whole prr and performing a class ii amalgam restoration .
in this situation an amalgam - tooth interface with less microleakage than amalgam - composite interface is developed.removing caries , leaving intact parts of prr and performing a single - box amalgam restoration . in this case
an amalgam - composite interface is developed which , according to our findings , had the most microleakage . removing caries , leaving intact parts of prr and performing a class ii composite restoration . in this case
, we will have composite - composite interface which showed the least microleakage among the three interfaces .
in this situation an amalgam - tooth interface with less microleakage than amalgam - composite interface is developed . removing caries , leaving intact parts of prr and performing a single - box amalgam restoration . in this case
an amalgam - composite interface is developed which , according to our findings , had the most microleakage . | objective : this study addresses the question of whether conservative methods of restoration may be applied efficaciously in permanent posterior teeth with proximal lesions and intact occlusal preventive resin restoration ( prr ) .
the purpose of the present study was to assess the microleakage at amalgam - composite interface and composite - composite interface in permanent tooth with prr.materials and methods : thirty - five premolar teeth extracted for orthodontic reasons were selected .
the occlusal surfaces were sealed as preventive resin restoration .
then the teeth were stored in incubator for 6 months .
after this period , two single boxes were prepared in mesial and distal surfaces in each tooth and filled with amalgam .
another class i composite restoration was prepared in occlusal surface in contact with the first prr
. then samples were thermocycled and marginal leakage was assessed by the degree of dye penetration on sections of the restored teeth .
friedman and wilcoxon signed - rank tests served for statistical analyses.results:in 51.4% of amalgam - composite interfaces the dye reached the pulpal wall .
the corresponded figures for amalgam - tooth and composite - composite interfaces were 31.4% and 14.3% , respectively .
the differences in microleakage among the three interfaces were statistically significant ( p<0.05).conclusion : in the teeth restored with prr technique , restoring proximal lesions with a conservative technique may lead to favorable results concerning microleakage . |
the introduction of the immunomodulatory drug lenalidomide has revolutionized the treatment of patients with myelodysplastic syndromes ( mds ) and deletion of the long arm of chromosome 5 .
treatment with lenalidomide results in transfusion independence in the majority of patients , but some questions remain unresolved , among them the duration of treatment . moreover , a number of unexpected long - term remissions in patients who stopped lenalidomide for various reasons have been observed .
we report the case of a 60-year - old caucasian male with deletion of the long arm of chromosome 5 and international prognostic scoring system ( ipss)-defined low - risk mds who was treated with lenalidomide , achieving complete cytogenetic remission and erythroid response . after tapering off and interrupting the treatment , the patient relapsed and showed a new response by lenalidomide retreatment .
six years after the initial treatment , we registered a durable erythroid long - term response and good tolerance , but there was no evidence of a very profound cytogenetic response compared to using lenalidomide as a first - line treatment .
cytogenetic and fluorescence in situ hybridization together with hemoglobin level , mean corpuscular volume ( mcv ) and vitamin b12 level helped us to monitor the patient response ; during the various phases of lenalidomide treatment , mcv and vitamin b12 normalization correlated with good response .
lenalidomide interruption and rechallenge in some 5q mds patients , with low risk according to the ipss , is safe and feasible but does not result in a profound cytogenetic response .
myelodysplastic syndromes ( mds ) are clonal bone marrow disorders characterized by ineffective bone marrow hematopoiesis , peripheral blood cytopenias and risk of transformation to acute myeloid leukemia ( aml ) .
patients are stratified according to the international prognostic scoring system ( ipss ) into low- , intermediate-1- , intermediate-2- and high - risk categories . among cytogenetic abnormalities ,
partial or complete deletion of the long arm of chromosome 5 [ del(5q ) ] is the most common cytogenetic abnormality found in mds patients , occurring in 1015% of all de novo mds patients [ 2 , 3 ] and in up to 30% of cases with abnormal karyotype .
the prognosis of mds cases with del(5q ) worsens with additional cytogenetic changes and increase in blast percentages .
treatment with the immunomodulatory drug lenalidomide has set a new standard for the management of low / intermediate-1-risk mds with 5q in transfusion - dependent patients .
lenalidomide suppresses the growth of mds progenitors harboring 5q , giving rise to a high frequency of transfusion independence ( ti ) and cytogenetic response and promotes erythroid lineage competence and colony - forming capacity .
lenalidomide may restore transcriptional response to endogenous erythropoietin in mds progenitors , suggesting that lenalidomide enhances cellular responsiveness to erythropoietin stimulation ; moreover , p53 expression in erythroid precursors decreased in lenalidomide responders but is upregulated upon the emergence of resistance to lenalidomide .
the current treatment recommendation is to treat 5q with lenalidomide until relapse or transfusion dependence or progressive disease .
consequences of the long - term effects of continuous immunomodulation with lenalidomide are unknown , and the question whether interruption of lenalidomide treatment is beneficial for patients in remission has never been formally addressed .
we herein report a patient with mds with isolated 5q deletion and ipss - defined low - risk mds , who was treated with lenalidomide , achieving complete cytogenetic remission and erythroid response , and who after tapering off and interrupting the treatment relapsed .
a new response was observed after re - exposure to lenalidomide , showing durable erythroid long - term response and good tolerance , but cytogenetic response was not very profound .
a 60-year - old caucasian male was first seen for the evaluation of macrocytic anemia , weakness and easy fatigue .
laboratory analyses confirmed the macrocytic anemia : hemoglobin ( hb ) 10.6 g / dl ; mean corpuscular volume ( mcv ) 109 fl with a normal reticulocyte count ; white blood cell count ( wbc ) was 3.34 10/l ; absolute neutrophil count ( anc ) was 1.87 10/l , and platelet count was 215 10/l .
bone marrow aspirate and biopsy were performed revealing hypoplastic bone marrow with dyserythropoiesis , no ring sideroblasts were present , and micromegakaryocytes with single eccentric nuclei were also observed .
cytogenetic analysis showed 5q with no other abnormalities ; at least 10 metaphases and whenever possible 2025 metaphases were analyzed by the classical cytogenetic method .
the karyotype was written as 46 , xy , del(5)(q31 ) . a diagnosis of mds with isolated 5q
iu / l and the patient was transfusion - independent ; therefore , we observed him periodically .
after 11 months , he showed a decline in the hb level : hb was 9.8 g / dl , mcv 112 fl and the serum erythropoietin level was less than 200
we then treated the patient with 40,000 iu of erythropoietin biweekly for 6 months . despite erythropoietin
after 7 months of this treatment , hb was 7.9 g / dl , mcv was 110 fl , vitamin b12 was 930 pg / ml ( range 191663 ) , the bone marrow showed an increased dyserythropoiesis , and the fluorescence in situ hybridization ( fish ) analysis , using lsi5q31 ( egr1)/d5s23 , d5s721 probe ( abbott , molecular inc .
, usa ) on 200 interphase nuclei , permitted to detect a higher percentage of cells with 5q since the diagnosis ( 65 vs. 45% ) .
the patient refused transfusion and lenalidomide was initiated at a dose of 10 mg / day for 21 days every 4 weeks , together with aspirin as thromboprophylaxis ( anc was 1.6 10/l and platelet count 301 10/l ) .
weekly blood controls showed grade 3 neutropenia and growth factor ( g - csf ) support was initiated biweekly from the second cycle of treatment to the fifth .
after 5 cycles of standard treatment , the patient obtained complete hematological and cytogenetic remission : hb was 12.6 g / dl , mcv 98 fl , vitamin b12 600 pg / ml , wbc 4.4 10/l , anc 3.3 10/l , and platelet count was 135 10/l .
we suspended the growth factor support and tapered off the dose of lenalidomide ( initially 5 mg for 21 days every 4 weeks for 3 cycles and subsequently 5 mg every other day for 21 days every 4 weeks for 6 cycles ) .
then we treated him with 5 mg biweekly for 3 weeks of every 28-day cycle for 12 cycles , remaining transfusion independent and in complete hematological and cytogenetic remission ( fig . 1 ; table 1 ) , with a range of platelet count between 149 and 128 10/l .
after 1 year of this schedule , the patient had a cytogenetic relapse with 2/10 metaphases and 18% interphase nuclei showing a 5q ( fig .
1 ) , but he remained transfusion independent ( hb 13.9 g / dl , mcv 100 fl , platelet count 128 10/l , wbc 3.5 10/l , anc 1.09 10/l and vitamin b12 831 pg / ml ) .
however , we decided to stop lenalidomide treatment and observed him for 14 months ; at this time , 5q was detected in 8/10 metaphases and in 60% of the interphase nuclei ( hb 12.1 g / dl , mcv 108 fl , vitamin b12 792 pg / ml , platelet count 182 10/l ) ; the patient was rechallenged with lenalidomide 10 mg for 21 days every 4 weeks ( fig .
he responded to the reintroduction of lenalidomide , achieving complete cytogenetic remission after 3 cycles and continuing lenalidomide at a standard dose of 10 mg until the sixth course [ hb was 14 g / dl ( fig .
2 ) , mcv decreased to 99 fl and vitamin b12 decreased to 442 pg / ml , platelet count 122 10/l , wbc 3.03 10/l , and anc 2.2 10/l ] .
cytogenetic and fish analysis were negative and no blasts were detected in bone marrow aspirate .
we reduced the dose at 10 mg biweekly for 3 weeks every 28 days for 4 months ; then 5q was detected in 44% interphase nuclei ( fig .
1 ) , karyotype was not available , hb was 13.5 g / dl , mcv 100 fl and vitamin b12 280 pg / ml .
then we changed the schedule with the dose of 5 mg for 21 days every 4 weeks for 6 courses , when 4/10 metaphases and 22% of interphase nuclei showed 5q ; hb was 13.9 g / dl , mcv 96 fl , vitamin b12 1,344 pg / ml , bone marrow blasts 3% , and a partial cytogenetic remission was obtained ( fig .
we increased lenalidomide to 10 mg for 21 days every 4 weeks ( 6 cycles ) . in this period , we observed grade 3 neutropenia , and we started g - csf once a week for 5 months .
after these 6 cycles , 1/10 metaphases and 4% of interphase nuclei showed 5q , no bone marrow blasts were observed , but the development of a new independent clone was detected by cytogenetic and fish analyses , containing loss of the y chromosome in 2/10 metaphases and in 28% of interphase nuclei ( fig .
other parameters were : hb 14 g / dl , mcv 97 fl , vitamin b12 448 pg / ml , platelet count 105 10/l , wbc 3.3 10/l , and anc 1.2 10/l .
we continued lenalidomide treatment for another 3 cycles at 10 mg dose , when 1/10 metaphases and 3% of interphase nuclei showed 5q and 3/10 metaphases and 31% of interphase nuclei were positive for loss of the y chromosome with hb 14.3 g / dl , mcv 98 fl , vitamin b12 411 pg / ml , platelet count 117 10/l , wbc 2.9 10/l , and anc 1.3 10/l .
at this point , we decided to reduce lenalidomide at 10 mg every other day for 21 days of every 28-day cycle , and this schedule was administered for 6 cycles ; after that , 8/12 metaphases and 24% of interphase nuclei showed 5q , and 3/12 metaphases and 28% of interphase nuclei were positive for loss of the y chromosome with bone marrow blasts 3% , hb 12.2 g / dl , mcv 102 fl , vitamin b12 744 pg / ml , platelet count 132 10/l , wbc 2.5 10/l , and anc 1.08 10/l .
then we increased lenalidomide dosage at 10 mg for 21 days of every 4-week cycle ; after 6 cycles , 7% of interphase nuclei showed 5q and 38% loss of y chromosome , bone marrow blasts 2% , hb was 13.6 g / dl , mcv 97 fl , vitamin b12 682 pg / ml , platelet count 91 10/l , wbc 2.42 10/l , and anc 1.17 10/l ; at present , this schedule is still administered .
the patient has never taken a supplement of vitamin b12 , he continues thromboprophylaxis with aspirin ( 100 mg / day ) , no thrombotic events have so far been observed , he has a good quality of life , assessed with the functional assessment of cancer therapy - anemia ( fact - an ) questionnaire , and he continues to perform daily sport activity by jogging for 2 h a day since the first achievement of complete hematological and cytogenetic remission .
consequences of the long - term effects of continuous immunomodulation with lenalidomide are unknown . furthermore , there is limited evidence that discontinuation of lenalidomide may lead to long - term transfusion freedom . our patient with ipss - defined low - risk mds with isolated 5q within 12 weeks of initiating lenalidomide 10 mg achieved ti and complete hematological and cytogenetic remission .
he maintained ti from february 2008 until march 2014 ( 6 years ) also stopping lenalidomide for 13 months ( december 2010 to december 2011 ) ; in many cases reported in the literature , the median duration of ti is 2 years .
we observed a correlation between cytogenetic response and normalization of mcv and vitamin b12 levels , with a decrease of the amount of abnormal interphase nuclei , showing 5q , detected by fish .
long - term outcome data indicate that a cytogenetic response to lenalidomide therapy might offer a survival advantage , compared with cytogenetic nonresponders , and lenalidomide treatment does not increase aml progression risk , among lower - risk , transfusion - dependent mds patients , but instead confers a possible benefit in red blood cell transfusion - dependent patients with del(5q ) low- or intermediate-1-risk mds [ 9 , 11 ] . in our patient , after 5 cycles of standard treatment , we obtained complete hematological and cytogenetic remission ; we then tapered off the dose of lenalidomide , and the patient remained transfusion independent and in complete hematological and cytogenetic remission for further 9 months ( fig . 1 , fig .
2 ) . in november 2009 , the patient had a cytogenetic relapse remaining transfusion independent ; we , however , stopped lenalidomide and observed him .
subsequently the patient was rechallenged with lenalidomide and he responded to the reintroduction of lenalidomide intervention as other cases described by giagounidis et al .
, achieving complete cytogenetic remission after 3 cycles and continuing this dosage until the sixth course ( july 2011 ) .
we continued to modulate the dose of lenalidomide on the basis of fish analysis ( table 1 ) ; in our patient , the reappearance of 5q was not equivalent to transfusion dependence and as in other patient series he remained transfusion - free , without being exposed for many months to any medication .
mcv and vitamin b12 levels , in our case , have always correlated with the hematologic and cytogenetic response , normalizing when the patient achieved complete remission and rising again to more than the normal reference value when the patient relapsed , indicating in our patient a variation in the promotion of effective erythropoiesis .
therefore , mcv and vitamin b12 values may be very simple parameters to monitor regularly . to our knowledge
, this observation has never been stressed in previous publications and monitoring those easily available parameters could help , together with cytogenetic and hematological analyses , to follow the response and eventually to modulate the lenalidomide schedule , in a manner as to reduce drug toxicity ; specially if the patients maintain a good hematological response with ti , at least in low - risk mds patients
analyzed the relationship between the development of treatment - induced cytopenias and the response to therapy in mds .
they specifically found that among lower - risk mds patients with del(5q ) whose platelet count decreased by 50% , packed red blood cell ti was likely to be achieved , as compared with patients not experiencing the same magnitude of thrombocytopenia ; however , they did not analyze mcv and vitamin b12 as parameters that predict the response .
also in our case we registered a platelet count of less than 150 10/l ( range 91149 10/l ) , except after 14 months of stopping treatment , when the platelet count was 182 10/l and 5q was detected in 60% of interphase nuclei ; however , we still observed ti but hb decreased to 12.1 g / dl .
a platelet count decline was again evident after the restart of lenalidomide treatment ; a platelet drop was also present when we used the schedule 5 mg for 21 days or every other day or biweekly . with the dose of 5 mg biweekly that , compared to the schedule of 5 mg every other day , was never published , we still had ti and a progressive normalization of the platelet count but eventually an increase in 5q and interphase nuclei .
six and a half years after the diagnosis and 5 years after the onset of lenalidomide treatment , we registered in our patient the development of a new independent clone with the loss of the y chromosome , detected in both conventional cytogenetics and fish .
the deletion of the y chromosome in men was not considered abnormal in a previous study ; the clinical association between the loss of the y chromosome and aml / mds is still debated because both phenomena are related to aging .
it has been demonstrated that normal males start to lose the y chromosome in bone marrow cells at the age of 60 years , and in a series of 142 patients with loss of y chromosome the cases with karyotype , demonstrating less than 100% loss of the y chromosome , were not statistically associated with aml / mds .
our patient was 60 years old at diagnosis and developed loss of y chromosome in about 30% of cells at the age of 65 , 5 years after the start of lenalidomide treatment , with periods of discontinuation of treatment and dose tapering .
clearly , the loss of y chromosome is still a gray zone and we will thus continue to monitor our patient . treatment with lenalidomide improved health - related quality of life ( fact - an ) ; improvements were apparent at week 12 and were significantly demonstrated through 6 years , with absolute change from baseline fact - an scores exceeding 7 points .
neutropenia grade 3 was the most common treatment - associated adverse event , no venous thromboembolism was registered , but aspirin as thromboprophylaxis was administered .
current recommendations state that treatment with lenalidomide in del(5q ) mds should be continued until disease progression .
the question whether interruption of lenalidomide treatment is beneficial in patients in remission has never been formally addressed .
this concept is appealing for several reasons : first , it would reduce costs and side effects ; second , the progression to aml in 5q disease is not entirely understood . reducing lenalidomide exposure
would prevent a notional selective pressure of the compound on 5q stem cells , facilitating disease progression .
it has been speculated that continuous administration of lenalidomide may lead to selective pressure on stem cells that induces genomic instability , resulting in acute leukemia transformation .
our patient , as other cases in the literature , remained in long - term complete cytogenetic remission without lenalidomide treatment , before showing reappearance of 5q .
the reappearance of 5q is not equivalent to transfusion dependence and many patients remain transfusion free for years without being exposed to lenalidomide ; in our case , the restart of lenalidomide treatment did not result in a very profound cytogenetic response compared to using lenalidomide as a first - line treatment .
in our case , lenalidomide interruption was safe and feasible as also reported in other mds patients with 5q of low and intermediate-1 risk according to the ipss .
mcv and vitamin b12 levels could help together with platelet count decline to predict the response . | backgroundthe introduction of the immunomodulatory drug lenalidomide has revolutionized the treatment of patients with myelodysplastic syndromes ( mds ) and deletion of the long arm of chromosome 5 .
treatment with lenalidomide results in transfusion independence in the majority of patients , but some questions remain unresolved , among them the duration of treatment .
moreover , a number of unexpected long - term remissions in patients who stopped lenalidomide for various reasons have been observed.case reportwe report the case of a 60-year - old caucasian male with deletion of the long arm of chromosome 5 and international prognostic scoring system ( ipss)-defined low - risk mds who was treated with lenalidomide , achieving complete cytogenetic remission and erythroid response . after tapering off and interrupting the treatment , the patient relapsed and showed a new response by lenalidomide retreatment .
six years after the initial treatment , we registered a durable erythroid long - term response and good tolerance , but there was no evidence of a very profound cytogenetic response compared to using lenalidomide as a first - line treatment .
cytogenetic and fluorescence in situ hybridization together with hemoglobin level , mean corpuscular volume ( mcv ) and vitamin b12 level helped us to monitor the patient response ; during the various phases of lenalidomide treatment , mcv and vitamin b12 normalization correlated with good response.conclusionlenalidomide interruption and rechallenge in some 5q mds patients , with low risk according to the ipss , is safe and feasible but does not result in a profound cytogenetic response . |
post traumatic hip dislocations are very rare in children . neglected anterior hip dislocations in children are not described in literature so far . here , we present a case of 6 weeks old anterior hip dislocation successfully managed by open reduction .
a 9-year - old male child presented with neglected anterior hip dislocation on left side .
follow up of 1 year , the child had unrestricted activities of daily living and no radiological signs of osteonecrosis or any joint space reduction .
however , we feel that open reduction through direct anterior approach is the preferred mode of management whenever considered possible .
traumatic hip dislocations in children are rare injuries and account for less than 5% of all paediatric dislocations [ 1 , 2 ] .
these are classified into anterior and posterior type and among this anterior dislocation in children is extremely rare injury .
the minimal trauma can produce dislocation in younger children because of generalized joint laxity and the acetabulum being soft with pliable cartilage .
it is not uncommon to miss the diagnosis of dislocations of hip in children especially the posterior dislocation .
there have been several cases of post - traumatic neglected posterior dislocation of hip in children . on the other hand ,
though the exact definition of neglected hip dislocation is not clear , any hip dislocation left unreduced for more than 72 hours is considered to be neglected .
the literature on treatment of neglected dislocation in children is very sparse . to our knowledge ,
no case of neglected anterior dislocation of hip in children has been reported in the literature till date . here
, we report a case of anterior dislocation of hip neglected for 6 weeks in a nine year old child managed successfully by open reduction .
a 9-year - old male child patient presented with history of fall from bicycle after which he was unable to bear weight on the left lower limb .
after removal of splint he was still unable to bear weight on the injured limb due to pain . at the time of presentation to us , the child has an antalgic gait . on clinical examination
, he had deformity of flexion abduction and external rotation with painful restricted movements of hip suggestive of anterior dislocation of hip .
examination of opposite hip , spine and knees is normal . radiological examination confirmed the diagnosis [ fig .
an open reduction of the joint through the anterior approach is planned and using the somerville approach , the hip is approached .
we passed 2.5 mm smooth k wire in to the femoral epiphysis though lateral cortex and neck to prevent separation of physis during reduction in to acetabulum .
intra - operatively , reduction is checked under fluoroscopy and is found to be stable , congruent and concentric through all range of motions of hip [ fig . 2 ] .
post - operative period is uneventful and x rays confirmed the intra - operative congruency [ fig .
after 6 weeks the child is allowed to squat and sit cross - legged . at final
follow up of 1 year , the child is able to perform all activities of daily living without any difficulty [ image 4 ] and x - rays showed no signs of osteonecrosis of head or any joint space reduction [ fig .
pre - operative x - ray showing anterior hip dislocation on left side intra - operative picture showing open reduction of femoral head through somerville approach immediate post - operative x - ray showing congruent joint reduction pre - operative x - ray showing anterior hip dislocation on left side .
x - ray pelvis with both hips ap and frog leg lateral views at 1 year follow up showing no signs of osteonecrosis or joint space reduction
post traumatic hip dislocation in children is a rare entity and its neglected type is much rarer .
traumatic anterior dislocations are less common than posterior type and neglected anterior dislocation is much more rare [ 1 - 3 ] . to our knowledge , there is no single case of neglected anterior dislocation in paediatric population reported in the literature so far .
ideal management includes closed reduction of hip under adequate sedation and analgesia as soon as possible .
unfortunately , this ideal may not be achieved in many developing countries because of difficulties in accessing the health care system and a lack of resources or trained health care professionals . compared to adults , relatively slight trauma and a trivial fall
this adds further to the delay in accessing the health care system in developing countries . with time , acetabulum becomes filled with fibrous tissue in unreduced dislocation so reduction becomes difficult by closed means .
an unreduced hip in a child would not only leave behind a deformity , limp , and pain but also shortening of the limb and thinning of the bone attributable to the absence of stimulus to growth .
the treatment options for reduction of old dislocation are closed reduction , closed reduction with heavy skeletal traction , open reduction .
the alternatives to reduction as a primary treatment in unreduced dislocations in children include sub trochanteric osteotomy and symptomatic treatment until after skeletal maturity when a reconstruction can be performed
. closed reduction and manipulation under general anaesthesia could be done if dislocation is of short duration ( 2 - 4 weeks ) .
the limb is placed in heavy skeletal traction ( 1520% of the patient s body weight ) for 35 days , and portable radiographs are taken every other day .
when the head of the femur is at the level of the acetabulum , the limb is gradually abducted to achieve reduction .
once the hip becomes concentric , the traction weight is reduced and maintained for additional 3 weeks .
buchanan et al concluded that although open reduction in old subluxation usually is difficult and not altogether devoid of danger , it was the best treatment . in a review of the literature ,
choyce et al reported open reduction in 15 neglected dislocations of hip in children and reported good results in nine children , satisfactory results in two children , and fibrous ankylosis in one child .
verma et al did open reduction in 14 patients who had neglected injuries that were 14 days to 1 year old and reported excellent outcomes in four patients , good outcomes in four patients , fair outcomes in one patient , and poor outcomes in five patients .
kumar and jain et al in their study on 18 patients of neglected posterior dislocation treated them by open reduction because by skeletal traction dislocation could not be reduced . in their study , there was varying degree of avascular necrosis with preservation of head .
all these studies support open reduction for neglected dislocations of hip but in these studies no single case of anterior dislocation of hip was described .
there are few studies on neglected anterior dislocation of hip but all these include adults .
avinash alva et al reported a case of a young man with 5 months neglected anterior dislocation of the hip .
a modified girdle stone operation was performed leaving the patient with a pain free functional hip . n.d.aggarwal and
hardas singh reported 7 cases ( 20yrs to 68 yrs ) of anterior dislocations treated with trochanteric osteotomy in 5 cases , open reduction in one case and arthroplasty in another case .
although the number of cases in this series is small , the authors feel that trochanteric osteotomy is the treatment of choice . v s
closed reduction was done in one case , open reduction in one case and girdle stone in one case . based on all these studies
it was understood that the treatment must be individualized because no method had been proven superior in the existing medical literature .
conclusions are difficult to draw because prior studies have included more than 1 treatment method in both adults and children . in the present case report , we have reported a case of 9-year - old child with neglected anterior dislocation of hip .
the child was able to squat and sit cross leg at 6 weeks of follow up and at 1 year of follow up he is able to do all daily activities without any difficulties .
no radiological signs of osteonecrosis are present at a minimum follow up of 1 year .
in developing countries , it is not very rare to come across neglected trauma . we conclude that open reduction through direct anterior approach to hip is the treatment of choice in neglected post traumatic anterior dislocation of hip especially in paediatric population where salvage of the joint remains top priority neglected traumatic anterior dislocation of hip in paediatric age group is rare and can be managed successfully by open reduction through anterior approach with necessary precautions . | introduction : post traumatic hip dislocations are very rare in children . neglected anterior hip dislocations in children are not described in literature so far . here , we present a case of 6 weeks old anterior hip dislocation successfully managed by open reduction.case presentation : a 9-year - old male child presented with neglected anterior hip dislocation on left side .
open reduction carried out through direct anterior approach to hip .
congruent reduction is achieved . at final
follow up of 1 year , the child had unrestricted activities of daily living and no radiological signs of osteonecrosis or any joint space reduction.conclusion:there is paucity of literature over neglected post traumatic anterior hip dislocations in children .
the treatment options vary from closed reduction after heavy traction to sub trochanteric osteotomy .
however , we feel that open reduction through direct anterior approach is the preferred mode of management whenever considered possible . |
a 55-year - old man with a 28-year history of diabetes was referred to our retina clinic for a regular ophthalmic examination for diabetic retinopathy . at the time of the first visit , the patient presented with proliferative diabetic retinopathy in both eyes and clinically significant macular edema .
he had undergone pars plana vitrectomy for proliferative diabetic retinopathy in combination with phacoemulsification and implantation of a hydrophilic acrylic iol in the capsular bag of the right eye at another hospital two months prior . in addition
four months later , the bcva of the right eye had decreased to a finger count at 10 cm and the intraocular pressure was 38 mmhg as measured by applanation tonometer .
he underwent ahmed valve implantation through pars plana vitrectomy at our hospital immediately after the diagnosis of neovascular glaucoma .
iol opacification , causing decreased visual acuity , was found five months following the surgery for glaucoma ( ten months following the implantation of the iol ) during monitoring of the clinical course ( fig .
1 ) . there was a concurrent presence of microhyphema as we monitored the clinical course .
however , after the disappearance of hyphema , his visual acuity of the right eye dropped to hand motion and did not improve .
the iol was explanted from the right eye 45 months after implantation . for the explantation of the lens ,
the optics were relieved from the capsular bag by manual dissection with a spatula and viscodissection .
the iol was explanted , piece by piece , through a 3.0 mm corneal incision . a hydrophobic acrylic iol ( ya-60bb ; hoya inc . ,
there was a well - circumscribed centrally and paracentrally located opacification of the original iol optic .
the opacification was generalized , white , homogenous and it affected the entire surface inside of the iol .
postoperatively , the patient did not exhibit specific complications and the visual acuity improved to 0.04 .
six months after the operation , the corrected visual acuity was maintained at 0.06 due to macular edema .
to date , the exchange of iols due to postoperative opacification has been reported in many cases .
these hydrophillic acryl iols include hydroview ( bausch & lomb ) , acrl-60 ( ophthalmed inc . ,
carlsbad , nm , usa ) , memorylens ( ciba vision , duluth , ga , usa ) [ 3 - 5 ] and aquasense ( ophthalmic innovations international , ontario , ca , usa ) .
several tens of cases of postoperative opacification have also been reported following the use of sc60b - ouv ( medical developmental research , clearwater , fl , usa ) [ 6 - 8 ] .
in addition , two cases of postoperative opacification after implantation of centerflex 570h ( rayner , east sussex , uk ) have been reported .
it is theorized that the deposition of minerals , including ca , on the optical surface of iols produces the opacification . in the case
outlined here , iol opacification developed in the optical substance of akros fit ( bausch & lomb ) .
it is important to note that histopathological assessments were not performed for iol that were removed in the current study . considering that the clinical characteristics of the current case are analogous to previous reports
, the deposition of minerals , including ca , on the surface of optical part is assumed to be the causative factor [ 1 - 12,14 ] .
werner et al . showed that the opacification of iols that were implanted in the eye following cataract surgery was not associated with the substance used during surgery .
recently , sher et al . suggested that the intraoperative use of viscoat ( alcon , fort worth , tx , usa ) has a facilitating role in the development of late opacification of the hydroview ( bausch & lomb ) iol .
based on results of studies that have been conducted up to the present , a higher rate of opacification was observed in patients with systemic diseases such as diabetes .
ha et al . reported that all three patients with ca deposition on the surface of their hydrophilic acrylic iols had a proliferative diabetic retinopathy .
suggested that the occurrence of proliferative ophthalmic diseases is associated with some growth factors and some of these exist within the vitreous body . in cases of proliferative diabetic retinopathy
, in the vitreous body of patients with proliferative diabetic retinopathy a higher concentration of protein is identified .
this is involved in the production of angiotensin i and elevates the concentration of serum ca . with the activation of some growth factors within the vitreous body , inositol phosphate
five of eighteen patients who developed opacification of iols following cataract surgery were noted to have diabetes .
however , the authors noted that no methods were available to establish a correlation between these complications and diabetes .
interestingly , in cases in which the disease duration of diabetes is prolonged the opacification occurs rapidly . in patients who had a proliferative diabetic retinopathy opacification developed more rapidly and with a greater severity . in the current case
, there was a 28-year history of diabetes and proliferative diabetic retinopathy in both eyes .
the type and duration of the diseases might be associated with the development of opacification in this case .
it may also be that the inflammatory responses due to the anterior chamber bleeding that developed during the clinical course in some cases affected the opacification of iols .
further histopathological studies are warranted to analyze the opacification of the akreos adapt iols . with the high frequency of postoperative opacification observed , it may be better to use hydrophobic acrylic iols rather than hydrophilic ones .
we report our case of the opacification of the hydrophilic akreos adapt iol , which was not previously reported . in patients with diabetes mellitus
further histopathological studies are warranted to analyze the causes of opacification of the hydrophilic akreos adapt iol . | a 60-year - old diabetic patient transferred to our retina clinic for a regular follow - up for diabetic retinopathy .
he had uneventful cataract surgery at the time of pars plana vitrectomy in the right eye due to diabetic retinopathy at a private ophthalmologic hospital .
six months after the surgery , neovascular glaucoma with hyphema developed in the right eye and an ahmed valve was implanted at our hospital .
ten months after cataract surgery , we found opacification of the intraocular lens ( iol ) which was causing significant visual disturbance . at the time , the best corrected visual acuity ( bcva ) in the right eye was hand motion .
the iol was explanted 45 months after the operation .
five months after explantation , the bcva was 0.06 .
unfortunately , pathologic analysis was not performed .
patient - related factors such as an anterior chamber reaction caused by hyphema might have been responsible for the opacification . to our knowledge
, there are no previous reports of opacification of the akreos adapt iol . |
chronic myelomonocytic leukemia ( cmml ) is a clonal hematopoietic stem cell neoplasm with overlapping myelodysplastic and myeloproliferative features . while progression to acute myeloid leukemia ( aml ) is common , the driving molecular aberrations involved in transformation remain obscure .
clonal cytogenetic abnormalities predict adverse prognosis and are evident in up to 40% of cases .
next generation sequencing has identified molecular aberrations in approximately 90% of cmml patients with tet2 gene mutations ( tet2 + ) being particularly frequent .
concomitant tet2 + and jak2 + have been described in chronic myeloproliferative disorders , but none of these are sufficient to drive blastic transformation . moreover ,
transformation of myeloproliferative disorders most often results in loss of jak2 + indicating the transformation to arise in a jak2-negative subclone .
we here report a case of tet2 + cmml who acquired jak2 + and progressed into overt aml 12 years after initial diagnosis .
array comparative genomic hybridization ( acgh ) revealed a novel del(8q)(q23.2q24.11 ) ( del(8q ) ) comprising genes with recently reported relevance in cancer , including aml .
in 1998 , a 64-year old male presented with pleural effusion , pericarditis , and leukocytosis of 3810/l with 30% monocytes . a complete overview of the clinical course of disease is given in table 1 .
lymph node enlargement emerged in 2007 and a biopsy showed infiltration of 50% fully differentiated monocytes . despite these various cmml - related manifestations , no cytopenias were evident .
however , in 2010 bm failure developed with decreasing hemoglobin and thrombocyte counts and increasing leukocyte count .
nine months later , in june 2011 at the age of 76 the patient was admitted with abdominal pain and severely deranged hematopoiesis and was diagnosed with aml .
flow cytometry of peripheral blood showing 40% myeloblasts staining positive for cd34 , cd117 , hla - dr , and cd13 .
a ct scan showed splenomegaly , and signs of malignant infiltration in the renal parenchyma and the soft tissue along the lower thoracic vertebras , suspicious of myelosarcomas .
the patient received palliative care , but succumbed from progressive renal failure in july 2011 .
routine molecular analysis at aml diagnosis showed a jak2 + allelic burden of 92% of mononuclear cells ( mncs ) from peripheral blood ( pb ) . since jak2 + is usually lost upon transformation this led us to retrospectively delineate the longitudinal evolution of molecular aberrations at critical time points , summarized in table 1 . in short ,
dna was extracted from diagnostic paraffin embedded bm biopsies ( 1998 ) , from thawed bm mncs from the time of disease progression ( 2010 ) , and from pb mncs at the time of overt aml ( 2011 ) .
jak2 + was analyzed for by standard quantitative polymerase chain reaction ( qpcr ) . while the diagnostic cmml sample was negative for jak2 + , the allelic burden was above the 90% level both in the transformation- and aml phase of disease .
the entire coding sequences and all splice sites of the tet2 gene ( exons 311 ) were scanned for mutations by pcr combined with denaturing gradient gel electrophoresis ( dgge ) as described in ref . .
in all samples , a stable frameshift mutation in exon 6 was found ( c.3658_3658del a , thr1220fs .
dna extracted from a benign skin biopsy from 1990 proved negative for tet2 mutations , hence excluding germline mutation ( fig .
1a ) . by multiplex fluorescent - labeled pcr followed by capillary gel electrophoresis we retrospectively analyzed mncs from the time of aml - diagnosis for recurrent aml related mutations ,
namely flt3-itd , flt3-d835 , ckit d816v , idh1 r132 , cebpa , npm1 exon 12 , and wt1 exon 7 of which all came out negative .
standard g - band karyotyping was not performed at initial diagnosis in 1998 , but the karyotype was 46,xy two and a half years from diagnosis in stable phase of disease . however , in september 2010 the karyotype had changed to 46,xy , dup(9)(p21p21)/46,xy . since progressive bm failure was not evident until september 2010 , we considered this time point pivotal in aml transformation .
consequently , we focused on identifying candidate aberrations of potential impact by applying acgh using human cancer cytochip at this time point .
regions of gain or loss contained within copy number variable regions ( cnvs ) were discarded .
high - resolution acgh analysis revealed an interstitial deletion in chromosome 8 at bands q23.2-q24.11 of maximal size 7,7 mb ( position 110.679.916118.334.826 ) ( fig .
to longitudinally analyze for the del(8q ) , we performed fluorescence in situ hybridization ( fish ) with the following directly labeled probes : rp11 - 11a18 ( spectrumorange - labeled , bluegnome , cambridge , uk ) located at 8q23.3 ( position 113.491.837113.659.918 ) and centromere se 8 probe ( fitc - labeled , kreatech , amsterdam , the netherlands ) .
the fish analysis confirmed the presence of del(8q ) in the progression- and aml phase and absence of del(8q ) in the stable phase of cmml in 2001 ( fig .
array cgh did not detect the dup(9)(p21p21 ) found with standard g - banding karyotyping in september 2010 , since the fraction of dup(9 ) positive cells is below the sensitivity of acgh .
we performed an ncbi gene database and pubmed search on each of these genes for their reported relevance in carcinogenesis .
importantly , several of these are of notified relevance ; trps1 and eif3h are reported as candidate oncogenes with increased expression in breast cancer . in a study of non - small cell lung
carcinomas the cub and sushi multiple domains 3 gene ( csmd3 ) was identified as the second most frequently mutated gene and loss of function cause increased proliferation of airway epithelial cells in vitro
. while the csmd gene family has recently been suggested tumor suppressor genes in colorectal cancer , the role of csmd3 in hematological cancers remains to be elucidated .
strikingly , rad21 has been associated with aml as it encodes a protein in the cohesin complex , which is involved in chromosome segregation during cell division , regulation of transcription , and dna double strand break repair .
recently , genes belonging to the cohesin complex were described as novel recurrent and mutually exclusive mutations in myeloid neoplasms .
we have longitudinally described the molecular aberrations present at critical time points from initial diagnosis of cmml to overt aml applying a comprehensive panel of molecular analyses .
firstly , the consistent and non - germ line tet2 + in all stages of disease verify that the aml stage indeed was transformed from cmml and not a de novo event .
it can not be ruled out that the massive jak2 + allelic burden have contributed to genomic instability and , speculatively , also influenced the proliferative potential of the leukemic blasts .
our results indicate that the leukemic transformation of an otherwise long - standing and stable cmml could have been driven by loss of gene function resulting from this exact deletion . of the deleted genes , rad21 and csmd3
are of particular interest , since their loss of function have recently been reported to play a role in carcinogenesis .
finally , this case report emphasizes the relevance of acgh in the search for candidate genes involved in leukemogenesis , not least in heterogeneous neoplasms such as cmml .
we wish to confirm that there are no known conflicts of interest associated with this publication .
there has been no significant financial support for this work that could have influenced its outcome .
we confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship .
we further confirm that the order of authors listed in the manuscript has been approved by all of us .
we confirm that we have given due consideration to the protection of intellectual property associated with this work and that there are no impediments to publication , including the timing of publication .
, from the department of pathology , aarhus university hospital for helping with dna extraction from paraffin - embedded tissue and marcus celik hansen , m.sc . , for graphical support . the karen elise jensen foundation and the danish cancer society ( grant no . | we have identified a novel 7.7 mb del(8)(q23.2q24.11 ) in a patient progressing to acute myeloid leukemia ( aml ) following a 12-year stable phase of chronic myelomonocytic leukemia ( cmml ) . a surprisingly high jak2 + allelic burden of 92% at the time of aml led us to delineate the molecular aberrations relevant for leukemogenesis .
while a frameshift mutation in the tet2 gene was stably present throughout the course of disease the jak2 mutation was acquired after initial diagnosis of cmml . at progression acgh revealed del(8q)(q23.2q24.11 ) encompassing various cancer relevant genes of which rad21 and csmd3 are of particular interest . |
one - third of patients with epilepsy have seizures that are resistant to pharmacological therapy .
resective surgery is effective for patients with pharmacoresistant epilepsy who have a localized area of epileptogenic tissue in noneloquent cortex .
these masses of disorganized neuronal tissue are usually associated with gelastic seizures , intellectual disabilities , and behavioral changes .
tissue destruction can achieve seizure freedom rates ranging from 30 to 50% in mixed adult pediatric populations .
a recent series of 14 patients treated with mri - guided stereotactic laser ablation of hypothalamic hamartomas achieved seizure freedom in 86% with a mean follow - up of nine months .
none of these patients suffered focal neurological deficits , neuroendocrine disturbances , or memory losses .
we present a young man who underwent mri - guided stereotactic laser ablation of a hypothalamic hamartoma following a right temporal lobectomy for resection of a focal cortical dysplasia .
his case illustrates the need to assess for dual pathology in treatment of pharmacoresistant epilepsy and the potential complications of mri - guided stereotactic laser ablation .
a 19-year - old right - handed man had attention deficit disorder and treatment - resistant focal epilepsy with weekly seizures ( behavioral arrest , incomprehensible speech , and postictal confusion ) since the age of nine .
seizures persisted despite trials with 12 antiepileptic drugs used in up to three - drug combinations , steroids , intravenous gamma globulin , modified atkin 's diet , and a vagus nerve stimulator .
on video - eeg , seizures involved bilateral changes evolving more over the right hemisphere .
magnetoencephalography showed multifocal bilateral polyspike - and - wave discharges as well as right frontal
temporal occipital discharges . magnetic resonance imaging demonstrated a subtle cortical abnormality in the right insula and frontal operculum , with subtle atrophy of the right fornix and mammillary body .
neuropsychological testing targeting delayed memory recall showed story memory delayed recall ( dr ) 50th percentile , list learning dr 75th percentile , and figure copy dr 14th percentile ( table 1 ) .
intracarotid amobarbital testing revealed left language dominance and right hemispheric memory impairment ( right hemisphere memory [ left injection ] score : 7/12 ; left hemisphere memory [ right injection ] score : 12/12 ) .
when the patient was 17 years old , intracranial eeg monitoring with right hemispheric grids , strips , and depths captured 49 seizures : 32 had broad onset over the right lateral
temporal , mesial temporal , frontal , and occipital lobes and insula , while 17 arose from depth electrodes in the right posterior mesial temporal lobe .
he underwent resection of the right lateral temporal and mesial cortex , along with the inferior insula and frontal operculum .
he remained active in varsity lacrosse , maintained a 3.5 gpa in a competitive high school , had a close circle of friends , and was accepted to his first - choice college .
a brief neuropsychological screen revealed list learning dr 50th percentile , figure copy immediate recall ( ir ) , and dr 18th percentile ( table 1 ) . when he was 18 , repeat mri demonstrated the right temporal lobectomy and now an 8-mm hypothalamic hamartoma on the right , not recognized on multiple previous mri studies ( fig .
in retrospect , the patient now admitted that his seizures both before and after the lobectomy included mirthless laughter .
he was referred to a center with expertise at mri - guided stereotactic laser ablation and underwent this procedure .
he reported feeling as though he was in a dream with events happening in a disjointed fashion .
three weeks postoperative , he required hospitalization for agitation and suicidal ideation and was diagnosed with a severe amnestic syndrome with confabulation .
video - eeg monitoring captured several complex partial seizures with impaired responsiveness and bilateral ictal discharges .
repeat mri showed not only successful ablation of the hamartoma but also unexpected contrast enhancement that crossed the midline involving the bilateral medial mammillary bodies and adjacent anteromedial left thalamus ( fig .
neuropsychological testing ( table 1 ) revealed a dense anterograde amnesia ( story memory ir 1st percentile , dr 0.1 percentile ; list learning ir 2nd percentile , dr 1st percentile ; and figure copy dr 1st percentile ) , with impaired attention and processing speed .
neuropsychological testing ( table 1 ) eight months after hamartoma ablation demonstrated improved attention , concentration , and immediate recall but severe deficits in delayed recall ( story memory ir 13th percentile , dr 2nd percentile ; list learning ir 18th percentile , dr < 0.1 percentile ; and figure copy memory dr < 0.1 percentile ) . clinically , he has a disabling amnestic syndrome .
he deferred his college education plans and is unable to drive because of ongoing seizures .
they cause medically refractory epilepsy associated with some combination of gelastic and other seizure types , cognitive impairment ( epileptic encephalopathy ) , and behavioral changes including aggression . removal or destruction of the hamartoma can control seizures and improve cognition , especially in children .
magnetic resonance imaging - guided laser ablation is a minimally invasive technique that uses mri - guided placement and application of thermal heat to destroy a tissue focus . among 14 patients with medically refractory epilepsy due to hypothalamic hamartoma who underwent stereotactic laser ablation , 11 ( 79% ) became seizure - free after a single treatment ;
another patient became seizure - free after a second ablation ( 12/19 ; 86% ) .
there were no surgical complications previously associated with traditional operative techniques , such as neuroendocrine disturbances , visual changes , or hemiparesis .
our patient 's case is the first reported serious complication of mri - guided stereotactic laser ablation of hypothalamic hamartoma .
the presence of bilateral postoperative changes in the mammillary bodies suggests that the laser ablation may have been sufficient to account for his deficits .
one group reported on a patient who also presented with such dual pathology : a 35-year - old man who underwent removal of a left temporal subarachnoid cyst and resection of temporal neocortex for treatment of intractable complex partial seizures .
similar to our patient , targeted questioning revealed that he had always experienced short outbursts of genuine laughter , which he had not felt was abnormal .
postoperative mri , ictal pet , and spect revealed an 8-mm hypothalamic hamartoma retrospectively present on preoperative scanning .
three other patients underwent partial or total resection of a hypothalamic hamartoma and later had temporal lobectomies . in two of these cases
, there were no pathological abnormalities found in the resected temporal lobe tissue ; pathology in the third case is not described .
secondary epileptogenesis was postulated as the cause of the temporal lobe focus after removal of the hypothalamic hamartoma .
transient memory loss ( two months ) following lesionectomy of the hamartoma was seen in one of the cases but did not worsen further after the temporal lobectomy .
by contrast , a fourth patient had mesial temporal sclerosis and a 5-mm hypothalamic hamartoma and presented with epigastric rising sensation , dizziness , and fear .
video - eeg recording localized seizure onset to the right temporal lobe , and she became seizure - free after a right temporal lobectomy .
gelastic seizures not only are associated with hypothalamic hamartomas but also occur with seizure foci due to diverse pathologies , including focal cortical dysplasias in the temporal , frontal , and parietal lobes .
our case was unique in having both a hypothalamic hamartoma and pathologically confirmed focal cortical dysplasia .
the hypothalamic hamartoma was missed at several academic medical centers but was present before the right temporal lobectomy , although subtle .
mild brain shift from the original resection widened the appearance of the third ventricle and made the hamartoma obvious .
our patient 's original seizures may have been attributable to the right temporal focal cortical dysplasia , the hypothalamic hamartoma , or a network involving the two abnormalities .
anterograde amnesia can result from disruption of mesial temporal lobe structures or the mesial diencephalon .
diencephalic ( mammillary bodies and medial thalamus ) pathology can result from alcoholism , malnutrition , infection , trauma , or infarct [ 1719 ] .
however , many cases show damage involving other portions of the memory network , including the hippocampus .
our case is unique since anterograde amnesia resulted from a right temporal lobectomy followed by an ablative lesion that unfortunately extended into both medial mammillary nuclei with greater involvement contralateral to the lobectomy .
it is likely that the bilateral nature of the temporal diencephalic lesion led to amnesia .
this case illustrates the potential for severe memory deficits following laser ablation of hypothalamic hamartomas .
since many children who undergo this procedure are very young or have moderate - to - severe intellectual disability , it may be difficult to assess memory function in these individuals .
it is worthwhile to consider dual pathology in epilepsy and the potential morbidity of mri - guided laser ablation of hypothalamic hamartomas , especially in a patient with a prior temporal lobectomy .
| a 19-year - old man with cortical dysplasia and intractable focal seizures underwent a right temporal lobectomy .
a hypothalamic hamartoma was subsequently recognized , and he then underwent mri - guided stereotactic laser ablation .
unfortunately , he sustained damage to the bilateral medial mammillary bodies and suffered significant memory loss .
we review laser ablation therapy for hypothalamic hamartomas and the anatomy of the memory network .
we postulate that his persistent memory disorder resulted from a combination of the right temporal lobectomy and injury to the bilateral medial mammillary bodies . |
eosinophilic gastroenteritis is an uncommon disease that 's pathologically characterized by marked eosinophilic infiltration in any area of the gastrointestinal tract without the presence of parasitic infections , drug reactions or malignancy . since it was first described in 1937 by kaijer1 ) , approximately 300 cases have been reported worldwide by 19962 ) and there have been korean 31 cases3 ) .
the clinical manifestations are related to the site of gastrointestinal ( gi ) involvement and the layer of the involved bowel wall4 ) . to the best of our knowledge , eosinophilic enteritis presenting as intussusception in adult has not been reported in the literature .
a previously healthy 55-year - old korean male was admitted to our hospital with a 7 day history of intermittent left abdominal pain without nausea , vomiting , diarrhea or hematochezia .
the man 's pain had intensified and loose stool had occurred over the previous 24 hours . he had no history of medications , atopy or food allergy . the physical examination on admission revealed an acute ill appearance , but the patient was alert and mentality orientated .
his body temperature was 36.8 , the blood pressure was 130/90 mmhg , the pulse 80/min and the respiratory rate 18/min .
he was tender upon palpation in the left mid abdomen ; he had no rebound tenderness .
laboratory investigation revealed a white blood cell count of 9,100/mm with 16.8% eosinophils , an eosinophil count of 1,824/mm , a hemoglobin level of 14.1 g / dl , a prothrombin percentage of 51% and an international normalized ratio ( inr ) of 1.72 .
the serum total protein (= 7.3 g / dl ) and albumin (= 4.2 g / dl ) were within the reference ranges .
the chest radiograph was within normal limits , and the abdominal film revealed a nonspecific bowel gas pattern .
abdominal ultrasound demonstrated a central echogenic core surrounded by a hypoechoic rim in the left midabdomen ( figure 1a .
the longitudinal section demonstrated jejunojejunal intussusception ( figure 1b ) . computed tomography scanning demonstrated diffuse circumferential wall thickening at the duodenal bulb and jejunum , and this
was combined with short segmental enteroenteric intussusception ( arrow ) without a definite mass or any enlarged lymph nodes ( figure 2 ) .
however , we could not rule out a small bowel mass as a leading point of intussusception in this adult .
it showed only diffuse mucosal edema and erythematous change at the jejunum without a mass lesion ( figure 3 ) .
a stool exam , a serologic test for parasitic infection via micro - elisa and the serum ige level ( 42.8 iu / ml , normal range : 0~170 ) were all within the normal ranges .
esophagogastroduodenoscopy and colonoscopy showed normal mucosa except for mucosal edema and the erythematous change at the duodenum .
histologically , normal mucosa was observed at the terminal ileum , cecum , ascending colon , transverse colon , descending colon , sigmoid colon , rectum , gastric antrum , body and fundus . at the duodenum ,
a diffuse infiltration by inflammatory cells and mainly eosinophils ( more than 20/high power field ) were observed .
in addition , there were extracellular eosinophilic granules in the lamina propria , and eosinophils in the epithelium were also observed ( figure 4 ) .
his abdominal pain was improved and the follow up eosinophil count after 7 days medication was within the normal range .
eosinophilic gastroenteritis is defined as a disorder that selectively affects the gastrointestinal tract with eosinophil - rich inflammation in the absence of any known causes for this eosinophilia such as drug reactions , parasitic infections or malignancy .
the clinical manifestations vary according to the site of the eosinophilic infiltrated layer of the bowel wall .
klein et al.4 ) classified it into three forms based on the dominantly involved layer of the bowel wall ( e.g. the mucosal , muscular and subserosal types ) .
in the mucosal type , symptoms such as diarrhea , hematochezia and cramping abdominal pain usually occur , which are similar to those of inflammatory bowel diseases . in the other hand ,
thickening of the muscular layer in the muscular type narrows the intestinal lumen and leads to intestinal obstruction or perforation .
therefore , eosinophilic gastroenteritis should be considered in the differential diagnosis for the above mentioned , unexplained gastrointestinal signs and symptoms .
most patients with this disorder can be treated successfully without surgical therapy if the correct diagnosis is made .
although in our case the dominant affected layer of the bowel wall was not confirmed histologically , it was thought to be the muscular type based on the clinical feature of the muscular type ( intussusception ) , and there was no diarrhea of the mucosal type or ascites of the subserosal one .
however , some gi symptoms and eosinophilic infiltration of the gi tract without involvement of other organs such as heart or cns may support the diagnosis .
the presence of food allergy and peripheral eosinophilia are not required for the diagnosis6 ) .
although a normal esophagus is devoid of eosinophils , the rest of the gastrointestinal tract contains readily detectable eosinophils .
thus , differentiation of eosinophilic gastroenteritis from the normal condition relies on several factors , including eosinophil quantification and comparisons with the normal values at each medical center , the location of the eosinophils ( e.g. their presence in abnormal positions such as he intraepithelial , superficial mucosal and intestinal crypt regions ) , the presence of extracellular eosinophilic staining constituents ( often free granules ) , and the absence of pathologic features suggestive of other primary disorders ( e.g. neutrophilia associated with ibd or vasculitis associated with churg - strauss syndrome)6 ) .
our patient , who had no history of medications , atopy or food allergy , presented with intussusception together with peripheral eosinophilia and a typical eosinophilic infiltration of the gi tract without involvement of the other organs ( figure 4 ) .
intussusception is an extremely rare complication of eosinophilic gastroenteritis and only 4 childhood cases of this disease have been reported so far7 - 10 ) .
however , eosinophilic enteritis presenting as intussusception in adult has not been reported in the literature .
intussusception remains a rare condition in adults , and it represents 1% to 3% of all bowel obstructions11 ) . in adults ,
acute intestinal obstruction is not common and most patients present with subacute , chronic or intermittent symptoms .
the classic clinical triad of conventional intussusception consists of abdominal pain , a palpable sausage - shaped mass and occult blood positive stool , but this complete spectrum of signs is rarely present12 ) .
our patient only has an intermittent cramping abdominal pain for about a week , yet based on ultrasonography , the correct diagnosis of intussusception was easy to make . because a demonstrable etiology can be found in 70% to 90% of the adult cases of intussusceptions , and about 40% of them are caused by a primary or secondary malignant neoplasm11 - 13 ) , we performed ct and capsule endoscopy .
the ct scan revealed diffuse circumferential wall thickening at the duodenal bulb and jejunum , and this was combined with short segmental jejunojejunal intussusception without a definite mass or any enlarged lymph nodes .
capsule endoscopy also showed only diffuse mucosal edema and erythematous mucosal change at the jejunum without a mass lesion .
the patient was diagnosed as suffering with intussusception due to eosinophilic gastroenteritis , and he was treated with oral prednisolone at 30 mg / day . from the therapeutic point of view , an appropriate therapeutic approach includes a trial of food elimination if sensitization is found on the basis of food skin testing , radioallergosorbent testing ( rast ) or both . however , because no sensitization was found , we choose the anti - inflammatory drug prednisolone .
drugs such as ketotifen , montelukast , sodium cromoglycate or alternative chinese medicines have been advocated , but controlled trials are lacking for any therapies14 - 17 ) .
our patient 's abdominal pain and tenderness were dramatically improved and this disappeared after 7 days of medication ; the eosinophil count was normalized .
the natural history of eosinophilic gastroenteritis has not been well documented , but regular evaluation with endoscopy and abdominal ultrasonography , and obtaining the eosinophil count are necessary due to the chronic waxing and waning nature of this disorder .
in addition , routine surveillance of the cardiopulmonary systems is recommended6 ) because these diseases can often be a manifestation of another primary disease process . for our patient ,
we report here on a first case of eosinophilic enteritis that presented as intussusception in a 55-year - old man . | eosinophilic gastroenteritis is defined as a disorder that selectively affects the gastrointestinal tract with eosinophil - rich inflammation in the absence of any known causes for eosinophilia .
the clinical manifestations vary according to the site of the eosinophilic infiltrated layer of the bowel wall .
eosinophilic enteritis presenting as intussusception in adult has not been previously reported in the literature .
especially , making the diagnosis of intussusception in adults is often difficult due to the variable clinical findings . in our case ,
the correct diagnosis of intussusception due to eosinophilic enteritis was arrived at rather easily based on the ultrasonography and endoscopic biopsy .
the patient was treated with oral prednisolone at 30 mg / day for 7 days , and then the drug was tapered off for 2 months ; we did n't perform surgery .
he has been asymptomatic for about 1 year after discharge without disease recurrence . |
leptospirosis is a bacterial zoonosis with global distribution , although it has been documented in developing and developed as well as temperate and tropical countries [ 1 , 2 ] .
this disease occurs predominantly as a subclinical infection although cases of clinical disease with numerous nonpathognomonic signs and symptoms have been reported [ 14 ] .
it is therefore responsible for morbidities and mortalities worldwide [ 2 , 5 , 6 ] .
it has been established that rodents are primary reservoirs for human and animal infections by leptospira spp . which is one of the reasons that the prevalence of leptospirosis is higher in tropical environments with high rainfall and humidity and prevalent poor sanitary conditions which support the proliferation of rodents [ 79 ] .
the distribution of the primary reservoir and the ability of the pathogen to infect animals ( livestock , wildlife , pet animals , and others ) have made leptospirosis an occupational disease [ 911 ] .
high risk individuals include livestock farmers , animal handlers , veterinarians , slaughter house workers , sewerage or environmental sanitation workers , sugar cane , and rice field workers , compared to members of the general population [ 9 , 11 , 12 ] .
human infections are known to result from direct and indirect contact with urine of rodents or other animals containing high numbers of viable leptospires or following consumption of contaminated food or water [ 13 , 14 ] .
a number of factors , in addition to occupational exposure , have been reported to affect exposure potential in humans to leptospirosis .
these factors include the age , gender , season of the year , and geographical locations and have been known to affect the infection rate in humans [ 15 , 16 ] .
diagnosis of human leptospirosis can be achieved through the demonstration of the microorganism itself or by the detection of antibodies produced against the pathogen following infection [ 13 , 17 ] .
the organism can be demonstrated by culture in growth media , special staining of infected tissues , and the use of dark - field microscopy [ 13 , 18 ] .
there is a wide variety of serological tests which can detect igg , igm , and iga .
some of these tests include the enzyme - linked immunosorbent assay ( elisa ) and microscopic agglutination test ( mat ) amongst others . the mat is considered the gold standard for the serological diagnosis of leptospirosis and also for the serotyping of leptospira isolates [ 21 , 22 ] .
the advantages and disadvantages of the mat as a diagnostic test are well documented in the literature [ 2123 ] .
the elisa is easy to perform , rapid , with a high sensitivity , and amenable to be standardized but the specificity is low and it is genus - specific and , therefore , unlike the mat , can not be used to serotype infecting leptospires [ 24 , 25 ] . in trinidad and tobago ,
several reports exist on the prevalence of leptospirosis with the detection or isolation in school children , apparently healthy individuals and in piggery farm workers .
mohan et al . conducted a retrospective study which determined the average annual incidence rate of leptospirosis and indicated that rate was affected by season , gender and age . in a study conducted on sugarcane field workers , adesiyun et al .
to date there is no report on the occurrence of leptospirosis in students at tertiary institutions in the country .
the specific objectives of the current study were to compare the frequency of serological evidence of leptospirosis in veterinary students with nonveterinary students in the faculty of medical sciences , to determine the infecting serovars of leptospira spp . and to investigate the important risk factors for leptospirosis in these students .
the study group comprised students in four schools , school of dentistry ( sod ) , school of veterinary medicine ( svm ) , school of advanced nursing education ( sane ) , and school of pharmacy ( sop ) , at the faculty of medical sciences ( fms ) .
the study was conducted from august 2010 to july 2011 when the student population in each of the schools were as follows : sod ( 160 ) , svm ( 170 ) , sop ( 279 ) , and sane ( 89 ) , a 3-year programme .
the study design involved the sampling of students of each of the schools who volunteered to participate and then comparing the serological evidence of veterinary students with those of nonveterinary students .
the sample size for the student population will be determined using the formula no = t p(1 p)/d , where t = 1.96 , d = precision at type 1 error of 0.04 , p = prevalence = 11% , and no = estimated sample size . since this equation is based on an infinite population ,
no was adjusted to suit a definite population of 698 student population in four schools ( sod , svm , sane , and sop ) in the fms , using the formula nadj = ( n no)/(n + no ) , where nadj was the number of humans required to estimate prevalence at the same absolute precision as the first equation .
the estimated sample size used in the current study was therefore : no = 1.96 0.11(1 0.11)/0.04 = 3.84 0.0979/0.0016 = 235 and the minimum adjusted sample size was nadj = ( 235 698)/(235 + 698 ) = 176 .
a questionnaire was administered to each participant in order to obtain information including the programme of study , year in the programme , age , gender , place of residence , ownership of pet animals ( dogs , cats , and rodents ) , association with livestock , farming activities outside the fms , and other risk factors . each participant was allowed to pick a random number which was used to identify the samples and the test results of the participant . to maintain the confidentiality of the study ,
e - mail addresses were obtained to convey the results of the study to each participant .
approximately 5 ml of blood was drawn from either the median cubital or cephalic veins of the arm using a 21-gauge one and a half inch needle attached to a 5 ml syringe .
the blood was then placed into tubes without anticoagulant . collected blood was refrigerated overnight at 4c after which it was centrifuged and serum harvested and stored at 20c until tested .
this was a serological study to detect exposure experience of leptospira spp . amongst the students
studied using both the elisa and mat and therefore no attempt was made to culture the blood samples for leptospira spp .
the captureelisa to detect igg ( existing infection ) was used to detect prior exposure of participants to leptospirosis in microtitre plates as stipulated by the manufacturer ( serion elisa classic leptospira igg / igm , hersteller manufacturer fabricant , friedrich - berguis - ring 19d , 97076 wurzburg , germany ) .
the concentration of igg ( units per ml ) in samples was determined using the standards provided in the test kit .
these samples were then classified as follows : negative : 0 to 4.9 units / ml .
, borderline : 5.0 to 9.9 units / ml , and positive : 10 units and higher as recommended for the test kit . for the microscopic agglutination test ( mat )
, 26 serovars of lyophilized antigens were obtained from the koninklijk instituut voor de tropen / royal tropical institute ( kit ) , biomedical research laboratory , amsterdam , the netherlands .
the international panel utilized consisted of the following serogroups / serovars : australis bratislava jez bratislava , ballum ballum mus 127 , canicola canicola hond utrecht iv , grippotyphosa grippotyphosa duyster , grippotyphosa grippotyphosa mandemakers , hebdomadis hebdomadis hebdomadis , icterohaemorrhagiae icterohaemorrhagiae kantorowic , icterohaemorrhagiae copenhageni wijnberg , pomona pomona pomona , pomona proechimys 1161 u , sejroe hardjo hardjoprajitno , sejroe saxkoebing mus 24 , sejroe sejroe m 84 , semaranga patoc patoc i , andaman andaman ch 11 , australis australis ballico , autumnalis rachmati rachmat , bataviae bataviae swart , cynopteri cynopteri 3522 c , panama panama cz 214 k , pyrogenes pyrogenes salinem , semaranga semaranga veldrat sem 173 , shermani shermani 1342 k , autumnalis bim , icterohaemorrhagiae mankarso , and tarassovi tarassovi perepelicin . the mat used consists of two parts , qualitative to detect the serogroups present in the antisera and the quantitative aspect to determine the titres of antibodies present . for the qualitative aspect , which followed the protocol described by world health organization ( 13 ) , the panel of 26 serovars were used .
the antigens were subcultured in bijou bottles weekly , incubated at 30c and checked for the attainment of a density of 1 - 2 10 after 57 days . for determination of titres ( the quantitative part ) ,
serial 2-fold serum dilutions were made with any sera showing agglutination to any of the antigens used . where there were 2 serovars with the same titre , these were considered as mixed infections .
this procedure was done following standard protocol as described by the royal tropical institute in the manual for the international course on laboratory methods for the diagnosis of leptospirosis ( 21 ) .
a titre of 1 : 20 and higher was considered as evidence of leptospira spp .
the ethics committee of the faculty of medical sciences approved the study prior to commencement .
the objectives and protocol for the study were explained to all the participants and a written consent was obtained . the statistical package for social sciences ( spss ) version 15.0
chi - square analysis was conducted to determine risk factors for leptospiral infection in humans and level of significance will be fixed at alpha = 0.05 .
table 1 shows the demographic data of students from the four schools in the fms , university of the west indies , trinidad and tobago , who volunteered to participate in the study .
overall , a total of 212 students participated in the study comprising 113 veterinary students and 99 nonveterinary ( 46 dental , 39 nursing , and 14 pharmacy ) students . based on data generated on students ' characteristics and risk factors for leptospirosis , a majority ( 54.7% ) of students sampled were in years 2 and 3 of their respective programmes , aged 25 years and older ( 37.3% ) , and female ( 73.1% ) and reside at homes ( 53.3% ) . amongst the participants across the four schools ,
none ( 0.0% ) had prior diagnosis of leptospirosis , 69.8% kept pet animals ( dogs / cats ) with the highest frequency amongst veterinary students ( 80.5% ) . a majority ( 41.0% ) kept animals strictly as home or pet animals ; the most ( 36.8% ) maintained low levels of contact with their animals with the exception of veterinary students where a majority ( 46.9% ) mentioned that they have close contact with their pets . a high frequency ( 98.6% ) of pet animals
also the highest frequency of farming ( 10.6% ) outside the faculty was practised by veterinary students of which most were livestock farming ( 9.7% ) .
a total of 83 ( 39.2% ) of 212 students stated that they encountered rodent problem in the premises where they lived but only 3.3% keep rodents as pets .
of the 113 veterinary students tested , using the elisa , igg immunoglobulins to leptospira spp .
11 ( 9.7% ) and 19 ( 16.8% ) were classified as positive and borderline results , respectively , while for nonveterinary students it was 1 ( 1.0% ) and 12 ( 12.1% ) , respectively , as shown in table 2 .
overall , a comparison of the seropositivity rate for igg immunoglobulins ( positive and borderline ) to leptospira spp . in veterinary students ,
26.5% ( 30 of 113 ) , was statistically significantly ( p < 0.05 ; ) higher than for nonveterinary students from the other schools , 13.1% ( 13 of 99 ) .
the seropositivity rates for immunoglobulins to leptospira spp . when assayed by the mat were similar for veterinary students , 7.1% ( 8 of 113 ) , and nonveterinary students , 7.1% ( 7 of 99 ) , as shown in table 3 .
only seven ( 26.9% ) of the 26 serovars tested were agglutinated at a titre of 20 and higher .
for the 16 significant agglutinations detected , 7 ( 43.8% ) , 7 ( 43.8% ) , 1 ( 6.3% ) , and 1 ( 6.3% ) were at titres 1 : 20 , 1 : 40 , 1 : 80 , and 1 : 320 , respectively . five ( 83.3% ) of the 6 significant agglutinations of serovar icterohaemorrhagiae were detected amongst veterinary students while all 5 ( 100.0% ) significant agglutinations of serovar australis rachmati were amongst nonveterinary students .
a comparison of both serological tests used in the study showed that the frequency of serological evidence in all students was significantly ( p < 0.05 ; ) higher , 20.3% ( 43 of 212 ) , by the elisa compared with the 7.1% ( 15 of 212 ) detected by the mat .
regarding seropositivity by risk factors , enrolment as a veterinary student was the only factor that was statistically significantly ( p < 0.05 ; ) associated with serological evidence of leptospirosis and this was detected only using the elisa .
notably , the other risk factors studied ( year in the programme , age , gender , place of residence , recent diagnosis of leptospirosis in pet animals or their owners , ownership of pets ( dogs , cats , and rodents ) , rodent problem at / around homes , class of dogs owned ( strictly pet , strictly guard , or both ) , and contact with pet animals or livestock ( low , medium , or high ) farming ( livestock , rice , or sugarcane ) were not significantly ( p > 0.05 ; ) associated with seropositivity for leptospira spp .
a seroprevalence of 9.7% detected amongst apparently healthy veterinary students using the igg elisa in the current study is comparable to the 8.14% reported for veterinary students in spain where the igg elisa was similarly used .
however , in that study it was established that the rate of infection by leptospira spp . increased with the number of years enrolled in the veterinary programme contrary to what was found in our study where the seropositivity rate was not significantly different for students by class in the programme
this may be due , in part , to the fact that from the first year and throughout the programme veterinary students are exposed to skills training and an externship programme which bring them in close contact to animals .
the finding , by the use of the elisa that the serological evidence of exposure to leptospira spp . in veterinary students was statistically significantly higher than found in nonveterinary students therefore did not come as a surprise .
in the current study , being a veterinary student was in fact the only risk factor that was determined to be significantly associated with exposure to leptospira spp .
the relatively low titres ( mostly 1 : 20 and 1 : 40 ) detected by mat known to have high specificity and low sensitivity [ 2123 ] may have been responsible for the low seropositivity rate detected by the mat . in apparently healthy individuals , low titres ranging from 1 : 20 to 1 :
40 have been used to determine seropositivity for leptospirosis [ 32 , 33 ] . of diagnostic significance
is the finding that the elisa detected significantly higher frequency ( 20.3% ) of serological evidence of exposure experience of leptospira spp . in all the students
this finding agrees with published reports where the elisa has been documented to have higher sensitivity and lower specificity than the mat [ 20 , 24 , 25 ] .
another reason that may be responsible , in part , for the lower sensitivity of the mat is the number and type of serovars of leptospira spp . in the panel
it has been reported that the use of serovars prevalent in a particular geographical area in the screening panel of serovars increases the sensitivity of mat [ 2123 ] .
a major advantage of the mat over the elisa is however the fact that it is able to determine the serovars of the infecting leptospira spp . while the elisa is genus specific .
it is also pertinent to mention that cross - reactions may occur across serovars but it is also known that individuals may be exposed to multiple serovars of leptospira spp . and therefore may not be necessarily due to cross - reaction amongst serovars
. of epidemiological significance was the finding that the predominant leptospira serovar to which veterinary students have been exposed was icterohaemorrhagiae copenhageni while , for nonveterinary students , serovar australis rachmati was the most frequently detected .
this is relevant because most recent studies using isolation and serological techniques demonstrated that serovar icterohaemorrhagiae copenhageni was most prevalent in dogs ( cases of clinical leptospirosis , apparently healthy stray and pet dogs ) , wild rats , and livestock [ 3537 ] .
it is therefore obvious that this serovar which is important in causing clinical leptospirosis and subclinical infections in apparently healthy animals is also most likely responsible for the seropositivity for leptospira spp . in veterinary students in the country , emphasizing the zoonotic significance of leptospirosis .
it was of interest that serovar australis rachmati , not detected in veterinary students , was most common in nonveterinary students from other schools .
the implication of this finding is not readily apparent because the serovar has not been reported in human clinical leptospirosis or subclinical infection in trinidad and tobago but it has been documented in other countries [ 7 , 36 ] .
it is however pertinent to mention that all several panels of serovars used for mat prior to the current study did not contain serovar rachmati . regarding the seven serovars detected in the current study , five ( icterohaemorrhagiae copenhageni , icterohaemorrhagiae icterohaemorrhagiae , sejroe sejroe , ballum ballum , and bataviae bataviae )
have earlier been reported in human and animal infections or clinical leptospirosis in the country [ 2628 , 35 , 38 , 39 ] .
it was concluded that although the frequency of detection of serological evidence of exposure experience of leptospira spp . in the students tested is relatively low , 20.3% by the elisa and 7.1% by the mat , in addition to the low titres ( mostly 20 and 80 ) detected in mat - positive samples , veterinary students have a significantly higher risk of becoming exposed to leptospira spp . than nonveterinary students .
none of the risks factors ( age , year in programme , and gender amongst others ) had any significant effect on infection by leptospira spp .
serovar icterohaemorrhagiae copenhageni was the predominant serovar to which veterinary students were exposed while serovar australis rachmati was most frequent amongst nonveterinary students , with possible epidemiological implications . | the study compared the serological evidence of leptospirosis in 212 students in four schools ( veterinary , dental , advanced nursing education and pharmacy ) of the university of the west indies ( uwi ) , by testing for igg immunoglobulins to leptospira spp . using the enzyme - linked immunosorbent assay ( elisa ) and the microscopic agglutination test ( mat ) .
overall , of 212 students tested by the elisa , 12 ( 5.7% ) and 31 ( 14.6% ) were positive and borderline , respectively . amongst the 113 veterinary students 11 ( 9.7% ) and 19 ( 16.8% ) were seropositive and borderline respectively compared with nonveterinary students with corresponding values of 1 ( 1.0% ) and 12 ( 12.1% ) .
the frequency of serological evidence of leptospirosis by the elisa was statistically significantly ( p < 0.05 ; 2 ) higher in veterinary students , 26.5% ( 30 of 113 ) than in nonveterinary students , 13.1% ( 13 of 99 ) . by the mat , the seropositivity for leptospirosis was similar for veterinary students , 7.1% ( 8 of 113 ) and nonveterinary students , 7.1% ( 7 of 99 ) . for veterinary students ,
the prevalent infecting serovar was icterohaemorrhagiae copenhageni while amongst nonveterinary students , the prevalent serovar was australis rachmati .
being a veterinary student was the only risk factor that was significantly associated with leptospira infection indicating that veterinary students need to be cognizant and to practise preventive measures for leptospirosis . |
laparoscopic surgery of the prepared upper and lower gastrointestinal ( gi ) tract has been well reported .
successful closure of ruptured duodenal ulcers associated with peritoneal soiling has demonstrated that laparoscopic techniques can be applied to repair of the perforated viscus .
more controversial is the therapeutic role of laparoscopic surgical techniques in perforations of the lower gi tract .
, a 24-year - old male , presented with an injury sustained when he fell upon a pneumatic jack - hammer . upon his arrival in the emergency room , his only complaint was that of perianal pain .
he was found to have a single complex laceration involving the perianal skin , subcutaneous tissue and completely lacerating the internal sphincter and the lower 4 cm of the rectum .
the patient remained in the emergency room for two hours prior to being taken to the operating room holding area .
there , he was found to have developed a complaint of generalized abdominal pain and findings of tachycardia and peritoneal signs .
a proctoscopic examination revealed a transmural laceration of the anterior aspect of the rectum at 6 cm .
no further studies were performed as it was felt that a patient with evolving peritoneal signs , penetrating trauma and free air needed to be explored . under general anesthesia ,
a transanal , single layer repair of the rectum was performed entirely via transanal approach , with continuous sutures of polyglycolic acid .
the external sphincter and cutaneous margins of the complex laceration were then approximated with interrupted polyglycolic acid sutures . following this ,
laparoscopic entry to the abdomen was obtained at the umbilicus by the open hasson technique .
a small volume of bloody serous fluid was noted in the pelvis and was aspirated and submitted for culture . using atraumatic bowel graspers ( snowden - pencer ) , the small bowel was run from the ligament of trietz to the ileo - cecal valve and no injury was detected .
the bladder appeared intact upon inspection and , on gentle elevation of the bladder flap , the repaired rectal tear was visualized .
a jackson - pratt drain was placed and positioned along the sigmoid gutter into the pelvis .
the patient was placed on empiric therapy with imipenam and was observed in the icu .
he was further evaluated by the urology service with a voiding cystourethrogram which was normal .
cultures of the peritoneal cavity revealed gram negative rods which proved to be e. coli .
his white blood count , 17,000 upon admission , decreased progressively and he was transferred from the icu .
the patient passed flatus on postoperative day ( pod ) 3 and was allowed clear liquids .
the drain was producing only small amounts of serous fluid following his first stools and was removed on pod 5 .
his recovery at home was uneventful other than the development of a keyhole deformity of the anus which was repaired , uneventfully , six weeks later .
there was no loss of sexual function or change in voiding or bowel habits , and he has since returned to work without disability .
less well described , and more controversial , is its use in the treatment of acute lower gi pathology , including perforation .
the approach to the issue of right vs. left - sided colonic perforation and the creation of a temporary stoma vs. primary resection or repair has evolved to the point where recent papers describe primary resection or repair without colostomy as the method of choice in selected left colon injuries .
our patient presented with penetrating trauma to an unprepped left colon and bacterial peritonitis . while the perforation proved to be amenable to transanal closure , laparoscopy offered the opportunity to inspect the pelvic and abdominal organs , irrigate the abdomen , place a drain and test the integrity of the suture line .
our experience in laparoscopic colon surgery would have allowed sutured or stapled closure , or resection , with or without colostomy , should the injury have been more proximal or associated with more extensive tissue damage or gross soilage .
this result would certainly agree with the suggestion by others that the laparoscopic approach be considered first in dealing with an expected single perforation from iatrogenic injury during colonoscopy and may suggest that a subset of perforated diverticulitis patients may exist in whom the standard two - stage hartmann procedure , and its resultant disability , may prove unnecessary . | elective laparoscopic colonic surgery is increasingly recognized as feasible and perhaps preferential . a case of laparoscopically assisted surgery for trauma to the rectum with bacterial peritonitis
is presented .
it presents an example of the application of this modality to the treatment of iatrogenic colon perforations and perhaps selected diverticulitis . |
staphylococcus aureus is a gram - positive bacterium , a ubiquitous pathogen that constitutes one of the major causes of infections in humans .
the most consistently identified ecological niche for s. aureus in humans is in the anterior nares and up to one third of healthy people carry this organism in the nose at any time .
asymptomatic carriage of s. aureus often precedes disease , and carriage isolates are frequently identical to strains recovered from subsequent clinical infection .
colonization offers a reservoir from where the pathogen can access the bloodstream when breaches appear in host defence systems but infections can occur without nasal colonization , particularly in the case of community - associated infections .
the main mode of transmission of s. aureus is through direct contact ( person person / fomite person ) [ 1 , 2 ] .
methicillin - resistant s. aureus ( mrsa ) clones have been recognized as a leading cause of nosocomial infections in the usa and around the world for several decades [ 3 , 4 ] .
however , mrsa is no longer only a nosocomial pathogen and in recent years has emerged as a significant health threat in community settings in people without known risk factors or prior healthcare exposure .
historically , penicillin resistance in s. aureus was initially reported in hospital settings 12 years after penicillin was introduced in 1941 . a rise in the community rates of penicillin - resistant strains
was documented shortly after and in the 1970s the two rates converged and accounted for 7085% of strains .
methicillin was introduced in 1961 and reports of resistant strains in hospitals emerged less than 1 year later .
the prevalence of mrsa has since progressively increased in hospitals in the usa and subsequently in the community during the past 20 years . national hospitalization and resistance data
were used to estimate the annual number of hospitalizations and deaths associated with s. aureus and mrsa from 1999 to 2005 . during this period ,
the estimated number of s. aureus - related hospitalizations increased by 62% , and the estimated number of mrsa - related hospitalizations more than doubled . with the prevalence of mrsa infection in the usa increasing over the past decade due to the emergence of community - acquired mrsa ( ca - mrsa ) ,
there is a need to evaluate better the transmission of s. aureus at the population level .
such tools can help test various hypotheses / scenarios , project potential future trends under various assumptions and assess the impact of interventions at the population level . in this context
, we developed a mathematical model of s. aureus transmission in the us population based on the natural history of infection and nationally representative data .
this type of model was used to test working hypotheses to understand and explain observed trends , investigate the potential spread of mrsa and methicillin - susceptible s. aureus ( mssa ) in the population , and project potential future trends and related estimates for the burden of infection .
a secondary objective was to explore the potential impact of systematic population - level interventions , illustrated here with a hypothetical s. aureus vaccination component .
we employed a susceptible - colonized - infected - recovered - susceptible ( scirs ) dynamic , population - based , mechanistic , compartmental modelling framework , with two competing phenotypes of s. aureus .
schematic of the model structure : baseline and an added vaccination component , respectively . in the baseline model
, individuals are born into the susceptible state and can die in any of the model states .
susceptible people can become colonized or directly infected ( no persistent colonization ) either with mrsa or with mssa , based on the corresponding component of the force of infection ( foi , i.e. per susceptible risk of infection ) .
a percentage of the individuals colonized with mrsa or mssa can subsequently develop invasive infection with the same strain .
we allow for the possibility ( short - lived ) that people recovered from invasive infection might be temporarily protected ( e.g. as a consequence of antibiotic treatment ) after which they return to a fully susceptible state .
. corresponding mathematical equations ( set of nonlinear ordinary differential equations ) are given in supplementary figure s1 .
this type of modelling framework can consider a variety of potential vaccine modes of action illustrated in the schematic here for completeness .
schematic of the model structure : baseline and an added vaccination component , respectively . in the baseline model
, individuals are born into the susceptible state and can die in any of the model states .
susceptible people can become colonized or directly infected ( no persistent colonization ) either with mrsa or with mssa , based on the corresponding component of the force of infection ( foi , i.e. per susceptible risk of infection ) .
a percentage of the individuals colonized with mrsa or mssa can subsequently develop invasive infection with the same strain .
we allow for the possibility ( short - lived ) that people recovered from invasive infection might be temporarily protected ( e.g. as a consequence of antibiotic treatment ) after which they return to a fully susceptible state .
. corresponding mathematical equations ( set of nonlinear ordinary differential equations ) are given in supplementary figure s1 .
this type of modelling framework can consider a variety of potential vaccine modes of action illustrated in the schematic here for completeness .
this basic model version includes both mrsa and mssa , with the assumption of strong competition for colonization of susceptible hosts , i.e. the average individual can be colonized either with mrsa or with mssa , but not simultaneously with both for sustained periods of time [ 9 , 10 ] .
this assumption can be relaxed to allow for an explicit niche of co - existence for both mrsa and mssa , but additional data would be needed to disambiguate ( remove uncertainty ) at the time of model calibration . for simplicity and in the absence of strong supporting evidence ,
symptomatic mssa or mrsa infection can occur via two alternative routes : either through primary nasal colonization ( with other body sites potentially colonized ) followed by infection , or by direct ( no apparent / persistent nasal or other body site colonization ) infection of susceptible hosts through contact with , for example , colonized or infected persons or contaminated fomites .
susceptible hosts are not yet colonized or infected with mrsa or mssa , but colonization might occur via adequate contact with other colonized or infected individuals .
recovered compartment was introduced here to allow and explore the possibility of a time delay for individuals who had recently recovered from a symptomatic infection before again becoming fully susceptible to colonization or infection , potentially due to short - term impact of some form of antibiotic treatment .
the proposed model is fully dynamic , accounting for an estimated projected us population growth rate of 126% per year ( based on census data ) .
the simplified model , without age stratification , was calibrated and validated based on published us national infection data ( 19992005 ) and colonization data ( 20012004 ) , respectively . in klein
et al . , the annual number of hospitalized s. aureus / mrsa infections in the usa between 1999 and 2005 was estimated based on national hospitalization and resistance data
. a nationally representative survey of colonization with s. aureus / mrsa was also conducted from 2001 to 2004 as part of the national health and nutrition examination survey ( nhanes ) , which is the centers for disease control and prevention 's biennial biomonitoring survey of a large sample of us residents .
a primary aim of the study was to construct a basic mechanistic framework which properly reflects and uses the us national trends reported over time to make further potential projections at the national level under various assumptions or working hypotheses . in this framework ,
all model parameters were regarded as averaged across the entire us population and the model outputs represented total ( hospitalized and non - hospitalized combined ) prevalence / incidence of mrsa and mssa infections in the usa at the national level .
best - fit estimates were obtained by simultaneously minimizing the difference , in the least - square sense , between all data points and the corresponding model outcomes . however , since mrsa infection data were available for hospitalized infections only , scaling factors representing the proportion of hospitalizations out of the total infections for mrsa and mssa , respectively , were introduced to project model - based hospitalizations and compare them against the actual data .
these factors were assumed to be constant for simplicity , within ranges of 5070% for mrsa and 4060% for mssa ( combining s. aureus / mrsa infection data reported in for both inpatient and outpatient settings ) , and further included in the overall parameter estimation to yield corresponding optimal values .
the estimation of model parameters can be formulated as a sophisticated constrained optimization problem . to enforce biological and epidemiological plausibility , whenever available , additional information was incorporated in the constraints ( e.g. feasible / plausible parameter ranges ) [ 14 , 15 ] .
the national datasets for infection and colonization [ 7 , 12 ] were simultaneously fitted over time to yield the best agreement between model outcomes and corresponding data ( table 1 ) .
table 1.best-fit estimates for the baseline model parametersparameter numberparameter nomenclaturesymbol ( see supplementary material)value ( unit ) ( best - fit model estimate)transmission rates 1colonized by colonized mrsa1146 10 ( day ) 2colonized by infected mrsa1176 10 ( day ) 3infected by colonized mrsa1730 10 ( day ) 4infected by infected mrsa1149 10 ( day ) 5colonized by colonized mssa2146 10 ( day ) 6colonized by infected mssa2401 10 ( day ) 7infected by colonized mssa2687 10 ( day ) 8infected by infected mssa2361 10 ( day)clearance rates 9colonized mrsa clearance1980 10 ( day ) 10colonized mssa clearance2102 10 ( day)infection rates 11colonized mrsa progressing to infection1120 10 ( day ) 12colonized mssa progressing to infection2822 10 ( day)other 13mean recovery period for mrsa infections11460 ( days ) 14mean recovery period for mssa infections2830 ( days ) 15mean temporary protection period770 ( days ) 16scaling factor mrsa ( proportion mrsa infections hospitalized / total mrsa infections)058 17scaling factor mssa ( proportion mssa infections hospitalized / total mssa infections)045 best - fit estimates for the baseline model parameters for exploratory purposes , we included a hypothetical vaccination component on top of the baseline model , as illustrated in figure 1 .
an annual vaccine uptake was assumed as follows : 35% of the susceptible population , 5% of the mrsa - colonized population and 5% of the mssa - colonized population .
this amounted to a cumulated coverage of about 5% of the total us population , vaccinated once per year . regarding potential effects of the vaccine ( see fig .
1 ) , the hypothetical case scenario shown assumed a 40% reduction in the risk of colonization , 50% reduction in the risk of direct infection and 40% reduction in the risk of infection in individuals colonized by mrsa or mssa .
the purpose here is essentially to illustrate the potential and versatility of this type of modelling framework to capture a broad host of potential vaccine effects , which can play important roles in subsequent analyses attempting to estimate the impact of vaccination .
this was already reported for vaccines against other pathogens such as neisseria meningitidis or streptococcus ( str . )
vaccine - related model parameters such as vaccine coverage and different efficacies / risk reductions were assumed to have values between 0% and 100% .
another important parameter in practice is the mean duration of vaccine protection in vaccinated individuals . for comparative purposes
, we assumed a mean duration of vaccine protection of 1 year vs. 5 years .
the model proved able to capture both the colonization and infection data , with estimated p values for model / data correlation of < 00001 for mrsa infection and < 005 for mssa infection . in order to test the predictive capabilities of the model ,
the 20042005 mrsa infection data points were omitted at calibration ; they were reasonably rendered by the best - fit model .
corresponding best - fit plots are shown in figure 2 for best - fit model parameter values given in table 1 . with model parameters calibrated based on the national datasets described above , baseline model projections illustrate how mrsa might expand and gradually replace mssa over time at the us population level , under the assumption of strong mssa / mrsa competition for colonization .
fig .
best - fit model vs. observed , for mrsa and mssa infections ( a , b ) hospitalized and ( c , d ) colonized .
nhanes 20012004 biennial colonization data are shown with the 95% confidence intervals ( vertical bars ) , as published .
the 19992003 annual numbers of mrsa infections hospitalized were used for model calibration , while the 20042005 data points were omitted for validation ; the calibrated model succeeded in capturing these data fairly well .
( a ) number of mrsa infections hospitalized in he usa 19992005 : best - fit model calibration against corresponding data in .
( b ) number of mssa infections hospitalized in the usa 19992005 : best - fit model calibration against corresponding data in .
( c ) biennial prevalence of mrsa colonization 20012004 : best - fit model calibration against corresponding data in .
( d ) biennial prevalence of mssa colonization 20012004 : best - fit model calibration against corresponding data in .
best - fit model vs. observed , for mrsa and mssa infections ( a , b ) hospitalized and ( c , d ) colonized .
nhanes 20012004 biennial colonization data are shown with the 95% confidence intervals ( vertical bars ) , as published .
the 19992003 annual numbers of mrsa infections hospitalized were used for model calibration , while the 20042005 data points were omitted for validation ; the calibrated model succeeded in capturing these data fairly well .
( a ) number of mrsa infections hospitalized in he usa 19992005 : best - fit model calibration against corresponding data in .
( b ) number of mssa infections hospitalized in the usa 19992005 : best - fit model calibration against corresponding data in .
( c ) biennial prevalence of mrsa colonization 20012004 : best - fit model calibration against corresponding data in .
( d ) biennial prevalence of mssa colonization 20012004 : best - fit model calibration against corresponding data in .
the model - based estimates of the basic reproduction number ( r0 ) , which quantifies the potential of spread , were > 1 for both mrsa and mssa , with an estimated r0 for mrsa slightly higher than for mssa ( 15 vs. 14 ) . using a next - generation matrix method , the estimates of r0 from the best - fit model are indicative of tight mrsa / mssa competition .
ultimately , expansion of the strain phenotype with the highest r0 ( here mrsa ) is favoured . however , the model projects a potential gradual replacement of mssa over a timeframe of several decades ( figs 3 and 4 ) .
the model also projects a sustained increase over time in the annual number of s. aureus infections in the us population , increasingly due to mrsa .
baseline model projections : potential mrsa infection incidence increase and gradual replacement of mssa over the next decade in the usa in the absence of systematic infection control , based on the 19992005 national trends ( infection and colonization ) and assuming strong competition between mrsa and mssa for colonization of susceptible hosts .
( a ) projection of us population growth for period 20002020 , based on historical us census data .
( b ) model - projected annual incidence of mrsa and mssa infection , respectively , relative to the us population , over time ( years 20002020 ) .
fig .
( b ) mrsa infection , ( c ) mssa infection . potential mrsa expansion and gradual replacement of mssa over the next decade in the usa in the absence of systematic infection control , based on the 19992005 national trends ( infection and colonization ) and assuming strong competition between mrsa and mssa for colonization of susceptible hosts .
( a ) model - projected prevalence of mrsa and mssa colonization , respectively , in the us population over time .
( b ) model - projected prevalence of mrsa infection in the us population over time .
( c ) model - projected prevalence of mssa infection in the us population over time .
baseline model projections : potential mrsa infection incidence increase and gradual replacement of mssa over the next decade in the usa in the absence of systematic infection control , based on the 19992005 national trends ( infection and colonization ) and assuming strong competition between mrsa and mssa for colonization of susceptible hosts .
( a ) projection of us population growth for period 20002020 , based on historical us census data .
( b ) model - projected annual incidence of mrsa and mssa infection , respectively , relative to the us population , over time ( years 20002020 ) .
potential mrsa expansion and gradual replacement of mssa over the next decade in the usa in the absence of systematic infection control , based on the 19992005 national trends ( infection and colonization ) and assuming strong competition between mrsa and mssa for colonization of susceptible hosts .
( a ) model - projected prevalence of mrsa and mssa colonization , respectively , in the us population over time .
( b ) model - projected prevalence of mrsa infection in the us population over time .
( c ) model - projected prevalence of mssa infection in the us population over time . regarding the possibility of a time delay for individuals who had recently recovered from a symptomatic infection before again becoming fully susceptible to colonization or infection , the best - fit model calibration against data estimated a very short period ( 7.7 days ) of potential temporary protection ( table 1 ) .
in order to assess model output variations to small perturbations in the model parameters , we conducted a parametric sensitivity analysis for the model governing system of ordinary differential equations ( odes , shown in the supplementary material ) and computed numerically derivatives ( sensitivities ) for all the model state variables ( n = 6 ) with respect to the 17 parameters listed in table 1 , over the timeframe used for the simulations in figures 3 and 4 .
based on this analysis , summarized and illustrated in supplementary figure s2 , the model outputs are most sensitive to the following parameters in this order : colonized mssa clearance rate ( 2 , model parameter no . 10 in table 1 ) , followed closely by the colonized mrsa clearance rate ( 1 , model parameter no . 9 in table 1 ) .
this appears the most influential parameter pair , followed by the rate of colonized mssa progressing to infection ( 2 , model parameter no .
the fourth and fifth equally influential parameters closely following are then the rate of colonization by colonized mssa ( 2 , model parameter no . 5 in table 1 ) and the rate of colonized mrsa progressing to infection ( 1 , model parameter no . 11 in table 1 ) , respectively .
coming relatively closely after is the rate of colonization by colonized mrsa ( 1 , model parameter number 1 in table 1 ) .
finally , coming last is the pair represented by the rate of infection by colonized mssa ( 2 , model parameter no . 7 in table 1 ) and the rate of infection by colonized mrsa ( 1 , model parameter no . 3 in table 1 ) , respectively ; however , these last two parameters appear notably less influential compared to the previous other six model parameters listed above .
the model is significantly less sensitive to the remaining nine model parameters listed in table 1 .
projected effects of vaccination on s. aureus incidence and prevalence over the first 5 years are depicted in figure 5(a , b ) , respectively . under the assumption of a mean duration of vaccine protection of 5 years in vaccinated individuals ,
the estimated mean annual reduction of s. aureus incidence over the first 5 years was about 12% . in this case , a reduction of about 16% was projected for the 5th ( and last ) year of this vaccination scenario .
however , assuming a mean duration of vaccine protection of only 1 year , the benefits were less marked , with a mean annual reduction of incidence close to 6% over the first 5 years .
the corresponding reductions in prevalence are illustrated in figure 5b , which also highlights the impact of potentially stopping annual vaccination after each subsequent year considered in this simulation ( 1 , 2 , 3 , 4 years , respectively ) .
fig .
model projections for ( a ) incidence and ( b ) prevalence shown here correspond to annual vaccine coverage of about 5% , with vaccination once per year ( flu - like ) and assumed vaccine modes of action ( fig .
1 ) as follows : 40% reduction in the risk colonization , 50% reduction in the risk of direct infection and 40% reduction in the risk of infection in mrsa / mssa carriers .
( a ) model - projected annual incidence of s. aureus infection in the usa ( shown here as proportion of the growing population ) before and after a hypothetical s. aureus vaccination .
( b ) model - projected prevalence of s. aureus infection in the us population over time ( shown here in absolute numbers ) before and after a hypothetical s. aureus vaccination .
[ colour online ] . a model - based hypothetical s. aureus vaccination case scenario .
model projections for ( a ) incidence and ( b ) prevalence shown here correspond to annual vaccine coverage of about 5% , with vaccination once per year ( flu - like ) and assumed vaccine modes of action ( fig .
1 ) as follows : 40% reduction in the risk colonization , 50% reduction in the risk of direct infection and 40% reduction in the risk of infection in mrsa / mssa carriers . ( a ) model - projected annual incidence of s. aureus infection in the usa ( shown here as proportion of the growing population ) before and after a hypothetical s. aureus vaccination .
( b ) model - projected prevalence of s. aureus infection in the us population over time ( shown here in absolute numbers ) before and after a hypothetical s. aureus vaccination .
this basic dynamic transmission model for s. aureus in the us population explicitly accounts for both mrsa and mssa .
the model was simultaneously calibrated and validated against published us national colonization and infection data , and demonstrated good overall correlation with these data . to our knowledge , this is the first attempt to develop a dynamic transmission model with competition between mrsa and mssa and calibration / validation against nationally representative colonization / infection data in the us population .
based on the natural history of infection and nationally representative 19992005 data , projections from a simple dynamic transmission model at the us population level suggest how mrsa might continue to expand and gradually replace mssa over time , assuming competition for colonization .
this has already been observed with penicillin , where more than 80% of the s. aureus strains were reported penicillin - resistant by the 1970s and the community rates increased soon after nosocomial rates exceeded 4050% .
the model - based estimate of r0 emphasizes the need for efficient means of control to limit the spread of infection .
projections for the mssa growth rate in the near future appear comparable to the estimated us population growth rate , suggesting that the slow growth still seen in projected mssa infection numbers could potentially be a direct consequence of population growth . as a secondary objective
, we built an exploratory vaccination component on top of our baseline model and illustrated its application here with a hypothetical case scenario , highlighting the potential impact of vaccination on s. aureus infection at the us population level .
our results are in line with those published by lucero et al . who used a population - based surveillance programme to explore the effect of a hypothetical vaccine in preventing invasive mrsa infections .
they estimated that vaccination of all adults aged > 65 years would reduce the incidence of mrsa infections by 121% over 1 year .
a dynamic transmission modelling framework is versatile and allows for testing and simulation of multiple potential mechanisms of action of a vaccine and the subsequent impact on reducing transmission and spread in a population , as previously demonstrated for n. meningitidis or str .
one of the primary usages of mathematical models of this type is to test and generate / re - generate hypotheses and what - if case scenarios . here , we set out to investigate the hypothesis of strong mrsa - mssa competition for colonization , which has been proposed by others , and assess corresponding outcomes .
et al . concluded that mssa and mrsa do compete for colonization of the anterior nares ( of 680 patients only 06% carried both mrsa and mssa ) and estimated a protective efficacy of 78% for mssa against colonization with mrsa .
this was supported by lasseter et al . who enrolled 748 subjects across 51 different care homes and failed to find co - colonization of both mrsa and mssa .
further , margolis et al . , concluded from a rat model of colonization that unlike haemophilus influenzae or str .
pneumoniae , where multiple strains can co - exist , s. aureus strains failed to colonize a host animal with other s. aureus present .
other supportive data showed that only 3% of subjects colonized at least once with s. aureus , harboured mixed phenotypes of mssa and mrsa .
the reader is directed to a comprehensive literature review exploring the issue of potential mrsa / mssa replacement and related competition which concluded that colonization with ca - mrsa may at least partially replace colonization with mssa .
potential mssa / mrsa co - colonization was therefore not explicitly included in this basic model , which could constitute a limitation of the current study .
this might have led to an overestimation of the strength of the competition between mrsa and mssa , with subsequent overestimation of the magnitude of replacement .
if further robust nationally representative data become available over longer time - spans that indicate that replacement has not occurred or has been less extensive , then one possible conclusion based on this basic modelling exercise is that mrsa / mssa competition for colonization is not as strong as speculated in some studies , and that there may be more opportunity for co - colonization . in that event , further studies / data would be necessary , particularly to disambiguate s. aureus colonization data ; the assumption of strong mrsa / mssa competition for colonization could be further relaxed and included in the model to allow for an explicit niche of co - existence for both mrsa and mssa
. other limitations of the current study are that no explicit distinction is made in the model between persistent and intermittent colonization or between hospital and community strains , and no age stratification or other heterogeneities of the us population are explicitly considered
. more complex models with increased level of detail would be very interesting and desirable .
however , realistically , for practical purposes , model complexity needs to be backed by available data , with corresponding stratification . in the absence of
nationally representative data at the us population level with appropriate usa100 vs. usa300 explicit strain stratification , for instance , both in terms of colonization and symptomatic infection , we treated mrsa as a single entity .
all resulting parameters , including the corresponding r0 value are implicitly understood as averages across all the potential mrsa strains that might be pooled in the data .
the model is able to reproduce the data and is focused here on the big picture , in this case interplay between mrsa and mssa .
however , models of this type have been developed for several infectious agents with high strain diversity , polyclonality , etc .
pneumoniae , n. meningitidis and level of complexity depends on the driving questions and available data . another useful level of granularity would be to explicitly introduce high - risk vs. low - risk populations in the model , but again , in order for such an exercise to be realistic , corresponding data need first to be generated .
technically , from the stand - point of the model structure / complexity , further risk stratification of the population would mean , at a minimum , doubling the number of existing compartments ( each of the boxes currently in the model schematic would be split into high - risk and low - risk compartments , respectively ) , and the introduction of corresponding transmission paths , various transmission parameters and progression rates .
this level of complexity is unfortunately not sustainable currently by the data available for calibration .
it is not the computational complexity , but the large number of a priori unknown parameters that need to be calibrated based on available data that creates issues .
the same comment stands true for age stratification . for that , all calibration data would need to be age - stratified and the number of model parameters increased .
for this reason one must first assess the primary working hypotheses ( e.g. strong mrsa / mssa competition for colonization ) and subsequent impact on the outcomes in simpler more basic models such as that presented here .
the data employed here for this basic model calibration , although nationally representative , has its own limitations .
nhanes biennial colonization data were publicly available only for the periods 20012002 and 20032004 ; the infection data were based on related hospital discharges only ; and colonization and infection datasets were for the 19992005 time - window only , which is a particular timeframe for s. aureus evolution and dynamics in the usa , characterized by the emergence and spread in the community .
further additional data points over longer time - spans may help confirm an actual sustained trend vs. a transient early phenomenon , and model re - calibration / re - assessment can and should be done in the presence of new evidence and/or data .
recent publications have suggested that the incidence of invasive healthcare - associated mrsa infections may be decreasing .
this is most likely due to the implementation of prevention measures : hand hygiene , physical isolation of patients with infection , environmental decontamination and decolonization of colonized individuals .
while the impact of these measures on s. aureus at the overall us population level is not known , our dynamic transmission model can be recalibrated when new data become available . in conclusion ,
dynamic transmission models are powerful mathematical tools that can help project potential future trends as well as evaluate the potential impact of future population - level interventions . with the proliferation of several antibiotic - resistant bacteria ,
these models are likely to continue to play an increasingly important role in understanding the transmission of emerging infectious diseases .
cosmina hogea and thierry van effelterre are employed by the glaxosmithkline group of companies ( gsk ) , camilo j. acosta was employed by gsk at the time the analysis was performed and is now employed by merck . | summarywe present a basic mathematical model of staphylococcus aureus transmission in the usa based on natural history of infection and nationally representative data .
we employed a susceptible - colonized - infected - recovered - susceptible compartmental modelling framework with two different phenotypes of s. aureus : methicillin - susceptible ( mssa ) and methicillin - resistant ( mrsa ) .
the model is dynamic and accounts for the us population growth . for model calibration / validation ,
we used published 19992005 s. aureus infection data in conjunction with the 20012004 national health and nutrition examination survey colonization data .
baseline model projections illustrated how mrsa might continue to expand and gradually replace mssa over time , in the absence of intervention , if there is strong competition for colonization .
the model - based estimate of the basic reproduction number ( r0 ) highlights the need for infection control .
we illustrate the potential population - level impact of intervention with a hypothetical s. aureus vaccination component . |
increased interest in an esthetic facial appearance has led to an increase in the number of adult orthodontic patients .
many patients underwent previous dental restorations to treat wear , attrition , missing teeth , and malformed teeth.1 distinct surface treatments are required to increase the bond strength between orthodontic brackets and the restorations because the bond between bracket and previous restorations is weaker than the bond to natural teeth.2 esthetic demands and the development of ceramic systems have increased the use of all - ceramic crowns .
zirconia is a widely used core for all - ceramic crowns due to its high strength and superior esthetic appearance . to construct an esthetic prosthesis ,
however , fracturing of the veneer is frequently reported in the posterior teeth , which apply strong masticatory forces,34 prompting increased use of monolithic zirconia crowns without veneers.56 in orthodontic patients with monolithic zirconia crowns , the orthodontic bracket should be bonded directly onto the zirconia surface .
currently , an additional zirconia surface treatment is required to obtain proper bond strength.7 in prosthodontics , various mechanical and chemical surface treatments have been studied to improve the bond strength between zirconia and resin cement .
one such technique sandblasting was reported to increases mechanical retention,89 and as a chemical method , many recently developed zirconia primers have been introduced.10111213 however , few studies have examined the bond strength between orthodontic brackets and zirconia prostheses , and the effects of surface treatment with zirconia primers on bonding .
thus , the aim of this study was to compare the shear bond strength ( sbs ) of orthodontic brackets using three different zirconia primers and one silane primer , and subjected to thermocycling .
a total 100 blocks of yttrium oxide - stabilized zirconia ( naturaz -series ; dmax international , seoul , korea ) were embedded in acrylic resin ( ortho - jet ; lang dental manufacturing co. , inc . , wheeling , il , usa )
all specimens underwent airborne - particle abrasion with 50-m al2o3 particles at 40 psi for 10 s at a 10-mm distance perpendicular to the surface .
the specimens were randomly divided into five primer groups ( n = 20 per group ) , and each primer was divided into two subgroups ( n = 10 each ) to examine by thermocycling protocols ( table 1 ) . the composition of the primers used in this study is presented in table 2 . before bonding the orthodontic metal brackets ( gemini series ; 3 m unitek corporation , monrovia , ca , usa ) , all specimens were steam - cleaned and air - dried .
in the control no - primer ( np ) group , transbond xt primer ( 3 m unitek corporation ) was applied to the zirconia surface and bracket base .
the remaining specimen groups were treated with either porcelain conditioner ( pc ) , z - prime plus ( zp ) , monobond plus ( mp ) , or zirconia liner premium ( zl ) primer according to each manufacturer 's instructions .
all orthodontic brackets were bonded to the specimens using transbond xt paste and light polymerized for 15 s at 1,100 mw / cm ( mr .
light led curing light ; dent zar , tarzana , ca , usa ) . after bonding the orthodontic brackets ,
the five primer groups were then split into a total 10 subgroups , with one subgroup of specimens from each primer treatment subjected to thermocycling ( kd - tcs30 ; kwang - duk f.a . ,
gwangju , korea ) in 5 and 55 water for 2,000 cycles , yielding groups npt , pct , zpt , mpt , and zlt .
the remaining five subgroups ( np , pc , zp , mp , and zl ) did not undergo thermocycling .
the sbs was measured in all 10 groups using a universal testing machine ( model 3366 ; instron co. , norwood , ma , usa ) at a 1 mm / min crosshead speed .
the failure mode was assessed by examination with a stereomicroscope ( sz61 ; olympus , tokyo , japan ) , and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index ( ari)14 ( table 3 ) .
one representative specimen from each group was flecked with gold using an ion coater ( ib-3 ; eiko co. , tokyo , japan ) and examined via scanning electron microscopy ( s-800 ; hitachi , tokyo , japan ) to further evaluate the failure mode .
statistical analysis was performed with ibm spss statistics version 20.0 ( ibm co. , armonk , ny , usa ) .
two - way analysis of variance ( anova ) was applied to detect significant differences in the sbs between the groups .
the significance for all statistical tests was set at p < 0.05 , and tukey 's honest significant difference post - hoc test was used to detect pairwise differences between the groups ( table 4 ) .
statistical analysis was performed with ibm spss statistics version 20.0 ( ibm co. , armonk , ny , usa ) .
two - way analysis of variance ( anova ) was applied to detect significant differences in the sbs between the groups .
the significance for all statistical tests was set at p < 0.05 , and tukey 's honest significant difference post - hoc test was used to detect pairwise differences between the groups ( table 4 ) .
the interactions between the variables exerted significant effects on the sbs ( p < 0.05 ; table 6 ) .
2015 - 07 - 28 in all five surface treatment groups , the sbs decreased after thermocycling ( figure 1 ) . among the groups that did not undergo thermocycling , group
np exhibited a significantly lower sbs than the other groups ( pc , zp , mp , and zl ; p < 0.05 ) .
group pc , which was treated with a silane primer , showed significantly lower sbs than groups zp and zl ( p < 0.05 ) .
however , groups pc and mp did not significantly differ between each other ( p > 0.05 ) , and no significant differences were detected among the groups treated with zirconia primers ( p > 0.05 ; figure 1 ) . in the thermocycling groups , there was no significant difference between groups npt and pct ( p > 0.05 ) .
groups zpt , mpt , and zlt , which used zirconia primers , were associated with a significantly higher sbs than the groups npt and pct ( p < 0.05 ; figure 1 ) .
there were no significant differences between groups zpt and mpt or between groups mpt and zlt ( p > 0.05 ) ; however , groups zpt and zlt differed significantly between each other ( p < 0.05 ; figure 1 ) . for the ari score ,
both of the groups lacking primer ( np and npt ) displayed adhesive failure modes , but the groups with zirconia primers ( zp , zpt , mp , mpt , zl , and zlt ) were associated with mixed failure modes ( table 7 ) .
in this study , the effect of zirconia primers on the sbs of orthodontic metal brackets was determined .
kern and wegner15 reported that sandblasting treatment increased the roughness of the zirconia surface , but compared to other alloys , it also decreased the number of undercuts and failed to maintain bond stability after water invasion .
similarly , the sbs of group npt was 49% of the bond strength for group np .
the control groups that lacked primer showed the lowest sbs both with and without thermocycling ( table 5 ) .
reynolds16 indicated that the minimum sbs able to resist normal orthodontic forces is 5.9 - 7.9 mpa , and mccarthy and hondrum17 reported a minimum value of 7 mpa .
based on these prior studies , groups npt ( 5.68 mpa ) and pct ( 6.12 mpa ) lack proper sbs .
group pc , which used a silane primer , exhibited significantly higher sbs than group np ( p < 0.05 ) .
the sbs of group pct ( which underwent thermocycling ) was only 26.1% of the bond strength of group pc , and no significant difference was detected between pct and npt ( p > 0.05 ) .
monobond plus largely comprises silane methacrylate , 10-methacryloyloxydecyl dihydrogen phosphate ( mdp ) , and sulfide methacrylate .
zirconia liner premium is similar to monobond plus , but does not contain sulfide methacrylate .
phosphate monomer can co - polymerize with resin monomers because its functional group bonds with the metal oxide of the substrate via its phosphoric acid group .
another monomer , carboxylic acid , helps form the bond to the substrate.1218 however , lorenzoni et al.19 reported that z - prime plus displayed lower bond strength than mdp - containing primers because the carboxylic acid monomer of z - prime plus weakened the bonding with the methacrylate group of the resin cement .
many studies have examined the efficacy of mdp monomer in chemical bonding with zirconium oxide on a zirconia surface152021 and found that mdp - containing primers maintain bonding stability both before and after thermocycling of a zirconia surface treated with sandblasting.15172223 in the current study , mdp - containing primers also showed less strength reduction than observed in the other groups ( 39.2% mdp in groups mp and mpt ; 39.6% mdp in groups zl and zlt ) .
koizumi et al.24 reported that the sulfide methacrylate monomer in monobond plus affects bond strength , but in our study , there was no significant difference in sbs between the mdp - containing primers ( monobond plus and zirconia liner premium ) ( p > 0.05 ) . for the ari score , control groups np and npt exhibited an adhesive failure mode , reflecting the low sbs in these groups.25 the groups using zirconia primers displayed mixed failure modes in which most of the bonding resin remained on the zirconia surface ( figure 2 and table 7).26
following the results of this study , regardless of thermocycling application , the groups without primer ( np and npt ) showed lower sbs and adhesive failure but the groups using zirconia primers ( zp , zpt , mp , mpt , zl , and zlt ) showed higher sbs and mixed failure . thus , surface treatment with zirconia primer contributes to an increased in sbs compared with no - primer and silane primer application for orthodontic bracket bonding to zirconia prostheses . | objectivethe aim of this study was to compare the shear bond strength ( sbs ) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer , and subjected to thermocycling.methodswe designed 10 experimental groups following the surface treatment and thermocycling .
the surface was treated with one of the following method : no - primer ( np ) , porcelain conditioner ( pc ) , z - prime plus ( zp ) , monobond plus ( mp ) and zirconia liner premium ( zl ) ( n=20 ) .
then each group was subdivided to non - thermocycled and thermocycled groups ( npt , pc , zpt , mpt , zlt ) ( n=10 ) .
orthodontic brackets were bonded to the specimens using transbond xt paste and light cured for 15 s at 1,100 mw / cm2 .
the sbs was measured at a 1 mm / min crosshead speed .
the failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index ( ari).results the sbs of all experimental groups decreased after thermocycling . before thermocycling ,
the sbs was zl , zp mp pc > np but after thermocycling , the sbs was zlt mpt zpt > pct = npt ( p > 0.05 ) . for the ari score ,
both of the groups lacking primer ( np and npt ) displayed adhesive failure modes , but the groups with zirconia primers ( zp , zpt , mp , mpt , zl , and zlt ) were associated with mixed failure modes.conclusionssurface treatment with a zirconia primer increases the sbs relative to no - primer or silane primer application between orthodontic brackets and zirconia prostheses . |
of these newly diagnosed breast tumors , 6570% will express the estrogen receptor alpha ( er ) .
estrogen activation of the er is required in the development of a healthy mammary gland .
however , it also can be involved in the development of both primary and secondary breast cancers due to altered er signaling [ 3 , 4 ] .
activation of er by estrogen ( e ) promotes cell growth and survival of tumor cells .
ae drugs can be used in the metastatic , adjuvant , and chemopreventive settings and responses are typically seen in about 70% of er+ patients selected for such treatment [ 4 , 6 ] .
currently , tamoxifen ( tam ) is the most widely used ae for er+ breast cancer .
tam is an example of a selective estrogen receptor modulator ( serm ) which acts as an antagonist to er in the breast , leading to a reduction in the proliferation of tumor cells .
however approximately 1/3 of tumors treated with tam either possess de novo or acquire resistance to tam , leading to breast cancer recurrence .
further , tam acts as an er agonist in the endometrium and in certain cases in the breast epithelium [ 4 , 8 , 9 ] .
fulvestrant ( faslodex , ici 182 , 780 ; ici ) is a steroidal ae designed to have no agonist activity with the er . ici acts by degrading , and downregulating the er in the tumor cells [ 10 , 11 ] .
currently , ici is used for the treatment of advanced breast cancer that is resistant to other endocrine therapies .
it is effective in tumors and cell lines that are resistant to tam yet still express er .
however , in the clinic the duration of response ( dor ) and time to progression ( ttp ) on ici is only 19 and 5.5 months , respectively .
finding strategies to increase the sensitivity of the breast cancer cells to ici may result in increased efficacy of drug therapy .
there is evidence to show that healthy changes in diet can prevent up to 40% of breast cancers .
further , data is beginning to show that an increased intake of fruits and vegetables in patients recently diagnosed with breast cancer may reduce the risk of recurrent breast cancer [ 1517 ] .
this preventive effect can largely be attributed to the various phytochemicals present in fruits and vegetables .
these bioactive compounds have been shown to affect the development of both primary and secondary breast cancer by affecting cell proliferation , survival , and death [ 3 , 18 ] .
red raspberry ( rrb ) is a readily available fruit that is part of our diets and is a rich source of phytochemicals .
it is composed of compounds that inhibit the proliferation of many types of cancer cells , including breast cancer [ 1921 ] .
rrb contains high levels of anthocyanins such as cyanidin-3-sophoroside , cyanidin-3-glucoside , pelargonidin-3-glucoside , and ellagic acid [ 3 , 22 ] . in vivo studies in mice
further , the polyphenols present in rrb can inhibit nuclear receptors , growth factors , and kinase signaling leading to cell - cycle arrest , apoptosis , or autophagy - associated cell death .
the red raspberry extract ( rre ) used in the study has been previously standardized and inhibits the growth of several cancer cell lines , including breast cancer , in a dose - dependent manner .
the java plum , also called the jamun fruit , is the fruit of eugenia jambolana lam . , a tree that can be found in florida and hawaii in the united states and other various tropical zones in the world .
the jamun fruit extract ( ejae ) used in this study has been previously standardized .
ejae is rich in anthocyanidins including petunidin , malvidin , delphinidin , cyanidin , and peonidin [ 24 , 25 ] .
ejae reduces the proliferation of mcf7-aro ( aromatase and er positive ) and mda - mb-231 ( er negative ) breast cancer cell lines .
neither ejae nor rre has been previously tested in er+ , ici - resistant cell lines .
clarke and coworkers have developed a series of cell lines as an in vitro model of ae resistance .
the lcc series were initially derived from mcf7 cells and consists of lcc1 ( e independent , e stimulated and tam and ici sensitive ) and lcc9 ( e independent , e stimulated and tam and ici resistant ) [ 26 , 27 ] .
more recently we have derived another ici - resistant variant of the zr75 - 1 cells ( zr75 - 1r ) , that was developed by culturing zr75 - 1 in sequentially increasing concentrations of ici for more than one year ( a. zwart and r clarke , unpublished data ) .
these cell lines serve as in vitro models that represent some phenotypes of ici - resistant breast cancer . in this study
, we tested the effects of jamun ( ejae ) and red raspberry ( rre ) extracts and the individual phenolics ellagic acid ( ea ) and delphinidin ( del ) on ici - sensitive ( lcc1 , zr75 - 1 , bt474 ) and resistant ( lcc9 , zr75 - 1r ) cells .
we hypothesized that in sensitive cells , berry extracts and their compounds would have a synergistic effect with ici , increasing the inhibition of cell proliferation by a sublethal dose of ici ( < ic50 ) , and in resistant cells , the extracts would resensitize the cells to ici making them more susceptible to ici - induced growth inhibition .
cell proliferation was measured in the presence of extracts / compounds with or without ici .
in addition , molecular markers of apoptosis , autophagy , and er signaling were also analyzed to understand the mechanism by which ejae , rre , and their compounds reduced the growth of these cells .
the lcc1 and lcc9 cells were cultured in modified imem ( without phenol - red ) containing 5% charcoal - stripped calf serum ( e level < 10 m. ) the zr75 - 1 , zr75 - 1r , and bt474 cells were cultured in modified imem containing 5% fetal bovine serum ( e levels ~10 m. ) establishment of lcc1 cells has been previously described .
lcc9 and zr75 - 1r cells were derived by the long - term selection of lcc1 and zr75 - 1 cells , respectively , in sequentially increasing concentrations of ici as described .
cells were then harvested at 70% confluence for use in cell proliferation and biomarker analysis .
navindra p. seeram ( university of rhode island , ri ) and have been previously described .
briefly , ejae was obtained by sequential extraction of freeze - dried jamun fruit in cold hexanes , ethyl acetate , and acidified methanol .
ejae is the same acidified methanol extract referred to as the jamun fruit extract ( jfe ) , in a previous publication .
( irvine , ca . ) cells were plated in 48-well plates ( 5,000 cells for lcc1 and lcc9 ; 10,000 for zr75 - 1 , zr75 - 1r , and bt474 ) and incubated overnight for attachment .
rre , ejae , ea , and del were dissolved in dmso and ici was dissolved in ethanol .
dmso ( 0.1% ) and ethanol ( 0.01% ) were used as appropriate vehicle controls either alone or in combination .
all cells were treated with 1100 g / ml rre , 0.1100 g / ml ejae , or 0.110 m ea or del with or without ici ( 1 nm and 1 m ) .
for sensitive cell lines ( lcc1 , zr75 - 1 , and bt474 ) , cells were treated with 1 nm ici , which is a sublethal dose and well below the ic50 of ici for lcc1 .
for resistant cell lines ( lcc9 and zr75 - 1r ) , ici was used at a concentration of 1 nm and 1 m . all groups were treated after 24 h for the first time and the treatment was repeated at 72 h for all 6 d time points .
cells were stained with 0.5% crystal violet in 25% methanol , dried , and the stain dissolved in 100 mm sodium citrate in 50% ethanol .
cells were plated in 6-well plates ( 200,000 cells ) and incubated overnight for attachment .
the concentration of phytochemical with the most significant reduction in cell proliferation for that respective cell line was used for treatment of cells for molecular marker analysis .
after 3 d , cells were suspended in radioimmunoprecipitation assay ( ripa ) buffer ( 50 mmol / l tris - hcl , ph 7.4 ; 150 mmol / l nacl ; 1% np40 ; 0.25% na - deoxycholate ; 1 mm phenylmethylsulfonyl fluoride ( pmsf ) ; 1 mm sodium orthovanadate ; 1x roche complete miniprotease inhibitor cocktail ) . twenty
forty g of protein was fractionated using an sds - page gel , transferred to a nitrocellulose membrane , and blocked with 5% milk in tbs - t .
these membranes were incubated with primary ( 1 : 1000 ) followed by an appropriate hrp - conjugated secondary antibodies ( 1 : 5000 ) for 1 h at room temperature .
reactive products were visualized by chemiluminescence ( thermoscientific , rockford , il ) and quantified by densitometry using the quantity one software ( bio - rad , hercules , ca ) .
membranes were stripped and reprobed for -actin ( 1 : 1,000 ) as the loading control .
cell proliferation data is derived from three to four independent experiments performed in triplicate for each cell line .
a t - test was used to calculate the differences in mean using microsoft excel and a p value 0.05 was considered significant .
the relative index ( ri ) was also calculated using the formula ri = s(expected)/s(observed ) = s[a ] s[b]/s[a + b ] , where a and b are extracts / compounds and ici , respectively .
an ri = 1 is considered additive , < 1 antagonism or absence of synergism , and > 1 presence of synergism .
in this study we have used three models of endocrine resistance to test the effect of berry extracts and compounds .
the lcc1 cells , originally derived from mcf7 cells , are er+ , e independent , and sensitive to both tam and ici .
these cells are er+ , e independent and are tam and ici cross - resistant .
previous studies have shown the effect of both rre and del in mcf7 cells [ 22 , 29 ] .
we also used zr75 - 1 cells , initially derived from a tumor that was unresponsive to tam .
these cells are er+ , pgr+ , tam , and ici sensitive and express a low level of p53 [ 31 , 32 ] .
zr75 - 1r cells were derived from zr75 - 1 cells by a similar procedure as for lcc9 cells .
they also are cross - resistant to tam and ici ( data not shown ) .
the bt-474 cells belong to the luminal b molecular classification along with the zr75 - 1 cells .
these cells are er+ , pgr+ and overexpress her 2 [ 32 , 33 ] .
to our knowledge , this is the first study to assess the effects of berry extracts in lcc1 , lcc9 , zr75 - 1 , zr75 - 1r , and bt-474 cells .
this is also the first study to evaluate the effect of berry extracts and phytochemicals on ici - resistant cell lines .
all ici - sensitive cells were slightly growth inhibited by 1 nm ici ( 1030% ) .
this effect was most prominent after 6 d. in lcc1 cells , 6 d ici treatment resulted in a 30% decrease in cell proliferation compared to vehicle treatment ( 0.705 ; p value = 0.0003 ) . in zr75 - 1 cells , 1 nm ici did not cause a significant reduction in cell proliferation at 3 d ( fold change = 0.91 ) , but caused a 20% reduction at 6 d ( p = 0.02 )
. in bt474 cells , ici treatment ( 1 nm ) alone caused a 13% and 25% ( p = 0.02 ) reduction in cell proliferation after 3 and 6 d , respectively .
since the growth inhibitory effect was less than 50% ( < ic50 ) , we considered 1 nm ici to be sublethal dose in sensitive cells . on the other hand ,
resistant cells were not growth inhibited by ici concentrations of up to 1 m .
thus , we tested the effects of extracts and compounds to resensitize lcc9 and zr75 - 1r at two different concentrations of ici ( 1 nm and 1 m ) .
we found that all berry extracts and compounds had an estrogenic effect on lcc1 cells indicated by the moderate to significant , dose - dependent , increase in cell proliferation after 6 d treatment ( figures 1(a)1(d ) ) .
further , this effect was found to be er - mediated since cotreatment of lcc1 cells with ici abrogated the effects of extracts / compounds ( figures 1(a)1(d ) ) .
these effects were more prominent after 6 d rather than a 3 d treatment . of note
, del has a significant proliferative effect on lcc1 at 0.1 m , 1 m , and 10 m with a fold change of 1.26 ( p = 0.046 ) , 1.33 ( p = 0.035 ) , and 2.04 ( p = 0.008 ) , respectively ( compared to vehicle value of 1.00 ) ( figure 1(c ) ) .
after 6 d treatment , concentrations of 0.1 m and 1 m of ea showed a nonsignificant proliferative effect , but 10 m of ea showed no change in cell proliferation ( figure 1(d ) ) .
this shows that there is a specific range of concentrations at which ea may have estrogenic properties .
while berry extracts and compounds had significant growth promoting effects on e - independent lcc1 cells , they showed a dose - dependent but moderate growth inhibitory effects of zr75 - 1 and bt474 cells grown in e - sufficient medium ( figures 1(e)1(l ) ) .
ejae alone , dose dependently inhibited the proliferation of zr75 - 1 cells after 6 d treatment ( figure 1(e ) ) .
this effect was enhanced by cotreatment with ici but significant only at 100 g / ml of ejae ( p = 0.05 ; ri = 0.90 ) . in bt474 cells ,
there were no synergistic or additive effects seen after addition of 1 nm ici ( figure 1(i ) ) .
however , it must be noted that the lower dose had a greater effect when combined with ici suggesting that doses in physiologically achievable ranges may achieve an additive effect with drug therapy .
a lower dose of rre ( 1 g / ml ; 22% ) was more effective than the higher dose ( 100 g / ml ; 13% ) in zr75 - 1 cells after 3 d. however , at 6 d , only the 100 g / ml rre showed a 20% reduction in cell proliferation ( figure 1(f ) ) .
this effect was slightly modified to 26% by the addition of 1 nm ici . in bt474 cells ,
both 1 and 100 g / ml rre showed 15% reduction in cell proliferation without ici ( p 0.05 ) after 3 d treatment .
however , after 6 d , rre alone showed a dose - dependent 1528% reduction ( p 0.05 at 10 g / ml ) ( figure 1(j ) ) .
however , an ri of 0.86 in zr75 - 1 and of 0.89 in bt474 suggests that at higher doses ( 100 g / ml ) rre and ici may trend toward antagonizing the action of each other . in zr75 - 1 cells
, we observed only 28% and 20% antiproliferative effect at the highest dose of del ( 10 m ) at 3 and 6 d , respectively ( ns ; figure 1(g ) ) .
however , a linear dose response and a synergistic effect were observed when ici was added ( ri 1.0 ) ( ns ; figure 1(g ) ) . in bt474 cells , after 3 d , the lowest dose of del was the most effective in curbing proliferation ( 15% reduction ; p = 0.02 for 0.1 m versus 5% for 1 and 10 m ) .
an additive effect was also evident with 1 nm ici ( ri = 1.0 ; 22% reduction for 0.1 m del+ ici versus 13% for ici alone or other doses of del+ici ) .
after 6 d , all doses of del ( 0.1 m10 m ) achieved a 30% reduction in the presence of ici showing an ri .
= 1.0 , suggesting that the effects were additive ( figure 1(k ) ) .
ea treatment did not significantly alter the proliferation of either cell line at doses tested with or without ici after 6 d treatment ( figures 1(h ) and 1(m ) ) . in lcc9 cells , ejae alone ( 1 g / ml ) caused a modest , but significant , reduction in cell proliferation after 3 d ( 19% ; p = 0.028 ) .
however this effect was not present at 6 d ( figure 2(a ) ) .
ejae did not significantly resensitize lcc9 cells to either 1 nm ( figure 2(a ) ) or 1 m ici at any concentration tested ( data not shown ) . at 6 d ,
rre ( 10 g / ml ) increased the inhibitory response of lcc9 cells to 1 nm ici ( 33% ; ns . ; ri = 1.34 ) ( figure 2(b ) ) .
however , we did not observe this synergistic effect at 1 m ici ( data not shown ) , suggesting that specific cellular responses are elicited at specific doses of the drug ( ici ) and the extract ( rre ) .
del alone had no effect on cell proliferation at 3 or 6 d. in the presence of 1 nm ici and 0.1 m del , there was a 35% induction of cell proliferation ( p = 0.03 ) at 3 d. however , this effect was not seen at 6 d ( figure 2(c ) ) .
rre alone ( 100 g / ml ) caused a 28% and 18% nonsignificant reduction at 3 and 6 d , respectively .
this effect was not altered by ici ( 1 nm ) after 3 d ( 27% ) or 6 d ( 11% ) .
ea neither had a significant growth inhibiting effect on lcc9 cells after 3 d ( data not shown ) or 6 d treatment , nor showed an ability to resensitize lcc9 cells to 1 nm ici ( figure 2(d ) ) .
zr75 - 1r cells were overall more susceptible to the effects of both ejae and rre than lcc9 cells .
after 3 d , ejae alone at 100 g / ml and 0.01 g / ml showed a reduction in cell proliferation by 20% and 35% , respectively .
however , after 6 d treatment , the reduction was sustained only at the highest dose ( figure 2(e ) ) . in
the presence of 1 nm ici , ejae ( 100 g / ml ) showed a reduction in cell proliferation ( 35% ; ri = 1.23 ) .
this effect is slightly greater than that seen for ejae alone ( figure 2(e ) ) .
however , in the presence of 1 m ici , we observed a linear dose response with 1 , 10 , and 100 g / ml of ejae reducing cell proliferation by 15% , 15% , and 40% , respectively ( ri 1.2 for each treatment ) ( figure 3(a ) ) .
an interesting rre dose response with an inverted - u curve was observed in zr75 - 1r cells . at 6 d ,
lower doses ( 1 g / ml and 10 g / ml ) showed a proliferative effect , whereas higher dose ( 100 g / ml ) showed a 22% reduction in cell proliferation ( figure 2(f ) ) .
addition of 1 nm ici does not change this effect ( figure 2(f ) ) .
however , in the presence of 1 m ici , rre significantly and dose - dependently inhibited zr75 - 1r growth by 2550% ( p = 0.05 at 100 g / ml ; ri 1.4 ) ( figure 3(b ) ) . both 1 g / ml and 10 g / ml rre had a highly synergistic effect in the presence of 1 m ici with ri values of 1.98 and 1.71 , respectively ( figure 3(b ) ) .
del treatment of zr75 - 1r did not show any significant change in cell proliferation after 3 or 6 d treatment with or without 1 nm ici ( figure 2(g ) ) .
ea treatment of zr75 - 1r did not show a change in cell proliferation ( figure 2(h ) ) . however , ea treatment with 1 nm ici showed a synergistic dose response after 3 d as 1 m and 10 m displayed a 15% ( ri .
this shows that ea could resensitize the cells to ici at 3 d. however , this response was not seen after 6 d ea treatment ( figure 2(h ) ) . in order to understand the molecular mechanisms by which berry extracts and its constituents
cause the observed effects in lcc1 and lcc9 cells , we assessed the levels of various molecular markers in these cells after treatment with berry extract / compound alone or in the presence of ici . since the antiproliferative effects of the compounds were evident at 3 d , we chose this time point to study molecular mechanisms . also , we specifically chose those concentrations of extracts / compounds that produced the greatest reduction in cell proliferation at 6 d ( figures 1(a)1(h ) ) .
as expected in lcc1 cells , ejae and del alone showed an estrogenic response with an observed increase of 3- and 2.5-fold , respectively , in progesterone receptor ( pgr ) expression ( figure 4(a ) ) .
interestingly , ea and del alone also raised er levels ( figure 4(b ) ) .
we also assessed molecular markers of cell death ( parp cleavage ) , autophagy ( p62 , beclin 1 , light chain-3 ( lc3 ) ) , and the levels of the antiapoptotic b - cell lymphoma ( bcl ) family members ( bcl2 , bclw , and bclxl ) .
it has been previously shown that combined knockdown of bcl2 and bclw leads to resensitization of lcc9 cells to tam and ici .
although we observed a clear increase in parp expression by ea alone and a reduction in levels after ici treatment across all extracts , we did not see cleavage of parp in any of the treatments ( figure 4(c ) ) .
ejae , rre , and del caused a 2-fold induction in lc3ii levels , which was reversed by the addition of ici , except for ejae ( figure 4(f ) ) .
ejae + ici caused a 3.3-fold induction of lc3ii in lcc1 cells ( figure 4(f ) ) .
on the other hand , ejae , del , and ea increased the levels of p62 to various extents ( 1.4 to 2.5-fold ; figure 4(d ) ) . as expected , ici treatment reduced p62 levels by 60% , suggesting active autophagy .
ejae did not alter this response ; however , rre , ea , and del all reversed this reduction .
rre and ea treatments significantly increased the levels on beclin-1 ( figure 4(e ) ) .
ejae induced beclin-1 levels by 5-fold in the presence of ici ( figure 4(e ) ) .
the effect of extracts / compounds on the bcl2-family members was neither uniform nor significant ( figures 4(g)4(j ) ) .
ea increased the expression of bcl-2 > 1.5-fold without or with ici ( figure 4(g ) ) .
bclw and bclxl expression was induced by ea and del alone and ejae + ici ( figures 4(h ) and 4(j ) ) . in lcc9 cells ,
ejae + ici treatment increased lc3ii levels by 13.7-fold over vehicle or ici - only treatment , suggesting that ejae may increase autophagosome formation in lcc9 cells .
however , we failed to see a baseline increase in lc3ii with ici - only treatment .
on the other hand , rre + ici , del alone , and del + ici showed an across - the - board increase in the expression of all bcl2-family proteins ( bcl2 , bclw , and bclxl ) , as well as beclin-1 .
rre + ici treatment and del increased p62 expression 22.5 fold suggesting an inhibition of autophagy .
in this study , we tested whether berry extracts / compounds synergize with a sublethal dose of ici and increase drug response in ici - sensitive cell lines .
we also tested whether cotreatment of berry extracts reverses the resistant phenotype in ici - resistant cells , thereby leading to an increased cell death in the presence of ici .
we used multiple cell lines with different molecular characteristics that are representative of the er+ tumors commonly seen in the patient population .
the ici - sensitive cells used can be divided into luminal a ( er+ , pgr+ , her2- ; lcc1 ) and b ( er+ , pgr+ , her2 + ; zr75 - 1 and bt-474 ) subtypes and the resistant cells derived from the same subtypes ( lcc9 from lcc1 and zr75 - 1r from zr75 - 1 ) .
further , these cells were also cultured in different media with lcc1 and lcc9 in e - deficient medium ( < 10 m e ) and all other cell lines in an e - sufficient medium ( ~10 m e ) .
in addition to this , we tested two berry extracts ( ejae and rre ) and their representative compounds ( del and ea ) .
this complex design was purposely selected to mimic the complex nature of breast cancer as it presents in the clinic . in the clinic , we are likely to see patients , both pre- ( e sufficient ) and postmenopausal ( e deficient ) , with er+ tumors of either subtypes ( luminal a and b ) that will be treated with ici . furthermore , dietary recommendations will involve whole fruits and not pure components .
finally , we included individual components from each berry extract to determine the contribution of the food matrix .
the results from the cell proliferation studies are straightforward and answer many of these questions . both berry extracts and compounds synergize with a sublethal dose of ici ( 1 nm ) to cause an inhibition of cell proliferation in ici - sensitive cell lines .
the berry extracts / compounds are most effective in bt-474 cells and least effective in lcc1 cells .
the effects of the extract / compounds alone vary greatly with the doses used and the type of cell - line .
we observed that both extracts and compounds had an estrogenic effect on lcc1 cells grown in an e - deficient medium ( figures 1(a)1(d ) ) .
this effect was significant and dose dependent for ejae and del ( figures 1(a ) and 1(c ) ) .
however , the same extracts / compounds showed a dose - dependent inhibition of cell proliferation in zr75 - 1 and bt-474 cells grown in e - sufficient medium ( figures 1(e)1(l ) ) .
this effect is similar to that observed with tam , which stimulates mcf-7 cell growth under e - deficient , and inhibits proliferation under e - sufficient conditions ( aiyer , unpublished results ) .
the serm activity of tam reported in literature also suggests such effects [ 6 , 36 ] .
many polyphenolic compounds including those present in berries have been reported to show serm - like effects .
further , they also show a dose - dependent selective recruitment of coactivators and repressors to the er , which dictates whether these compounds will act as estrogens or antiestrogens [ 3 , 37 ] .
for example , rre shows a slight estrogenic effect ( increased cell growth ) at 1 g / ml , whereas inhibits growth at 10 and 100 g / ml ( figure 1(g ) ) .
regardless of their effects alone , all extracts / compounds tested show varying degrees of either additive or synergistic response with ici in sensitive cells .
both bt-474 and zr-75 cells are her2 + , whereas lcc1 cells are not [ 6 , 33 ] .
although all cell lines possess er , the constitutive levels of this receptor vary greatly among these cell lines at baseline ( aiyer , unpublished results ) .
thus , the differential effect of berry extracts / compounds seen among various cell lines could be partially explained by these differences .
many berry compounds have been shown to deactivate tyrosine kinase signaling and can inhibit her2-mediated effects on cell proliferation ( reviewed in ) .
there is an extract - induced increase in pgr levels ( figure 4(a ) ) , which suggests a classic genomic response due to er activation .
additionally , treatment with extracts seems to stabilize er levels and antagonize the ici - mediated degradation of er in lcc1 cells ( figure 4(b ) ) .
the implications of such effects on long - term ici - treatment and resistance development must be explored further . in ici - resistant cells , neither extracts nor pure compounds resensitized the cells to lower dose of ici ( 1 nm ) ( figures 2(a)2(h ) ) .
the resistant cells continue to grow in the presence of ici up to 1 m and hence may be resistant to many chemopreventive agents tested at lower doses . however , both ejae and rre at all concentrations tested synergize with 1 m ici to cause a significant reduction in resistant ( zr75 - 1r ) cell growth ( figure 3 ) .
a limitation of this study is the lack of clear mechanistic detail regarding how berry extracts and compounds reduce cell growth .
we studied the induction of autophagy using p62 , lc3ii , and beclin 1 as surrogate markers .
many compounds present in berries have been shown to induce autophagy - associated cell death [ 3 , 3941 ] . however , in terms of endocrine resistance , autophagy is possibly a survival mechanism and inhibition of autophagy alone , or in combination with bcl2+bclw coinhibition , resensitizes the resistant cells to aes .
there is some evidence to suggest that rre , del , and ea may interfere with autophagy in lcc1 cells .
they reverse the ici - induced degradation of p62 to various extent ( figure 4(d ) ) .
it is clear that ejae ici consistently increases autophagy in both lcc1 and lcc9 cells .
since we have not directly counted lc3 punctae formation , the data is inconclusive as to whether berry extracts / compounds inhibit autophagy and the exact mechanisms by which they do so .
however , we only analyzed these markers in lcc1 and lcc9 cells , where the effects of the extracts / compounds were minimal .
the assessment of the markers in other cell lines is currently underway and should provide a clearer understanding of the various mechanisms by which berry extracts / compounds increase cell - line responsiveness to ici . other research into berry extracts and compounds
previous studies show that the ic50 of rre in mcf7 cells grown in e - sufficient medium is 190 g / ml at 48 h .
this is comparable to the effect seen in the zr75 - 1 and bt474 cells , grown under similar conditions , in this study .
ejae has been tested in breast cancer cell lines such as mcf7-aro and mda - mb-231 with an ic50 of 27 and 40 g / ml , respectively , at 72 h .
have shown that hydrolyzed extract of the jamun fruit pulp was effective in reducing the growth of the non - small cell lung cancer cell - line a549 with an ic50 of 59 g / ml at 72 h. such studies have typically reported the cytotoxic effects of extracts / compounds within 72 h. by contrast , our data presents the effect at both 72 h ( 3 d ) and at 6 d. it is seen that many of the effects at 3 d are not carried over at 6 d. this could be due to the clonogenic expansion of the cells that were initially unresponsive to the chemopreventive agent .
since effects of dietary bioactive compounds on cancer cells are a chronic process , 2 or 3 d cell proliferation studies , as is typically performed for a majority of these agents , may lead to the overrepresentation of the effectiveness of such compounds . in conclusion , using a clonogenic assay , we have shown that berry extracts and compounds can increase the cell - death response of ici - sensitive breast cancer lines to a sublethal dose of ici ( 1 nm , < ic50 dose ) .
additionally , berry extracts resensitize ici - resistant cells to ici treatment showing a synergistic response , especially at the higher dose ( 1 m ) .
finally , we found that extracts were more effective at lower , physiologically relevant doses than at higher experimental doses in some cell lines .
these results indicate that berry extracts and compounds can potentially interact with ici in breast epithelial cells to alter drug - response .
further in vivo research is warranted regarding the implications of such food - drug interactions in response to ici treatment and the development of drug resistance . | fulvestrant ( ici 182,780 ; ici ) is approved for the treatment of advanced metastatic breast cancer that is unresponsive to other endocrine therapies .
berries are frequently consumed for their antioxidant , anti - inflammatory , and anticancer potential . in this study , we tested the efficacy of two berry extracts ( jamun - ejae and red raspberry - rre ) and their bioactive compounds ( delphinidin - del and ellagic acid - ea ) to inhibit cell proliferation with or without a sublethal dose of ici in various breast cancer cell lines .
ici - sensitive ( lcc1 , zr75 - 1 , and bt474 ) and -resistant ( lcc9 , zr75 - 1r ) cells were subjected to treatment with berry extracts alone ( 0.1100 g / ml ) or with a sub - lethal dose of ici ( < ic50 dose ; 1 nm for sensitive ; 1 m for resistant cells ) .
extracts and del enhanced the effect of ici in sensitive zr75 - 1 and bt474 cells primarily in an additive fashion ( measured by relative index ( ri)~1 ) . in zr75 - 1r cells ,
both ejae and rre synergistically enhanced the effects of ici ( 1550% ; p < 0.05 ; ri > 1 ) .
ea , in doses tested , did not have any significant effects on any of the cell lines .
finally , we found that the extracts were more effective at lower , physiologically relevant concentrations than at higher experimental doses . |
nowadays , insertion of an expandable metallic stent ( ems ) is the standard treatment to rescue obstructive jaundice caused by unresectable pancreaticobiliary malignancies .
as one of the problematic complications of biliary ems , stent migration occurs in 1.8 - 8.3% of cases with covered biliary ems and in 0 - 2.4% of uncovered ems .
migration of biliary ems may cause severe complications such as ulceration , perforation and intestinal obstruction , so that appropriate treatments are needed .
several techniques have been reported on endoscopic removal of biliary ems and the success rate of removal was 86.4 - 92.3% in cases of covered ems .
however , it is still difficult in cases of uncovered ems ( 0 - 38.4% ) .
stent trimming is another approach to treat ems migration . to date , yag laser and argon plasma have been applied to transect metallic stents .
we herein report a case of advanced pancreatic cancer with occurrence of obstructive jaundice due to migration and occlusion of a self - expandable biliary nitinol stent .
in april 2007 , an 84-year - old man developed jaundice and was admitted to hospital . by several image examinations and blood test
he refused aggressive therapies such as surgical operation and chemotherapy because of insufficient physical condition and high age . to rescue obstructive jaundice , after temporary nasobiliary drainage
, an uncovered ems ( niti - s biliary stent , 10 mm 6 cm ) was inserted in the lower bile duct in june 2007 . during best supportive care , he developed icterus and was referred to our institute in july 2008 . on admission , laboratory data showed bilirubinemia ( total bilirubin : 3.0 mg / dl ) , a high level of hepatobiliary enzyme ( got : 129 u / l , gpt : 78 u / l , gtp : 574 u / l ) and inflammatory reaction ( crp : 3.11 mg / dl ) . a duodenoscope ( olympus , jf-260v ) was inserted to examine biliary obstruction . at the duodenal papilla ,
the biliary ems was migrated toward the anal side of the duodenal lumen about 2 cm in length ( fig .
the stent was not covered and it seemed difficult to remove by grasping or snaring stent despite a couple of attempts .
the endoscope was changed into the upper gastrointestinal scope ( olympus , gf - h260 ) with hood attachment at the top and was inserted again .
trimming of the ems was performed using argon plasma , a few millimeters from the papilla 's orifice , in order not to cause ulceration or oozing from the duodenal mucosa ( fig .
air vacuuming was frequently done to reduce inspired gas in the duodenum . in about 30 min , the ems was completely cut off and the distal side of the stent was removed . by mechanical cleaning using balloon catheter ( olympus , multi3v , 15 mm ) ( fig .
four months after this procedure , the patient succumbed to severe pneumonia , but no recurrence of jaundice was noted after the procedure of ems trimming .
the incidence of biliary ems migration is not really high ( 0 - 8.3% ) and it is less frequent in cases of uncovered ems .
endoscopic removal is successful in most cases of covered ems ( success rate : 86.4% to 92.3% ) , but it is difficult in uncovered ones ( 0% to 38.4% ) .
several methods have been developed to efficiently improve the removal of ems without complication , such as the lasso technique , the wire - loop technique , or the open - biopsy - forceps technique using foreign - body forceps and polypectomy snares .
described that removal of uncovered ems was difficult and required a combination of techniques in addition to the devices previously described .
however , when the inserted ems was migrated , most patients with pancreaticobiliary malignancies were thought to be in advanced stage , hence a less invasive approach is needed for the management of biliary drainage .
recently , demarquay et al . demonstrated the efficacy of argon plasma for endoscopic shortening of biliary wallstent and they also succeeded in trimming other types of ems , including esophageal and colorectal stents . according to the report mostly done on wallstent with largest the series ( 31 cases ) , recommended power setting was 70 - 80 w with argon flow of 0.8 l / min , however it was quite similar to ours according to the second largest study ( 6 cases ) done on nitinol stent ( 60 w , 1.8 l / min ) . by
an in vitro experimental model , it is reported that at least 60 w of argon plasma was required to cut the bare metallic stent , with a different effect level by duration of irradiation and stent condition ( wet or dry ) .
we should be careful on the type of stent metal , because melting temperature is different between nitinol alloy ( niti - s stent ) and stainless steel ( wallstent ) . as the temperature generated by argon plasma is between 1,000 and 1,300c and
the melting point of nitinol ( alloy of nickel and titanium ) is around 1,200 - 1300c , nitinol stents can be easily cut . while trimming ems , we must be aware that the stent is well washed out and there is no sludge on the surface so that heat energy conducts well .
transection of the biliary metallic stent was performed with argon plasma in acceptable time without complication . today
we suggest that argon plasma trimming is a less expensive , safe and effective method to rescue migrated uncovered biliary metallic stents . | metallic stent migration is a well - known complication which can not always be managed by removal or repositioning , especially in case of uncovered stent .
we report a patient who developed obstructive jaundice due to migration of an expandable metallic stent ( ems ) inserted in the lower bile duct .
trimming of the ems using argon plasma was performed , with the power setting of 60 w and 2.0 l / min of argon flow .
the distal part of the ems was removed and mechanical cleaning using balloon catheter was performed for remnant ems . without additional stent insertion , jaundice was relieved in a few days .
no complication was recognized during the procedure and no recurrence of jaundice in the rest of his life . |
breast cancer is a malignancy arising from the epithelial tissues that line the terminal ductal - lobular units of the breast [ 1 , 2 ] . breast cancer ( bc ) is the most common cancer in females worldwide ; bc is the leading cause of cancer death among females , with an estimated 1.7 million cases and 521,900 deaths in 2012 ; bc alone accounts for 25% of all cancer cases and 15% of all cancer deaths among females .
based on data from the national cancer registry program of egypt ( ncrp ) in 20082011 , bc is the most common malignancy among egyptian females .
the age - standardized incidence rate ( asr ) of breast cancer was 42.3 per 100,000 egyptian females , with a mortality rate of 17.4 per 100,000 females .
many environmental factors combined with multiple genetic and epigenetic changes are involved in the onset and development of breast cancer [ 6 , 7 ] .
the carcinogenesis process is a multistep process during which genetic and epigenetic alterations accumulate in a cell , resulting in the progressive transformation of normal cells through steps of initiation , promotion , and progression into cancer cells .
dna methylation has an essential role in the regulation of gene expression in mammalian cells . in normal cells , the majority of promoter cytosine phosphate guanosine ( cpg ) islands are protected from this epigenetic event
conversely , in cancer cells , several promoter cpg islands are hypermethylated and form a closed repressive chromatin configuration that affects the transcription initiation of the corresponding genes [ 1113 ] .
moreover , promoter methylation is a common epigenetic mechanism to silence genes during breast cancer development .
currently , genes that are epigenetically regulated via promoter methylation in breast cancer include cyclin - dependent kinase inhibitor ( p16 ) , breast cancer susceptibility gene 1 ( brca1 ) , estrogen receptor ( er ) , progesterone receptor ( pr ) , retinoic acid receptor-2 ( rar2 ) , glutathione s - transferase p1 ( gstp1 ) , e - cadherin , and tissue inhibitor of metalloproteinase 3 ( timp3 ) .
the identification of these methylated promoters had significantly contributed to elucidating the altered molecular pathways in breast carcinoma and provided potential targets for molecular detection .
brca1 is a tumor suppressor gene that is involved in critical biological processes , including dna damage repair , cell cycle control , and transcriptional regulation .
silencing of brca1 gene via promoter hypermethylation is a common mechanism for its inactivation ranging from 9 to 44% of sporadic breast cancers [ 1921 ] .
breast cancer , with extensive hypermethylation in the brca1 promoter , correlates with a reduced brca1 expression . in normal breast tissues ,
the growth of both normal and neoplastic mammary tissue is affected by a number of hormones especially estrogen , which exists in several forms , estrone ( e1 ) , estradiol ( e2 ) , estriol , estrone sulfate , and estradiol sulfate .
increasing evidence indicates that intratumoral estrogens derived in situ are mitogenic ; thus they promote bc progression , irrespective of the serum concentrations of ovarian estrogen [ 24 , 25 ] .
17 beta hydroxysteroid dehydrogenases ( 17hsds ) catalyze the interconversion of active and inactive forms of estrogens within tissues .
17 beta hydroxysteroid dehydrogenase type 1 ( 17hsd-1 ) mainly converts e1 to the potent e2 . the encoding gene ( 17hsd-1 )
is located at 17q1221 , a region that often is rearranged in breast cancer . in a study carried out by gunnarsson et al .
, they found amplification of the encoding gene ( 17hsd-1 ) in 14.5% of the breast tumors . meanwhile 17 beta hydroxysteroid dehydrogenase type 2 ( 17hsd-2 ) catalyzes the conversion of e2 to e1 , thereby reducing estradiol level and hence controlling its proliferative activity . the encoding gene ( 17hsd-2 )
is located at 16q24 and loss of heterozygosity ( loh ) at this site is frequent and early event in breast cancer .
interestingly , brca1 had been found to negatively affect estradiol activity by direct interaction with the estrogen receptor , thus controlling the proliferation caused by this steroid hormone .
clinical interest in the treatment of tumors has gained increased impetus interest because the evidence on the use of novel therapeutic agents suggests that dna promoter methylation is potentially reversible .
this may thus allow for the development of future therapeutic interventions . in the light of these evidences and
because of the potential roles of estrogens in the early stages of human breast carcinogenesis , in the present study , we aimed to assess the promoter methylation status of both brca1 and 17hsd-1 genes in the tumor and adjacent normal tissue from sporadic breast cancer patients to establish the role of epigenetic in regulating intratissue estrogen activity and thereby in the etiology of breast cancer .
surgically resected specimens were freshly obtained at the operation room from forty diagnosed primary breast carcinomas enrolled in the surgical oncology unit in suez canal university hospital during the period from 2013 to 2014 .
their matching normal breast tissues , taken 35 cm away from the healthy safety margin of the site of the tumor in the same breast , were obtained to serve as controls .
harvested breast tissues were either divided for dna isolation or kept in 10% neutral - buffered formalin for histopathological analysis . labeled tissue sections were examined by a pathologist blinded to the identity of samples and only the researcher would know to whom it referred . prior to surgical tumor removal ,
written informed approval consents were obtained from all participants included in the study according to the ethics committee of the faculty of medicine , suez canal university .
genomic dna was extracted from collected tissues using qiagen genomic dna purification kit ( cat # 51304 ; qiagen , hilden , germany ) according to the manufacturer 's instructions .
the quality of extracted genomic dna was measured using the nanodrop- ( nd- ) 1000 spectrophotometer v3.1.0 ( nanodrop technologies , inc .
extracted dna was digested using the fast restriction enzyme hpaii according to the manufacturer 's instructions ( fast digest , fermentas , ca , usa ) .
the reaction mixture was incubated at 37c in an oven for 1 hour followed by enzyme inactivation for 10 minutes at 90c .
digested dna aliquots were then pcr analyzed using brca1 and 17hsd-1 specific primers encompassing methylation - specific sites ( table 1 ) and the taq pcr master mix kit ( cat # 201445 ; qiagen , hilden , germany ) .
a mock undigested sample containing 1 l of nuclease - free water , instead of 1 l of fast digest enzyme ( hpaii ) , was used as a control .
a sample of water instead of dna was used as a negative control for each pcr .
pcr was performed for 32 cycles using the following thermal cycling conditions : initial denaturation at 94c for 5 minutes , denaturation at 94c for 30 seconds , primer annealing at 55c or 58c for 30 seconds , extension at 72c for 45 seconds , and a final extension at 72c for 7 minutes .
an attempt to perform brcai pcrs at higher annealing temperatures gave a total absence of bands .
pcr products were detected using ethidium bromide - stained 2% agarose gels and bands were visualized under uv light .
the presence of bands with sizes of 500 bp and 238 bp indicated methylation of brca1 and 17hsd-1 promoters , respectively , while the absence of these bands indicated a lack of methylation ( figures 1 and 2 ) . coded collected data was analyzed using statistical package spss 16.0 for windows ( spss , chicago , il , usa ) .
student 's t - test was performed for statistical evaluation of quantitative variable between two independent groups in parametric data with p < 0.05 considered significant .
chi - square test , described in the form of frequency and percentages , was used to compare a qualitative variable between two independent groups .
rems - pcr showed pcr products of the expected sizes 500 bp and 238 bp for brca1 and 17hsd-1 genes , respectively , in methylated samples , while the absence of these bands indicated a lack of methylation ( figures 1 and 2 ) .
brca1 promoter was methylated in 42.5% of tumor tissue compared to 35% in control normal tissue ( figure 3 ) . to our surprise ,
17hsd-1 promoter methylation was seen in 97.5% of tumor tissues as compared to 95% of neighboring normal tissue ( figure 4 ) .
we found a trend towards brca1 and 17hsd-1 promoter hypermethylation in cancer tissue specimens of sporadic breast cancer patients compared with controls , although the difference was nonsignificant ( p > 0.05 ) .
we categorized our patients into two age groups below 50 years and above or equal to 50 years ; there was a nonsignificant increase in brca1 promoter methylation of breast cancer tissue specimens in older women compared with younger patients ( 70.6% versus 29.4% , resp . )
similarly , 17hsd-1 promoter methylation , in both study groups , was not associated with age ( table 3 ) , indicating no dramatic effect of age on brca1 and 17hsd-1 methylation status . moreover ,
postmenopausal status was associated with a nonsignificant increased methylation of brca1 promoter in cancer tissue specimens compared with premenopausal females ( 70.6% versus 29.4% ) , respectively ( table 2 ) .
in contrast , the mean age at menopause was significantly higher among brca1-methylated than the brca1-unmethylated group in cancer tissue specimens , as shown in table 2 ( 50.7 3.1 , 48.3 3.4 , resp .
; p = 0.048 ) . finally , our results showed no statistically significant difference in brca1 promoter methylation in both study groups with tumor size , the number of positive nodes , or tumor stage ( table 2 ) .
however , brca1-methylated promoter in cancer tissues tended to be of a higher grade ( 82.4% methylated versus 69.6% unmethylated in grade 2 tumors ) .
when studying 17hsd-1 , promoter methylation did not associate with any clinicopathological characteristics in both study groups ( table 3 ) .
in addition , 17hsd-1 promoter methylation did not correlate with lymph node status , clinical stage , or histological grade ( table 3 ) .
methylated brca1 in breast cancer specimens correlated with increased mitotic index , the negativity of her2 receptors , and hence molecular subtype
( p = 0.042 , p = 0.007 , and p = 0.049 , resp . )
although methylation of this promoter tended to be higher in positive estrogen receptor specimens , this correlation was not significant ( table 4 ) .
17hsd-1 promoter methylation occurred with almost equal percentages when correlated with all molecular subtypes ( table 5 ) .
we observed a high trend towards 17hsd-1 promoter methylation in the breast cancer tissue specimens in women who had positive estrogen , progesterone receptors , and negative her2 ( table 5 ) .
in addition , the concordant promoter methylation of the two studied genes was also investigated ( tables 6 and 7 ) .
brca1 promoter was methylated in both normal and cancer breast tissue specimens of 11 patients which was statistically significant ( p < 0.001 ) , while 20 cases showed combined unmethylation of brca1 promoter ( table 6 ) . in the case of a 17hsd-1 promoter
, 37 tissue specimens had methylated normal and cancer tissues , while none of the studied tissues showed combined unmethylation of this gene promoter ( table 7 ) . among the studied samples , 45% of cancer tissues and 35% of normal tissues
. however , there was no significant relation between combined brca1 and 17hsd-1 promoter methylation and type of tissue . the odds ratio = 1.5 ; 95% confidence interval = 0.63.7 and p = 0.361 .
brca1 promoter hypermethylation is implicated as one of the mechanisms of loss of gene expression .
the mitogenic effect of estradiol on breast epithelium is counteracted by the upregulation of brca1 expression , which in turn exerts a negative feedback effect on estradiol action by direct interaction with estrogen receptor .
hence , transcriptional inactivation of brca1 due to methylation may fail to decrease estradiol activity resulting in increased breast tissue proliferation . despite the ample studies on the role of brca1 in bc and its epigenetic modification , nevertheless , its association with the estrogen level regulating gene 17hsd-1 has not been conducted . in this study , we investigated the methylation status of brca1 and 17hsd-1 in sporadic breast cancer egyptian patients and correlated the findings to those in normal breast tissues .
brca1 methylation percentage in our study is near to the upper end of previously reported frequencies for this alteration in sporadic breast cancer [ 1921 ] .
data had hypermethylation of the brca1 in 56% ( 78 of 139 ) of taiwanese women with early - stage sporadic breast carcinomas , which is significantly higher than previously reported frequencies for this alteration in sporadic breast tumors . the incidence of brca1 methylation has previously been reported to be higher in breast tumors of infiltrating ductal type suggesting that it might play a role in breast carcinogenesis . in other studies , brca1 existed in even lower percentages , 932% , in sporadic breast cancer .
this variation may be due to several factors : first factor is the methylation assay or the analysis method used , bisulfite method [ 15 , 19 , 36 , 37 ] , and genomic sequencing [ 22 , 38 , 39 ] ; secondly , msp detects differential methylation status by amplification of bisulfite - treated dna with primers specific for methylated versus unmethylated dna .
cpg sites residing within the primer sets were used as a proxy for the methylation status of the region of interest .
although most published studies mentioned above [ 15 , 19 , 36 , 37 ] used msp , the primer sequences and target regions varied from study to study . finally , contaminating unmethylated normal tissue may occur during tissue dissection that might attenuate the methylation levels of the tumor tissue . a small population of
apparently normal breast epithelial cells could harbor brca1 promoter methylation in patients ' samples with brca1-methylated tumors [ 41 , 42 ] , but not in those with brca1-unmethylated tumors .
brca1 promoter was methylated in both normal and cancer breast tissue specimens of 11 patients which was statistically significant ( p < 0.001 ) , while 20 cases showed combined unmethylation of brca1 promoter . in the case of 17hsd-1 promoter , 37 tissue specimens had methylated normal and cancer tissues , while none of the studied tissues showed combined unmethylation of this gene promoter .
brca1 methylation was detected in 76.5% of cancer tissues with positive er and 64.7% with positive pr ; on the other hand , methylation was significantly ( p = 0.007 ) higher among tissues with negative her2 ( 68.4% ) than those with positive her2 , while 17hsd-1 promoter methylation was found in cancer tissue specimens in women who had positive er ( 66.7% ) , positive pr ( 64.1% ) , and negative her2 ( 46.2% ) .
although we could not have complete data for the er , pr , and her2 receptor staining status for the entire studied sample size , our data showed that
luminal a molecular subtype , defined as being positive for both er and pr but negative for her2 receptor , had the highest level of promoter methylation .
our finding that 17hsd-1 is associated with the luminal subtypes a and b is surprising since it has been shown that this enzyme activity correlates with the positivity of both er and pr .
methylation of 17hsd-1 in both normal and cancer tissue specimens directs the attentions towards saving those patients from the long term use of adjuvant antiestrogen therapies .
although our results indicated that brca1 promoter methylation did not correlate significantly with triple - negative breast cancer ( p = 0.174 ) , bal et al .
showed that brca1 promoter methylation correlated with decreased expression of er and basal - like phenotype .
more than half of the patients with the brca1 mutation had triple - negative breast cancer , and they also shared common clinical and pathological features .
however , a significant portion of triple - negative breast cancer patients does not carry brca1 mutations . in studies of us and
british women , triple - negative / basal - like tumors appeared to be more common among black women ( especially before menopause ) compared to white women [ 44 , 45 ] .
theoretically , unmethylated / hypomethylated 17hsd-1 should increase the levels of active estradiol and the risk of bc . contrary to this , we observed that methylation of 17hsd-1 was seen in 97.5% of tumor tissue compared to 95% of neighboring normal tissue .
some genes are known to alter their methylation status with age and these are usually tissue - specific .
our results showed that the mean age of sporadic breast cancer patients with 17hsd-1 promoters methylation group ( 56.0 9.3 years ) was slightly higher than unmethylated group ( 49.0 years ) , although the relation between age and 17hsd-1 methylation was statistically insignificant .
the present study , therefore , indicates that the methylation status of 17hsd-1 may be age - specific ; alteration of this methylation pattern of the 17hsd-1 gene in breast tissue may play an important role in bc progression .
our preliminary results presented here only demonstrate the association of brca1 promoter methylation between tumors and normal breast tissues .
direct evidence shows that progression from brca1-methylated normal breast epithelial cells to brca1-methylated breast cancer needs to be investigated in future studies .
the high methylation of 17hsd-1 promoter in both normal and cancer breast tissues rules out the biological significance of this epigenetic modification in distinguishing normal and cancer tissues .
given the fact that breast tumors express high heterogeneity , one limitation in explaining this finding is the small sample size of our studied population .
showed that 17hsd-1 negative breast tissues are less differentiated ; hence , they escape normal regulation of proliferation ; thus , it is possible that the reduced expression of this enzyme via hypermethylation in normal tissue reflects an increased carcinogenic potential in normal breast tissues harboring a nearby cancer tumor . in addition ,
based on the fact that the activity of both 17hsd-2 and 17hsd-1 controls the in situ level of breast estrogen , it is possible that 17hsd-2 activity is dominating the control of estrogen level in the 17hsd-1 hypermethylated tumors and it would be beneficial to evaluate the methylation status of this gene especially in breast cancer hypermethylated 17hsd-1 tissues .
furthermore , we found that methylation of 17hsd-1 in both normal and cancer tissue specimens may direct the attentions towards saving those patients from the long term use of adjuvant antiestrogen therapies , for example , tamoxifen , especially in er .
increased understanding of the genetic / epigenetic abnormality in the pathogenesis of breast cancer is crucial and may provide a basis for detection and treatment .
this study highlights the frequent promoter methylation of brca1 and its prognostic significance , irrespective of brca1 gene mutation in egyptian patients with early - stage breast cancer . in conclusion
, we showed that a significant proportion of patients with brca1-methylated tumors harbored brca1 promoter methylation in normal breast tissues and that 17hsd-1 methylation was observed in the normal tissues of the 17hsd-1 promoter methylation status of the tumors .
this suggests a possibility that a small proportion of the epithelial cells with brca1 promoter methylation can be precursor cells from which brca1-methylated breast tumors originate .
although our preliminary results presented here need to be validated by future studies , they may provide further insight into the different roles of promoter methylation of these genes in breast carcinogenesis . | epigenetic modifications are involved in breast carcinogenesis .
identifying genes that are epigenetically silenced via methylation could select target patients for diagnostic as well as therapeutic potential .
we assessed promoter methylation of breast cancer susceptibility gene 1 ( brca1 ) and 17 beta hydroxysteroid dehydrogenase type 1 ( 17hsd-1 ) in normal and cancer breast tissues of forty sporadic breast cancer ( bc ) cases using restriction enzyme based methylation - specific pcr ( rems - pcr ) . in cancerous tissues , brca1 and 17hsd-1
were methylated in 42.5% and 97.5% , respectively , while normal tissues had 35% and 95% methylation , respectively .
brca1 methylation in normal tissues was 12.2-fold more likely to associate with methylation in cancer tissues ( p < 0.001 ) .
it correlated significantly with increased age at menopause , mitosis , the negative status of her2 , and the molecular subtype
luminal a
( p = 0.048 , p = 0.042 , p = 0.007 , and p = 0.049 , resp . ) .
methylation of brca1 and 17hsd-1 related to luminal a subtype of breast cancer .
since a small proportion of normal breast epithelial cells had brca1 methylation , our preliminary findings suggest that methylation of brca1 may be involved in breast tumors initiation and progression ; therefore , it could be used as a biomarker for the early detection of sporadic breast cancer .
methylation of 17hsd-1 in normal and cancer tissue could save patients the long term use of adjuvant antiestrogen therapies . |
coronary artery disease ( cad ) including myocardial infarction ( mi ) is a leading cause of death worldwide [ 1 , 2 ] .
the well - known conventional coronary risk factors include age , male sex , hypertension , diabetes mellitus , hypercholesterolemia , smoking and family history , which have been repeatedly demonstrated in multiple epidemiological studies [ 35 ] .
lifestyle and environmental factors play an important role in the pathogenesis ; however , genetic predisposition is also thought to contribute to cad / mi since these diseases cluster in families . in the epidemiological studies using twins ,
the relative hazard of death among men from cad when one 's twin died of cad before the age of 55 years , as compared with the hazard when one 's twin did not die before 55 , was 8.1 for monozygotic twins and 3.8 for dizygotic twins .
the recent epidemiological survey in the framingham study showed that parental cardiovascular disease independently predicted future offspring events . in this survey , participants with at least one parent with premature cad had greater risk for events with age - adjusted odds ratios ( ors ) of 2.6 for men and 2.3 for women compared with those with no parental cad .
elucidating the genetic determinants would improve risk assessment and provide better measures for prevention and treatment .
as the molecular biology and genetics had progressed , the genetic backgrounds were explored in the several genes which were thought to contribute to the pathogenesis of atherosclerosis and conventional coronary risk factors .
candidate gene studies tested the hypothesis that proteins known to be involved in the pathogenesis of atherosclerosis carry variants that affect their protein functions and the risk of developing cad . in 1992 , cambien et al . explored a possible association between cad and a variation found in the gene encoding angiotensin - converting enzyme ( ace )
the polymorphism ace / insertion / deletion ( ace / id ) is strongly associated with the level of the circulating enzyme .
they reported that the deletion homozygote ( dd genotype ) , which was associated with higher levels of circulating ace , is significantly more frequent in patients with mi than in controls .
the representative variants associated with cad / mi found by candidate gene approach are listed in table 1 .
one of the reasons for poor reproducibility is that many of the study samples were not large enough with some exceptions to identify disease - associated genetic variants with odds ratio < 2.0 .
in addition , candidate gene studies only tested a single to few variants for association with cad and these approaches can not discover unknown novel variants and also can not evaluate how strong each variant contribute to the susceptibility to cad .
therefore , the candidate gene approach resulted in only limited success in the elucidation of genetic risks for cad . in parallel with candidate gene studies , other strategies were carried out to interrogate the entire human genome without hypotheses on which genes may be responsible for disease risk .
one of the strategies is genome - wide linkage analysis and it is based on the mendelian cosegregation of a genetic marker within a family . however , great efforts had to be made in order to collect sufficient numbers of affected sibling pairs .
only a small number of studies were successfully performed and few genetic loci ( 2q21 - 22 , xq23 - 26 , myocyte enhancer factor-2 ( mef2a ) , arachidonate 5-lipoxygenase - activating protein ( alox5ap ) , leukotriene a4 hydrolase ( lta4h ) ) were detected to be associated with cad ( table 2 ) .
these genes had never been suggested as causative genes before these family - based studies , suggesting the effectiveness of this approach in detection of novel genetic determinants .
such a family - based study has been frequently used to identify new loci in monogenic diseases , but the application of this strategy to multifactorial diseases is relatively limited . in this situation ,
whole genome analysis in a case - control study design had gradually emerged around the beginning of the 21st century .
resources including the single nucleotide polymorphism ( snp ) databases , major technological advances in high - throughput genotyping , and methods of data processing and statistical analysis allow researchers to confront limitations in previous approaches . here ,
we introduce the representative genome - wide case - control association studies in the next two sections .
beginning in 2000 , the prime minister 's millennium project ( j - snp ) was launched in japan and about hundred thousand snps located in genes or in adjacent regions that might influence the coding sequence of the genes were identified in japanese population .
j - snp established a web - based database and allowed researchers access to high quality snp data .
genome - wide association studies using this snp database were performed in our country in many important clinical fields including cardiovascular diseases , diabetes , renal dysfunction and autoimmune collagen diseases . as the first genome - wide case - control association study in the world , ozaki et al . used 92,788 gene - based snp markers and identified that the homozygosity in two snps in lymphotoxin a ( lta ) at 6p21 was significantly associated with increased risk for mi in japanese ( odds ratio ( or ) = 1.78 ) . in vitro analyses showed that one functional snp ( thr26asn ) caused a twofold increase in induction of several inflammation - related cell - adhesion molecules including vascular cell adhesion molecule 1 ( vcam1 ) in vascular smooth - muscle cells .
moreover , the snp located in intron 1 of lta enhanced the transcriptional level of lta .
these results indicated the variants in the lta are risk factors for mi and implicated lta as a novel pathogenic factor for mi . in the same year , lta knockout mouse was shown to be resistant to atherosclerosis .
double knockout mice of apolipoprotein e ( apoe ) and lta ( apoe/lta/ mice ) showed less extent of atherosclerosis than apoe/lta+/+ mice , indicating lta deteriorates atherosclerosis in vivo , consistent with the result of the genetic association study of lta as a genetic risk for atherosclerotic disease .
subsequently , they identified snps that were significantly associated with mi in lectin , galactoside - binding , soluble , 2 gene ( lgals2 ) , proteasome subunit alpha type 6 gene ( psma6 ) , myocardial infarction associated transcript ( miat ) , inter - alpha ( globulin ) inhibitor 3 gene ( itih3 ) and brca1-associated protein gene ( brap ) mainly by functional approaches .
all the six causative genetic regions are related to inflammatory process in vasculature and are thought to contribute to the process in atherosclerotic changes through its inflammatory functions and thus increase the risk of mi .
genome - wide association studies based on the j - snp database ( approximately 100,000 snps ) have detected several snps which had significant association with myocardial infarction .
however , the j - snp database does not cover snps in intergene regions . in the meantime ,
the international hapmap project was conducted to create a public genome - wide database of common snps and enable systematic studies of common snps for their potential role in human disease [ 22 , 23 ] .
the project analyzed dna samples from 90 people with european ancestry , 90 yoruba people in nigeria , 44 japanese and 45 han chinese and has now genotyped over 3.1 million snps in each of these populations
. however , testing all of these snps in a person 's chromosomes would be extremely expensive .
adjacent snps across the genome are correlated each other , a phenomenon known as linkage disequilibrium and snps that are inherited together were compiled into
a haplotype block may contain many snps , but only a few tag snps can provide most of the information on the pattern of genetic variation in the block . the hapmap project identified these tag snps within haplotypes that uniquely identify these haplotypes .
the hapmap data allowed efficient design of chip - based genome association studies and allowed investigators to genotype far fewer snps while still retaining statistical power to find genetic variants related to common illness .
the development of dense genotyping chips enables genotyping up to 1 million snps on a single small chip .
this chip technology allowed genome - wide association studies ( gwas ) to be performed on a large numbers of subjects .
chip - based gwas typically involves genotyping approximately a few thousands cases with a disease and a few thousands of controls for about 500,000 tag snps .
since there are 500,000 comparisons per study , there is a high potential for false positive results .
the proposed solution for that is applying the stringent p value using the bonferroni correction for multiple tests . in that case , p value will be 0.05 divided by 500,000 and that is 0.0000001 ( 10 ) and this stringent p value is often termed as genome - wide significance ' .
the most statistically significant variants identified in the initial case - control analysis are tested for replication in subsequent case - control studies . in gwas method ,
associations between snps and the diseases are made free of bias of particular candidate genes .
this makes the possibility of obtaining novel and unbiased information and provides the important direction to better understand the pathophysiology of the disease . for cad ,
three chip - based gwas were simultaneously reported in 2007 and all of them showed the significant association between cad and snps on chromosome 9p21 .
enrolled a total of 4587 mi cases and 12,767 controls and genotyped total 305953 snps using illumina hap300chip ( illumina ) ( table 3 ) .
they identified disease association variant located in 9p21 , adjacent to the tumor suppressor genes cyclin - dependent kinase inhibitor 2a ( cdkn2a ) and cyclin - dependent kinase inhibitor 2b ( cdkn2b ) with great statistical significance .
they showed the allele g of the snp rs10757278 ( figure 1 ) showed the strongest association with mi .
the ors for heterozygous and homozygous carriers of the risk allele g were 1.26 and 1.64 , respectively .
the ors for early - onset mi ( mi before the age of 50 for males and before the age of 60 for females ) are 1.49 and 2.02 for heterozygous and homozygous carriers of the risk allele , respectively .
they estimated the population attributable risk is 21% for mi in general and 31% for early - onset cases .
the snps on chromosome 9p21 associated with mi are located in the same disequilibrium block of the one which contains cdkn2a and cdkn2b .
these genes encode two members of the inhibitors of cdk4 ( ink4 ) family of cyclin - dependent kinase inhibitors , p16 and p15 , and a completely unrelated protein called arf .
the p16 and p15 which activates retinoblastoma ( rb ) family members and arf which activates p53 were shown to be upregulated in cancer cells .
they play a critical role in cell proliferation and aging , senescence and apoptosis [ 25 , 26 ] .
however , sequencing 93 early - onset mi patients across these genes did not reveal obvious causal functional variants or variants that could account for the correlation of rs10757278 to mi .
the linkage disequilibrium block also contains two exons of the transcript hypothetical methylthioadenosine phosphorylase fusion protein mrna , however the functional significance of the variants in this region remains to be elucidated .
mcpherson et al . also identified a 58-kilobase region on chromosome 9p21 that was consistently associated with cad in six independent samples consisted of 4306 cases and 20119 controls from four caucasian populations .
they identified two snps rs10757274 and rs2383206 on 9p21 that are significantly associated with incident of cad .
the risk allele was associated with and ~15 to 20% increase risk of cad in the 50% individuals who are heterozygous and ~30 to 40% increase in the 25% who are homozygous for the allele .
they further genotyped surrounding region of these snps in detail and found that eight additional snps at the locus spanning a 58-kb region were significantly associated with cad . again
however , the region overlaps a newly annotated noncoding rna called noncoding rna in the ink locus ( anril ) .
the whole blood rna expression levels of short variants of anril are increased and the expression levels of the long variant are decreased in subjects homozygous for the risk alleles .
there is also a positive correlation between transcript levels of the long variant of anril and cdkn2b .
the study using genetically engineered mice showed that the deletion of orthologous 70-kb non - coding interval on mouse chromosome 4 ( chr4mice ) highly reduced cardiac expression of two neighboring genes cdkn2a and cdkn2b .
primary culture of smooth muscle cells from chr4mice showed increased proliferation and diminished senescence , the features relevant to atherosclerosis .
these findings indicated the noncoding interval is involved in the disease process via gene - regulatory effects on cdkn2a and cdkn2b .
the wellcome trust case control consortium ( wtccc ) study which enrolled 1926 case subjects with cad and 2938 controls also reported the powerful association between the snps on chromosome 9p21 and cad .
the strongest signal was seen at rs1333049 , however the associations were seen for snps across > 100 kb .
then , they further looked for replication in the german mi family study which involved 875 mi cases and 1644 controls using the genechip human mapping 500k array set ( affymetrix ) .
the same locus on chromosome 9p21 ( rs1333049 ) had the strongest association with cad in both studies with the risk increased by 36% per copy of the c allele .
of the nine loci which were shown to be strongly associated with cad , two of these loci were able to replicate in the german mi study : chromosome 6q25.1 ( rs6922269 ) and chromosome 2q36.3 ( rs2943634 ) .
further , the combined analysis of the two studies revealed four additional loci significantly associated with cad : chromosome 1p13.3 ( rs599839 ) , 1q41 ( rs17465637 ) , 10q11.21 ( rs501120 ) and 15q22.33 ( rs17228212 ) . in 2009
, they performed another replication study with 11550 cases with cad and 11205 controls from 9 european studies .
other than the 9p21 locus , they confirmed significant association at 1p13.3 ( rs599839 ) , 1q41 ( rs3008621 ) and 10q11.21 ( rs501120 ) .
they were not able to show the significant association with 6q25.1 and 2q36.3 and there was no evidence for association with the locus at 15q22.33 .
the four loci ( 9p21 , 1p13.3 , 1q41 and 10q11.21 ) act independently and cumulatively increased the risk for cad by 15% per additional risk allele .
the genes located within or adjacent to the these four loci are listed in table 4 .
the locus at chromosome 1p13.3 has been shown to be associated with increased plasma ldl cholesterol , and thus may contribute to cad development [ 3437 ] .
the locus at 10q11.21 lies adjacent to the chemokine ( c - x - c motif ) ligand 12 gene ( cxcl12 ) which encodes stromal cell - derived factor-1 , a chemokine which plays a important role in stem - cell homing and regeneration of myocardial tissue in ischemic cardiomypopathy and in promoting angiogenesis by recruiting endothelial progenitor cells from the bone marrow .
the snps at 1q41 locates within the melanoma inhibitory activity family , member 3 ( mia3 ) gene .
underlying mechanism how these genetic loci affect the pathogenesis of cad need to be further investigated . the meta - analysis of aforementioned three studies [ 24 , 27 , 32 ] and 7 additional case - control studies successfully replicated the significant association between the risk allele ( c ) of the lead snp , rs1333049 at chromosome 9p21 and risk of cad ( or= 1.29 ) .
these study have analyzed primarily on european descent , however , since the allele frequency differs among the different ethnic groups , the risk of cad related to the snps at 9p21 may differ among each ethnic group . since then , the replicated results in other ethnics such as chinese , japanese and pakistanis are published and the association of the snps at 9p21 with cad seems to be consistent among various ethic groups [ 4245 ] . it is noteworthy that the snps in 9p21 region are also found to be associated with variety of diseases such as ischemic stroke ( or = 1.011.21 ) [ 46 , 47 ] , abdominal aortic aneurysm ( or = 1.31 ) , intracranial aneurysm ( or = 1.29 ) , peripheral artery disease ( or = 1.29 ) , incident heart failure ( or = 1.17 ) , perioperative myocardial injury after coronary artery bypass graft surgery , type 2 diabetes ( or = 1.20 ) [ 52 , 53 ] .
more recently , the loci other than 9p21 have been shown to be associated with cad or mi .
applied less stringent statistical thresholds on their gwas for cad to identify any dismissed snps with modest effects or low allele frequencies and they found one new locus on 3q22.3 in muscle ras oncogene homolog ( mras ) ( or = 1.15 ) , the gene thought to play an important role in inflammation [ 54 , 55 ] .
there is another gwas which identified the snps in the gene related to inflammation to be associated with mi .
they found five snps which affect eosinophil counts in blood in icelandic population and reported that a nonsynonymous snp at 12q24 in sh2b adaptor protein gene ( 3sh2b3 ) was associated with mi significantly ( or = 1.13 ) .
three of them were newly identified in the study : ( i ) an intergenic region between mrps6 ( mitochondrial ribosomal protein s6 ) , slc5a3 ( solute carrier family 5 ( sodium / myo - inositol cotransporter ) , member 3 ) and kcne2 ( potassium voltage - gated channel , isk - related family , member 2 ) on chromosome 21q22 ( or = 1.19 ) , 6p24 in phactr1 ( phosphatase and actin regulator 1 ) ( or = 1.13 ) and 2q33 in wdr12 ( wd repeat domain 12 ) ( or = 1.17 ) .
the mechanism by which genes at these three regions increases the risk of mi needs to be elucidated .
in addition to the common variant , copy number variations can be analyzed by snp chip and there were no common or rare copy number variations associated with risk of early - onset mi in this study .
the group from the wtccc / german mi study further conducted a genome - wide haplotype association study for the first time and identified the slc22a3-lpal2-lpa gene cluster on 6q26 - 27 as a strong susceptibility locus for cad ( or = 1.8 ) .
clarke et al . identified three chromosomal regions ( 6q26 - 27 , 9p21 and 1p13 ) were strongly associated with the risk of cad using the human cvd bead chip which included 48742 markers relevant to cardiovascular disease on 6500 subjects . among them , the lpa locus on 6q26 - 27 encoding lp(a ) lipoprotein had the strongest association .
they identified two lpa variants that were strongly associated with both an increased level of lp(a ) lipoprotein and an increased risk of cad ( or = 1.70 and 1.92 ) .
both variants were strongly associated with a reduced copy number in lpa kringle iv - type 2 repeats and an increased level of lp(a ) lipoprotein .
after adjustment for the lp(a ) lipoprotein level , the association between the lpa genotype score and the risk of cad was abolished .
initially , gwas have been primarily assessed only on european descent and the results of these gwas may not be applicable to other ethnics due to wide difference of distribution of snps and allele frequency .
further studies for various ethnicity need to be done with use of newer chips which contains 1 million snps to increase coverage .
the cad associated loci have been found in regions without known gene - encoding loci .
therefore , further studies will be required to elucidate the exact functional mechanism by which these loci modulate cad risk .
the odds ratios for cad risk in each selected snps are small ( around 1.2 ) and explain only a small proportion of the heritable , genetic component of susceptibility to the disease .
newer susceptibility loci for cad need to be validated with replication studies and in the future , we should evaluate the genetic risks by combining multiple independent common variants susceptible for cad .
the gwas method is supported by the common disease - common variant hypothesis , which predicts that genetic variants causing common disease exist frequently , but each variant only have a small effect on disease susceptibility .
the rare variant hypothesis postulates that common disease is caused by multiple rare variants which have a strong causative effect on disease and this hypothesis was confirmed in colorectal adenomas [ 63 , 64 ] .
rare variants can not be captured by gwas and requires whole genome sequencing using next generation sequencing system .
in addition , other types of variants , such as insertion - deletion variant , block substitution and inversion variant , so called structural variants may account for important contributors to the diseases and are also hard to detect by the chip - based method .
the snps data from the hapmap project and development of new chip technology enabled genotyping large amount of common variants simultaneously and contributed to efficiently identify gene loci affecting susceptibility to common diseases including cad .
the region at 9p21 was shown to be significantly associated with cad in 2007 and comprehensive replication across multiple studies provides unequivocal evidence that this locus is associated with cad in european descent .
this region is also associated with abdominal aneurysm , intracranial aneurysm and type 2 diabetes , and seems to be a very important region for various diseases .
since the odds ratios of the risk allele at 9p21 for cad are small , screening for this risk allele probably affects little , if any , to the each individual 's risk prediction .
using genomic tests to improve existing risk models would likely require combining the effects of multiple common genetic variants .
rare variants and structural variants which can not be captured by gwas need to be searched by whole genome sequencing .
gwas approach has identified novel and unbiased genetic contributors to cad and these insights provide the important direction to better understand the pathogenesis of cad and to develop new and improved preventive measures and treatments for cad . | coronary artery disease ( cad ) is a multifactorial disease with environmental and genetic determinants .
the genetic determinants of cad have previously been explored by the candidate gene approach .
recently , the data from the international hapmap project and the development of dense genotyping chips have enabled us to perform genome - wide association studies ( gwas ) on a large number of subjects without bias towards any particular candidate genes . in 2007 ,
three chip - based gwas simultaneously revealed the significant association between common variants on chromosome 9p21 and cad .
this association was replicated among other ethnic groups and also in a meta - analysis .
further investigations have detected several other candidate loci associated with cad .
the chip - based gwas approach has identified novel and unbiased genetic determinants of cad and these insights provide the important direction to better understand the pathogenesis of cad and to develop new and improved preventive measures and treatments for cad . |
vitamins are essential for nutrition and physiological function , and therefore , their intake is necessary for humans and animals , as the body is unable to synthesize these essential nutrients required for growth .
vitamins can be classified into water - soluble and fat - soluble vitamins ; the former includes niacin , nicotinamide , vitamin b6 , vitamin b2 , vitamin b1 , folic acid , pantothenic acid , and vitamin c , while the latter includes vitamin a , vitamin d , vitamin e , and vitamin k .
vitamins have specific and important functions , and as such , both humans and animals require vitamins to achieve and maintain health and productivity .
vitamins function to control various endogenous metabolic activities taking place in the body , such as energy and amino acid metabolism .
although only small amounts of vitamins are required , vitamin deficiency ( or indeed , excess ) can lead to diseases such as beriberi and dermatitis [ 2 , 6 , 7 ] .
thus , to prevent a vitamin deficiency or excess in animals , as well as to attain maximum performance , the control of feed additives is necessary .
indeed , vitamins are essential for maintaining normal metabolic processes in animals , while also retaining their condition and performance . as
animals are unable to synthesize vitamins , the small amounts of these nutrients required must be supplied in their feed .
various methods have been reported for the characterization of water - soluble vitamins , such as high performance liquid chromatography ( hplc ) coupled with ultraviolet ( uv ) detection [ 10 , 11 ] , liquid chromatography ( lc ) coupled with mass spectrometry ( ms ) , lc coupled with ms / ms , and gas chromatography .
the most commonly used methods for the determination of vitamin components are based on hplc separation . lc - ms and lc - ms / ms , which provide information about the molecular mass and structural features of components , are considered more useful than other methods for the separation , identification , and quantification of the characteristic vitamin compounds . however , since these methods are expensive to purchase and maintain , many laboratories prefer hplc - uv detection , which is less costly , relatively convenient to operate , and suitable for the routine analysis of vitamins .
ion - paring reagent we used in this study has amine group , so it is suitable for water - soluble vitamins analysis as well as iodine speciation analysis and pesticide residue analysis [ 1618 ] . in this study , six water - soluble vitamins in animal feed ( nicotinic acid ( niacin ) , nicotinamide , folic acid , riboflavin , pyridoxine ( vitamin b6 ) , and thiamine ( vitamin b1 ) )
complete animal feeds have complex matrixes containing fat , protein , carbohydrate , salt , and so on .
water - soluble vitamins we targeted have amine functional group which represents polarity . to increase the selectivity of the water - soluble vitamins in complicated matrixes ,
in addition , simultaneous analytical method for the determination of 6 water - soluble vitamins has been rarely reported . moreover ,
therefore , this newly developed simultaneous method should be validated in various feed matrixes . a novel analytic method
is therefore reported , which is suitable for detecting and quantifying the vitamins present in animal feed , while also aiding in the management of feed standards .
a total of 30 animal feed samples were used , and 20 dried samples were pulverized into fine powders ( hmf-100 , hanil electric co. , seoul , korea ) .
the pulverizer was set at a maximum speed of 22,000 rpm to give fine powders ranging in size from 400 to 1000 m .
hplc grade acetonitrile , methanol , and acetic acid were purchased from merck ( darmstadt , germany ) , and picb-6 ( pic , paired - ion chromatography ; b , separate bases ) was purchased from waters ( st . milford , ma , usa ) .
water was purified using a milli - q rios/elix water purification system ( millipore , bedford , ma , usa ) .
nicotinic acid ( niacin ) , nicotinamide , pyridoxine ( vitamin b6 ) , riboflavin , thiamine ( vitamin b1 ) , and folic acid standards were purchased from sigma aldrich chemie gmbh ( bellefonte , pa , usa ) .
the six vitamins were classified into three groups , groups 1 , 2 , and 3 , and stock solutions were prepared using the preprocessing reagent , water , and 0.01 n naoh to obtain a final vitamin concentration of 100
group 1 consisted of thiamine and pyridoxine , and the stock solutions were prepared by mixing the standard preparation with water ( 100 ml ) .
group 2 consisted of riboflavin and folic acid and was prepared by mixing the standard preparation ( 10 mg ) , 0.01 n naoh , and water ( 100 ml ) .
group 3 consisted of nicotinic acid and nicotinamide and was prepared by mixing the standard preparation ( 10 mg ) with the preprocessing reagent ( 100 ml ) .
working solutions were prepared by diluting the stock solutions , and all solutions were refrigerated .
the samples were prepared for extraction by the ion - pairing reagent . each homogenized sample from animal feed ( 1.5 g )
was placed into a centrifuge tube and mixed with the extraction solvent ( 10 ml , 5 mm picb-6 in 0.1% ch3cooh ) .
a portion of the liquefied sample ( 10 g ) was added to a 25 ml volumetric flask , and the volume was made up to 25 ml using the extraction solvent ( 5 mm picb-6 in 0.1% ch3cooh ) .
we used picb-6 as ion - pairing reagent because most of vitamins we determined showed higher resolution when we used picb-6 than other ion - pairing reagents .
the mixtures were then homogenized for 10 min , sonicated for 10 min at room temperature , and centrifuged at 13,000 rpm for 10 min at 4c .
the resulting supernatant was filtered through a 0.45 m disposable filter ( whatman ) .
finally , the stabilities of the standard preparations were determined over one week in an amber vial at room temperature , with samples being taken for analysis every 24 h. hplc was performed on a shiseido nanospace si-2 system ( shiseido , tokyo , japan ) equipped with a binary solvent delivery pump , an autosampler , and a photodiode array detector ( pda ) and was controlled using the ezchrome elite software ( agilent technologies , palo alto , ca , usa ) . a reversed phase unison uk - c18 ( 100 m 4.6 mm , 3 m particle size ) ( tokyo , japan ) column was used for all separations at a column temperature of 40c .
prior to use , the mobile phase was filtered through a 0.45 m membrane filter ( millipore , milford , ma , usa ) and degassed under vacuum .
the mobile phase was composed of buffers a ( 5 mm picb-6 in 0.1% ch3cooh ) and b ( 5 mm picb-6 in 65% methanol ) with the following gradient elution : 0 min , 10% b ; 02 min , 10% b ; 222 min , 70% b ; 2227 min , 70% b ; 27 - 28 min , 10% b ; and 2835 min , 10% b. the sample injection volume was 2 l , and the flow rate was set at 0.5 ml / min .
method validation was performed according to the guidelines set by the international conference on harmonization ( ich , 2005 ) and the international union of pure and applied chemistry ( iupac , 2002 ) .
the method was validated for linearity , sensitivity , selectivity , accuracy , and precision , as outlined in figure 2 and table 1 .
the developed rp - hplc / uv method incorporating an ion - pairing reagent was validated to verify that its performance met the requirements for routine vitamin analysis .
several performance characteristics were measured , including selectivity , linearity , sensitivity , accuracy , and precision .
selectivity was determined by the absence of interference in the chromatographic window , and this was measured using blank chromatograms at the specific quantification wavelength ( i.e. , 270 nm ) . as shown in figure 2 and table 1 , the chromatograms of the water - soluble vitamins indicate successful separation of all six compounds in < 29 min , with good resolution ( 5.5534.85 ) and asymmetry ( 0.941.08 ) , thereby indicating satisfactory selectivity for this hplc system .
linearity was assessed by building external calibration curves for each compound using the vitamin - containing working solutions .
calibration curves were obtained by plotting the analyte peak area versus its concentration over seven different concentrations .
each concentration of the mixed standard solution was injected in triplicate , and then , the regression parameters were calculated .
the sensitivity of the developed method was evaluated by determining the lod and loq values . under the described chromatographic conditions , these values were calculated based on the response and slope of each regression equation at signal - to - noise ratios ( s / n ) of 3 : 1 and 10 : 1 , respectively . for the different components , the lod values ranged from 25 to 197 g / kg , while the loq values ranged from 84 to 658 g / kg .
the method precision was then determined by measuring the intra- and interday precision . for the intraday precision , six replicates of the mixed standard solutions
were analyzed within 1 d , while the solutions were examined in triplicate for three consecutive days for the intraday precision .
the precision was expressed as the percentage of the relative standard deviation ( % rsd ) .
the overall intraday % rsd values were < 5.6% , while the interday values were < 4.8% ( see table 1 ) .
the accuracy was evaluated by adding the mixed standard solutions at two different concentrations ( high : 20.0 mg / kg ; low : 2.0 mg / kg ) to feed from the association of american feed control official ( affco , 201591-swine mineral and vitamin supplement ) .
the mixture was extracted using the developed ion - pairing reagent technique and hplc method .
excellent recovery rates of 82.398.9% indicated a high level of accuracy for this method , as detailed in table 1 .
the stability of all standard solutions was also tested over 7 d , with the majority having decomposed within 3 d. in particular , in the case of folic acid , rapid decomposition was observed after 3 d compared to that of the other water - soluble vitamins ( i.e. , 63.38% cf .
these results demonstrated that it is necessary to prepare a fresh standard preparation for each analysis .
based on the above validation data , the proposed method was concluded to provide good linearity , sensitivity , selectivity , accuracy , and precision for the simultaneous analysis of water - soluble vitamins . among the 30 different animal feeds that were analyzed in this study , vitamins were detected in all animal feeds purchased from supermarkets ( table 3 ) .
identification of the six compounds was by comparison of their retention times and uv spectra with those of the standards and the pure compounds .
the qualitative and quantitative compositions of the six compounds in the animal feed varied significantly .
more specifically , the nicotinic acid content ranged from 1,868 to 46,289 mg / kg with an average content of 15,969 mg / kg , while the nicotinamide content ranged from 1,339 to 49,920 mg / kg with an average of 16,257 mg / kg . in addition , the content of folic acid varied between 102 and 5,012 mg / kg ( average = 813 mg / kg ) , while that of pyridoxine was between 2,065 and 49,530 mg / kg ( average = 17,758 mg / kg ) .
finally , the riboflavin and thiamine contents ranged from 3,015 to 36,820 mg / kg ( average = 13,286 mg / kg ) and from 1,359 to 48,930 mg / kg ( average = 11,786 mg / kg ) , respectively .
thus , a simple , qualitative , and quantitative method for the simultaneous detection and quantification of six vitamin compounds from animal feed was successfully developed and validated using rp - hplc / uv detection .
the proposed method showed accuracy and precision and was successfully employed for analyzing different types of feeds .
analytical results demonstrated that this hplc method provides a good alternative for routine analysis , owing to its simplicity , specificity , and sensitivity .
finally , it exhibits the potential to be applied as a reliable quality evaluation method for animal feed . | a novel and simple method for detecting six water - soluble vitamins in animal feed using high performance liquid chromatography equipped with a photodiode array detector ( hplc / pda ) and ion - pairing reagent was developed .
the chromatographic peaks of the six water - soluble vitamins were successfully identified by comparing their retention times and uv spectra with reference standards .
the mobile phase was composed of buffers a ( 5 mm picb-6 in 0.1% ch3cooh ) and b ( 5 mm picb-6 in 65% methanol ) .
all peaks were detected using a wavelength of 270 nm .
method validation was performed in terms of linearity , sensitivity , selectivity , accuracy , and precision .
the limits of detection ( lods ) for the instrument employed in these experiments ranged from 25 to 197 g / kg , and the limits of quantification ( loqs ) ranged from 84 to 658 g / kg .
average recoveries of the six water - soluble vitamins ranged from 82.3% to 98.9% .
method replication resulted in intraday and interday peak area variation of < 5.6% .
the developed method was specific and reliable and is therefore suitable for the routine analysis of water - soluble vitamins in animal feed . |
acute acalculous cholecystitis ( aac ) is a well - recognized but still poorly understood entity .
it is well - known to occur in very sick patients already admitted in intensive care unit ( icu ) , e.g. , after major trauma , burns , sepsis , major non - biliary surgery and after parenteral feeding , with high incidence of complications such as perforation and high mortality .
other factors such as prolonged hyperalimentation , prolonged suctioning by nasogastric tube , positive pressure ventilatory support , numerous transfusions , use of vasoactive amines and use of morphine analgesia also have been implicated .
the condition most likely results from a gradual increase in bile viscosity , due to prolonged stasis , that leads to a functional obstruction of the cystic duct .
aac , if not managed effectively , tends to have a more fulminant course , frequently associated with gangrene , perforation , and empyema .
unfortunately , both clinical and laboratory tests lack sensitivity and specificity for arriving at a diagnosis .
after aac is clinically suspected , the next step is to diagnose and evaluate it .
a hepatobiliary iminodiaceticacid ( hida ) scan is advised by the rome ii consensus group to be the next step in patient evaluation .
the aim of our study was to determine the role of cholescintigraphy in management of patients diagnosed to have acalculous cholecystitis on usg abdomen .
patients presenting to the out - patient department ( opd ) or referred from in - patient department or icu during the period between february 2008 and february 2010 were considered.patients with complaints of flatulent dyspepsia , vomiting , fever , upper abdominal pain and showing possibility of cholecystitis.usg abdomen findings suggestive of acalculous cholecystitis this added up to a total of 32 patients .
patients presenting to the out - patient department ( opd ) or referred from in - patient department or icu during the period between february 2008 and february 2010 were considered .
patients with complaints of flatulent dyspepsia , vomiting , fever , upper abdominal pain and showing possibility of cholecystitis .
usg abdomen findings suggestive of acalculous cholecystitis this added up to a total of 32 patients .
the criteria for labeling cholecystitis on usg abdomen were as per previous reports and studies .
these were : gall bladder wall thickness > 4 mm in absence of ascites or hypoalbuminemia.pericholecystic fluid collection.sonographic murphy 's sign.gall bladder oedema with sonographic murphy 's sign and no underlying pathology such as ascites or hypoalbuminemia .
gall bladder oedema with sonographic murphy 's sign and no underlying pathology such as ascites or hypoalbuminemia .
patients were advised nil per orally for 4 hours ( h ) prior to the study .
patients fasting for more than 12 h were fed with a standardized meal and were on fast for 4 - 5 h and then taken up for the study . there was a strict adherence to these criteria .
this is because a recently ingested meal stimulates endogenous cholecystokinin production , which continues until the food has emptied from the upper small bowel .
the rising serum cholecystokinin ( cck ) level causes gall bladder contraction , prevents radiotracer entry and may result in a false positive study for acute cholecystitis . on the other hand ,
fasting for long hours , causes collection of viscous bile and sludge in the gall bladder ( gb ) , thus preventing radiotracer entry and causing false positive results .
technetium-99m(tc-99 m ) mebrofenin was administered intravenously ( a dose of 5 mci of tc-99 m mebrofenin was administered in patients with s. bilirubin < 2 mg / dl and increased up to 10 mci in patients with s. bilirubin > 10 mg / dl ) .
the study was performed on multispect dual head gamma camera ( siemens , germany ) .
serial static isotime * * images of the abdomen were acquired in anterior view , at different time intervals with the patient in supine position , up to delayed 4 h images , if the gall bladder was not visualized . in cases
where gall bladder was visualized , pre- and post - fatty meal images were also acquired .
fatty meal was formulated as humana fatty meal formula , 240 ml containing 20 g fats and 415 kcal .
standardization of this fatty meal with gbef was done based on readings from ten normal volunteers .
( * * it was difficult to acquire dynamic 1 - 1.5 h. images for patients referred from the icu .
studies were analyzed for hepatic uptake and excretion of tracer in to the biliary system , time to visualization of activity in small - bowel , time of visualization of gall bladder .
endogenous cck secreted by the duodenal mucosa in response to fatty meal stimulus peaks during 20 - 30 min .
the cck levels remain elevated until the meal has passed through the upper small - bowel and promptly return to baseline due to its rapid metabolism ( 2.5 min serum half - life ) .
gall bladder contraction is initiated when the serum cck reaches a threshold that is considerably lower than the peak cck .
simultaneously , cck relaxes sphincter of oddi , allowing bile to empty in to small - bowel .
hence , in patients where in the gall bladder was visualized , gall bladder ejection fraction ( gbef ) 30 min post fatty meal was calculated .
gbef was calculated by the following formula : scintigraphic criteria for interpretation as acalculous cholecystitis non - visualization of gall bladderif gall bladder was visualized , gbef < 40% non - visualization of gall bladder if gall bladder was visualized , gbef < 40% the following patients were taken up for surgery : patients who showed hepatic uptake and excretion of radiopharmaceutical through the common bile duct , however , without visualization of gall bladder until the delayed 4 h image.patient with gbef < 40% , if they gave an informed consent for surgery .
patients who showed hepatic uptake and excretion of radiopharmaceutical through the common bile duct , however , without visualization of gall bladder until the delayed 4 h image .
patient with gbef > 40% and those with gbef < 40% but did not consent for surgery , were taken in to the conservative management arm .
patients were followed - up in the opd for 3 months post - commencement of treatment ( medical / surgical ) .
they were assessed for the presence of symptoms , and if so , whether there was an improvement or worsening of symptoms .
in addition , post - operative patients were assessed for surgery related symptoms / complications and wound healing . in patients with either non - visualized gallbladder or gbef < 40% , the odds ratio for the different modes of management was calculated .
patients presenting to the out - patient department ( opd ) or referred from in - patient department or icu during the period between february 2008 and february 2010 were considered.patients with complaints of flatulent dyspepsia , vomiting , fever , upper abdominal pain and showing possibility of cholecystitis.usg abdomen findings suggestive of acalculous cholecystitis this added up to a total of 32 patients .
patients presenting to the out - patient department ( opd ) or referred from in - patient department or icu during the period between february 2008 and february 2010 were considered .
patients with complaints of flatulent dyspepsia , vomiting , fever , upper abdominal pain and showing possibility of cholecystitis .
usg abdomen findings suggestive of acalculous cholecystitis this added up to a total of 32 patients .
the criteria for labeling cholecystitis on usg abdomen were as per previous reports and studies .
these were : gall bladder wall thickness > 4 mm in absence of ascites or hypoalbuminemia.pericholecystic fluid collection.sonographic murphy 's sign.gall bladder oedema with sonographic murphy 's sign and no underlying pathology such as ascites or hypoalbuminemia .
gall bladder oedema with sonographic murphy 's sign and no underlying pathology such as ascites or hypoalbuminemia .
patients were advised nil per orally for 4 hours ( h ) prior to the study .
patients fasting for more than 12 h were fed with a standardized meal and were on fast for 4 - 5 h and then taken up for the study .
this is because a recently ingested meal stimulates endogenous cholecystokinin production , which continues until the food has emptied from the upper small bowel .
the rising serum cholecystokinin ( cck ) level causes gall bladder contraction , prevents radiotracer entry and may result in a false positive study for acute cholecystitis . on the other hand ,
fasting for long hours , causes collection of viscous bile and sludge in the gall bladder ( gb ) , thus preventing radiotracer entry and causing false positive results .
technetium-99m(tc-99 m ) mebrofenin was administered intravenously ( a dose of 5 mci of tc-99 m mebrofenin was administered in patients with s. bilirubin < 2 mg / dl and increased up to 10 mci in patients with s. bilirubin > 10 mg / dl ) .
the study was performed on multispect dual head gamma camera ( siemens , germany ) .
serial static isotime * * images of the abdomen were acquired in anterior view , at different time intervals with the patient in supine position , up to delayed 4 h images , if the gall bladder was not visualized . in cases
where gall bladder was visualized , pre- and post - fatty meal images were also acquired .
fatty meal was formulated as humana fatty meal formula , 240 ml containing 20 g fats and 415 kcal .
standardization of this fatty meal with gbef was done based on readings from ten normal volunteers .
( * * it was difficult to acquire dynamic 1 - 1.5 h. images for patients referred from the icu .
studies were analyzed for hepatic uptake and excretion of tracer in to the biliary system , time to visualization of activity in small - bowel , time of visualization of gall bladder .
endogenous cck secreted by the duodenal mucosa in response to fatty meal stimulus peaks during 20 - 30 min .
the cck levels remain elevated until the meal has passed through the upper small - bowel and promptly return to baseline due to its rapid metabolism ( 2.5 min serum half - life ) .
gall bladder contraction is initiated when the serum cck reaches a threshold that is considerably lower than the peak cck .
simultaneously , cck relaxes sphincter of oddi , allowing bile to empty in to small - bowel .
hence , in patients where in the gall bladder was visualized , gall bladder ejection fraction ( gbef ) 30 min post fatty meal was calculated .
gbef was calculated by the following formula : scintigraphic criteria for interpretation as acalculous cholecystitis non - visualization of gall bladderif gall bladder was visualized , gbef < 40% non - visualization of gall bladder if gall bladder was visualized , gbef < 40%
the following patients were taken up for surgery : patients who showed hepatic uptake and excretion of radiopharmaceutical through the common bile duct , however , without visualization of gall bladder until the delayed 4 h image.patient with gbef < 40% , if they gave an informed consent for surgery . patients who showed hepatic uptake and excretion of radiopharmaceutical through the common bile duct , however , without visualization of gall bladder until the delayed 4 h image .
patient with gbef > 40% and those with gbef < 40% but did not consent for surgery , were taken in to the conservative management arm .
patients were followed - up in the opd for 3 months post - commencement of treatment ( medical / surgical ) .
they were assessed for the presence of symptoms , and if so , whether there was an improvement or worsening of symptoms .
in addition , post - operative patients were assessed for surgery related symptoms / complications and wound healing .
in patients with either non - visualized gallbladder or gbef < 40% , the odds ratio for the different modes of management was calculated .
the findings of cholescintigraphy [ figure 1 ] were as follows:(i)non - visualization of gb [ figure 2 ] 7 ( 21.87%).(ii)gbef < 40% [ figure 3 ] 4 ( 12.5%).(iii)gbef > 40% [ figure 4] 20 ( 62.5%).(iv)rim sign 6 ( 18.75%).(v)duodenogastric reflux 4 ( 12.5%).of the patients suspected to have cholecystitis clinically , 32 patients had usg abdomen findings suggestive of acalculous cholecystitis.twenty six of the 32 patients had positive sonographic murphy 's sign . out of these 26 , 10 were having ef < 40% or non - visualization of gall bladder.all patients who had pericholecystic fluid collection were having non - visualization of gall bladder on cholescintigraphy .
one of these patients had finding of gangrenous gall bladder per operatively [ figure 5].gbef of < 40% or non - visualization of gall bladder were considered as indicators of better post - operative outcome as suggested by many investigators.surgical option was given to patients falling in these two categories .
however , as some of these patients denied surgery , they were shifted to control arm and managed conservatively . of the 11 patients in this category
, six underwent cholecystectomy [ figure 6 ] and 5 were medically managed as per patient 's decision .
these patients were followed for 3 months and evaluated for symptom relief . of the surgically treated patients ,
however , 83.33% of the surgically treated group showed improvement as against 40% of the medically treated group [ figure 7 , 8].twenty - one patients had gbef > 40% and were managed medically and followed - up . of the medically managed patients , 19 patients
hence , in this group , the percentage of patients having symptomatic improvement was 90.47% [ figure 2].the odds ratio was found to be 7.4 with a confidence interval of 0.46 - 122.70 .
the findings of cholescintigraphy [ figure 1 ] were as follows : ( i)non - visualization of gb [ figure 2 ] 7 ( 21.87%).(ii)gbef < 40% [ figure 3 ] 4 ( 12.5%).(iii)gbef > 40% [ figure 4] 20 ( 62.5%).(iv)rim sign 6 ( 18.75%).(v)duodenogastric reflux 4 ( 12.5% ) .
non - visualization of gb [ figure 2 ] 7 ( 21.87% ) . gbef < 40% [ figure 3 ] 4 ( 12.5% ) .
suspected to have cholecystitis clinically , 32 patients had usg abdomen findings suggestive of acalculous cholecystitis .
out of these 26 , 10 were having ef < 40% or non - visualization of gall bladder .
all patients who had pericholecystic fluid collection were having non - visualization of gall bladder on cholescintigraphy .
one of these patients had finding of gangrenous gall bladder per operatively [ figure 5 ] .
gbef of < 40% or non - visualization of gall bladder were considered as indicators of better post - operative outcome as suggested by many investigators .
however , as some of these patients denied surgery , they were shifted to control arm and managed conservatively . of the 11 patients in this category
, six underwent cholecystectomy [ figure 6 ] and 5 were medically managed as per patient 's decision .
these patients were followed for 3 months and evaluated for symptom relief . of the surgically treated patients ,
however , 83.33% of the surgically treated group showed improvement as against 40% of the medically treated group [ figure 7 , 8 ] .
twenty - one patients had gbef > 40% and were managed medically and followed - up . of the medically managed patients , 19 patients
hence , in this group , the percentage of patients having symptomatic improvement was 90.47% [ figure 2 ] .
the odds ratio was found to be 7.4 with a confidence interval of 0.46 - 122.70 .
findings of cholescintigraphy in various patients image of cholescintigraphy in patient with non - visualization of gallbladder image of cholescintigraphy in patient with gall bladder ejection fraction < 40% image of cholescintigraphy in patient with gall bladder ejection fraction > 40% gangrenous gall bladder intraoperative photograph in patient with non - visualization of gall bladder on cholescintigraphy specimen of empyematous gall bladder in patient with gall bladder ejection fraction < 40% on cholescintigraphy comparison of groups according to ejection fraction and management , on follow - up comparison of various treatment groups according to gall bladder ejection fraction in terms of symptomatic improvement on follow - up comparison of treatment groups in patients with gall bladder ejection fraction < 40%
imaging studies have played an incremental role in the diagnosis and management of acute cholecystitis .
overall sensitivity and specificity for hepatobilliary scintigraphy in the diagnosis of acute cholecystitis are 95 - 100% and 81 - 100% respectively , whereas the sensitivity and specificity of sonography is reported as 67 - 93% and 82 - 100% , respectively .
the role of imaging studies in establishing the diagnosis and management of aac is less established . a 7 years review at yale university by savoca et al .
showed an increasing prevalence of aac in out - patients with 77% patients developing aac while at home and 23% while hospitalized .
our study showed 21 patients presenting to out - patients department with aac which is 65.62% . in - patients consisted 34.38% , out of which
some investigators have developed the ultrasonographic scoring system to improve the accuracy in detecting aac in critically - ill .
two points are given for distention of the gallbladder or thickening of the gallbladder wall , and one point each is given for striated thickening of the gallbladder wall , sludge , or pericholecystic fluid .
the overall sensitivity of ultrasonography for detecting aac has been reported to range from 67% to 92% , with specificity for more than 90% .
a cholescintigraphy scan has been advised by the rome ii consensus group to be the next step in patient evaluation .
a cholescintigraphy scan can be done using cck infusion or fatty meal provocation if proper attention to meals and measurement sequence has been given .
we used fatty meal provocation method as it is more cost - effective , more physiological and easily available .
on the other hand , use of sincalide ( synthetic c - terminal octapeptide of cck ) is quicker , reliable and reproducible .
group criteria , assessment of gall bladder emptying by cholescintigraphy is a decision making tool in the diagnosis of functional gall bladder disorders .
they have suggested a limit of gbef > 40% to call it as normally functioning gallbladder . on the other hand
, they also suggested that in presence of normal sonography findings and liver function tests ( lft)/pancreatic enzyme levels and a reduced gbef , cholecystectomy is recommended .
there are three meta - analyses on the issue of predictive value of cholescintigraphy in symptomatic aac patients .
yap et al . studied only symptomatic patients with abnormal and normal cholescintigraphy results who underwent surgery . while study by ponsky et al . and
mahid et al . examined outcomes of patients with abnormal cholescintigraphy results who were medically treated compared with those who underwent surgery .
these meta - analyses concluded that cholecystectomy is indicated in symptomatic patients with low ejection fraction on cholescintigraphy , however , without gallstones .
our results were comparable to the odds ratio with confidence interval of the work done by mishkind et al .
the percentage of patients having symptom relief after cholecystectomy , obtained in our study , is comparable to the results obtained in previous studies [ table 3 ] .
patients with gbef > 40% who were managed medically were followed up after 3 months and revealed a symptom relief rate of 90.47% which is also comparable with previous studies .
a small sample size was one of the limitations of the study . a larger number of patients need to be studied in order to draw statistically significant conclusions . also randomization of patients would have given more reliable results and conclusions .
cholescintigraphy is a functional study that defines the underlying pathophysiology of the disease and the value of gbef directly correlates with gall bladder motility . | aim : this study is aimed to evaluate the role of cholescintigraphy in management of acute acalculous cholecystitis.materials and methods : a total of thirty two patients who had presented to the surgical out - patient department or referred from in - patient department or intensive care unit between february 2008 and february 2010 were studied .
all patients with ultrasonography abdomen findings of acalculous cholecystitis were included in the study and they underwent cholescintigraphy . gall bladder ejection fraction ( gbef ) was calculated 30 min after fatty meal .
patients who either had non - visualization of gall bladder or gbef less than 40% were considered to have acalculous cholecystitis on cholescintigraphy .
the patients were followed - up for a period of 3 months after the commencement of treatment.results:eleven patients had either non - visualization of gall bladder or gbef < 40% . of these , six patients underwent cholecystectomy and the rest were medically managed , as patients deferred surgery .
83.33% of post - cholecystectomy patients as against 40% of medically treated patients were symptom free .
twenty one patients had gbef > 40% , 90.74% of these patients were symptom free at the end of 3 months , with medical management.conclusion:cholescintigraphy is an important adjunct in management of patients with acalculous cholecystitis by guiding the course of therapy - surgical management versus medical management . |
the infection by this protozoan is called amoebiasis ; a primary intestinal infection which may be complicated by extra - intestinal infection ( 1 ) .
this protozoan organism is the third leading parasitic cause of death in the developing world and is an important health risk to travelers in endemic areas ( 2 ) .
amoebic liver abscess ( ala ) is the commonest extra - intestinal manifestations of amoebiasis .
the incidence of ala has been reported to vary between 3% and 9% of all cases of amoebiasis and usually occurs in the right lobe of liver and is solitary ( 3070% ) ( 1 ) .
a 35-year old female presented by fever and dyspnea . on detailed history taking she gave no history of any chronic medical disease .
the condition started one month ago by gradual onset , progressive course of dull aching right hypochondrial pain that was continuous , referred to the right shoulder and to the back .
it was associated with continous fever , more at night and subsided by the use of antipyretics .
there was anorexia , vomiting , dyspepsia to fatty meals , altered bowel habits in the form of ( constipation alternating with diarrhea ) with no dysentery or tenesmus .
she sought medical advice one week later in a primary health care unit and was diagnosed as acute cholecystitis and she was prescribed ciprofloxacin 500 mg / twice daily , paracetamol and i.v .
ten days ago the patient developed dyspnea on exertion associated with orthopnea with no paroxismal nocturnal dyspnea , no lower limb edema , associated also with right sided dull aching chest pain increased by respiration , relieved by holding breath with cough and expectoration of whitish sputum .
few days later with progressive increase in her body temperature , cough and progressive dyspnea she presented to our outpatient clinic . on examination she looked ill and toxic with temperature 39.4 c , blood pressure 110/70 , pulse 86/minute and was regular , abdominal and lower chest tenderness that hindered local abdominal palpation , and diminished air entry over the right lung and stony dull percussion note .
her laboratory investigations were hemoglobin 8.7 gm / dl , white blood cells 16 600/ mm ( mainly neutrophils ) , total bilirubin 0.4 mg / dl , total serum proteins 7.2 gm / dl , creatinine 0.9 mg / dl , alt 35 iu / l , ast 41 iu / l , serum albumin 2.9 gm / dl , esr 102/120 , inr 1.17 , chest x ray showed homogenous opacity obliterating the right zone ( fig 1 ) .
abdominal ct ( fig 3 ) showed cystic mass in right lobe of the liver .
pleural fluid aspiration showed total leucocyte count of 180580 cell/ mm ( mainly neutrophils ) , ldh 10981 iu / l , protein 2.2 gm / dl .
the fluid in the abscess cavity was aspirated under us guidance and was chocolate colored anchovy sauce and subjected to culture & sensitivity which showed no bacterial growth , while the diagnosis of an amoebic abscess was made by identification of e. histolytica trophozoites .
the case was then treated by hydroxychloroquine 250 mg two tablets twice daily for 2 days then once daily for 21 days .
drip twice daily for one week then orally 500 mg three times daily for another two weeks .
intravenous third generation cephalosporin cefotaixme in a dose of 1 gm / twice daily for two weeks was given plus other supportive therapies including antipyretics and i.v . fluids .
the empyema was treated by fixation of an intercostal tube with good response ( fig 4 ) , while the liver abscess was drained through fixation of a pig - tail catheter with daily wash and aspiration . on discharge
abdominal ultrasonography showed collapsed abscess cavity and the pig - tail catheter was removed and also good lung inflation and intercostal tube extraction was done .
entamoeba histolytica protozoan is a cosmopolitan infection that is frequent in tropical and subtropical areas including egypt .
various factors such as poor hygiene , diabetes , steroid overuse , immunosuppressants have been known to complicated amoebiasis and predispose to the development of ala ( 3 ) .
development of ala in this case per se is not surprising because she lives in a subtropical community where this infection is frequent and she is a farmer vulnerable to faeco - oral contamination .
ala occurs most commonly in the age group of 2045 years and has been noted infrequently in the extremes of ages ( 4 ) , our case is a middle age and her framer job would expose her to the risk of infection .
cysts are infective and are ingested through contaminated water or soil , and once reaching the alkaline medium of the small intestine , releases immature trophozoites .
liver abscesses have been attributed to invasion of the portal venous system by the amoebae . when the amoebic infection reaches the liver parenchyma , microscopic sites of thrombosis , cytolysis , and liquefaction develop , causing hepatic necrosis .
this material often contains mobile trophozoites , which can be demonstrated on a warmed microscope stage ( diagnosis of our case was achieved by detection of this trophozoite on microscopic examination ) .
the reddish brown color of the abscess content is due to the digestion of liver tissue and red blood cells .
the frequent location in the right lobe is most likely due to its larger volume .
further , it receives a major part of the venous drainage from the cecum and ascending colon , the portions of bowel most frequently affected by amoebiasis ( 5 ) .
liver abscess can be presented by a variety of manifestations that may mimic abdominal and systemic diseases ( 4 , 5 ) .
this was occurred in our case , she was initially diagnosed as acute cholecystitis . at this moment the patient was not investigated by abdominal ultrasonography , a simple and bedside effective diagnostic modality , an investigation that if performed early would prevent further complications of liver abscess particularly ruptures .
amoebiasis is a treatable disease but delay in the diagnosis may predispose the patient to serious complications and even death ( 3 ) and that was reinforced by this case , she was presented more than two weeks after her initial complaint and the lack of diagnostic facilities in the primary health care contributed to this delay in diagnosis and development of the complication empyema .
perforation sites mostly include pleuropulmonary structures ( 72% ) , the subphrenic space ( 14% ) and the peritoneal cavity ( 10% ) ( 6 ) .
our case was complicated by right side empyema because her liver abscess was not only huge but also lies in the right lobe near the dome of the liver .
the incidence of secondary involvement of the adjoining organs and other complications is higher in cases involving the left lobe rather than the right ( 4 ) , but the huge size of the abscess and its proximity to the surface would explain the sequale of perforation into the right hemithorax .
the mortality in ruptured ala is higher than non - ruptured ala , while the hospital stay also prolonged for ruptured cases ( 3 , 6 ) .
our case had hospital stay of 24 days and she was delivered in a good condition , we assume this success to the rapid intervention to both the empyema by the intercostal tube insertion and drainage of the liver abscess , also the use of anti - amoebic medications and antibiotics .
the patient was also some what lucky because her huge abscess was not ruptured inside the abdominal cavity a complication if occurred would not only complicate the management plan but also potentially threatens her survival .
amoebic liver abscess is a complication of amoebiasis that needs early diagnosis and proper treatment before further complications occur . | amoebic liver abscess is a complication of amoebiasis that needs early diagnosis and proper treatment before further complications occur .
we report a-35 year old female presented by fever and dyspnea due to huge liver abscess complicated by massive right side empyema .
the patient was effectively treated by percutaneous drainage for both the right lobe abscess and empyema together with pharmacologic agents . |
huntington s disease ( hd ) is a devastating inherited neurodegenerative disease caused by an expansion of the cag repeat region in exon 1 of the huntingtin gene .
although huntingtin is expressed throughout the body , the polyglutamine expanded protein is especially toxic to medium spiny neurons in the striatum and their cortical connections .
patients struggle with emotional symptoms , including depression and anxiety , and with characteristic movement disturbances and chorea . whereas the mutant protein exerts its toxic effects through myriad cellular pathways , elimination of huntingtin in the striatum has the potential to improve the lives of patients by treating some of the severe effects of the disease .
our goal is to reduce huntingtin in the brain using an artificial microrna ( mirna ) targeting human huntingtin mrna , which can be delivered using a recombinant adeno - associated virus ( aav ) vector and which will be safe and effective for long - term use .
rnai - based therapy depends on successful delivery to striatal medium spiny neurons and to neurons in layers 5 and 6 of the cortex .
unfortunately , the blood - brain barrier limits the distribution of systemically delivered oligonucleotide therapeutics to the cns .
following a single injection , antisense oligonucleotides targeting the human huntingtin mrna can provide a sustained reduction in human huntingtin mrna lasting up to 3 months .
nevertheless , therapeutics based on chemically synthesized oligonucleotides would necessitate repeated administration to maintain silencing .
recombinant aav vectors can deliver an rnai effector in the form of a short hairpin rna ( shrna ) or artificial mirna and , in the non - dividing cells of the brain , a single dose is expected to last indefinitely .
aav vector - mediated rnai has enormous potential for chronic , severe diseases such as hd.6 , 7 initial studies using aav - mediated rnai focused on shrnas as the effector molecules .
shrnas are transcribed from polymerase iii promoters ( usually the u6 or h1 promoter ) and are designed to bypass drosha / dgcr8 cleavage .
after export from the nucleus by exportin 5 , shrnas are cleaved by dicer to form a duplex that can be loaded into argonaute - risc complexes .
shrnas are simple and effective and , with care , off - target effects due to improper strand loading or imprecise dicer cleavage can be minimized.8 , 9 however , shrnas are often produced at extremely high levels , and toxicity due to oversaturation of the rnai machinery has been reported in the liver , heart , and cns.10 , 11 , 12 , 13 , 14 , 15 in contrast to shrnas , artificial mirnas are designed to undergo cleavage both by drosha / dgcr8 and dicer .
they can be transcribed from their own promoters , embedded in an intron , or located in the 3-utr of a protein - coding gene .
although in theory artificial mirnas could also saturate the endogenous rnai machinery , in practice the incorporation of endogenous mirna flanking arms reduces expression of the mature small rna and improves the safety of vector delivered small rnas .
we selected nine sequences targeting the human huntingtin mrna ( table 1 ; figure 1a ) .
we cloned two copies of the artificial mirna in tandem into a backbone on the basis of the endogenous mirna 155 and placed the entire artificial mirna into the 3-utr of egfp ( figure 1b , top ) , which was expressed under the control of a chicken beta - actin promoter .
the resulting plasmids were transfected into hela cells , and 48 hr later , we harvested the cells and measured the levels of endogenous huntingtin mrna using a qrt - pcr probe targeting the boundary between exons 64 and 65 ( figure 1a ) .
we have previously shown that probes upstream and downstream of this target site report consistent levels of silencing of yac128 mrna using assays upstream and downstream of the artificial mirna cleavage site .
three of the nine artificial mirnas reduced huntingtin by > 50% ( figure 2a ) .
we selected the three best sequences from our initial screen for in vivo experiments .
in addition , we included an artificial mirna on the basis of a previously published small interfering rna ( sirna ) ( e1.4 ) .
we packaged these candidates into a self - complementary aav9 vector and injected it directly into the striatum of transgenic mice expressing human huntingtin with a stretch of approximately 128 polyglutamine encoding repeats ( yac128 mice ) . at a vector dose of 3.0 10 vg / striatum ,
gfp staining was present throughout the striatum , and human huntingtin mrna was significantly reduced in mice treated with either scaav9-ca - anti - htt-6433 ( p = 0.0007 ) ( figure 2b ) compared with mice treated with an scaav9-gfp . to investigate the possibility that increasing the expression further would improve silencing , we cloned a single copy of the most potent mirna into an aav9 vector under the control of the u6 promoter ( figure 1b , bottom ) .
mice were injected unilaterally with the original two - copy scaav9-ca - anti - htt-6433 , scaav9-ca - anti - htt-5155 , scaav9-u6-anti - htt-6433 , or scaav9-u6-anti - htt-5155 .
there was a significant reduction in human huntingtin in mice treated with scaav9-u6-anti - htt-5155 , scaav9-ca - anti - htt-6433 , or scaav9-u6-anti - htt-6433 but not in those treated with scaav9-ca - anti - htt-5155 compared with the contralateral ( non - injected ) side ( figure 2c ) .
expression from scaav9-u6-anti - htt-6433 was about 150 times higher than from scaav9-ca - anti - htt-6433 ( figure s1 ) .
using the contralateral side as a control for each animal reduces the inter - animal variability by controlling for animal to animal variation in huntingtin expression .
this approach assumes that there is no spread of aav or artificial mirna from the injected to the non - injected , contralateral side . in mice injected with scaav9-gfp unilaterally
, we often see a small number of gfp - positive neurons on the contralateral side .
therefore , using the contralateral side as the control may underestimate silencing . to eliminate this potential confounding effect , we repeated the experiment using a group of animals injected with pbs as the control .
we confirmed that both scaav9-ca - anti - htt-6433 and scaav9-u6-anti - htt-6433 reduced huntingtin mrna by approximately 50% in the striatum ( figure 2d ) .
we did not observe a difference in silencing between the two studies , suggesting that spread to the contralateral side is insufficient to produce silencing . to determine if we could achieve huntingtin silencing with a lower vector dose , we injected mice ( n = 3/group ) with vector diluted by 0.5 log ( final dose 1.5 10 vg / striatum ) and 1 full log ( final dose 3.0 10 vg / striatum ) .
gfp is present in 89% of the striatum with the highest dose of the vector , but reducing the dose of the vector results in reduced spread ( figures 3a and 3b ) and decreased silencing of human huntingtin mrna ( figure 3c ) . to examine whether the same small rna species were produced from processing of both the u6 and ca promoter - driven artificial mirna
, we injected groups of mice unilaterally with either scaav9-ca - anti - htt-6433 or scaav9-u6-anti - htt-6433 .
we cloned and sequenced the total 18- to 30-nucleotide small rnas at 2 weeks post - injection .
we mapped the sequences back onto the predicted hairpin structure of the artificial mirna ( figure 4a ) . in both scaav9-ca - anti - htt-6433- and scaav9-u6-anti - htt-6433-injected groups ,
96% of the sequences mapping to the aav genome were the expected small rna product .
imprecise dicer or drosha cleavage of mirna precursors can result in small rnas with heterogeneous 5 ends .
these noncanonical small rna isoforms ( isomirs ) can have a different target profile than the canonical isoform .
therefore , we looked at the distribution of 5 ends along the sequence of the pre - mirna .
fewer than 4% of the small rnas produced from scaav9-ca - anti - htt-6433 and scaav9-u6-anti - htt-6433 were noncanonical isomirs ( figure 4b ; table 2 ) .
however , because of the high levels of expression produced by the u6 promoter , it should be noted that these represent a much higher proportion of the total small rna pool in the scaav9-u6-anti - htt-6433 group than in those mice injected with scaav9-ca - anti - htt-6433 . in the group injected with the u6 promoter - driven artificial mirna , however , the huntingtin - targeting sequence dominated the sequencing results , accounting for half ( 50% ) of the combined genome matching and aav vector matching sequences , whereas in the mice injected with the ca vector , only 5% of the sequences matched the vector - encoded small rna ( figure 4b ) .
this finding means that small rnas with alternative seed sequences , including the sense strand , + 1 and 1 products , could be present at levels comparable with functional endogenous mirnas .
endogenous mirna 30 sequences are commonly used as a scaffold for artificial mirna.8 , 20 to determine if the isomir profiles derived from this scaffold were more favorable , we embedded the anti - htt-6433 sequence in a mir-30 backbone and injected into 10-week - old yac128 mice ( figure 4c ) .
the mir-30 scaffold produces levels of the mature artificial mirna comparable with those produced by the ca promoter ( figure 4d ) and also reduces human huntingtin by close to 50% ( figure s2 ) . unlike the mir-155 scaffold , the mir-30 scaffold produces the mature sense ( passenger ) strand at levels comparable with the antisense ( guide ) strand . when designing artificial mirna
, mirna backbone can be used as an additional method to control the asymmetry of artificial mirna . for this huntingtin - targeting sequence ,
the combination of ca promoter with mir-155 backbone is unique , as it is the only combination that produces only the intended antisense strand above background ( figure 4b ) .
having established that both scaav9-u6-anti - htt-6433 and scaav9-cba - anti - htt-6433 silence human huntingtin in the short term , we wished to evaluate the duration of effect and long - term consequences of expression and overexpression of the huntingtin - targeting artificial mirna .
we injected scaav9-u6-anti - htt-6433 or scaav9-ca - anti - htt-6433 unilaterally into the striatum of yac128 mice .
six months after injection , we noticed that the mice injected with scaav9-u6-anti - htt-6433 appeared behaviorally abnormal .
when a new nestlet is placed in the cage , normal mice will shred the material , producing a nest .
the mice injected with scaav9-u6-anti - htt-6433 appeared to leave the bedding material untouched . to document this
twenty - four hours later , the mice treated with scaav9-u6-anti - htt-6433 had not used the new nestlets , whereas the bedding of pbs and scaav9-ca - anti - htt-6433 mice looked as expected ( figure 5a ) . using an automated home - cage monitoring system , we recorded the mice for 24 hr . this system produces unbiased tracking of the movements of the mice over the course 24 hr , without interference from the experimenter .
individual mice are placed in the cage , and the computer records the amount of time they spend moving versus remaining stationary .
the mice treated with scaav9-u6-anti - htt-6433 spent significantly more time moving around their home cage than mice treated with pbs or with scaav9-ca - anti - htt-6433 ( figure 5b ) . finally , we measured the average time it took for the mice to cross an elevated beam . for this test , we require that the mice complete the beam crossing three times . whereas both scaav9-ca - anti - htt-6433-injected and pbs - injected mice crossed the beam easily , two of the four remaining mice in the scaav9-u6-anti - htt-6433 group were unable to successfully cross , either jumping or falling off the beam ( figure 5c ) .
we repeated this experiment with a larger group of animals , testing them on the beam at regular intervals .
mice injected with scaav - u6-anti - htt-6433 at 6 weeks of age were unable to cross the beam by 4 months post - injection ( figure s3a ) .
older yac128 mice ( injected at 7 months of age ) exhibited an age - related increase in time to cross the beam .
this increase was present in both naive mice and in mice treated with aav9-ca - anti - htt-6433 . like the younger animals ,
older mice treated with scaav9-u6-anti - htt-6433 showed a deterioration of beam crossing 4 months post - injection ( figure s3b ) . by 6 months post - injection ,
three of five animals injected with aav9-u6-anti - htt-6433 failed to cross the beam in under 1 min , whereas all of the mice in the aav9-ca - anti - htt-6433 and naive groups crossed within that time .
neuropathological findings explained the behavioral outcomes . on the injected side , the scaav9-u6-anti - htt-6433 mice showed enlargement of the ventricle , loss of darpp-32-positive neurons , and striatal shrinkage ( figure 6 ) . it has previously been shown that yac128 mice display increased numbers of activated microglia compared with wild - type mice .
we expected , on the basis of the loss of darpp-32 neurons , that the mice injected with scaav9-u6-anti - htt-6433 would exhibit increased microglial activation , but we were curious whether the scaav9-ca - anti - htt-6433 mice would also exhibit signs of immune activation .
one month after injection , we were able to locate the needle track in mice injected with both scaav9-u6-anti - htt-6433 and scaav9-ca - anti - htt-6433 ( figure 7a , top ) .
five months later , this was no longer true in the ca - treated mice .
meanwhile , in the surviving striatum , the scaav9-u6-anti - htt-6433 mice exhibited increased iba1 staining ( figure 7a , bottom ) , an increase in total and activated microglia , and a decrease in the number of resting microglia ( figures 7b7d ) .
this suggests an ongoing innate immune response , which could be a result of or participate in striatal cell death .
in contrast , by 6 months post - injection , the mice treated with scaav9-ca - anti - htt-6433 do not show an increase in microglial activation .
immune system , may be more susceptible to toxicity by mirna overexpression than wild - type mice . to determine if toxicity was dependent on the presence of mutant huntingtin , we injected wild - type c57bl/6 mice and fvb mice with the same vectors and assessed the consequences of the u6-driven mirna in that context . in fvb mice ,
the effect was similar to that in yac128 mice with rapid degeneration on the beam and severely enlarged ventricles ( data not shown ) .
in c57bl6 mice , the effect was present but less pronounced ( figure s3 ) .
although there was an initial increase in time to cross the beam in the u6 cohort , at the study endpoint , there was no significant difference between groups ( figure s4a ) .
striatal shrinkage was also less severe in the c57bl6 mice ( figure s4b ) .
we examined the small rna sequencing for clues to explain the toxicity . at 1 week post - injection ,
the mice treated with ca - anti - htt-6433 produced 32 endogenous mirnas whose expression was changed greater than 2-fold compared with pbs - injected mice ( table s1 ) . of these ,
18 ( 56% ) were downregulated , whereas 14 ( 44% ) were upregulated . in the mice treated with u6-anti - htt-6433 ,
58 mirnas were significantly altered , with 33 being downregulated ( 57% ) and 25 ( 43% ) being upregulated .
we also performed rna sequencing ( rna - seq ) on total rna . in the mice injected with aav9-u6-anti - htt-6433 ,
44 transcripts were significantly downregulated , while 30 were significantly upregulated compared with the naive control . in the aav - ca - anti - htt-6433 group
overall , transcripts containing a seed sequence target are downregulated in the scaav - u6-anti - htt-6433 group but not the scaav9-ca - anti - htt-6433 group ( figures s5b and s5f ) .
those originating from the + 1 and 1 positions and the sense strand ( figures s5a , s5c , s5d , s5e , s5 g , and s5h ) were not altered .
this result suggests that off - target effects are exacerbated by overexpression and are likely to be due to overexpression of the intended huntingtin - targeting artificial guide strand rather than to the presence of other small rnas with alternative seed sequences .
we have achieved a higher level of expression of the vector - encoded small rna than has been previously described for artificial mirnas .
we show that the mir-155 backbone produces mostly the intended small rna species , reducing the chance of off - target effects due to improper strand loading or imprecise processing .
we also show that the mir-155-based artificial mirna using a ca promoter reduces human huntingtin by 50% at 1 month and causes no overt toxicity up to 6 months .
using a u6 promoter increases the levels of this artificial mirna guide strand but does not result in additional huntingtin lowering .
expression of the anti - htt artificial mirna from a ca promoter in the context of the scaav9 and the mir-155 backbone is sufficient to achieve maximum silencing from a direct injection .
we have previously reported that the same artificial mirna reduces human huntingtin by up to 80% in liver .
unlike the liver , the striatum contains a highly heterogeneous population of cell types , including medium spiny neurons , cholinergic and gabaergic interneurons , astrocytes , oligodendrocytes , and microglia . in homozygous q140 knockin mice ,
treatment with an artificial mirna targeting mouse huntingtin shifts the distribution , but does not eliminate huntingtin mrna from darpp32-positive medium spiny neurons .
this suggests that a relatively small amount of huntingtin mrna is present in non - neuronal cell types and hints at the presence of a mirna - inaccessible pool of huntingtin mrna in medium spiny neurons .
additional delivery routes , aav optimization , improved formulation , and additional therapeutic moieties could improve silencing by improving delivery to other cell types , increasing distribution and targeting inaccessible huntingtin mrna .
first , overexpression of the mir-155-based hairpin results not only in overexpression of the intended mature artificial mirna strand , but it also reveals additional processing products .
these additional products are expressed at levels comparable with functional endogenous and artificial mirnas and increase the potential for sequence - specific off - target effects .
however , our results indicate that only the artificial mirna guide strand is expressed at a high enough level to produce a detectable global pattern of seed - mediated silencing .
so , although we have been unable to find a single off - target mrna that would explain the observed toxicity , overexpression of the guide strand may in fact be revealing an otherwise hidden off - target effect .
however , species - specific toxicities due to seed - mediated off - target effects have been reported for other huntingtin - targeting artificial mirnas .
second , overexpression of an exogenous mirna might disrupt the balance of endogenous mirnas . in liver ,
expression of an shrna causes a reduction in the predominant liver mirna , mir-122 . in brain
, there is no corresponding dominant mirna ; nonetheless , it is conceivable that overexpression of an artificial mirna causes a disruption in endogenous mirna in brain .
additional explanations for the observed toxicity include saturation of various components of the cellular rnai machinery ( argonaute2 , exportin-5 ) and an innate immune response .
we do see evidence for a long - lived immune response in the form of activated microglia that persist up to 1 month post - injection , even in mice treated with aav9-ca - anti - htt-6433 .
these toxicities may be exacerbated by ongoing disease processes or the presence of a toxic disease - related transgene .
the fact that some strains of mice exhibit accelerated pathology should encourage us to consider factors that might influence susceptibility to such toxicity and caution when transitioning vectors from one animal species or model to another . in non - human primates , partial silencing of huntingtin with a u6 promoter - driven , mir-30-based artificial mirna appears safe up to 6 weeks , and intrathecal delivery of a u6 promoter - driven artificial mirna targeting sod1 is safe in non - human primates .. it is possible that the toxicity of the vector carrying the u6 promoter is exacerbated by the method of delivery , particularly in the small brain of a mouse .
when we deliver an aav vector by direct injection to the striatum , there is a limited transport of vector away from the injection site , and the local concentration is high . in some cases
likewise , the mir-30 backbone , which seems to produce lower levels of the mature artificial mirna , may also be preferable . as we move toward other modes of delivery
in which the vector distributes to a wider area , individual cells will receive fewer copies of the aav , and high levels expression of the artificial mirna produced from a strong promoter and optimized backbone may be necessary . in our hands , the mir-155 backbone produces higher levels of the mature artificial mirna than the mir-30 backbone .
the level and expression pattern of the mature artificial mirna can be further tuned by promoter choice .
promoter , backbone , aav serotype , and injection method should be considered together when attempting to deliver vector - mediated rnai to the brain .
finally , we show using the same anti - htt-6433 sequence that the mirna backbone can influence the strand biasing of artificial mirna processing .
when we placed our targeting sequence in the mir-30 backbone , the sense and antisense strands were produced at very similar levels .
in contrast , in the context of the mir-155 backbone , there was strong asymmetry , and the antisense strand predominated .
asymmetric strand selection of mirna is due primarily to thermodynamic instability at the 5 end of the guide / antisense strand .
when a different , luciferase - targeting sequence is embedded in the mir-155 backbone , both strands were produced in roughly equal proportions .
these differences likely affect processing efficiency and fidelity of artificial mirnas , while interactions between the targeting sequence and backbone determine strand selection .
a comprehensive analysis of pri - mirna features was used to design from scratch a mirna scaffold that is processed as efficiently as the most commonly used endogenously derived mirna scaffolds .
hela cells were maintained in dmem , high glucose with 10% heat - inactivated fetal bovine serum ( fbs ) , and 1% penicillin streptomycin ( thermofisher ) .
twenty - four hours before transfection , cells were seeded onto six - well plates at 0.8 10 to 1.0 10 cells / well . on the day of transfection , we first replaced the growth medium with 1.6 ml of opti - mem ( thermofisher ) .
plasmids were transfected in triplicate using 2 l / well of dharmafect duo ( dharmacon ) .
forty - eight hours after transfection , the cells were harvested , and total rna was extracted using the mirvana rna isolation kit .
we made cdna using 1 g of rna per reaction using oligo - dt and superscript iii ( invitrogen ) .
relative levels of htt mrna were calculated using the c(t ) method , with human hypoxanthine - guanine phosphoribosyltransferase ( hprt ) as the housekeeping gene .
they were bred on the fvb background by mating wild - type male mice with yac128 females .
the resulting heterozygous yac128 and wild - type mice were maintained on a 12:12 light schedule and were given access to food and water ad libitum .
all animals were maintained and used according to the institutional animal care and use committee guidelines of university of massachusetts medical school ( docket a978 - 12 or a978 - 15 ) .
mice were injected with selected aav directly into the striatum by means of a small animal stereotax sas-4100 ( asi instruments ) aided by umpc3 or umpc4 microinjectors ( world precision instruments ) .
mice were anesthetized with 284 mg / kg of tribromoethanol and placed in the stereotax .
surgery was performed using the bregma as the zero point , measuring anterior 1.0 mm , lateral 2.0 mm , and lowering a 33 gauge needle 3.0 mm into the striatum .
the pumps were set to deliver 3.0 l at a rate of 125 nl / min . after the injections the mice were allowed to recover on a warming pad and then placed back in their cages in the housing area .
females were housed together in groups of three and males were housed separately to prevent fighting . at the appropriate time point , mice were sacrificed and tissue was extracted for rna analysis or immunohistochemistry . for rna extraction , mice were anesthetized and killed by cervical dislocation .
brains were removed , and the striatum was dissected out manually , removing as much white matter as possible . to ensure that only animals in which the vector was delivered to the striatum were analyzed , gfp expression was visualized by placing the entire tissue chunk under the fluorescent scope .
tissue was then placed in rnalater ( ambion ) for 24 hr , at which point the rnalater was removed and the tissue was stored at 80c until use .
these mice were deeply anesthetized and perfused intracardially first with saline and then with 4% paraformaldehyde .
they were postfixed overnight in cold 2% paraformaldehyde and then stored in pbs at 4c .
coronal sections were made by slicing 40 m sections on the leica vt1000s vibratome .
after training , we recorded the mice as they crossed from one end of the beam to the other .
we recorded three trials per mouse . from the recording we measured the amount of time it took for the mice to cross from mark on one end of the beam to the other .
mice were placed singly in an automated home cage phenotyping scanning system ( clever sys ) for 26 hr .
this system records and automatically calculates the activity of the mouse during both the active and inactive period without the presence or interference of the investigator . to calculate the average active time per hour
, we first removed the first hour of data , during which the mouse acclimates to the new environment .
fixed tissue slices were blocked with 3% hydrogen peroxide for 3 min and then incubated with 0.5% triton x for 20 min .
immunocytochemistry was performed using vector laboratories elite abc kit reagents and protocols for rabbit- or mouse - derived antibodies against darpp32 ( abcam ab40801 , 1:10,000 dilution ) , iba1 ( wako 019 - 19741 , 1:1,000 dilution ) , gfp ( life technologies g10362 , 1:1,000 dilution ) , and neun ( emd millipore mab377 , 1:1,000 dilution ) .
sections were stained for 2 min with diaminobenzidine using the metal enhanced dab substrate kit ( pierce ) .
for quantification of gfp in the striatum , eight coronal sections spanning from anterior to posterior of mouse striatum were stained for gfp and mounted onto microscope slides .
pictures were taken at 2 magnification on nikon eclipse e600 microscope of entire striatum using nikon ds - qi1mc camera with nis - elements . from these pictures ,
area of striatum on either side of each mouse brain and gfp within striatum were outlined using the polygon selection tool in imagej and calculated with the analyze : measure function . the percentage of striatal area saturated with gfp
was calculated using the areas measured by imagej to show the percentage distribution of gfp - tagged aav within each coronal section .
the total percentage area of gfp within striatum was calculated by adding the area of gfp among all coronal sections within each brain , beside the total striatal area of all sections .
artificial mirnas were designed and cloned according to the protocol detailed by toro cabrera and mueller .
aavs were packaged by the university of massachusetts vector core , according to published protocols .
total rna was extracted using the mirvana rna isolation kit , according to the manufacturer s protocol .
size selection of the 18- to 30-nucleotide rnas was performed using 5 g of total rna on a 15% denaturing polyacrylamide gel .
following size selection , the small rnas were ethanol precipitated and ligated to a pre - adenylated 3-adaptor ( 5-rapptggaattctcgggtgccaagg / ddc/-3 ) .
the ligated products were annealed to the rt primer ( 5-ccttggcacccgagaattcca-3 ) and ligated to a 5-adaptor ( rna : 5-guucagaguucuacaguccgacgauc-3 ) .
reverse transcription was performed using amv reverse transcriptase mix ( neb ) and pcr - amplified using accuprime pfx dna polymerase ( invitrogen ) with one universal primer ( 5-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3 ) and one barcoded primer ( 5-caagcagaagacggcatacgagatnnnnnngtgactggagttccttggcacccgagaattcca-3 ) .
libraries were sequenced on the illumina hiseq at the university of massachusetts deep sequencing core .
we classified mirna species on the basis of the position of the 5 end mapping on the mirna hairpin ; therefore each species consists of all the small rnas with shared seed sequences .
differential expression of endogenous mirnas was analyzed using the edger package , which is not sensitive to changes in distribution caused by overexpression of the aav - derived artificial mirna in the u6 group .
the data discussed in this publication have been deposited in ncbi s gene expression omnibus ( geo : gse97353 ) .
reads were mapped using tophat2 , and differential expression was calculated using the deseq2 package .
, f.b . ; formal analysis , h.s . ; writing original draft , e.l.p . ; writing review and editing , n.a . and c.m . ; project management , e.l.p . ; funding acquisition , n.a . and c.m . | huntington s disease is a devastating , incurable neurodegenerative disease affecting up to 12 per 100,000 patients worldwide .
the disease is caused by a mutation in the huntingtin ( htt ) gene .
there is interest in reducing mutant huntingtin by targeting it at the mrna level , but the maximum tolerable dose and long - term effects of such a treatment are unknown . using a self - complementary aav9 vector
, we delivered a mir-155-based artificial mirna under the control of the chicken -actin or human u6 promoter . in mouse brain ,
the artificial mirna reduced the human huntingtin mrna by 50% .
the u6 , but not the ca promoter , produced the artificial mirna at supraphysiologic levels .
embedding the antisense strand in a u6-mir-30 scaffold reduced expression of the antisense strand but increased the sense strand . in mice treated with scaav9-u6-mir-155-htt or scaav9-ca - mir-155-htt , activated microglia were present around the injection site 1 month post - injection .
six months post - injection , mice treated with scaav9-ca - mir-155-htt were indistinguishable from controls .
those that received scaav9-u6-mir-155-htt showed behavioral abnormalities and striatal damage . in conclusion
, mirna backbone and promoter can be used together to modulate expression levels and strand selection of artificial mirnas , and in brain , the ca promoter can provide an effective and safe dose of a human huntingtin mirna . |
the prevalence of asthma is approximately 300 million cases in the world and in thailand it affects approximately 6.9% of adults .
the airway becomes swollen and inflamed and the muscles around the airway contract causing the bronchial tubes to narrow .
symptoms and exacerbations of asthma include breathlessness , coughing , wheezing , and chest tightness .
severe exacerbations of asthma are potentially life - threatening and require prompt care , close observation for deterioration , and frequent treatments .
the public health burden of acute exacerbation asthma is an especially important and costly problem .
vitamin d is a fat - soluble vitamin that is important to the body by balancing calcium and bone , innate and adaptive immunity , and homeostasis of many organs .
vitamin d from food or dermal synthesis is inactive and requires enzymatic conversion to become active .
hypovitaminosis d is typically diagnosed by measuring the concentration in blood of 25-hydroxyvitamin d ( 25(oh)d ) , the primary circulating form of vitamin d , and then 1,25-dihydroxyvitamin d , the active form of vitamin d , by the enzyme 25-hydroxylase in the liver and kidney .
vitamin d insufficiency is defined as a 25(oh)d level less than 30 ng / ml .
furthermore , vitamin d deficiency is defined as 25(oh)d levels below 20 ng / ml , with a resultant consistent elevation of pth and reduction in intestinal calcium absorption .
people living in tropical countries are exposed to the sun and usually have high levels of vitamin d. however , studies in tropical countries have found the prevalence of vitamin d deficiency to be about 30 to 50% [ 8 , 9 ] . in thailand ,
low serum levels of vitamin d have been linked to increased risk of asthma exacerbation in children and adults .
hypovitaminosis d is associated with increased risk of cardiovascular disease , autoimmune disease , cancer , and allergy disease [ 11 , 12 ] .
it directly affects the adaptive immune system through its effects on th1 , th2 , and regulatory t cells .
it promotes peripheral tolerance by inhibiting inflammation and the induction or maintenance of regulatory t cell populations , both il-10 and foxp3 .
this cross - sectional study demonstrated that the frequency of circulating cd4foxp3 treg cells is significantly lower in steroid resistance than in steroid sensitive asthmatic patients .
also , it directs the induction of innate antimicrobial mechanisms to efficiently resolve infection , especially respiratory viral infections .
notably , vitamin d insufficiency has been associated with severe asthma exacerbations in children and decreased serum vitamin d levels are associated with increased corticosteroid use [ 18 , 19 ] .
vitamin d deficiency has been associated with the asthma epidemic , obesity in african americans , westernization of countries with higher - risk populations for asthma , increased airway hyperresponsiveness , lower pulmonary functions , worse asthma control , and possibly steroid resistance .
the average number of asthma attacks per person per year decreased from 0.44 to 0.28 with vitamin d .
vitamin d reduced the risk of attending hospital with acute exacerbation asthma from 6 per 100 to around 3 per 100 .
however , in tropical countries like thailand , data on the association between serum vitamin d level and asthma exacerbation in adult patients is limited .
this study compared serum vitamin d levels during the period of asthma exacerbation and during the periods in stable condition . also , patients with low vitamin d levels received vitamin d2 supplement for three months and then asthma control and lung function were monitored .
adults with asthma exacerbation were recruited from the allergy clinic and emergency department , phramongkutklao hospital , bangkok , thailand .
severe asthma exacerbation is defined by acute episodes of progressively worsening shortness of breath , coughing , wheezing , and chest tightness .
a patient with asthma exacerbation requires treatment with nebulized short - acting beta-2 agonist and oral corticosteroid added to daily asthma medications .
we enrolled patients ( 18 years of age or older ) with asthma exacerbation and without upper respiratory tract infection .
serum 25(oh)d , asthma control test ( act ) score , and peak expiratory flow rate ( pefr ) were measured during the period of severe exacerbation .
at least two weeks after the exacerbation , the patients during the period in stable condition ( control asthma without inhaled short - acting beta-2 agonist ) visited the allergy clinic again to check serum vitamin d levels , act score , and pefr .
a clinical history of asthma was confirmed by bronchodilator responsiveness ( as defined by an improvement in the fev1 of > 200 ml and 12% after administration of four puffs ( 360 mg ) of salbutamol by metered dose inhaler ) .
participants with significant medical illness other than asthma , those with a history of respiratory tract infection in the past seven days , those with nonadherence to use control medication , and those taking vitamin d supplement were excluded .
the control subjects were adults without a history of chronic illness . during the period of control asthma ,
if the serum level of 25(oh)d was less than 30 ng / ml , the subjects were treated with the ergocalciferol ( vitamin d2 ) supplement at a dose of 20,000 iu every alternate day .
after 3 months , subjects were evaluated again for serum 25(oh)d , act score , and pefr . during 3 months of vitamin d2 supplement
, subjects received the same control asthma medication , that is , inhaled long - acting beta-2 agonist plus corticosteroid and leukotriene receptor antagonists .
the study was approved by the institutional review board , royal thai army medical department .
pefr was measured during forceful exhalation , starting from full lung inflation with the patient standing .
serum total 25(oh)d was quantified by high - performance liquid chromatography - tandem mass spectrometry and categorized in 25(oh)d sufficiency 30 ng / ml , insufficiency < 30 ng / ml , and deficiency < 20 ng / ml . therefore , the serum level of 25(oh)d was considered the best biomarker of vitamin d metabolic status and reflected contributions from all sources of vitamin d. patients were divided into three groups : complete asthma control ( act = 25 ) , partial asthma control ( act 2124 ) , and poor asthma control ( act < 20 ) .
data were analyzed using graphpad prism 6 ( graphpad software , la jolla , ca , usa ) .
data description was primarily based on means and standard deviations ( sd ) for continuous endpoints and on frequencies for categorical parameters .
nonparametric comparisons between asthma exacerbation and asthma control were made using wilcoxon matched - pairs signed test . the mann
whitney test is a method to compare two population means that come from the same population .
we assessed the association between serum vitamin d levels and act that was evaluated by spearman 's correlation . a p value < 0.05 was considered statistically significant .
a total of 47 adult patients with exacerbation asthma were enrolled and baseline characteristics are shown in table 1 .
a total of 13 of 16 ( 81.25% ) patients with age > 70 years had abnormal vitamin d levels .
of these , three patients had a vitamin d level < 10 ng / ml .
subjects were predominantly female ( 74.47% ) . also , females had more abnormal d levels ( 82.85% ) than males ( 41.66% ) .
thirty - four subjects ( 72.34% ) with asthma exacerbation had vitamin d levels below normal .
therefore , patients that had uncontrolled asthma ( act < 20 ) and vitamin d deficiency constituted a third of the total . in the healthy control group , females comprised 65% and the mean age was 63 17.29 years .
the prevalence of vitamin d insufficiency in the healthy control group was 47.5% without vitamin d deficiency .
mean 25(oh)d concentrations were 23.84 8.89 ng / ml in the period of asthma exacerbation and increased to 24.34 9.8 ng / ml in terms of no exacerbation but differed insignificantly , p = 0.6 ( figure 1(a ) ) .
in the healthy control group , mean 25(oh)d concentration was 31.75 7.28 ng / ml . to compare between asthmatic patients and healthy controls , the mean 25(oh)d levels in the period with asthma exacerbation and without exacerbation in the asthma group
were significantly lower than those in the healthy control group , p = 0.0002 and p < 0.0001 , respectively ( figure 1(a ) ) . analyzing mean
25(oh)d concentrations between females , 22.55 7.74 ng / ml , and males , 27.59 11.16 ng / ml , revealed no significant difference ( figure 1(b ) ) .
however , females had a higher risk of developing vitamin d deficiency ( or = 5.83 ; 95% ci = 1.1230.4 , p = 0.03 ) and vitamin insufficiency than males ( or = 8.17 ; 95% ci = 1.3051.4 , p = 0.02 ) .
severe asthma exacerbation mean 25(oh)d concentrations , found between ages 50 , 5159 , 6069 , and 70 years , were 33.57 5.77 ng / ml , 23.67 6.68 ng / ml , 23.2 7.4 , and 20.24 9.82 , respectively .
age 50 years presented more significantly higher vitamin d levels than other age groups ( figure 1(c ) ) .
also , in the period without exacerbation , age 50 had higher vitamin d levels than 70 years ( figure 1(c ) ) .
no significant difference was observed between partly controlled ( act < 20 ) and uncontrolled asthma ( act 2124 ) in mean 25(oh)d concentration with asthma exacerbation and without asthma exacerbation ( figure 1(d ) ) . for asthmatic patients with
% predicted pefr > 80% , mean 25(oh)d concentration 26.48 6.17 ng / ml was significantly higher than in asthmatic patients with % predicted pefr < 60% ( 18.81 7.04 ng / ml , p = 0.02 ) ( figure 1(e ) ) . in patients with
% predicted pefr > 80% , mean 25(oh)d concentrations between with asthma exacerbation 26.48 6.17 and without asthma exacerbation 24.34 6.36 ng / ml significantly differed , p = 0.009 ( figure 1(e ) ) .
representative vitamin d status and asthma control test score are shown in figure 2(a ) .
patients with sufficient vitamin d levels had significantly higher act scores than patients with vitamin d deficiency during asthma exacerbation ( 20.23 1.83 versus 15.11 5.73 , p = 0.04 ) ( figure 2(a ) ) . moreover , during the period without asthma exacerbation , patients with vitamin d insufficiency and deficiency significantly increased asthma control test score to compare in the period with exacerbation asthma ( figure 2(a ) ) .
vitamin d status presented no difference in % predicted pefr ( figure 2(b ) ) .
we next tested whether serum vitamin d levels were associated with age , controlled asthma , and % predicted pefr . increasing age inversely correlated with serum vitamin d level ( p = 0.003 , r = 0.30 ) ( figure 3(a ) ) . then serum 25(oh)d levels significantly positively correlated with controlled asthma ( p = 0.006 ; r = 0.30 ) ( figure 3(b ) ) .
however , an association between serum vitamin d levels and lung function was not observed ( figure 3(c ) ) .
twenty - four of 34 subjects ( 70.58% ) who had serum 25(oh)d level less than 30 ng / ml participated in receiving vitamin d2 supplement ( 12 subjects denied treatment with vitamin d supplement ) . we prescribed a vitamin d2 supplement , ergocalciferol ( vitamin d2 ) , 20,000 iu every alternate day for 3 months to 24 asthmatic patients ( 7 , partly controlled , and 17 , uncontrolled asthma ) . after 3 months of vitamin d administration ,
mean 25(oh)d concentration was significantly higher than baseline among asthmatic patients ( 20.41 5.13 versus 36.41 5.22 ng / ml , p < 0.0001 ) ( figure 4(a ) ) . to compare with baseline ,
in the uncontrolled asthma group , mean act score at baseline , 16.12 1.03 , significantly increased after receiving vitamin d supplement for 3 months ( 20.37 3.55 , p = 0.0004 ) ( figure 4(b ) ) . the lung function in the partly controlled and uncontrolled asthma group showed slightly increased % predicted pefr after 3 months of vitamin d supplement but without significant difference ( figure 4(c ) ) .
next , we observed % change of act score and percent predicted pefr between partly controlled and uncontrolled asthma group .
uncontrolled asthma group had significantly improved act score more than partly controlled asthma group ( figure 4(d ) ) .
no significant difference with % change of percent predicted pefr between both groups was observed ( figure 4(e ) ) .
this cross - sectional study examined vitamin d levels in adult asthmatic patients with differing periods of severe asthma exacerbation and without exacerbation .
the study could not conclude that decreased vitamin d level was the leading cause of severe asthma exacerbation among asthmatic thai adults .
however , many studies have suggested vitamin d deficiency was linked to increased risk of asthma exacerbation .
vitamin d insufficiency among north american and puerto rican children was associated with severe asthma exacerbations [ 25 , 26 ] .
moreover , adults presenting vitamin d deficiency were reported in to be linked to the risk of severe asthma exacerbations .
furthermore , a large cohort from israel showed asthmatic patients with vitamin d deficiency had a 25% higher chance of having an exacerbation than patients within normal range .
however , many studies examined serum vitamin d level only one time and did not compare with the period without exacerbation in the same patient .
we showed vitamin d insufficiency and deficiency were more highly prevalent among asthmatic patients than among healthy people .
similarly , the study in asthmatic thai children showed the prevalence of decreased vitamin d status was 64% .
thailand , a southeast asian country , is located close to the equator and has a tropical rainforest climate with high sun exposure , one source of vitamin d among humans .
one possible explanation is that vitamin d metabolism is influenced by various factors including skin pigmentation , sunscreen use , clothing , drugs , smoking , age , obesity , and several chronic illnesses .
dietary intake and supplements are a secondary source of vitamin d. few natural vitamin d rich food sources are available in thailand and foods are not fortified with vitamin d . avoiding sun exposure and low intake of vitamin d may play significant roles in vitamin d insufficiency among people .
the study by chailurkit et al . among 2,641 thai adult subjects found the prevalence of vitamin d insufficiency was dependent on geographic region and associated with females , younger age , and living in an urban area .
the findings of the present study confirmed report that patients with various degrees of vitamin d status were associated with asthma severity , monitored among children and adults [ 27 , 33 ] .
asthma has been treated by vitamin d supplement in at least three adult random controlled trials ( rct ) .
conducted an rct enrolling 130 patients with moderate persistent asthma and found vitamin d supplementation to be associated with asthma controllers that could significantly improve fev1 in mild to moderate persistent asthma after 24 weeks .
in addition , yadav and mittal reported monthly doses of 60,000 iu vitamin d3 significantly reduced the number of exacerbations as compared with placebo and pefr significantly increased in the treatment group .
moreover , the study by de groot et al . conducted an rct involving 44 patients with nonatopic asthma and found vitamin d supplementation reduced eosinophilic airway inflammation among patients with nonatopic asthma with severe eosinophilic airway inflammation .
studied rct involving 408 adult asthmatic patients and concluded vitamin d3 did not reduce the rate of exacerbation among adults with persistent asthma and vitamin d insufficiency .
in addition , martineau et al . conducted an rct comprising 250 adults with asthma in london and reported bolus - dose vitamin d3 supplementation did not influence time to exacerbation in a population of adults with asthma .
the more recent rct results suggest likely interactions of the vitamin d acute respiratory tract infection association by baseline vitamin d status ( i.e. , vitamin d deficient individuals receive more benefit than those with normal concentrations ) and possibly greater advantage for subgroups that are at higher risk of acute respiratory tract infection , such as young children , older adults , or individuals with immune defects . providing vitamin d supplements to improve asthma symptoms and
the limitation of the study is no randomized control trial and no control group in vitamin d supplement study that it is difficult to conclude the benefit of vitamin d supplement in uncontrolled asthmatic patients .
in addition , the subjects in this study are of low number because asthma exacerbation with upper respiratory tract infection is common in thailand ; this study excluded the cause of asthma exacerbation with upper respiratory tract infection .
we used vitamin d2 supplementation because the cost of the treatment is less than vitamin d3 supplementation .
however , vitamin d2 supplementation is effective in increasing serum 25(oh)d level and not toxic when provided in large amounts .
further study will be planned to do randomized control trial and multicenter study to prove the benefit of vitamin d supplement in asthmatic patients .
hypovitaminosis d was common in patients with asthma exacerbation , but the low vitamin d level did not cause asthma exacerbation .
the study showed the benefits of examining serum 25(oh)d and providing vitamin d supplements to uncontrolled asthmatic patients . | introduction .
vitamin d deficiency has been linked to an increased risk of asthma exacerbations . objective .
this study aimed to compare vitamin d status during the period of severe asthma exacerbations and investigate if vitamin d supplementation improves asthma control . methods .
a total of 47 asthmatic patients and 40 healthy subjects participated in this study .
serum 25-hydroxyvitamin d ( 25(oh)d ) , asthma control test ( act ) score , and % predicted peak expiratory flow rate were evaluated in the period with and without severe asthma exacerbations .
after that , we provided vitamin d2 supplements to the patients with low vitamin d levels for 3 months . results . at the period of asthma exacerbation ,
the prevalence of vitamin d deficiency and insufficiency was 38.29% and 34.04% .
there was no significant difference in the levels of serum 25(oh)d with and without asthma exacerbations but the levels were significantly higher in the healthy group .
serum 25(oh)d levels significantly correlated with act score .
moreover , vitamin d2 supplementation improved asthma control in uncontrolled asthma group . conclusions .
hypovitaminosis d was common in asthmatic patients but was not the leading cause of asthma exacerbations .
serum 25(oh)d levels correlated with the ability to control asthma .
improving vitamin d status might be a benefit in uncontrolled asthmatic patients . |
as an undergraduate chemistry major at the university of illinois in urbana - champaign , i did not have a clear idea of what i was going to do after college until i attended a standing - room - only seminar by sol spiegelman on his demonstration of phage q replication in vitro .
it was not a difficult decision as a new graduate student at the massachusetts institute of technology ( mit ) to join ethan signer s laboratory in 1966 .
ethan himself had joined the mit faculty that same year after his postdoctoral training with sydney brenner at the mrc lab in cambridge england , and francois jacob and jacques monod at the institut pasteur in paris .
it felt as if i had two full - time jobs , working on my phd thesis on the one hand and being a political operative on the other .
my first project as a first - year graduate student was to obtain evidence , lacking at that time , that lac repressor binds to dna .
ethan had calculated that if repressor was bound to the dna of a lac - transducing phage and was packaged into the phage head , it would change the density of the phage just enough to be detectable on a cesium chloride gradient .
c - labeled lac - transducing phage grown in the absence of isopropyl -d-1-thiogalactopyranoside ( iptg ) mixed with h - labeled phage grown with iptg and vice versa .
( iptg is a stable synthetic lactose mimic that binds lac repressor , causing it to dissociate from dna . ) in the same gradient , c- and h - labeled wild - type , which had a distinct density from the lac - transducing phage , served as an internal control in the gradient .
unfortunately , i never detected a density difference between the h- and c - labeled lac - transducing phages , presumably because the repressor was stripped from the dna during packaging .
nevertheless , it was a marvelous introduction to the thinking behind and practice of molecular biology and illustrated to me in a very powerful way that relatively simple experiments can yield important new insights .
my graduate student years , 19661972 , were notable not only because of the seminal discoveries being made in molecular biology , but also because of the political and social upheavals occurring as a consequence of the vietnam war and the bombing of cambodia .
it felt as if i had two full - time jobs , working on my phd thesis on the one hand and being a political operative on the other .
i was newsletter editor for the major graduate student antiwar organization at mit , the science action coordinating committee , which regularly lambasted mit s involvement in weapons - related research .
i was also an active participant in science for the people , an organization founded on the principle that science , including genetic engineering , should benefit the poor and disenfranchised rather than being used to benefit militarism and the wealthy classes . in 1971 and 1972 when i was finishing my phd work on integrase , prominent molecular biologists such as gunther stent and jim watson were saying that the golden age of molecular biology was over ; they advised graduate students and postdocs to stop working on escherichia coli and its phages and to seek opportunities for carrying out work in eukaryotic model systems .
although many of my classmates made the switch with relative ease , it seemed a complicated choice to me .
ethan , my advisor , and arthur galston from yale traveled to vietnam and china .
they were the first american scientists to visit the people s republic of china since its founding in 1949 , and while they were in china they had the opportunity to meet with chou en - lai , the first premier of china and the right - hand man of mao zedong during the revolution .
i started thinking about plant - related science as a potential future field , which finally materialized into a decision to work on nitrogen fixation , a microbial process , but important for agricultural yield .
i decided to construct a -like phage to transfer the nitrogen fixation ( nif ) gene cluster from klebsiella pneumoniae to plant cells in the hope of engineering a nitrogen - fixing plant !
while looking into the literature for a suitable plant host , i came across a large body of genetic work on arabidopsis thaliana , which appeared to me to be a potential drosophila of the plant world .
although transferring functioning bacterial nif genes to plants seems hopelessly naive in retrospect , in these precloning days it was considered a cutting - edge strategy .
the plan was to spend the first year at the universities of leicester and nottingham to work with arabidopsis tissue culture cells and protoplasts with h. e. street and edward cocking , respectively . in the second year
, i would bring the tissue culture and protoplast systems to the lab of lawrence bogorad at harvard and work on the nif gene transfer .
this plan did not go well . working with arabidopsis tissue cultures and protoplasts was extraordinarily tedious compared to bacteria and phages , and i became quite discouraged .
i was not aware of anyone else who was working to develop arabidopsis as a model plant for molecular genetic analysis , and i could not see a clear career path that involved the use of arabidopsis tissue culture .
gary ruvkun , harvard university in a stroke of good luck , however , stanley cohen at stanford and herb boyer at university of california at san francisco invented cloning while i was in england and i found that k. pneumoniae could be easily transformed with psc101 , cohen s and boyer s original cloning vector .
i realized that the strains that i had constructed that were deficient in both nitrogen fixation and restriction / modification could be used to clone nif genes . in another stroke of luck ,
i met frank cannon from the unit of nitrogen fixation at the university of sussex , and he invited me to his lab to work on the nif gene - cloning project .
the switch temporarily ended my work with arabidopsis , and i did not take it up again for almost 10 years .
when i moved to the bogorad laboratory in 1974 , i received a national science foundation ( nsf ) postdoctoral fellowship entitled transfer of functioning nitrogen fixation genes to plants . the plant in the nsf application was a. thaliana . in 1975
i became an assistant professor in the cellular and developmental biology department at harvard and my nsf fellowship was converted to a grant .
unexpectedly , i received quite a bit of pushback on the nif gene - cloning project from my former colleagues at science for the people , who wanted me to take a stand against cloning .
this confused me because one of the major drivers in my decision to transfer nif genes to plants was to benefit developing countries and the environment . in any case ,
work on the project largely came to standstill in 1975 following the asilomar conference on recombinant dna and the establishment of guidelines for carrying out recombinant dna work .
i was using k. pneumoniae , a human pathogen , as a potential host for recombinant plasmids carrying nif genes .
this was strictly forbidden in the original guidelines , but recombinant dna guidelines were eventually relaxed after a couple of years , and the first nif genes were cloned in 1977 ( cannon et al .
in shifting from chemistry to molecular biology to plant biology , i had simply followed my inclinations to carry out work that i perceived to be on the cutting edge scientifically , as well as socially important .
when i started on the quest to transfer nif genes to plants , there was no clear path to success , and the entire venture could easily have been considered foolhardy .
nevertheless , i was able to obtain a postdoctoral fellowship ( with a little help from salvador luria ) and forge a somewhat unusual program to pursue my long - term goals .
after cohen and boyer , the nif gene part of the project suddenly became much more feasible , but the transfer of functioning nif genes to plants was most likely unachievable , given the fundamental differences in the structures of prokaryotic and eukaryotic genes , which became apparent only in subsequent years , and the fact that the k. pneuonniae nif gene cluster consists of 17 genes .
nevertheless , as stated above , i was awarded an nsf grant to pursue the project . indeed , the nsf proposal was very highly ranked .
i toned down subsequent applications as the complexities of the nitrogen fixation system came into focus .
but i doubt whether postdoctoral and nsf applications comparable to the ones that i wrote in the early 1970s would be funded today .
i did not have three clearly achievable specific aims that were interrelated but did not depend on each other and that did not involve a genetic screen .
the aims were based on minimal preliminary data , and it was not obvious that a complete functioning nif gene cluster could be readily cloned or that bacterial genes could be expressed in plants .
in 1977 , there was still lot of work to be done on elucidating how the klebsiella nif genes were organized and regulated , but i was not content to limit the lab to this complex project . soon after i started my lab at harvard , we were working on several distinct projects , including ( 1 ) identifying and cloning nif and nodulation - related genes in rhizobium meliloti , the nitrogen - fixing symbiont of alfalfa ; ( 2 ) identifying alfalfa genes involved in nodulation ; and ( 3 ) developing petunia as a model system in which to transfer nif genes . in those days , petunia was much more amenable to tissue culture than arabidopsis .
the petunia work turned out to be a dead end , but we were able to demonstrate that nif genes are highly conserved in evolution ( ruvkun and ausubel 1980 ) .
we successfully developed techniques to mutate specific rhizobium genes ( ruvkun and ausubel 1981 ) , thereby allowing us to study the organization and regulation of rhizobium nif genes ( ruvkun et al .
1982 ) and to clone rhizobium nod genes ( long et al . 1982 ) .
the study of nif gene regulation resulted in the discovery of two - component regulatory systems , which are widely dispersed in prokaryotes and consist of an environmental sensor protein and a response regulator protein that activates gene expression ( nixon et al .
we initiated work to investigate the regulation of legume genes involved in nodule development and function ( dickstein et al .
i was recruited by howard goodman , one of the pioneers of recombinant dna technology , to the newly formed department of genetics at harvard medical school and department of molecular biology at massachusetts general hospital . at this time
i was firmly committed to studying host microbe interactions but i was disillusioned about working on legumes because of the inability to readily carry out genetic analysis of host genes . in 1983
i heard a lecture by christopher somerville at a gordon conference on the identification of arabidopsis photosynthesis - related mutants , leading me to conclude that it was a propitious time to return to arabidopsis . with the ability to construct physical - genetic maps using recombinant dna technology
, it was now possible to use a chromosomal walking strategy to clone an arabidopsis gene identified only by its phenotype .
however , because arabidopsis is not a legume , we could not use it to study symbiotic nitrogen fixation .
so i gradually switched the focus of the lab from plant symbionts to plant pathogens .
similarly , instead of the plant nodulation response to rhizobium , we studied the plant innate immune response to pathogen attack .
this led to the cloning of the founding member of a large family of plant genes that confer resistance to particular strains of pathogens ( mindrinos et al .
1994 ) and the use of forward genetic analysis to dissect the components of the plant immune response ( glazebrook et al .
this was the first time that forward genetic analysis had been used to study the process of host immunity in a higher eukaryote .
laurence rahme joined the lab in 1992 as a postdoctoral fellow after completing her phd at the university of california at berkeley . at berkeley
, she had learned about experiments showing that the opportunistic human pathogen pseudomonas aeruginosa could also infect plants .
however , it was not known whether the same p. aeruginosa strain could infect both plants and animals .
she reasoned that p. aeruginosa strains that were infectious in both plants and animals could be used to identify key features of pathogenesis that were independent of the host .
it turned out that many p. aeruginosa strains were infectious in arabidopsis , and laurence chose for further study one of these strains , ucbpp - pa14 ( pa14 ) , which was also highly infectious in mice ( rahme et al .
1995 ) . when man - wah tan , a graduate student , showed that pa14 also killed caehnorhabditis elegans , we started a c. elegans project designed to identify pa14 virulence factors on the one hand and c. elegans immune genes on the other ( tan et al
one of the reasons i have not been able to drill down very often on particular projects to their mechanistic underpinnings is that i have always let my postdocs take their projects with them .
but i also just happen to be somewhat restless and more interested in starting new projects than finishing old ones .
this has always served me well , and until recently it was not a problem getting a grant funded that was not an obvious extension of the projects in a previous grant .
the former genetics study section at the national institute of general medical sciences was content with the lab s record of opening up new areas of research .
i did not have to determine the underlying details of the molecular mechanisms because i could explain that former postdocs had taken these projects to start their own laboratories .
the genetics study section was also content when i proposed to extend the genetic analysis of the innate immune response from arabidopsis to c. elegans , making the argument that the two projects might be synergistic .
nobody questioned whether i was qualified to carry out c. elegans research or whether the study of plant and nematode immunity was relevant to human disease , and no one raised a question about the biological relevance of studying immune responses in an artificial laboratory assay significantly different from the ecological niches in which arabidopsis and c. elegans encounter pathogens in the wild .
although many of my former postdocs have started their own laboratories based on studies of arabidopsis or c. elegans innate immunity , it appears that this is becoming more difficult .
nsf support for arabidopsis genetic resources appears to be in doubt . at the national institutes of health ,
concerns are often raised about the relevance of model organisms , given rapid advances in our ability to identify and manipulate human genes correlated with disease .
this should be troubling not only to those who study model genetic organisms , but also to everyone in the scientific community committed to the importance of basic science .
there are other obstacles for aspiring young scientists that i did not have to face .
obstacles include not only the very low funding rates , but also the funding priorities that favor the larger pork barrel
projects over smaller investigator - initiated grants ; the exaggerated influence of science , nature , and cell on hiring , promotion , and funding decisions and the corresponding pressure to publish in these journals ; the soft academic job market and the precariousness of soft money positions for phd faculty at many medical schools ; the continuously rising bar for publication in mainstream journals , fueled in part by development of powerful new genomic technologies ( that are often quite expensive ) and the demands of referees for months of additional experiments .
as i reach the end of my career , i find these obstacles daunting , even though they affect me only indirectly through the difficulties my students and postdocs encounter as they attempt to thread their way through this career minefield .
what i find particularly unfortunate is that these trends are arising during an unprecedented explosion of biological knowledge as a consequence of next - generation genomic techniques .
full - genome sequencing , rna interference , and crispr ( clustered regularly interspaced short palindromic repeats ) technologies allow almost all biologists to carry out sophisticated genetic analysis and have enabled previously unthinkable evolutionary studies .
genome - wide association studies have revolutionized human genetic analysis , and whole - genome sequencing has created a renaissance in the study of prokaryotes .
indeed , molecular biology as a field of inquiry has been spectacularly successful in the past decade , and we are experiencing a new golden age of discovery . yet despite our newfound abilities , in many ways i think that it is more difficult and a lot less enjoyable to carry out and publish seminal work in 2014 than it was in the early 1970s .
the united states is now at a time when many question the relevance of science and the impartiality of scientists . until the u.s .
public demands adequate funding for a robust scientific enterprise , it seems unlikely that the pursuit of a scientific career will become once again a goal of our brightest young minds . | the genetics society of america s thomas hunt morgan medal is awarded to an individual gsa member for lifetime achievement in the field of genetics .
the 2014 recipient is frederick ausubel , whose 40-year career has centered on host microbe interactions and host innate immunity .
he is widely recognized as a key scientist responsible for establishing the modern postrecombinant dna field of host microbe interactions using simple nonvertebrate hosts .
he has used genetic approaches to conduct pioneering work that spawned six related areas of research : the evolution and regulation of rhizobium genes involved in symbiotic nitrogen fixation ; the regulation of rhizobium genes by two - component regulatory systems involving histidine kinases ; the establishment of arabidopsis thaliana as a worldwide model system ; the identification of a large family of plant disease resistance genes ; the identification of so - called multi - host bacterial pathogens ; and the demonstration that caenorhabditis elegans has an evolutionarily conserved innate immune system that shares features of both plant and mammalian immunity . |
despite advances in insulin therapy , hypoglycaemia remains a significant concern and limits optimization of insulin dosing to achieve glycaemic targets.1 hypoglycaemia is associated with increased morbidity and cardiovascular risk.1 patients / caregivers may be fearful of nocturnal hypoglycaemia , which may affect sleep and wellbeing.2
basal insulin peglispro ( bil ) is pegylated insulin lispro and has a flat pharmacokinetic profile with a 23 day halflife.3 bil has an hepatopreferential action versus glargine as a result of a reduced peripheral action rather than an enhanced effect on the liver 4
.
the primary objective of the bil phase iii studies was to demonstrate the noninferiority of glycated haemoglobin ( hba1c ) for bil versus glargine .
the three doubleblind studies were also powered for the key secondary objective of superiority of bil versus glargine for reduction in nocturnal hypoglycaemia rate . in five phase iii imagine trials , bil treatment met the primary objective of noninferiority to glargine for hba1c.5 , 6 , 7 , 8 , 9 the five imagine trials also resulted in 0.20.5% greater hba1c reduction versus glargine over 26 , 52 and 78 weeks in patients with type 1 diabetes ( t1d ) and those with type 2 diabetes ( t2d ) , meeting the key secondary objective of statistical superiority ( with multiplicity adjustment ) , with higher basal insulin doses.5 , 6 , 7 , 8 , 9
the present report summarizes prespecified pooled hypoglycaemia analyses from the imagine studies with a glargine comparator .
table 1 provides an overview of the five phase iii imagine studies of bil versus glargine that were included in the prespecified pooled analyses of : patients with t2d receiving basal insulin only ; patients with t2d receiving basalbolus insulin ; and patients with t1d receiving basalbolus insulin .
entry criteria , study design , dosing algorithms and results , including individual study glycaemic / hypoglycaemia data , have been previously reported.5 , 6 , 7 , 8 , 9 all were treattotarget trials with the same basalbolus insulindosing algorithms applied to both treatments and with a fasting / premeal selfmonitored blood glucose ( smbg ) target of 5.6 mmol / l .
overview of imagine studies , patient clinical characteristics , glycated haemoglobin and insulin dose
gl , insulin glargine ; ls , least squares ; oam , oral antihyperglycaemic medication ; s.d . , standard deviation ; s.e .
52 weeks for t2d basal only ; 26 weeks for t2d basalbolus ; 52 weeks for t1d .
nocturnal hypoglycaemia was an event between bedtime and waking for t2d basalonly studies ( imagine 2 and 5 ) . for studies using electronic diaries ( imagine 1 , 3 and 4 ) with direct transfer of time / date stamped smbg values,10 nocturnal hypoglycaemia
severe hypoglycaemia was investigatordetermined and defined as episodes accompanied by neurological impairment requiring medical assistance to administer carbohydrates , glucagon or other resuscitative actions .
for the pooled analyses of patients with t2d on basal insulin only ( imagine 2 and 5 ) and patients with t1d ( imagine 1 and 3 ) , 52week data were included , as this was a consistent time point .
blinded continuous glucose monitoring ( cgm ) was performed in patient subsets in the three doubleblind studies ( imagine 2 , 3 and 4 ) to assess duration ( min ) with glucose values 3.9 mmol / l from 00:00 to 06:00 hours and over 24 hours and duration of individual hypoglycaemic episodes .
the medtronic cgms ipro continuous glucose recorder ( imagine 3 ) or the ipro2 professional cgm ( imagine 2 and 4 ) were used over 3 or 6 days , respectively .
cgm data were centrally collected ( phase v technologies , wellesley , massachusetts ) at baseline / prespecified time points during treatment .
the 52week data are presented for imagine 2 and 3 and 26week data for imagine 4 ( table s1 , appendix s1 ) .
analyses ( sas 9.1 , cary , north carolina ) were conducted on the modified intentiontotreat population of all randomized patients who received 1 study insulin dose .
all tests were conducted at a twosided value = 0.05 and 95% confidence intervals ( cis ) were calculated .
total / nocturnal hypoglycaemia frequencies were analysed using negative binomial regression and a modelbased rate for each treatment was estimated.11 the rate of severe hypoglycaemia was analysed using an empirical method ; hypoglycaemia incidence was assessed using a logistic regression model or cochran mantel haenszel test ( if < 10 patients with events ) .
a total of 4927 patients randomized to bedtime bil ( n = 2949 ) or glargine ( n = 1978 ) were included .
4972% of patients with t2d and 6471% of patients with t1d were previously treated with glargine .
the pooled analyses were consistent with the individual study results , with a 0.210.33% greater reduction in hba1c with bil versus glargine ( table 1 ) .
basal insulin doses were 1024% higher with bil versus glargine across phase iii studies ( table 1).5 , 6 , 7 , 8 , 9 bolus insulin doses were 27% lower with bil versus glargine in t1d ( table 1 ) , but not statistically significantly different in patients with t2d receiving basalbolus insulin ( table 1).6
nocturnal hypoglycaemia rates were reduced by 36% in patients with t2d on basal insulin only , 45% in patients with t2d on basalbolus insulin , and 43% in patients with t1d with bil versus glargine ( figure 1a ) .
nocturnal hypoglycaemia incidence was statistically significantly lower with bil versus glargine in all patient populations ( figure 1b ) .
the nocturnal hypoglycaemia rate and incidence sensitivity analyses were consistent with the primary results including : prespecified analyses of the alternative nocturnal hypoglycaemia definition for basal only and basalbolus ediary studies and post hoc analyses including events between 00:01 and 05:59 hours ( figure s1 , appendix s1 ) .
nocturnal , total , daytime and severe hypoglycaemia . a , nocturnal hypoglycaemia rate per patientyear standard error ( s.e . ) .
values are aggregated rate , calculated using the total number of severe hypoglycaemia episodes divided by the cumulative days on treatment from all patients within that treatment , then times 36 525 days ( for rate per 100 years ) .
weeks of study data included : t2d basal only ( 052 weeks ) , t2d basalbolus ( 026 weeks ) , t1d ( 052 weeks ) .
b , basal only ; bb , basalbolus ; gl , insulin glargine ; rr , relative rate . *
the total hypoglycaemia rate was not significantly different in patients with t2d on basal insulin only , there was a 10% higher trend in patients with t2d on basalbolus insulin ( p = .053 ) , and the rate was 15% higher in patients with t1d ( p < .001 ) with bil versus glargine ( figure 1c ) .
the total hypoglycaemia incidence was not different between treatments in any population ( figure 1d ) . in patients with t1d or t2d on basalbolus
insulin , daytime hypoglycaemia was significantly higher with bil versus glargine ( figure 1e ) from 0 to 52 and 0 to 26 weeks , respectively . in t1d patients , during the maintenance period of 2652 weeks , the total hypoglycaemia relative rate ( bil / glargine ) was 1.07 ( 95% ci 1.00 , 1.14 ; p = .062 ; figure s2 , appendix s1 ) .
there were no significant differences in the rate or incidence of severe hypoglycaemia between treatments in all three patient populations ( figure 1f and g ) . in the three doubleblind studies , cgm was performed in patient subsets ( bil , n = 313 , glargine , n = 215 ) . in patients with t1d or t2d , there were no significant treatment differences in duration with glucose level 3.9 mmol / l ( 00:0006:00 hours or over 24 hours ) or in the average duration of individual hypoglycaemic episodes with bil versus glargine ( table s1 , appendix s1 ) .
the present analyses provide a summary of prespecified and pooled hypoglycaemia analyses from the five imagine studies with glargine comparator .
bil treatment resulted in a 3645% reduction in nocturnal hypoglycaemia rate versus glargine , despite greater reduction in hba1c and higher basal insulin dosing .
there was a 15% increase in total hypoglycaemia in t1d with an associated increase in daytime hypoglycaemia with basalbolus therapy in t1d and t2d .
cgm in patient subsets showed no evidence of prolongation or shortening of hypoglycaemic episodes with bil versus glargine .
nocturnal hypoglycaemia was also reduced with morning dosing of bil versus glargine in t1d and t2d phase ii studies12 , 13 and nocturnal / total hypoglycaemia were similar with bedtime versus 840hours variabletime dosing of bil in a t1d phase iii study.14
the significant reduction in nocturnal hypoglycaemia was achieved simultaneously with greater improvements in hba1c with bil versus glargine .
in contrast , significant reductions in nocturnal hypoglycaemia rates were reported in clinical studies of insulin degludec15 and glargine u30016 versus glargine u100 , but with noninferiority of hba1c .
this may reflect the hepatopreferential action of bil as well as longer duration of action , lower peaktotrough ratio , and reduced glucose variability versus glargine u100 seen across the bil phase iii trials.5 , 6 , 7 , 8 , 9 a study in the conscious dog has shown that peripheral insulin delivery increased hypoglycaemia risk versus portal vein insulin delivery , suggesting that hepatopreferential insulin analogues may be associated with a lower risk of hypoglycaemia.17 glucose variability has also been independently associated with the risk of hypoglycaemia.18 , 19
increased daytime hypoglycaemia with bil versus glargine in basalbolus therapy may also reflect the hepatopreferential action and longer duration of action of bil . in t1d ,
the adjustment of basalbolus dosing occurred gradually during the titration period and resulted in significantly reduced bolus insulin requirements with bil compared with glargine . during the maintenance period of 2652 weeks and after basalbolus dose adjustment and stabilization , total hypoglycaemia decreased in t1d and was not significantly different between groups ( figure s2 , appendix s1 ) .
the strengths of the present pooled analyses of five bil phase iii studies include the doubleblind design of three trials , which were also powered to detect differences in nocturnal hypoglycaemia , the large sample size of > 4900 patients , as well as the global nature of the studies . the use of an ediary in three basalbolus studies10 allowed wireless , direct capture of smbg values and hypoglycaemic events .
limitations include the ability to translate the findings outside of a clinical trial setting and exclusion of patients with t1d with > 1 and patients with t2d with 1 severe hypoglycaemic episode within 6 months of screening .
in addition , it is unknown from these studies if other basalbolus insulindosing algorithms , including algorithms different from those used with conventional basal insulins , could more rapidly optimize bolus insulin dosing with bil . in conclusion , across five phase iii trials , bil treatment resulted in greater hba1c reduction with less nocturnal hypoglycaemia in all patient populations compared with glargine despite higher basal insulin doses .
basalbolus treatment with bil versus glargine resulted in higher daytime hypoglycaemia in t1d and t2d , with an associated increase in total hypoglycaemia in patients with t1d .
as assessed by continuous glucose monitoring ( cgm ) in three doubleblind imagine studies .
figure s1 .
sensitivity analyses for nocturnal hypoglycemia between 00:00 and 05:59 hours . a , nocturnal hypoglycemia rate per patient year se .
weeks of study data included : t2d basal only ( 052 weeks ) , t2d basalbolus ( 026 weeks ) , t1d ( 052 weeks ) .
abbreviations : b , basal only ; bb , basalbolus ; bil , basal insulin peglispro ; ci , confidence interval ; gl , insulin glargine ; pt , patient ; rr , relative rate ; se , standard error ; t1d , type 1 diabetes ; t2d , type 2 diabetes ; yr , year . * p < .05 for between treatment group comparisons .
figure s2 .
abbreviations : bil , basal insulin peglispro ; gl , insulin glargine ; se , standard error ; t1d , type 1 diabetes . * p < .05 for between treatment group comparisons . click here for additional data file .
j. r. has served on scientific advisory boards and received honoraria or consulting fees from eli lilly , novo nordisk , sanofi , merck , daiichi sankyo , janssen , boehringer ingelheim , astrazeneca and intarcia .
he has received grants / research support from merck , pfizer , sanofi , novo nordisk , bristolmyers squibb , eli lilly , glaxosmithkline , takeda , astrazeneca , hanmi , janssen , daiichi sankyo , asahi , mannkind , boehringer ingelheim , intarcia and lexicon .
m. m. has served on advisory boards for abbott , intarcia , merck sharpe & dohme , novo nordisk , sanofi and servier , has received honoraria or speaking fees from abbott , eli lilly and company , merck sharpe & dohme , novo nordisk , sanofi and servier and has received research grants from merck sharpe & dohme , novartis , novo nordisk , sanofi and servier .
e. j. b. was an employee of eli lilly and company during these clinical trials and is currently a consultant to viacyte , inc .
, san diego , california . y. q. , s. z. and a. m. c. are employees and shareholders of eli lilly and company .
j. r. and m. m. participated as trial investigators and in the discussion / interpretation of the research , and reviewed / edited the manuscript .
e. j. b. and m. j. p. participated in study design , the conduct of the studies , the data analysis / interpretation of the research , and reviewed / edited the manuscript .
y. q. and s. z. contributed to the study design , designed and conducted the statistical analyses , and participated in the interpretation of the research and reviewed / edited the manuscript .
a. m. c. contributed to the study design , the conduct of the studies , the data analysis / interpretation of the research and in writing the manuscript . | basal insulin peglispro ( bil ) is a novel basal insulin with hepatopreferential action , resulting from reduced peripheral effects .
this report summarizes hypoglycaemia data from five bil phase iii studies with insulin glargine as the comparator , including three doubleblind trials . prespecified pooled analyses ( n = 4927 ) included : patients with type 2 diabetes ( t2d ) receiving basal insulin only , those with t2d on basalbolus therapy , and those with type 1 diabetes ( t1d ) .
bil treatment resulted in a 3645% lower nocturnal hypoglycaemia rate compared with glargine , despite greater reduction in glycated haemoglobin ( hba1c ) and higher basal insulin dosing .
the total hypoglycaemia rate was similar in patients with t2d on basal treatment only , trended towards being higher ( 10% ) in patients with t2d on basalbolus treatment ( p = .053 ) , and was 15% higher ( p < .001 ) with bil versus glargine in patients with t1d , with more daytime hypoglycaemia in the t1d and t2d groups who were receiving basalbolus therapy . in t1d , during the maintenance treatment period ( 2652 weeks ) , the total hypoglycaemia rate was not significantly different .
there were no differences in severe hypoglycaemia in the t1d or t2d pooled analyses .
bil versus glargine treatment resulted in greater hba1c reduction with less nocturnal hypoglycaemia in all patient populations , higher daytime hypoglycaemia with basalbolus therapy in the t1d and t2d groups , and an associated increase in total hypoglycaemia in the patients with t1d . |
fans of doctor who , the quintessential british science fiction television series , have been able to enjoy the adventures of its main character ( the doctor ) for over three decades . as a time lord from the planet gallifrey , the doctor can regenerate his body completely as he nears death .
the doctor s regenerative abilities , however , are not without flaw : after he regenerates , he takes on different features and characteristics .
this imperfect process enables the series to continue with a new actor portraying the doctor upon the departure of his predecessor .
the doctor s slightly defective regenerative power is not only a boon for the show s fans ( and producers ) , but it is also a rare example of science fiction being outdone by the real world . on earth , a wide range of actual organisms can regenerate missing parts after injury . unlike the fictional doctor , these animals can rebuild new structures that are indistinguishable from those they are replacing . with the goal of understanding the factors that enable some organisms , but not others , to restore missing structures ,
biologists have been studying regeneration for well over two centuries ( morgan , 1901 ; lenhoff and lenhoff , 1986 ) .
although the doctor s regenerative abilities remain a mystery , recent research on various earthlings has started to reveal the mechanisms leading to regeneration of complex structures . during the past decade
the application of molecular genetic techniques , including double - stranded rna - mediated genetic interference ( rnai ) and transgenesis , has revitalized studies of classical animal models of regeneration ( poss , 2010 ) . here we highlight a sample of recent work addressing some of the critical questions facing regeneration researchers : what signals initiate regeneration ?
the answers to these and related questions should help developmental biologists , tissue engineers , and clinicians to understand and one day overcome the limits on human regeneration .
after amputation , local responses at the site of the wound play important roles in the initiation of regenerative processes .
ion flux ( levin , 2009 ) , and interactions between the wound epidermis and the underlying tissue appear critical for regenerative outgrowth .
recent work suggests that programmed cell death may play a role in triggering regenerative responses in many different organisms , including hydra ( bergmann and steller , 2010 ) .
hydra , a freshwater polyp belonging to the phylum cnidaria ( which includes jellyfish , sea anemones , and corals ) , was the subject of the first scientific investigations of regeneration in animals ( lenhoff and lenhoff , 1986 ) .
the hydra body consists of ectodermal and endodermal cell layers separated by an extracellular matrix ; neurons and interstitial cells ( stem cells that produce neurons , gland cells , and germ cells , among other cell types ) reside between these two layers .
the animal is radially symmetric , and is polarized along the oral ( head and tentacles)/aboral ( foot ) axis ( fig .
small fragments of hydra tissue can regenerate a complete organism ; even dissociated single cells can reaggregate , reestablish polarity , and form a new animal ( noda , 1971 ; gierer et al . , 1972 ) .
( a ) after mid - gastric bisection in hydra , mapk signaling leads to rapid activation of the transcription factor creb in fragments regenerating a head ( blue cells ) .
mapk / creb activity is required for stimulating a wave of apoptosis in interstitial cells near the site of injury ( red cells ) .
these apoptotic cells secrete wnt3 , inducing a zone of proliferation ( green cells ) below the region of apoptosis .
( b ) planarians and ( c ) xenopus larval tails also show a rapid , localized increase in apoptosis after amputation . in xenopus , like hydra , apoptosis may provide important signals during early phases of regeneration ; inhibiting apoptosis during the first 24 h post amputation ( hpa ) blocks regeneration .
the fragment that will regenerate a new head displays a robust apoptotic response near the wound site , whereas the fragment regenerating a new foot does not ( fig .
2009 ) . inhibition of apoptosis blocks head regeneration , and activation of apoptosis at a foot - regenerating wound leads to ectopic head formation ( chera et al . ,
the apoptotic response stimulates a synchronous burst of proliferative activity in neighboring cells and leads to the establishment of a head organizer via secretion of wnt3 ligand by apoptotic interstitial cells ( chera et al . , 2009 ) .
rnai knockdown of wnt3 prevents the proliferative burst induced by apoptosis , whereas treatment with exogenous wnt3 rescues proliferation when apoptosis is inhibited ( chera et al . , 2009 ) .
the induction of apoptosis after injury appears to require the mitogen - activated protein kinase ( mapk ) pathway , including ribosomal s6 kinase ( rsk ) , and camp response element binding protein ( creb ) .
rnai knockdown of rsk and creb blocks apoptosis at the head - regenerating tip , as does treatment with u0126 , a pharmacological inhibitor of mek , the kinase that phosphorylates mapk ( chera et al . ,
, the transcription factor creb is phosphorylated by rsk within minutes of amputation ( fig .
intriguingly , mapk / creb - induced apoptosis is not required in fragments regenerating a foot , and cell proliferation is not up - regulated in foot regenerates .
the exact nature of the signal that leads to asymmetric mapk activation ( and , thus , apoptosis ) at the site of injury in head - regenerating fragments remains to be determined .
the apoptosis - induced compensatory proliferation ( fan and bergmann , 2008 ) observed in hydra may be a conserved mechanism for stimulating proper wound healing and regeneration .
apoptotic cells have been observed during early phases of regeneration in several animals that can regenerate missing tissues : planarians ( fig . 1 b ) , xenopus ( fig
. 1 c ) , and newts ( hwang et al . , 2004 ; vlaskalin et al .
, 2004 ; tseng et al . , 2007 ; chera et al . , 2009 ; pellettieri et al . ,
although the requirement for apoptosis during regeneration has not been addressed in planarians and newts , treatment of xenopus larvae with caspase inhibitors during the first 24 h after amputation blocks tail regeneration ( tseng et al .
as observed in hydra , inhibition of apoptosis impedes proliferation ; in addition , nerves fail to extend appropriately toward the site of amputation .
because nerves release important regenerative signals ( see penultimate section ) , it is unclear whether reduced proliferation results directly from lack of signals derived from apoptotic cells , or indirectly from defective innervation .
furthermore , because these assays rely on caspase inhibition it is possible that nonapoptotic roles for caspases ( kuranaga and miura , 2007 ) may be involved rather than apoptosis by itself .
apoptotic cells have been shown to provide a number of signals that can regulate wound healing and regeneration . in drosophila , the larval imaginal discs are capable of regenerating : wing discs can produce appropriately sized adult wings after radiation - induced killing of over 50% of the cells ( haynie and bryant , 1977 ) .
mapk signaling through jun kinase is important both for initiating apoptosis and production of wnt ( wg ) and bmp ( dpp ) mitogens ( prez - garijo et al . , 2009 ; bergantios et al .
after radiation - induced apoptosis , neither dpp nor wg were required ( prez - garijo et al . , 2009 )
however , after ectopic expression of a pro - apoptotic gene , wg was required for the proliferative response ( smith - bolton et al . , 2009 ) .
furthermore , wg is also required for disc regeneration after surgical transection ( schubiger et al . , 2010 ) .
additional roles for apoptosis have been reported in epidermal wound healing and liver regeneration in mouse .
caspase 3 and caspase 7 mutant mice have defects in both processes , and these mutants show reduced cell proliferation in these contexts ( li et al . , 2010 ) .
caspases 3 and 7 can activate ca - independent phospholipase a2 , leading to production of arachidonic acid and prostaglandin in apoptotic cells , the latter of which can stimulate proliferation ( li et al . , 2010 ) .
when cells of the adult drosophila midgut are injured by toxins or induced to undergo apoptosis , intestinal enterocytes secrete the cytokine unpaired , which stimulates proliferation of intestinal stem cells through activation of the jak / stat pathway ( jiang et al .
similarly , in the mouse intestine massive induction of apoptosis ( via intestine - specific knockout of the p53 inhibitor mdm2 ) is eventually compensated in adults by increased proliferation and expansion of the stem cell pool ( valentin - vega et al . , 2008 ) .
apoptotic cells also contribute to homeostasis in epithelia by lipid - based signaling ( sphingosine-1-phosphate ) that triggers actomyosin contraction in the surrounding cells , leading to the extrusion of the dying cells ( gu et al . , 2011 ) .
these observations suggest many potential roles for dead and dying cells to alter cell behavior at sites of injury .
in most regenerating organisms , replacing an amputated structure requires the production of new cells .
therefore , one of the main functions of early signaling events after injury is to stimulate the production of additional cells that are capable of rebuilding lost structures .
new cells coalesce near the site of injury , giving rise to a mass of undifferentiated cells called the regeneration blastema .
subsequent signals then regulate outgrowth and patterning of the newly formed tissue . to understand how early signaling events initiate regeneration and stimulate blastema formation , it is crucial to identify the cells upon which these signals act .
new cells can be generated in a variety of ways , including proliferation of a resident stem cell population , division of terminally differentiated cells , or dedifferentiation / transdifferentiation of mature cells to a stem cell like precursor or another cell type ( fig .
2 a ) . the extent to which each mode is used varies between species and even across tissues within the same species . cellular sources of regeneration .
( a ) the ability to regenerate amputated structures often requires the production of new cells .
these new cells can be derived from amplification and differentiation of resident stem cells , proliferation of differentiated cells , dedifferentiation of cells to a more primitive state , or transdifferentiation of one cell type to another cell type .
neoblasts are the only mitotic somatic cells and are defined by their high nuclear ( blue ) to cytoplasm ( green ) ratio and the presence of cytoplasmic ribonucleoprotein complexes called chromatoid bodies ( arrows ) .
image courtesy of ana vieira ( university of illinois at urbana - champaign , urbana , il ) .
( c ) rescue of a lethally irradiated planarian by introduction of a single neoblast .
s. mediterranea exists as two genetically distinct strains : an asexual strain ( brown ) that reproduces by transverse fission ; and a sexual , hermaphroditic strain ( gray ) that reproduces by cross - fertilization .
wagner et al . ( 2011 ) have shown that lethally irradiated sexual animals can be rescued by injection of a single asexual neoblast . because the asexual donor neoblast is the only source of new cells , the sexual host is eventually converted into an asexual animal after repeated rounds of amputation , regeneration , and tissue turnover .
these animals possess three distinct stem cell populations : ectodermal , interstitial , and endodermal stem cells ( galliot et al . , 2006 ) .
development of transgenesis in hydra ( wittlieb et al . , 2006 ) has enabled in vivo tracking of the stem cell lineages : for example , investigating the differentiation of interstitial stem cells and migration of their progeny in intact animals ( khalturin et al . , 2007 ) .
transgenesis has also aided the analysis of transdifferentiation . by expressing egfp in the zymogen gland cells ( a derivative of the interstitial stem cells ) , siebert et al .
( 2008 ) showed that these cells move up the body column and down - regulate the expression of a zymogen gland cell specific marker . by using histology , electron microscopy , and in situ hybridization with cell type
specific markers , they identified cells with characteristics of both zymogen gland cells and another cell type ( granular mucous cells ) , suggesting that zymogen gland cells could convert to granular mucous cells as they were displaced up the body column and entered the head region ( siebert et al . , 2008 ) .
the ability of hydra cells to transdifferentiate permits these animals to regenerate even in the absence of cell proliferation ( cummings and bode , 1984 ) .
freshwater planarians ( another classical model for studying regeneration ) owe their amazing regenerative abilities to stem cells . in these animals ,
a population of mesenchymal stem cells , called neoblasts , is the source of cells for regeneration ( bagu et al . , 1989 ) .
neoblasts are the only dividing somatic cells and have been defined by their high nuclear / cytoplasmic ratio and sensitivity to -radiation , as well as the expression of several post - transcriptional regulators and markers of proliferation ( fig .
2 b ; bagu et al . , 1989 ; newmark and snchez alvarado , 2000 ; orii et al . , 2005 ; reddien et al .
, 2005 ; salvetti et al . , 2005 ; guo et al . , 2006 ; yoshida - kashikawa et al . , 2007 ;
classical experiments showed that injection of neoblasts could restore regenerative abilities and long - term viability to lethally irradiated planarians ; furthermore , injection of neoblasts derived from a sexual planarian strain could
transform lethally irradiated asexual individuals into sexuals ( bagu et al . , 1989 ) . because these injections used thousands of cells , neoblasts as a population
however , whether individual neoblasts are pluripotent or if there are subsets of lineage - committed neoblasts has remained an open question .
they injected single asexual donor neoblasts into lethally irradiated sexual hosts ( the irradiated sexual animals survive longer after irradiation than the asexuals do , permitting sufficient time for clonal expansion of the injected cells ) .
single neoblast injections were able to restore viability to the sexual animals and convert them to an asexual mode of reproduction .
restriction fragment length polymorphism and haplotype sequencing confirmed the genotypic conversion of the host to that of the donor strain ( fig .
2 c ; wagner et al . , 2011 ) . characterizing this pluripotent subset of the neoblast population will be an important avenue for future research .
the source of regenerative cells in vertebrates varies between tissues and organisms , and in some cases remains a matter of continued debate .
many vertebrate tissues contain adult stem cells that play important roles in tissue turnover and homeostasis .
nonetheless , division , dedifferentiation , and transdifferentiation of differentiated cells contribute to regeneration in several different contexts .
for example , whereas liver progenitor cells appear to be major sources of new hepatocytes under conditions of extreme damage or chronic disease , restoration of liver mass after partial hepatectomy or mild liver injury is largely accomplished through proliferation of remaining hepatocytes ( riehle et al . , 2011 ) .
similarly , recent lineage - tracing experiments indicate that after damage to the zebrafish heart , existing cardiomyocytes undergo dedifferentiation and proliferate to generate new cardiomyocytes for replacing lost heart mass ( jopling et al . , 2010 ; kikuchi et al . , 2010 ) .
pigmented epithelial cells in the newt dorsal iris can regenerate a new lens via transdifferentiation : these cells from the dorsal iris can dedifferentiate , reenter the cell cycle , and differentiate to produce new lens cells ( henry and tsonis , 2010 ) .
dedifferentiation also contributes new cells during appendage regeneration in urodele amphibians ( newts and axolotls ) .
near the site of amputation , syncytial skeletal myotubes fragment and produce mononucleate cells that reenter the cell cycle ( lo et al .
skeletal muscle from adult newts also contains pax7-positive muscle stem cells ( satellite cells ) that become activated and contribute to new tissues during regeneration ( morrison et al .
the respective contributions of muscle dedifferentiation and satellite cell activation during limb regeneration in the axolotl and newt remain open questions .
in contrast , larval tail regeneration in xenopus laevis appears to be driven largely by progenitor cells ; in lineage - tracing experiments the extent of labeling of new muscle correlates with the amount of satellite cell labeling before amputation ( slack et al .
lineage tracing experiments in both axolotl and xenopus indicate that multiple cell types contribute to formation of the blastema ( slack et al . , 2004 ; kragl et al . ,
however , it is still unclear whether these other tissues contribute cells through proliferation of progenitor cells or dedifferentiation of mature cells
. such an understanding will be crucial for deciphering the mechanisms by which early regenerative signals trigger blastema formation .
in addition to identifying the cellular sources of regeneration in different systems , researchers have been examining whether blastemal cells are pluripotent , multipotent , or have more limited potential .
as discussed already , pluripotent neoblasts are the source of new cellular material that drives regeneration in planarians .
however , cell proliferation is restricted largely to regions outside the blastema ( reddien and snchez alvarado , 2004 ; wenemoser and reddien , 2010 ) ; thus , post - mitotic neoblast progeny are the predominant cells within the blastema that rebuild lost tissues .
( 2008 ) have exploited the sensitivity of neoblasts to -radiation to identify numerous neoblast as well as early and late neoblast progeny markers .
interestingly , not all early neoblast progeny express the same panel of markers ( fig .
although this difference could reflect transient temporal alterations in gene expression in early neoblast progeny , it more likely indicates that these cells are in various early stages of lineage commitment and/or en route to different terminal cell types .
this heterogeneity has also been suggested by gene expression profiling on individual neoblasts ( and their progeny ) isolated using fluorescence - activated cell sorting ( hayashi et al . , 2010 ) .
a subset of radiation - sensitive cells with g2 dna content and expressing various neoblast markers also expressed a marker of muscle differentiation , suggesting that not all lineage - committed neoblasts are post - mitotic ( hayashi et al . , 2010 ) .
consistent with this result , s phase or g2 neoblasts have been observed to express markers of differentiated cell types , including excretory and neuronal markers ( nishimura et al . , 2011 ; scimone et al . ,
( a ) the planarian blastema is composed of a heterogeneous mixture of differentiating cells .
the blastema is largely devoid of proliferating neoblasts , and instead is composed of cells expressing early and late neoblast progeny markers with distinct spatial distributions .
although some cells coexpress early ( or late ) neoblast progeny markers , other cells show distinct expression profiles for various early neoblast progeny markers , suggesting early neoblast progeny may be en route to committing to terminal cell types ( adapted from eisenhoffer et al . , 2008 ) .
( b ) 3-d anterior blastemas ( top ) are capable of forming anterior structures , including photoreceptors and cephalic ganglia , after being surgically isolated from intact tissue and cultured in vitro .
similarly , 3-d posterior blastemas ( bottom ) repigment and form muscle , but do not generate anterior structures , suggesting that by 3 d of regeneration head or tail specification has occurred .
when 3-d anterior and posterior blastemas are juxtaposed ( middle ) they can generate a planarian containing mid - body structures ( including a pharynx ) , in addition to head and tail tissue .
these results indicate that at least some of the post - mitotic neoblast progeny that compose the blastema are capable of altering their fates ( adapted from sengel , 1960 ) . in planarians ,
specification of blastema positional identity ( i.e. , as anterior or posterior ) likely occurs early during regeneration .
sengel ( 1960 ) removed anterior blastemas after 3 d of regeneration and cultured them as explants in vitro ; these blastema explants produced only anterior tissues , including photoreceptors and cephalic ganglia ( fig .
therefore , these early experiments suggested that specification of blastemas to produce heads or tails occurs during early stages of regeneration .
this idea has been confirmed by recent molecular studies showing rapid up - regulation of polarity signals ( petersen and reddien , 2009 , 2011 ; gurley et al . , 2010 ) .
surprisingly , when anterior blastemas were co - cultured together with posterior blastemas , they were now able to produce small planarians containing head , central body , and tail structures ( fig .
these results suggest that , although neoblast progeny are specified early during regeneration , they may retain some developmental plasticity ; in response to altered position cues ( e.g. , juxtaposition of anterior and posterior tissues ) they may be able to change their fates and generate different cell types and tissues than they would have formed otherwise .
alternatively , the blastema explants may have contained some neoblasts that responded to the juxtaposition of anterior and posterior tissues to generate distinct body structures .
recent experiments using transgene - based lineage tracing suggest that vertebrate blastema cells can remember the tissue from which they are derived , and that their fates are largely restricted to forming similar tissues in the regenerate .
for example , transgenesis in axolotl and xenopus has been combined with embryonic grafting to specifically label various tissues , including muscle , schwann cells , spinal cord , and dermis ; this tissue - specific labeling enables the contribution of various tissues to be analyzed during regeneration ( fig .
4 a ; gargioli and slack , 2004 ; kragl et al . , 2009 ) .
these experiments revealed that regenerated muscle tissue is derived solely from muscles present in the limb before amputation .
both of these tissues are derivatives of lateral plate mesoderm , suggesting that these tissues may dedifferentiate to produce progenitors restricted to lateral plate fates or that the dermis may contain an uncommitted stem cell population ( kragl et al . , 2009 ) .
cellular memory during vertebrate limb regeneration . ( a ) although the regeneration blastema appears to be a homogeneous mass of undifferentiated cells , lineage - tracing experiments in the axolotl limb , the xenopus tail , and the zebrafish caudal fin indicate that blastema cells only contribute to tissues of similar developmental origin as that from which they are derived .
although dermis ( gray ) can give rise to new skeletal elements , these tissues are both lateral plate mesoderm derivatives , suggesting only limited dedifferentiation .
therefore , the blastema is composed of a heterogeneous mixture of lineage - restricted cells and is not a homogeneous population of multipotent cells .
( b ) blastema cells retain their proximo - distal identity : distal amputations produce blastemas that only regenerate distal structures , whereas more proximal amputations produce blastemas that regenerate medial and distal structures .
when cells from a distal blastema ( green dots ) are transplanted into a proximal blastema , they contribute only to distal structures ; by contrast , cells from a proximal blastema ( green dots ) contribute to structures along the length of the proximo - distal axis .
overexpression of the cell surface protein prod1 transforms distal blastema cells to more proximal fates .
tu and johnson ( 2011 ) have used transposon - based clonal analysis to examine the potency of various cell lineages during development , growth , and regeneration ( tu and johnson , 2010 , 2011 ) .
this method stably labels one to a few cells in the developing fin bud , enabling the progeny of single fin bud cells to be monitored .
examination of hundreds of animals indicated that fin bud cells are greatly restricted in developmental potential , only generating one to a few cell types in the adult fin ( tu and johnson , 2011 ) .
as in axolotl and xenopus , zebrafish caudal fin cells remain lineage committed during regeneration , and do not contribute to lineages other than that from which they are derived ( tu and johnson , 2011 ) .
osteoblasts near the amputation site down - regulate osteoblast differentiation markers , lose their differentiated morphology , proliferate , and give rise to new bone in the regenerate ( knopf et al . , 2011 ) .
these results reveal that regeneration in these contexts does not require dedifferentiation to a pluripotent state , and that the cells that make up the blastema are lineage restricted .
these lineage - restricted progenitors even occupy distinct spatial domains in the blastema , indicating that the initial sorting and positioning of these cells may be crucial for producing a properly patterned appendage ( kragl et al . ,
although the lineage restrictions observed during limb regeneration ( kragl , et al . , 2009 ) are similar to those observed during limb development ( pearse et al . , 2007 ) , there are dramatic differences between development and regeneration .
in addition to nerve dependence ( see next section ) and differences in scale of the structures being formed , limb regeneration differs significantly from limb development in that some components of the proximo - distal axis of the limb are retained after amputation . to prevent duplication or deletion of limb structures , cells at the site of amputation
must be able to determine their position along the proximo - distal axis and use this information to regenerate only the structures that have been lost .
interestingly , when distal ( wrist ) blastemas are transplanted onto proximal ( shoulder ) blastemas , the distal blastema cells contribute only to distal structures , suggesting that they retain memory of their proximo - distal origin ( fig .
additionally , when proximal and distal blastemas are co - cultured , the proximal blastema encapsulates the distal blastema , suggesting that the adhesive properties of cells differ along the proximo - distal axis ( nardi and stocum , 1984 ; da silva et al . ,
lineage tracing and examination of proximal ( e.g. , nuclear localized meis ) and distal limb markers ( e.g. , hoxa13 expression ) indicate that although some cells ( such as cartilage ) retain positional identity , other cells ( such as schwann cells ) do not ( kragl et al . ,
because of the important role positional identity plays in limb regeneration , it is critical to understand the sources that provide positional values along the limb axes . based on its differential expression along the proximo - distal axis , da silva et al .
( 2002 ) identified a cell surface protein , referred to as prod1 , that is expressed at high levels proximally and low levels distally .
treatment with anti - prod1 antibodies blocked the encapsulation of distal blastema by proximal blastema tissues , suggesting that prod1 plays a role in cell cell interactions that mediate identity along the proximo - distal axis .
furthermore , when distal blastema cells overexpressing prod1 were transplanted into proximal blastemas , they contributed to proximal rather than distal structures ( echeverri and tanaka , 2005 ) . the mechanisms by which differences in prod1 expression along the proximo - distal axis translate into faithful regeneration of the limb are not completely clear ; however , prod1 has been found to interact with a secreted protein called newt anterior gradient ( nag ; see next section ) , providing a link between proximo - distal patterning and the role of innervation in regeneration ( kumar et al . , 2007a ) .
the above , out - of - context quote ( rowling , 2003 ) introduces the important role that innervation plays during regeneration in many organisms .
for example , earthworms in which a portion of the ventral nerve cord was removed near the amputation plane failed to regenerate new heads , whereas manipulations resulting in two anteriorly exposed nerve cords produced two heads ( morgan , 1901 ) . in another annelid ,
the polychaete spirographis spallanzani , deviation of the nerve cord toward the lateral body wall induced the formation of supernumerary structures : the anterior - directed cut nerve cord led to the formation of an ectopic head , whereas the posterior - directed cut nerve cord led to the production of an ectopic tail ( kiortsis and moraitou , 1965 ) .
the nervous system also appears to be required for arm regeneration in echinoderms because removal of the radial nerve in the starfish prevents arm regeneration ( huet , 1975 ) . in planarians ,
the nervous system is required for proper regeneration of the gonads and accessory reproductive organs .
( 2010 ) identified a single neuropeptide that mediates the effects of the nervous system on the postembryonic development and maintenance of the reproductive organs .
furthermore , the formation of ectopic cephalic outgrowths in planarians with improperly connected cephalic ganglia and ventral nerve cords suggests that discontinuities between the brain and nerve cords result in the production of signals that trigger proliferative outgrowth ( cebri and newmark , 2007 ) .
classical experiments by singer showed that denervated limbs failed to regenerate , and that the amount of innervation was critical for proper regeneration ( carlson , 2007 ) .
( 2007b ) identified the nag protein as a ligand for prod1 , the cell surface protein involved in proximo - distal patterning . during regeneration nag
is expressed in the schwann cells of the nerve sheath and , later , in gland cells of the wound epidermis .
remarkably , introduction of a vector encoding nag into denervated limbs was able to rescue regeneration to the digit stage , thus restoring proximo - distal patterning .
experiments in which nag was added to blastemal cells in culture revealed that nag exerts its effects upon regeneration by stimulating blastemal cell proliferation . the mechanism by which nag stimulates blastema cell proliferation remains an open question . however , when prod1 is expressed in cultured newt blastema cells , it leads to the activation of mmp9 expression and erk signaling ; it also interacts with the epidermal growth factor receptor ( blassberg et al . , 2011 )
. it will be important to determine whether nag plays a role in mediating these activities of prod1 . given the wide distribution of regenerative abilities throughout the animal kingdom , it has been postulated that some regenerative mechanisms have been conserved throughout evolution ( snchez alvarado and tsonis , 2006 ; brockes and kumar , 2008 ; bely , 2010 ; poss , 2010 ) . according to this view ,
however , prod1 provides an intriguing example of a molecule that has apparently evolved within a specific evolutionary lineage , the urodele amphibians ( garza - garcia et al . , 2010 ) .
thus , it will also be important for investigators to consider the roles of such taxon - specific genes in regeneration in diverse organisms .
ultimately , we need to know a great deal more about the cellular and molecular mechanisms operating during various regenerative processes to better understand the distribution of regenerative abilities throughout the metazoa .
as discussed in this review , investigations of model organisms have begun to characterize the cellular sources of regeneration , define their potency , and identify molecules required for restorative events .
thus , there is now a great opportunity for cell biological studies to link gene function to cellular behavior .
for example , the cell biology of dedifferentiation is poorly understood : how is the complex cytoskeleton of cardiomyocytes or skeletal muscles reconfigured during the course of dedifferentiation to enable assembly of a mitotic spindle ?
in addition , we need to understand how individual cell behaviors are integrated across tissues to permit a coordinated response to tissue loss . for example , the observation that tissues from proximal limb blastema encapsulate those from distal limb blastema suggests that cell cell interactions are critical for proper sorting and organization within the blastema ( nardi and stocum , 1984 ; da silva et al . , 2002 ) .
similarly , it will be important to characterize how the extracellular environment is altered during regeneration , and how different extracellular matrices shape cell behaviors in the blastema ( calve et al . , 2010 ) .
one of the long - term goals of regeneration research is to understand why humans have such limited regenerative potential and what , if anything , can be done to improve it .
the knowledge gained from studying cell biological questions in model organisms should help drive such future efforts of regenerative medicine . | regeneration of complex structures after injury requires dramatic changes in cellular behavior .
regenerating tissues initiate a program that includes diverse processes such as wound healing , cell death , dedifferentiation , and stem ( or progenitor ) cell proliferation ; furthermore , newly regenerated tissues must integrate polarity and positional identity cues with preexisting body structures .
gene knockdown approaches and transgenesis - based lineage and functional analyses have been instrumental in deciphering various aspects of regenerative processes in diverse animal models for studying regeneration . |
the obesity treatment literature includes many sophisticated analyses , methods , and conclusions , yet the problem persists [ 13 ] . given all of the information now known , to move forward in intervention development and evaluation , more accurate measures of success are needed to monitor changes .
the field of obesity treatment often has redundancy of interventions and measures but heterogeneity of outcome measures , making it difficult to combine results and move toward the ultimate goal of achieving healthy weights [ 35 ] .
most weight loss studies measure weight and/or bmi to assess intervention - related changes , given their ease of measurement and interpretation [ 4 , 5 ] . though well correlated with body composition , weight and bmi only inform total loss or change , which could include lean body mass in addition to fat loss [ 6 , 7 ] .
bmi may also inaccurately reflect intervention - related change , in that it does not account for bone and muscle density , frame size , and fat distribution [ 8 , 9 ] .
loss of fat is the major outcome of interest for a variety of health reasons .
body fat can have varying degrees of benefit and harm , depending on location , amount , and time of fat disposition [ 1012 ] . while babies and young children depend on body fat to promote brain and tissue growth , as children age , the percent of fat that is beneficial decreases . among older adults ,
body fat is also metabolically harmful , with an exception that it may offer some protection against bone loss and fractures .
however , for adults , excess body fat is widely acknowledged to be associated with such diseases as type 2 diabetes , stroke , hypertension , cardiovascular disease , and arthritis [ 15 , 16 ] . in particular ,
abdominal fat has been associated with increased morbidity and mortality among adults [ 11 , 12 ] .
body fat is best captured by measures other than weight and bmi , such as bioelectrical impedance ( bia ) , dual - energy x - ray absorptiometry ( dexa ) , underwater weighing , air displacement , and skinfold thickness .
measuring body fat as part of weight loss interventions is a common but not universal practice and it is usually viewed as a secondary outcome , with weight or bmi being primary [ 5 , 18 ] .
compounding the measurement issues described above , adult weight loss intervention studies primarily target dietary interventions , rather than ( or more than ) physical activity ( pa ) interventions .
although diet can lead to reduced body fat , it can also lead to overall weight loss that can include reduced fat - free mass ( bone and muscle ) .
much research shows that pa is a key driver of fat loss and maintenance or increase of fat - free mass [ 19 , 20 ] .
ideally , interventions should include components of both diet and pa , to reduce body fat and maintain or increase fat - free mass [ 18 , 20 ] .
therefore , studies that include pa as a component of interventions ( in addition to diet ) should theoretically include a measure other than weight or bmi to potentially best capture changes .
the objectives of this review were to address the following questions : ( 1 ) what are the best or most consistent measures of success in adult weight loss interventions that include diet and pa : weight or bmi , or body composition ? ( 2 ) are weight loss or bmi changes or body composition changes adequate measures of intervention success ? ( 3 ) do the studies that include a body composition measure in addition to weight or bmi reach the same conclusions ?
a systematic review was conducted to examine and evaluate all of the existing findings on these topics .
this review does not include a meta - analysis because intervention studies contain many heterogeneous components ( duration , intensity , length , and setting of interventions ) , so that compiling results may lead to incomplete or inconclusive findings .
the cochrane library was searched for existing reviews on this topic and information from related systematic reviews .
as there were no available or registered review papers on these specific questions , the following search methods were employed in july and august 2012 .
pubmed ( 1953present ) and psychinfo ( 1806present ) were used to do an exhaustive search combining all terms .
additional search resources were used to acquire remaining papers meeting review criteria : the online database at google scholar ( 1992present ) and searching through references from eligible papers found ( ancestry search ) .
the overarching goal of the search was to identify studies of adult weight loss interventions that included diet and pa and a measure of weight or bmi and body composition .
the following title and abstract keyword search terms were used in all databases , with limitations to humans , english language , randomized controlled trials ( rcts ) or clinical trials , and adults over age 18 : weight loss and overweight or
obese or obesity and diet or dietary or calorie restriction and exercise or physical activity or fitness and bmi or body mass index and fat loss or body composition or skinfold or
dxa or underwater weigh or bioelectrical impedance or bia .
the types of participants intended for this review were adults ages 1865 who were overweight or obese ( bmi 25.0 ) .
studies of adults with comorbid health conditions ( i.e. , prediabetes and prehypertension ) were included because many interventions target such populations .
all interventions were eligible if they targeted weight loss and included a diet and aerobic pa component .
no restrictions were placed on duration , intensity , or setting of intervention ( i.e. , inpatient and outpatient ) .
the eligible outcome measures were at least one measure of overall weight change ( taken both before and after intervention ) , pounds or kilograms of weight or bmi reduction , and at least one body fat measure ( taken both before and after intervention ) : skinfold thickness , dexa , underwater weighing , bia , or air displacement .
while waist or hip circumference is sometimes considered to be a body composition measure , it can be too gross to reliably identify changes in short - term studies , so it was excluded from this search .
exclusion criteria were studies not published in english , inclusion of children or older adults , interventions that included only diet or only pa , interventions in which the only pa was strength training , studies that included only one outcome measure ( weight or bmi or body composition ) , nonintervention studies or designs other than rcts ( reviews , position papers , and cross - sectional or noncontrolled studies ) , studies that included dietary supplements or drugs to assist in weight loss , secondary or redundant data analyses ( in that case , only the primary results were included in this review ) , and the case when the full - text article was unavailable from interlibrary loan , online sources , or correspondence with the author . the study selection process , all completed by the author , began with general keyword ( title and abstract ) searches in the databases and reference lists of appropriate papers . of those titles that appeared relevant , a more thorough abstract review was conducted . of abstracts that appeared relevant ,
a full - text review was conducted , when available , and all eligible full - text articles were included in this paper . throughout the study selection process , duplicates were removed .
if one trial published multiple papers , only the primary outcome paper or the most recent ( whichever was most relevant ) was included .
the author extracted and compiled the detailed data items and study characteristics from all articles . the data extraction tables included , as available , study type , sample size including gender breakdown , baseline ages , ses or race , comorbidities , intervention setting and length , body composition measure , baseline weight and/or bmi ( and standard deviations ( sd ) or range ) , baseline body composition ( and sd or range ) , follow - up weight and/or bmi ( and sd ) , and follow - up body composition ( and sd or range ) .
for the principle summary measures , the variables were extracted from the studies when the data were published , but when the average weight and/or bmi change , average body composition change , and summary of agreement were not explicitly listed , they were calculated from the available data ( e.g. , calculating the average weight change from the baseline to follow - up weight ) .
the flowchart describing study screening , exclusion , eligibility , and selection is shown in figure 1 .
two hundred and thirty - five studies were identified through the various search sources . of the nonduplicate studies ,
145 were excluded for the reasons listed in the flowchart ; the main reasons were that the intervention did not include both diet and pa , that the study did not include or measure body composition , and that the intervention did not involve a calorie restricted diet ( e.g. , manipulating macronutrient composition in isocaloric weight maintenance diets ) .
of the 56 excluded full - text articles , the main exclusion reasons were that the studies did not report body composition data , included older adults , and used drugs or supplements to aid weight loss . ultimately , 28 studies met all inclusion criteria and were included in this review .
sample sizes ranged from 5 to 111 , and a majority of studies ( 18 studies = 64% ) used only women participants .
the studies included and focused on a range of adult ages , with baseline ages ranging from 28 to 54.7 .
no studies reported participants ' socioeconomic status ( ses ) . of the few studies that reported racial composition of samples , most participants were white .
the country of origin could perhaps be used to infer racial composition of samples when otherwise not indicated ( e.g. , primarily white participants in belgium , the netherlands , and australia ) .
most studies were conducted in the united states , with fewer from europe and australia .
three main body composition measures were used ( categories were not mutually exclusive , as some studies used multiple measures ) : dexa was used in 13 studies , bia was used in eight , and underwater weighing was used in six .
two studies used skinfold thickness ( bi- or triceps ) , one used air displacement , and one used doubly labeled water with appropriate body composition calculations .
the studies also demonstrated heterogeneity in factors such as intervention emphases , diet types , and length ( table 1 ) .
most studies took place at outpatient facilities ( university or hospital clinical research centers ) , two studies took place in inpatient clinics , and three studies did not give details on intervention setting .
the interventions ranged from six weeks to two years in length , with half ( 13 studies ) in the 12- to 16-week range , and five studies lasted 24 weeks .
for the diet component of the interventions , strategies included visits with a dietician , calorie restriction ( ranges : 4201800 cal / day ) , specific macronutrient proportions ( e.g. , % calories from fat and carbohydrates ) , liquid diets with and without solid food supplementation , food provided by programs , and nutrition education .
for the calorie restriction , the most common target value was 1200 calories / day or a range including 1200 , but the liquid and inpatient diets were much lower ( e.g. , 420 calories / day ) , and when men were included in studies , the calorie ranges were higher ( 15001800 calories / day ) .
several studies did not report a specific calorie target but rather gave each participant an individualized goal based on their resting metabolic rate and subtracting 2501000 calories from that as the daily goal .
for the pa components of the interventions , the strategies included varied amounts of activity per day and week , structured and supervised aerobic activity ( commonly walking and indoor cycling ) , circuit classes , skills - based and noncompetitive activity classes , individualized heart rate training goals , and emphases on lifestyle activity . most of the studies included weekly or biweekly individual or group meetings with a nutritionist , exercise counselor , and/or psychologist for support , education , and behavior modification strategies .
the outcome measures of baseline and follow - up bmi , body fat , and fat mass , plus the average changes , summary of agreement , and attrition are presented in table 2 .
the follow - up outcomes are reported for the intervention group and for the longest follow - up period reported in the paper .
weight and bmi outcomes .
averages are presented as overall values , unadjusted for length or intensity of intervention and unweighted for sample size .
all 28 studies reported weight as an outcome , and all reported losses with wide ranging values ( 2.9 to 17.3 kg ) .
the average weight loss at the longest reported follow - up time point was 8.2 kg . while most studies measured baseline bmi , only nine reported follow - up bmi values as an outcome .
the range of bmi losses was 1.1 to 5.1 kg / m , with an average loss of 3.1 kg / m .
twenty studies measured % body fat , all finding losses ( 0.7 to 10.2% ) , with an average decrease of 5.1% .
the range of fat mass lost was 0.9 to 14.9 kg , and the average decrease was 6.6 kg . all of the studies found a decrease in weight , and those that measured bmi showed decreases that were in agreement with the weight losses .
that is , there was no discrepancy between the interpretations of weight and bmi changes , though weight loss showed greater changes than bmi .
most of the weight lost was accounted for by fat loss . in control groups that included diet
only interventions , the percentage of fat lost was significantly greater in the diet + pa groups , while the diet + pa groups preserved or increased their fat - free mass more so than control ( diet only ) groups .
overall , all of the studies had agreement between the weight or bmi and body composition measure(s ) .
two studies were discrepant between the significance of the measures : one had a borderline significant reduction in fat mass , with a significant weight decrease , and the other had a more significant reduction in fat mass and % body fat than weight .
overall agreement did not describe the variability among weight loss measures completely . across studies ,
the losses of fat mass and % body fat were proportionally greater than losses of bmi or weight and , in one instance , fat mass or % body fat losses were more significantly different before and after intervention than the overall weight or bmi losses . while there is some redundancy across weight loss measures , body composition was a consistent measure of success in these studies , with all of the studies that reported it finding decreases after intervention in parallel or more so than weight or bmi decreases .
this review focused on evaluating measures of success in diet and pa weight loss interventions for adults .
there was heterogeneity across studies in terms of designs , settings , participants , and types of outcome measures .
all of the studies demonstrated agreement across measures ( weight or bmi and % body fat or fat mass ) .
while not a primary focus of this review , several studies reported that fat - free mass was preserved or increased following the interventions that included pa .
the conclusions from measures of weight or bmi and body fat % or fat mass were largely in agreement and body fat is more metabolically informative than overall weight .
thus , it can be proposed that measuring body fat should be considered a primary outcome of weight loss studies . in aggregate ,
the data presented here support the conclusion that measuring % body fat or fat mass before and after weight loss interventions that include diet and pa may be the most efficient and informative measure of success or change .
underwater weighing is the gold - standard , but it can be unpleasant and inconvenient and often not feasible for obese participants .
dexa , which was commonly used in the studies reviewed here , is highly accurate but expensive [ 17 , 21 , 22 ] .
however , given the increased precision of measurement , the cost of dexa scans may be justifiable for research groups , with long - term use .
bia is also commonly used to measure fat , but its accuracy is more questionable and likely depends on different equations used to estimate body composition and the quality of the equipment [ 17 , 23 ] .
skinfold thickness is an inexpensive and useful method for large surveillance studies , but its accuracy and reliability are variable , depending on rater training and precision of caliper location [ 17 , 23 ] .
body fat also is the most metabolically harmful tissue type , so it makes sense to promote its measurement over others [ 11 , 12 , 15 , 16 ] .
further , just as weight and bmi do not provide nuanced measures of health , body fat mass is a similarly gross measure .
body fat % may be a more indicative measure of health , as it allows more specificity by accounting for other tissue types ' contributions to weight and body composition . as bmi and weight are ubiquitous in weight loss studies , it is not likely that a paradigm shift will occur quickly , in which measurement shifts to focus on % body fat .
further , most people do not know their body fat percentage or have a context for its interpretation the way people do for weight and , increasingly , bmi .
however , healthy body fat % ranges do exist for different ages and genders [ 13 , 24 ] , and these values could become more commonly evaluated and discussed .
the evidence presented herein suggests that % body fat should become more of a primary measure of health and weight loss success , as it provides a succinct and meaningful indication of a person 's body composition , and likely disease risk , than weight , bmi , and fat mass .
while this may introduce bias , most of the countries that bear the largest burden of adult obesity are economically developed and english - speaking .
so it is unlikely that many contradictory or critical studies have been published in other languages . as with all reviews ,
while , at this stage of research , this problem is mostly inevitable , future studies may become more homogenous in measurement and reporting of outcomes if they follow the consort and equator network guidelines .
another limitation is that most studies did not describe their attrition rates . of those that did , many had high loss , over the 20% considered acceptable for weight loss studies .
attrition is an important consideration for generalizing the results of this and other studies , so more consistent reporting is necessary , along with improved strategies for retaining participants in weight loss studies .
there is a concern that authors and journal editors typically prefer to show weight / fat loss , and so there is a risk of positive publication bias in this field .
indeed , while we know that when properly carried out , diet and pa studies do promote fat loss , many interventions suffer from attrition , loss of participant motivation , and weight / fat regain over time ; most studies presented here do not include long - term follow - up data .
it is likely that many studies with negative findings do not make it into the published literature .
unfortunately , there is no way to tell how many of those studies existed ( particularly before the nih clinical trials registry : http://clinicaltrials.gov/ ) , but everyone in the weight loss research field should consider results with this caveat in mind . risk of bias in individual studies also merited attention . while , ideally , this would have been assessed , most studies did not provide enough information to make consistent or relevant judgments of bias ( i.e. , blinding is not possible in weight loss trials and attrition and funding sources were not always reported ) .
four out of the 28 studies ( 8.5% ) reported funding conflicts of interest , indicating a low risk of bias .
the risk of bias in the present review is also minimal , as the author had no sources of financial support in its creation . in conclusion ,
% body fat in addition to or along with weight , bmi , and fat mass appears to be a useful , consistent , and meaningful measure of success in adults weight loss studies .
it is recommended that researchers include it as a primary outcome measure in future studies . | background . measuring success of obesity interventions is critical . several methods measure weight loss outcomes but there is no consensus on best practices
.
this systematic review evaluates relevant outcomes ( weight loss , bmi , % body fat , and fat mass ) to determine which might be the best indicator(s ) of success . methods .
eligible articles described adult weight loss interventions that included diet and physical activity and a measure of weight or bmi change and body composition change . results .
28 full - text articles met inclusion criteria .
subjects , settings , intervention lengths , and intensities varied .
all studies measured body weight ( 2.9 to 17.3 kg ) , 9 studies measured bmi ( 1.1 to 5.1 kg / m2 ) , 20 studies measured % body fat ( 0.7 to 10.2% ) , and 22 studies measured fat mass ( 0.9 to 14.9 kg ) .
all studies found agreement between weight or bmi and body fat mass or body fat % decreases , though there were discrepancies in degree of significance between measures .
conclusions .
nearly all weight or bmi and body composition measures agreed .
since body fat is the most metabolically harmful tissue type , it may be a more meaningful measure of health change .
future studies should consider primarily measuring % body fat , rather than or in addition to weight or bmi . |
the presence of an idic(ph ) chromosome(s ) represents a mechanism for genomic bcrabl1 amplification and may contribute to resistance against targeted therapies based on imatinib or dasatinib . a 52yearold , previously healthy man presented to his local ed with worsening right groin pain of 2months duration , which began after a traumatic fall with direct trauma to that site . at that time
, he was discharged home from the ed with a diagnosis of rectus sheath hematoma .
his pain continued to progress , and he returned to the ed where repeat ct demonstrated worsening hematoma size and a cbc showed significant leukocytosis .
the patient was transferred to our hospital with a concern for leukemia . at our institution ,
the admission white blood cell count ( wbc ) was 116.4 10/l with a differential consisting of 70% neutrophils , 3% metamyelocytes , 6% myelocytes , 2% promyelocytes , 7% lymphocytes , 5% eosinophils , 4% basophils , and 3% blasts ( fig .
the platelet count was 506 10/l and the hemoglobin level was 10.5 g / dl .
( a ) the peripheral blood smear shows a leukocytosis with neutrophils at various stages of maturation , a basophilia ( < 20% ) , and 3% blasts ; ( b ) the marrow is hypercellular with diffuse granulocytic proliferation and numerous dwarf megakaryocytes ; ( c ) bcrabl1 fish showed a variant fusion pattern ( 3 fusions ; 1 orange ; 1 green ) ; ( d ) chromosome analysis revealed an abnormal male karyotype with an isodicentric philadelphia chromosome ; ( e ) metaphase fish studies show the presence of two bcr / abl1 fusion signals on the idic(ph ) chromosome .
peripheral blood flow cytometry showed an increased granulocyte population with leftshifted maturation and myeloblasts accounting for about 2.5% of the total events .
a bone marrow biopsy showed findings consistent with cml including marked marrow hypercellularity with leftshifted granulocytic preponderance , numerous dwarf megakaryocytes , and 3% blasts ( fig . 1b ) .
fluorescence hybridization ( fish ) analysis on the bone marrow with bcrabl1 dualcolor , dualfusion probes revealed three distinct bcr / abl1 fusion patterns .
the typical bcr / abl1 fusion pattern was observed in 31% of interphase nuclei analyzed . a variant bcr / abl1 fusion pattern ( 3 fusions ; 1 orange ; 1 green )
1c ) and 2.5% of nuclei showed 4 fusions ; 1 orange ; and 1 green pattern .
karyotyping studies revealed the presence of an isodicentric philadelphia chromosome , 46,xy , der(9)t(9;22)(q34;q11.2),22,+ider(22)(q10)t(9;22)(q34;q11.2 ) , in all 20 analyzed metaphases ( fig .
additional metaphase fish studies with bcr / abl1 probes showed the localization of two fusion signals on the isodicentric philadelphia chromosome and another fusion signal on the derivative chromosome 9 ( fig .
bcrabl1 fusion transcripts were at the level of 100% on the international scale ( is ) .
two weeks later , the wbc trended down to 40 10/l and ldh level was 299
the 3month followup visit showed complete hematological response , with the bone marrow showing morphologic remission and a normal karyotype ( 46,xy ) by unstimulated bone marrow culture .
however , pcr studies for the mutant transcript showed that there was lack of a major molecular response ( mmr , defined as < 0.1% on the is ) with bcrabl1 transcripts at 6.12% on the is .
the patient is clinically well and continues to be followed closely in the clinic at this time
. chronic myeloid leukemia ( cml ) is linked to the philadelphia chromosome t(9;22)(q34;q11.2 ) , which results in the formation of a chimeric bcrabl1 gene fusion . by binding to the kinase domain of abl1
, imatinib mesylate inhibits the function of the fusion gene and is a highly effective therapy .
. mechanisms of resistance against imatinib treatment may include mutations within the abl1 kinase domain , genomic bcrabl1 amplification and clonal evolution 1 .
very few cases of cml with the presence of idic(ph ) chromosome(s ) have been reported in the literature .
the idic(ph ) chromosome has generally been observed in accelerated phase or in blast phase of cml 2 , 3 .
in other cases , idic(ph ) chromosome(s ) were observed as a secondary chromosomal abnormality in patients resistant to imatinib mesylate or dasatinib 1 , 4 , 5 , 6 . in our patient ,
the idic(ph ) chromosome was observed at diagnosis with 3% blasts , suggesting the presence of idic(ph ) in chronic phase .
additional studies will help in clarifying the prognostic significance of the presence of idic(ph ) chromosome during the chronic phase of cml .
to date , only one other study reported the occurrence of idic(ph ) chromosome during chronic phase cml , and this case was associated with lack of hematological and cytogenetic response despite administering higher doses of imatinib 7 .
| key clinical messagean isodicentric philadelphia chromosome is an uncommon finding previously described as a secondary chromosomal abnormality in accelerated or blastphase of chronic myeloid leukemia ( cml ) with resistance to imatinib mesylate or dasatinib . here ,
we present a case with idic(ph ) chromosome identified at initial diagnosis in a patient with chronicphase cml . |
testis tumors are rare , but it is the most common solid tumor in men under 45 years of age .
although intracardiac metastases of testicular germ cell tumors occur rarely in clinics , they may lead to the congestive heart failure , paradoxical systemic emboli and vena cava superior syndrome with disseminated involvement of the right or left heart [ 25 ] .
lung cancer and breast cancer are the most frequent tumors that lead to metastases to the heart .
. revealed that the most common metastatic sites for testicular carcinoma are the lungs , liver , brain , and bone whereas intracardiac metastases are found in less than 1% of patients . here ,
we report a patient with a prediagnosis of testis tumor and developed symptoms of the cerebrovascular accident and heart failure .
a 38-year - old man admitted to hospital with the complaint of swelling in the left testis for the last 3 months .
scrotal ultrasonography revealed heterogeneous and hypoechogenic solid mass lesion in the left testis with 9 x 6 cm dimensions .
thoracic computed tomography ( ct ) showed many bilateral parenchymal metastatic lesions in the lungs , the biggest one was 7 x 9 x 11 cm in dimensions and located in the left upper paramediastinal region ( fig .
serum -hcg was 89.7 iu / ml and afp was 1050 ng / dl . computed tomography of thorax shows extension of metastatic mass in the lung to the left atrium via left lower pulmonary vein and the filling defect created by it while the patient had been followed up by the medical oncology department , a cerebrovascular accident ( cva ) developed and symptoms of nyha class 4 heart failure were detected .
echocardiography revealed a mass attached to the mitral valve with 18 x 52 mm in dimensions and filling two thirds of the left atrium .
mass image in the left atrium by echocardiography under general anesthesia , after median sternotomy , cardiopulmonary bypass was started with bicaval cannulation .
left atrium was explored and a 5 x 3 cm pedunculated fragile mass was seen in the left atrium .
the pedicle was extending to the left lower pulmonary vein and was probably a part of metastatic mass in the left lung .
the left atrial space was irrigated by saline after excision and there was no residual mass .
b ) macroscopic appearance of the mass after excision the patient was taken to the postoperative intensive care unit for 1 day and discharged on the 6 postoperative day .
he was taken to the medical oncology department for therapy . symptoms of the patient declined to nyha class 1 postoperatively .
pathologic examination of the left atrial mass with a large amount of polypoid tissue revealed hypocellular mesenchymal tissue consistent with a non - seminomatous germ cell tumor metastasis .
microscopically teratoid glandular and ductular structures lined by columnar or squamous epithelial cells were seen in an edematous and hemorrhagic fibrous stroma .
immunohistochemically , while teratoid areas were stained with pankeratin , choriocarcinoma areas were stained with hcg ( fig .
d ) choriocarcinomatous component was stained with hcg antibodies ( x100 ) metastatic testicular germ cell tumor was diagnosed and bep ( bleomycin , etoposide , cisplatin ) chemotherapy protocol was started 15 days after the surgery .
the patient did not have any problem in wound healing during the follow - up .
the thoracic ct at sixth month 's control showed regression in the pulmonary mass and no recurrence in the cardiac cavity ( fig .
computed tomography shows regression of metastatic mass in the lung and no filling defect in the cardiac cavity
testicular tumors are among the tumors with the best therapy success and the longest survival .
five - year survival rate is 90% without distant metastases and 60% with distant metastases .
cardiac metastases are rare in malignant tumors and their incidence ranged between 1.5% and 18.3% in various reports .
based on autopsy reports of 1029 patients with malignancy , the most frequent metastasis occurs in pericardium and the most frequently metastasizing tumor is lung cancer which is followed by lymphoma , breast cancer and esophagus cancer .
the most common sites of metastasis in testis tumors are paraaortic lymph nodes , mediastinal lymph nodes , lungs and supraclavicular fossa .
the incidence of metastatic involvement of cardiac endothelium and valvular surface due to testis tumors is 3.8% and it is considered that hematogenous spread via vena cava inferior is the main route .
chest pain , newly developed effusion , symptoms of tamponade , increase in the dimensions of the heart , new murmurs , new electrocardiography ( ecg ) changes and unexplained cardiac failure may point out to cardiac metastasis in patients with a neoplastic disease .
in addition , dizziness , hypotension , loss of consciousness , and seizure may indicate embolization to the brain and intracardiac mass . in literature , cases of right atrial mass and right heart failure are more common , but our case showed left atrial mass and symptoms of left heart failure .
there was no recurrence at the postoperative 6 month follow - up visit . in conclusion ,
cardiac output can be corrected by radical cardiac surgery in malignant germ cell testicular tumors with cardiac involvement .
although cardiac involvement has been related to short survival and worse prognosis , tumor type , tumor marker levels and the number of metastatic sites may affect prognosis .
the resulting clinical status in this patient encouraged us to conclude that a patient with disseminated cancer can be operated for treatment purposes .
developments in imaging techniques and surgical methods enable curative treatment choices in such patients during metastatic stages .
| although intracardiac metastasis of germ cell tumors is rare , it can be localized in the right or left heart by disseminating spread and give their cardiac symptoms depending on the location of metastatic mass .
we present a 38-year - old male patient with a preliminary diagnosis of testicular tumor who was followed by the medical oncology clinic with cerebrovascular event and heart failure symptoms . |
median arcuate ligament syndrome ( mals ) or celiac artery compression syndrome is a rare disorder caused by compression of celiac artery by the median arcuate ligament .
clinical symptoms include postprandial abdominal pain , nausea , vomiting , epigastric bruit and weight loss .
most of the patients with this syndrome are investigated with several diagnostic procedures and managed as functional gastrointestinal disorder ( fgid ) before a certain diagnosis is established .
doppler ultrasonography reveals the stenosis / compression of celiac artery with increased flow velocity and computed tomography ( ct ) angiography confirms the compression of celiac trunk and therefore the diagnosis of mals .
we report a case of a teenage female patient treated with laparoscopic release of the median arcuate ligament at our institution .
a 17-year - old girl with chronic postprandial abdominal pain and weight loss was referred to our clinic .
the other causes of chronic abdominal pain were investigated by several studies including gastrointestinal endoscopies and imaging ; however , no definitive cause could be identified .
peak systolic velocity ( psv ) in the celiac trunk was measured as 250 cm / s , and dropped to 170 cm / s with deep inspiration ( psv = 80 cm / s ) .
diagnosis was confirmed by three - dimensional ( 3d ) ct angiography confirming the narrowing of celiac artery at the beginning of the celiac trunk arising from abdominal aorta [ figure 1 ] .
the narrowing of celiac artery at the beginning of the celiac trunk was demonstrated on computed tomography angiography the procedure was carried out via four 5 mm trocars .
after opening the lesser omentum , crural fibers of diaphragm was dissected to expose median arcuate ligament .
, arcuate ligament was dissected above celiac artery and released with a sealing device ( ligasure ; covidien ) [ figure 2 ] .
after the releasing of the ligament , celiac trunk was free , and pulsation can be seen clearly at the distal branches of celiac artery .
there were no intraoperative complications and the patient was discharged on the second postoperative day . in the postoperative period , patient was admitted to our clinic with recurrent symptoms of mild abdominal pain .
psv in the celiac trunk was measured as 202 cm / s , and dropped to 162 cm / s with deep inspiration ( psv = 40cm / s ) .
also , 3d ct angiography was performed to demonstrate the improvement in narrowing of celiac artery .
although the pain was described to be of lower intensity when compared with presurgical state , it continued to be disturbing and required frequent use of analgesics .
therefore , the patient was referred to the pain management service in the department of anesthesiology for paraspinal ganglion blockage .
the patient is free of symptoms in the 9-month follow - up , gained weight and resumed normal daily activity .
since the first description of mals in 1961 , there are several debates in the diagnosis and treatment of this rare clinical entity .
postprandial abdominal pain , vomiting , and weight loss are the typical clinical symptoms for this syndrome
. however , these patients are frequently diagnosed and treated as fgid before the correct diagnosis is confirmed .
it is speculated that compression on celiac artery may result in impairment of intestinal perfusion , especially following enteral intake , and results in intestinal angina .
other investigators , on the other hand , implicate that the course is a neurological pathology of the celiac ganglion , and consider this disease a primary neurological disorder .
several management strategies are instituted for the treatment of mals including interventional angioplasty or stenting and surgical procedures such as releasing of the median arcuate ligament compressing the celiac artery or bypass surgeries .
the releasing of the ligament may be done by open , laparoscopic or robotic surgery .
minimally invasive techniques have gained popularity in the surgical management of this condition limiting open surgery to more complicated celiac by - pass procedures which do not appear in the pediatric surgical literature .
minimally invasive techniques are very efficient in approaching to this surgical site and may be performed safely by an experienced surgeon .
there are reports in the literature that complete resolution of symptoms may not be achieved in some patients as in our case .
some patients may require prolonged use of analgesics while some others may necessitate para - spinal celiac ganglion blockage as an additional measure to completely alleviate the symptoms .
mals should be considered in the differential diagnosis of patients with chronic abdominal pain , especially in those that are triggered postprandially .
the diagnosis of fgid virtually requires to be scrutinized if the symptoms are persistent , and should be compelling for the physician / surgeon to search for this perhaps more frequent but rarely recognized entity . doppler ultrasonography revealing increased psv on celiac artery and ct angiography demonstrating compression on the truncus are diagnostic .
laparoscopic release of the median arcuate ligament is safe and effective technique in the management of this disorder .
| median arcuate ligament syndrome is a rare disorder characterized by chronic postprandial abdominal pain and weight loss caused by compression on celiac artery .
a 17-year - old girl with chronic severe abdominal pain and weight loss was referred to our clinic .
other causes of chronic abdominal pain were investigated and excluded .
the compression on celiac artery was detected on doppler ultrasound and diagnosis was confirmed by computed tomography angiography .
the patient underwent laparoscopic release of median arcuate ligament .
there were no intraoperative complications ; however , partial pain response was observed postoperatively that necessitated para - spinal ganglion blockage .
the patient is symptom - free in 1-year follow - up period . |
hence , compounds that selectively modulate the action as well as the levels of endocannabinoids represent templates for potential new therapeutic strategies . in this sense
, the exogenous administration of the endocannabinoid anandamide is known to induce the decrease of blood pressure in spontaneously hypertensive rats as well as in wistar rats fed with a high - salt diet .
inhibition of the fatty acid amide hydrolase , enzyme involved in intracellular anandamide degradation , normalizes the cardiovascular function in hypertensive rats without producing adverse metabolic effects .
estrogens are also positive modulators of the anandamide effects at the vascular wall since they stimulate the release of anandamide from human endothelial cells as well as potentiate the anandamide - induced vasorelaxations by increasing the bioavailability of the calcitonin - related peptide ( cgrp ) in the rat mesenteric vasculature .
this potent vasodilator peptide is released , at least in part , as a consequence of the activation of the transient receptor potential vanilloid type 1 ( trpv1 ) by anandamide .
phytoestrogens , such as genistein and daidzein , are able to activate estrogen receptors which confer to them weak estrogen - like activity . they are associated with a favorable cardiovascular risk profile and therefore constitute an interesting food - based alternative to the hormone replacement therapy during the menopausal transition in women . since in a variety of rat cell lines phytoestrogens inhibit anandamide uptake by blocking the fatty acid amide hydrolase , it is possible that phytoestrogens also regulate the vascular effects of anandamide .
hence , the aim of the present study was to elucidate whether oral administration of the soy - derived phytoestrogens genistein and daidzein modulates the anandamide - induced reductions of the contractions to na in the rat isolated mesenteric bed that was used as an in vitro model of the adrenergic hyperactivity that usually precedes the onset of primary hypertension .
the hypothesis is that the endocannabinoid system could be another target , in addition to nitric oxide , prostanoids , and antioxidant defense genes , for the beneficial cardiovascular actions proposed for phytoestrogens [ 13 , 14 ] .
male and female sprague - dawley rats were housed under a 12 : 12 h light : dark cycle , at controlled room temperature with food and water ad libitum .
experiments were conducted in accordance to the guide for the care and use of laboratory animals of the national research council ( usa , 1996 ) .
adult female rats ( 810 weeks , 165200 g body weight ) were either bilaterally ovariectomized ( ovx ) or sham - operated through dorsal incision , under anaesthesia ( 4060 mg / kg ketamine hydrochloride + 10 mg / kg xylazine hydrochloride ) . after 21 days of endogenous hormonal decline , the animals were randomly allocated to either drug - treated or vehicle - treated groups .
dose and duration of treatment with phytoestrogens were selected on the basis that they reverted partially , but significantly the uterine atrophy caused by ovariectomy that is considered a parameter of estrogenic activity . according to this , genistein ( 10 mg / kg ) or daidzein ( 1020 mg / kg ) was administered by oral gavage ( p.o . ) once daily during three days .
drugs were dissolved in dimethylsulfoxide ( residual concentration < 1% ) and were diluted in corn oil .
some intact as well as ovx female rats treated with phytoestrogen received concomitant subcutaneous administrations of the estrogen receptor antagonist 2.5 mg / kg fulvestrant ( ici 182,780 ) dissolved in ethanol and diluted in corn oil .
adult male ( 250350 g ) and female ( 230350 g ) sprague - dawley rats were anaesthetized with urethane ( 1.2 g kg body weight ) , the abdomen was opened , and the mesenteric vascular bed was cannulated and removed according to .
the isolated mesenteric bed was transferred to a perspex chamber and perfused with the krebs solution at 37c bubbled with 95% o2 plus 5% co2 at a constant flow rate of 2 ml / min , maintained by a peristaltic pump .
changes in vascular resistance were measured as changes in perfusion pressure and recorded through a statham pressure transducer connected to a grass polygraph .
up to nine consecutive , 20 min apart bolus injections of noradrenaline ( na ) were performed in one preparation because the short contractile responses induced by this drug are highly reproducible . on the contrary , the sustained contractions that are obtained whenever
the agonists are added to the perfusate are difficult to reproduce in the same preparation .
table 1 shows that the contractile responses to na in the mesenteric bed had similar magnitudes between the groups ( e.g. , males and intact and ovariectomized females ) .
moreover , phytoestrogen treatment did not modify per se either the basal tone or the reactivity to na ; respect to the vehicle - treated groups .
to evaluate anandamide - induced effect , after the first na bolus injection considered as control , cumulative anandamide concentrations were perfused during 20 min , and the responsiveness to na ( a submaximal pressor effect , i.e. , 40 to 60 mm hg ) was challenged on every one concentration .
anandamide was dissolved in ethanol ( < 0.1% ) , and further dilutions were made in the krebs solution .
no effects on basal tone of mesenteries isolated from either male or female rats were observed for any concentration of anandamide .
deeply anaesthetized rats were fixed by transcardiac perfusion with pbs containing 4% w / v paraformaldehyde , and mesenteric vascular beds were dissected .
the endogenous peroxidase activity was blocked with 1% h2o2 , and the preparations were permeabilized with 0.2%
overnight incubation at room temperature with 1/3,000 anti - cgrp antibody ( sigma aldrich , st . louis , mi , usa ) and 1 h incubation with 1/200 goat anti - rabbit peroxidase conjugated antibody ( sigma aldrich , st .
several branches of each mesenteric bed were not incubated with the primary antibody to obtain the corresponding controls .
peroxidase activity was evidenced with diaminobenzidine in an eclipse 50i nikon light microscope equipped with a video camera nikon ds - sm .
relative area ( stained / total area ) per field and the difference between anti - cgrp - incubated tissues and the corresponding controls were measured .
morphometric analysis was performed with image j software ( 1.34 s national institutes of health usa ) .
( )-noradrenaline bitartrate , genistein , and daidzein were obtained from sigma - aldrich ( st louis , mi , usa ) .
data are presented as the mean sem ( n = 4 to 6 ) of the percent reductions of the initial contraction to na and were analyzed by two - way analysis of variance followed by bonferroni 's post hoc t - test .
one - way analysis of variance followed by dunnett 's multiple comparison tests were performed for the immunohistochemical assays as well as for noradrenaline - induced contractions .
as shown in figure 1 , the endocannabinoid anandamide reduced , in a concentration - dependent manner , the transient contractions elicited by 10 nmol na in mesenteric beds isolated from either male or female sprague - dawley rats .
the oral administration of the phytoestrogen genistein ( 10 mg / kg ; daily during 3 days ) significantly potentiated the effect of anandamide in mesenteric beds isolated from female but not from male mesenteric beds . in turn
, a 3-day treatment with the soy - derived phytoestrogen daidzein did not modify the anandamide - induced reduction of contractile responses when administered at a dose of 10 mg / kg to either female ( figure 2(a ) ) or male rats ( figure 2(b ) ) but did significantly increase the anandamide effects in mesenteries isolated from female rats when dose was scaled up to 20 mg / kg ( figure 2(c ) ) .
the oral administration of the phytoestrogen genistein ( 10 mg / kg ; daily during 3 days ) significantly potentiated the effect of anandamide in mesenteric beds isolated from female but not from male mesenteric beds .
twenty - one days after ovariectomy , the ability of anandamide to decrease the contractile response to na in mesenteric arteries declined significantly ( compare intact females in figure 1 and untreated ovx females in figure 3 ; p < 0.001 ) . figure 3 shows that a 3-day treatment with either 10 mg / kg genistein or 20 mg / kg daidzein could restore anandamide - induced vascular effects in ovx rats . on the other hand ,
no effects were evidenced by treatment with 10 mg / kg daidzein ( figure 3(b ) ) .
the estrogen receptor antagonist fulvestrant ( 2.5 mg kg , s.c . during 3 days ) did not modify per se the anandamide - induced reductions of precontracted arteries either in intact ( figure 4(a ) ) or in ovx ( figure 5(a ) ) females rats but significantly prevented the potentiation on anandamide - induced effects caused by either 10 mg / kg genistein or , 20 mg / kg daidzein in intact ( figures 4(b ) and 4(c ) ) as well as in ovx female rats ( figures 5(b ) and 5(c ) ) .
as shown in figure 6 , the density of the cgrp - containing fibers surrounding mesenteric arteries was markedly reduced by ovariectomy and significantly restored after a 3-day oral treatment with 10 mg / kg genistein . moreover , when animals were concomitantly treated with genistein and fulvestrant , the enhancing effect of genistein was not observed .
a similar profile was found after a 3-day oral treatment with 20 mg / kg but not with 10 mg / mg daidzein ( figure 7 ) .
the present study shows that oral administration of the soy - derived phytoestrogens genistein and daidzein daily during 3 days enhanced the decrease in the contractile responses to na induced by anandamide in mesenteric arteries isolated from female but not from male rats .
taking into account that the anandamide effect is already greater in female mesenteries compared to males , the enhancing effect of the phytoestrogens shown here in female rats adds to the overall sex differentiation in this model .
the tissue was selected because it represents a group of resistance vessels that greatly contributes to the maintenance of the total peripheral vascular resistance [ 17 , 18 ] .
precontractions to na were used to resemble the effects of the adrenergic hyperactivity in vascular tissues that usually precedes the onset of primary hypertension . the observation that the anandamide - induced relaxations in the ovx rats were restored by a 3-day oral administration of phytoestrogens ( present results ) to the same extent as that produced by
17-estradiol administration suggests that a common site of action , namely , estrogen receptors ( er ) , could be involved in both cases . in support of this view is the finding that in intact as well as in ovx female rats the facilitatory effect of phytoestrogens was counteracted by the er antagonist fulvestrant .
moreover , a direct effect of phytoestrogens on the contractility to na is precluded on the basis that no differences were observed in the responsiveness to na between male and age - matched female rats after treatment with genistein or daidzein ( and present results ) .
the fact that , as previously observed for 17-estradiol , the 3-day oral treatment with either 10 mg / kg genistein or 20 mg / kg daidzein restored the decrease in the density of cgrp - containing perivascular fibers in mesenteries isolated from ovx rats could indicate that the modulation of cgrp levels contributes , among other factors , to the ability of phytoestrogens to potentiate the effect of anandamide in the mesenteric vasculature .
in addition , this finding is supported on the basis that the presence of fulvestrant completely prevented the enhancing effect of phytoestrogens on cgrp perivascular levels .
this hypothesis agrees with previous evidence showing that mesenteric availability of cgrp underlies the ability of anandamide to reduce the contractile responses to na in mesenteric arteries .
similarly , a cause - effect relationship between estrogen levels and cgrp arises from the observation that cgrp - containing fibers density is faded after ovariectomy and restored by estradiol treatment in sensory and perivascular neurons [ 6 , 19 ] . specifically related to phytoestrogens
, it was reported that a diet with fujiflavone p40 , a soybean isoflavone product , completely reverses the decrease in the levels of the mrna coding for cgrp in dorsal root ganglion neurons , as well as the diminutions of the gastric tissue levels of cgrp in ovx rats . in this sense
, the lack of effect of oral treatment with 10 mg / kg daidzein agrees with the present observation that 10 mg / kg daidzein did not counteract the decrease in mesenteric cgrp content caused by ovx .
this observation is consistent with previous evidence showing that genistein is 10 to 100 times more potent than daidzein and that this difference is linked to a higher affinity of genistein for er , as observed for the modulation of the expression of enzymes that metabolize 17 -estradiol in cultured mcf-7 cells . on the other hand ,
the fact that phytoestrogens enhanced anandamide - induced effects selectively in the vasculature of female rats ( present results ) differs from the potentiation caused by 17-estradiol in this tissue that is only observed in males .
this discrepancy could arise from the fact that the sex - related differences in the rat vasculature , which include variations in the density and distribution of er subtypes , could only become evident when tissues are exposed to compounds , such as genistein and daidzein , that are known to possess a 1000-times lower estrogenic activity than estradiol and are supposed to act as erbeta partial agonist . in accordance to this , vasodilation to genistein but not to
17-estradiol is enhanced in postmenopausal women suffering coronary heart disease that express high erbeta in the vascular wall . however , a more extensive analysis of the estrogen receptor subtypes involved in the vascular effects of anandamide , including variations in the density and distribution of er subtypes in the mesenteric bed of male and female sprague - dawley rats , is necessary to reinforce this possibility . moreover ,
the lack of effect of phytoestrogens in males ( present results ) could rely on the fact that phytoestrogens modify male gonadal steroids levels [ 24 , 25 ] . in support of the latter ,
it was reported that the control of anxiety - related behaviours produced by the systemic administration of phytoestrogens in male rats depends on the gonadal status . at the molecular level
, the fatty acid amidohydrolase ( faah ) , the major anandamide - hydrolyzing enzyme , is a potential locus for an interaction between oestrogens and endocannabinoid signalling .
the faah enzyme possesses an oestrogen response element in its genetic sequence , and translocation of the oestrogen receptor to the nucleus results in inhibition of faah transcription that leads to an increase in the anandamide signalling .
since genistein and daidzein inhibit the fatty acid amidohydrolase in vitro , the possibility exists that , at least in part , the modulatory effect of phytoestrogens on the anandamide - induced reductions of the contractility to na could involve the increase of anandamide levels . nevertheless , this possibility is likely to be precluded since the faah inhibitor pmsf is devoid of effects on anandamide - induced vasodilations in the rat mesenteric vascular beds isolated from either sex , as well on anandamide actions in other rat tissues , namely , the brain . in conclusion , this is the first evidence that the soy - derived phytoestrogens , genistein and daidzein , modulate positively the reduction of the contractility to na produced by anandamide in the mesenteric vasculature and supports the hypothesis that the endocannabinoid system could be a target for the beneficial cardiovascular actions of dietary phytoestrogens , as proposed before for estrogens .
finally , the present results give further support to the view that a dietary intervention with an isoflavone - enriched soy extract , acting at the cardiovascular level with minimal impact in the reproductive tract , could have implications for women 's cardiovascular health , for example , enhancing the vasorelaxation of small arteries whenever increased adrenergic hyperactivity occurs . | in rat isolated mesenteric beds that were contracted with na as an in vitro model of the vascular adrenergic hyperactivity that usually precedes the onset of primary hypertension , the oral administration ( 3 daily doses ) of either 10 mg / kg genistein or 20 mg / kg daidzein potentiated the anandamide - induced reduction of contractility to na in female but not in male rats . oral treatment with phytoestrogens also restored the vascular effects of anandamide as well as the mesenteric content of calcitonin gene - related peptide ( cgrp ) that were reduced after ovariectomy .
the enhancement of anandamide effects caused by phytoestrogens was prevented by the concomitant administration of the estrogen receptor antagonist fulvestrant ( 2.5 mg / kg , s.c .
, 3 daily doses ) .
it is concluded that , in the vasculature of female rats , phytoestrogens produced an estrogen - receptor - dependent enhancement of the anandamide - vascular actions that involves the modulation of cgrp levels and appears to be relevant whenever an adrenergic hyperactivity occurs . |
in 1955 , pepys postulated that histamine ( ha ) could affect the immune response . since then , the influence of ha on immune and inflammatory reactions has been well documented . in the late 1970s and early 1980s ,
watanabe 's , schwartz 's , and panula 's groups in japan , france , and finland , respectively , demonstrated the presence of ha in the brain where this ancestral biogenic amine acts as a neurotransmitter and neuroimmune modulator [ 13 ] .
ha is at a privileged position to display multiple pleiotropic functions in peripheral tissues and in the central nervous system ( cns ) .
ha is synthesized by histidine decarboxylase ( hdc ; ec 4.1.1.22 ) from l - histidine in different cellular compartments ( mast cells , basophils , glial cells , endothelial cells , and neurons ) .
ha acts through different types of ha receptors ( h1r , h2r , h3r , and h4r ) . h1r and
h2r are widely distributed in most cells and tissues ; however , h3rs are mainly expressed in the cns , and h4rs are expressed in hematopoietic cells , indicating their function in neurotransmission and immunomodulation , respectively .
the h3r is a recognized drug target for neuronal diseases , such as cognitive impairment , schizophrenia ( scz ) , sleep / wake disorders , epilepsy , and neuropathic pain .
the organization of the brain histaminergic system shows a strategic disposition , with ha neurons located in the posterior hypothalamus , from where ascending pathways ( to the anterior hypothalamus , limbic structures ( hippocampus ) , neocortex , and subcortical structures ) and descending pathways ( to the brain stem and spinal cord ) are organized .
the interplay of brain ha in neurons , endothelial cells , glia , and mast cells is fundamental for the regulation of diverse physiological functions ( neuroendocrine system , circadian rhythms , sleep - wakefulness cycle , psychomotor activity , mood , learning , cognition , appetite , and eating behavior ) ; and alterations in multicompartment brain ha are involved in several pathological conditions , such as epilepsy , stroke , anxiety , depression , psychosis , neurodegeneration , and neuroinflammatory processes [ 3 , 5 , 6 ] .
brain ha is distributed in several compartments ( neuronal , glial , endothelial , and mast cells ) .
mast cells are connective tissue cells , discovered by ehrlich in 1887 , which are rich in metachromatic granules containing ha , heparin , and serotonin .
riley , west , and coworkers were the first to establish an association between mast cells and ha in 1953 , and benditt and colleagues showed , in 1955 , that mast cells also contained 5-hydroxytryptamine ( 5-ht ; serotonin ) . in 1953 , riley demonstrated that injection of ha releasers was followed by damage to mast cells .
examples of ha releasers include compound 48/80 , mast cell - degranulating peptide ( mcd ) , polylysine , polymyxin b , dextran , phosphatidylserine , melittin , f - met - tripeptides , c5a / c3a anaphylatoxins , c4a , calcium ionophore a23187 , and many cytokines and growth factors .
many , if not all , mast cells are innervated by varicose axons in different body structures , and even an axon reflex pathway involving mast cells was proposed in the skin by kiernan in 1965 .
mast cells originate from bone marrow hematopoietic cd34 progenitor cells , which enter the circulation and migrate to distal tissues where they ultimately reside .
mature mast cells are a heterogeneous population of cells with various phenotypes depending on their location .
mast cells express fcri , a high - affinity ige receptor , which upon activation induces exocytosis of cytoplasmic secretory granules , de novo synthesis of lipid - derived mediators , and release of cytokines , chemokines , monoamines , and growth factors .
mast cell secretory granules contain a great variety of mediators , such as histamine , serotonin , tryptase , chymase , and antizyme inhibitor 2 ( azin2 ) , an activator of polyamine biosynthesis whose catalyzing enzyme is ornithine decarboxylase .
mast cells are resident in the brain and contain numerous mediators , including neurotransmitters , cytokines , and chemokines , that are released in response to a variety of natural and pharmacological triggers .
brain mast cells are of two types , namely , metachromatic type i cells and normochromatic type ii cells , or neurolipomastocytoid cells . in mice devoid of mast cells ( w / w mice )
, the administration of -fluoromethylhistidine ( fmh ) , a suicide inhibitor of hdc , reduces the concentration of brain ha to nearly zero , suggesting that approximately 50% of the content of ha in the cns belongs to the nonneuronal pool [ 9 , 10 ] .
the presence of mast cells in meninges and perivascular locations on the brain side of the bbb , especially in thalamic and hippocampal regions , may indicate that this cell type is relevant in neurovascular responses .
the number of mast cells in the brain fluctuates with stress and various behavioral and endocrine states .
some mast cell mediators are synthesized upon activation ( e.g. , neuropeptides , cytokines ) while others are preformed and stored in granules from which they are rapidly released ( e.g. , serotonin , histamine ) .
mast cells can act via autocrine and paracrine mechanisms ; their secretions can reach a large space volume , and they can migrate to critical regions influencing neuronal activity , repairing tissue damage , or aggravating inflammatory processes within the cns .
these properties suggest that mast cells are poised to influence neural systems underlying behavior . using genetic and pharmacological loss - of - function models , nautiyal et al .
performed a behavioral screen for arousal responses including emotionality , locomotor , and sensory components and found that mast cell - deficient kit ( sash ) mice had a greater anxiety - like phenotype than wt and heterozygote littermate control animals in the open field arena and elevated plus maze .
blockade of brain , but not peripheral , mast cell activation increased anxiety - like behavior .
brain mast cells might be implicated in the modulation of anxiety - like behavior and provide evidence for the behavioral importance of neuroimmune links .
microglia can constitutively express ha receptors ( h1r , h2r , h3r , and h4r ) , and the expression of h1r and h4r can be selectively upregulated by ha in microglial cells in a dose - dependent manner .
ha induces tnf- and il-6 release from activated microglia via h1r and h4r - mapk and the pi3k / akt - nf - kappa b signaling pathway .
microglia express h2r , h3r , histidine decarboxylase , and histamine n - methyltransferase . both forskolin - induced camp accumulation and atp - induced intracellular ca transients are reduced by the h3r agonist imetit but not by the h2r agonist amthamine .
ha and imetit inhibit microglial chemotaxis , phagocytosis , and lipopolysaccharide ( lps)-induced cytokine production . ha and substance p can trigger microglial activation and release of proinflammatory factors from microglia , thus contributing to the development of microglia - mediated inflammation in the brain .
the interplay of brain ha in neurons , endothelial cells , glia , and mast cells is fundamental for the regulation of diverse physiological functions ( neuroendocrine system , circadian rhythms , sleep - wakefulness cycle , psychomotor activity , mood , learning , cognition , appetite , and eating behavior ) ; and alterations in multicompartment brain ha are involved in several pathological conditions [ 3 , 5 , 15 , 16 ] .
ha is implicated in the control of arousal state , exerting a potent phase - shifting effect on the circadian clock in the suprachiasmatic nucleus ( scn ) . to reset the circadian clock ,
ha increases [ ca]i in scn neurons by activating cav 1.3 channels through h1rs and secondarily by causing ca - induced ca release from ryr - mediated internal stores .
light has direct effects on sleep and wakefulness causing arousal in diurnal animals and sleep in nocturnal animals .
histaminergic neurotransmission attenuates the light - induced sleep response during the dark period . using knockout ( ko ) mice lacking hdc , parmentier et al
h1-receptor ko ( h1 ) mice share several characteristics with hdc ko mice , including a decrease in wakefulness after lights - off despite its normal baseline daily amount , a decreased eeg slow wave sleep ( sws)/w power ratio , and inability to maintain wakefulness in response to behavioral challenges .
yu et al . reported that gaba and ha are involved in the mechanisms of wakefulness .
ha neurons in the tuberomammillary nucleus ( tmn ) of the hypothalamus form a widely projecting , wake - active network that sustains arousal .
selective sirna knockdown of the vesicular gaba transporter ( vgat , slc32a1 ) in ha neurons produces hyperactive mice with an exceptional amount of sustained wakefulness .
optogenetic stimulation in the caudate - putamen and neocortex of ha axonal projections from the tmn evokes tonic , extrasynaptic gabaa receptor cl currents onto medium spiny neurons and pyramidal neurons .
thus , wake - active ha neurons may generate a paracrine gabaergic signal that serves to provide a brake on overactivation of ha and to increase the precision of neocortical processing .
yu et al . studied the contribution of one putative local clock in mouse histaminergic neurons in the tuberomammillary nucleus to the regulation of the sleep - wake cycle .
deletion of the bmal1 ( arntl / mop3 ) clock gene from ha cells removes this variation , producing higher hdc expression and brain ha levels during the day .
the consequences include more fragmented sleep , prolonged wakefulness at night , shallower sleep depth ( lower nonrapid eye movement [ nrem ] power ) , increased nrem - to - rem transitions , hindered recovery sleep after sleep deprivation , and impaired memory . removing bmal1 from histaminergic neurons does not , however , affect circadian rhythms .
there are important age- and sex - related changes in the concentration of ha and h1r in different regions of the cns [ 6 , 22 ] ( figure 1 ) .
dramatic changes in ha and h1r have been reported after surgical manipulation of the neuroendocrine system ( e.g. , castration , adrenalectomy ) , clearly indicating the relevant effect that changes in the hypothalamus - pituitary - gonadal axis and hypothalamus - pituitary - adrenergic axis exert on brain ha [ 9 , 22 ] .
similarly , direct interactions between the somatotropinergic system ( grh / ss - gh - igf1 ) and ha and the vasopressinergic system and ha have been extensively demonstrated .
l - histidine and ha induce a time- and dose - dependent decrease in hypothalamic interleukin-1 ( il-1 ) , and this effect is not affected by mepyramine ( h1r antagonist ) , famotidine ( h2r antagonist ) , or thioperamide ( h3r antagonist ) .
the abolishment of neuronal ha by -fluoromethylhistidine , a suicide inhibitor of hdc , causes a significant decrease in the hypothalamic concentration of tnf- .
important changes in the peripheral ( figure 2 ) and central levels of ha ( figure 3 ) occur in patients with different cns disorders .
these changes are particularly important in alzheimer 's disease ( ad ) , where ha levels are significantly increased in most cns regions [ 6 , 27 ] ( figure 3 ) .
changes in ha , tnf- , and il-1 [ 28 , 29 ] in ad correlate with cerebrovascular dysfunction and cognitive decline [ 3 , 30 ] .
furthermore , improvement in cognitive function with neuroprotectants ( e.g. , cdl - choline ) [ 3133 ] or vegetal neurotrophins ( e.g. , anapsos ) [ 34 , 35 ] can reverse alterations in ha , tnf- , and il-1 levels in ad and in animal models of dementia [ 7 , 25 , 3437 ] .
ad - related neurodegeneration exhibits a pathological phenotype compatible with a reactive neuroinflammatory process in which ha , tnf- , and il-1 , among many other immune effectors , are involved .
there is also a correlation between microglia activation and apoe genotypes [ 38 , 39 ] ; and peripheral ha levels are also apoe - related , with the lowest levels present in patients harboring the apoe-4 allele [ 6 , 40 ] ( figures 4 and 5 ) .
an association between apoe-4 and increased expression of cd95 on t cells has also been reported , suggesting that hyperexpression of fas mrna and surface fas receptor on cd45ro t lymphocytes may explain the occurrence of inflammatory cellular infiltrates in ad brain tissue .
all these data together illustrate the potential role of ha as a fundamental player in ad - related neuroinflammation and other neuropsychiatric disorders .
in fact , results of clinical trials with h3 antagonists such as abt-288 or gsk239512 have been recently reported .
patients with different types of cns disorders exhibit significant variation in lymphocyte subsets with regard to that of the general population , indicating that alterations in brain function may alter lymphocytes and immune markers in the periphery . by flow cytometry analysis
, we have studied changes in lymphocyte subpopulations and immune markers in healthy controls ( n = 374 ) and in the general population ( n = 3311 ) , as well as in patients with diverse cns disorders including anxiety ( n = 340 ) , depression ( n = 483 ) , psychosis / schizophrenia ( n = 199 ) , stroke ( n = 77 ) , alzheimer 's disease ( n = 247 ) , parkinson 's disease ( n = 81 ) , attention - deficit hyperactivity disorder ( adhd ) ( n = 47 ) , migraine ( n = 238 ) , epilepsy ( n = 81 ) , vascular dementia ( n = 215 ) , vascular encephalopathy ( associated with diabetes , hypertension , or symptomatic arteriosclerosis ) ( n = 404 ) , multiple sclerosis ( n = 22 ) , chronic cerebral insufficiency ( n = 152 ) , brain tumors ( n = 14 ) , cranial nerve neuropathy ( trigeminal neuralgia , facial palsy ) ( n = 32 ) , mental retardation ( n = 135 ) , and posttraumatic brain injury ( n = 65 ) ( table 1 )
. cd3 ( total t cells ) only showed significant differences ( p < 0.05 ) in children with mental retardation and in patients with vascular dementia .
cd4 ( t helper / inducer cells ) significantly differ between controls and adhd , mental retardation , and epilepsy ; between depression and adhd , mental retardation , and epilepsy ; between migraine and adhd and mental retardation ; and between cerebrovascular insufficiency , adhd , and mental retardation .
cd7 ( t cells + natural killer , nk ) differ between vascular encephalopathy and psychosis , migraine , epilepsy , and mental retardation .
cd8 ( t suppressor / cytotoxic ) did not show any relevant difference among different cns pathologies with regard to controls .
hla - dr ( class ii mch antigen ) exhibit significant differences between adhd and parkinson 's disease , stroke , vascular dementia , ad , and vascular encephalopathy ; between epilepsy and parkinson 's disease , stroke , vascular dementia , ad , and vascular encephalopathy ; and between mental retardation and parkinson 's disease , stroke , vascular dementia , ad , and vascular encephalopathy .
cd25 ( il-2 receptors ) were found lower in adhd , mental retardation , and epilepsy with respect to controls and vascular encephalopathy .
cd28 ( 6080% cd3 ) were found lower in vascular dementia and parkinson 's disease with regard to controls , anxiety , depression , psychosis , migraine , epilepsy , multiple sclerosis , and posttraumatic brain injury .
cd56 ( nk cells ) were significantly increased in parkinson 's disease and vascular dementia in relation to most other groups .
no significant changes were found in both cd3/hla - dr and cd4/cd8 ratios in cns disorders ( table 1 ) .
all these data together clearly reflect that brain damage and/or pathologic alterations in brain function leading to neurologic and/or psychiatric disorders can induce significant changes in peripheral lymphocytes and immune markers .
this fact provides additional support to the predominant role of brain on immune function and immune mediators .
recent studies bring new insights into the nature of inflammation signaling and regulation of proinflammatory genes , opening new avenues for novel therapeutic intervention in inflammatory processes .
one example is the a20 protein , a cytosolic peptide that controls interactions between key ubiquitin - conjugating enzymes , thereby regulating the expression of proinflammatory genes [ 44 , 45 ] .
the a20 gene locus has been associated with risk for crohn 's disease , systemic lupus erythematosus , rheumatoid arthritis , type i diabetes , psoriasis , and atherosclerosis .
a20 is an important regulator of autoimmunity and a tumor suppressor for hodgkin 's lymphoma and large b cell lymphoma .
a20 acts through the transcription factor nuclear factor-b ( nf-b ) to control inflammation , and nf-b regulates the expression of genes involved in inflammation and immunity .
nf-b protein inhibitor ( ib ) maintains inactive nf-b in the cytoplasma of unstimulated cells .
proinflammatory ligands , such as tnf- , lps , and il-1 , activate the ib kinase ( ikk ) complex to phosphorylate ibs , inducing their degradation , which releases associated nf-b to translocate into the nucleus and activate the transcription of genes that promote inflammation .
one target gene is a20 ( tnfaip3 ) , a negative feedback regulator that terminates ikk and nf-b activation .
shembade et al . have reported that a20 negatively regulates inflammation by inhibiting nf-b transcription factor in the tnf receptor ( tnfr ) and toll - like receptor ( tlr ) pathways .
a20 contains deubiquitinase and e3 ligase domains and has been proposed to function as a ubiquitin - editing enzyme downstream of tnfr1 by inactivating rip1 .
a20 inhibits the e3 ligase activities of traf6 , traf2 , and clap1 by antagonizing interactions with the e2 ubiquitin - conjugating enzymes ubc13 and ubch5c .
a20 , together with the regulatory molecule tax1bp1 , interacts with ubc13 and ubch5c and triggers their ubiquitination and proteasome - dependent degradation .
these results suggest that pharmacological inhibition of the e2 ligases controlled by a20 might be beneficial in treating certain autoimmune diseases and cancer .
injury causes a systemic inflammatory response syndrome ( sirs ) that is clinically similar to sepsis .
cellular injury can release endogenous damage - associated molecular patterns ( damps ) that activate innate immunity . as postulated by sagan , altman , and others in the 1960s , mitochondria are evolutionary endosymbionts derived from bacteria which might bear bacterial molecular motifs .
zhang et al . have shown that injury releases mitochondrial damps ( mtds ) into the circulation with functionally important immune consequences .
mtds include formyl peptides and mtdna that activate polymorphonuclear neutrophils ( pmns ) through formyl peptide receptor-1 and toll - like receptor ( tlr ) 9 , respectively .
mtds promote pmn calcium flux and phosphorylation of mitogen - activated protein ( map ) kinases , thus leading to pmn migration and degranulation .
the release of such mitochondrial factors by cellular injury is a key link between trauma , inflammation , and sirs .
the notch1 pathway dictates activation of m1 phenotypes in isolated mouse hepatic macrophages ( hmacs ) and in a murine macrophage cell line by coupling transcriptional upregulation of m1 genes with metabolic upregulation of mitochondrial oxidative phosphorylation and ros ( mtros ) to augment induction of m1 genes .
enhanced mitochondrial glucose oxidation is achieved by increased recruitment of the notch1 intracellular domain ( nicd1 ) to nuclear and mitochondrial genes that encode respiratory chain components and by notch - dependent induction of pyruvate dehydrogenase phosphatase 1 ( pdp1 ) expression , pyruvate dehydrogenase activity , and glucose flux to the tca cycle .
inhibition of the notch pathway or pdp1 knockdown abrogates glucose oxidation , mtros , and m1 gene expression .
conditional notch1 deficiency in the myeloid lineage attenuates hmac m1 activation and inflammation in a murine model of alcoholic steatohepatitis and markedly reduces lethality following endotoxin - mediated fulminant hepatitis in mice .
monocyte tracking requires notch1 for the migration of blood monocytes into the liver and subsequent m1 differentiation . according to the elegant studies reported by xu et al .
. demonstrated for the first time that early hyperlipidemia promotes endothelial cells ( ec ) activation before monocyte recruitment via a caspase-1-sirtuin 1-activator protein-1 pathway , which provides an important insight into the development of novel therapeutics for blocking caspase-1 activation as early intervention of metabolic cardiovascular diseases and inflammations . using new apolipoprotein e ( apoe)/caspase-1 double knockout mice
, they observed that ( i ) early hyperlipidemia induced caspase-1 activation in apoe mouse aorta ; ( ii ) caspase-1/apoe mice attenuated early atherosclerosis ; ( iii ) caspase-1/apoe mice had decreased aortic expression of proinflammatory cytokines and attenuated aortic monocyte recruitment ; and ( iv ) caspase-1/apoe mice had decreased ec activation , including reduced adhesion molecule expression and cytokine secretion .
oxidized lipids activated caspase-1 and promoted pyroptosis in ec by a reactive oxygen species mechanism .
caspase-1 inhibition resulted in accumulation of sirtuin 1 in the apoe aorta , and sirtuin 1 inhibited caspase-1 upregulated genes via activator protein-1 pathway .
tristetraprolin ( ttp ) is an anti - inflammatory protein that acts by binding to ares in its target mrnas , such as tnf mrna , and promoting their deadenylation and decay .
tnf released from inflammatory cells can then stimulate gene expression in tissue cells , such as fibroblasts .
the decay rates of transcripts encoded by several early - response genes , including cxcl1 , cxcl2 , ier3 , ptgs2 , and lif , are significantly slowed in ttp - deficient fibroblasts after tnf stimulation .
these changes are associated with ttp - dependent increases in cxcl1 , cxcl2 , and ier3 protein levels .
the ttp - susceptible transcripts contain multiple , conserved , closely spaced , potential ttp binding sites in their 3-utrs .
wt ttp , but not a nonbinding ttp zinc finger mutant , binds to rna probes that are based on the mrna sequences of cxcl1 , cxcl2 , ptgs2 , and lif .
ttp - promoted decay of transcripts encoding chemokines and other proinflammatory mediators is thus a critical posttranscriptional regulatory mechanism in the response of secondary cells , such as fibroblasts , to tnf released from primary immune cells .
neutrophils have the capacity to package a variety of cytokines into cytoplasmic granules for subsequent release upon inflammatory conditions .
the rapid secretion of cytokines orchestrates the action of other immune cells at the infection site and contributes to the development and chronicity of inflammatory diseases .
naegelen et al . studied the intracellular snare machinery responsible for the regulation of cytokine secretion and degranulation and demonstrated that syntaxin-3 ( stx3 ) is required for the maximal release of il-1 , il-1 , il-12b , and ccl4 without alteration of other cytokine secretions in dhl-60 cells .
stx3 is involved in mmp-9 exocytosis from gelatinase granules , where stx3 is partly localized .
the secretion of il-1 , il-1 , il-12b , and ccl4 occurs during gelatinase degranulation , a process controlled by stx3 which has an essential role in trafficking pathways of cytokines in neutrophil granulocytes .
sestrins ( sesns ) are conserved antioxidant proteins that accumulate in cells in response to various stresses .
yang et al . investigated whether sesn2 regulates toll - like receptor- ( tlr- ) mediated inflammatory signaling and sought to identify the molecular mechanism responsible . sesn2 almost completely inhibits lps - induced no release and inos expression .
a gene knockdown experiment confirmed the role of sesn2 in lps - activated raw264.7 cells .
sesn2 prevents lps - elicited cell death and ros production via inhibition of nadph oxidase .
nf-b and ap-1 are redox - sensitive transcription factors that regulate the expressions of diverse inflammatory genes .
sesn2 specifically inhibits ap-1 luciferase activity and its dna binding , but not those of nf-b .
ap-1 inhibition by sesn2 is due to a lack of jnk , p38 , and c - jun phosphorylation .
sesn2 protects galactosamine ( gal)/lps - induced liver injury in mice infected with a recombinant adenovirus sesn2 ( ad - sesn2 ) .
ad - sesn2 causes less severe hepatic injury as supported by decreases in the alt , ast , and hepatocyte degeneration .
sesn2 inhibits tlr - induced proinflammatory signaling and protects cells by inhibiting jnk- or p38-mediated c - jun phosphorylation .
abundant data provide support to a multidimensional crosstalk among neural , endocrine , and immune signals probably contributing to global homeostasis , constant surveillance to maintain control against exogenous and/or endogenous stressors , brain maturation and development , neuroprotection , and fine - tuning of brain functions associated with higher activities of the cns .
neuroimmune dysfunction may be part of the pathogenesis of different cns disorders , including mental disorders ( scz , depression , anxiety , and posttraumatic stress disorder ) , neurodegenerative disorders ( ad , parkinson 's disease , and prion disease ) , brain infections , stroke , brain tumors , and demyelinating disorders .
it is likely that the neuroimmune system acts as a regulatory , defense system which reacts against noxious stimuli that endanger brain function stability and optimum performance . in this context ,
neuroimmune activation in cns pathology might be a double - faced reactive phenomenon : ( i ) neuroprotective , when the stimulus activating the neuroimmune cascade is able to neutralize tissue damage and/or brain dysfunction and ( ii ) neurotoxic , when the reactive neuroinflammatory event is persistent and becomes an autoaggression which magnifies the damage .
this sword of damocles ( dual role ) hanging over the cns and other peripheral tissues under central control must be exquisitely balanced to avoid dangerous decompensation ( dominance of neurotoxic effects over neuroprotective effects ) .
this homeostatic equilibrium can be maintained by the interplay of different cytokines , chemokines , neurotransmitters , neuropeptides , neurohormones , and pleiotropic substances such as histamine .
this biogenic amine , acting on different receptors or emanating from different sources ( neuronal histamine versus nonneuronal histamine ) can exert antagonistic effects ( neurotrophic versus neurotoxic ) on neuronal targets inducing either protection or damage .
although there was a growing interest for neuroimmune function and neuroinflammation during the past two decades , with relevant scientific contributions to the field , our impression is that the present knowledge on neuroimmune mechanisms and their pathological consequences is still at a very primitive stage .
therapeutic intervention to halt progression of deleterious neuroinflammatory reactions in cns disorders is a major challenge for molecular psychoneuropharmacology in the future . | neuroimmune dysregulation is a common phenomenon in different forms of central nervous system ( cns ) disorders .
cross - links between central and peripheral immune mechanisms appear to be disrupted as reflected by a series of immune markers ( cd3 , cd4 , cd7 , hla - dr , cd25 , cd28 , and cd56 ) which show variability in brain disorders such as anxiety , depression , psychosis , stroke , alzheimer 's disease , parkinson 's disease , attention - deficit hyperactivity disorder , migraine , epilepsy , vascular dementia , mental retardation , cerebrovascular encephalopathy , multiple sclerosis , brain tumors , cranial nerve neuropathies , mental retardation , and posttraumatic brain injury .
histamine ( ha ) is a pleiotropic monoamine involved in several neurophysiological functions , neuroimmune regulation , and cns pathogenesis .
changes in brain ha show an age- and sex - related pattern , and alterations in brain ha levels are present in different cns regions of patients with alzheimer 's disease ( ad ) .
brain ha in neuronal and nonneuronal compartments plays a dual role ( neurotrophic versus neurotoxic ) in a tissue - specific manner .
pathogenic mechanisms associated with neuroimmune dysregulation in ad involve ha , interleukin-1 , and tnf- , whose aberrant expression contributes to neuroinflammation as an aggravating factor for neurodegeneration and premature neuronal death . |
high invasiveness and resistance to therapy are common biological and clinical characteristics of refractory cancer that represent major challenges for research and treatment .
the mechanisms involved in tumor invasion include cell motility and migration , degradation of the extracellular matrix and interaction with stromal and inflammatory cells .
these are orchestrated in a way that enables the tumor to invade the host organ and often beyond.3 , 4 an early morphological and functional change for tumor cells of epithelial origin to acquire a proinvasive phenotype is epithelial to mesenchymal transition ( emt ) , altering cell behavior to resemble a mesenchymal type.16 , 17 the major modes by which cancers evade the effect of anticancer drugs include intrinsic ( or constitutive ) resistance and acquired resistance .
constitutive resistance to therapy may be due to mutational activation of signaling for cell survival , cytoprotective alterations in the cell cycle and in dna repair ability , differences in the efficiency of drug uptake and efflux by cancer cells , and insufficient drug delivery [ reviewed in alexander and friedl9 ] .
acquired resistance to chemotherapeutic and moleculartargeted agents involves distinct mechanisms , including genetic alterations to the drug targets , activation of surrogate prosurvival pathways , and interactions between tumor cells and components of the tumor environment [ reviewed in holohan et al.5 , ramos and bentiresalj6 and alexander and friedl9 ] .
intratumor heterogeneity emerges in many tumors and often underlies their resistance to therapeutic agents.18 , 19
the processes of tumor invasion and therapy resistance and their underlying mechanisms are often investigated as independent pathological events in cancer .
however , recent studies ( shown in table 1 ) have demonstrated that tumor cells acquire morphological and functional proinvasive phenotypes with the ability to migrate and invade following the development of resistance to anticancer therapeutics ( suppl .
the therapeutic modalities included conventional chemotherapeutic agents , different types of radiation therapy as well as bioactive compounds targeting epidermal growth factor ( egf ) receptor and vascular endothelial growth factor ( vegf ) .
these studies indicate the therapeutic insult and/or resistance elicits proinvasive phenotypes and evokes the invasive capability of tumor cells in a broad spectrum of cancer types , including breast , colorectal , pancreatic , ovarian and prostate cancers , as well as rare intractable tumors ( e.g. glioblastoma and osteosarcoma ) .
a large number of preclinical studies have demonstrated that all available cancer treatments , including surgery , facilitate metastatic tumor spread .
such treatment often results in therapeutic benefit , but occasionally also results in resistance , leading to the paradoxical concept of treatmentinduced metastasis
these experimental and preclinical studies suggest that the invasive behavior of cancer cells and their acquired resistance to therapy may not be separate pathological properties and could , instead , represent interconnected processes [ reviewed in alexander and friedl9 ] .
representative previous studies showing interrelationship between therapeutic stimuli / resistance and proinvasive phenotype in cancer s. shimozaki et al .
aif , apoptosisinducing factor ; ar , androgen receptor ; bax , bcl2associated x protein ; bfgf , basic fibroblast growth factor ; bmi1 , b lymphoma momlv insertion region 1 homolog ; csc(s ) , cancer stemlike cell(s ) ; cxcl1 , chemokine ( cxc motif ) ligand 1 ; cxcr4 , cxc receptor type 4 ; dnmt3a , dna ( cytosine5)methyltransferase 3a ; egfr , epidermal growth factor receptor ; emt , epithelialmesenchymal transition ; erk , extracellular signalregulated kinase ; fak , focal adhesion kinase ; 5fu , 5fluorouracil ; hif , hypoxia inducible factor ; htert , human telomerase reverse transcriptase ; jnk , cjun nterminal kinase ; mgmt , omethylguanine dna methyltransferase ; mir , microrna ; mmp , matrix metalloproteinase ; mt1mmp , membrane type 1mmp ; nfb , nuclear factorb ; parp1 , poly [ adpribose ] polymerase 1;pgp , pglycoprotein ( multidrug resistance ) ; pi3k , phosphatidylinositol3kinase ; rb , retinoblastoma ; sparc , secreted protein , acidic , cysteine rich ; sr , supplementary reference no . ; timp , tissue inhibitor of mmp ; tnf , tumor necrosis factor ; tp53inp1 , tumor protein p53inducible nuclear protein 1 ; trail , tumor necrosis factorrelated apoptosisinducing ligand ; wave2 , was ( wiskottaldrich syndrome ) protein family member 2 .
regardless of the tumor type and therapeutic agent , the proposed mechanisms for invasion and resistance are attributable to molecular pathways that participate in tumor cell survival , transition to mesenchymal ( emt ) and cancer stem cell ( csc ) phenotypes , migration and invasion with extracellular matrix degradation , and drug efflux ( table 1 ) .
the reported molecules that mediate and interconnect these pathways include growth and transcription factors , chemokines , ras and rho family members ( e.g. ras , rac1 ) and cellmatrix adhesion molecules ( e.g. integrin family and focal adhesion kinase [ fak ] ) ( table 1).9 bevacizumab is a humanized monoclonal antibody to vegf used clinically as an antiangiogenic agent . acquired resistance to bevacizumab leads to enhanced tumor cell invasion due to the metabolic shift to glycolysis and degradation and remodeling of tumor stromal tissues
. a better understanding of the biological mechanisms underlying the tight association between tumor invasion and therapy resistance should provide a solid rationale for the development of innovative cancer treatments.9
gsk3 is a family of serine / threonine protein kinases comprising two highly conserved isoforms , gsk3 and gsk3 , that show approximately 85% overall homology and 98% homology in their kinase domains .
gsk3 is constitutively active in normal cells and its activity is regulated by the differential phosphorylation at serine ( s ) residues 21 ( pgsk3 ) and 9 ( pgsk3 ) ( both inactive forms ) , and tyrosine ( y ) residues 279 ( pgsk3 ) and 216 ( pgsk3 ) ( both active forms ) ( fig .
gsk3 regulates a diverse array of physiological cellular functions via the phosphorylation of and interaction with various proteins ( fig .
although the two gsk3 isoforms share many substrates , they are not functionally identical and show some differences in their substrate specificity [ reviewed in beurel et al.10 ] .
a growing number of studies have demonstrated that deregulated gsk3 activity contributes to the pathogenesis and progression of various diseases , including glucose intolerance , neurodegenerative disorders , and chronic inflammatory and immunological diseases.10 , 21 this points to gsk3 being an attractive and druggable target for a broad spectrum of diseases.22 consequently , many gsk3 inhibitor compounds have been developed in academic and pharmaceutical institutes over recent years . some are reported to inhibit both the and isoforms with different affinities , while others are specific for gsk3 ( reviewed in sr25,26 ) . among the latter compounds ,
it was reported that ara014418 does not inhibit the activity of 26 closely related kinases and is , therefore , considered to be highly specific for gsk3.
( a ) comparison of the structural and functional domains of the two gsk3 isoforms , ( b ) the sites ( s9 and y216 ) of phosphorylation of gsk3 by different kinases regulating gsk3 activity , and ( c ) the substrates of gsk3 and proteins that interact with it .
( a ) gsk3 ( 51 kd ) and gsk3 ( 47 kd ) are products of their respective genes located in chromosomes 19q13 and 3q13 .
the isoforms share high ( 98% ) homology of the catalytic domains , and gsk3 has a glycinerich extension at the nterminal side .
blue and red narrow columns indicate the sites of serine ( s ) and tyrosine ( y ) phosphorylation , respectively .
( b ) the kinases indicated in blue phosphorylate gsk3s9 resulting in its inactivation , while those indicated in red phosphorylate gsk3y216 resulting in its activation .
( c ) gsk3 stabilizes / activates ( red arrows ) and destabilizes / inactivates ( blue lines ) various transcription factors as well as structural and functional proteins .
ap1 , activator protein 1 ; apc , adenomatous polyposis coli ; bax , bcl2associated x protein ; bcl , bcell lymphoma ; c , cterminal of protein ; c / ebp , ccaat ( cytosinecytosineadenosineadenosinethymidine)enhancerbinding protein ; cdc25a , cell division cycle 25 homolog a ; creb , camp ( cyclic adenosine monophosphate ) response element binding protein ; crmp2 , collapsin response mediator protein 2 ; eif2b , eukaryotic initiation factor 2b ; fak , focal adhesion kinase ; fgd1/3 , fyve rhogef ( guanine nucleotide exchange factor ) and ph domaincontaining protein 1/3 ; fkhr , forkhead in rhabdomyosarcoma ; gly , glycine ; gr , glucocorticoid receptor ; gs , glycogen synthase ; gsk3 , glycogen synthase kinase 3 ; hif1 , hypoxia inducible factor1 ; hsf1 , heat shock transcription factor1 ; ilk , integrinlinked kinase ; ipf1/pdx1 , insulin promoter factor 1/pancreatic and duodenal homeobox 1 ; irs1 , insulin receptor substrate 1 ; lrp5/6 , lipoprotein receptorrelated protein 5/6 ; mafa , musculoaponeurotic fibrosarcoma oncogene homolog a ; map1b/2c , microtubule associated protein 1b/2c ; mcl1 , myeloid cell leukemia 1 ; mcry2 , mouse cryptochrom 2 ; mdm2 , mouse double minute 2 homolog ; mek , mapk ( mitogenactivated protein kinase)/erk ( extracellular signalregulated kinase ) kinase ; mitf , microphthalmiaassociated transcription factor ; mlk3 , mixed lineage kinase 3 ; n , nterminal of protein ; nac , nascent polypeptideassociated complex subunit ; nfat , nuclear factor of activated tcells ; nfb , nuclear factorb ; nrf2 , nuclear factor erythroid 2related factor 2 ; p130rb , p130 retinoblastoma ; p21cip1 , p21 cdk ( cyclindependent kinase)interacting protein 1 ; p90rsk , p90 ribosomal protein s6 kinase ; pdh , pyruvate dehydrogenase ; pka , protein kinase a ; pkc , protein kinase c ; pp2a , protein phosphatase 2a ; ppar , peroxisome proliferatoractivated receptor ; pten , phosphatase and tensin homolog ; pyk2 , prolinerich tyrosine kinase 2 ; rar , retinoic acid receptor ; red1 , rnaediting deaminase 1 ; s , serine ; src3 , steroid receptor coactivator3 ; srebp , sterol regulatory elementbinding protein ; tsc2 , tuberous sclerosis complex 2 ; vdac , voltagedependent anion channel ; y , tyrosine of the two gsk3 isoforms , most studies in the field of oncology have focused on gsk3. this is partly because of the functional redundancy of the two isoforms in regulating the canonical wnt/catenin pathway , responsible for generating the most prevalent oncogenic signaling.23 , 24 based on its known effects on several protooncoproteins ( e.g. catenin , cyclin d1 and cmyc ) , cell cycle regulators ( e.g. p27 ) and mediators of emt ( e.g. snail ) ( fig .
1c ) , it has long been recognized that gsk3 suppresses tumor development [ reviewed in clevers and nusse,24 jope et al.,25 luo26 and mccubrey et al.27 ] , as discussed later ( table s1 ) .
paradoxically , our earlier studies found increased expression and deregulated activity of gsk3 due to changes in the differential phosphorylation of s9 and y216 residues in gastrointestinal cancers , glioblastoma and osteosarcoma compared to respective normal cells and tissues.28 , 29 , 30 , 31 these observations suggested that gsk3 could participate in cancer development and progression , despite the general belief that it has tumorsuppressive functions.25 , 26 , 27 we and other research groups have shown that inhibition of gsk3 activity with specific pharmacological inhibitors , or inhibition of its expression by rna interference , can preferentially attenuate the survival and proliferation of tumor cells and induce them to undergo apoptosis .
this effect has been observed not only in gastrointestinal and pancreatic cancer cells28 , 29 , 30 , 32 , 33 , 34 , 35 but also in glioblastoma,31 , 36 , 37 osteosarcoma ( s. shimozaki , n. yamamoto , t. domoto , h. nishida , k. hayashi , h. kimura , a. takeuchi , s. miwa , k. igarashi , t. kato , y. aoki , t. higuchi , m. hirose , r.m .
hoffman , t. minamoto , h. tsuchiya , unpublished data , 2016)38 and other malignant neoplasms such as gynecological and urogenital cancers,39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 soft tissue sarcomas,48 , 49 hematological malignancies50 , 51 and lung cancers.52 , 53 this accumulating evidence firmly establishes gsk3
as a valuable target in cancer treatment.11 , 12
there has been substantial interest in the molecular mechanisms by which gsk3 favors tumor progression and by which inhibition of its activity or expression attenuates tumor cell survival , immortalization and proliferation .
the reported mechanisms for tumor cell survival include the nuclear factor ( nf)bmediated prosurvival pathway,34 , 35 , 36 , 38 tumor cell resistance to apoptosis induced by tumor necrosis factorrelated apoptosisinducing ligand ( trail),41 and failure of the p53mediated tumor suppressor pathway or of the rbmediated cell cycle regulation.31 , 32 preservation of telomere length by maintaining activity of human telomerase reverse transcriptase ( htert ) and telomerase also immortalizes tumor cells in response to the aberrant activation of gsk3.30 cell proliferation pathways mediated by cmyc and cyclin d1 sustain tumor cell proliferation that is dependent on gsk3.36 , 39 in osteosarcoma and rhabdomyosarcoma , the induction of catenin signaling , a wellknown tumor suppressive mechanism in these cancers , has been linked to decreased cell proliferation following gsk3 inhibition ( s. shimozaki et al . , unpublished data).49 another recent study reported that mitotic catastrophe caused by disruption of centrosome biodynamics was associated with attenuated tumor cell survival and proliferation following gsk3 inhibition.54 importantly , gsk3 has little impact on the cell survival , immortalization and growth of normal cells , where the differential phosphorylation of s9 and y216 residues functions to fine tune gsk3 activity.28 , 29 , 30 , 31 , 34 the growing body of evidence on the role of aberrant gsk3 in sustaining and promoting cancer cell survival , immortalization and proliferation , together with the differential effects of gsk3 inhibition on cancer and normal cells , underpins the targeting of gsk3 as a novel cancer treatment.11 , 12
the dependency of cancer cells on gsk3 for their survival and proliferation has encouraged further studies on whether aberrant gsk3 participates in tumor cell invasion and therapy resistance , the two major determinants of patient outcome.3 , 4 , 5 , 6 as shown in table 1 , most tumors that acquire proinvasive phenotypes as they evade therapy are susceptible to experimental treatment involving inhibition of gsk3. here we review what is known about the involvement of gsk3 in tumor invasion and resistance to therapy based on our previous studies in pancreatic cancer and glioblastoma .
these are representative of lethal tumors and are characterized by high invasive capacity and resistance to available therapies.55 , 56
while gsk3 plays pivotal roles in cytoskeletal organization , cell polarity and migration in the physiological processes of organogenesis and wound healing,57 little is known about its role in cancer cell motility , migration and invasion .
earlier studies showed that lithium chloride and some indirubins , both classical gsk3inhibiting agents , inhibited the migration and invasion of glioblastoma cells , but the mechanism underlying this effect was not clear.58 , 59 subsequently , we demonstrated that inhibition of gsk3 by a specific pharmacological inhibitor and by rna interference decreases the capacity for migration and invasion of pancreatic cancer and glioblastoma cells and of their tumors in animal models.60 , 61 morphologically , these effects were associated with reduced formation of lamellipodia and invadopodia , the horizontal and vertical cellular surface microarchitectures , respectively , that drive cell migration , stromal degradation and invasion.62 , 63 inhibition of gsk3 disrupted the functional subcellular colocalization of rac164 and cortactin63 with the cytoskeletal molecule factin in lamellipodia and invadopodia , respectively .
these changes in the proinvasive phenotype of tumor cells following gsk3 inhibition coincide with the suppression of molecular pathways mediated by focal adhesion kinase ( fak),65 guanine nucleotide exchange factors ( gef)/rac164 , 66 and cjun nterminal kinase ( jnk ) .
this results in decreased expression of matrix metalloproteinase ( mmp)2 and membrane type ( mt ) 1mmp . our observations therefore suggest that gsk3 sustains tumor invasion via the promotion of morphological and functional proinvasive cellular phenotypes and that the molecular axis involves fak , gefs / rac1 and jnk ( fig .
2).60 , 61
putative molecular pathway through which deregulated gsk3 promotes tumor cell migration and invasion .
the exact molecular pathway by which gsk3 mediates the activation of fak ( open arrow ) remains to be determined .
fak , focal adhesion kinase ; gdp , guanosine diphosphate ; gef , guanine nucleotide exchange factor ; gsk3 , glycogen synthase kinase 3 ; gtp , guanosine triphosphate ; jnk , cjun nterminal kinase ; mmp , matrix metalloproteinase ; mt1mmp , membrane type 1mmp ; circled p , phosphorylation
subsequent to our studies,60 , 61 other workers have reported the proinvasive effect of gsk3 in pancreatic , colorectal and breast cancer cells in association with modulation of cytoskeletal organization and cytokinemediated matrix degradation.67 , 68 .
these studies highlight the pivotal role of gsk3 in tumor invasion and probably also in metastatic spread .
the combination of multiple agents having different targets and mechanisms of actions is important in the treatment of cancer in order to optimize the therapeutic effects and minimize the adverse effects .
this is particularly relevant for the treatment of refractory cancer , and , hence , moleculartargeted therapy is often combined with conventional chemotherapeutics and/or radiation therapy , as well as with other targeted agents.7 , 8 as discussed above , accumulating evidence on the effects of gsk3 inhibition against cancer cell survival and proliferation has led us to address whether this could be used in combination with chemotherapy and irradiation .
the standard treatment modalities prescribed are often ineffective in patients with refractory tumors such as pancreatic cancer and glioblastoma.55 , 56 we have shown that administration of a gsk3specific pharmacological inhibitor ( e.g. ara014418 ) at a dose below that which results in a therapeutic effect when given on its own can significantly enhance the cytotoxic effects of temozolomide and gemcitabine.31 , 60 , 69 , 70 these are the standard chemotherapeutic agents prescribed for patients with glioblastoma and pancreatic cancer , respectively.55 , 56 lowdose gsk3 inhibitor given in combination with chemotherapeutic agents had additive and synergistic effects .
investigation of the underlying molecular mechanism is crucial to justify treatment combinations of gsk3 inhibitor with other anticancer therapeutics ( fig .
, the combined effect was attributed to modulation of the mouse double minute ( mdm)2/p53 and cmycmediated pathways resulting in epigenetic silencing of o6methylguanine dna methyltransferase ( mgmt ) , a clinically proven biomarker of temozolomide efficacy56 in tumor cells ( fig .
3b).31 , 69 in pancreatic cancer , inhibition of tumor gsk3 activity decreased cyclin d1/cyclindependent kinase ( cdk)4/6 complexdependent phosphorylation of rb tumor suppressor protein.60 one of the important functions of rb is to bind the oncogenic transcription factor e2f1 and inhibit its transcriptional activity.71 , 72 gsk3 may , therefore , sensitize pancreatic cancer to gemcitabine by downregulating the expression of ribonucleotide reductase , a wellknown pharmacological biomarker of gemcitabine55 that is regulated by the rb / e2f pathway ( fig .
3a).71 , 72 in addition to modulation of this pathway , we found that downregulation of the tp53inp1 gene ( encoding tumor p53inducednuclearprotein 1 ) involved in dna repair is associated with the chemosensitizing effect of gsk3 inhibitor.70 the gsk3 inhibitor used in these studies also sensitized both pancreatic cancer and glioblastoma to ionizing radiation.31 , 60 this radiosensitizing effect may depend on the restoration of rb function following gsk3 inhibition , resulting in the inability of e2f1 to induce the transcription of thymidylate synthase and thymidine kinase ( fig .
( a ) putative molecular pathway that links gsk3 activity with the resistance of pancreatic cancer cells to dna damage induced by gemcitabine and ionizing radiation .
the effects of gsk3 on e2fdependent gene transcription and on the expression of rr , ts and tk remain to be determined .
cdk , cyclindependent kinase ; e2f , e2 factor ; circled p , phoshorylation ; rb , retinoblastoma ( tumor suupressor protein ) ; rr , ribonucleotide reductase ; tk , thymidine kinase ; ts , thymidylate synthase .
gsk3 inhibition results in cmyc activation directly and via activation of cateninmediated signaling , which consequently increases recruitment of dnmt3a by cmyc to the mgmt promoter , thus increasing de novo
dna methylation in the mgmt promoter .
other recent studies have also reported that gsk3 inhibition allows therapyresistant colon and pancreatic cancer cells to become susceptible to 5fluorouracil ( 5fu),73 and renal cell carcinoma cells to become susceptible to a synthetic multikinase inhibitor ( sorafenib ) that targets growth signaling and angiogenesis.74 together , these studies suggest that gsk3 participates in multiple molecular pathways used by various cancer types to evade chemotherapy , radiotherapy and targeted therapies . collectively , a growing body of experimental evidence supports the notion that gsk3 is a molecular hub that mediates and connects various pathways responsible for tumor invasion and resistance to therapy .
together with the role of gsk3 in promoting tumor cell survival and proliferation and its differential functions between tumor and normal cells [ reviewed in miyashita et al.11 and mccubrey et al.12 ] , this evidence reinforces the promise of novel cancer therapeutic strategies that target gsk3.
while gsk3 plays pivotal roles in cytoskeletal organization , cell polarity and migration in the physiological processes of organogenesis and wound healing,57 little is known about its role in cancer cell motility , migration and invasion .
earlier studies showed that lithium chloride and some indirubins , both classical gsk3inhibiting agents , inhibited the migration and invasion of glioblastoma cells , but the mechanism underlying this effect was not clear.58 , 59 subsequently , we demonstrated that inhibition of gsk3 by a specific pharmacological inhibitor and by rna interference decreases the capacity for migration and invasion of pancreatic cancer and glioblastoma cells and of their tumors in animal models.60 , 61 morphologically , these effects were associated with reduced formation of lamellipodia and invadopodia , the horizontal and vertical cellular surface microarchitectures , respectively , that drive cell migration , stromal degradation and invasion.62 , 63 inhibition of gsk3 disrupted the functional subcellular colocalization of rac164 and cortactin63 with the cytoskeletal molecule factin in lamellipodia and invadopodia , respectively .
these changes in the proinvasive phenotype of tumor cells following gsk3 inhibition coincide with the suppression of molecular pathways mediated by focal adhesion kinase ( fak),65 guanine nucleotide exchange factors ( gef)/rac164 , 66 and cjun nterminal kinase ( jnk ) .
this results in decreased expression of matrix metalloproteinase ( mmp)2 and membrane type ( mt ) 1mmp . our observations therefore suggest that gsk3 sustains tumor invasion via the promotion of morphological and functional proinvasive cellular phenotypes and that the molecular axis involves fak , gefs / rac1 and jnk ( fig .
2).60 , 61
putative molecular pathway through which deregulated gsk3 promotes tumor cell migration and invasion .
the exact molecular pathway by which gsk3 mediates the activation of fak ( open arrow ) remains to be determined .
fak , focal adhesion kinase ; gdp , guanosine diphosphate ; gef , guanine nucleotide exchange factor ; gsk3 , glycogen synthase kinase 3 ; gtp , guanosine triphosphate ; jnk , cjun nterminal kinase ; mmp , matrix metalloproteinase ; mt1mmp , membrane type 1mmp ; circled p , phosphorylation .
subsequent to our studies,60 , 61 other workers have reported the proinvasive effect of gsk3 in pancreatic , colorectal and breast cancer cells in association with modulation of cytoskeletal organization and cytokinemediated matrix degradation.67 , 68 .
these studies highlight the pivotal role of gsk3 in tumor invasion and probably also in metastatic spread .
the combination of multiple agents having different targets and mechanisms of actions is important in the treatment of cancer in order to optimize the therapeutic effects and minimize the adverse effects .
this is particularly relevant for the treatment of refractory cancer , and , hence , moleculartargeted therapy is often combined with conventional chemotherapeutics and/or radiation therapy , as well as with other targeted agents.7 , 8 as discussed above , accumulating evidence on the effects of gsk3 inhibition against cancer cell survival and proliferation has led us to address whether this could be used in combination with chemotherapy and irradiation .
the standard treatment modalities prescribed are often ineffective in patients with refractory tumors such as pancreatic cancer and glioblastoma.55 , 56 we have shown that administration of a gsk3specific pharmacological inhibitor ( e.g. ara014418 ) at a dose below that which results in a therapeutic effect when given on its own can significantly enhance the cytotoxic effects of temozolomide and gemcitabine.31 , 60 , 69 , 70 these are the standard chemotherapeutic agents prescribed for patients with glioblastoma and pancreatic cancer , respectively.55 , 56 lowdose gsk3 inhibitor given in combination with chemotherapeutic agents had additive and synergistic effects .
investigation of the underlying molecular mechanism is crucial to justify treatment combinations of gsk3 inhibitor with other anticancer therapeutics ( fig .
, the combined effect was attributed to modulation of the mouse double minute ( mdm)2/p53 and cmycmediated pathways resulting in epigenetic silencing of o6methylguanine dna methyltransferase ( mgmt ) , a clinically proven biomarker of temozolomide efficacy56 in tumor cells ( fig .
3b).31 , 69 in pancreatic cancer , inhibition of tumor gsk3 activity decreased cyclin d1/cyclindependent kinase ( cdk)4/6 complexdependent phosphorylation of rb tumor suppressor protein.60 one of the important functions of rb is to bind the oncogenic transcription factor e2f1 and inhibit its transcriptional activity.71 , 72 gsk3 may , therefore , sensitize pancreatic cancer to gemcitabine by downregulating the expression of ribonucleotide reductase , a wellknown pharmacological biomarker of gemcitabine55 that is regulated by the rb / e2f pathway ( fig .
3a).71 , 72 in addition to modulation of this pathway , we found that downregulation of the tp53inp1 gene ( encoding tumor p53inducednuclearprotein 1 ) involved in dna repair is associated with the chemosensitizing effect of gsk3 inhibitor.70 the gsk3 inhibitor used in these studies also sensitized both pancreatic cancer and glioblastoma to ionizing radiation.31 , 60 this radiosensitizing effect may depend on the restoration of rb function following gsk3 inhibition , resulting in the inability of e2f1 to induce the transcription of thymidylate synthase and thymidine kinase ( fig .
( a ) putative molecular pathway that links gsk3 activity with the resistance of pancreatic cancer cells to dna damage induced by gemcitabine and ionizing radiation .
the effects of gsk3 on e2fdependent gene transcription and on the expression of rr , ts and tk remain to be determined .
cdk , cyclindependent kinase ; e2f , e2 factor ; circled p , phoshorylation ; rb , retinoblastoma ( tumor suupressor protein ) ; rr , ribonucleotide reductase ; tk , thymidine kinase ; ts , thymidylate synthase . ( b ) regulation of mgmt expression by gsk3 signaling in glioblastoma .
gsk3 inhibition results in cmyc activation directly and via activation of cateninmediated signaling , which consequently increases recruitment of dnmt3a by cmyc to the mgmt promoter , thus increasing de novo
dna methylation in the mgmt promoter .
other recent studies have also reported that gsk3 inhibition allows therapyresistant colon and pancreatic cancer cells to become susceptible to 5fluorouracil ( 5fu),73 and renal cell carcinoma cells to become susceptible to a synthetic multikinase inhibitor ( sorafenib ) that targets growth signaling and angiogenesis.74 together , these studies suggest that gsk3 participates in multiple molecular pathways used by various cancer types to evade chemotherapy , radiotherapy and targeted therapies . collectively , a growing body of experimental evidence supports the notion that gsk3 is a molecular hub that mediates and connects various pathways responsible for tumor invasion and resistance to therapy . together with the role of gsk3 in promoting tumor cell survival and proliferation and its differential functions between tumor and normal cells [ reviewed in miyashita et al.11 and mccubrey et al.12 ] , this evidence reinforces the promise of novel cancer therapeutic strategies that target gsk3.
targeting of the biological pathways that link tumor invasion and therapy resistance is clearly an attractive prospect for the development of innovative cancer treatments .
another important challenge is to understand the biology of cancer initiating or stemlike cells ( csc ) so that stemness phenotypes can also be targeted .
based on the clonal evolution model of tumorigenesis and on the normal stem cell concept , csc are conceptually defined as a population of tumor cells with selfrenewing and pluripotent capacity.13 csc have been identified in a wide range of hematopoietic malignancies and solid tumors and are assumed to be progenitors of the entire neoplastic cell population .
one of the most striking characteristics of csc is their influence on tumor cell plasticity , intratumor heterogeneity , invasion and metastasis , therapy resistance and tumor relapse after surgery and adjuvant treatment.14 , 75 eradication of csc is , therefore , of paramount clinical importance for combatting refractory cancer.15 , 76
gsk3 has pivotal functions in normal cell biology10 , 21 , 22 and is also central to the processes of cancer cell survival , proliferation , invasion and therapy resistance , as discussed above . a number of studies have reported that csc phenotypes share unique molecular pathways and tumor environment interactions that are also associated with tumor invasion and therapy resistance.14 , 75 this leads us to propose a working hypothesis whereby gsk3 underlies the basal mechanism for sustaining the csc phenotype ( fig .
recent studies have shown that gsk3 negatively controls the differentiation of malignant glioma cells,77 and that gsk3 inhibition results in depletion of cancer stemlike or progenitorlike cells and attenuation of metastatic spread in prostate cancer.78 consistent with the physiological roles of gsk3 in negatively regulating canonical wnt/catenin and hedgehog signaling,10 , 23 , 24 inhibition of gsk3 is a prerequisite for the maintenance of stemness phenotypes in embryonic and hematopoietic stem cells.79 , 80 therefore , future work should aim to understand the influence of gsk3 on both tumor and normal stem cell phenotypes
. this knowledge can be applied for the development of novel cancer treatments that target gsk3. involvement of gsk3 in the representative pathological hallmarks of cancer .
gsk3 positively regulates the distinct molecular pathways and participates in survival , proliferation , migration and invasion of tumor cells and their insensitivity and resistance to cancer therapy .
one of the concerns about targeting gsk3 for cancer treatment is that its inhibition may promote the progression of existing tumors [ reviewed in takahashiyanaga22 , jope et al.,25 luo26 and mccubrey et al.27 ] .
a number of studies have focused on the putative tumor suppressive role of gsk3 ( table s1 ) .
many of these report inactivation or activation of gsk3 as a mediating event in pathways leading to tumor progression or suppression , respectively .
an inverse association between tumor expression of gsk3 ( either total or active form pgsk3 ) and the survival of cancer patients has been reported .
other studies found causal links between pharmacological gsk3 inhibition and/or depletion of gsk3 expression ( e.g. gene knockout and rna interference ) or activity ( e.g. recombinant kinasedead or constitutively active mutant form ) and tumor cell survival , proliferation and susceptibility to cancer therapies .
gsk3 inhibition strategies and the development of gsk3targeted agents therefore require careful evaluation to determine whether the tumor promoting function of gsk3 is counteracted by its putative tumor suppressor function in different cancer types
. the development and administration of gsk3 inhibitors for the treatment of chronic diseases , including diabetes mellitus , neurodegenerative disorders and cancer , requires serious awareness of the safety issues .
a major concern is whether and how gsk3 can be targeted to treat disease , because its systemic inhibition may lead to unwanted effects by disrupting multiple biological pathways ( fig .
most notably , longterm inhibition of gsk3 may initiate tumorigenesis due to its role in suppressing protooncogenic pathways , in particular that are mediated by catenin [ reviewed in takahashiyanaga22 , jope et al.,25 luo26 and mccubrey et al .
a previous study showed that genetic deletion of gsk3 in mammary epithelial cells resulted in catenin activation and induced intraepithelial neoplasia that progressed to the development of adenosquamous carcinoma .
moreover , overexpression of wildtype and constitutively active mutant gsk3 in 12otetradecanoylpholbor13acetate ( tpa)mediated , transformationresistant mouse epidermal cells suppressed egfmediated and tpamediated anchorageindependent growth in soft agar and tumorigenicity in rodents ( table s1 ) . however , there is currently no direct evidence to support tumor development in vivo following treatment with a gsk3 inhibitor [ reviewed in miyashita et al.11 and sr27 ] .
as discussed in previous studies that report cancer therapeutic effects of gsk3 inhibition ( table 1 ) , none of the available experimental gsk3 inhibitors induces neoplastic transformation of nonneoplastic ( normal ) cells or tumor development in experimental animal models [ reviewed in miyashita et al.11 and sr27 ] .
longterm prescription of lithium , the only gsk3 inhibitor approved for the treatment of bipolar disorder since the 1950s , has not been associated with an increased risk of cancer or death from cancer .
posttranslational regulation of gsk3 activity via the phosphorylation of s9 and y216 ( pgsk3 versus pgsk3 ) ( fig .
1b ) in response to various stimuli could partly underlie a mechanism that protects normal cells from the detrimental effects of gsk3 inhibition . despite the concerns outlined above
, clinical trials for neurodegenerative diseases and cancer have tested some seed pharmacological gsk3( ) inhibitor compounds and also approved medicines with the ability to inhibit gsk3 activity ( table s2 ) .
the former trials include azd1080 ( astrazeneca ) for the treatment of alzheimer 's disease ( phase i ) , and np031112 ( tideglusive ; noscira sa ) for the treatment of progressive supranuclear palsy ( nct01049399 : phase iib ) and of alzheimer 's disease ( nct01350362 : phase ii ) .
clinical trials for cancer treatment have used ly2090314 ( eli lilly ) alone for acute leukemia ( nct01214603 : phase ii ) , and the same compound in combination : ( i ) with gemcitabine , the combined folate , 5fu and oxaliplatin ( folfox ) regimen or the combined gemcitabine and nabpaclitaxel regimen for metastatic pancreatic cancer ( nct01632306 : phase i / ii ) ; and ( ii ) with pemetrexed and carboplatin for advanced or metastatic solid cancer ( nct01287520 : phase i ) . our group is undertaking the phase i / ii clinical trials by repurposing approved gsk3inhibiting medicines ( combined cimetidine , lithium , olanzapine and valproate regimen ) in combination with gemcitabine for advanced pancreatic cancer ( umin000005095 ) and with temozolomide for recurrent glioblastoma ( umin000005111 ) ( t. furuta , h. sabit , d. yu , k. miyashita , m. kinoshita , m. kinoshita , y. hayashi , y. hayashi , t. minamoto , m. nakada , unpublished data , 2016 ) .
currently , information regarding the side effects of gsk3 inhibitors is limited because the clinical trials have evaluated only a small number of seed compounds and also because lithium chloride is the only currently approved inhibitor for clinical use .
it is , therefore , difficult to predict what serious adverse events , if any , will occur in patients treated with gsk3 inhibitors .
the extent of gsk3 inhibition and the differential effects between normal and diseased cells / tissues ( therapeutic window ) are critical determining factors for therapeutic efficacy and undesirable side effects .
it is clear that gsk3 activity is deregulated in various pathological conditions , including many , but not all , cancer types ( table 1).10 , 11 , 12 , 22 , 25 , 26 , 27 identifying the range of gsk3 inhibition that is efficient for treatment of disease but which results in minimal detrimental effects to normal tissues and organs will be important for the clinical application of gsk3 inhibitors .
numerous studies have shown that , in addition to differential phosphorylation at s9 and y216 residues ( fig .
1a , b ) , the subcellular localization of gsk3 together with various upstream pathways can regulate the expression and activity of this kinase [ reviewed in beurel et al.10 and takahashiyanaga22 ] .
new classes of gsk3 inhibitors that spatially and temporally control the expression and activity of gsk3 may therefore be required to reduce the risk of adverse events such as carcinogenesis that may be associated with longterm gsk3 inhibition .
| tumor cell invasion and resistance to therapy are the most intractable biological characteristics of cancer and , therefore , the most challenging for current cancer research and treatment paradigms .
refractory cancers , including pancreatic cancer and glioblastoma , show an inextricable association between the highly invasive behavior of tumor cells and their resistance to chemotherapy , radiotherapy and targeted therapies .
these aggressive properties of cancer share distinct cellular pathways that are connected to each other by several molecular hubs . there is increasing evidence to show that glycogen synthase kinase ( gsk)3 is aberrantly activated in various cancer types and this has emerged as a potential therapeutic target . in many but not all cancer types ,
aberrant gsk3 sustains the survival , immortalization , proliferation and invasion of tumor cells , while also rendering them insensitive or resistant to chemotherapeutic agents and radiation .
here we review studies that describe associations between therapeutic stimuli / resistance and the induction of proinvasive phenotypes in various cancer types .
such cancers are largely responsive to treatment that targets gsk3. this review focuses on the role of gsk3 as a molecular hub that connects pathways responsible for tumor invasion and resistance to therapy , thus highlighting its potential as a major cancer therapeutic target .
we also discuss the putative involvement of gsk3 in determining tumor cell stemness that underpins both tumor invasion and therapy resistance , leading to intractable and refractory cancer with dismal patient outcomes . |
obtain frozen mouse embryonic fibroblasts ( mefs ) ( generated previously from individual embryo primary cultures ) from liquid nitrogen .
thaw cells by immersing vial in 37c water with swirling until contents are completely thawed .
add 9ml of dmem that has been supplemented with 10% fetal bovine serum and 1% penicillin - streptomycin to a 10 cm cell culture plate .
add the thawed cell suspension drop - wise to the plate , rock the plate gently to disperse cells and place plate in a 37c , 5% co2 incubator overnight . note that if cells are sensitive to dmso ( from the freezing process ) , initial media can be replaced with fresh media after cells have adhered to the plate ( approximately four hours post plating ) .
also note that confluence of the cells after thawing depends on the number of cells frozen , the recovery rate of the cells after freezing , and the growth rate of the cells . when cells have grown to essentially 100% confluency ( ie : the next day ) , aspirate off the media and wash cells with 5ml of sterile pbs .
remove pbs and add 1ml of trypsin containing 10 mm edta and place plate in incubator for approximately 5 minutes to allow cells to detach from plate .
when cells have detached , add 9ml of media to the trypsinized cells , pipette 2 - 3 times to disperse clumps , add 1ml of this suspension drop - wise onto a new plate containing 9ml of media , and place this into the 37c incubator overnight .
remove cells from incubator , wash and trypsinize as before , except this time add 5 - 6ml media back to the trypsinized cells instead of 9ml .
pipette cells thoroughly to ensure complete dissociation into a single cell suspension , and remove 15l to combine with 15l of trypan blue in a separate microfuge tube . mix this cell/ trypan blue suspension by pipetting up and down several times , and add 15l to the hemocytometer . under the microscope , dead cells will appear blue . count the number of clear / colourless ( living ) cells in one of the 4x4 grids on the hemocytometer .
repeat this count on the three other 4x4 grids ( denoted a , b , c and d ) and use the following equation to calculate the number of cells per l of suspension : through protocol optimization , we have determined that plating 30,000 cells results in appropriate cell density for visualization at the conclusion of the experiment . to calculate the volume of cell suspension needed for 30,000 cells , use the following equation : now place a sterile glass cover
slip into each well of a six well dish and add 2ml of media to each well , and then add drop - wise from your cell suspension the volume required for 30,000 cells into each well .
note that glass cover slips are used for this experiment as we will be visualizing the cells using fluorescence microscopy at a later time point ; not all applications will necessarily require microscopy , and thus cover slips may not be required .
after several hours or overnight ( sufficient time to ensure that the cells adhere to the cover slips ) , remove media and wash cells with 1ml of serum - free dmem .
add 1ml of serum - free media to each well for the addition of the virus .
for this experiment , adeno - cre virus was obtained commercially from vector biolabs .
previous protocol optimization has shown that a multiplicity of infection ( moi ) of 500 provides highly efficient gene transduction into primary mefs with little or no effect on cell viability .
moi can be calculated as follows :
add the calculated volume of virus directly to each well that is to be infected , gently rock the plate to disperse the virus and place cells into the 37c incubator overnight .
the next morning , remove the virus - containing media from the cells and wash cells in 1ml sterile pbs and then add 2ml of regular media to each well . in the case of the rac1 cells exemplified in this experiment , morphological changes occurred in the cells at approximately 72 hours post transduction .
cells were visualised by staining with the actin dye phalloidin ( for imaging purposes only ) and imaged using the leica tcs - sp5 multiphoton confocal laser scanning microscope at the advanced analysis centre at the university of guelph .
figure 1 shows the contracted and elongated morphology of the rac1 cells that were exposed to adeno - cre virus compared to the same cells not exposed to virus .
comparison between rac1 cells infected with adeno - cre virus ( left ) compared to uninfected cells from the same source ( right ) .
obtain frozen mouse embryonic fibroblasts ( mefs ) ( generated previously from individual embryo primary cultures ) from liquid nitrogen .
thaw cells by immersing vial in 37c water with swirling until contents are completely thawed .
add 9ml of dmem that has been supplemented with 10% fetal bovine serum and 1% penicillin - streptomycin to a 10 cm cell culture plate .
add the thawed cell suspension drop - wise to the plate , rock the plate gently to disperse cells and place plate in a 37c , 5% co2 incubator overnight . note that if cells are sensitive to dmso ( from the freezing process ) , initial media can be replaced with fresh media after cells have adhered to the plate ( approximately four hours post plating ) .
also note that confluence of the cells after thawing depends on the number of cells frozen , the recovery rate of the cells after freezing , and the growth rate of the cells .
when cells have grown to essentially 100% confluency ( ie : the next day ) , aspirate off the media and wash cells with 5ml of sterile pbs .
remove pbs and add 1ml of trypsin containing 10 mm edta and place plate in incubator for approximately 5 minutes to allow cells to detach from plate .
when cells have detached , add 9ml of media to the trypsinized cells , pipette 2 - 3 times to disperse clumps , add 1ml of this suspension drop - wise onto a new plate containing 9ml of media , and place this into the 37c incubator overnight .
remove cells from incubator , wash and trypsinize as before , except this time add 5 - 6ml media back to the trypsinized cells instead of 9ml .
pipette cells thoroughly to ensure complete dissociation into a single cell suspension , and remove 15l to combine with 15l of trypan blue in a separate microfuge tube . mix this cell/ trypan blue suspension by pipetting up and down several times , and add 15l to the hemocytometer . under the microscope , dead cells will appear blue . count the number of clear / colourless ( living ) cells in one of the 4x4 grids on the hemocytometer .
repeat this count on the three other 4x4 grids ( denoted a , b , c and d ) and use the following equation to calculate the number of cells per l of suspension : through protocol optimization , we have determined that plating 30,000 cells results in appropriate cell density for visualization at the conclusion of the experiment . to calculate the volume of cell suspension needed for 30,000 cells , use the following equation :
now place a sterile glass cover slip into each well of a six well dish and add 2ml of media to each well , and then add drop - wise from your cell suspension the volume required for 30,000 cells into each well .
note that glass cover slips are used for this experiment as we will be visualizing the cells using fluorescence microscopy at a later time point ; not all applications will necessarily require microscopy , and thus cover slips may not be required .
after several hours or overnight ( sufficient time to ensure that the cells adhere to the cover slips ) , remove media and wash cells with 1ml of serum - free dmem .
add 1ml of serum - free media to each well for the addition of the virus .
for this experiment , adeno - cre virus was obtained commercially from vector biolabs .
previous protocol optimization has shown that a multiplicity of infection ( moi ) of 500 provides highly efficient gene transduction into primary mefs with little or no effect on cell viability .
moi can be calculated as follows :
add the calculated volume of virus directly to each well that is to be infected , gently rock the plate to disperse the virus and place cells into the 37c incubator overnight . the next morning ,
remove the virus - containing media from the cells and wash cells in 1ml sterile pbs and then add 2ml of regular media to each well . in the case of the rac1 cells exemplified in this experiment , morphological changes occurred in the cells at approximately 72 hours post transduction .
cells were visualised by staining with the actin dye phalloidin ( for imaging purposes only ) and imaged using the leica tcs - sp5 multiphoton confocal laser scanning microscope at the advanced analysis centre at the university of guelph .
figure 1 shows the contracted and elongated morphology of the rac1 cells that were exposed to adeno - cre virus compared to the same cells not exposed to virus .
comparison between rac1 cells infected with adeno - cre virus ( left ) compared to uninfected cells from the same source ( right ) .
the accompanying video exemplifies how a recombinant virus can be used to excise a specific gene in vitro using cre recombinase .
proper safety procedures should always be employed when working with adenoviruses . a lab coat and gloves
should be worn at all times while working with the virus . media and plastic ware
should be treated with 10% bleach for at least 30 minutes , and plastic ware should be autoclaved thereafter .
avoid repeated freeze - thawing of the virus stock as this can affect virus titer and thus reduce transduction efficiency .
mois ranging from 50 - 500 were tested during method development and efficient transduction rates were observed in most cases , without negative effects on cell viability .
this control ( or an empty vector ) should be conducted during the experiment to ensure that viral infection alone does not result in cellular changes .
similarly , if excising the floxed gene of interest in your cells does not result in any cellular changes ( i.e. changes in morphology or viability ) , then infecting the same cell type with adeno - gfp is an important control to use to demonstrate that virus transduction is occurring . beyond the examination of signalling cascades in culture ,
the adeno - cre approach has also been employed in vivo to conditionally remove genes from experimental animals , and to label specific populations of cells within an organism .
the adenovirus system can also be adapted to introduce genes other than cre recombinase into host cells .
two principal advantages of using this delivery vector are its high transduction and gene delivery efficiency , and lack of integration with host dna . however , the generation of novel recombinant adenoviruses can be labour intensive .
the protocol described here therefore harnesses the power of the adenoviral system by exploiting the previously developed adeno - cre virus , and coupling that with our floxed allele of interest , rac1 . through this
conditional knock out experiment , we have confirmed that transduction using the adeno - cre virus of mefs carrying a floxed rac1 allele does indeed cause excision of rac1 leading to the changes in cellular morphology characteristic of rac1-deficient cells .
experiments on animals were performed in accordance with the guidelines and regulations set forth by the canadian council on animal care . | the ability to genetically remove specific components of various cell signalling cascades has been an integral tool in modern signal transduction analysis .
one particular method to achieve this conditional deletion is via the use of the cre - loxp system .
this method involves flanking the gene of interest with loxp sites , which are specific recognition sequences for the cre recombinase protein .
exposure of the so - called floxed ( flanked by loxp site ) dna to this enzyme results in a cre - mediated recombination event at the loxp sites , and subsequent excision of the intervening gene3 .
several different methods exist to administer cre recombinase to the site of interest . in this video ,
we demonstrate the use of an adenovirus containing the cre recombinase gene to infect primary mouse embryonic fibroblasts ( mefs ) obtained from embryos containing a floxed rac1 allele1 .
our rationale for selecting rac1 mefs for our experiments is that clear morphological changes can be seen upon deletion of rac1 , due to alterations in the actin cytoskeleton2,5 .
72 hours following viral transduction and cre expression , cells were stained using the actin dye phalloidin and imaged using confocal laser scanning microscopy .
it was observed that mefs which had been exposed to the adeno - cre virus appeared contracted and elongated in morphology compared to uninfected cells , consistent with previous reports2,5 .
the adenovirus method of cre recombinase delivery is advantageous as the adeno - cre virus is easily available , and gene deletion via cre in nearly 100% of the cells can be achieved with optimized adenoviral infection . |
the concept of endometriosis is based on histological confirmation of ectopic implants of glands and/or endometrial stroma sensitive to hormones but not including those located in the myometrium.123 the pathogenesis of the disease is probably multifactorial .
retrograde menstruation is the most widespread theory that explains the implants.4 the development of endometriosis from the metaplasia of the pluripotential coelomic epithelium may also serve as an explanation .
the disease affects between 8% and 15% of women in childbearing age.56 epidemiological data are conflicting , and clinical manifestations of this illness are usually nonspecific , making the profiles of high - risk patients difficult to establish.27 implants can be unique or may occur in various parts of the body .
they are commonly found in the ovaries , fallopian tubes , pouch of douglas , uterosacral ligaments , pelvic peritoneum , uterus , sigmoid colon , rectum , ileum , appendix , bladder , ureter , cecum , rectovaginal septum , and vagina.89101112 the presence of endometriosis in lymph nodes and other sites are less frequent.89131415161718192021 a lesion infiltrating 5 mm or more beyond the peritoneal epithelium is considered deep pelvic endometriosis.22 intestinal endometriosis is the most common extra genital disease that affects between 3% and 37% of women with endometriosis.811 up to 95% of intestinal endometriosis is found in the rectum and sigmoid colon .
in addition , it may be present in more than one intestinal segment in 39.1% of patients or be found isolated , without being present in other pelvic sites in 20.6% of cases.8101223242526 deep invasion of the intestinal wall is frequent , with infiltration of the muscularis propria or even of the submucosa .
the mucosa is infiltrated in less than 5% of intestinal lesions.92227 intestinal endometriosis is difficult to diagnose and should be considered a severe disease .
an adequate diagnosis of deep endometriotic lesions remains a challenge28 and usually occurs only years after the onset of symptoms .
the time elapsed from the first complaints until the diagnosis of endometriosis is 7.0 ( range 3.5 - 12.1 ) years.29 the lack of specific signs and symptoms can lead to errors in diagnosis and treatment.73031 even for cases showing signs , symptoms , and/or tests suggestive of endometriosis , other intestinal diseases , such as intestinal malignant neoplasm , should be ruled out to avoid delay or wrong medical treatment.171832 the main gynecological clinical manifestations include chronic pelvic pain , back pain , menstrual disorders , and infertility.679182733 among women with endometriosis , up to 60% present chronic , not necessarily cyclic , intestinal symptoms .
diarrhea , constipation , tenesmus , nausea , vomiting , fever , anorexia , weight loss , and hematochezia may be present at different intensities.334 even without parietal invasion , an endometriotic lesion adjacent to any intestinal segment may cause digestive symptoms.25 gynecological pelvic exam is considered essential for evaluating the extent of pelvic lesions.35 through vaginal and rectal touch examination , thickening or nodularity in the pouch of douglas , uterosacral ligaments , and/ or the rectovaginal septum is the most significant data.3336 however , the absence of positive signs does not rule out the disease.3738 in the presence of intestinal infiltration , clinical treatment is not effective , and the chronic use of systemic therapy can lead to side effects.7253139 for surgical treatment of symptomatic pelvic endometriosis , laparoscopic surgical resection of all identified lesions is currently the best method of choice.253340 a preoperative map is crucial for the management of the disease.10 at the presence of lesions in intestinal or urinary organs , a gastrointestinal or urologic surgeon is respectively recommended .
different surgical approaches are available for intestinal lesions : superficial skinning , partial longitudinal resection ( with linear stapler ) , nodulectomy ( with an endorectal circular stapler or with partial surgical resection of the wall ) , or segmentectomy ( figure 1 ) . the proper choice of surgical technique depends on the extension , position , and depth of the lesion , which must be previously well defined through imaging methods.2833404142 macroscopic aspect of intestinal endometriosis ( segmentectomy of the sigmoid ) . diagnostic tools , including transrectal ultrasound ( trus ) ( figure 2 ) , magnetic resonance imaging ( mri ) ( figure 3 ) , transvaginal ultrasound ( tvus ) ( figure 4 ) , barium enema ( figure 5 ) , and colonoscopy ( figure 6 ) , play significant roles in determining a precise preoperative diagnosis of the disease.18404344454647484950 these data are useful in avoiding unnecessary laparoscopic approaches .
moreover , they are used for preoperative prediction and discussion of surgical plan , as well as possible complications with the patient ( table 1).51 endometriotic infiltrating lesion in the intestinal wall ( trus ) .
main questions to be defined preoperatively for a better treatment ( surgical or clinical ) plan51 mri is very useful in the complete evaluation of the pelvis ( pelvic floor , bladder , ureter , and muscles ) .
it is the best option for the evaluation of ovarian endometriosis and for the accurate diagnosis of deep implants in the intestinal wall or rectovaginal septum.4344 due to low cost and easy access , several authors pointed out that tvus should be the first examination for the diagnosis of various gynecological diseases , including intestinal endometriosis.464852 barium enema presents 88% of sensitivity in the detection of deep intestinal lesions ; however , its specificity is very low ( 54%).3545 colonoscopy provides specific signs of endometriosis in only 50% of deep intestinal lesions , such as subephitelial lesions that promote deformation and reduction of the lumen.53 sometimes , the mucosa that covers the subepithelial lesion presents edema , enanthema , friability , irregularity of surface , and/or vascular patterns.5051 given the high sensitivity and specificity obtained from using different preoperative diagnostic tools , the laparoscopic approach of endometriosis should be reserved for surgical treatment of the disease.54 in gastrointestinal practice , trus is considered the test choice to assess lesions infiltrating the intestinal wall with high accuracy in the determination of depth and histology.25262846535556575859606162 however , trus is not widely used in the management of intestinal endometriosis .
this review aims to provide knowledge and references to endoscopic ultrasonographers for the improvement of trus and fine - needle aspiration ( fna ) in the algorithm of the diagnosis of endometriosis .
articles in pubmed were searched in english and in french . for relevant clinical points , gynecological and gastrointestinal reference books in english and in portuguese were consulted . for technical review ,
the literature search was conducted prior to march 1 2012 , not limited to publication year .
the keywords used in the pubmed search include the following : endometriosis with transrectal ultrasonography , endoscopic ultrasonography , and endorectal ultrasonography .
this review focuses on the accuracy of trus and its comparison with other diagnostic tools for intestinal endometriosis .
trus was considered a diagnostic method for detecting the presence of deep rectal endometriosis . initially , we compared preoperative trus with the histology of the specimens obtained during open or laparoscopic surgery .
table 2 shows the effectiveness of trus in predicting intestinal infiltration.43444546536364656667686970 studies that evaluated the endometriosis use of endorectal ultrasonography for predicting rectal infiltration of deep pelvic endometriosis in 2007 , bazot et al .
compared trus with tvus for the infiltration of the rectovaginal septum and intestinal wall in 81 patients ( table 3).48 tvus was performed without bowel preparation using a 5 to 9 mhz rigid probe , whereas trus was performed using a 7.5 to 12 mhz flexible echoendoscope .
transvaginal ultrasonography vs. trus for the diagnosis of deep endometriosis bergamini compared trus with tvus through water contrast in the rectum using a 6.5 mhz curvilinear rigid probe in both examinations .
the results include sensitivities of 88.2% and 96% , specificities of 80% and 80% , positive predictive values of 95.7% and 98% , and negative predictive values of 57.1% and 81.8% for trus and tvus , respectively.71 the introduction of mri in the evaluation of patients with endometriosis led to the comparison of this technique with trus .
the studies that compared both methods are listed in table 4.4472 comparison between mri and trus for the diagnosis of deep endometriosis in 2007 , bazot compared mri with endoscopic ultrasound ( eus ) for the diagnosis of deep infiltrating endometriosis in different locations for 88 patients .
mri performed better than eus , except for the diagnosis of intestinal endometriosis ( table 5).73 comparison between mri and trus performance for the diagnosis of deep infiltrating endometriosis in different locations73 only one article compared the performance of mri , eus , and tvus for the diagnosis of deep infiltrating endometriosis of 92 patients .
the results are shown in table 6.74 comparison among mri , trus , and tvs performance for the diagnosis of deep infiltrating endometriosis in different locations74 in terms of technical review , few studies described in detail any special trus technical procedure .
most studies performed trus using a 7.5 mhz to 12 mhz radial flexible echoendoscope without special tricks for the procedure .
few studies used rigid probes through different techniques and equipment , and only one study used miniprobes .
only one detailed description was available for linear rigid probes , and it is summarized below.636465666768697071727374
the patient should be positioned in the left lateral decubitus with flexion of the thighs and legs .
first , a deep rectal touch examination should be performed to check for anorectal stenosis and/or nodules in the regions of the anus , rectum , rectovaginal septum , pouch of douglas , cervix , and paracervical regions .
subsequently , the rigid probe ( figure 7 ) should be introduced through the anus and immediately pointed to the back of the patient .
the probe should then be slid over the sacrum for up to approximately 7 cm to 10 cm in the rectal lumen . at this point , a balloon coupled over the probe is filled with water ( at least 40 ml ) .
the probe is then pushed up gently with short up and down movements until the distal sigmoid colon . in this position ,
the right and left iliac vessels ( figure 8) and sometimes the bifurcation of abdominal aorta can be observed ( figure 9 ) .
evaluation of the intestinal wall and surrounding tissues , including pelvic organs and iliac vessels , is performed using movements of introduction , traction , and rotation of the probe on its longitudinal axis ( clockwise and counterclockwise ) , as well as by compression or decompression of the transducer against the wall .
hitachi rigid linear probe ( eup u 33 ) used in the study for intestinal endosonography .
trus : transrectal ultrasound . to determine the depth of the endometriotic lesions , the presence of hypoechogenic , irregular , homogeneous or heterogeneous lesions , around or infiltrating pelvic structures or the intestinal wall
shown in table 7 , only one study proposed a standard classification for the determination of the depth ( figure 11 ) and location ( figure 12 ) of intestinal parietal invasion.7576 trus hypoechogenic and heterogeneous lesions infiltrating the intestinal wall .
echo - logic classification of intestinal endometriosis75 echo - logic schematic classification of the depth of intestinal infiltration ( uet1-t5).7576 echo - logic schematic classification according to pelvic site ( uel1-l5).7576 endometriotic lesion uet1 ( trus ) .
only five studies employed fna : four retrospectives studies with few cases and one prospective with 97 patients.7778798081 all except one used flexible eus probes for fna without any comment about special techniques .
rossini employed the rigid trus - fna technique using a transvaginal probe , with a guide to perform fna ( figure 18).81 according to the author , trus - fna must be performed only in intestinal lesions , which infiltrate , at least , the deep muscular layer ( uet3 ) , avoiding seeding implants in the path of the needle ( figure 19 ) .
in addition , the author stated that prophylaxis antibiotic is not necessary because the needle does not pass beyond the thickness of the affected intestinal wall
. if the lesion is adherent to a cystic ovarian lesion , fna with cystic penetration must be avoided , and prophylaxis antibiotic is recommended . during the puncture ,
chiba needles ( 19 or 22 gauge ) , measuring at least 20 cm in length , or flexible standard needles for eus ( 19 or 22 gauge ) can be used with the rigid transducer .
rigid probe hitachi eup v-33 and dchn-22 - 20 needle used in the study for trus - fna .
endometriosis is a disease affecting women 's health with high prevalence between menarche and menopause.5840 intestinal endometriosis occurs in 3% to 37% of women with endometriosis.8 an appropriate treatment for the disease could be selected by considering essential parameters , such as staging and histological confirmation.128 until recently , the absence of a correct preoperative diagnosis frequently leads to unnecessary surgeries.9 current available imaging examinations provide an accurate preoperative idea of the presence and level of lesions that infiltrate the intestinal wall and other pelvic structures .
the most used methods are mri , tvus , colonoscopy , barium enema , and trus.2528324144 comparative studies showed better results by using either turs or tvus in the evaluation of lesions that infiltrate the intestinal wall ( table 3).4852 however , these data should be analyzed with caution because published studies evaluated only selected patients with high probability of deep endometriosis , and sonographers were not blinded about the clinical data of the patients .
in addition , most studies did not compare all the different diagnostic methods in the same study .
moreover , the type of transducer and the generation of the technology used for trus and other imaging methods vary from one publication to another . the terminology used in most studies does not adopt a standard classification system concerning the depth of intestinal infiltration in layers and topographical distribution in the pelvis .
finally , the median size of the lesion is different , and percentage of the circumference of the intestinal infiltration was not mentioned in any paper.26548283 information and uniformity are lacked in the studies ; hence , comparison of data among different diagnostic tools is difficult .
therefore , during initial medical investigation , patients following different algorithms according to the main clinical manifestation have three types .
patients with predominant gastrointestinal symptoms will naturally follow gastrointestinal algorithms , those with predominant gynecological symptoms will probably follow gynecological algorithms , and those with occasional incidentalomas may follow other algorithms depending on the suspicion on the images .
mri has lower sensitivity and specificity than trus and tvus in determining the extent of infiltration on the intestinal wall and does not allow histological diagnosis ( tables 46).43448485 mri has the capacity to evaluate all pelvic organs and has high specificity for differentiating endometriosis from other ovarian cystic lesions .
thus , this method is usually performed in all cases of suspected deep pelvic endometriosis , allowing complete mapping of pelvic lesions .
in addition , mri may be used in re - evaluating images after the test .
hence , we suggest that mri should be the first test in the diagnosis algorithm of deep endometriosis . for cases
when mri results show specific sites of endometriosis or are negative , more specific tests focusing on the clinical and mri results ( e.g. , trus for intestinal infiltration ) should be done to obtain adequate data about the lesions .
it may also be used in determining the level of infiltration of the rectum , distal sigmoid colon , and rectovaginal septum in patients with deep endometriosis858687 ( table 6).74 in most cases , transvaginal transducers could be placed at an appropriate focal length from the lesion because intestinal endometriotic lesions are usually located near the posterior fornix of the vagina
. however , histological diagnosis using tvus - fna still presents limitations , i.e. , the risk of peritoneal and/or vaginal implants in the path of the needle .
however , techniques for the evaluation of deep pelvic lesions are not widely used because they require special training , learning curve , and dedicated group of interest . these facts
are well exposed in data from clinical practice and literatures . before a correct diagnosis can be achieved , patients have already spent many years ( time elapsed ) and have undergone various tvus.29 barium enema has a low specificity in the diagnosis of infiltration of the intestinal wall and does not allow for histological diagnosis.4588 colonoscopy has a low sensitivity in providing the depth of infiltration of the intestinal wall and can only permit histological diagnosis in 5% of cases.72530318990 nevertheless , up to 60% of patients with deep endometriosis present nonspecific chronic intestinal signs and symptoms.2 thus , in all these cases , colonoscopy is an essential test for ruling out the suspicion of inflammatory and malignant epithelial diseases of the colon and rectum.2794050899091929394 once symptoms indicate colonoscopy , performing colonoscopy and trus in the same procedure with a unique intestinal cleansing and sedation seems to be a better technical and cost effective approach than performing the two methods separately . in gastrointestinal practice , trus is the standard test in determining the depth of invasion of intestinal wall lesions.56 the results obtained in determining the presence , depth , and other data regarding endometriotic lesions of the sigmoid , rectum , and rectovaginal septum justify its clinical application.445372 although less frequent , inflammatory diseases , epithelial and subepithelial neoplasm , or invading extrinsic tumors of the intestinal wall can mimic the sonographic features of endometriosis .
although some of these features are nonspecific , they help differentiate the lesions.959697 endometriotic lesions are greater in depth and do not infiltrate the mucosal layer .
c format often found in advanced stages of intestinal endometriosis due to fibrosis retraction normally does not occur in malignant diseases.5375 other subepithelial benign lesions usually do not infiltrate more than one intestinal layer .
trus is the standard technology for fna in subepithelial and surrounding intestinal lesions.565758 in 2010 , rossini performed trus - fna in 85 patients with suspected endometriotic lesions , characterizing the histological findings of endometriosis in 97%.98 this number established better results than the results of pishvaian that , in a retrospective study , evaluated five patients and obtained histological results of endometriosis in only one case.60 however , in that study , only three patients were operated . therefore , comparison of the results between fna and surgical specimens is impossible .
the results of the first study are also higher than those obtained generally in subepithelial lesions of the intestinal wall.565758 the author may have gotten better results because fna was performed with five punctures in each lesion .
the hypothetical risk of seeding of these structures was avoided because trus fna was performed without the penetration of the peritoneal cavity , and no other organs were transfixed .
in asymptomatic or oligosymptomatic patients , histological confirmation of intestinal endometriosis using trus - fna , a minimally invasive procedure , rules out the diagnosis of neoplasm .
although rare , if not diagnosed early , neoplasm can bring about disastrous consequences to the patient . with a correct histological diagnosis , the asymptomatic or oligosymptomatic disease could be safely controlled through clinical and imaging examinations .
the same approach is valid in symptomatic patients who do not agree with intestinal resection .
after surgical intestinal resections , staplers can lead to an inflammatory reaction and produce an infiltrative process .
trus - fna can be useful in post surgical intestinal resections for differentiating the inflammatory process from a recurrence of the disease in the anastomosis region , thereby helping in the therapeutic decision .
the possibility of obtaining the histological pattern ( stromal , glandular , and mixed ) and the degree of histological differentiation of the disease ( non - differentiated , well differentiated , and mixed ) before beginning the treatment should stimulate the development of more precise medical therapeutics focusing on this information.99100 in addition , intestinal lesion samples may be used for research on alternative treatments based on immunohistochemical or other available biological markers .
therefore , special interest should be placed on this technology as a possible tool to precisely place microparticles of slow - release drugs , such as hormones and/or anti - inflammatory agents , directly at the site of the lesion .
the use of stem cells could also be a potential method for conservative treatment at the lesion site of the intestinal disease through fine - needle inoculation .
| the widespread use of endoscopic ultrasound has facilitated the evaluation of subepithelial and surrounding lesions of the gastrointestinal tract .
deep pelvic endometriosis , with or without infiltration of the intestinal wall , is a frequent disease that can be observed in women in their fertile age .
patients of this disease may present nonspecific signs and symptoms or be completely asymptomatic .
laparoscopic surgical resection of endometriotic lesions is the treatment of choice in symptomatic patients .
an accurate preoperative evaluation is indispensable for therapeutic decisions mainly in the suspicion of intestinal wall and/or urinary tract infiltration , and also in cases where we need to establish histological diagnosis or to rule out malignant disease .
diagnostic tools , including transrectal ultrasound , magnetic resonance image , transvaginal ultrasound , barium enema , and colonoscopy , play significant roles in determining the presence , depth , histology , and other relevant data about the extension of the disease .
diagnostic algorithm depends on the clinical presentation , the expertise of the medical team , and the technology available at each institution .
this article reviews and discusses relevant clinical points in endometriosis , including techniques and outcomes of the study of the disease through transrectal ultrasound and fine - needle aspiration . |
splenic artery aneurysms are the most common visceral artery aneurysms ( 1 ) . aberrant origin of splenic artery from the superior mesenteric artery ( sma ) is rare .
aneurysms of an aberrant splenic artery are very uncommon with only 25 cases reported in literature ( 2 ) .
we describe the imaging findings and the endovascular treatment of a patient with an aberrant splenic artery aneurysm using a combination of stent graft and coil embolization .
a 35-year - old man presented with recurrent upper abdominal pain . physical examination and laboratory
ct angiography revealed a 2.2 cm saccular aneurysm arising from splenic artery close to its anomalous origin from the sma .
the ct angiography showed that the splenic artery was the first branch of sma and there was only a 5 mm distance between the ostium of splenic artery and the aneurysm .
the next branch from the sma was the first jejunal branch , 1 cm distal to the splenic artery ostium .
the proximal sma measured 7 mm and the distal splenic artery 6 mm in diameter .
it was decided to ' trap ' the aneurysm by occluding the splenic artery distal to the aneurysm with coils and placing a stent graft in the sma to block the inflow into the aneurysm . under conscious sedation and local anesthesia
the left axillary artery was punctured and a 45 cm long 8 fr sheath ( flexor , cook , bloomington , in , usa ) was placed into the upper abdominal aorta . in addition , a pigtail catheter was introduced from a right femoral route and placed at the level of sma ostium to enable angiography prior to stent deployment .
a 4 fr vertebral glide catheter and 0.35 " hydrophilic wire ( terumo , tokyo , japan ) combination was used to engage the splenic ostium and the catheter was negotiated through the aneurysm into the normal segment just distal to aneurysm .
four 0.38 " steel coils ( tornado , cook , bloomington , in , usa ) with diameters ranging from 7 mm to 4 mm were delivered through the catheter to occlude the splenic artery ( fig .
the catheter was then withdrawn into the sma and exchanged for a stiff amplatz wire .
an 8 mm 4 cm fluency plus stent graft ( bard , tempe , arizona , usa ) was negotiated over the wire and deployed with its proximal end at the sma ostium and distal end just short of the first jejunal branch .
angiography showed complete exclusion of aneurysm and good filling of all sma branches ( fig .
the patient made an uneventful recovery and was discharged on the third day after procedure .
follow - up ct scans at one month and three years showed patent sma and complete thrombosis of the aneurysm .
a celiac trunk with normal branching into splenic , hepatic and left gastric arteries is seen in about 85% of individuals .
hepatomesenteric ( replaced hepatic artery ) and celiacomesenteric ( common celiac axis and superior mesenteric ) trunks are frequent variations . a splenomesenteric trunk ( replaced splenic artery from sma ) is rare and is estimated to occur in less than 1% of individuals ( 1 , 3 ) .
visceral artery aneurysms have been reported to occur in 0.2% of the general population ( 4 ) .
splenic artery aneurysms are the commonest visceral aneurysms and account for up to 70% of all visceral aneurysms in some series ( 5 ) .
other etiologies include pregnancy , essential hypertension , atherosclerosis , arteritis , pancreatitis and trauma .
we presume that a congenital weakening of the wall of the anomalous vessel led to the aneurysm .
visceral aneurysms carry a high risk of rupture and mortality in the event of rupture is reported to range from 35% to 100% ( 6 , 7 ) .
size more than 2 centimeters , rapid increase in size and concurrent pregnancy are considered to be risk factors for rupture and hence indications for treatment of splenic artery aneurysms ( 5 ) . in our patient ,
all except one patient were treated with open surgery or a combination of endovascular coiling and laparoscopy ( 2 ) .
( 3 ) successfully used an intra - aneurysmal coil packing for treating a similar aneurysm .
various endovascular techniques are used for management of aneurysms ( 8) . ' trapping ' the aneurysm by occluding the vessel proximal and distal to the lesion is the simplest method of treating splanchnic aneurysms . in our patient , due to the location of the aneurysm close to the ostium of the vessel , safe coiling of the artery proximal to the aneurysm was not possible .
use of amplatzer vascular plug and n - butyl cyanoacrylate glue injection for splenic aneurysms have also been reported ( 9 , 10 ) .
filling the aneurysm with coils to induce thrombosis is another well established technique that is useful when the parent vessel has to be preserved and the aneurysm involves only part of the circumference of the vessel . in our patient
the aneurysm involved the entire circumference of the vessel and filling the aneurysm with coils would have certainly resulted in occlusion of the vessel .
moreover the technique is time - consuming and prolapse of coils into sma was a potential risk we wanted to avoid .
treatment of a celiac axis trunk aneurysm with stent graft has been reported ( 11 ) . using a stent graft allowed us to block the inflow into the aneurysm while maintaining flow in the sma . given the complex anatomy , employing the stent graft simplified the procedure considerably and fluoroscopy time could be reduced .
stent grafts are polytetrafluroethyelene covered self expandable metallic stents that are used to exclude aneurysms from the circulation while maintaining patency of the parent vessel . in the sma
, stent graft deployment carries the potential risk of occluding vital branches supplying the bowel .
ct angiography clearly depicted the anomaly and provided all of the vascular anatomical details and measurements to plan the procedure .
the stent graft delivery system is very stiff and a brachial approach was required to get a favorable angle of entry into the sma . though stent grafts are approved for use and are being used widely , their long term patency and structural integrity have not been established .
they should probably be used in young patients with long life expectancy only if other modes of therapy are not feasible or carry greater risk ( 12 ) .
our case shows that stent grafts can be very useful in the management of aneurysms in the splanchnic circulation with complex anatomy . | we report a rare case of aneurysm of splenic artery arising anomalously from the superior mesenteric artery ( sma ) .
the aneurysm was treated successfully by coil embolization of the splenic artery distal to aneurysm and then deploying a stent graft in the sma .
a combination of stent graft and coil embolization for the treatment of aberrant splenic artery aneurysm has been reported only once .
we describe the imaging findings and the endovascular procedure in this patient . |
congenital heart disease is the most prevalent form of developmental abnormality in newborns , with an estimated prevalence of 1% , and is the leading non - infectious cause of infant mortality , with more than 29% of neonates who die of a birth defect having a cardiovascular deformity .
congenital cardiovascular anomaly is clinically classified into at least 18 different types , with many additional anatomic variations , of which ventricular septal defect ( vsd ) is the most common type .
vsd occurs in 3060% of all children , with various kinds of congenital cardiovascular deformations , and accounts for 1416% of birth defects that require an invasive procedure within the first year of life [ 13 ] .
congenital vsd can occur by itself or in combination with other cardiac malformations such as atrial septal defect , tetralogy of fallot , and patent ductus arteriosis .
regardless of other potential conditions that accompany vsd , isolated moderate - to - large vsd with persistent left - to - right shunting of blood may give rise to cardiac enlargement , ventricular dysfunction , pulmonary hypertension , eisenmenger s syndrome , delayed fetal brain development , arrhythmias , and even sudden cardiac death in the absence of surgical or catheter - based repair [ 613 ] . despite the high incidence and the significant association of vsd with substantial morbidity and mortality in human , the etiology of vsd remains largely unclear .
abnormally developed interventricular septum is implicated in a heterogeneous , complex pathogenic process , for which both environmental risk factors and genetic defects may be responsible [ 2,1416 ] . recently , growing evidence points to a crucial role of the zinc finger transcription factor gata4 in the cardiogenesis .
the human gata4 gene maps to chromosome 8p23.1-p22 and comprises 7 exons encoding a protein of 442 amino acids .
therefore , gata4 has been one of prime candidate genes in identifying the molecular components underlying structural congenital heart defects .
presently , over 22 germline mutations in the coding exons of the gata4 gene have been identified in patients with a wide variety of congenital heart anomalies , including vsd , atrial septal defect , atrioventricular septal defect , tetralogy of fallot , and endocardial cushion defect [ 2033 ] .
nevertheless , vsd is genetically heterogeneous and the heritable determinants leading to vsd in the majority of cases are still to be identified .
a cohort of 230 unrelated patients with vsd , including 205 cases with apparently sporadic vsd and 25 index patients with familial vsd , was identified among a chinese han population .
subjects were evaluated by individual and familial history , review of the medical records , complete physical examination , 12-lead electrocardiogram ( ecg ) and two - dimensional transthoracic echocardiography with color flow doppler .
all patients had a classic form of vsd , with a defect diameter of > 3 mm and nearly all patients underwent cardiac catheterization and , if required , cardiac surgery .
the available family members of the probands harboring identified gata4 mutations were enrolled and evaluated by medical history , medical records , physical examination , ecg and echocardiography with color flow doppler .
a total of 200 ethnically matched unrelated healthy individuals , recruited from the general population , were used as controls to screen for likely mutations in gata4 .
peripheral venous blood specimens from vsd patients , available relatives of the mutation carriers , and control individuals were prepared .
the study protocol was reviewed and approved by the local institutional ethics committee and written informed consent was obtained from all participants or their guardians prior to investigation .
genomic dna from all participants was extracted from blood lymphocytes with wizard genomic dna purification kit ( promega ) .
genotyping gata4 in the available relatives of an index patient carrying an identified mutation and the 200 ethnically matched unrelated healthy control individuals was conducted subsequently .
nc_000008 ) . by the aid of on - line primer 3 software ( http://frodo.wi.mit.edu ) ,
the primer pairs used to amplify the coding exons and exon / intron boundaries of gata4 by polymerase chain reaction ( pcr ) were designed , as shown in table 1 .
the pcr was carried out using hotstar taq dna polymerase ( qiagen ) on a pe 9700 thermal cycler ( applied biosystems ) , with standard conditions and concentrations of reagents .
amplified products were analyzed on 1% agarose gels stained with ethidium bromide and purified with qiaquick gel extraction kit ( qiagen ) .
both strands of each pcr product were sequenced with a bigdye terminator v3.1 cycle sequencing kit ( applied biosystems ) under an abi prism 3130 xl dna analyzer ( applied biosystems ) .
the dna sequences were viewed and analyzed with the dna sequencing analysis software v5.1 ( applied biosystems ) .
the variant was validated by re - sequencing an independent pcr - generated amplicon from the subject and met our quality control thresholds with a call rate > 99% .
the multiple gata4 protein sequences across species were aligned using the online program of clustalw ( http://www.bioinformatics.nl/tools/clustalw.html/ ) .
a cohort of 230 unrelated patients with vsd , including 205 cases with apparently sporadic vsd and 25 index patients with familial vsd , was identified among a chinese han population .
subjects were evaluated by individual and familial history , review of the medical records , complete physical examination , 12-lead electrocardiogram ( ecg ) and two - dimensional transthoracic echocardiography with color flow doppler .
all patients had a classic form of vsd , with a defect diameter of > 3 mm and nearly all patients underwent cardiac catheterization and , if required , cardiac surgery .
the available family members of the probands harboring identified gata4 mutations were enrolled and evaluated by medical history , medical records , physical examination , ecg and echocardiography with color flow doppler .
a total of 200 ethnically matched unrelated healthy individuals , recruited from the general population , were used as controls to screen for likely mutations in gata4 .
peripheral venous blood specimens from vsd patients , available relatives of the mutation carriers , and control individuals were prepared .
the study protocol was reviewed and approved by the local institutional ethics committee and written informed consent was obtained from all participants or their guardians prior to investigation .
genomic dna from all participants was extracted from blood lymphocytes with wizard genomic dna purification kit ( promega ) .
genotyping gata4 in the available relatives of an index patient carrying an identified mutation and the 200 ethnically matched unrelated healthy control individuals was conducted subsequently .
nc_000008 ) . by the aid of on - line primer 3 software ( http://frodo.wi.mit.edu ) ,
the primer pairs used to amplify the coding exons and exon / intron boundaries of gata4 by polymerase chain reaction ( pcr ) were designed , as shown in table 1 .
the pcr was carried out using hotstar taq dna polymerase ( qiagen ) on a pe 9700 thermal cycler ( applied biosystems ) , with standard conditions and concentrations of reagents .
amplified products were analyzed on 1% agarose gels stained with ethidium bromide and purified with qiaquick gel extraction kit ( qiagen ) .
both strands of each pcr product were sequenced with a bigdye terminator v3.1 cycle sequencing kit ( applied biosystems ) under an abi prism 3130 xl dna analyzer ( applied biosystems ) .
the dna sequences were viewed and analyzed with the dna sequencing analysis software v5.1 ( applied biosystems ) .
the variant was validated by re - sequencing an independent pcr - generated amplicon from the subject and met our quality control thresholds with a call rate > 99% .
the multiple gata4 protein sequences across species were aligned using the online program of clustalw ( http://www.bioinformatics.nl/tools/clustalw.html/ ) .
a cohort of 230 unrelated patients with vsd was enrolled and clinically evaluated in contrast to a cohort of 200 ethnically matched unrelated healthy individuals as controls .
the baseline clinical characteristics of the 230 unrelated patients with vsd are summarized in table 2 .
direct sequencing of the coding exons of the gata4 gene was conducted after pcr amplification of genomic dna from the 230 unrelated vsd patients .
the total population prevalence of gata4 mutations based on the cohort patients was approximately 1.74% .
specifically , displacement of adenine by guanine in the second nucleotide of codon 55 of the gata4 gene ( c.164a > g ) , equivalent to the replacement of glutamine by arginine at amino acid 55 ( p.q55r ) , was identified in the proband from family 1 .
substitution of adenine for guanine in the first nucleotide of codon 96 of the gata4 gene ( c.286g > a ) , predicting the transition of glycine to arginine at amino acid position 96 ( p.g96r ) , was identified in the index patient from family 2 .
a change of adenine into guanine in the second nucleotide of codon 197 of the gata4 gene ( c.590a > g ) , corresponding to the transversion of asparagine to serine at amino acid residue 190 ( p.n197s ) , was identified in the proband from family 3 .
a gata4 sequence variation of c.1211a > g , resulting in the conversion of lysine into arginine at amino acid 404 ( p.k404r ) , was identified in the proband from family 4 .
the sequence chromatograms showing the detected heterozygous gata4 mutations in comparison with control sequences are shown in figure 1 .
the variants were not detected in 200 control individuals and they are not described in the human snp database ( http://www.ncbi.nlm.nih.gov/snp/ ) .
genetic scan of the available family members of the mutation carriers demonstrated that in each family the variant was present in all affected family members , but absent in unaffected family members who were tested .
analysis of the pedigrees showed that each mutation co - segregated with vsd in the family with complete penetrance .
the phenotypic characteristics and results of genetic screening of the affected pedigree members are listed in table 3 .
a cross - species alignment of multiple gata4 protein sequences showed that the affected amino acids of q55 , g96 , n197 , and k404 were completely conserved among mammals , as shown in figure 3 , suggesting that these amino acids are functionally important .
a cohort of 230 unrelated patients with vsd was enrolled and clinically evaluated in contrast to a cohort of 200 ethnically matched unrelated healthy individuals as controls .
the baseline clinical characteristics of the 230 unrelated patients with vsd are summarized in table 2 .
direct sequencing of the coding exons of the gata4 gene was conducted after pcr amplification of genomic dna from the 230 unrelated vsd patients .
the total population prevalence of gata4 mutations based on the cohort patients was approximately 1.74% .
specifically , displacement of adenine by guanine in the second nucleotide of codon 55 of the gata4 gene ( c.164a > g ) , equivalent to the replacement of glutamine by arginine at amino acid 55 ( p.q55r ) , was identified in the proband from family 1 .
substitution of adenine for guanine in the first nucleotide of codon 96 of the gata4 gene ( c.286g > a ) , predicting the transition of glycine to arginine at amino acid position 96 ( p.g96r ) , was identified in the index patient from family 2 .
a change of adenine into guanine in the second nucleotide of codon 197 of the gata4 gene ( c.590a > g ) , corresponding to the transversion of asparagine to serine at amino acid residue 190 ( p.n197s ) , was identified in the proband from family 3 .
a gata4 sequence variation of c.1211a > g , resulting in the conversion of lysine into arginine at amino acid 404 ( p.k404r ) , was identified in the proband from family 4 .
the sequence chromatograms showing the detected heterozygous gata4 mutations in comparison with control sequences are shown in figure 1 .
the variants were not detected in 200 control individuals and they are not described in the human snp database ( http://www.ncbi.nlm.nih.gov/snp/ ) .
genetic scan of the available family members of the mutation carriers demonstrated that in each family the variant was present in all affected family members , but absent in unaffected family members who were tested .
analysis of the pedigrees showed that each mutation co - segregated with vsd in the family with complete penetrance .
the phenotypic characteristics and results of genetic screening of the affected pedigree members are listed in table 3 .
a cross - species alignment of multiple gata4 protein sequences showed that the affected amino acids of q55 , g96 , n197 , and k404 were completely conserved among mammals , as shown in figure 3 , suggesting that these amino acids are functionally important .
in the present study , 4 novel heterozygous missense mutations of gata4 were identified in 4 families with congenital vsd . in each family , the mutation was present in all the affected family members alive but absent in unaffected relatives tested and 400 normal chromosomes from a matched control population .
a cross - species alignment of gata4 protein sequences demonstrates that the altered amino acids were highly conserved evolutionarily .
therefore , it is very likely that mutated gata4 is involved in the pathogenesis of vsd in these families .
gata transcription factors are a family of transcription factors characterized by the ability to bind to the consensus dna sequence
gata. to date , 6 members of the gata family have been identified in vertebrates , of which gata4 , gata5 and gata6 are expressed mainly in the developing heart and in several endodermal lineages .
structurally , gata4 comprises 2 transcriptional activation domains ( tad1 , amino acids 174 ; tad2 , amino acids 130177 ) , 2 zinc finger domains ( zf1 , amino acids 215240 ; zf2 , amino acids 270294 ) , 1 nuclear localization signal ( nls , amino acids 295324 ) , and 1 c - terminus ( c - ter , amino acids 325442 ) .
the c - terminal zf1 is required for dna sequence recognition and binding to the consensus motif , while the n - terminal zf2 is responsible for sequence specificity and stability of protein - dna binding .
the gata4 mutation p.q55r identified in this study is located in tad1 , and thus may be expected to exert direct influence on the transactivating activity of gata4 .
the other 3 gata4 mutations , including p.g96r and p.n197s located in the neighbor of tads and p.k404r located in the c - terminus , may indirectly influence the transcriptional activity of gata4 by altering the molecular conformation .
our results are supported by the reports of other gata4 mutations associated with congenital cardiac septal defects .
presently , at least 13 out of 22 germline mutations identified in the coding region of the gata4 gene ( p.h28y , p.a66 t , p.p163s , p.e216d , p.g296s , p.g296r , p.q316e , p.s377 g , p.v380 m , p.p407q , p.a411v , p.d425n , and p.h436y ) have been associated with isolated or syndromic vsd , showing that although gata4 mutations underlie a long list of cardiac developmental aberrations , one of the most common phenotypes ascribed to mutations of the gata4 gene is vsd [ 2033 ] .
however , the prevalence of gata4 mutations varies significantly in different cohorts of individuals with congenital heart diseases . according to the 12 reports on the prevalence of gata4 mutations in different cohorts of patients with vsd , the detection frequencies of gata4 mutations are 12.50% ( 2/16 ) , 10.00% ( 5/50 ) , 6.90% ( 2/29 ) , 3.74% ( 4/107 ) , 3.23% ( 1/31 ) , 2.47% ( 12/486 ) , 1.67% ( 2/120 ) , 1.48% ( 2/135 ) , 0.80% ( 5/628 ) , 0.49% ( 1/205 ) , 0.48% ( 1/210 ) , and 0% ( 0/99 ) , and the prevalence in the compound population is 1.75% ( 37/2116 ) . similar to these findings , the mutational prevalence in our vsd cohort
was 1.74% ( 4/230 ) , suggesting that gata4 mutations are an uncommon cause of congenital cardiovascular defects .
additionally , based on known mutation sites , no mutation hot spots exist within the gata4 gene and the penetrance of different gata4 mutations differs considerably , which may be ascribed to genetic backgrounds , environmental modifiers , epigenetic regulations , or even phenotypic ascertainment bias .
furthermore , the remarkable genetic heterogeneity of vsd was supported by a failure to detect mutations in nearly 98% of our cohort patients .
mutations in other transcription factors associated with cardiogenesis , such as nkx2 - 5 , tbx5 , tbx20 , and gata6 , have also been identified in patients with vsd .
in addition , mutations in cardiac structural proteins as troponin i type 3 ( tnni3 ) and alpha myosin heavy chain ( myh6 ) were identified in vsd patients .
therefore , genetic analysis of these candidate genes in our cohort patients with vsd is warranted .
however , these vsd - associated genes have also been reported to result in other cardiac or even extracardiac defects that underlie the clinical heterogeneity and the suggestive roles of the established genotype - phenotype relations of these genes .
interestingly , nkx2 - 5 mutations were mainly reported to cause atrial septal defect and atrioventricular block , implying the essential role of nkx2 - 5 in the morphogenesis of the heart and in the construction of the cardiac conduction system [ 4749 ] .
moreover , tbx5 mutations were predominantly found to cause holt - oram syndrome , which is clinically characterized by upper limb and heart defects . despite the variable clinical manifestations , upper limb abnormalities were always present , highlighting the pivotal role of tbx5 in the development of both heart and upper limbs . in the present study ,
a compound phenotype of vsd and atrioventricular block was observed in 3 out of 230 patients .
genetic screening of nkx2 - 5 in the 3 patients was performed , but no non - synonymous variants were found , largely excluding the possibility of nkx2 - 5 as a cause for vsd combined with atrioventricular block in these patients .
association of compromised gata4 with increased susceptibility to vsd has been demonstrated in animal experiments . in the embryonic hearts of knock - down chicks generated by using small interfering rnas targeted to gata4
, the bilateral myocardial rudiments failed to travel to the midline , resulting in the formation of 2 separate hearts in lateral positions , an anomaly of cardia bifida . in mice , gata4 is one of the earliest transcription factors expressed in developing cardiac cells and continues to be expressed abundantly in cardiomyocytes throughout the life of mice .
homozygous gata4-deficient mice died between day 7.0 to 9.5 and analysis of the gata4-null embryo substantiated the lethal failure to form a linear heart tube .
transgenic mice expressing gata4 mutants demonstrated a wide variety of cardiac malformations , including septal defects , right ventricular hypoplasia , endocardial cushion defect , tetralogy of fallot , double outlets of the right ventricle , and cardiomyopathy , similar to the anomalies seen in humans . taken together , these experimental results from animals suggest that gata4 mutations underlie a wide variety of congenital cardiac abnormalities , including vsd in humans .
the findings link novel gata4 mutations to vsd and provide additional insight into the molecular etiology associated with vsd , suggesting potential implications for the prophylaxis and therapy of vsd . | summarybackgroundventricular septal defect ( vsd ) is the most prevalent type of congenital heart disease and is a major cause of substantial morbidity and mortality in infants .
accumulating evidence implicates genetic defects , especially in cardiac transcription factors , in the pathogenesis of vsd . however , vsd is genetically heterogeneous and the genetic determinants for vsd in most patients remain to be identified.material/methodsa cohort of 230 unrelated patients with congenital vsd was included in the investigation .
a total of 200 unrelated ethnically matched healthy individuals were recruited as controls .
the entire coding region of gata4 , a gene encoding a zinc - finger transcription factor essential for normal cardiac morphogenesis , was sequenced initially in 230 unrelated vsd patients .
the available relatives of the mutation carriers and 200 control subjects were subsequently genotyped for the presence of identified mutations.resultsfour heterozygous missense gata4 mutations of p.q55r , p.g96r , p.n197s , and p.k404r were identified in 4 unrelated patients with vsd .
these mutations were not detected in 200 control individuals nor described in the human snp database .
genetic analysis of the relatives of the mutation carriers showed that in each family the mutation co - segregated with vsd.conclusionsthese findings expand the mutation spectrum of gata4 linked to vsd and provide new insight into the molecular etiology responsible for vsd , suggesting potential implications for the genetic diagnosis and gene - specific therapy for vsd . |
in vertebrates , dickkopf ( dkk ) family genes encode four secreted proteins ( dkk14 ) and a unique dkk3-related protein , soggy or dkk - like1 ( dkkl1 ) .
dkks are potent inhibitors of -catenin stabilization in the wnt signaling pathway and suppress the expression of a variety of canonical wnt/-catenin signaling target genes .
dkk1 , dkk2 , and dkk4 inhibit the wnt signaling pathway through both their high - affinity binding to the wnt coreceptors lrp-5/6 [ 35 ] and blockade of the signaling cascade downstream of wnt receptor frizzled .
in contrast , dkk3 appears to inhibit the wnt signaling pathway by directly binding to -catenin through a complex with a -transducin repeat - containing protein , trcp .
we previously reported identifying the dkk3 gene as a molecule that is predominantly expressed in mouse retinal progenitor cells .
dkk3 expression is observed during vertebrate development in various organs [ 1 , 811 ] . in our previous report , we used in situ hybridization to show that mouse dkk3 mrnas were detectable in the entire neuroblastic layer ( nbl ) of the retina at embryonic stages , and then in the inner nuclear layer ( inl ) at postnatal stages .
moreover , we generated a bac - dkk3-cre transgenic mouse , which utilizes a bacterial artificial chromosome ( bac ) expressing cre recombinase inserted into the dkk3 gene locus .
this transgenic mouse line is a powerful tool for ablating a gene of interest in mitotic retinal progenitor cells ( rpcs ) [ 1214 ] .
the expression pattern and the possible function of dkk3 suggest that this molecule exerts a role in proliferation , cell fate determination , and/or maintenance of rpcs during mouse development .
however , it is still unclear what types of differentiated cells express dkk3 in the developing retina . here
, we report the generation of a bac - dkk3-egfp mouse line , which expresses the egfp gene under the control of dkk3 regulatory elements .
this mouse enables us to investigate the expression pattern of dkk3 in the developing retina in detail . in the current study
, we found that egfp is specifically and strongly expressed in rpcs at embryonic stages , and in mller glial cells and a subset of amacrine cells at mature stages .
a bac clone ( clone i d : rp23 - 12m6 ) containing the entire dkk3 gene was purchased from children 's hospital oakland research institute . according to the ncbi database ( available at http://www.ncbi.nlm.nih.gov/ ) ,
this bac clone also contained a fragment of ubiquitin - specific peptidase 47 ( usp47 ) , a microtubule - associated monooxygenase called calponin , and a lim domain - containing gene ( mical2 ) .
however , neither the transcription initiation site nor the start codon of usp47 is included in the bac clone , but it does contain the 5 untranslated region of mical2 .
two homology arms ( 5 arm , 486 bp ; 3 arm , 453 bp ) from exon 1 of the dkk3 gene were amplified by pcr from the bac clone dna and cloned into a t - easy vector ( promega ) .
the pcr primers used were 5-ggcgcgcctatgtcgcctgtctag ggactt-3 and 5-cccggggcaagctggatctggtcacgaccgg-3 for the 5 homology arm and 5-ttaattaattgggtgagcggtggtcatcgtc-3 and 5-gg ccggcccagactcaatccctgctggaaaca-3 for the 3 homology arm .
the two homologous arms were inserted into both sides of the enhanced green fluorescent protein - polya ( egfp - pa ) cassette in the modified pld53 sca - cre - b shuttle vector .
the egfp - pa cassette was introduced into the 5utr of the first exon of the dkk3 gene by homologous recombination ( figure 1(a ) ) .
pcr and sequencing were used to confirm the correct insertion of the egfp gene into the dkk3 locus .
the entire dkk3-egfp transgene was purified by dialysis on a filter ( millipore , vswp02500 ) floating in an injection buffer ( 10 mm tris , ph 7.5 ; 0.1 mm edta ; 100 mm nacl ) .
the purified construct was injected as circular dna into the pronuclei of fertilized one - cell eggs of b6c3f1 mice then implanted into pseudopregnant foster mothers ( icr , japan slc inc ) .
all procedures conformed to the arvo statement for the use of animals in ophthalmic and vision research , and the procedures were approved by the institutional safety committee on recombinant dna experiments and the animal research committee of osaka bioscience institute .
pcr genotyping for the dkk3-egfp transgene was performed under the following conditions : 94c for 2 min , then 94c , 1 min 60c , 1 min ; 72c , 1 min for a total of 35 cycles and followed by 72c for 10 min ( primers : 5-cagaccatactagtttggcagtac-3 and 5-gcagcttgccggtggtgcagatgaact-3 ) .
we extracted total rnas ( retina : 10 g , other tissues : 20 g ) from adult bac - dkk3-egfp transgenic mice using the trizol reagent ( invitrogen ) .
a full - length cdna of egfp was used as a radiolabeled probe for hybridization .
mouse eye cups were fixed with 4% paraformaldehyde in phosphate - buffered saline ( pbs ) for immunohistochemistry .
the samples were cryoprotected , embedded , frozen , and sectioned into 20 m thick sections .
we preincubated them with blocking solution ( 4% normal donkey serum and 0.1% triton x-100 in pbs ) for 30 min .
then , we incubated the sections with primary antibodies at 4c overnight , rinsed them with blocking solution , and incubated them with secondary antibodies for 30 min .
we used the following primary antibodies : rhodopsin ( lsl , lb-5597 ; rabbit polyclonal ; 1 : 10000 ) , s - opsin ( chemicon , ab5407 ; rabbit polyclonal ; 1 : 1000 ) , m - opsin ( oriental bioservice ; rabbit polyclonal ; 1 : 1000 ) , s100 ( sigma , s-2532 ; mouse monoclonal ; 1 : 1000 ) , sox9 ( chemicon , ab5535 ; rabbit polyclonal ; 1 : 750 ) , pax6 ( dshb , p3u1 ; mouse monoclonal ; 1 : 200 ) , and chx10 ( mbl ; rabbit polyclonal ; 1 : 100 ) .
we used cy3-conjugated anti - rabbit igg ( jackson immunoresearch laboratories , no . 711 - 165 - 152 ; 1 : 400 ) and anti - mouse igg ( jackson immunoresearch laboratories , no .
we also used rhodamine - labeled peanut agglutinin ( pna , vector laboratories , rl-1072 ; 1 : 200 ) .
to generate a dkk3 regulatory elements - driven , egfp - expressing mouse , we took advantage of a bacterial artificial chromosome ( bac ) transgenic mouse , carrying bacs modified using homologous recombination in bacteria [ 15 , 17 , 18 ] .
we designed a bac construct with the egfp cdna placed in the 5utr of the dkk3 gene by homologous recombination ( figure 1(a ) ) . to verify the tissue - specific egfp expression , total rna from the bac - dkk3-egfp mouse retina and other tissues at the adult stage was analyzed by northern blotting .
a single transcript was detected in the retina and cerebrum , but no significant signal was observed in other tissues examined ( figure 1(b ) ) .
dkk3 expression was strongly detected in the retina and cerebrum by northern blot analysis using wild - type adult mouse tissues ( figure 1(c ) ) .
since the egfp expression level was extremely high in the retina , we even observed the egfp expression as green eyes under the room light at the adult stage after mydrin - m ophthalmic solution 0.4% ( santen , no .
084162243 ) was administrated ( figures 1(d ) and 1(e ) ) . in the bac - dkk3-egfp mouse embryo
, we observed an egfp expression in the eye , heart , and spinal cord at embryonic day 9.5 ( e9.5 ) ( figures 2(a ) and 2(b ) ) .
an egfp signal was weakly detected in the palate and heart at e16.5 ( figures 2(c ) and 2(d ) ) . in our previous study ,
dkk3 mrna expression was detected in the entire nbl of the embryonic retina and in the inl in the postnatal retina using in situ hybridization . to confirm this result , we investigated egfp expression in the developing retina of the bac - dkk3-egfp mouse . from e15.5 to postnatal day 0 ( p0 )
, egfp was detected in most mitotic and undifferentiated rpcs throughout the nbl ( figures 2(e)2(g ) ) . at p3 ,
egfp expression was limited to rpcs , and differentiated retinal cells were not labeled by egfp ( figure 2(h ) ) . at p6
, egfp was expressed in mller glia - like cells , which exhibit long glial fibers and localize their cell bodies in the inl ( figure 2(i ) ) . at p14 , only mller glial cells in the inl - expressed egfp , and we observed a large number of glial fibers extending into the surrounding retinal layers ( figure 2(j ) ) . it remains to be clarified which cell types express dkk3 in the adult mouse retina . to examine cell types expressing egfp , we performed immunostaining using antibodies against several photoreceptor cell - specific markers ( figure 3 ) . using antibodies against rhodopsin ( rod photoreceptors ) , pna , s - opsin , and m - opsin ( cone photoreceptors )
, we did not detect an egfp signal significantly overlapping with any photoreceptor cell - specific markers ( figures 3(a)3(l ) ) .
then , we immunostained the adult retina with another set of retinal cell - type antibodies , including antibodies against s100 , sox9 ( mller glial cells ) , pax6 ( amacrine cells ) , and chx10 ( bipolar cells ) ( figure 4 ) .
we observed an egfp signal overlapping with that of s100 in the mller glial fibers extending into other retinal layers ( figures 4(a)4(c ) ) .
moreover , cell bodies of the mller glial cells immunostained with sox9 antibody were positive for egfp ( figures 4(d)4(f ) ) .
we also found that a small number of amacrine cells express egfp in the inl ( figures 4(g)4(i ) ) .
in contrast , bipolar cells were easily distinguished from egfp - expressing cells ( figures 4(j)4(l ) ) .
dkk3 was reported to be expressed in rpcs at embryonic stages and inl cells at postnatal stages , as detected by in situ hybridization [ 7 , 10 ] .
however , the precise identification of the cell types expressing dkk3 remains to be elucidated . in the current study , we generated a bac - dkk3-egfp transgenic mouse in which dkk3-expressing cells were labeled by egfp and easily distinguished from dkk3-nonexpressing cells ( figures 3 and 4 ) .
we showed that almost all rpcs in embryonic retinas and the mller glial cells in postnatal retinas were labeled by egfp ( figures 2 , 3 , and 4 ) , indicating that the bac - dkk3-egfp mouse is a useful tool to specifically identify the mller glial cells in vivo .
recently , growing evidence suggests that the mller glial cells appear to contain a similar potential to rpcs in cases of acute injury to the retina [ 19 , 20 ] . in response to excitotoxic damage elicited by n - methyl - d - aspartate ( nmda ) ,
a large number of mller glial cells undergo dedifferentiation , reentering the cell cycle , and upregulating transcription factors expressed in rpcs including pax6 , chx10 , six3 , sox2 [ 23 , 24 ] , and sox9 [ 23 , 25 ] .
these reports suggest that the mller glial cells are a potential source of neurons in retinal regeneration in the adult retina .
thus , further studies of the mller glial cells may lead to development of new therapies for retinal damage .
the bac - dkk3-egfp mouse may give us clues to address the molecular and cellular nature of the mller glial cells .
abnormal overactivation of wnt signaling is a major feature of various human cancers . a large number of studies have focused on the wnt signaling pathway to develop a novel cancer therapy [ 2628 ] .
notably , dkk3 has been identified as a downregulated gene in many human cancer cell lines [ 29 , 30 ] .
moreover , dkk3 exhibits an ability to suppress cancer cell growth due to its inhibitory function in the wnt signaling pathway , suggesting that dkk3 can be a potential clinical target in cancer therapies [ 2 , 30 ]
. the bac - dkk3-egfp mouse may thus be useful for the development of innovative cancer therapies as well as that in the mller glial cell studies , because dkk3 expression can be easily detected by the intense egfp signals .
in the current study , we generated the bac - dkk3-egfp transgenic mouse in which dkk3-expressing cells were strongly labeled by egfp . by analyzing the developing retina of this mouse
, we showed that almost all rpcs express egfp at embryonic stages and the mller glial cells at postnatal stages . because of the important function of the mller glial cells in retinal regeneration , the bac - dkk3-egfp mouse is a valuable tool for developing regenerative therapies of the retina . furthermore , since dkk3 is an attractive tool for anticancer drug development , the bac - dkk3-egfp mouse may contribute to the advancement of novel cancer therapies . | dickkopf ( dkk ) family proteins are secreted modulators of the wnt signaling pathway and are capable of regulating the development of many organs and tissues .
we previously identified dkk3 to be a molecule predominantly expressed in the mouse embryonic retina .
however , which cell expresses dkk3 in the developing and mature mouse retina remains to be elucidated . to examine the precise expression of the dkk3 protein
, we generated bac - dkk3-egfp transgenic mice that express egfp integrated into the dkk3 gene in a bac plasmid . expression analysis using the bac - dkk3-egfp transgenic mice revealed that dkk3 is expressed in retinal progenitor cells ( rpcs ) at embryonic stages and in mller glial cells in the adult retina . since mller glial cells may play a potential role in retinal regeneration , bac - dkk3-egfp mice could be useful for retinal regeneration studies . |
gastric adenocarcinoma ( gc ) is the fifth most common cancer in the world , with approximately one million new cases and 730,000 deaths occurring annually . in the united states , approximately 21,600 new cases occurred in 2015 .
therapeutic advances in gastric cancer have been slow and 5-year survival is less than 10% with a median overall survival of 1 year for advanced disease .
surgery with or without chemotherapy and/or radiation is potentially curative in resectable disease although metastatic recurrence rates remain high [ 5 - 7 ] .
the phase iii toga trial ( trastuzumab for gastric cancer ) was the first study to demonstrate success for a targeted therapy in erbb2-amplified gastric cancer , but this is only relevant for the 12%20% of advanced gastric cancer patients who harbor erbb2 ( her2 ) amplification , and new therapies are needed .
geographic differences in gastric cancer incidence are well described , and gastric cancers are the second most commonly diagnosed cancer and a leading cause of cancer - related death in korea .
risk is partly related to geographic and ethnic origins and observations that migration and associated change in environmental risk factors affects gastric cancer risk has led to some questions about underlying biologic differences .
the incidence of gastric cancer in asian american populations has remained stable or slightly decreased over time , largely mirroring the larger united states trend .
although data is limited it appears pik3ca mutations may be less common in east asian populations whereas phosphatase and tensin homolog ( pten ) deletion more frequent when compared to caucasian gastric cancer patients . despite the lack of well characterized genomic differences , large phases ii and iii trials continue to report outcome differences in asian and non - asian populations [ 16 - 19 ]
. molecular characterization of gastric cancers has revealed high rates of recurrent somatic alterations in members of the pi3k / akt / mtor pathway , suggesting potential therapeutic targets .
the pi3k / akt / mtor pathway is an important promoter of cell growth , metabolism , survival , metastasis , and resistance to chemotherapy . despite the appreciation of frequent pi3k pathway alterations in gc
, the ability to translate this genomic observation to improved outcomes has been limited . in the following review
we discuss pi3k signaling , preclinical rationale , current clinical data , and future directions .
phosphatidylinositol-3-kinase ( pi3k ) is a lipid kinase existing as a heterodimer consisting of a regulatory subunit p85 ( p85 , p85 , and p55 ) and a catalytic subunit p110 ( p110 , p110 , p110 , and p110 ) .
although there are 3 classes of pi3k based on the structure , distribution , and mechanism of activation , class ia pi3k is mostly associated with malignancy . under physiologic conditions pi3k
is activated by multiple receptor tyrosine kinases ( rtks ) and/or g - protein - coupled receptors located at the cell surface ( fig .
phosphatidylinositol 4,5 bisphosphate ( pi(4,5 ) p2 ) at the 3 oh position to become phosphatidylinositol 3,4,5 trisphosphate ( pi(3,4,5)p3 ) , which in turn directly binds to the pleckstrin homology ( ph ) domains of various signaling proteins , including phosphoinositide - dependent kinase 1 ( pdk1 ) .
pdk1 phosphorylates akt in the kinase domain at threonine 308 while pdk2 phosphorylates akt at serine 473 domain , leading to full akt activation .
once activated , akt phosphorylates multiple downstream targets in the cytoplasm and nucleus to promote cell growth and survival .
for instance , akt inhibits proapoptotic bcl-2 proteins such as bax and bad and antagonizes p-53 mediated apoptosis by phosphorylating mdm2 [ 26 - 28 ] .
activated rheb stimulates the mammalian target of rapamycin ( mtor ) complex 1 ( mtorc1 ) , resulting in increased activity of eukaryotic initiation factor 4e ( 4ebp1 ) and the ribosomal s6 protein ( s6k1 ) , leading downstream to cell proliferation .
mtorc1 also upregulates other genes involved in cell division and angiogenesis , such as cyclin d and hypoxia - inducible factor-1a ( hif-1a ) , respectively .
the major negative regulator of the pi3k pathway is the lipid pten , a tumor suppressor gene that encodes a lipid phosphatase that converts pip3 back to pip2 .
loss of pten results in constitutive activation of akt and alteration of downstream factors in akt signaling in multiple preclinical models ( fig .
the pi3k / akt / mtor pathway is the second most commonly altered pathway in human cancer after the p53 pathway with the observed frequency of 30%60% across tumor types .
pathologic pi3k pathway activation is mediated by several mechanisms ranging from upstream rtks , decreased expression of pten , genetic alteration in pik3ca and akt and other less frequent events . within gc pik3ca
is the most commonly mutated pi3k isoform with a mutation and amplification frequency of 18% and 5% respectively ( fig .
this finding is consistent with previous studies that reported pi3kca mutation rates of 4%25% [ 34 - 37 ] .
occur at three recurrent hotspots ; e545k and e542k in the helical domain ( exon 9 ) and h1047r in the kinase domain ( exon 20 ) .
pik3ca mutation frequency in gc correlates with stage , seen in 21.4% of pt4 tumors compared to 6.4% in pt2 lesions .
in addition to stage there is a strong predilection for pik3ca mutation in epstein - barr virus ( ebv ) positive gastric cancer with a nonsilent mutation rate up to 80% .
in contrast the activating alterations in other p110 isoforms ( delta and beta ) are rare ( fig .
pten is a tumor suppressor gene on chromosome 10q23.3 and the major negative regulator of pi3k activity under physiologic conditions . within the cancer genome atlas ( tcga )
database , the frequency of deletion , mutation and amplification of pten in gastric cancer is 0.3% , 3.1% , and 4% , respectively ( fig .
2 ) . there is significant difference in the rate of pik3ca and pten mutations between asian and caucasian gc patients .
a meta - analysis found that east asian and caucasian gc patients differ significantly among the frequencies of pik3ca exon 9 and 20 mutations ( 7% vs. 15% , respectively ) , pten deletion ( 21% vs. 4% ) and pten loss ( 47% vs. 78% ) .
the genetic alterations in the study included missense ( 55.6% ) , nonsense ( 33.3% ) , deletion ( 7.4% ) , and a mutation within pten intron 6 ( 3.7% ) .
pten missense mutations abrogated or attenuated phosphatase activity up to 90% of the time suggesting functional relevance .
pten status did not predict response to pi3k / mtor inhibitors reliably , perhaps because patients with negative and reduced pten expression had a higher incidence of simultaneous mapk ( kras , nras , braf ) mutations .
akt1 and 2 are normally expressed in all tissues while akt 3 is mainly restricted to brain and testes .
although the overexpression of akt by immunohistochemistry is up to 74% in gastric cancer , genomic alterations are relatively rare at 1%3% in gastric cancer ( fig .
differential isoform expression has functional implications and may be relevant for future isoform - specific therapeutic approaches .
for example , akt1 promotes cellular survival and proliferation while akt2 stimulates cellular invasiveness and mesenchymal transformation .
loss of akt2 expression may decrease metastatic potential while loss of akt1 paradoxically can increase invasiveness , presumably due to a shunt to akt2 isoform production .
the functional implications of genomic aberrations in downstream signaling nodes mtor are less well studied although effective inhibitor of mtor signaling appears important for optimal efficacy .
there are 4 major classes of drugs that target the pi3k - akt pathway : pi3k inhibitors , dual pi3k - mtor inhibitors , mtor inhibitors , and akt inhibitors ( table 1 ) .
pi3k inhibitors have been developed as either isoform - specific or pan - pi3k inhibitors .
theoretically , isoform - specific inhibitors should have an inherent specificity thereby minimizing on - target side effects results from inhibition of all isoforms .
however , potential disadvantage of selective pi3k inhibition is an incomplete blockade of akt activation in conditions where multiple p110 isoforms exist .
compounds inhibiting the mtor catalytic site block both mtor1 and mtor2 , a critical node mediating downstream function .
catalytic site inhibitors largely overcome the insulin receptor substrate 1 ( irs-1)-mediated feedback thought to limit the efficacy of earlier mtor inhibitors like sirolimus ( rapamycin ) [ 46 - 48 ] .
allosteric inhibitors block the ph domain from binding phosphoinositides at the plasma membrane , preventing akt phosphorylation .
similar to the theory of pi3k inhibitors , it is possible that akt inhibitors may eventually be isoform specific for akt1 or akt2 , to deliver lower effective doses with less side effects .
a phase ii s1005 study evaluated mk-2206 , an allosteric inhibitor of akt , as second - line therapy for 66 patients with advanced gastric cancer .
common toxicities included anemia 15% , anorexia 27% , diarrhea 24% , fatigue 48% , hyperglycemia 29% , nausea 40% , vomiting 20% , maculopapular rash 30% , and acneiform rash 8% .
the response rate ( rr ) , progression free survival ( pfs ) , and overall survival ( os ) were 2% , 1.8 month , and 5 months , respectively .
a multinational phase ii jaguar trial comparing the efficacy of mfolfox6 plus ipatasertib , an oral akt inhibitor , versus mfolfox6 plus placebo in 120 patients with advanced untreated gastric cancer is currently undergoing . though pi3k signaling inhibitors are promising , there are some theoretical shortcomings which raise concern for their clinical efficacy . preclinical studies in breast cancer cells with pi3kca mutations show in vivo efficacy of pi3k - mtor inhibitors or akt inhibitors .
it remains to be seen whether inhibitors of the pi3k signaling pathway will be efficacious in single - agent therapy , though unlikely .
a potential reason for limited efficacy of single - agent therapy is positive feedback loops and activation of coinciding proliferative signaling pathways .
the most common alternate pathway involves nodes in the ras - raf - mek - erk signal transduction pathway .
murine models of lung cancer with kras overexpression showed no efficacy of either a pi3k or mek inhibitor alone , however , the combination was highly effective .
kras mutant colorectal cancer mouse model cells that demonstrated resistance to pi3k / mtor inhibitor had restored sensitivity to dual pi3k / mtor inhibitor in combination with a pan - erbb inhibitor .
similarly , the combination of pi3k / mtor and ras / erk pathway inhibitors shows synergy in treating ovarian cancer .
studies such as these suggest that combination therapy may delay resistance and by used in cancers which were initially responsive .
preclinical studies demonstrated that treatment of gastric cancer cell lines with everolimus and sirolimus lead to g1 cell cycle arrest and growth inhibition . in 5-fu - resistant gastric cancer cells , the addition of everolimus to chemotherapy demonstrated synergistic growth inhibition .
administration of rapamycin to mouse xenograft models decreased tumor volume and microvessel density , as well as downstream factors such as s6k1 , 4ebp1 , hif-1a and vascular endothelial growth factor . in a phase 2 multicenter trial in 53 advanced heavily pretreated gastric cancer patients who was treated with everolimus , the disease control rate ( dcr ) , pfs , and os were 56% , 2.7 months , and 10.1 months , respectively .
there was no observed partial response ( pr ) or complete response , and common side effects included stomatitis ( 73.6% ) , anorexia ( 52.8% ) , fatigue ( 50.9% ) , rash ( 45.3% ) , nausea ( 32.1% ) , peripheral edema ( 22.6% ) , diarrhea ( 20.8% ) , and pruritus ( 18.9% ) . based on these results ,
the phase iii granite 1 trial evaluated the safety and efficacy of everolimus versus placebo in 656 patients who progressed after the first or second line chemotherapy , randomized to a 2:1 schedule . although pfs was modestly improved ( median : 1.7 months vs. 1.4 months , p<0.001 ) , overall survival , the primary endpoint , was not ( median : 5.4 months vs. 4.3 months , p=0.124 ) .
however , there were patients who derived durable stable disease and the modest pfs improvement suggested potential benefit in selected patients .
multiple potential predictive biomarkers have been explored , including pik3ca / pten mutation status , akt activation , ps6ser240/4 and other members of the akt / mtor pathway .
one preclinical study demonstrated that tumor cells harboring pik3ca and/or pten mutations were more likely to be rapamycin responsive ( p=0.0123 ) .
additionally , akt phosphorylation ( s473 and t308 ) was significantly higher in rapamycin sensitive cells ( p<0.0001 ) in this study .
another study demonstrated significant correlations between everolimus sensitivity and a battery of markers consisting of total s6 levels , p235-s6 , p240-s6 , peif4 , rictor , raptor , total akt , and pakt .
however , the authors noted that such approach would be infeasible in real clinical practice .
the ratio of p235-s6/total - s6 and pakt alone are able to provide adequate predictive power .
the potential role of ps6ser240/4 as predictive marker was shown in an asian phase ii study evaluating pfs rate at 4 months in 54 advanced gastric cancer pts receiving everolimus .
the 4-month pfs rate was 18.4% ( less than the hypothesized pfs of 30% ) and the median pfs and os were 1.7 and 8.3 months , respectively .
however , high baseline expression of ps6ser240/4 , defined as immunohistochemistry ( ihc ) staining > 2 , was significantly associated with higher disease control rate ( dcr ) ( p
the us study showed numerically inferior outcomes compared to the asian study with median os 3.4 months and pfs 1.8 months .
however , this study reaffirmed a strong correlation between 2+ihc staining for p - s6 in tumor samples with better pfs ( p < 0.0001 ) and dcr ( p = 0.0001 ) .
anecdotal evidence seems to validate the p - s6 overexpression and concurrent pik3ca mutation may identify a group of patient able to derive prolonged benefit from pi3k - directed therapy .
further studies are required to validate these biomarkers not only for mtor inhibitors but also other pi3k pathway inhibitors .
the disappointing activity of everolimus in advanced gc highlighted the need for a more biologically informed development process for pi3k pathway inhibitors in gastric cancer .
recently lei et al . proposed a new gastric cancer classification that was distinct from the well - known 1965 lauren classification .
this classification included mesenchymal , proliferative and metabolic as the 3 distinct histologic subtypes based on the differentially expressed genes .
for instance , the gene clusters in the mesenchymal tumors are mostly involved in the epithelial mesenchymal transition pathway with high mtor pathway activity .
the mesenchymal subtype was found to be sensitive to pik-3ca inhibitors while the proliferative subtype was more sensitive to 5-fu in vitro .
another subgroup that may benefit from pik3ca inhibitors are those who carry ebv positive tumors which was shown to harbor pik3ca mutation up to 80% according to the tcga study .
we believe that omics platforms characterizing gastric cancer and other tumors are a critical step toward refining the role of pi3k compounds . while hotspot mutational analysis is readily available
we feel that the genomic context of a pi3k / akt / mtor alterations will be important in guiding outcomes .
the relatively low response rate even for pik3ca mutated tumors may be due to intrinsic resistance , acquired resistance mechanism and crosstalk between different pathways .
one preclinical study demonstrated that hnscc cell lines with pik3ca mutations were universally sensitive to pi3k , mtor inhibitors , or both .
however , pik3ca amplification , pten loss , and basal pik3ca / akt / mtor pathway activity did not predict response . as more clinical experience with pi3k inhibitors becomes available , we will be able to predict which specific pi3k pathway gene dysregulation would be sensitive to specific combination of inhibitors .
whole genome sequencing will also identify genetic alteration in other pathways such as ras or braf , which are known to negate the effect of pi3k inhibitor .
one study using the pik3ca / pten / ras testing protocol prior to pi3k pathway inhibition found that treated patients with wild - type kras had a higher pr rate of 31% compared to 6% in patients with simultaneous kras mutations ( p=0.05 ) .
the pi3k / akt / mtor and ras / raf / mek / erk pathways are known to interact at multiple points , resulting in cross - activation , cross - inhibition , and pathway convergence .
examples include activation of pi3k directly by ras , suppression of tsc2 by phosphorylated erk or akt , initiating mtorc1 complex formation .
multiple resistance mechanisms to pik3ca inhibitors have been identified and they likely contribute to poor efficacy .
the most well - known mechanism is the activation of multiple rtk pathways after pik3ca inhibition .
inhibition of mtorc1 with rapamycin and catalytic mtor inhibitors increase insulin receptor substrate 1 ( irs-1 ) levels and induce akt phosphorylation and downstream signaling .
akt inhibition leads to loss of transcription factor foxo3 regulation and subsequent increased expression of multiple rtks . moreover , simultaneous wnt-catenin pathway hyperactivation and pi3k - akt signaling inhibition promote nuclear accumulation of -catenin and foxo3a , and eventual metastasis .
additionally , enhanced her2 signaling following pi3k inhibition has been reported to lead to erk activation .
dual blockade with either mek and pi3k or erk and pi3k inhibitors lead to higher rate of apoptosis in numerous preclinical studies , prompting the rationale for combination therapy .
the clinical experience with dual mek and pi3k inhibitors in treating solid tumors are limited as most trials are still in early phases .
the preliminary results from these studies implicate potential efficacy in the combination therapy . there are no known published gastric cancer cases that are sensitivity to dual pathway blockade . in a phase i trial where 49 patients with ras or braf mutant advanced solid tumors were treated with trametinib and bkm120 , 3 patients with ras ovarian cancers achieved pr , 2 with braf mutant melanoma achieved stable disease ( sd ) .
the combination was well tolerated with common adverse events including rash , nausea , fatigue , vomiting , decreased appetite , and elevated cpk .
grade 3 dlts included stomatitis , dysphagia , decreased ejection fraction , cpk elevation , nausea and anorexia .
the combination of gdc-0973 and gdc-0941 was evaluated in 78 patients with solid tumors yielded 3 prs ( 1 braf mutant melanoma , 1 braf mutant pancreatic , and 1 kras mutant endometrial cancer ) and 5 sd .
this combination therapy was well tolerated , with comparable toxicities to monotherapy . in a retrospective study , 5 patients with coactivation of pi3k / akt and ras / raf / mek pathways who received dual inhibition had tumor regression / stabilization from 2%64% ( 3 colon , 2 melanoma ) .
conversely , all 4 colon cancer patients in the single pathway inhibition group developed progressive disease .
this finding is consistent with other studies that pi3k inhibition alone is insufficient for tumors with concurrent ras / braf activation . for the unselected population
, there was no significant difference in both tumor control rate for single or dual inhibition ( 52.7% and 64.6% , respectively , p=0.16 ) .
there were more grade iii / iv adverse events observed in the dual pathway inhibition group .
the response rates are low and appear mainly restricted to ras and raf mutated cancers .
the most responsive tumors included braf positive melanoma , kras positive ovarian cancer , and kras positive colon cancer .
gastric cancer is a heterogeneous disease and recent genomic characterization has refined our understanding of molecular subtypes .
alterations in the pi3k / akt / mtor pathway occur across gastric cancer types but have yet to translate to improved outcomes in prospective trials .
anecdotal reports provide preliminary support for a possible rare subset with multiple pi3k pathway activating alterations and the absence of mapk alterations which may provide ready resistance .
the need to assess multiple genomic alterations in order to identify a narrow subset makes large prospective trials more difficult , however , is likely a key need to maximize the potential to exploit oncogenic pi3k pathway alterations in gastric and other tumors . | phosphatidylinositol-3-kinase ( pi3k ) pathway signaling is an established oncogenic signal transduction pathway implicated in multiple malignancies .
therapeutic targeting of pi3k pathway components has improved outcomes in chronic lymphocytic leukemia , kidney cancer , breast cancer , and neuroendocrine tumors .
gastric cancers harbor some of the highest rates of oncogenic alterations in pi3k but attempts to translate this genomic observation have met with limited clinical success and novel approaches are needed . in the following review we discuss pi3k signaling , previous preclinical and clinical investigations in gastric cancer , and discuss future strategies aimed at overcoming resistance and improving efficacy . identification and refinement of molecular tumor subtypes , development of predictive biomarkers along , and rational drug combination strategies are key to capitalizing on the therapeutic potential of pi3k pathway directed therapies in gastric cancers . |
treatment of limited stage of hodgkin lymphoma by introducing new chemotherapy regimens and combining radiotherapy and chemotherapy has significantly evolved in recent years and failure in treatment is seen only in 10 to 20% of patients .
recently , there are tangible improvements in advanced stages of hodgkin lymphoma but 10% of patients failed to achieve complete response with combined modality therapy , and 20 to 40% of patients suffered from recurrence or progressive disease .
salvage chemotherapy and autologous bone marrow transplant has become the standard of treatment in recurrence or refractory hodgkin 's lymphoma .
different regimens of salvage chemotherapy have been introduced in literature , with the goal of attaining a higher response rate , least side effects , and least damage to bone marrow cells in order to avoid distortion in next phase of treatment which needs mobilization and harvesting stem cells .
considering acceptable progression free survival following this treatment , proper chemotherapy before autologous bone marrow transplant is a critical step .
the two main salvage chemotherapies vastly implemented are gdp ( gemcitabine , dexamethasone , and cisplatine ) with less hospitalization introduced by baetz , and eshap ( etoposid , methyl prednisolone , cisplatine , cytarabine ) introduced by aparicio et.al .
the latter needs at least five days of hospitalization and has been used as the standard protocol in our institute over the last few years .
although several studies have been performed to demonstrate the efficacy of these protocols , no comparison has been made between these two treatment regimens . in order to compare the efficacy of these two protocols
the study included 50 patients with recurrent of hodgkin lymphoma between jan 2010 and dec 2011 .
all patients received standard protocol of abvd ( doxorubicin , bleomycin , vinblastine and dacarbazine ) as the first - line of treatment .
disease recurrence was histopathologically confirmed in patients with recurrence one year after their primary diagnosis , or there was radiologic evidence of recurrence in any organ in the body other than primary site .
no histopathologic study was done on patients with recurrence disease in less than one years of diagnosis and radiologic evidence of recurrence in primary site .
other inclusion criteria were : age 16 years ' old , eastern cooperative oncology group performance states of 02 , creatinine<1.4 mg / dl , serum aspartate or alanine aminotransferase<2.5 upper limit of normal and bilirubin<1.5 uln .
patients with inclusion criteria were randomly assigned into two treatment groups : gdp and eshap ( block randomization ) .
complete physical examination , cbc with differentials , and biochemistry profile ( bun , cr , and liver function tests ) were conducted before starting treatment in each cycle and one week after chemotherapy .
this study was approved by the institutional review board and medical ethics committee of shiraz university of medical science ( sums ) .
chemotherapy in gdp group consisted of gemcitabine 1000 mg / m2 on days 1 and 8 ; dexamethasone 40 mgiv on days 1 to 4 , and cisplatin 75mg / m . in order to reduce the risk of cisplatin - induced nephrotoxicity
, patients were hospitalized for a maximum of 36 hours and hydrated with normal saline 12 hours prior to chemotherapy that was continued 8 hours after introduction of cisplatin .
dexamethasone and granisetron were used intravenously as anti - emetic agent . in eshap group , patients were hospitalized during chemotherapy and the protocol included the followings : etoposide 40mg /
m on days 1 to 4 , methylprednisolone 500mgiv on days 1 to 4 , cytarabine 2000mg
/ m on day 5 , and cisplatin 25mg / m on days 1 to 4 . courses were repeated every 3 weeks and anti - emetic agents used for treatment were the same as gdp protocol .
treatment cycles were delayed by 1 week for garnulocytopenia of < 1.0 10 or thrombocytopenia of < 100 10/l , or attenuation schedule was implanted .
all patients were evaluated during 3 weeks of third course of chemotherapy with complete physical examination and chest , abdomen and pelvis ct - scan .
the primary objective of this study was to evaluate the response rate according to the national comprehensive cancer network ( nccn ) guide line version 1 - 2011 .
chemotherapy side effects were evaluated based on national cancer institute common toxicity criteria version 4.0 . pet scan or gadolinium scan was not done for patients .
the study included 50 patients with recurrent of hodgkin lymphoma between jan 2010 and dec 2011 .
all patients received standard protocol of abvd ( doxorubicin , bleomycin , vinblastine and dacarbazine ) as the first - line of treatment .
disease recurrence was histopathologically confirmed in patients with recurrence one year after their primary diagnosis , or there was radiologic evidence of recurrence in any organ in the body other than primary site .
no histopathologic study was done on patients with recurrence disease in less than one years of diagnosis and radiologic evidence of recurrence in primary site .
other inclusion criteria were : age 16 years ' old , eastern cooperative oncology group performance states of 02 , creatinine<1.4 mg / dl , serum aspartate or alanine aminotransferase<2.5 upper limit of normal and bilirubin<1.5 uln .
patients with inclusion criteria were randomly assigned into two treatment groups : gdp and eshap ( block randomization ) .
complete physical examination , cbc with differentials , and biochemistry profile ( bun , cr , and liver function tests ) were conducted before starting treatment in each cycle and one week after chemotherapy .
this study was approved by the institutional review board and medical ethics committee of shiraz university of medical science ( sums ) .
chemotherapy in gdp group consisted of gemcitabine 1000 mg / m2 on days 1 and 8 ; dexamethasone 40 mgiv on days 1 to 4 , and cisplatin 75mg / m . in order to reduce the risk of cisplatin - induced nephrotoxicity
, patients were hospitalized for a maximum of 36 hours and hydrated with normal saline 12 hours prior to chemotherapy that was continued 8 hours after introduction of cisplatin .
dexamethasone and granisetron were used intravenously as anti - emetic agent . in eshap group , patients were hospitalized during chemotherapy and the protocol included the followings : etoposide 40mg / m on days 1 to 4 , methylprednisolone 500mgiv on days 1 to 4 , cytarabine 2000mg / m on day 5 , and cisplatin 25mg / m on days 1 to 4 . courses were repeated every 3 weeks and anti - emetic agents used for treatment were the same as gdp protocol .
treatment cycles were delayed by 1 week for garnulocytopenia of < 1.0 10 or thrombocytopenia of < 100 10/l , or attenuation schedule was implanted .
all patients were evaluated during 3 weeks of third course of chemotherapy with complete physical examination and chest , abdomen and pelvis ct - scan .
the primary objective of this study was to evaluate the response rate according to the national comprehensive cancer network ( nccn ) guide line version 1 - 2011 .
chemotherapy side effects were evaluated based on national cancer institute common toxicity criteria version 4.0 . pet scan or gadolinium scan was not done for patients .
a total of 44 patients who met the inclusion criteria were entered into the study .
mean age of patients was 29.73(rang : 17 56 ) in gdp group and 26.5(rang : 18 56 ) years old in ehsap group .
no statistically significant difference was observed between the two treatment groups ( mann - whitney test , p value = 0.655 ) . in gdp group ,
disease stage was stage ii in 45% , stage iii in 45.5% and stage iv in 9.1% of patients .
in eshap group , these proportions were 54.6% , 22.7% and 22.7% , respectively , suggesting the equal distribution of patients in both groups with respect to disease stage . in gdp group ,
77% of patients had first relapse , 9.1% had second relapse and 13.6% of them had primary refractory disease .
in eshap group , these values were 72.2% , 4.5% and 22.7% , respectively ( fisher 's exact test , p - value : 0.546 ) .
therefore , no difference was observed in disease stages between two groups . the mean time to relapse was 20.42 and 16.35 months in gdp and eshap groups , respectively and there was no statistically significant difference between the two groups ( mann - whitney sig : 0.247 ) .
considering the aforementioned factors , it can be concluded that patients were equally distributed in both groups with respect to age , sex , stage and time to relapse ( s1 ) .
27.3% of patients in gdp group had complete response , 31.8% had more than 50% response , and 40.9% had no response .
statistical analysis with the chi - square test showed that response rate was identical in both groups ( sig 0.578 ) . overall response rate in gdp and eshap groups was 54.1% and 50% , respectively ( sig 0.763 ) ( s2 ) . of two patients with thrombocytopenia in gdp group , one ( 4.5% ) developed grade
two patients were experienced thrombocytopenia in gdp group , one patient grade i ( 4.5% of patients in this group ) and another one grade iii .
this event in eshap group was seen in 9.1 % ( grade ii ) . in gdp group ,
grade iii neutropenia was seen in one ( 4.5% ) patient and two ( 9.1% ) patients experienced grade ii neutropenia in eshap group creatinine in eshap group was raised from 1.8 to 2 mg / d in one patient and remained in this level after one - year follow - up period .
ast and alt also rose to greater than 2 times about 2xuln ( upper normal limit ) during chemotherapy and returned to normal levels after two weeks in this patient .
( s3 ) in gdp group , one patient suffered from hyperglycemia in the last cycle of treatment and blood sugar was not corrected after termination of treatment .
of two patients with thrombocytopenia in gdp group , one ( 4.5% ) developed grade i and one ( 4.5% ) developed grade iii .
two patients were experienced thrombocytopenia in gdp group , one patient grade i ( 4.5% of patients in this group ) and another one grade iii .
this event in eshap group was seen in 9.1 % ( grade ii ) . in gdp group ,
grade iii neutropenia was seen in one ( 4.5% ) patient and two ( 9.1% ) patients experienced grade ii neutropenia in eshap group creatinine in eshap group was raised from 1.8 to 2 mg / d in one patient and remained in this level after one - year follow - up period .
ast and alt also rose to greater than 2 times about 2xuln ( upper normal limit ) during chemotherapy and returned to normal levels after two weeks in this patient .
( s3 ) in gdp group , one patient suffered from hyperglycemia in the last cycle of treatment and blood sugar was not corrected after termination of treatment .
because achievement to adequate response to salvage chemotherapy before bone morrow transplantation is important this influences transplantation 's results and progression free survival of patients . in this study the researcher attempted to compare the results of two methods of treatments : eshap vs. gdp .
the former has been used as a common treatment regimen at our center over the last few years and needs 5 days of hospitalization .
hospitalization with another method which had acceptable effectiveness with far less side effects and hospitalization required i.e. gdp .
baetz introduced gdp protocol ( gemcitabine , dexamethasone , cisplatin ) and evaluated patients after 2 cycles of chemotherapy . among his patients , 4 had complete response , had partial response and 7 had stable disease ( without progression on treatment ) . in the study conducted by aparicio ,
22 patients were treated with eshap ( etoposid , methyl prednisolone , cisplatin and cytarabine ) protocol and were evaluated after 3 cycles of chemotherapy . at the end of the study , 9 patients had complete response and 5 patients had partial response ( overall response : 73% ) .
chemotherapy regimen in gdp group of the current study was slightly different from baetz study . in this study , patients were hospitalized at least 36 hours in order to hydration in order to reduce the risk of cisplatin - related nephrotoxicity , while in baetz study this protocol was prescribed as outpatient and manitol was used in addition to dextrose / saline before cisplatin .
due to lack of response to initial salvage treatment protocol ( gdp or ehsap ) ; cross - over trial was performed in three patients in two groups at the beginning of our study .
none of these patients showed response to second - line salvage chemotherapy ( either gdp or eshap ) , therefore , this trend was stopped .
one of the significant findings was that none of the patients with primary refractory disease responded to protocols used in this study , but all responded to iev ( ifosfamide , epirubicin , etoposide ) .
none of the patients with recurrent stage iv disease in both groups reached complete response .
in baetz study , 52% of patients treated with gdp protocol had stage iii and iv diseases and 48% had stage i and ii . in the current study , these rates were 45.5% and 54.5% , respectively . in this study ,
13.6% of patients in gdp group had primary refractory disease , while only 26% of patients had primary refractory disease in baetz study .
compared to baetz study in which patients received 2 cycles of chemotherapy , in this study patients received 3 cycles of chemotherapy . in the current study ,
overall response rate in gdp group was 54.1% , while it was reported 69.5% in baetz study .
in the present study , overall response rate was 50% in eshap group , while it was 73% in patients treated with similar protocol in aparicio study . here , we present the results of comparison on side effects between the two treatment groups and with previous studies ( s4 , s5 ) : in aparicio study , 59% of patients developed myelotoxicity ( grades iii and iv ) and one patient died of neutropenic fever , while in the present study side effects were significantly lower and there were no mortality . in baetzstudy , four patients needed hospitalization , 8.6%
in the present study , 4.5% of patients showed grade iii neutropenia and 4.5% of patients showed grade i and iii thrombocytopenia .
, there was no significant difference in response rate between the two salvage regimens , but gdp regimen can be used as an outpatient regimen with low toxicity . based on this study ,
these two regimens were not suitable options for primary refractory hodgkin lymphoma as salvage treatment .
there is no significant difference in overall response rates between the two protocols but due to least toxicity and lower health care costs result from less hospitalization , gdp could be considered as the better option for salvage regimen . | abstractbackground : despite multiple published studies reporting result of salvage regimens for relapsed and refractory hodgkin 's lymphoma , there are no comparisons of different combinations.patients and methods : a total of 44 patients identified with refractory or relapsed hodgkin 's lymphoma were considered eligible for this study . the patients were randomly divided into two groups of 22 , one of which were treated with gdp regimen ( gemcitabine , dexamethasone and cisplatin ) and the other with ehsap regimen ( etoposide , methyl prednisolone , cisplatin and cytarabine ) in a prospective manner .
the results of each group were compared.results:there were 27.3% complete response , 31.8% more than 50% response , and 40.9% no response with gdp .
eshap results were 29.5% , 24% and 45.5% , respectively.conclusion:there is no significant difference in response rate between gdp and eshap regimens as salvage chemotherapy in refractory or relapsed hodgkin 's lymphoma . |
medication is central to treating and managing type ii diabetes mellitus , a prevalent age - related chronic illness .
effective treatment is often undermined by nonadherence , with as many as half of patients not taking medications as prescribed [ 2 , 3 ] .
nonadherence is traced to many causes but often involves a gap between the cognitive demands of adherence and inadequate cognitive resources that patients bring to the task , a problem that is compounded by limited healthcare system support .
for example , to manage complex medication regimens , patients with type ii diabetes must create plans for taking multiple medications that meet constraints such as avoiding medication interactions and timing with respect to meals or other daily events .
planning requires cognitive resources related to health literacy [ 57 ] , such as processing capacity ( e.g. , working memory ) and health knowledge .
older adults are especially likely to demonstrate nonadherence because they tend to have more complex medication regimens , yet experience declines in literacy and cognitive resources needed for self - care .
for example , patient - provider collaboration is crucial for adherence [ 10 , 11 ] .
education by providers can increase patient knowledge and self - care skills , and simplifying regimens and coordinating treatment across providers reduce adherence demands on patient cognitive resources .
however , effective collaboration requires patients and providers to work together to ensure information is mutually understood , and providers do not always collaborate with patients effectively . while providers do most of the talking during consultations , they may skip key information , use non - patient - centered language , or fail to check patients ' comprehension of the information that they present .
medication review with patients is sporadic and fragmented and reconciliation , the process of ensuring accurate , complete , and current patient medication lists , is often inadequate . as a consequence ,
patients leave consultations with deficits in memory for important information and inadequate plans for self - care .
adults with lower health literacy and cognitive resources are especially vulnerable to inadequate collaboration with providers .
patients with diabetes and lower health literacy report worse communication with providers and have worse outcomes than do patients with adequate literacy [ 20 , 21 ] .
adults with complex regimens and multiple self - care needs are candidates for system support because they are less likely to develop shared adherence plans with their providers , leading to nonadherence [ 2 , 22 ] .
inadequate collaboration reflects barriers such as limited contact time and lack of support for consistent use of patient - centered communication strategies .
patient memory for self - care information is improved when information is provided visually ( text and graphics ) as well as verbally during clinic visits , especially when the presented information is consistent , standardized , and embedded in structured processes that activate patients [ 13 , 23 ] .
well - designed information technology can support multimedia approaches to patient - centered communication , but this potential has yet to be realized .
for example , comprehensive medication lists printed on cards are recommended for medication review and reconciliation with patients , but studies evaluating such cards in pharmacy , hospital discharge , and specialized clinic environments produced inconsistent evidence .
this finding may reflect the fact that the cards were not specifically designed to support patient - provider collaboration nor were they linked with health information technology , thus not integrated with clinical practice .
we developed a patient education tool called the medtable that is integrated with the electronic medical record ( emr ) in primary care clinics .
the purpose of the medtable is to improve patient self - management via patient - provider collaboration .
guided by distributed cognition theory , which suggests that cognitive activity can be effectively distributed across individuals ( such as nurses and patients ) and external artifacts ( tools such as computers or paper ) to support collaboration , the medtable was designed to accomplish three goals : ( 1 ) to promote patient knowledge by clearly conveying accurate and relevant medication information ; ( 2 ) to support collaborative planning wherein a patient , guided by a nurse , could efficiently organize medications tailored to his or her daily schedule to support use ; ( 3 ) to embed the tool into clinical practice by integrating it with emr systems so that it is easily updated , reliable , and shareable with providers .
our use of emr - integrated technology to support collaborative planning for medication use is unique in the literature on medication adherence among patients with diabetes .
few previous studies focus on patient / provider consultation ( for review , see ) .
for example , one study assesses the use of paper - based tools to support patient / provider planning about medication taking .
other studies evaluate problem solving protocols to address barriers to adherence during face - to - face [ 3032 ] or telephone - based communication .
these studies do not involve the use of emr - integrated tools designed to support specific cognitive processes underlying patient / provider collaboration and learning .
this emr - enabled medtable strategy was evaluated to determine its impact on medication use and health outcomes among patients with type ii diabetes mellitus .
we hypothesized that , compared to usual care , patients randomized to this intervention will have greater medication knowledge , adherence , and better outcomes ( as measured by glycosylated hemoglobin hba1c levels ) , as well as being more satisfied with provider communication about medications .
a secondary hypothesis was that intervention benefits would be greater for patients with lower health literacy than for those with adequate literacy , because the intervention was designed to address literacy - related barriers .
the study design was a two - arm , patient - randomized , controlled trial .
all the research sites used the same electronic medical record and version ( epic , verona , wisconsin ) .
the institutional review boards of northwestern university and the university of illinois approved the research .
a group of experts comprised the data safety and monitoring board that monitored the trial and reviewed protocol changes .
criteria for enrollment were ( a ) age 40 years and older ; ( b ) native speaker of english ; ( c ) no physical or cognitive impairments that could limit participation ( e.g. , stroke in the last 3 years , current cancer treatment involving radiation or chemotherapy ) ; ( d ) score of 4 or higher on the short screen for dementia ; ( e ) no severe visual impairment ( less than 20/50 corrected vision ) or auditory impairment that would limit participation ; ( f ) diagnosis of type ii diabetes mellitus ; ( g ) taking at least 5 prescribed medications ; and ( h ) glycosylated hemoglobin ( hba1c ) level of 7.0% or higher . the inclusion / exclusion criteria related to language proficiency and physical , sensory , and cognitive impairment were designed to minimize factors that might reduce response to the intervention and confound interpretation of the findings .
recruitment occurred from ambulatory care general internal medicine clinics in chicago and peoria , illinois , which served as the performance sites for this study .
primary care physicians gave permission to screen their patient panels for potential participants who had the appropriate age , hba1c , and number of medications .
then , potential participants received a letter via mail that described the research and said the patient would be contacted via telephone . shortly before a scheduled clinic visit with the primary care clinician ,
clinical research coordinators contacted potential participants via phone to provide a questionnaire for inclusion / exclusion criteria , determine eligibility , and initiate the informed consent process .
participants who provided informed consent via telephone were scheduled for the baseline research visit that coincided with the next clinic visit with the primary care clinician .
participants completed the informed consent process at the baseline research visit and then immediately received the randomized intervention . because of slow recruitment , the data safety and monitoring board authorized a change in the inclusion criteria to enroll participants with hba1c of 6 or more .
patients who were allocated to the experimental condition received the medtable - based intervention ( see figure 1 ) . a complete description of the medtable has been published . in summary ,
the medtable is a structured tool that was implemented within the electronic medical record ( emr ) at the outpatient clinics .
the goal of the medtable was to organize collaborative , patient / provider interactions for medication review , reconciliation , and education .
features of the medtable included searchable libraries of medication administration instructions in direct , actionable language , timelines that support text , and familiar icons that represent key daily events .
implementation of the tool occurred during routine clinic visits , and this occurred in three stages . during the setup stage and prior to the patient visit , the nurse loaded the patient medication list from the emr into the medtable . at this stage ,
the nurse used the medtable to customize the technical language from the emr to provide language appropriate for patients with low health literacy .
the patient reviewed the emr - based medication list , and then the nurse and patient collaboratively reconciled the list .
the nurse added or deleted information in the emr in response to the reconciliation stage .
the goal of the second stage was an accurate and current medication list . in the final stage ,
patients described their daily routine so the nurse could set up the tool around the routine .
the medtable displayed icons and highlighted columns to which the patient and nurse could refer while developing the schedule .
the nurse and patient scheduled each medication by clicking on the cell in the table corresponding to the medicine ( row ) and the time slot ( column ) . in this way , the tool scaffolded collaborative planning for taking the patient 's medications .
the nurses also discussed how to take each medication with the patients and used teach - back techniques to ensure patient comprehension . at the end of the third stage ,
the patient received a paper copy of the medtable - based summary of their daily medication schedule to take home .
the intervention nurses were trained to use the medtable as part of patient - centered care .
nurses received a multimedia manual with project overview , rationale for the intervention , overview of the medtable tool and how it is used , and specific information about medtable procedures .
the education emphasized teach - back and teach - to - goal strategies to ensure patients understand how to take their medicines . while training , nurses interacted with the medtable as patients as well as providers to optimize understanding from multiple perspectives . nurses participated in simulated patient encounters to set up the tool and work with patients to develop schedules for medication regimens of varying complexity . to ensure fidelity of the intervention to the research protocol , the research personnel observed intervention nurses while working with several actual patients at both research sites .
feedback was provided to the nurses to reinforce initial training and ensure consistent delivery of the intervention across sites .
patients allocated to usual care received medication counseling and communication from clinic nurses according to the standard of care at the research sites .
the medication instructions on the list were comparable to the text commonly found on prescription labels .
usual care recipients and their providers did not receive prompts to organize the medication list around the patient 's daily activities .
the primary prespecified outcomes were verbal and demonstrated knowledge of the medication regimen [ 5 , 35 ] .
research personnel assessed medication knowledge at baseline , immediately following the research intervention , and then 3 and 6 months later . patients received a reminder to bring current prescription medication bottles or containers to each study visit .
clinical trial coordinators recorded all medications and dose directions from the label . to assess verbal knowledge of directions for use of injectable medications like insulin , clinical trial coordinators recorded the patient 's responses to two questions : on a usual day , how many times a day do you take this medicine ? and how many units of this medicine
do you usually take each time ? we scored correct verbal knowledge per injectable medication if the patient answered both questions correctly when compared to directions on the label . to assess verbal medication knowledge of directions for use of noninjectable , prescribed medications , clinical trial coordinators recorded the patient 's responses to three questions for each medication : on a usual day , how many times a day
do you take each time ? and how many pills of this medicine do you take each day in total ? for noninjectable medications , we scored correct verbal knowledge per medication if the patient answered all three questions correctly when compared to directions on the label . for purposes of analysis ,
we calculated combined verbal knowledge of the regimen for all questions : the number of medications scored as correct verbal knowledge divided by the total number of medications in the regimen .
another verbal medication knowledge item was indication for each medicine in the patient 's regimen .
older and less educated adults are less likely to know the purpose of their medications . clinical trial coordinators recorded the verbatim response to the following question : what is the medicine for ? for purposes of analysis , we calculated combined knowledge of the indication for drugs in the regimen : the number of medications scored as correct indication knowledge divided by the total number of medications in the regimen .
clinical trial coordinators asked patients to show how they would take each of their medicines by placing beads ( representing pills ) into a pillbox that was partitioned into 24 slots , each slot representing an hour of the day .
we scored correct demonstrated knowledge per medication if the patient correctly demonstrated all 4 of the following : number of pills per dose , number of doses per day , number of pills each day in total , and amount of time ( spacing ) between doses .
combined demonstration knowledge of the regimen was the number of medications scored as correct demonstrated knowledge divided by the total number of medications in the regimen .
we employed board - certified internal medicine physicians who adjudicated the verbal and demonstrated knowledge items .
the adjudicators had no contact with research participants , clinical trial coordinators , intervention nurses , or clinical site nurses .
two adjudicators who were blind to intervention allocation independently scored each patient response as correct or incorrect when compared to the prescription label on the medication container .
the initial scores by each adjudicator were compared and revealed moderate to very good agreement .
for example , cohen 's kappa was 0.87 for two adjudicators who scored patient responses to the question , how many pills of this medicine do you take each day in total ? the kappa was 0.43 for two adjudicators who scored responses to the question , how many pills of this medicine do you take each time ? the other verbal and demonstrated knowledge questions had kappa values between 0.54 and 0.95 .
when initial adjudications were discordant , the adjudicators met and they successfully resolved all discrepancies .
we assessed patient - reported adherence with the patient medication adherence questionnaire ( pmaq ) .
clinical trial coordinators recorded adherence at baseline and then three and six months after randomized allocation . for each daily prescribed medication
, clinical trial coordinators asked patients if they missed taking a dose yesterday , the day before yesterday , 3 days ago , or over the past weekend .
participants were scored as being adherent to the medication if they answered no to all of the four questions . for purposes of analysis
, we constructed a regimen adherence score for each patient : the total number of medicines for which the patient was adherent divided by the total number of medications in the patient 's regimen .
satisfaction with information about medicines was another secondary , prespecified , patient - reported outcome .
clinical trial coordinators asked patients in both intervention groups to rate satisfaction with the information received from the doctor or nurse about medicines during the visits immediately after intervention , at month 3 , and at month 6 .
the response options were too much , about right , too little ,
the five satisfaction items were a subset of the satisfaction with information about medicines scales ( sims ) : what your medicine is called , what your medicine is for ,
how to use your medicine , whether the medicine has any unwanted effects ( side effects ) , and whether the medicine interferes with other medicines .
we scored dissatisfaction if the patient reported too much , too little , or
hba1c , a common measure for glycemic control , was another secondary , prespecified outcome .
the blood tests were analyzed at certified clinical laboratories from patient samples drawn at baseline and then during subsequent visit windows that were 3 , 6 , 9 , and 12 months after random allocation .
we assumed 45% of patients in the usual care arm would have correct knowledge of their multidrug regimens at six months .
we needed to recruit a sufficient number of patients to have 600 evaluable participants at six months .
under these assumptions , the sample size of 600 ( 300 per arm ) at six months had 82% power to detect a difference of 12% between study arms with a 5% type i error rate .
research personnel at the clinical trial coordination center generated the random allocation sequence with computer - generated random numbers .
the allocation ratio was 1 : 1 with stratification by site , chicago versus peoria , and random permuted blocks within site . the coordination center personnel in champaign , illinois , transferred the allocation sequence to sequentially numbered , opaque envelopes and then distributed the sealed envelopes to the clinical sites in chicago and peoria . clinical trial coordinators in chicago and peoria
performed telephone interviews to screen potential participants , confirm eligibility , and obtain verbal consent .
next , the clinical trial coordinators obtained the concealed allocation to medtable or usual care by opening the sealed envelope . after random allocation , the participant , the clinical trial coordinator , and the clinic personnel were not blind to the study intervention .
health literacy was measured by the rapid estimate of adult literacy in medicine ( realm ) , a health word recognition test that involves pronouncing 66 medical terms .
performance on realm is associated with patient age , medication adherence , and health outcomes [ 6 , 40 ] .
a patient with limited health literacy was defined as having a realm score of less than 61 .
we measured fluid mental ability ( speed of mental processing ) with the letter and pattern comparison tests .
fluid mental ability is vulnerable to aging and is associated with differences in health literacy [ 41 , 42 ] .
we measured patient knowledge about diabetes mellitus with the 24-item diabetes knowledge questionnaire . to adjust for patient self - activation , we assessed the summary of diabetes self - care activities ( sdsca ) .
we assessed illness experience in years when we asked the question , how long have you had diabetes ? to adjust for health status , we measured comorbidity with the charlson method and general health status via short form-36 [ 45 , 46 ] .
we measured the medication regimen complexity index ( mrci ) , a 65-item tool with three domains : medication dosage form , dosing frequency , and additional medication directions .
the variables for patient age , gender , race , education , employment , and income were measured by a modified version of the older americans resources and services ( oars ) instrument .
we analyzed all outcome measures under the principle of intention to treat . to address missing glycosylated hemoglobin ( hba1c ) scores
, we used the last observation carried forward . missing satisfaction values were replaced with dissatisfaction values .
all other missing outcome measures and missing baseline covariates were replaced using the method of maximum likelihood estimation .
generalized estimating equations were used for correlated response data when testing the intervention effects over time with logit link and identity link functions for binary outcomes and continuous outcomes , respectively . when examining the intervention effects within each time visit , we used logistic regression or linear regression models for binary and continuous responses , respectively .
two - tailed p values were calculated for all tests and p < 0.05 was the threshold for significance .
the primary analyses evaluated whether the medtable intervention improved patient outcomes relative to the usual care group .
generalized estimating equations included group ( medtable versus usual care ) , time , group time , and appropriate covariates .
the group time interaction term evaluated intervention - related benefits that varied with the amount of time exposure to the medtable collaborative tool .
the assumption was that patients might need time to learn to use the tool to structure medication - taking strategies at home and to communicate with providers during office visits .
clinical trial coordinators recruited participants between september 2011 and october 2013 . the trial flow diagram ( figure 2 ) shows the numbers of patients screened , excluded , randomized , and followed up .
the patient - participants who received the randomized intervention , medtable versus usual care , were comparable at baseline ( table 1 ) except for years with diabetes mellitus .
the characteristics of the participants included age greater than 65 years for 43.3% ( 292/674 ) , high school or less education for 30.1% ( 203/674 ) , and limited literacy ( as measured by the realm ) for 22.3% ( 150/674 ) .
one of the primary outcomes of the clinical trial was the effect of the intervention , medtable versus usual care , on the patients ' verbal knowledge of their medication regimen . to score the verbal knowledge , we used adjudicators who were blind to intervention allocation
there was no difference between the intervention and control group for combined verbal knowledge of the regimen for all questions
( generalized estimating equation parameter group , adjusted p = 0.3035 ; parameter group time , adjusted p = 0.6280 ) .
separate analyses for each question within the verbal knowledge score also revealed no consistent effect of the intervention .
the only significant effect was for the following : on a usual day , how many times a day do you take this medicine ? ( generalized estimating equation parameter group , adjusted p = 0.0373 ; parameter group time , adjusted p = 0.5294 ) .
the analysis of verbal knowledge of the regimen for injectable drugs showed similar results to noninjectable drugs ( data available upon request ) .
the other primary outcome of the trial was the patient 's demonstrated knowledge of their medication regimen .
the results in table 3 reveal no difference between the intervention and control group for combined demonstration knowledge of the regimen for all 4 questions ( generalized estimating equation parameter group , adjusted p = 0.3916 ; parameter group time , adjusted p = 0.8227 ) .
separate analyses for each question within the demonstrated knowledge score exposed no consistent effect of the intervention .
some evidence for the impact of the intervention on medication knowledge was provided by the measure of medication indication .
adjudicators who were blind to intervention allocation scored the patients ' responses to the question , what is the medicine for ? the results in table 4
reveal significant increases in correct patient knowledge about indication in the medtable intervention versus usual care group immediately after the beginning of the intervention that persisted for 6 months ( generalized estimating equation parameter group , adjusted p less than 0.0001 ) .
patient - reported responses to five satisfaction questions were recorded by research personnel who were not blind to the intervention allocation .
the results of the intention - to - treat analysis in table 5 reveal that patients reported greater satisfaction with medtable versus usual care at all times .
the generalized estimating equation for each satisfaction question included all time points and confirmed the significant increase with medtable : all adjusted p values for group were less than 0.0161 .
patient - reported adherence was recorded by research personnel who were not blind to the intervention allocation .
adherence was greater at baseline in the usual care group and then adherence decreased monotonically over the next 6 months .
in contrast , adherence in the medtable group remained flat and did not deteriorate over time .
figure 3 shows the difference in slopes for the medtable group and usual care group .
the generalized estimating equation for adherence reflects the difference in slopes in the group time interaction : adjusted p = 0.0268 .
however , the gee for adherence did not reveal a significant overall effect of medtable : group adjusted p value = 0.7423 .
glycosylated hemoglobin ( hba1c ) was a prespecified secondary outcome that was abstracted from the patient record .
regardless of the intervention group , patients had significant decreases ( improvements ) in their hba1c during their time in the trial : the adjusted parameter estimate for time in the generalized estimating equation had p less than 0.0001 .
estimating equation for hba1c , the parameter for group had adjusted p = 0.3639 and the parameter for group time had adjusted p = 0.6079 .
table 8 has knowledge and adherence outcomes within strata defined by limited or adequate literacy . for verbal and demonstrated knowledge of the regimen
patients ' knowledge of drug indication improved with medtable regardless of their literacy status . for regimen adherence
, the improvements caused by medtable were seen in patients with adequate literacy and were only demonstrable at the sixth month .
however , there was only mixed evidence that the intervention also improved patients ' knowledge about their medications .
in contrast , the medtable did not improve verbal or demonstration measures of knowledge about directions for use .
the intervention also sustained adherence to medications during the trial while adherence declined in the control group , but the overall difference with the usual care control group was not significant .
finally , the intervention did not influence hba1c levels , which declined ( better glycemic control ) equally for the two groups during the trial .
the study results are partially consistent with the process - knowledge model of health literacy .
according to this model , improving health knowledge ( medication knowledge in our study ) should improve self - care behaviors ( adherence in this case ) , which in turn should influence outcomes such as hba1c . while use of the medtable by nurses and patients in the clinics influenced collaboration ( reflected by improved patient satisfaction ) and improved some aspects of patients ' medication knowledge ( knowledge about indication but not directions for use ) , the intervention had only limited impact on adherence .
our results are similar to a recent trial in which a computer - based decision aid designed to support self - care planning among patients with diabetes improved patient perceptions of information clarity and helpfulness , but not health knowledge or outcomes .
the finding that the medtable intervention improved patient satisfaction with provider communication might be important because patient satisfaction is linked to quality and reimbursement .
the medicare shared savings program and other pay - for - performance programs rely on patient satisfaction measures , specifically the clinician and group survey , consumer assessment of healthcare providers and systems ( cg - cahps ) .
a limitation of our study is the unknown correlation between satisfaction with information about medicines scales ( sims ) and broader measures of satisfaction , like cg - cahps , which are used for value - based purchasing .
future studies should include measures like cg - cahps to assess patient satisfaction with the medtable .
first , performance on both the verbal and the demonstration measures approached ceiling , perhaps reducing the ability of the measures to detect differences between conditions .
second , taking the results at face value , they suggest that usual care practices related to patient education and medication reconciliation at the research site clinics were effective in supporting patients ' knowledge about medication .
the limited impact of the intervention on medication adherence may reflect the fact that adherence was self - reported in this study , which can overestimate adherence .
the intervention may also have had a limited effect on adherence because of its selective effect on participants ' medication knowledge .
while it is important for patients to know what medications are used for , it is equally if not more important to know how to take the medication , and both groups of participants in the study demonstrated good knowledge about directions for use .
in addition , adherence is a complex behavior that is influenced by many factors in addition to medication knowledge , such as patient self - efficacy and cost of the medication .
it is also possible that the intervention improved planning for taking medication when working with providers at the clinics , but patients had difficulty implementing these plans at home due to either cost , health , unmeasured socioeconomic factors , or prioritization .
the intervention did not improve hba1c , which tended to improve equally in both groups .
this may well reflect the limited impact of the intervention on medication knowledge and adherence .
also , like medication adherence , hba1c is influenced by a range of patient factors .
therefore , an intervention designed to improve knowledge and planning for how to take medication might have a limited impact on this outcome , even if it had had a large impact on knowledge .
for example , only four of 15 studies investigating impact of communication interventions on patients with cardiovascular disease showed improved clinical outcomes .
it is also possible that 6 months was too short for the intervention to produce detectable effects on health outcomes .
one of the limitations of our trial design was the unmasked intervention . for participants assigned to usual care ,
their clinic nurses may have changed communication and collaborative planning after observation of colleagues who used the medtable .
we attempted to minimize contamination when we blocked the medtable display in the electronic medical records of participants assigned to usual care .
when contamination occurred , there was bias toward the null ( increased type ii error ) .
only 18% ( 674/3644 ) of the patients in the screening population provided consent to participate in our trial .
the results of our study are most applicable to ambulatory clinic populations that resemble the characteristics reported in table 1 .
the medtable tool supported provider / patient collaboration related to medication use , as reflected in patient satisfaction with communication , but had limited impact on patient medication knowledge , adherence , and outcomes .
a possible reason for this pattern is that the tool as implemented in this study was designed to support collaboration in the clinic but did not support patients at home when taking their medication .
integrating the tool into smartphones or other patient - centered technologies used at home , especially if integrated with provider information technology ( e.g. , electronic health record patient portal ) , may support distributed collaboration between providers and patients at home , so that patients can more easily implement plans and update them as medication regimens change . | among patients with various levels of health literacy , the effects of collaborative , patient - provider , medication - planning tools on outcomes relevant to self - management are uncertain . objective . among adult patients with type ii diabetes mellitus , we tested the effectiveness of a medication - planning tool ( medtable ) implemented via an electronic medical record to improve patients ' medication knowledge , adherence , and glycemic control compared to usual care . design .
a multicenter , randomized controlled trial in outpatient primary care clinics .
674 patients received either the medtable tool or usual care and were followed up for up to 12 months . results .
patients who received medtable had greater knowledge about indications for medications in their regimens and were more satisfied with the information about their medications .
patients ' knowledge of drug indication improved with medtable regardless of their literacy status
. however , medtable did not improve patients ' demonstrated medication use , regimen adherence , or glycemic control ( hba1c ) .
conclusion .
the medtable tool supported provider / patient collaboration related to medication use , as reflected in patient satisfaction with communication , but had limited impact on patient medication knowledge , adherence , and hba1c outcomes .
this trial is registered with clinicaltrials.gov nct01296633 . |
deep sternal wound infection ( dswi ) is a severe and life - threatening complication of median sternotomy after cardiac surgery , with an incidence ranging from 1% to 3% and a mortality rate ranging from 19% to 29% .
this complication is associated with prolonged hospital stay , augmented surgical load due to repeated wound revision , chest wall instability and consequent respiratory impairment , and elevated financial impact on hospital stay .
although the predictive factors and risk profile of patients are well identified , the exact mechanism of dswi has not been clearly described . regarding the risk factors
, there is a strong suggestion that impairment of vascular supply of the sternum may be one of the most important factors influencing the incidence of dswi , including obesity , diabetes mellitus , chronic obstructive pulmonary disease ( copd ) , connective tissue disease , steroid use , smoking , peripheral vascular disease ( pvd ) , and renal insufficiency .
in addition , intraoperative factors ( e.g. , use of bilateral internal mammary arteries ) and postoperative variables ( e.g. , prolonged mechanical ventilation ; reoperation for bleeding ; postoperative transfusions ; and gastrointestinal , nephrologic , and respiratory complications ) have been shown to be associated with dswi [ 46 ] .
although the risk factors and treatment modalities were well explored and described in recent reports , the long - term influence of dswi on postoperative life expectancy has seldom been addressed . in this report
additionally , the natural history and evolution of history of patients with dswi after discharge from the hospital is described with a focus on major cardiovascular events .
included in these analyses were a total of 4732 consecutive patients who underwent open heart surgery at university hospital lausanne , chuv , switzerland , from january 1995 to december 2005 .
patients having assist device implantation , heart transplantation , recent steroid treatment , and age younger than 18 years were excluded .
data from the institutional database were prospectively collected for variables such as age , sex , body mass index ( bmi ) , type of surgical intervention , urgency of operation , prior cardiac surgery , congestive cardiomyopathy , history of myocardial infarction , smoking , diabetes mellitus , hypertension , family history , preoperative ejection fraction , cancer , copd , and renal dysfunction .
procedural data were also collected on the use of cardiopulmonary bypass and the number of distal anastomoses .
postoperative parameters included emergency exploration due to hemodynamic instability , hospital mortality , length of stay , and major complications after surgery ( e.g. , transmural myocardial infarction , dswi sepsis , renal failure , and respiratory failure ) .
follow - up ended on april 15 2011 and was performed by phone calls to the patients and referred physicians .
deep sternal wound infection patients were compared in a ratio of 1 : 2 to the patients without infection ; the matching criteria were : age , sex , surgical intervention , renal impairment , copd , smoking , obesity , ejection fraction , and diabetes .
matching was performed in the institutional database , in which patients are routinely registered according to preoperative co - morbidities , intervention type , and in - hospital events .
deep sternal wound infection was defined according to the guidelines of the centers for disease control and diagnosis , which requires fulfillment of at least 1 of the following criteria : ( 1 ) an organism isolated from culture of mediastinal tissue or fluid ; ( 2 ) evidence of mediastinitis evident to the unaided eye ; or ( 3 ) presence of either chest pain , sternal instability , or fever ( 38c ) , and either purulent discharge from the mediastinum isolation of an organism isolated from blood culture or culture of drainage of the mediastinal area .
statistical analyses were performed using spss software , version 17.0 ( spss , chicago , il , usa ) .
data were tested for normality and equal distribution ( kolmogorov - smirnov test and assessment of skewness and kurtosis ) .
risk factors of dswi were identified using a binary logistic regression model applied to the entire population , after stepwise selection of the variables to be entered into the model . adjusted odds ratios ( or ) and 95% confidence intervals ( ci95 ) were estimated . to control for risk factors of dswi , every patient with dswi
was matched with 2 control patients without dswi , according to known risk factors of dswi , and to those identified here .
balance between matched groups was checked using paired t tests for continuous variables , and mcnemar s test for categorical variables . in - hospital
correlations between pre- , intra- , or postoperative variables and infection , or survival were evaluated by pearson or spearman correlation tests .
differences in postoperative survival between patients with dswi and without dswi were assessed by kaplan - meier analysis , the log - rank test , and a cox regression model adjusted on parameters that were significantly correlated with survival or infection , as well as on the matching criteria mentioned above .
unless otherwise specified , numerical data are presented as mean and standard deviation ( sd ) , and categorical data as group proportion ( % ) unless otherwise specified , and p < 0.05 was considered significant throughout .
included in these analyses were a total of 4732 consecutive patients who underwent open heart surgery at university hospital lausanne , chuv , switzerland , from january 1995 to december 2005 .
patients having assist device implantation , heart transplantation , recent steroid treatment , and age younger than 18 years were excluded .
data from the institutional database were prospectively collected for variables such as age , sex , body mass index ( bmi ) , type of surgical intervention , urgency of operation , prior cardiac surgery , congestive cardiomyopathy , history of myocardial infarction , smoking , diabetes mellitus , hypertension , family history , preoperative ejection fraction , cancer , copd , and renal dysfunction .
procedural data were also collected on the use of cardiopulmonary bypass and the number of distal anastomoses .
postoperative parameters included emergency exploration due to hemodynamic instability , hospital mortality , length of stay , and major complications after surgery ( e.g. , transmural myocardial infarction , dswi sepsis , renal failure , and respiratory failure ) .
follow - up ended on april 15 2011 and was performed by phone calls to the patients and referred physicians .
deep sternal wound infection patients were compared in a ratio of 1 : 2 to the patients without infection ; the matching criteria were : age , sex , surgical intervention , renal impairment , copd , smoking , obesity , ejection fraction , and diabetes .
matching was performed in the institutional database , in which patients are routinely registered according to preoperative co - morbidities , intervention type , and in - hospital events .
deep sternal wound infection was defined according to the guidelines of the centers for disease control and diagnosis , which requires fulfillment of at least 1 of the following criteria : ( 1 ) an organism isolated from culture of mediastinal tissue or fluid ; ( 2 ) evidence of mediastinitis evident to the unaided eye ; or ( 3 ) presence of either chest pain , sternal instability , or fever ( 38c ) , and either purulent discharge from the mediastinum isolation of an organism isolated from blood culture or culture of drainage of the mediastinal area .
statistical analyses were performed using spss software , version 17.0 ( spss , chicago , il , usa ) .
data were tested for normality and equal distribution ( kolmogorov - smirnov test and assessment of skewness and kurtosis ) .
risk factors of dswi were identified using a binary logistic regression model applied to the entire population , after stepwise selection of the variables to be entered into the model . adjusted odds ratios ( or ) and 95% confidence intervals ( ci95 ) were estimated . to control for risk factors of dswi ,
every patient with dswi was matched with 2 control patients without dswi , according to known risk factors of dswi , and to those identified here .
balance between matched groups was checked using paired t tests for continuous variables , and mcnemar s test for categorical variables . in - hospital
correlations between pre- , intra- , or postoperative variables and infection , or survival were evaluated by pearson or spearman correlation tests .
differences in postoperative survival between patients with dswi and without dswi were assessed by kaplan - meier analysis , the log - rank test , and a cox regression model adjusted on parameters that were significantly correlated with survival or infection , as well as on the matching criteria mentioned above .
unless otherwise specified , numerical data are presented as mean and standard deviation ( sd ) , and categorical data as group proportion ( % ) unless otherwise specified , and p < 0.05 was considered significant throughout .
out of 4792 patients who received open heart surgery during the period between december 1995 and january 2005 , 74 patients ( 1.54% ) developed deep sternal infection ( dswi ) .
matching of patients characteristics resulted in 2 groups : the dswi group ( n=74 ) compared to the control group ( n=148 ) without infection ( 1:2 match ) .
significant independent predictors for the development of dswi were : active smoking ( or 2.19 , ci 1.353.53 , p=0.001 ) , obesity ( or 1.96 , ci 1.203.21 , p=0.007 ) , and insulin - dependent diabetes mellitus ( or 2.09 , ci 1.0510.06 , p=0.16 ) . the time to dswi diagnosis ranged between 3 and 36 days , with a median of 13 days .
after diagnosis was established , the surgical revision was performed , including debridement of necrotic tissue and topical treatment with antiseptic solution . in the second part of the treatment ,
secondary closure of the open chest wound was performed in all patients : as direct closure in 54 cases ( 72.3% ) , as reconstruction with rotated rectus abdominis flap in 11 patents ( 14.8% ) , and as pectoral muscle flap in 9 cases ( 12.2% ) .
lengths of interventions ( 26165 in dswi vs. 20855 min in controls ; p=0.09 ) , extracorporeal circulation time ( 11161 in dswi vs. 10569 min in controls ; p=0.74 ) , and aortic cross - clamping time ( 7642 min in dswi vs. 6735 min in controls ; p=0.17 ) were not different between the 2 groups . in - hospital
mortality was significantly higher in the dswi group with 8% as compared to the control group with 2.7% ( p=0.03 ) .
in the dswi group , the hospital stay was longer as compared to the control group , 35 vs. 11 days , p<0.001 ) .
incidence of acute postoperative renal impairment was also higher ( 25% vs. 8% , p=0.009 ) .
the frequencies of postoperative myocardial infarction , respiratory failure , and hemorrhage requiring re - intervention did not differ between patients with and without dswi ( table 2 ) .
cardiac cause of death during follow - up was not significantly different between groups ( 15% in the dswi group vs. 11% in the control group , p=0.65 ) the median follow - up in the matched set was 125 months and the iqr ranged from 99 to 162 months . during follow - up ,
the mortality rate was 27.0% in the dswi group and 21.6% in controls ( log - rank test p value 0.57 , figure 1 ) .
after adjustment on the parameters that were significantly correlated with survival or infection , as well as on the matching criteria mentioned above , the risk of death during follow - up was not related to the occurrence of dswi ( hr 1.5 , ci95 0.73.2 , p=0.33 ) .
independent predictors for long - term mortality were preoperative cancer ( hr 12.1 , ci95 3.937.2 ; p<0.001 ) , surgery for heart valve in conjunction with aorto - coronary bypass ( hr 3.8 , ci95 1.69.1 ; p=0.003 ) , and preoperative chronic lung disease ( hr 2.6 , ci95 1.16.2 ; p=0.03 ) .
deep sternal wound infection is one of the most serious postoperative complications after median sternotomy and it has a relatively high mortality .
this has motivated numerous research groups to evaluate in detail the clinical profiles of patients with dswi as well as to explore the predictive factors that may presage this pathology . in this context , the influence of dswi on in - hospital and short - term mortality was one of the most intensively discussed subjects in the past [ 16 ] .
. however , most risk factors for dswi are not amenable to modification . in order to reduce the incidence of dswi , different preventive measures were undertaken .
for example , in patients with diabetes mellitus , tight control of blood sugar level reduced the incidence of dswi , and use of skeletonized mammary artery also significantly contributed to reduction of this complication .
although the characteristics of dswi were well explored , long - term survival and mortality profile of the patients having dswi after hospital admission has not been sufficiently described and evaluated . to the best of our knowledge ,
few reports in the literature have discussed mid - term or long - term results following dswi [ 1012 ] . in the present study , a follow - up of more that 10 years was executed by phone calls to the patients and their personal physicians .
incidence of dswi was 1.56% , with perioperative mortality of 8.1% ; both results are comparable to results published in the literature , in which the incidence of dswi is reported to be between 1.5% and 3% , with a perioperative mortality ranging from 15% to 30% [ 1012 ] . out of 74 patients , a cardiac cause of death
was presented in 5 patients and sepsis was presented in 4 cases . in 1 case with cardiac cause of death , laceration of the right ventricle was the cause of death . in the 3 remaining cases ,
the total mortality was 27% in the dswi group and 21.6% in the controls ( p=0.57 ) , which actually corresponds to the long - term mortality after open heart surgery .
mortality due to a cardiac event was not significantly different in the 2 groups investigated : 15% in dswi and 11% in controls .
this result corresponds to the reports published in which the impact of dswi following cardiac surgery was evaluated over a period of 8 years .
no further differences in 4-year and 8-year survival rate between the 2 groups were found ( 77.2% and 61.8% , respectively , in patients with dswi , as compared with 78.0% and 67.5% , respectively , in patients without dswi ) .
however , we have to be aware that this statement is only true after the perioperative period passed .
this can also be seen in the kaplan meier curve , where the survival between the 2 groups is parallel after the perioperative period .
this means that the in - hospital period for patients is critical , with elevated mortality .
if this phase is successfully survived , their life expectancy does not differ from that of patients without dswi .
the in - hospital mortality was 7% , which is about 3 times higher than in the in - patient population without dswi . in the majority of cases , it was a consequence of septicemia and/or multi - organ failure .
in addition to the septic events , repeated surgical revision with change of vac systems may contribute to elevated mortality .
repeated surgical revisions are earmarked by repeated surgical trauma , which clearly increases perioperative stress .
debridement and occasional sternal bone fractures due to infection , as well as debridement and repeated surgical manipulation with vac system , may contribute to laceration and perforation of the right ventricle .
dswi is one of the most devastating complications in the postoperative period patients suffer from a prolonged hospital stay coupled with repeated surgical interventions , which leads to increased hospital costs .
the incidence has remained stable , and although different prevention measures have been proposed in the last decade , they have not lowered the prevalence of this complication .
however , we believe that if prevention is impossible at this point of our knowledge , then treatment modalities may be changed to reduce the length of hospital stay , as well as reduce surgical trauma , mortality , and morbidity . however , to prove this hypothesis , further clinical trials should be conducted . | backgroundthis study aimed to investigate the influence of deep sternal wound infection on long - term survival following cardiac surgery.material/methodsin our institutional database we retrospectively evaluated medical records of 4732 adult patients who received open - heart surgery from january 1995 through december 2005 .
the predictive factors for dswi were determined using logistic regression analysis .
then , each patient with deep sternal wound infection ( dswi ) was matched with 2 controls without dswi , according to the risk factors identified previously .
after checking balance resulting from matching , short - term mortality was compared between groups using a paired test , and long - term survival was compared using kaplan - meier analysis and a cox proportional hazard model.resultsoverall , 4732 records were analyzed .
the mean age of the investigated population was 69.312.8 years .
dswi occurred in 74 ( 1.56% ) patients .
significant independent predictive factors for deep sternal infections were active smoking ( or 2.19 , ci95 1.353.53 , p=0.001 ) , obesity ( or 1.96 , ci95 1.203.21 , p=0.007 ) , and insulin - dependent diabetes mellitus ( or 2.09 , ci95 1.0510.06 , p=0.016 ) .
mean follow - up in the matched set was 125 months , iqr 99162 .
after matching , in - hospital mortality was higher in the dswi group ( 8.1% vs. 2.7% p=0.03 ) , but dswi was not an independent predictor of long - term survival ( adjusted hr 1.5 , ci95 0.73.2 , p=0.33).conclusionsthe results presented in this report clearly show that post - sternotomy deep wound infection does not influence long - term survival in an adult general cardio - surgical patient population . |
haemolytic uraemic syndrome ( hus ) is a thrombotic microangiopathy characterized by coombs - negative haemolytic anaemia , thrombocytopenia and microvascular thrombosis , with many patients also experiencing acute renal failure .
approximately 90% of cases have typical hus , which is secondary to infection by a shiga - like toxin - producing escherichia coli .
atypical hus ( ahus ) is a relatively rare non - shiga toxin - associated form of hus and accounts for the remaining 10% of cases .
ahus is associated with dysregulation of the complement system , which causes chronic uncontrolled complement activation and leads to a pro - coagulant , platelet - activation state endothelial swelling and , ultimately , thrombotic microangiopathy [ 1 , 2 ] . in approximately 50% of ahus cases , mutations in genes encoding complement regulatory proteins [ e.g. membrane cofactor protein ( mcp ) ]
ahus has a poor prognosis , with 50% of patients progressing to end - stage renal disease or dying within the first year of diagnosis , with a high risk of recurrence after kidney transplantation .
patients with ahus do not always respond to plasma exchange . as ahus is linked to complement
system dysregulation , inhibition of this system has been suggested as a rational therapeutic approach .
eculizumab ( soliris ; alexion pharmaceuticals ) is a humanized monoclonal antibody that binds to the complement protein c5 , preventing cleavage of c5 to c5a and c5b , thereby inhibiting the generation of the terminal complement complex c5b-9a .
eculizumab is approved for the treatment of paroxysmal nocturnal haemoglobinuria and case reports indicate that eculizumab may also be beneficial in ahus [ 2 , 7 , 9 , 10 ] .
a 44-year - old man was admitted to hospital with prolonged diarrhoea ( lasting 1 week ) , fever and anuria . on admission ,
blood analysis showed haemolytic anaemia : haemoglobin 6.9 g / dl , schistocytes in the blood smear , lactate dehydrogenase elevated to 1837 u / l and platelet count 111 000/dl .
anti - nuclear , anti - phospholipid , anti - topoisomerase iii and anti - adamts-13 antibodies were negative .
three weeks after being admitted , the patient still required haemodialysis despite receiving 4 u of fresh frozen plasma and initiating plasmaphaeresis . following 21 sessions of plasmaphaeresis , haemolysis ,
classical and alternative complement pathway analysis revealed normal plasmatic factor h ( 26 mg / ml , normal range 1256 ) , 70% plasmatic concentration of factor i ( normal range 71115 ) , without antibodies against factor h. the expression of mcp on leucocytes was 51% compared to control ( normal range 91109 ) and heterozygous mutation of intron 2 ( c.286 + 1g > c ) of the mcp gene .
eculizumab was initiated 90 days after hospital admission at a dose of 900 mg weekly for 5 weeks , then 1200 mg every 2 weeks until week 27 .
the patient received an anti - meningococcal vaccine 15 days prior to starting eculizumab . during eculizumab treatment ,
haemolysis was inhibited completely , thrombocytes and platelets returned to normal levels and diuresis increased slowly to 1.5 l / day .
renal biopsy ( figure 1 ) conducted the second week after admission revealed occlusive thrombosis in several small- and medium - sized arteries with secondary ischaemic glomerular changes .
there was extensive acute tubular necrosis in the renal tubules with focal areas of tubular atrophy .
a second renal biopsy ( figure 2 ) performed 2.5 months after admission , and 3 weeks before starting eculizumab , showed changes similar to those observed at the first biopsy : thrombotic microangiopathic lesions persisted and there was deterioration of interstitial fibrosis and tubular atrophy .
ahus is a rare and devastating disease linked to complement dysregulation and chronic uncontrolled complement activation .
mcp mutations occur in 1015% of ahus patients and may be familial or sporadic with incomplete disease penetrance in families .
ahus usually manifests in childhood , but sporadic cases have been reported that have variable onset and are often related to infections , drugs or other clinical situations that trigger complement activation . in the case
reported here , the clinical disease onset seems to have a been triggered by an infection .
patients with ahus , particularly those with mcp mutations , often have a poor response to plasmaphaeresis and/or fresh frozen plasma infusions [ 1 , 6 ] and require alternative or additional therapy . as an inhibitor of terminal complement activation , eculizumab may offer an effective treatment option .
our patient presented with typical hus features , but a lack of response to plasmaphaeresis and no evidence of shiga toxin suggested ahus , although no family history of the disease was apparent . based on positive results from other cases [ 2 , 7 , 9 , 10 ] , we began eculizumab therapy 90 days post - admission .
eculizumab was associated with inhibition of haemolysis and normalization of thrombocyte and platelet levels , allowing cessation of haemodialysis . unfortunately , renal function recovery was not possible with eculizumab in our patient .
renal biopsy revealed that irreversible damage to the kidney had already been established by the time eculizumab was initiated .
our case supports previous findings that initiation of eculizumab late in disease progression is unable to reverse pre - existing renal damage .
early use of eculizumab in patients with ahus may prevent the thrombotic microangiopathy resulting from uncontrolled complement activation and could therefore help to avoid irreversible renal damage .
indeed , eculizumab treatment has resulted in recovery of renal function in other ahus cases [ 7 , 10 ] .
ahus caused by a mutation in the mcp gene has a good prognosis post - transplant , as the normal kidney corrects the defect and complement activation is maintained within the normal range . in conclusion , this case describes how eculizumab normalized the haematological parameters in a patient with ahus .
probably due to the late initiation of treatment , eculizumab was unable to have an impact on the irreversible renal damage that had already occurred .
consequently , we propose that early treatment initiation with eculizumab is warranted in patients with ahus in order to avoid irreversible renal damage . | atypical haemolytic uraemic syndrome ( ahus ) is a rare and life - threatening disease caused by complement system dysregulation leading to uncontrolled complement activation and thrombotic microangiopathy .
we report the case of an adult patient with plasmaphaeresis - resistant ahus and hypertension treated with the complement inhibitor eculizumab .
eculizumab was shown to completely inhibit haemolysis , normalize thrombocyte levels and increase diuresis .
full recovery of renal function was not possible due to irreversible renal damage prior to eculizumab initiation .
these findings highlight the importance of early treatment with eculizumab in patients with poor response to standard therapy , in order to avoid irreversible renal damage . |
the arctic and antarctic regions are rich and diverse ecosystems for birds , fish , and mammals .
this in turn means that there is a risk that migratory birds ( and other animals ) can bring pathogens or resistant bacteria into animal populations in the arctic and antarctic environments ( 42 ) .
whether the introduction of antibiotic - resistant bacteria is a hazard to the ecosystems remains to be elucidated . yet
the number of tourists visiting the polar regions is continuously increasing , which raises the risk of introducing microorganisms ( 7 , 43 ) .
the consequences that human - associated microorganisms , pathogenic or not , may have on the environment and the local wildlife in the polar regions are difficult to predict .
the only continent without esbl - producing bacteria until now was antarctica ( 44 ) .
in the arctic , industrial development has been intense and has resulted in substantial impacts while the region has also been strategic militarized territory .
the arctic has a population of about 3.8 million inhabitants , and the environment has been under external stress for considerable amount of time ( 45 ) .
the local biota has been exposed to anthropogenic pressure and is considered particularly vulnerable to alterations ( 46 ) . in one of the few studies from the arctic ,
it was shown that bacteria from migratory shorebirds from the siberian and alaskan tundra displayed antibiotic resistance , suggesting that these bacteria have reached broad geographic dissemination ( 6 ) .
probably the birds picked up the bacteria in their wintering grounds and brought them to their breeding grounds . in antarctica , however , international agreements regulate the number of visitors , researchers , or tourists who can be present at the same time ( 47 ) .
one additional factor is the waste from antarctic research bases , military bases , fishing boats , scientific programs , and tourism .
when inadequately treated liquid waste spills into the seawater , human - associated bacteria may become introduced into the environment ( 43 ) . before 1990
, all the waste from antarctic research stations were dumped in landfill sites located close to the bases , or were discarded into the sea ( 48 ) .
the low water temperature allows certain bacteria to survive in the environment for a relatively long time ( 8) .
fecal bacteria can survive a few minutes to several days in the seawater , depending on temperature , solar radiation , and salinity ; in antarctica these factors change dramatically according to the season ( 49 ) .
another possibility is the introduction by birds , as there are species such as kelp gulls ( larus dominicanus ) and other sporadic visitors that during non - breeding time may reach densely populated areas in southern south america during the polar winter ( 2 , 3 , 50 , 51 ) .
human - derived bacteria have been documented in sewage outlets and waste from the antarctic stations , and the local fauna has accidentally been infected by contamination from sewage .
the finding of vancomycin - resistant enterococcus ( vre ) in glaucous gulls from alaska ( 52 ) in 2005 showed that antibiotic - resistant bacteria and antibiotic resistance genes ( vana ) had already reached remote areas .
outbreaks by vre strains can possibly arise in hospitals when already well - established vancomycin - sensitive e. faecium strain acquire vancomycin resistance genes via a resistant plasmid ( 53 ) .
the finding of similar vre bacteria belonging to the same clonal cluster ( cc17 ) was described internationally as well established in hospital environments .
the glaucous gull is a bird that has a circumpolar distribution and is short distance migrator from the north atlantic to north pacific ocean .
this species is a regular visitor of urban environments such as city dumps and sewage outlets close to human habitats ( 54 , 55 ) .
five years later , in 2010 , vre was found in the same bird species in the same place ( 56 ) .
the current isolates harbored both vana and esp genes and belonged to the same lineage found in 2005 ( 52 , 56 ) .
the long - distance spreading of vre is probably not as a result of migratory birds .
it is more likely that the birds are indicators of vre in the environment and that the birds act as a short distance or local disseminators .
the situation contrasts with enterococcus and enterobacteriaceae resistance in the sub - arctic area . despite the low resistance to antibiotics demonstrated in arctic bird bacteria in 2005
, esbl - producing e. coli in the kamchatka peninsula and in the commodore islands were detected .
e coli of two different esbl - producing strains were detected , and these carried esbl - type ctx - m genes blactx - m-14 and blactx - m-15 . one isolate belonged to the globally disseminated esbl e. coli o25b - st131 clone .
this strain was found in glaucous - winged gulls at commander island , which may be a consequence of the successful transfer of the pandemic st131 e. coli clone of human origin to the environment ( 57 ) .
esbl - carrying bacteria isolated from birds illustrate the presence of resistance genes in the sub - arctic area . in summer 2010 , feces samples from glaucous gulls were collected in barrow , ak , usa . the results showed the occurrence of antibiotic - resistant bacteria of enterobacteriaceae with the esbl types ctx - m , tem , and shv , either in single or combined form .
bacteria that harbored esbl were found in 34.1% of samples , and were both e. coli and k. pneumoniae . in e. coli ,
both ctx - m and tem were detected , and k. pneumoniae had all ctx - m , tem , and shv variants .
the multilocus sequencing typing showed different sts in e. coli that are correlated to previously described clinical isolates in humans .
esbl - producing bacteria , principally the ctx - m variant , are no longer just a problem in medical facilities .
e. coli st13 ( o25b : h4 ) , associated with the ctx - m-15 esbl , are probably one of the most important and predominant in human infections and were also found in e. coli in the analyzed arctic material , which means that this antibiotic - resistant type has spread globally .
antibiotic susceptibility testing in esbl - carrying bacteria revealed differences between the two species : all e. coli were resistant to six of the 11 compounds while all k. pneumoniae were resistant to three to eight compounds ( 56 ) .
esbl - carrying bacteria were not present in the material sampled by the swedish arctic expedition ,
remarkable is the presence of st10 , st38 , st131 , and st405 in e. coli which are the sts responsible for the dissemination of ctx - m worldwide .
this is an indication that the esbl did not emerge spontaneously in the alaska environment .
the fact that these esbl genotypes are found in remote parts of alaska strongly supports the theory that they spread from urbanized areas to more pristine environments .
birds in general are good bioindicators that reflect the presence of microorganisms in the ecosystems , in particular under non - breeding periods close to urban areas with high antibiotic pressure , and the dissemination of antibiotic - resistant bacteria and resistance genes to the environment .
this study has verified that antibiotic resistance genes can also be found in bacteria isolated from wild birds not exposed to significant antibiotic pressure .
the bacteria that carry antibiotic resistance genes could be introduced by migratory birds or human intervention by inhabitants , tourism , and research programs in the region . in summary , in only few years between 2005 and 2010 ,
the frequency of esbl - harboring bacteria that can be associated with human clinical strains , in the same sampling area and in the same bird species , has increased in the region .
antarctica is geographic isolate , with extreme ecological conditions and limited accessibility , often considered the last pristine continent .
several studies have demonstrated the presence of coliforms and other fecal bacteria since many research stations discharge human waste directly into the sea ( 59 ) .
penguins can be used as biological markers to detect the presence of human - associated microorganisms or human indicator intestinal bacteria as enterobacteriaceae ( 57 ) . up till now , the lower prevalence of e. coli in gentoo penguins , the highly antibiotic sensibility , and the absence of esbl indicate a sporadic interaction between penguins and the human intestinal bacteria . on the other side ,
penguins are part of the ecosystem in which esbl - carrying bacteria were found and they may be less exposed to waste water discharged from human settlements into the sea .
no esbl or antibiotic resistance was detected in penguins samples ; the presence of human intestinal bacteria carrying esbl genes in sea water can expose penguins to contamination .
bacteria , such as e. coli and k. pneumoniae , found in normal bowel flora , play a crucial role in the spread of resistance genes and can act as important reservoir for esbl - type genes . in a study published in 2016 , it is concluded that naturally occurring antibiotic resistance in e. coli strains from antarctic bird is rare and the bacterial antibiotic resistance found in seawater is probably associated with discharged treated wastewater ( 60 ) .
furthermore , antarctica , is considered as an unexplored viruses , bacteria , and fungies pantry , in which the microorganisms growing under extreme conditions .
these microorganisms can provide answers to the new challenges facing humanity , such as the uncontrolled antibiotic resistance development which threatens public health , as these may give rise to new antibiotic prototypes .
until now , esbl - producing bacteria have been described in all continents except antarctica ( 61 ) .
this reality has changed with the first finding of esbl - type ctx - m in the region ( 44 ) .
antibiotic - resistant bacteria have been detected in the polar regions , but the situation is different , as the trend in the arctic indicates an increase when comparing the findings in wildlife over an interval of 5 years , while in antarctica the detection is only linked to human activity .
the results of the studies performed in the polar regions to detect the presence of human - associated bacteria and args support the assumption that bird migration can be accidentally or partly involved in the spread of pathogenic microorganisms to the arctic and/or antarctic .
however , these studies support the notion that human - associated bacteria are mainly spread through human presence and human activities in the regions . in few years between studies in the same artic area and same bird species ,
the frequency of human - associated bacteria carrying args , and specifically esbl genes , has notoriously increased .
this tendency is in accord with the antibiotic resistance development in the urbanized world where new and most versatile and broadly resistant bacteria have been detected .
the overall antibiotic susceptibility of bacteria isolated from the arctic and antarctic samples is low in contrast to that in highly urbanized and densely populated areas .
antibiotic - resistant bacteria carrying esbl genes were documented in the environment adjacent to the scientific bases in antarctica .
bacteria isolated from wildlife at the same time in the same places showed the absence of antibiotic resistance and esbl genes .
this indicates that antibiotic - resistant bacteria isolated from the antarctic environment are mainly because of human presence and human activities in the region .
e. coli and k. pneumoniae associated with human clinical isolates , carrying both virulent and antibiotic resistance genes , were detected both in the arctic and in the antarctic regions .
those bacteria carried molecular markers linked to strains previously described in humans , which could explain the mobilization of human - associated microorganisms to the polar regions .
certainly , antibiotic - resistant bacteria have been detected in the arctic and antarctic regions .
however , the observed situation is radically different ; the trend in the arctic region on resistant bacteria is increasing whereas in antarctica the presence of resistant bacteria is closely related to human activity and resistant bacteria has not been detected in wildlife .
esbl - producing bacteria are nowadays present also in the last esbl - free continent , the antarctica .
the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | anthropogenic influences in the southern polar region have been rare , but lately microorganisms associated with humans have reached antarctica , possibly from military bases , fishing boats , scientific expeditions , and/or ship - borne tourism .
studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of escherichia coli strains least resistant to antibiotics in penguins , whereas e. coli from seawater elsewhere showed resistance to one or more of the following antibiotics : ampicillin , tetracycline , streptomycin , and trim - sulfa . in seawater samples
, bacteria were found carrying extended - spectrum -lactamase ( esbl)-type ctx - m genes in which multilocus sequencing typing ( mlst ) showed different sequence types ( sts ) , previously reported in humans . in the arctic , on the contrary , people have been present for a long time , and the presence of antibiotic resistance genes ( args ) appears to be much more wide - spread than was previously reported .
studies of e coli from arctic birds ( bering strait ) revealed reduced susceptibility to antibiotics , but one globally spreading clone of e. coli genotype o25b - st131 , carrying genes of esbl - type ctx - m , was identified . in the few years between sample collections in the same area , differences in resistance pattern were observed , with e. coli from birds showing resistance to a maximum of five different antibiotics
. presence of resistance - type esbls ( tem , shv , and ctx - m ) in e. coli and klebsiella pneumoniae was also confirmed by specified pcr methods .
mlst revealed that those bacteria carried sts that connect them to previously described strains in humans . in conclusion
, bacteria previously related to humans could be found in relatively pristine environments , and presently human - associated , antibiotic - resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions . |
fishes are the largest group of vertebrates , with a wide variety of adaptive responses to diversified aquatic habitats and ecological limitations . also with respect to sex determination ,
unlike the situation in most vertebrates , where the male and female sexes are represented by two different individuals ( gonochorism ) , hundreds of fish species are known to be hermaphroditic ( devlin and nagahama , 2002 ; schartl , 2004 ) .
sex chromosomes are fundamental in many vertebrate species for the development of either a male or a female ( livernois et al . , 2012 ) .
few species of fish are carriers of heteromorphic chromosomal systems when compared to the enormous taxa diversity ( oliveira et al . , 2007 ) .
however , fishes have a remarkable variety of sex determination chromosome systems ( xy , x0 , x1x2y , xy1y2 , zw , z0 , zw1w2 , z1z1z2z2/z1z2 , w1w2 , wxz ) ( moreira - filho et al . , 1993 ; devlin and nagahama , 2002 ; oliveira et al . , 2008 ) ,
in which the zz / zw simple system with female heterogamety is the most frequent one among neotropical fishes ( artoni and bertollo , 2002 ; bellafronte et al . , 2011 ; machado et al . 2011 ) .
the family parodontidae occurs throughout south america and its species are classified in three genera : parodon , apareiodon and saccodon ( pavanelli , 2003 ) .
generally they are robust fish , with strong pectoral , ventral and caudal fins , a fusiform body , and a dorsal profile which is more arched than the ventral one ( travassos , 1957 ) .
parodontidae taxonomy is controversial because the family members lack diagnostic morphological traits that are sufficiently reliable for accurate phylogenetic analysis ( pavanelli and britski , 2003 ; ingenito lfs , 2008 , ph.d thesis , universidade federal do rio de janeiro , brazil ) .
ingenito argued that existing morphological phylogenetic evidence for the genus apareiodon is insufficient to support its maintenance , and that apareiodon should be regarded as a junior synonym of parodon .
cytogenetic analyses of both parodon and apareiodon revealed a conserved diploid number of 54 chromosomes , but with remarkable heterogeneity in the distribution of heterochromatin , nor activity , number and location of 18s rdna , 5s rdna and satellite dna familiy sites , and morphologically differentiated sex chromosome systems ( for a review see bellafronte et al . , 2011 ) .
from the parodontidae species that have been cytogenetically analyzed , six have sex chromosomes : zz / zw1w2 for apareiodon affinis steindachner , 1879 , and zz / zw for parodon hilarii reinhardt , 1867 , parodon moreirai ingenito & buckup , 2005 , apareiodon vladii pavanelli , 2006 , apareiodon sp . and apareiodon ibitiensis campos , 1944 ( moreira - filho et al . , 1980 , 1993 ;
, 2002 ; vicente et al . , 2003 ; rosa et al . , 2006 ; vicari et al .
2009 ) . in parodontidae , satellite dna has great importance for the understanding of karyotype differentiation .
so far , two satellite dnas have been described for this fish group : pph2004 ( vicente et al . , 2003 ) and wap ( schemberger et al . , 2011 ) .
the physical mapping of the pph2004 sequence showed that this satellite dna is present on chromosomes z and w ( also on autosomal chromosomes ) ; however , it is not a part of the heterochromatic amplified region of the w chromosome heteromorphism ( bellafronte et al . , 2011 ) .
the wap satellite dna probe is capable of detecting the amplification region and the chromosome w heteromorphism , corroborating the common origin of this system in parodontidae , apart from homologies to other chromosome sites ( schemberger et al . , 2011 ) .
the integrated analysis of chromosomal markers has also allowed to deduce the chromosomal differentiation of the family , which is organized in : ( i ) species without morphologically differentiated sex chromosomes ( apareiodon piracicabae eigenmann , 1907 and apareiodon vittatus garavello , 1977 ) , ( ii ) species with differentiated sex chromosomes and without satellite dna pph2004 ( a. ibitiensis , apareiodon sp . ,
a. vladii ) , and ( iii ) species with proto sex chromosomes and/or heteromorphic sex chromosome systems and presence of satellite dna pph2004 ( a. affinis , p. hilarii , p. moreirai , parodon nasus kner , 1859 and parodon pongoensis allen , 1942 ) ( schemberger et al . , 2011 ) .
based on these data , the present study aimed at characterizing the species apareiodon hasemani eigenmann , 1916 ( from the so francisco river basin , brazil ) with respect to chromosome number , morphology , banding , sex system , presence or absence of certain molecular cytogenetic markers , as well as to establish karyoevolutionary relationships based in other cytogenetic studies performed in the family parodontidae .
chromosome studies were carried out in 18 specimens ( 7 males and 11 females ) of a. hasemani , collected in the main channel of the so francisco river , in pirapora city , state of minas gerais , brazil ( 172117.47 s and 445718.45 w ) .
the analyzed samples were deposited in the ncleo de pesquisas em limnologia , ictiologia e aquicultura ( nupelia ) , universidade estadual de maring , brazil , with voucher number nup11512 .
samples were collected in compliance with the ethics committee on animal experimentation ( process ceua 07/2011 ) of the universidade estadual de ponta grossa , brazil ) and with authorization to collect the biological material ( brazilian federal license : ministrio do meio
ambiente / instituto brasileiro do meio ambiente e dos recursos renovveis mma / ibama / sisbio number 10538 - 1 ) and the instituto estadual de florestas de minas gerais .
mitotic chromosomes were obtained from the anterior kidney , according to the methodology described by bertollo et al .
the heterochromatin was detected using the methodology of c - banding ( sumner , 1972 ) .
c - banded chromosomes were stained with propidium iodide ( 50 g ml ) according to lui et al .
the nucleolar organizer regions were detected using the silver nitrate method ( ag - nor ) described by howell and black ( 1980 ) .
fluorescence in situ hybridization ( fish ) experiments were performed in the parodontidae specimens using probes for 18s rdna ( hatanaka and galetti jr , 2004 ) , 5s rdna ( martins and galetti jr , 1999 ) , pph2004 satellite dna ( vicente et al . , 2003 ) and wap satellite dna ( schemberger et al . , 2011 ) .
the 18s rdna , 5s rdna and pph2004 cloned probes were labeled with biotin or digoxigenin via pcr , using plasmid vector primers ( t7 promoter and m13 reverse ) .
the pcr amplification was done with : 20 ng of template dna , 1x reaction buffer , 2 mm mgcl2 , 40 m datp , dgtp and dctp , 28 m dttp , 12 m biotin 16-dutp , or digoxigenin 11 dutp ( roche applied science ) , 0.3 m of each primer and 1 u taq dna polymerase ( invitrogen ) . the wap probe was labeled via degenerate oligonucleotide - primed polymerase chain reaction ( dop - pcr ) , using 11-dutp - digoxigenin ( roche applied science ) .
this pcr amplification was done with : 100 ng of template dna , 1x reaction buffer , 2 mm mgcl2 , 40 m datp , dgtp and dctp , 28 m dttp , 12 m 11-dutp - digoxigenin , 2 m dop primer , and 1 u taq dna polymerase ( invitrogen ) .
the fish procedure was performed under high stringency conditions ( 2.5 ng/l probe , 50% formamide , 2x ssc , 10% dextran sulfate ) following the methodology described by pinkel et al .
the signal was detected using the anti - streptavidin antibody conjugated to alexa fluor 488 ( invitrogen ) and an anti - digoxigenin antibody conjugated to rhodamine ( roche applied science ) .
the chromosomes were counterstained with dapi ( 0.2 g / ml ) , covered with vectashield mounting medium ( vector ) and analyzed with the aid of an olympus bx41 epifluorescence microscope equipped with a dp71 digital image capture system ( olympus ) .
( 1964 ) and classified as metacentric ( m ) , submetacentric ( sm ) , or subtelocentric ( st ) .
the species a. hasemani showed 2n = 54 meta - submetacentric chromosomes , with a fundamental number equal to 108 for both sexes ( figure 1 ) .
however , a heteromorphism in size and morphology was observed for chromosome pair 4 , restricted to females , which had a medium - sized submetacentric chromosome ( z ) and a large metacentric chromosome ( w ) ( figure 1 ) .
the c - banding technique revealed centromeric heterochromatin regions in some chromosomes , as well as interstitial and terminal bands ( figure 1b and 1d ) .
the zz pair showed centromeric and terminal c - bands on both chromosome arms . in all metaphases of females , the w chromosome had similar centromeric and terminal heterochromatin bands on the long arm , when compared to the z chromosome .
the heterochromatin segments , however , occupied almost the entire short arm of the w chromosome , being twice as large as in the z chromosome ( figure 1b , d ) .
the nucleolar organizer regions stained with silver ( ag - nors ) showed terminal signals on the long arm of one chromosome pair , pair 11 , which was subtelocentric ( figure 2 , box ) , while fish with 18s rdna probes showed up to five terminal signals on the long arm of pairs 11 ( larger and more evident marks ) , 7 and 22 ( smaller in size ) , and all these signals generally coinciding with gc - rich regions ( figure 2a ) . fish with 5s rdna probes showed only one marked pair , located in the interstitial region of the long arm of chromosome pair 14 ( figure 2a ) .
apareiodon hansemani did not show pph2004 satellite dna sites ( data not shown ) , but wap satellite dna sites were found in the terminal regions of some chromosomes of the karyotype ( figure 2b ) .
the z chromosome showed the satellite dna wap in the terminal region of the short and long arms and in the proximal region of the short arm ( figure 2bb ) . in turn , the w chromosome also showed a wap amplification from the proximal region of the short arm ( figure 2b ) .
karyotype analyses of apareiodon hasemani ( figure 1 ) show a diploid number of 54 chromosomes , similarly to other species of parodontidae , except for the population of a. affinis from the upper paran river basin ( moreira - filho et al . , 1980 ) , which has 2n = 54/55 chromosomes .
the chromosome morphology of a. hasemani consists mainly of meta - submetacentric chromosomes , a characteristic shared with a. affinis ( moreira - filho et al . , 1980 ) ,
p. hilarii ( moreira - filho et al . , 1993 ) and p. moreirai ( centofante et al . , 2002 ) .
in addition to meta - submetacentric chromosomes , other species also have subtelocentric chromosomes ( moreira - filho et al . , 1985 ; jesus and moreira - filho 2000a , b ; bellafronte et al . , 2005 ; vicari et al . , 2006 ; rosa et al . ,
populations of a. affinis from the lower paran and paraguay river basins showed a structural polymorphism with the presence of acrocentric chromosomes , probably caused by pericentric inversions ( jesus et al .
the location of the major nors sites of a. hasemani in the terminal region of the long arm of a subtelocentric chromosome pair , revealed by silver nitrate staining and the 18s rdna probes ( figure 2a , box ) , is a character shared by other species of the genus apareiodon and by p. nasus ( bellafronte et al . , 2005 ; vicari et al . , 2006
; rosa et al . , 2006 ; bellafronte et al . , 2009 , 2011 ) . in populations of a. affinis in the lower paran and paraguay basins ,
additional sites were also found in a. hasemani , in a characteristic shared with a. ibitiensis and a. vittatus .. dispersal events may have originated the additional 18s rdna sites in these species , since they are found in more than one chromosome pair ( jesus and moreira - filho , 2000a ; bellafronte et al . , 2009 , 2011 , this study ) . considering that nors are generally associated with terminal heterochromatin ,
chromosome rearrangements and transpositions become more likely , which may result in dispersion in the genome ( moreira filho et al . , 1984 ) .
fish with 5s rdna probes in parodontidae revealed that these cistrons are often located on the short arm of one of the submetacentric chromosome pairs ( centofante et al .
additional sites may , however , occur in different locations in a. vladii , p. hilarii , p. pongoensis and p. nasus , which show a case of synteny with the 18s rdna gene ( vicente et al . , 2001 ;
apareiodon hasemani and most species of parodontidae show only one submetacentric pair carrying 5s rdna sites ; however , the cistron is located in the subterminal region of the long arm .
it is likely that this pattern originated from a pericentric inversion , since in other parodontidae species and in the outgroup anostomidae the 5s rdna sites are located on the short arm ( bellafronte et al . , 2011 ) .
2004 ) , where a. intermedius shows all 5s rdna sites located on acrocentric chromosomes , while a. guiton has a marked subtelocentric pair besides the aforementioned acrocentric chromosomes , probably originated by a pericentric inversion .
apareiodon hasemani shares a zz / zw heteromorphic sex chromosome system with p. hilarii , p. moreirai , a. vladii , a. ibitiensis and apareiodon sp .
the distribution of constitutive heterochromatin in a. hasemani ( figure 1b , d ) is characterized by centromeric bands in some chromosome pairs , large interstitial and terminal blocks , and blocks adjacent to the nors , which have also been found in several other species of parodontidae ( moreira - filho et al . , 1984 ; jesus and moreira - filho 2000a , b ; vicente et al . , 2001 , 2003
; centofante et al . , 2002 ; bellafronte et al . , 2005 ; rosa et al . , 2006 ; vicari et al . ,
moreover , the z sex chromosome exhibited a correspondence of proximal and terminal bands on short arms with those of other parodontids bearing sex chromosomes ( bellafronte et al .
( 2011 ) inferred that the z and w chromosomes of parodontidae were initially a homologous pair , and that heterocromatinization through the accumulation of wap sequences was a decisive step in the differentiation of the w chromosome . on the other hand
, the terminal heterochromatic block in the long arm of the z and w chromosomes of a. hasemani ( figure 2b ) led to a size increase of the long arm of these chromosomes , in relation to other species in the group .
thus , with the increase in the long arm of the z chromosome due to this terminal heterochromatin , the heterochromatic differentiation of the w chromosome in the short arm region did not lead to a sufficient size increase to exceed the total length of the long arm ( figure 3 ) , a common state observed among the other parodontid carriers of heteromorphic sex chromosomes . in this proposed scenario , not only
would the w chromosome change in shape and size , but the z chromosome would also have increased in size in relation to a possible ancestral condition .
this mechanism is in agreement with the model for the evolution of heteromorphic sex chromosomes ( muller , 1964 ; charlesworth , 1978 ; green , 1990 ) . during the evolution of the heteromorphic sex chromosomes
xy or zw , there is a suppression of meiotic recombination between a pair of homomorphic chromosomes ( homologues ) , which progressively accumulate sex determining genes , followed by structural chromosomal rearrangements such as deletions , insertions , accumulation of transposable elements , and expansion of repetitive sequences ( schartl , 2004 ; kasahara , 2009 ; livernois et al . , 2012 ) . in recent years
, repetitive dna sequences have been widely studied in fishes , providing important information on the differentiation and evolution of sex chromosomes .
these studies have shown that the differentiation of sex chromosomes is frequently associated with the accumulation of such dna sequences on chromosomes ( vicente et al .
fish with the sequence pph2004 in a. hasemani showed that this satellite dna is not present in the karyotype or in species with heteromorphic zw sex chromosomes : a. ibitiensis , apareiodon sp . and a. vladii ( bellafronte et al . , 2011 ) .
furthermore , the wap satellite dna probe ( schemberger et al . , 2011 ) detected the w chromosome amplification region of a. hasemani , suggesting that this system is common to other parodontid carriers of sex chromosomes .
in the family parodontidae , all species studied so far have positive sites for this marker , suggesting a common origin of this satellite dna and therefore of the sex chromosome systems ( schemberger et al . , 2011 ) .
the simple zz / zw sex chromosome systems may have originated from a paracentric inversion of a wap terminal site to the proximal region of the short arm of a metacentric chromosome pair , with the subsequent amplification of this sequence leading to differentiation of the w sex chromosome in most species . through the use of chromosome markers , schemberger et al .
( 2011 ) demonstrated the existence of closely related species groups : ( i ) those without heteromorphic sex chromosomes ( a. piracicabae and a. vittatus ) ; ( ii ) those with proto sex chromosomes and the presence of satellite dna pph2004 ( p. nasus and p. pongoensis ) ; ( iii ) those with a heteromorphic sex chromosome system ( a. ibitiensis and a. vladii ) ; ( iv ) those with a heteromorphic sex chromosome system and the presence of satellite dna pph2004 ; and ( v ) a species with a multiple sex chromosome system and satellite dna pph2004 ( a. affinis ) .
apareiodon hasemani shows chromosomal markers similar to those found in a. ibitiensis , apareiodon sp . and
a. vladii ( bellafronte et al . , 2011 ; schemberger et al . , 2011 ) ; however , the location of the 5s rdna can be considered derived in a. hasemani .
the main brazilian rivers are separated by barriers that prevent the dispersal of species and populations , favoring the occurrence of events that cause the isolation of groups ( weitzman et al . , 1988 ) .
by such conditions , unique karyotypes and distinct sex chromosomes systems in fish may have become fixed independently in different species of a genus , promoting diversification and contributing to the speciation process ( centofante et al . , 2001 ) .
although allopatry may have contributed to the origin of sex chromosome systems , moreira - filho et al .
( 1985 ) reported the occurrence of four species of parodontidae in sympatry and syntopy , so the different sex chromosomes systems in some species would play an important role in their isolation .
this study found that the repetitive dna in parodontidae seemed to play an important role in the chromosome diversification of the studied species , as in a. hasemani .
furthermore , a. hasemani presented derived chromosomal regions with respect to 5s rdna , contributing to the genetic isolation of the population and differentiation of strains . | parodontidae fish show few morphological characteristics for the identification of their representatives and chromosomal analyses have provided reliable features for determining the interrelationships in this family . in this study ,
the chromosomes of apareiodon hasemani from the so francisco river basin , brazil , were analyzed and showed a karyotype with 2n = 54 meta / submetacentric chromosomes , and a zz / zw sex chromosome system .
the study revealed active nors located on pair 11 and additional 18s rdna sites on pairs 7 and 22 .
the 5s rdna locus was found in pair 14 .
it showed a pericentric inversion regarding the ancestral condition .
the satellite dna pph2004 was absent in the chromosomes of a. hasemani , a shared condition with most members of apareiodon .
the wap probe was able to detect the amplification region of the w chromosome , corroborating the common origin of the system within parodontidae .
these chromosomal data corroborate an origin for the zw system of parodontidae and aid in the understanding of the differentiation of sex chromosome systems in neotropical fishes . |
actually ugtb is not rare disease but it is often overlooked disease . the main reasons for delayed diagnostic are two : vague clinical features and low index of suspicion .
ugtb is an infectious contagious disease , and it is one of the most reasons for infertility . | tuberculosis is a disease with myriad presentations and manifestations ; it can affect any organ or tissue , excluding only hair and nails .
doctors who are not familiar with extrapulmonary tuberculosis often overlook this disease .
urogenital tuberculosis ( ugtb ) is the second most common form of tb in countries with severe epidemic situation and the third most common form in regions with low incidence of tb .
the term urogenital tuberculosis includes kidney tuberculosis ; male and female tuberculosis and urinary tract tuberculosis as complication of kidney tuberculosis .
we describe rarest case of tuberculosis of a placenta in young woman , suffered from genital tuberculosis , which was overlooked before delivery , as well as typical tubo - ovarian tuberculomas . |
traditionally , patients with liver cirrhosis have an auto - anticoagulation status because they often have an elevated prothrombin time ( pt ) or international normalized ratio ( inr ) [ 14 ] .
however , the accumulated evidence suggests that cirrhotic patients have an increased risk of venous thromboembolism ( vte ) , which is defined as deep vein thrombosis ( dvt ) and pulmonary embolism ( pe ) [ 525 ] .
case - control studies have also confirmed that cirrhotic patients are more likely to develop vte than the general population .
our recent systematic review and meta - analysis found that about 1% of patients with chronic liver diseases had and developed vte during their hospitalizations .
however , the relevant data are almost all from western countries ; by comparison , few studies have been conducted in chinese populations . the most common etiology of liver cirrhosis was hepatitis b virus in china . on the other hand , there was no consensus about the risk factors of vte in liver cirrhosis .
herein , we conducted a retrospective observational study to evaluate the epidemiology and risk factors of vte in chinese hospitalized patients with liver cirrhosis and to explore whether vte might influence the in - hospital mortality of liver cirrhosis .
in this retrospective observational study , all patients with a diagnosis of liver cirrhosis who were consecutively admitted to the general hospital of shenyang military area between january 2011 and december 2013 were identified by searching the international classification codes ( icd)-9 , icd-10 , and discharge diagnoses in the department of information .
diagnosis of liver cirrhosis was primarily established according to the history of liver disease , clinical presentations , laboratory tests , and abdominal imaging .
the study protocol was approved by the ethics committee of our hospital the number was k(2015)30 . informed written consents were waived .
considering that the potential pathogenesis and prognosis might be different between vte and portal venous system thrombosis , portal venous system thrombosis was not considered in the present study .
the medical records were thoroughly searched by an investigator to identify the history and new onset of vte ( xz ) .
additional data were collected by our study group , including the age , sex , blood pressure at admission , history of liver cirrhosis , etiology of liver disease , acute gastrointestinal bleeding ( augib ) , ascites , hepatic encephalopathy , and laboratory tests ( red blood cell count , hemoglobin , white blood cell count , platelets , total bilirubin , albumin , alanine aminotransferase , aspartate aminotransferase , alkaline phosphatase , glutamyl transpeptidase , blood urea nitrogen , creatinine , potassium , sodium , pt / inr , activated partial thromboplastin time , and d - dimer ) .
arterial hypertension was classified into grade i , ii , and iii according to the guideline .
child - pugh and model for end - stage liver diseases ( meld ) scores were calculated according to the previous criteria . in - hospital death
continuous data are expressed as mean standard deviation and median with range and were compared by the independent sample t test .
categorical data were expressed as frequency ( percentage ) and were compared by the chi - square test or fisher exact test .
a bar chart was also drawn to compare the in - hospital mortality between patients with and without vte .
continuous data are expressed as mean standard deviation and median with range and were compared by the independent sample t test .
categorical data were expressed as frequency ( percentage ) and were compared by the chi - square test or fisher exact test .
a bar chart was also drawn to compare the in - hospital mortality between patients with and without vte .
a majority of patients were male , had hepatitis b virus and alcohol abuse , and had child - pugh class a and b ( table 1 ) . among them , 5 patients had a previous history of lower extremity dvt , 1 patient had a previous history of lower extremity dvt and developed new onset of pe during hospitalization , 1 patient developed new onset of pe during hospitalization , and 2 patients developed new onset of dvt during hospitalization .
thus , the prevalence of vte in liver cirrhosis during hospitalization was 0.4% ( 9/2006 ) and the incidence of vte was 0.2% ( 4/2006 ) . compared with those without vte , patients with vte had a significantly higher proportion of hypertension and significantly higher red blood cells , hemoglobin , alanine aminotransferase , aspartate aminotransferase , pt , inr , d - dimer , and child - pugh scores ( table 1 ) .
the in - hospital mortality was significantly higher in patients with vte than in those without vte ( 33.3% [ 3/9 ] versus 3.4% [ 67/1997 ] , p<0.001 ) ( figure 1 ) .
the overall mortality due to vte was 0.09% ( 2/2006 ) and vte accounted for 2.8% of all causes of death ( 2/70 ) .
a majority of patients were male , had hepatitis b virus and alcohol abuse , and had child - pugh class a and b ( table 1 ) . among them , 5 patients had a previous history of lower extremity dvt , 1 patient had a previous history of lower extremity dvt and developed new onset of pe during hospitalization , 1 patient developed new onset of pe during hospitalization , and 2 patients developed new onset of dvt during hospitalization .
thus , the prevalence of vte in liver cirrhosis during hospitalization was 0.4% ( 9/2006 ) and the incidence of vte was 0.2% ( 4/2006 ) .
compared with those without vte , patients with vte had a significantly higher proportion of hypertension and significantly higher red blood cells , hemoglobin , alanine aminotransferase , aspartate aminotransferase , pt , inr , d - dimer , and child - pugh scores ( table 1 ) .
causes of death are shown in table 2 . the in - hospital mortality was significantly higher in patients with vte than in those without vte ( 33.3% [ 3/9 ] versus 3.4% [ 67/1997 ] , p<0.001 ) ( figure 1 ) .
the overall mortality due to vte was 0.09% ( 2/2006 ) and vte accounted for 2.8% of all causes of death ( 2/70 ) .
our study demonstrated that the prevalence and incidence of vte during hospitalization was 0.4% and 0.2% in chinese patients with liver cirrhosis , respectively .
this finding was relatively lower than our recent systematic review that the incidence of vte in patients with chronic liver diseases was 1% ( 95% confidence interval : 0.71.3% ) , and the prevalence of vte was 1% ( 95% confidence interval : 0.71.2% ) .
this discrepancy might be explained by the heterogeneous sample size and etiology of liver cirrhosis among studies ; despite this , we preferred to emphasize another major finding that patients with vte had an approximately 10-fold higher risk of in - hospital death than those without vte . certainly , a small number of patients with vte might restrict the interpretation of comparative analysis . considering a statistically significant difference of in - hospital mortality between the 2 groups , we had to acknowledge the importance of early diagnosis and treatment of vte in liver cirrhosis .
d - dimer , red blood cells , hemoglobin , alanine aminotransferase , aspartate aminotransferase , pt , inr , and child - pugh scores were significantly associated with the presence of vte . except for d - dimer , which has been a routine diagnostic test for vte , and arterial hypertension , which is an important determinant of vte in the general population , the risk factors for vte should be interpreted carefully .
first , patients with vte had significantly higher red blood cell and hemoglobin than those without vte , possibly because none of patients with vte had augib , but 28.3% of patients without vte had augib .
second , patients with vte had significantly higher alanine aminotransferase and aspartate aminotransferase than those without vte .
similarly , patients with vte also had significantly higher child - pugh scores than those without vte . additionally , higher total bilirubin and lower albumin were observed in patients with vte , but the difference was not statistically significant .
thus , the relationship between severity of liver dysfunction and probability of vte is suggested .
third , patients with vte had significantly higher pt and inr than those without vte .
this finding is seemingly counterintuitive , but was largely consistent with the modern concept that pt and inr do not reflect the global coagulation status , and that elevated pt and inr does not protect cirrhotic patients from the development of vte .
this has been repeatedly reported in previous studies and was recently reviewed [ 4244 ] .
this finding can be explained by the fact that pt and inr mirror the liver synthesis of the procoagulants only , whereas other parameters associated with an overall decrease of liver function can be more accurate surrogates for impaired production of procoagulants as well as natural anticoagulants . except for our findings , previous studies should be deeply and systematically discussed .
we described a detailed search strategy in our recent systematic review of the epidemiology of vte in liver diseases .
studies were eligible if they compared the characteristics between liver disease patients with and without vte .
notably , we just summarized the risk factors of vte in the patients with liver diseases , but not in the general population .
indeed , in the latter condition , the presence of liver disease might be one of the variables included .
thus , the following items about the risk factors of vte were collected : variables included in the univariable analyses , significant factors calculated in the univariate analyses , the variables included in the multivariate analyses , and the independent predictors calculated in the multivariate analyses .
the odds or risk ratio for each factor was also recorded to clarify whether the independent factors increased or decreased the risk of vte in liver diseases .
overall , 7 individual studies evaluated the risk factors of predicting the development of vte in patients with liver diseases in univariate analyses , and 5 of them also conducted multivariate analyses ( table 3 ) .
they included age , race , charlson co - morbidity index , insurance , encephalopathy , variceal bleeding , ascites , coagulopathy , hypo - osmolality , malnutrition , total parenteral nutrition , mechanical ventilation , central venous line placement , diabetes mellitus , albumin , creatinine , aspartate aminotransferase , alanine aminotransferase , and hematocrit .
the race with the highest risk of vte was black , followed by white and hispanics . a higher charlson co - morbidity index , malnutrition , central venous line placement , active malignancy , trauma or surgery during hospitalization , history of vte , and diabetes mellitus
the presence of encephalopathy , variceal bleeding , ascites , coagulopathy , and hypo - osmolality , medicaid insurance , and use of vte prophylaxis were associated with a decreased risk of vte .
a lower albumin level was identified as an independent predictor of vte in 2 studies by northup and walsh . in the study by northup ,
the albumin level was significantly lower in cirrhotic patients with vte than in those without vte ( mean : 2.85 g / dl , 95%ci : 2.703.01 versus mean : 3.10 g / dl , 95%ci : 2.963.23 , p=0.01 ) ; in the study by walsh , the albumin level was significantly lower in patients with vte than in those without vte ( median : 2.1 g / dl , interquartile range : 1.72.6 versus median : 2.4 g / dl , interquartile range : 22.8 , p=0.02 ) .
by contrast , another two studies did not identify the albumin level as a significant predictor of vte in the multivariate analyses . in the study by lesmana , the proportion of an albumin level <3 mg / dl was lower in patients with dvt than in those without dvt ( 75% [ 9/12 ] versus 49.2% [ 120/244 ] , p=0.081 ) , but the difference was not statistically significant .
although a firm conclusion was not achieved , these preliminary findings from our team and others are helpful for the identification of high - risk patients . however , these data were scattered and needed to be integrated into a score system or predictive index .
ideally , a prospective study should include a training cohort to produce a predictive model to stratify the risk of the development of vte and a validation cohort to confirm its accuracy .
although we selected all patients consecutively admitted to our hospital and had very few exclusion criteria , the patient selection bias should not be neglected in a retrospective study .
second , laboratory and radiological examinations for the diagnosis of vte were not routinely performed .
prospective studies might be warranted to establish the accurate epidemiology of vte , especially asymptomatic vte .
third , the regional and ethnic difference in the epidemiology of vte could not be evaluated in this single - center study .
vte was observed in 0.4% of patients with liver cirrhosis during hospitalization and it significantly increased the in - hospital mortality .
degree of liver dysfunction might be significantly associated with the presence of vte in liver cirrhosis .
more importantly , elevated pt / inr did not protect from the development of vte , but increased the risk of vte in liver cirrhosis .
due to potential study limitations , these findings should be cautiously interpreted and further validated . | backgroundrisk of venous thromboembolism ( vte ) , including deep vein thrombosis ( dvt ) and pulmonary embolism ( pe ) , may be increased in liver cirrhosis .
we conducted a single - center study to explore the epidemiology , risk factors , and in - hospital mortality of vte in chinese patients with liver cirrhosis.material/methodsall patients with liver cirrhosis who were consecutively admitted to our hospital between january 2011 and december 2013 were retrospectively included.resultsof 2006 patients with liver cirrhosis included , 9 patients were diagnosed with or developed vte during hospitalization , including 5 patients with a previous history of dvt , 1 patient with either a previous history of dvt or new onset of pe , and 3 patients with new onset of vte ( pe , n=1 ; dvt , n=2 ) . risk factors for vte included a significantly higher proportion of hypertension and significantly higher red blood cells , hemoglobin , alanine aminotransferase , aspartate aminotransferase , prothrombin time ( pt ) , international normalized ratio ( inr ) , d - dimer , and child - pugh scores .
the in - hospital mortality was significantly higher in patients with vte than those without vte ( 33.3% [ 3/9 ] versus 3.4% [ 67/1997 ] , p<0.001).conclusionsvte was observed in 0.4% of patients with liver cirrhosis during hospitalization and it significantly increased the in - hospital mortality .
elevated pt / inr aggravated the risk of vte . |
infertility is an important health problem , with an estimated prevalence of 48.5 million couples worldwide ( 1 ) .
although infertility is mostly common in aging populations and in urban areas where women have their first child at an older age , the burden of infertility and its social consequences are predominantly found in developing and transitional countries ( 2 ) . in response to the increasing rates of infertility ,
rapid progress in reproductive medicine and research has been largely attributed to significant developments and novel technologies in the treatment and care of infertile couples in the world ( 3 ) . in this context ,
assisted reproductive technologies ( arts ) have been widely recommended as successful and common treatments in most countries .
arts include a wide range of treatments or procedures involving in vitro handling of human oocytes , sperms or embryos for establishing a pregnancy(4 ) . in vitro fertilization ( ivf ) and
its extended technologies , such as intracytoplasmic sperm injection ( icsi ) , pre - implantation genetic diagnosis ( pgd ) , and cryotechnology , are among the most common arts worldwide .
it is estimated that more than half a million ivf cycles are performed annually in the european countries , resulting in 100,000 new - borns ( 3 , 5 , 6 ) .
the total number of successful ivf and icsi births worldwide was reported as 5 million cases in 2012 ( 7 ) .
with respect to worldwide recognition and increased demands for art services , high quality research and key publications are still required to develop these technologies in developing countries . although the number of journals and publications in the field of reproductive medicine has increased dramatically in recent years ( 3 , 8) , much regional and country variation is in progress .
global research on arts has been highly concentrated among the world s richest countries while developing countries have indicated the least contribution to the research on arts and reproductive technologies ( 9 , 10 ) . as research on arts has been distributed disproportionately among countries , further investigations are needed to explore these patterns between and within countries . indeed , previous analyses have identified trends and the geographical distribution in the field of clinical reproductive medicine ( 3 , 9 , 11 ) .
collaboration networks ( 12 ) and the most cited articles ( 8 , 13 , 14 ) have also been investigated to some extent . although research is the key driver for developing arts in communities , it has remained neglected or ranked low on national research priorities in developing countries ( 15 ) .
therefore , national evaluations are required to evaluate the research productivity and its attributes for the purpose of making research policies and priorities within countries . in an attempt to address these challenges , the present study aimed to provide detailed information on global research publications on arts between 1998 and 2014 in the medline database .
further analysis has been made to compare the research performance between the leading countries in the field using bibliometric techniques .
the present study illustrates the patterns of global research on infertility involving different technologies implemented for the purpose of treatment and care of infertile couples .
it also helps obtain a comprehensive and up - to - date perspective of this field to better understand the contribution of international scientists to the global art research .
the present study s findings tend to help policymakers evaluate the research performance of scientists within and across borders .
in march 2015 , the medline database was searched for research publications indexed under the medical subject heading ( mesh ) reproductive techniques , assisted ( including the following mesh headings : in vitro fertilization ; intracytoplasmic sperm injections ; cryopreservation ; and ovulation induction ) , with the following expressions in the fields of title or abstract : intrauterine insemination ; sperm donation ; embryo / egg donation and surrogate mothers .
the number of research publications in the medline database was recorded for each individual year , from 1998 to 2014 , and for each country .
the affiliation of the corresponding author was used to identify affiliation of a research publication to a country .
the first year used for the search was 1998 to ensure the ability to retrieve reliable data on authors and countries affiliations from the medline database .
the following countries were arbitrarily selected for data retrieval : united states , united kingdom , france , germany , canada , italy , japan ( g7 countries ) , brazil , russia , india , china ( bric countries ) , egypt , turkey , israel and iran . data for the global burden of infertility were extracted from the who disability - adjusted life - year ( daly ) estimates for 2012 .
the semantic word mapping technique was implemented to identify major domains using vosviewer software ( version 16.0 ) .
in total , 96,739 articles were published in the medline database between 1998 and 2014 .
trends in global research publications on arts have shown that art and cryopreservation experienced dramatic growth in the number of publications .
the absolute number of research publications for each art from 1998 to 2014 ranged from 71 ( sperm donation ) to 20277 ( art ) , with a median of 2451 .
the top techniques according to the absolute number of publications were art ( 20277 ) , ivf ( 11209 ) , cryopreservation ( 11623 ) , ovulation induction ( 4352 ) , and icsi ( 2960 ) .
the major research domains of selected countries in the field of arts are illustrated in figure 1 . in this graph ,
the absolute number of research publications for each country from 1998 to 2014 ranged from 75 ( russia ) to 11674 ( us ) , with a median of 2024 .
the top five countries according to the absolute number of publications were the us ( 16453 publications ) , the uk ( 5427 publications ) , japan ( 4805 ) , china ( 4660 ) and france ( 3795 ) . according to these data , the us is the major producer of art research in the world , having many more publications than other countries .
figure 2 illustrates the distribution of the global burden of infertility and the share of research publications for selected countries . in this graph
in total , 96,739 articles were published in the medline database between 1998 and 2014 .
trends in global research publications on arts have shown that art and cryopreservation experienced dramatic growth in the number of publications .
the absolute number of research publications for each art from 1998 to 2014 ranged from 71 ( sperm donation ) to 20277 ( art ) , with a median of 2451 .
the top techniques according to the absolute number of publications were art ( 20277 ) , ivf ( 11209 ) , cryopreservation ( 11623 ) , ovulation induction ( 4352 ) , and icsi ( 2960 ) .
the major research domains of selected countries in the field of arts are illustrated in figure 1 . in this graph ,
the absolute number of research publications for each country from 1998 to 2014 ranged from 75 ( russia ) to 11674 ( us ) , with a median of 2024 .
the top five countries according to the absolute number of publications were the us ( 16453 publications ) , the uk ( 5427 publications ) , japan ( 4805 ) , china ( 4660 ) and france ( 3795 ) . according to these data , the us is the major producer of art research in the world , having many more publications than other countries .
figure 2 illustrates the distribution of the global burden of infertility and the share of research publications for selected countries . in this graph
the evaluation of the research literature in the art field indicated regional and country variations .
global research on arts was geographically distributed and highly concentrated among the world s richest countries , particularly the us , the uk and japan .
further inspection of data indicated the major semantic clusters of research literature published by selected countries . according to our findings ,
this trend was previously observed in similar investigations ( 3 , 11 , 16 ) .
however , this growth followed different patterns within different art domains , as art , ivf and cryopreservation indicated significant progress over the years .
our findings indicated that cryopreservation and ivf were the most productive research domains among arts .
preliminary investigations suggested that art and ivf are the most cited research domains among reproductive medicine literature ( 3 ) .
these technologies , which enable scientists and physicians to use frozen stored sperm , oocytes , embryos , and testicular and ovarian tissues , are also among the most common and successful treatments in the world .
the broad provision of these technologies has potentially increased the chance of extended research on these domains .
although art and ivf research literature indicated upward trends over the years , a detailed analysis revealed the global shift from developing new infertility interventions towards more in - depth analysis of the health implications for mothers and their children ( 3 ) .
however , further analysis is required to investigate the characteristics of other arts , such as egg or sperm donation , that are potentially restricted in some countries due to legal and social issues , particularly in developing and transitional countries .
our analysis also indicated the share of g7 and brics in the global art research .
these findings are consistent with early evidence suggesting that g7 countries are the major sources of art research in the world ( 16 ) .
the highest level of research productivity has been reported by the united states , with a 21.82% share of the global output .
the united kingdom ranked second with 9.78% , followed by italy ( 7.98% ) , turkey ( 5.19% ) and china ( 4.33% ) ( 16 ) .
this study has revealed many regional and country variations in the research literature published in the medline database .
previous studies have indicated significant variations among the rich countries , especially in europe , in art research output due to legal restrictions affecting the practice of arts in some countries ( 17 , 18 ) .
these restrictions have not only influenced the type of research performed , but also the amount of research data published ( 11 ) .
other empirical studies have also suggested the availability of financial funding as a key driver of art research in the world ( 11 ) . for most developing countries ,
although optimal utilization of ivf has been estimated to be around 1500 cycles per one million people per year , the provision of such services has declined significantly in developing countries ( 15 ) .
indeed , the contribution of developing countries to global art research has remained limited due to the lack of infrastructures and financial resources .
in addition , infertility prevention , treatment and care have been neglected , ranking low on the research priorities , particularly in developing countries ( 15 ) .
first , with current methodology , every publication is affiliated with a single ( the corresponding ) author . however , in the case of international collaborations , different countries are involved .
searching other databases such as scopus or web of science may lead to different results . however , mesh headings are only available through the medline and pubmed interfaces .
in summary , global research on arts has been geographically distributed and highly concentrated among the world s richest countries .
further investigations into the causes and characteristics of less common arts research are required to foster art research in developing countries . | introductionthis study illustrated the global contribution to assisted reproductive technologies ( arts ) research in medline database from 1998 to 2014.methodsin march 2015 , the medline database was searched for research publications indexed under reproductive techniques , assisted ( including the following mesh headings : in vitro fertilization [ ivf ] ; intracytoplasmic sperm injections ; cryopreservation ; and ovulation induction ) , with the following expressions in the fields of title or abstract : intrauterine insemination ; sperm donation ; embryo / egg donation and surrogate mothers .
the number of publications in medline database was recorded for each individual year , 19982014 , and for each country .
the following countries were arbitrarily selected for data retrieval : united states , united kingdom , france , germany , canada , italy , japan ( g7 countries ) , brazil , russia , india , china ( bric countries ) , egypt , turkey , israel and iran.resultsthe absolute number of publications for each country from 1998 to 2014 ranged from 75 to 16453 , with a median of 2024 .
the top five countries were the us ( 16453 publications ) , the uk ( 5427 publications ) , japan ( 4805 ) , china ( 4660 ) and france ( 3795 ) .
art ( 20277 ) , cryopreservation ( 11623 ) and ivf ( 11209 ) were the most researched areas.conclusionglobal research on arts were geographically distributed and highly concentrated among the world s richest countries .
cryopreservation and ivf were the most productive research domains among arts . |
mesenchymal stem cells ( mscs ) are one of the most interesting types of adult stem cells that are isolated , cultured , manipulated ex vivo , and have the ability of self - renewal and differentiation into various mesodermal cell lineages ( 1 - 3 ) . since the first description of mscs by friedenstein et al in 1976 as the clonal and plastic adherent cells , the interest in mscs rapidly grew with expanding knowledge about their exceptional characteristics and usefulness in the cell therapy applications ( 4 , 5 ) .
several clinical case reports ( 6 ) have concluded the successful treatment of bone and cartilage defects , vascular ischemia and coronary artery disease , and of chronic skin wounds upon local administration of mscs to sites of injury .
the injected cells were well tolerated and some spectacular healing results were obtained ( 7 ) . these results indicated that the immunosuppressive effects should be considered whenever msc transplantation takes place .
human mscs may participate in cell therapy protocols by producing a broad range of mediators such as transforming growth factor- , hepatocyte growth factor ( hgf ) , and nitric oxide ( 8 , 9 ) .
intravenous administration of murine mscs improves the outcome of neural ( 10 ) and lung ( 11 ) injury in experimental animal models primarily through paracrine effects and a shift from the production of pro - inflammatory to anti - inflammatory cytokines at the site of injury .
in addition , several studies have shown the immunosuppressive effect of mscs through mechanisms identified for inhibition of proliferation and differentiation of immune cells ( 12 ) .
the primary source of mscs in adult individuals is bone marrow ( bm ) , where they are immersed in the stroma at a low frequency . in humans , there is one msc per 34,000 nucleated cells ( 8) .
although present in very low numbers , mscs are easily isolated from bm and are capable of substantial proliferation and expansion in culture . however , due to the possibility of donor morbidity , high degree of viral exposure , and invasiveness of procedures , the need to identify alternative sources to provide mscs with immunomodulatory properties has emerged ( 2 ) .
mscs in adult individuals are also isolated and efficiently expanded from other body tissues such as adipose tissue ( at ) , which is derived from the embryonic mesenchyme , represent a rich source of mscs , and provides an abundant and accessible source of adult stem cells with minimal patient discomfort ( 13 - 16 ) .
a recently reported alternative tissue source of mscs is the connective tissue wharton s jelly ( wj ) of human umbilical cord .
these cells have the potential to be expanded , and can be obtained by a less invasive method , without posing harm to the mother or infant .
moreover , it is a biological waste and can be used as an abundant source of mscs ( 3 , 14 , 17 , 18 ) . in this study
, we compared the growth suppression effect of mscs derived from adult human bm , at , and wj on peripheral blood mononuclear cells ( pbmcs ) .
human mscs were obtained from 5 ml bm aspirates from the iliac crest of normal donors within the age range of 1945 years .
they were donors of bm to a related patient after obtaining approval of the ethics committee , shiraz university of medical sciences , shiraz , iran .
written informed consent was also obtained allowing analysis of the clinical data and testing mentioned in this study .
each sample of aspirate was diluted 1:1 with dmem - low glucose ( invitrogen , merelbeke , belgium ) and layered over about 5 ml of ficoll ( lymphoprep ; oslo , norway ) .
the isolation method was according to a previously reported method ( 19 ) by some modifications , which will be stated completely .
after centrifugation at 939 g for 20 min , the mononuclear cell layer was removed from the interface .
cells were suspended in dmem and centrifuged at 338 g for 15 min then resuspended in basal dmem medium containing 10% fetal calf serum ( invitrogen , merelbeke , belgium ) , 1% penicillin ( invitrogen , merelbeke , belgium ) , 1% streptomycin ( invitrogen , merelbeke , belgium ) , and 2 mm glutamine ( invitrogen , merelbeke , belgium ) .
the cells were seeded at a density of 80.000/cm in 25 cm t - flasks and maintained at 37 c in an atmosphere of 5% co2 .
after 4 days , the non - adherent cells were removed and the media was changed every 3 days . in order to expand mscs , the adhered monolayer was detached with trypsin - edta ( invitrogen , merelbeke , belgium ) for 5 min at 37 c , after 14 days for the first passage and every 45 days for successive passages . during in vitro passaging , the cells were seeded at a density of 5 - 1010 cells / cm and expanded for several passages until they no longer reached confluence . at - mscs
were extracted from breast ats of healthy human adult donors with cosmetic mammoplasty surgery after obtaining the fully informed consent as described previously ( 20 , 21 ) .
briefly , fragments of ats washed with phosphate buffered saline ( pbs ) , minced and digested with 0.2% collagenase type i ( gibco , usa ) at 37 c .
the resulting cell suspension was centrifuged and the pellet including the adherent stromal cells was put on a ficoll gradient ( biosera , uk ) to separate the stromal vascular fraction ( svf ) .
the separated cells were resuspended in dmem culture medium ( gibco , usa ) containing 10% fetal bovine serum ( gibco , usa ) and 1% penicillin / streptomycin ( biosera , uk ) .
umbilical cords from healthy infants were transferred to our laboratory within 424 hr after delivery .
a longitudinal section was made through the umbilical vein and the endothelial cells were scratched and discarded .
each piece was put into a 100 mm petri dish and cultured in the presence of -mem containing 10% fcs , 0.1% l - glutamine , and 0.1% penicillin / streptomycin for 810 days . upon confluency
, the cells were passaged . at each passage , the cells were counted and analyzed for viability by trypan blue staining analysis .
flow cytometric analysis and functional ability of differentiation into osteocyte and adipocyte were achieved in response to specific culture conditions .
the identification of adherent cells was performed by flow cytometric analysis . at the third passage
, the cells were detached from the culture flasks with trypsin - edta and counted .
about 110 cells were incubated on ice for 30 min with goat serum , resuspended in pbs and pelleted by centrifugation .
subsequently , the cells were stained for 30 min at 4 c with fluorescein isothiocyanate ( fitc)-coupled or phycoerythrin ( pe)-conjugated cd34 , cd45 , cd90 , cd73 , cd80 , and hla - class ii .
isotype - matched mouse monoclonal antibodies ( bd - pharmingen , usa ) were used to rule out non - specific staining of the cells .
the labeled cells were thoroughly washed with pbs and analyzed on an facscalibur machine ( bd biosciences , usa ) using the cell quest as data acquisition software .
the potential of at - mscs to differentiate into chondrogenic , osteogenic , and adipogenic lineages was examined as described before ( 20 , 21 ) .
briefly , 110 at - mscs were used for differentiation when the cultures were 6080% confluent by using appropriate differentiation kits ( stempro differentiation kit , gibco , usa ) .
after 2 weeks the cells were stained with alizarin red s , safranin , and oil red o for evaluating osteogenic , chondrogenic , and adipogenic differentiation , respectively ( merck , germany ) .
the potentials of the bm - mscs and wj - mscs to differentiate into osteogenic and adipogenic lineages were examined . for osteogenic differentiation ,
osteogenic medium consisted of dmem supplemented with 10 m / l dexamethasone ( sigma - aldrich , st .
louis , usa ) , 10 mm / l glycerol phosphate ( sigma - aldrich , st .
louis , usa ) , 3.7 g / l sodium bicarbonate ( sigma - aldrich , st .
louis , usa ) , and 0.05 g / l ascorbic acid ( sigma - aldrich , st .
adipogenic medium consisted of dmem supplemented with 1 m / l hydrocortisone ( sigma - aldrich , st .
louis , usa ) , 0.05 g / l ascorbic acid , 0.05 g / l indomethacin ( sigma - aldrich , st .
peripheral blood sample was collected from a healthy donor and pbmcs were prepared by density gradient centrifugation using ficoll - hypaque media and were labeled with 5 nm cfse dye ( invitrogen molecular probe , usa )
. then cells were incubated at 37c for 10 min ; 2 ml fetal bovine serum ( fbs ) ( gibco , usa ) was added to the cells and centrifuged at 1800 rpm for 10 min . afterward , rpmi culture media with 2% fbs was added to the cell pellet and centrifuged again at 1800 rpm for 10 min .
next cfse labeled pbmcs were counted and added into wells at a concentration of 110 cells per well .
210 mscs were plated in culture plates 24 hr prior to co - culture with pbmcs . in this way
pbmcs were stimulated with pha ( gibco , uk ) and the effect of mscs on lymphocyte proliferation was studied in both direct and indirect ( using 0.4 m transwell plates , corning , usa ) culture system after 3 , 5 , and 7 days post culture by flow cytometry and compared to pha - activated pbmcs .
all experiments were carried out with 3 at , 2 wj , and 2 bm samples .
human mscs were obtained from 5 ml bm aspirates from the iliac crest of normal donors within the age range of 1945 years .
they were donors of bm to a related patient after obtaining approval of the ethics committee , shiraz university of medical sciences , shiraz , iran .
written informed consent was also obtained allowing analysis of the clinical data and testing mentioned in this study .
each sample of aspirate was diluted 1:1 with dmem - low glucose ( invitrogen , merelbeke , belgium ) and layered over about 5 ml of ficoll ( lymphoprep ; oslo , norway ) .
the isolation method was according to a previously reported method ( 19 ) by some modifications , which will be stated completely .
after centrifugation at 939 g for 20 min , the mononuclear cell layer was removed from the interface .
cells were suspended in dmem and centrifuged at 338 g for 15 min then resuspended in basal dmem medium containing 10% fetal calf serum ( invitrogen , merelbeke , belgium ) , 1% penicillin ( invitrogen , merelbeke , belgium ) , 1% streptomycin ( invitrogen , merelbeke , belgium ) , and 2 mm glutamine ( invitrogen , merelbeke , belgium ) .
the cells were seeded at a density of 80.000/cm in 25 cm t - flasks and maintained at 37 c in an atmosphere of 5% co2 .
after 4 days , the non - adherent cells were removed and the media was changed every 3 days . in order to expand mscs , the adhered monolayer was detached with trypsin - edta ( invitrogen , merelbeke , belgium ) for 5 min at 37 c , after 14 days for the first passage and every 45 days for successive passages . during in vitro passaging , the cells were seeded at a density of 5 - 1010 cells / cm and expanded for several passages until they no longer reached confluence .
at - mscs were extracted from breast ats of healthy human adult donors with cosmetic mammoplasty surgery after obtaining the fully informed consent as described previously ( 20 , 21 ) .
briefly , fragments of ats washed with phosphate buffered saline ( pbs ) , minced and digested with 0.2% collagenase type i ( gibco , usa ) at 37 c .
the resulting cell suspension was centrifuged and the pellet including the adherent stromal cells was put on a ficoll gradient ( biosera , uk ) to separate the stromal vascular fraction ( svf ) .
the separated cells were resuspended in dmem culture medium ( gibco , usa ) containing 10% fetal bovine serum ( gibco , usa ) and 1% penicillin / streptomycin ( biosera , uk ) .
umbilical cords from healthy infants were transferred to our laboratory within 424 hr after delivery .
a longitudinal section was made through the umbilical vein and the endothelial cells were scratched and discarded .
each piece was put into a 100 mm petri dish and cultured in the presence of -mem containing 10% fcs , 0.1% l - glutamine , and 0.1% penicillin / streptomycin for 810 days . upon confluency
at each passage , the cells were counted and analyzed for viability by trypan blue staining analysis .
flow cytometric analysis and functional ability of differentiation into osteocyte and adipocyte were achieved in response to specific culture conditions .
the identification of adherent cells was performed by flow cytometric analysis . at the third passage ,
about 110 cells were incubated on ice for 30 min with goat serum , resuspended in pbs and pelleted by centrifugation .
subsequently , the cells were stained for 30 min at 4 c with fluorescein isothiocyanate ( fitc)-coupled or phycoerythrin ( pe)-conjugated cd34 , cd45 , cd90 , cd73 , cd80 , and hla - class ii .
isotype - matched mouse monoclonal antibodies ( bd - pharmingen , usa ) were used to rule out non - specific staining of the cells .
the labeled cells were thoroughly washed with pbs and analyzed on an facscalibur machine ( bd biosciences , usa ) using the cell quest as data acquisition software .
the potential of at - mscs to differentiate into chondrogenic , osteogenic , and adipogenic lineages was examined as described before ( 20 , 21 ) .
briefly , 110 at - mscs were used for differentiation when the cultures were 6080% confluent by using appropriate differentiation kits ( stempro differentiation kit , gibco , usa ) .
after 2 weeks the cells were stained with alizarin red s , safranin , and oil red o for evaluating osteogenic , chondrogenic , and adipogenic differentiation , respectively ( merck , germany ) .
the potentials of the bm - mscs and wj - mscs to differentiate into osteogenic and adipogenic lineages were examined . for osteogenic differentiation ,
osteogenic medium consisted of dmem supplemented with 10 m / l dexamethasone ( sigma - aldrich , st .
louis , usa ) , 10 mm / l glycerol phosphate ( sigma - aldrich , st .
louis , usa ) , 3.7 g / l sodium bicarbonate ( sigma - aldrich , st .
louis , usa ) , and 0.05 g / l ascorbic acid ( sigma - aldrich , st .
adipogenic medium consisted of dmem supplemented with 1 m / l hydrocortisone ( sigma - aldrich , st .
g / l ascorbic acid , 0.05 g / l indomethacin ( sigma - aldrich , st .
peripheral blood sample was collected from a healthy donor and pbmcs were prepared by density gradient centrifugation using ficoll - hypaque media and were labeled with 5 nm cfse dye ( invitrogen molecular probe , usa )
. then cells were incubated at 37c for 10 min ; 2 ml fetal bovine serum ( fbs ) ( gibco , usa ) was added to the cells and centrifuged at 1800 rpm for 10 min .
afterward , rpmi culture media with 2% fbs was added to the cell pellet and centrifuged again at 1800 rpm for 10 min .
next cfse labeled pbmcs were counted and added into wells at a concentration of 110 cells per well .
210 mscs were plated in culture plates 24 hr prior to co - culture with pbmcs . in this way
pbmcs were stimulated with pha ( gibco , uk ) and the effect of mscs on lymphocyte proliferation was studied in both direct and indirect ( using 0.4 m transwell plates , corning , usa ) culture system after 3 , 5 , and 7 days post culture by flow cytometry and compared to pha - activated pbmcs .
all experiments were carried out with 3 at , 2 wj , and 2 bm samples .
using the same previous approach , single cell - derived colonies of msc - like cells which were rapidly grown and exhibiting homogeneous morphology were selected for culture expansion .
bm cells rapidly generated a confluent layer of cells possessing an elongated and fibroblastic shape .
their surface phenotype was determined by flowcytometry ; also , we have characterized a population of cells resident within human bm cultures that were negative for the major histocompatibility complex ( mhc ) class ii , and cd80 ( b7 - 1 ) costimulators for t lymphocyte activation .
however , they were positive for the msc - candidate markers cd90 and cd73 ( figure 1a ) .
a. the cells were negative for cd80 , hla - dr , cd45 , and cd34 ( the black histogram shows the profile of the isotype control ) , but were positive for cd90 and cd73 ( the shaded area shows the profile of the negative control ) .
b. human bm - mscs before differentiation c. the adipose droplet in differentiated cells after incubating with adipogenic media ( 10x ) d. osteogenic differentiation was positive for alizarin red staining ( 10x ) lipid droplets in differentiated adipocytes were located by oil red o - staining .
likewise , alizarin red s staining confirmed the presence of calcium deposits in osteocytes , whereas undifferentiated mscs were negative in staining procedure ( figures 1b and c ) .
these results indicate that the isolated cells have the basic properties of mscs . at - mscs
emerged with a spindle - shaped appearance in the culture as depicted in figure 2a .
results of osteocyte differentiation demonstrated the accumulation of calcium in the culture ( figure 2b ) .
differentiation to chondrocytes caused morphological changes in at - mscs into rounder and cuboidal shapes as shown in figure 2c .
differentiation to adipocytes caused the formation of well - formed lipid vesicles in at - mscs as presented in figure 2d .
the flow cytometry analysis for stem cell - specific markers revealed that at - mscs express cd44 and cd73 ( higher than 98% of all cells ) .
they were negative ( higher than 90% of all ascs ) for the expressions of mhc ii , cd80 , cd45 , and cd34 ( figure 2e ) . at - mscs with a spindle - shaped appearance in culture before treating for differentiation ( a ) .
these cells emerged in culture with the ability to differentiate into osteocytes ( b ) , chondrocytes ( c ) , and adipocytes ( d ) .
results are representative of two independent experiments . filled histograms represent the specific markers ( cds ) and the unfilled were isotype control ( 40x ) .
wj - mscs were positive for the expression of cd90 , cd73 , cd44 , cd105 , and cd106 , but were negative for the expression of cd34 and cd144 ( figure 3a ) .
adipose vacuoles and calcium deposition in culture showed the ability of wj - mscs for differentiation ( figure 3b and c ) .
c and d. differentiation ability of wj - mscs to adipocytes and osteocytes , respectively in order to show the inhibitory effects of the extracted cells , three different types of mscs were co - cultured with normal allogeneic human pha - activated pbmcs .
the proliferation of pbmcs was assessed by flow cytometry of cfse stained cells and compared to each other and to the growth of pbmcs in the absence of mscs , 3 , 5 , and 7 days post co - culture .
based on the results , data of days 3 and 7 were compared between different groups . as depicted in figure 4 , the proliferation of pbmcs reduced to 6.2 , 7 , and 15.4- fold ( 74% , 76% , and 83% growth suppression , respectively ) in cultures with at - mscs , wj - mscs , and bm - mscs , respectively , compared to the pha - activated cells at day 3 post culture .
the meansem frequencies of dividing cells were 14.85.6 , 12.63.4 , 5.70.4 , and 88.3 for at - mscs , wj - mscs , bm - mscs , and non - co - cultured cells , respectively .
when the growth suppression was indirectly assessed by using transwell culture system , it is revealed that at - mscs , wj - mscs , and bm - mscs caused growth reduction in pbmcs to 3 , 8 , and 8-fold ( 59% , 77% , and 77% growth suppression ) , respectively , lower than pha - activated cells .
the meansem frequencies of dividing cells were 296.4 , 11 6.4 , and 117.6 for at - mscs , wj - mscs , and bm - mscs , respectively ( figure 4 ) .
growth suppression of pbmcs after coculture with at , bm , and wj - mscs .
( a ) typical representation of flow cytometry plots showing growth suppression of pbmcs in coculture with mscs after 3 days .
( b ) growth suppression of pbmcs in coculture with mscs based on the mean frequency of dividing pbmcs no significant difference was found between the data of days 3 and 5 , but results of day 7 were different . at day 7 the growth suppression effect of all types of mscs was lower than that of day 3 because it showed 60% , 49% , and 84% reduction 7 days post culture with at- , wj- , and bm - mscs , respectively , compared to day 3 .
similar effects were seen in indirect cultures for at- and wj- , but not bm - msc because 27% and 4% reduction in growth suppression effect of at- and wj - msc was observed compared to day 3 .
using the same previous approach , single cell - derived colonies of msc - like cells which were rapidly grown and exhibiting homogeneous morphology were selected for culture expansion .
bm cells rapidly generated a confluent layer of cells possessing an elongated and fibroblastic shape .
their surface phenotype was determined by flowcytometry ; also , we have characterized a population of cells resident within human bm cultures that were negative for the major histocompatibility complex ( mhc ) class ii , and cd80 ( b7 - 1 ) costimulators for t lymphocyte activation .
however , they were positive for the msc - candidate markers cd90 and cd73 ( figure 1a ) .
a. the cells were negative for cd80 , hla - dr , cd45 , and cd34 ( the black histogram shows the profile of the isotype control ) , but were positive for cd90 and cd73 ( the shaded area shows the profile of the negative control ) .
b. human bm - mscs before differentiation c. the adipose droplet in differentiated cells after incubating with adipogenic media ( 10x ) d. osteogenic differentiation was positive for alizarin red staining ( 10x ) lipid droplets in differentiated adipocytes were located by oil red o - staining .
likewise , alizarin red s staining confirmed the presence of calcium deposits in osteocytes , whereas undifferentiated mscs were negative in staining procedure ( figures 1b and c ) .
at - mscs emerged with a spindle - shaped appearance in the culture as depicted in figure 2a .
results of osteocyte differentiation demonstrated the accumulation of calcium in the culture ( figure 2b ) .
differentiation to chondrocytes caused morphological changes in at - mscs into rounder and cuboidal shapes as shown in figure 2c .
differentiation to adipocytes caused the formation of well - formed lipid vesicles in at - mscs as presented in figure 2d .
the flow cytometry analysis for stem cell - specific markers revealed that at - mscs express cd44 and cd73 ( higher than 98% of all cells ) .
they were negative ( higher than 90% of all ascs ) for the expressions of mhc ii , cd80 , cd45 , and cd34 ( figure 2e ) . at - mscs with a spindle - shaped appearance in culture before treating for differentiation ( a ) .
these cells emerged in culture with the ability to differentiate into osteocytes ( b ) , chondrocytes ( c ) , and adipocytes ( d ) .
results are representative of two independent experiments . filled histograms represent the specific markers ( cds ) and the unfilled were isotype control ( 40x ) .
wj - derived cells were seen as spindle - shaped cells in the culture . figure 3 shows the phenotypic and differentiation characteristics of these cells .
wj - mscs were positive for the expression of cd90 , cd73 , cd44 , cd105 , and cd106 , but were negative for the expression of cd34 and cd144 ( figure 3a ) .
adipose vacuoles and calcium deposition in culture showed the ability of wj - mscs for differentiation ( figure 3b and c ) .
in order to show the inhibitory effects of the extracted cells , three different types of mscs were co - cultured with normal allogeneic human pha - activated pbmcs .
the proliferation of pbmcs was assessed by flow cytometry of cfse stained cells and compared to each other and to the growth of pbmcs in the absence of mscs , 3 , 5 , and 7 days post co - culture .
based on the results , data of days 3 and 7 were compared between different groups . as depicted in figure 4 ,
the proliferation of pbmcs reduced to 6.2 , 7 , and 15.4- fold ( 74% , 76% , and 83% growth suppression , respectively ) in cultures with at - mscs , wj - mscs , and bm - mscs , respectively , compared to the pha - activated cells at day 3 post culture .
the meansem frequencies of dividing cells were 14.85.6 , 12.63.4 , 5.70.4 , and 88.3 for at - mscs , wj - mscs , bm - mscs , and non - co - cultured cells , respectively .
when the growth suppression was indirectly assessed by using transwell culture system , it is revealed that at - mscs , wj - mscs , and bm - mscs caused growth reduction in pbmcs to 3 , 8 , and 8-fold ( 59% , 77% , and 77% growth suppression ) , respectively , lower than pha - activated cells .
the meansem frequencies of dividing cells were 296.4 , 11 6.4 , and 117.6 for at - mscs , wj - mscs , and bm - mscs , respectively ( figure 4 )
. growth suppression of pbmcs after coculture with at , bm , and wj - mscs .
( a ) typical representation of flow cytometry plots showing growth suppression of pbmcs in coculture with mscs after 3 days .
( b ) growth suppression of pbmcs in coculture with mscs based on the mean frequency of dividing pbmcs no significant difference was found between the data of days 3 and 5 , but results of day 7 were different . at day 7
the growth suppression effect of all types of mscs was lower than that of day 3 because it showed 60% , 49% , and 84% reduction 7 days post culture with at- , wj- , and bm - mscs , respectively , compared to day 3 .
similar effects were seen in indirect cultures for at- and wj- , but not bm - msc because 27% and 4% reduction in growth suppression effect of at- and wj - msc was observed compared to day 3 .
the specific characteristics of mscs , including their extensive proliferative potential and the ability to differentiate into various cell types , like bone , fat , and cartilage , make them an attractive tool in regenerative medicine . apparently , these cells might be simply isolated from various tissues and expanded in culture in large numbers , which gives the opportunity to create tissue - engineered constructs for re - introducing them into patients ( 22 ) .
further interest in the clinical application of mscs has been raised by the observation that these cells are strongly immunosuppressive in vitro and in vivo .
mscs exist in almost all tissues , including bm , fat , muscle , tooth root , hair follicles , placenta , dermis , umbilical cord , wj , lung , liver , and spleen ( 1 , ) . to date
the mscs derived from bm have been applied in cell - based therapies , including the treatment of osteogenesis imperfecta , intracoronary transplantation in patients with acute myocardial infarction ( 23 - 25 ) , and the treatment of graft - versus - host disease after allogeneic bm transplantation ( 26 ) .
although bm has been represented as the main available and well - accepted source of mscs , alternative sources such as at and wj of human umbilical cord may potentially be used in tissue injuries ( 16 , 27 ) .
bm- , at- , and wj - mscs have initially shown similarities in their immunomodulatory effects , but additional studies showed various disparities ( 28 , 29 ) .
pr et al reported several differences between wj- , bm- , and at - mscs including a higher proliferation potential and higher production of chemokines , pro - inflammatory proteins , and growth factors in wj - msc .
they showed that at - mscs are better sources for pro - angiogenic factors such as vegf and extracellular matrix components and metalloproteinases ( 30 ) . at - mscs showed a stronger inhibitory effect on cd4 and cd8 t cells .
in contrast to bm- and at - mscs , umbilical cord matrix - mscs did not influence the activation or lymphoblast characteristics of b cells ( 31 ) . here
, we compared the growth suppression effects of bm- , at- , and wj - mscs on pbmcs .
initial studies on mscs showed that extracted cells from all three sources have the specific mesenchymal characteristics such as expression of surface markers and differentiation abilities .
additionally , based on the results of this study , all kinds of mscs showed suppression effects on the proliferation of pbmcs . when the growth suppression was compared between different types of mscs , bm - mscs and then wj - mscs showed higher growth suppression effects on pbmcs compared to at - mscs .
indirect culture experiments using the transwell system showed similar results because using at - ascs had the least effect on growth suppression of pbmcs compared to the culture supernatants of wj- and bm - mscs .
when we compared the direct and indirect cultures of each msc to itself , it was revealed that the presence of at and bm - mscs , thus cell to cell contact , was more important than the secretary effects of these cells . on day 7 , the influence of at - mscs compared to other sources was similar to day 3 , but it seems that the effects of all types of mscs were generally diminished during the time .
bochev et al indicated that at - mscs inhibited antibody production in pbmcs to a much greater extent than bm - mscs ( 32 ) .
furthermore , they demonstrated that at - mscs are more capable of suppressing the differentiation of blood monocytes into dendritic cells ( dcs ) and the expression of costimulatory molecules in mature monocyte - derived dcs ( 33 ) .
results of our study on the underlying effect of at- and bm - mscs on the proliferation of pbmcs were inconsistent with these reports because we showed that bm - mscs had a higher suppression effect than at - mscs which may be related to the source of at because they used liposuction , but our at - mscs originated from breast tissue .
thus , mscs originating from different sources of adipose may not have similar immunomodulatory effects .
the assessment of immune - suppression caused by bm - mscs and wj - mscs showed that although both mscs distort the cytokine profile from a pro - inflammatory to an anti - inflammatory phenotype , bm - mscs , but not wj - mscs increase the levels of immune suppressive cytokine il-10 and modulate the level of pro - inflammatory cytokine il-2 .
interestingly , indoleamine 2,3-dioxygenase ( ido ) activity was higher in bm - mscs than wj - mscs when both cells were treated with interferon gamma ( ifn ) . also , bm - mscs secreted higher levels of prostaglandin e2 ( pge2 ) in comparison with wj - mscs ( 29 ) .
these differences in secretion pattern of mscs and disparity in expressing distinct molecules ( 34 ) may reflect why mscs from different sources show specific growth suppression effects .
our results of direct cultures are consistent with these data because we also observed the higher suppression effect of bm - mscs compared to wj - mscs .
in contrast , the supernatant of wj - mscs was more effective than bm - mscs for reducing the proliferation of pbmcs .
based on the present investigation , it is concluded that direct or cell - cell contact and indirect immunomodulatory effects of mscs are different .
additionally , mscs from various sources and even different parts of the body have special characteristics , which undoubtedly impact their properties and effects .
results of this study may contribute to the application of adult stem cells in regenerative medicine . | objective(s):immunosuppressive property of mesenchymal stem cells ( mscs ) has great attraction in regenerative medicine especially when dealing with tissue damage involving immune reactions .
the most attractive tissue sources of mscs used in clinical applications are bone marrow ( bm ) , adipose tissue ( at ) , and wharton s jelly ( wj ) of human umbilical cord .
the current study has compared immunomodulatory properties of human bm , at , and wj-mscs.materials and methods : three different types of human mscs were isolated , cultured , and characterized by flow cytometry and differentiation potentials .
the mscs were co - cultured with allogeneic phytohemagglutinin ( pha ) activated peripheral blood mononuclear cells ( pbmcs ) .
the proliferation of pbmcs was assessed by flow cytometry of carboxyfluorescein succinimidyl ester ( cfse ) stained cells and compared to each other and to the growth of pbmcs in the absence of mscs .
additionally , the growth suppression was indirectly assessed by using the transwell culture system.results:the proliferation of pbmcs reduced to 6.2 , 7 and 15.4- fold in cultures with at - mscs , wj - mscs , and bm - mscs , respectively , compared to the pha - activated cells .
when the growth suppression was indirectly assessed by using the transwell culture system , it was revealed that at - mscs , wj - mscs , and bm - mscs caused growth reduction in pbmcs to 3 , 8 , and 8 -fold , respectively , compared to the pha - activated cells.conclusion:these data collectively conclude that the immunomodulatory effects of mscs , which may mostly carry out through direct cell to cell contact , are different between various sources .
accordingly results of this study may contribute to the application of these cells in cell therapy and regenerative medicine . |
when attempting to measure potential health benefits , a number of methods are available including cost benefit analysis , cost - effectiveness analysis , and cost - of - illness analysis .
the selection of an appropriate method should be consistent with the available data and the phenomenon being studied .
benefit analysis and cost - effectiveness analysis are both used for evaluation of two or more alternative treatments ; these techniques require the costs associated with both the treatment and the alternatives to be well - known .
the purpose of this research is to determine the potential benefits from allowing plant sterol - enriched foods to be sold into a market where they are currently not available , not to compare plant sterol - enriched foods to alternative treatments .
additionally , it is not possible to estimate the cost premium that would be attached to foods enriched with plant sterols in canada as this market would need to evolve in order to establish a long - term price . as such , neither cost - effectiveness nor cost benefit analysis is an appropriate tool for this analysis .
a cost - of - illness analysis measures the direct and indirect costs of a specific disease in this case chd .
a variation of a cost - of - illness analysis is to calculate the dollar savings associated with preventing or avoiding an illness .
this variation has been used to calculate the economic benefit of drug abuse interventions ( 10 ) , preventable drug - related medical complications ( 11 ) , and trans - fat - free canola oil ( 9 ) . a similar approach to the technique employed here was used previously by malla , hobbs , and perger to estimate health care savings from trans - fat - free canola oil in canada ( 12 ) .
the economic benefit of consumption of plant sterol - containing foods is evaluated using an economic simulation involving four steps , described below . in order to realize health benefits from plant sterols
the proportion of the canadian population that will consume a sufficient quantity of plant sterol - enriched foods to reduce their cholesterol level is defined as the success rate .
plant sterols can feasibly be added to a number of food products such as orange juice , cheese , milk , yogurt , salad dressing , cereal products , cooking oils , and margarine . according to statistics canada , the average canadian consumption of these food categories is around nine servings per day ( 13 ) .
it is thus reasonable to conclude that there is sufficient scope within the canadian diet to accommodate an adequate dose of plant sterols without having to drastically alter food consumption patterns .
it should be noted that all of the foods listed above may not be equally effective as delivery vehicles for plant sterols ; it may also be the case that claims will be allowed for different foods containing plant sterols along different timelines . since the market for plant sterol - enriched foods has not until very recently existed in canada , estimating its size and characteristics is difficult .
the overall canadian functional food market , of which phytosterol fortified foods will become a subset , is still evolving and changing rapidly and thus available data are relatively sparse . given the lack of available information ,
the best method for predicting how canadians would respond to plant sterol - enriched food products is to examine the markets for similar functional foods in canada and plant sterol - enriched foods in other countries .
an activities , interests , and opinions ( aio ) framework and cluster analysis was used to determine the potential markets for functional foods in canada ( 14 ) .
survey information from across canada enabled a cluster analysis to determine attitudes , knowledge , and motivations combining to identify consumers likely to buy functional foods .
it was discovered that a cluster representing approximately 47% of the adult canadian population possesses the characteristics that would make them likely to purchase functional food products .
canadian survey data available to determine the acceptance of specific functional foods are limited when compared to larger markets ; however , the acceptance of conjugated linoleic acid ( cla ) fortified foods has been examined in western canada ( 15 ) . it was found that the high percentage of survey respondents likely to purchase cla - enriched dairy products , if available where they normally shop , ranged from 4% to 13% .
since many of these dairy products are similar to potential phytosterol - fortified foods , it seems reasonable to extend these results to such products . in finland , a country which has allowed phytosterol / stanol - fortified foods in the marketplace for quite some time ,
a survey found 17% of adults reported daily use of plant sterol - enriched margarine , with another 20% reporting monthly use ( 16 ) .
an additional 7% indicated having occasionally used the product . for the purpose of this economic evaluation ,
the success rates shown in table 1 were used in the various sensitivity analysis scenarios as an estimate of the success ratio .
estimated plant sterol success rates the primary health benefit of consuming foods fortified with phytosterols is a reduction in serum cholesterol levels . approximating this reduction
requires extrapolation of results of meta - analyses of available human phytosterol - feeding studies .
since plant sterols are relatively well - established as functional food additives , several thorough meta - analyses exist ( 25 ) .
one of these was limited in scope to plant sterol - enriched spreads and found a reduction in ldl - cholesterol of 8.4% ( 95% ci 6.610.0% ) ( 3 ) .
another included 23 plant sterol and stanol trials and found a serum cholesterol reduction ranging between 4.6 and 24.3% with a mean ldl - cholesterol reduction of 11.0% ( 4 ) .
yet another used 21 published plant sterol studies found that average dose of 2.3 g of plant sterols per day yielded an average cholesterol reduction of 9.7% ( 95% ci 8.510.8% ) ( 2 ) .
the most recent meta - analysis examined the results of 59 studies and found that plant sterol containing products reduced ldl - cholesterol by 0.31
the results from the meta - analysis based on 21 published plant sterol studies ( 2 ) were adopted for the majority of the scenarios in the sensitivity analysis .
this work included the largest number of trials limited exclusively to plant sterol - enriched foods and did not include plant stanol - enriched foods .
as a result , this dataset was judged as best representing the relationship between plant sterol consumption and serum ldl - cholesterol level reduction in humans . since
no long - term studies have directly tracked the relationship between phytosterol consumption and heart disease in humans , it was necessary to make assumptions regarding the rate at which lower cholesterol levels due to plant sterol consumption will reduce the incidence of chd .
a meta - analysis of cholesterol - reducing treatment studies found a 1314% reduction in chd mortality for every 10-percentage - point net reduction in serum cholesterol levels ( 17 ) . in a similar examination of studies concerning the relationship between cholesterol levels and ischemic heart disease
, it was found that a 10% cholesterol reduction would lead to a 2530% reduction in mortality from ischemic heart disease over the long - term ( 18 ) . as both those studies focused on reductions in chd mortality
, it seems likely that the non - fatal incidence of chd would decrease in a similar fashion if serum cholesterol was reduced across the population . in an economic evaluation of the health benefits associated with trans - fat - free canola oil , a ratio of a 1% reduction of cholesterol corresponding to 23% reduction in the incidence of chd
this result is consistent with the findings of previous research ( 17 , 18 ) and was therefore used as the assumption regarding the reduction in the incidence of chd due to decreased blood cholesterol levels resulting from plant sterol consumption in the majority of the sensitivity analysis scenarios .
the final step in the procedure is to quantify the economic benefit resulting from introducing plant sterol - enriched food to the canadian market .
health canada has estimated the cost of chd in canada ( 7 ) ; even though the data are more than a decade old , they are still the most recent and comprehensive available .
since the 1998 data are in nominal dollar amounts but health care costs are subject to inflation , the 1998 amounts require adjustment to more current monetary terms .
this adjustment is made using statistics canada 's consumer price index for health and personal care ( 19 ) .
adjustment of the 1998 estimate of $ 18.472 billion to 2007 levels yields a new approximation of $ 21.176 billion as the assumed economic cost of chd in canada .
the economic cost of disease is generally broken down into direct and indirect components ; the former are incurred directly by the health care system with the goal of improving and/or preventing a patient 's health status from deteriorating . in the case of heart disease ,
direct costs include hospital care , drug costs , physician expenses , and other miscellaneous items .
indirect costs are those incurred due to the loss of production arising from disease and include loss of production due to mortality and morbidity costs arising from long- and short - term disability . table 2 provides a summary of direct and indirect costs attributable to chd in canada in both 1998 and inflation - adjusted 2007 dollars . while it seems obvious that a reduction in the level of chd will lower related costs , is the extent to which these costs will be lowered is less clear .
previous work utilized a directly proportional relationship and assumed that a 1% reduction in chd would result in a 1% reduction in chd - related costs ( 9 ) .
this type of assumption may oversimplify the health care process and could thus result in an overstatement of the potential cost reduction .
summary of costs attributed to coronary heart disease in canada ( $ millions ) source : health canada ( 7 ) . rather than assuming a proportional cost reduction , it is appropriate to more
for example , hospitalization expenditures related to chd include a sizeable fixed cost component the costs of operating a hospital will be incurred regardless of the number of heart attack patients treated at the hospital .
research conducted with respect to the fixed cost variable cost breakdown in hospitals found that hospital costs are approximately 84% fixed and 16% variable ( 20 ) .
accordingly , it is assumed that a reduction in chd will not result in a reduction in fixed costs of hospitalization , but will cause a proportional reduction in variable hospitalization costs . approximating the reduction in drug costs due
to chd assumes that fewer individuals with chd will require less medication to treat chd .
since 49.6% of drug costs resulting from chd are for the treatment of hypertension ( 7 ) , a condition not normally improved as a result of cholesterol reduction , these costs are not reduced in the calculations .
the remaining 50.4% of drug costs associated with chd are reduced proportionally to the reduction in the overall rate of chd .
physician care costs associated with chd are based on physician billings which in turn are derived from patient visits to doctors offices .
it is assumed that if fewer people are afflicted with chd , fewer visits to physicians for chd treatment will occur , resulting in less numerous billings and lower health care costs . as such , a 1% reduction in chd is assumed to lead to a 1% reduction in chd - related physician costs .
a large component of the miscellaneous chd - related expenditures has been categorized by health canada ( 7 ) as services provided by other health providers. for this analysis ,
the cost of chiropractors ( 0.8% ) , dental ( 26.2% ) , and vision ( 9.6% ) health professionals were excluded , as such costs are unlikely to be reduced due to a reduction in heart disease .
however , the cost of physiotherapists ( 1% ) and all other health professionals ( 4.7% ) should be reduced in proportion to the overall chd reduction .
also ignored in this analysis are costs which are largely fixed and therefore unlikely to decrease with the rate of chd : expenditures on health research ( 4.4% ) , administration ( 6.5% ) , and public health ( 20.2% ) . by contrast , costs that will likely be reduced by a reduction in chd include ambulance ( 4.2% ) , home care ( 6.2% ) , and all other health expenditures ( 7.2% ) .
the final result is that a 1% decrease in the incidence of chd is expected to result in a 0.23% reduction in miscellaneous chd - related costs .
mortality , short - term disability , and long - term disability costs were taken to have a directly proportional chd reduction to reduction in cost relationship .
since the incidence of chd will decline , it was deemed reasonable to assume the number of people who will die or become disabled as a result of chd will decline proportionately . as a consequence ,
the loss of human capital that would ordinarily be incurred as a result of chd - related death and disability , would not take place ; this reduction results in an economic saving .
table 3 summarizes the proportion of cost reductions that could be achieved by a reduction in the incidence of chd .
summary of coronary heart disease cost reduction corresponding to a 1% decrease in incidence of coronary heart disease a number of assumptions are required to approximate the potential reduction in the cost of chd from introducing phytosterol - fortified foods to the canadian market .
though these assumptions are based on a review of the peer - reviewed scientific literature , it could be misleading to suggest a single number as best representing the exact economic cost savings .
as such , results are reported as a sensitivity analysis ; as this approach allows the effects of varying model assumptions within the simulation to be gauged . to make the numbers as robust as possible , four scenarios were examined ; a description of the sensitivity analysis scenarios is provided below with a summary of the assumptions shown in table 4 .
in order to realize health benefits from plant sterols , an individual must consume between 1 and 3 g / day .
the proportion of the canadian population that will consume a sufficient quantity of plant sterol - enriched foods to reduce their cholesterol level is defined as the success rate .
plant sterols can feasibly be added to a number of food products such as orange juice , cheese , milk , yogurt , salad dressing , cereal products , cooking oils , and margarine . according to statistics canada , the average canadian consumption of these food categories is around nine servings per day ( 13 ) .
it is thus reasonable to conclude that there is sufficient scope within the canadian diet to accommodate an adequate dose of plant sterols without having to drastically alter food consumption patterns .
it should be noted that all of the foods listed above may not be equally effective as delivery vehicles for plant sterols ; it may also be the case that claims will be allowed for different foods containing plant sterols along different timelines . since the market for plant sterol - enriched foods has not until very recently existed in canada , estimating its size and characteristics is difficult .
the overall canadian functional food market , of which phytosterol fortified foods will become a subset , is still evolving and changing rapidly and thus available data are relatively sparse . given the lack of available information ,
the best method for predicting how canadians would respond to plant sterol - enriched food products is to examine the markets for similar functional foods in canada and plant sterol - enriched foods in other countries .
an activities , interests , and opinions ( aio ) framework and cluster analysis was used to determine the potential markets for functional foods in canada ( 14 ) .
survey information from across canada enabled a cluster analysis to determine attitudes , knowledge , and motivations combining to identify consumers likely to buy functional foods .
it was discovered that a cluster representing approximately 47% of the adult canadian population possesses the characteristics that would make them likely to purchase functional food products .
canadian survey data available to determine the acceptance of specific functional foods are limited when compared to larger markets ; however , the acceptance of conjugated linoleic acid ( cla ) fortified foods has been examined in western canada ( 15 ) .
it was found that the high percentage of survey respondents likely to purchase cla - enriched dairy products , if available where they normally shop , ranged from 4% to 13% . since many of these dairy products are similar to potential phytosterol - fortified foods , it seems reasonable to extend these results to such products . in finland , a country which has allowed phytosterol / stanol - fortified foods in the marketplace for quite some time ,
a survey found 17% of adults reported daily use of plant sterol - enriched margarine , with another 20% reporting monthly use ( 16 ) .
an additional 7% indicated having occasionally used the product . for the purpose of this economic evaluation ,
the success rates shown in table 1 were used in the various sensitivity analysis scenarios as an estimate of the success ratio .
the primary health benefit of consuming foods fortified with phytosterols is a reduction in serum cholesterol levels .
approximating this reduction requires extrapolation of results of meta - analyses of available human phytosterol - feeding studies .
since plant sterols are relatively well - established as functional food additives , several thorough meta - analyses exist ( 25 ) .
one of these was limited in scope to plant sterol - enriched spreads and found a reduction in ldl - cholesterol of 8.4% ( 95% ci 6.610.0% ) ( 3 ) .
another included 23 plant sterol and stanol trials and found a serum cholesterol reduction ranging between 4.6 and 24.3% with a mean ldl - cholesterol reduction of 11.0% ( 4 ) .
yet another used 21 published plant sterol studies found that average dose of 2.3 g of plant sterols per day yielded an average cholesterol reduction of 9.7% ( 95% ci 8.510.8% ) ( 2 ) .
the most recent meta - analysis examined the results of 59 studies and found that plant sterol containing products reduced ldl - cholesterol by 0.31
the results from the meta - analysis based on 21 published plant sterol studies ( 2 ) were adopted for the majority of the scenarios in the sensitivity analysis .
this work included the largest number of trials limited exclusively to plant sterol - enriched foods and did not include plant stanol - enriched foods .
as a result , this dataset was judged as best representing the relationship between plant sterol consumption and serum ldl - cholesterol level reduction in humans .
since no long - term studies have directly tracked the relationship between phytosterol consumption and heart disease in humans , it was necessary to make assumptions regarding the rate at which lower cholesterol levels due to plant sterol consumption will reduce the incidence of chd .
a meta - analysis of cholesterol - reducing treatment studies found a 1314% reduction in chd mortality for every 10-percentage - point net reduction in serum cholesterol levels ( 17 ) . in a similar examination of studies concerning the relationship between cholesterol levels and ischemic heart disease
, it was found that a 10% cholesterol reduction would lead to a 2530% reduction in mortality from ischemic heart disease over the long - term ( 18 ) . as both those studies focused on reductions in chd mortality
, it seems likely that the non - fatal incidence of chd would decrease in a similar fashion if serum cholesterol was reduced across the population . in an economic evaluation of the health benefits associated with trans - fat - free canola oil , a ratio of a 1% reduction of cholesterol corresponding to 23% reduction in the incidence of chd
this result is consistent with the findings of previous research ( 17 , 18 ) and was therefore used as the assumption regarding the reduction in the incidence of chd due to decreased blood cholesterol levels resulting from plant sterol consumption in the majority of the sensitivity analysis scenarios .
the final step in the procedure is to quantify the economic benefit resulting from introducing plant sterol - enriched food to the canadian market .
health canada has estimated the cost of chd in canada ( 7 ) ; even though the data are more than a decade old , they are still the most recent and comprehensive available .
since the 1998 data are in nominal dollar amounts but health care costs are subject to inflation , the 1998 amounts require adjustment to more current monetary terms .
this adjustment is made using statistics canada 's consumer price index for health and personal care ( 19 ) .
adjustment of the 1998 estimate of $ 18.472 billion to 2007 levels yields a new approximation of $ 21.176 billion as the assumed economic cost of chd in canada .
the economic cost of disease is generally broken down into direct and indirect components ; the former are incurred directly by the health care system with the goal of improving and/or preventing a patient 's health status from deteriorating . in the case of heart disease ,
direct costs include hospital care , drug costs , physician expenses , and other miscellaneous items .
indirect costs are those incurred due to the loss of production arising from disease and include loss of production due to mortality and morbidity costs arising from long- and short - term disability .
table 2 provides a summary of direct and indirect costs attributable to chd in canada in both 1998 and inflation - adjusted 2007 dollars . while it seems obvious that a reduction in the level of chd will lower related costs ,
previous work utilized a directly proportional relationship and assumed that a 1% reduction in chd would result in a 1% reduction in chd - related costs ( 9 ) .
this type of assumption may oversimplify the health care process and could thus result in an overstatement of the potential cost reduction .
summary of costs attributed to coronary heart disease in canada ( $ millions ) source : health canada ( 7 ) . rather than assuming a proportional cost reduction , it is appropriate to more closely examine the nature of specific cost categories .
for example , hospitalization expenditures related to chd include a sizeable fixed cost component the costs of operating a hospital will be incurred regardless of the number of heart attack patients treated at the hospital .
research conducted with respect to the fixed cost variable cost breakdown in hospitals found that hospital costs are approximately 84% fixed and 16% variable ( 20 ) .
accordingly , it is assumed that a reduction in chd will not result in a reduction in fixed costs of hospitalization , but will cause a proportional reduction in variable hospitalization costs . approximating the reduction in drug costs due
to chd assumes that fewer individuals with chd will require less medication to treat chd .
since 49.6% of drug costs resulting from chd are for the treatment of hypertension ( 7 ) , a condition not normally improved as a result of cholesterol reduction , these costs are not reduced in the calculations .
the remaining 50.4% of drug costs associated with chd are reduced proportionally to the reduction in the overall rate of chd .
physician care costs associated with chd are based on physician billings which in turn are derived from patient visits to doctors offices .
it is assumed that if fewer people are afflicted with chd , fewer visits to physicians for chd treatment will occur , resulting in less numerous billings and lower health care costs . as such , a 1% reduction in chd is assumed to lead to a 1% reduction in chd - related physician costs .
a large component of the miscellaneous chd - related expenditures has been categorized by health canada ( 7 ) as services provided by other health providers. for this analysis ,
the cost of chiropractors ( 0.8% ) , dental ( 26.2% ) , and vision ( 9.6% ) health professionals were excluded , as such costs are unlikely to be reduced due to a reduction in heart disease .
however , the cost of physiotherapists ( 1% ) and all other health professionals ( 4.7% ) should be reduced in proportion to the overall chd reduction .
also ignored in this analysis are costs which are largely fixed and therefore unlikely to decrease with the rate of chd : expenditures on health research ( 4.4% ) , administration ( 6.5% ) , and public health ( 20.2% ) . by contrast , costs that will likely be reduced by a reduction in chd include ambulance ( 4.2% ) , home care ( 6.2% ) , and all other health expenditures ( 7.2% ) .
the final result is that a 1% decrease in the incidence of chd is expected to result in a 0.23% reduction in miscellaneous chd - related costs .
mortality , short - term disability , and long - term disability costs were taken to have a directly proportional chd reduction to reduction in cost relationship .
since the incidence of chd will decline , it was deemed reasonable to assume the number of people who will die or become disabled as a result of chd will decline proportionately . as a consequence ,
the loss of human capital that would ordinarily be incurred as a result of chd - related death and disability , would not take place ; this reduction results in an economic saving .
table 3 summarizes the proportion of cost reductions that could be achieved by a reduction in the incidence of chd .
summary of coronary heart disease cost reduction corresponding to a 1% decrease in incidence of coronary heart disease a number of assumptions are required to approximate the potential reduction in the cost of chd from introducing phytosterol - fortified foods to the canadian market .
though these assumptions are based on a review of the peer - reviewed scientific literature , it could be misleading to suggest a single number as best representing the exact economic cost savings .
as such , results are reported as a sensitivity analysis ; as this approach allows the effects of varying model assumptions within the simulation to be gauged . to make the numbers as robust as possible , four scenarios were examined ; a description of the sensitivity analysis scenarios is provided below with a summary of the assumptions shown in table 4 .
the ideal scenario is one in which the most positive assumptions are used to calculate the greatest possible economic benefit of allowing consumption of plant sterol - enriched food in canada .
it is unlikely that this scenario is achievable in the short - term ; however , over the long - term this estimate provides an index of the full potential of the economic savings resulting from the consumption of plant sterol - enriched foods in canada .
the optimistic and pessimistic scenarios make more reasonable assumptions and represent a medium - to - short - term estimate of the potential economic savings possible through plant sterol consumption .
very pessimistic scenario is included to determine the impact on the cost estimations under a worst - case scenario .
this scenario could be considered appropriate if the acceptance of phytosterol fortified foods is very low and the efficacy of plant sterols in reducing cholesterol and the health benefits of cholesterol reduction are considerably below expectations .
table 5 shows the range of values calculated to be representative of the economic savings to canada from allowing plant sterols in the diet of canadians .
each of the direct and indirect cost components is represented for the ideal , optimistic , pessimistic , and very pessimistic scenarios described above . under even the most pessimistic set of assumptions , substantial cost savings would be realized to canada 's publicly funded single - payer health system . under more reasonable assumptions ,
although it is unlikely the ideal scenario would be achieved in the short term , it is evident that under a very optimistic set of assumptions , the potential savings become substantial .
reduction in coronary heart disease cost due to consumption of plant sterol enriched foods ( $ millions )
denotes non - zero amounts too small for inclusion .
the dynamic process from the point in time when plant sterol - enriched foods are introduced to the market to the point in time at which the savings predicted in the various scenarios will occur is difficult to model with certainty .
the scenarios presented in this paper represent a static picture at some point in the future .
how quickly the product is adopted will determine the speed with which that point is reached .
the ideal scenario with a high success rate is more likely to occur at a point in time that is further into the future than the optimistic or pessimistic scenarios which have lower success rates built into their models .
while a specific timeline can not be predicted with certainty , the optimistic scenario requires that canadians adopt phytosterol - fortified foods in a manner similar to that of finland , which does not seem unreasonable .
based on the introduction pattern of plant sterol - enriched foods in finland over the 1990s of 17% , it would be reasonable to conclude that the impact of introducing plant sterol fortified foods into the canadian market could be realized in a period of 510 years .
the results of the simulation indicate that substantial economic savings can result from introducing plant sterol - enriched foods into the canadian market .
the rising costs of health care exist as a growing concern globally ; especially in countries such as canada where direct costs of treating disease are borne largely by the public health care systems .
it has also been found that the cholesterol - lowering effects of plant sterols are additive to other cholesterol lowering strategies such as diet ( 21 ) and statin treatment ( 22 ) . as such
, phytosterol enhanced foods can work in concert with lifestyle changes and medication to lower the economic cost of chd . a possible direction for
future research would be to explore the cost effectiveness of reducing chd through plant sterols in food products compared to statins , which currently enjoy a cost advantage over sterols . when considering the cost savings presented in this analysis
it should be noted that the cost premiums associated with plant sterol - enriched foods have not been accounted for in this valuation .
the costs of phytosterol fortified foods will fall outside of the medical system in canada and thus represent a benefit to the publicly funded health care system .
an excessive price premium would result in a lower economic benefit of plant sterol - enriched foods .
as the market for phytosterol fortified foods develops and more is known about possible price premiums , this issue should be revisited with a cost benefit or cost - effectiveness study .
chd is a substantial component of the economic burden of illness in canada and high serum cholesterol is a major risk factor in developing chd .
functional foods such as those which contain plant sterols have the potential to demedicalize and reduce significant portion of the economic costs associated with chd in canada , which in turn would allow health care funds to be allocated more efficiently .
this research was supported by the coalition for advancement of plant sterols in canada ( capsic ) . | background increased consumption of foods containing plant sterols has the potential to reduce the incidence of coronary heart disease ( chd ) and thus reduce costs associated with treating that disease in a significant way .
this paper reports the results of an investigation of the potential monetary benefits of allowing foods enriched with plant sterols to be marketed in canada.objective the objective of this research was to estimate the annual savings that would accrue to canada 's single - payer publicly funded health care system if plant sterols were approved for use .
if foods containing plant sterols are consumed at a sufficient rate , a reduction in chd should follow .
given the significant costs associated with chd , approval of plant sterols in canada has important public policy implications.design this research employs a variation of traditional cost - of - illness analysis entailing four steps : ( 1 ) estimation of a success rate
( proportion of persons who would consume plant sterols at the necessary rate ) ; ( 2 ) presumption of blood cholesterol reduction due to plant sterol consumption ; ( 3 ) assumption of reduction in chd that follows from blood cholesterol reduction ; and ( 4 ) calculation of cost savings associated with reduced incidence of chd.results calculations were carried out for four scenarios : ideal , optimistic , pessimistic , and very pessimistic .
it was estimated that between $ 38 million ( very pessimistic scenario ) and $ 2.45 billion ( ideal scenario ) could be saved annually by canada 's health care system with plant sterol - enriched food products being made available for sale.conclusion significant expenditure reductions within canada 's publicly funded health care system could be realized with plant sterols approved for sale . reduced chd resulting from lower blood cholesterol levels would lessen the financial burden of disease in canada . |
although glaucoma is primarily a disease of the ganglion cells , the retinal nerve fiber layer ( rnfl ) is the most commonly imaged layer of the retina in the evaluation of glaucoma patients . even before the widespread use of imaging technologies , rnfl evaluation has always been an important part of the clinical examination of glaucoma patients [ 1 , 2 ] . unlike the ganglion cell layer or other neurosensory retinal layers which are relatively optically transparent ,
the rnfl is more readily seen on a standard clinical exam and shows fine striations with ophthalmoscopy or slit lamp biomicroscopy with or without a red - free light source .
glaucomatous rnfl changes with red - free photography can even be visualized as early as 6 years prior to glaucomatous visual field defects [ 13 ] . with ultrahigh acquisition speeds and ultrahigh resolution capabilities [ 46 ] ,
spectral domain optical coherence tomography ( sdoct ) technology can image large areas around the optic nerve head and can potentially provide the most comprehensive quantitative evaluation of the rnfl and retina in glaucoma .
in contrast to time domain optical coherence tomography ( oct ) which only measures rnfl thickness along a circular scan centered on the optic nerve head , sdoct can create rnfl thickness maps of large areas around the optic nerve head ( e.g. , 5 5 mm areas ) .
a limitation of oct rnfl thickness measurements is that rnfl thickness measurements are less reliable when the rnfl is thinned , as occurs with glaucoma . in a study of the reliability of rnfl thickness measurements with time domain oct ( stratusoct , carl zeiss meditec , dublin , calif ) ,
the coefficients of variation were higher in glaucomatous patients than in normal patients for all the test parameters .
because of the inherent difficulties in obtaining reliable rnfl thickness maps in glaucoma patients , this study investigated whether supplemental sdoct peripapillary retinal thickness ( rt ) maps , which are easier to obtain , can also be correlated with fundus photography and visual field testing and whether rt maps may potentially be useful in the clinical evaluation of normal and glaucoma patients . to our knowledge , this is the first publication to suggest the use of peripapillary rt maps in the evaluation of glaucoma patients . after a pubmed search ,
we are also unaware of any previous publications correlating peripapillary retinal thickness maps with disc photography and visual field testing in glaucoma patients .
study protocols were approved by the massachusetts eye and ear infirmary and massachusetts general hospital institutional review boards and were in accordance with the health insurance portability and accountability act .
all volunteers had a complete eye exam which consisted of best - corrected visual acuity , goldmann applanation tonometry , slit lamp examination , gonioscopy , and fundus examination by a glaucoma specialist ( tc ) .
all volunteers were imaged with fundus photography ( topcon trc 50ix fundus camera ( topcon , tokyo , japan ) or visucam pro nm ( carl zeiss meditec , dublin , calif ) ) , had visual field testing using the sita - standard 24 - 2 program of the humphrey visual field analyzer 750i ( carl zeiss meditec , dublin , calif ) , and underwent sdoct imaging .
patients were defined as having glaucoma if they had ( 1 ) characteristic glaucomatous visual field changes and ( 2 ) optic nerve head changes characteristic for glaucoma , as defined below .
optic disc abnormalities included one or more of the following : excavation , notching , focal , or diffuse atrophy of neuroretinal rim area , cup - disc asymmetry between fellow eyes greater than 0.2 , or disc hemorrhage .
excavation was defined as undermining of the neuroretinal rim ; notching was considered if it involved 2 clock hours ; atrophy was defined as neuroretinal rim thinning involving 2 or more clock hours .
these eligibility criteria were modeled after the advanced glaucoma intervention study ( agis ) criteria for open - angle glaucoma ( table 1 from controlled clinical trials 1994 ; 15:299325 ) .
primary open - angle glaucoma , normal - tension glaucoma , pseudoexfoliation glaucoma , and chronic angle closure glaucoma patients were included .
chronic angle - closure glaucoma patients had to have at least half of the angle closed by gonioscopy .
physiologic cupping was diagnosed when patients had eye pressures under 22 mmhg , vertical cup - disc ratios greater than 0.4 , and normal visual field testing .
all normal eyes had normal - appearing optic nerves , had normal visual field testing , had refractive errors of less than 5 diopters , and were never documented to have intraocular pressures higher than 21 mm hg .
the experimental sdoct instrument was developed at the massachusetts general hospital , wellman center for photomedicine .
the basic setup has been published previously in detail [ 7 , 12 ] . for the light source , a superluminescent diode ( sld , superlum , russia ) with a full width at half maximum ( fwhm ) spectral width of 50 nm centered at 840
the sdoct data were processed using an algorithm which measured both the rnfl thickness and the rt [ 7 , 12 , 13 ] .
the algorithm sequentially finds the top surface of the retina , then the posterior boundary of the retinal pigment epithelium ( rpe ) , and then the posterior boundary of the rnfl .
the segmentation algorithm used anisotropic noise filtering and deformable contours to identify continuous boundaries of interest .
the depth difference between the top surface and the posterior rnfl boundary gives the rnfl thickness , while the difference between the top surface and the posterior rpe boundary gives the rt .
figure 1 shows an example of a typical sdoct frame illustrating the three boundaries : the top surface of the retina , the posterior rnfl , and the posterior rpe as estimated by our automatic algorithm .
poor scan quality included either patient inability to complete scanning of the entire optic nerve head region or physician verification of inaccurate automated rnfl or rt boundary determinations due to poor signal strength .
seven eyes of 6 patients were enrolled for this study . they were two males and five females with mean age of 61.0 years 20.7 standard deviations ( range 3683 ) .
the last two columns represent the rt maps and the rnfl thickness maps , respectively .
the range of the thickness scale is 0 to 500 microns for the rt maps and 0 to 180 microns for the rnfl thickness maps ( figure 2 ) .
the first eye is normal and shows maps consistent with known normal anatomy in that the retina and rnfl are both thicker superiorly and inferiorly ( figure 2 ) .
eye number 2 has a larger cup but still has a normal visual field ( vf ) .
eye number 3 with normal tension glaucoma has a superior nasal step on vf testing . in eye number 3
, the rnfl thickness map shows more rnfl thinning inferiorly than superiorly , which also correlates with the vf defect . in the disc photo , thinning of the inferotemporal neuroretinal rim
the 4th eye shows an inferior arcuate scotoma on vf testing . in this eye , the rt map clearly shows an arcuate area of superior retinal thinning ( arrow ) which correlates well with the inferior arcuate vf defect . in eye number 4 ,
the arcuate nature of the rnfl defect is not as clearly seen in the rnfl thickness map . in the disc photo , the superotemporal notch with associated superior neuroretinal rim thinning correlates well with the inferior arcuate vf scotoma .
eye number 5 shows a dense superior arcuate with an inferior paracentral defect and an inferior nasal step .
the rt map shows a diffusely thinned retina , although with perhaps more thinning inferiorly .
eye number 7 shows vertical cupping with greater thinning of the inferior neuroretinal rim on disc photography , which correlates well with the superior nasal step on vf testing .
this superior nasal step also correlates well with the inferior arcuate retinal thinning seen on the rt map ( arrow ) .
retinal nerve fiber layer evaluation is a classic part of the evaluation of a glaucoma patient , and imaging devices have been developed to measure rnfl thickness values which can be correlated with visual function [ 1417 ] .
rnfl imaging also provides a more objective quantitative evaluation of the rnfl than both the subjective clinical exam and qualitative red - free photography .
imaging devices which calculate rnfl thickness values include the following : scanning laser polarimetry ( slp , gdxvcc , carl zeiss meditec , dublin , calif ) , confocal scanning laser ophthalmoscopy ( hrt , heidelberg retina tomograph , heidelberg engineering , heidelberg , germany ) , and oct .
confocal scanning laser ophthalmoscopy also does not determine true rnfl values , because hrt rnfl thickness values are calculated retinal surface heights from a fixed reference plane 50 microns below the temporal surface of the retina .
of these three imaging technologies , oct is the only imaging device that measures the rnfl thickness directly [ 4 , 16 , 17 , 21 ] . although oct is the only technology that directly measures the rnfl thickness , accurate peripapillary rnfl thickness measurements in glaucoma patients are often difficult to obtain for a few reasons .
oct rnfl thickness measurements are sometimes less reliable in glaucoma patients [ 79 ] , because decreased rnfl reflectivity , which is associated with glaucomatous damage , makes the posterior rnfl boundary harder to distinguish from the less reflective underlying cellular layers ( i.e. , the ganglion cell and inner nuclear layers ) . especially with the decreased rnfl reflectivity seen in glaucoma , the contrast between the rnfl and the ganglion cell layer / inner plexiform layer ( gcl / ipl ) is less distinct compared to the contrast between the rpe and surrounding layers . because of the inherent problems with measuring peripapillary rnfl thickness in glaucoma patients , an alternative measurement of the peripapillary nerve tissue that may be helpful in glaucoma evaluation is rt evaluation .
rt measurements have theoretical advantages over rnfl measurements in glaucoma because , unlike the rnfl posterior boundary which becomes less distinct with glaucomatous change , the posterior boundary of the retina ( i.e. , the highly reflective rpe ) is always distinct with even end - stage glaucoma .
therefore , segmentation or identification of this rpe boundary ( i.e. , posterior retina boundary ) is consistently more robust in glaucoma patients , making peripapillary rt determinations potentially more reliable than the peripapillary rnfl thickness measurements .
also , in theory , rt should still have clinical relevance in that thinned rnfl areas should still correspond to areas of thinner rt .
lastly , despite sdoct 's improved resolutions ( i.e. , about 2 microns for experimental machines ) and shorter examination times [ 57 , 2225 ] , sdoct rnfl thickness measurements are still subject to the inherent measurement variabilities of thinner rnfls with less reflectivity . in summary , in light of the limitations of peripapillary rnfl thickness measurements in glaucoma patients with both the time domain oct and sdoct technologies , peripapillary rt maps may provide more reliable information which is also consistently easier to obtain . with oct imaging of glaucoma patients ,
rt and rnfl thickness measurements are not usually both used for analyzing the peripapillary region . in glaucoma evaluation ,
rt measurements have focused on evaluating the macular region of the retina [ 2628 ] , and rnfl thickness measurements have usually been used to evaluate the peripapillary retina .
evaluation of rt in the macular region in glaucoma has been used since the macula is the area of the retina where the ganglion cell layer is more than one cell layer thick , and glaucoma has been associated with lower rt values in the macula [ 27 , 28 ] .
sdoct studies have also shown good correlation of the macular ganglion cell complex with visual field testing .
although sdoct allows for better 3-dimensional imaging of the macular region , macular imaging of the glaucoma patient may ultimately be limited by nonglaucomatous macular pathology such as macular degeneration or diabetes . in these patients with concomitant macular disease
another advantage of peripapillary sdoct rt maps is that it includes the rnfl from the entire retina ( 100% ) compared to macular rt maps which image only about 50% of the ganglion cells of the eye .
therefore , in the current sdoct study , the peripapillary rt maps include rnfl information from the entire retina ( 100% ) as well as the ganglion cell layer around the optic nerve head .
this study proposes that the most comprehensive evaluation of glaucomatous structural changes in one region may be achieved with sdoct peripapillary rt and rnfl thickness maps ( figure 2 ) of large areas of the posterior pole ( e.g. , 6 mm by 6 mm area ) . in this sdoct study , we correlated structural changes in peripapillary rt and rnfl thickness maps with functional changes in visual field testing .
for example , in eyes with glaucoma ( figure 2 , eyes numbered 37 ) , both rt and rnfl thickness maps showed that areas of superior nerve thinning were associated with areas of inferior visual field loss .
also in figure 2 , areas of inferior rt and rnfl thinning were associated with areas of superior visual field loss . in eyes numbered 4 and 7 ( figure 2 ) , the rt maps more clearly demonstrate typical glaucomatous arcuate defects ( figure 2 , arrows ) compared to the rnfl thickness maps .
these two eyes in particular illustrate how rt maps can supplement and complement rnfl thickness maps .
the use of rt maps for glaucoma evaluation also has basis in histology since the total rt includes both the rnfl and the ganglion cell layer , both layers which are affected by glaucoma .
further investigation is necessary to establish a normative database for both rt and rnfl thickness maps .
this would enable better determination of glaucomatous changes compared to age - matched normals .
rt measurements have certain limitations . because it includes all the retinal layers , any changes of any of these layers by a nonglaucomatous disease process can affect rt maps .
for example , diabetic changes or age - related macular degeneration ( amd ) can cause significant rt changes in the macular region , which is why our current study focused on rt maps around the optic nerve head . like all information from other imaging devices or from other subjective diagnostic testing ( e.g. , visual field testing ) , rt maps should be considered as supplemental information that ultimately should be correlated with and be consistent with objective clinical exam findings .
in the patients with glaucoma ( eyes numbered 3 through 7 , figure 2 ) , the disc photos show that areas of neuroretinal rim thinning correlate well with both vf testing and sdoct rt / rnfl thickness maps .
therefore , this study suggests that there is good correlation between structure ( i.e. , optic nerve head photos , rt / rnfl thickness maps ) and function ( i.e. , visual field testing ) .
with sdoct , both peripapillary rt maps and rnfl thickness maps can be obtained and can correlate well with neuroretinal rim thinning and visual field defects in glaucoma patients . even though this is a small case series , it shows the novel concept of peripapillary rt maps that may be another useful parameter for evaluating glaucoma patients , especially when rnfl thickness maps are difficult to interpret or when rnfl thickness maps may be difficult to obtain due to glaucomatous rnfl changes .
the use of rt maps however is not meant to substitute for rnfl thickness maps and also should be used with caution in the presence of concomitant diseases that affect retinal layers deep to the rnfl .
structure - function correlations between clinical exam findings , quantitative sdoct measurements , and visual field testing need further investigation . | purpose . to show how peripapillary spectral domain optical coherence tomography ( sdoct ) retinal thickness ( rt ) maps can complement retinal nerve fiber layer ( rnfl ) thickness maps in the evaluation of glaucoma patients . methods .
after a complete eye exam with standard fundus photography and visual field testing , normal and glaucomatous eyes were imaged with an experimental sdoct system . from sdoct images , rnfl
thickness and rt maps were constructed and then correlated with disc photography and visual field testing .
results
. two normal eyes of 2 patients and 5 eyes of 4 glaucoma patients were imaged .
although both rnfl and rt maps correlated well with visual field defects , glaucomatous arcuate defects were sometimes more easily identified in the rt maps .
conclusions . to our knowledge , this is the first paper to show that peripapillary sdoct rt maps may provide important supplemental information to rnfl thickness maps in the evaluation of glaucoma patients . |
vitamin d is a fat - soluble secosteroid prohormone ingested in the diet and produced in the skin following exposure to ultraviolet rays in sunlight , and conversion to active forms of vitamin d occurs in the liver and kidneys.1 the metabolic processes regulated by vitamin d include serum calcium and phosphate homeostasis , bone remodeling , neuromuscular function , inflammation , and transcription of proteins involved in cell growth and apoptosis.2 nonspecific musculoskeletal pain and weakness are prominent features of many diseases linked to vitamin d deficiency.36 vitamin d deficiency may increase the risk of developing obstructive sleep apnea mediated by inflammatory rhinitis7,8 and/or tonsillar hypertrophy.9,10 vitamin d deficiency may also contribute to the development of daytime sleepiness via central inflammatory mediators.11,12 patients seeking care in a sleep medicine clinic typically complain of sleep disruption , fatigue , and sleepiness , sometimes in association with chronic nonspecific musculoskeletal pain .
low levels of serum vitamin d have been reported in patients who report such pain,4,13 but it is not clear if these data apply to patients whose pain is discovered incidentally during evaluation for another complaint .
we were interested in the possibility that the presence of pain might indicate low vitamin d levels contributing to poor sleep quality and/or daytime symptoms of impairment in patients undergoing evaluation for a suspected sleep disorder .
traditional risk factors for low vitamin d include race ( with darker skin tone conferring higher risk ) , obesity , and advancing age.1 our primary aim was to test the hypothesis that subnormal levels of vitamin d exist in patients with sleep disorders who admit to chronic nonspecific musculoskeletal pain , and to evaluate whether predictive risk factors were present .
our secondary aim was to formulate a biomarker for vitamin d deficiency based on the risk factors observed .
between april , 2008 and october , 2010 , consecutive patients seen during routine consultation visits at an academic sleep medicine clinic were interviewed within the context of a full sleep history and underwent a physical examination .
the patients also completed a questionnaire screening for the presence of various symptoms potentially linked to sleep disruption , including the presence of moderate to severe musculoskeletal pain contributing to sleep disruption or daytime discomfort , or both .
all questionnaire responses were subsequently reviewed and verified in a face - to - face interview by a physician board - certified in internal medicine and sleep medicine ( dm ) .
for some patients , pain symptoms were initially denied , but were disclosed after specific questioning about regions of the body where pain might be experienced ( eg ,
do you have pain in your back , legs , or arms that you notice during sleep ? ) .
patients who admitted to the presence of functionally significant pain and agreed to undergo venous blood sampling for 25-hydroxyvitamin d ( n = 153 ) were included in the analysis ( table 1 ) .
all research - related procedures were approved by the institutional review board for human research at our institution .
serum 25-hydroxyvitamin d levels were determined by immunoassay according to the specifications of the manufacturer ( diasorin liason , saluggia , italy ) .
a 25-hydroxyvitamin d level below 20 ng / ml was considered to indicate vitamin d deficiency.1 the study design is shown in figure 1 . the unpaired t - test
was used to compare mean 25-hydroxyvitamin d levels , with reported representative mean values for normal subjects and for groups formed on the basis of a primary complaint of somatic pain . the relationship between vitamin d deficiency and known risk factors
the risk factors considered were race ( black versus white / hispanic ) , obesity ( body mass index 30 kg / m versus > 30 kg / m ) , age ( 60 years versus > 60 years ) , gender , and season ( blood draw months during summer [ may - june - july ] versus winter [ november - december - january ] ) .
mean 25-hydroxyvitamin d values were analyzed for the entire cohort and according to significant risk factors .
a biomarker function for predicting vitamin d deficiency was derived using linear discriminant analysis.14 its predictive accuracy was assessed by calculating sensitivity , specificity , and area under the receiver - operator characteristics curve ( auroc).15 the likelihood that the results would be able to be generalized was estimated by computing a biomarker function using data from 90% of the patients and evaluating it using data from the remaining 10% of patients .
the procedure was repeated ten times using different groups of ten patients to evaluate the predictive accuracy .
between april , 2008 and october , 2010 , consecutive patients seen during routine consultation visits at an academic sleep medicine clinic were interviewed within the context of a full sleep history and underwent a physical examination .
the patients also completed a questionnaire screening for the presence of various symptoms potentially linked to sleep disruption , including the presence of moderate to severe musculoskeletal pain contributing to sleep disruption or daytime discomfort , or both .
all questionnaire responses were subsequently reviewed and verified in a face - to - face interview by a physician board - certified in internal medicine and sleep medicine ( dm ) .
for some patients , pain symptoms were initially denied , but were disclosed after specific questioning about regions of the body where pain might be experienced ( eg ,
do you have pain in your back , legs , or arms that you notice during sleep ? ) .
patients who admitted to the presence of functionally significant pain and agreed to undergo venous blood sampling for 25-hydroxyvitamin d ( n = 153 ) were included in the analysis ( table 1 ) .
all research - related procedures were approved by the institutional review board for human research at our institution .
serum 25-hydroxyvitamin d levels were determined by immunoassay according to the specifications of the manufacturer ( diasorin liason , saluggia , italy ) .
a 25-hydroxyvitamin d level below 20 ng / ml was considered to indicate vitamin d deficiency.1
was used to compare mean 25-hydroxyvitamin d levels , with reported representative mean values for normal subjects and for groups formed on the basis of a primary complaint of somatic pain . the relationship between vitamin d deficiency and known risk factors
the risk factors considered were race ( black versus white / hispanic ) , obesity ( body mass index 30 kg / m versus > 30 kg / m ) , age ( 60 years versus > 60 years ) , gender , and season ( blood draw months during summer [ may - june - july ] versus winter [ november - december - january ] ) .
mean 25-hydroxyvitamin d values were analyzed for the entire cohort and according to significant risk factors .
a biomarker function for predicting vitamin d deficiency was derived using linear discriminant analysis.14 its predictive accuracy was assessed by calculating sensitivity , specificity , and area under the receiver - operator characteristics curve ( auroc).15 the likelihood that the results would be able to be generalized was estimated by computing a biomarker function using data from 90% of the patients and evaluating it using data from the remaining 10% of patients .
the procedure was repeated ten times using different groups of ten patients to evaluate the predictive accuracy .
the mean 25-hydroxyvitamin d level in the study population was 19.8 11.1 ng / ml , with 54% of the patients having vitamin d deficiency ( 25-hydroxyvitamin d level < 20 ng / ml ) .
this 25-hydroxyvitamin d level was significantly lower than that commonly seen in clinically normal populations , and the prevalence of vitamin d deficiency was consistently higher ( table 2 ) . compared with the results of published studies involving patients for whom pain was a primary complaint , the mean level in our cohort was either significantly lower or statistically indistinguishable , with only one exception ( table 2 ) .
the risk for vitamin d deficiency was 50 times higher in black than in white / hispanic subjects , and an increased risk was also seen in subjects who were obese or younger than 60 years ( table 3 ) .
increased risk was not observed in association with gender or winter months . in subjects from whom blood
was collected during the summer months , 23 of 41 ( 56% ) had vitamin d deficiency compared with 18 of 31 subjects ( 58% ) from whom blood was collected during the winter months .
mean 25-hydroxyvitamin d levels in patients with and without obstructive sleep apnea were not significantly different ( table 4 ) .
risk factors for vitamin d deficiency ( table 3 ) were generally found to be predictive in patients with and without obstructive sleep apnea ( table 4 ) .
the biomarker function formed on the basis of the risk factors found to be associated with vitamin d deficiency was b(x ) = 0.207x1 + 0.011x2 0.007x3 + 0.092 , where x1 is race ( 1 = white / hispanic , 2 = black )
, x2 is body mass index ( kg / m ) , and x3 is age ( years ) .
the auroc was 0.78 , and the mean auroc for ten 90:10 cross - validation determinations was 0.75 0.02 . at a biomarker threshold value of 0.45 ,
the performance of the biomarker function in classifying each patient in the cohort is shown in figure 2 .
25-hydroxyvitamin d levels were not significantly different between patients with and without obstructive sleep apnea .
the biomarker function was found to be applicable for both groups ( table 4 ) .
vitamin d is an ubiquitous metabolic regulator , and sleep is a physiologic process that can be impaired as a consequence of dysregulation of many different metabolic processes .
we found that the presence of nonspecific functionally significant pain ( revealed on direct questioning , but not necessarily mentioned a priori by the patient ) is a reliable marker for the presence of low vitamin d in patients undergoing specialist evaluation for a suspected sleep disorder .
although low 25-hydroxyvitamin d has been previously reported in patients with complaints of chronic pain , patients in the cohort described in our study were incidentally discovered to have pain symptoms during consultation for another reason . in some cases ,
pain symptoms were disclosed only after specific questioning . nevertheless , the 25-hydroxyvitamin d values found mirror the low values reported in cohorts defined on the basis of pain as a chief complaint , suggesting that 25-hydroxyvitamin d may play a role in the pathophysiology of diseases typically classified as sleep disorders .
one possibility is that chronic nonspecific musculoskeletal pain contributes to subjective sleep disturbances and/or a magnification of perceived daytime impairment , and both symptoms frequently lead to specialist evaluation for a suspected sleep disorder .
vitamin d deficiency has the biologic potential to contribute mechanistically to obstructive sleep apnea via myopathy,16 facilitating development of chronic rhinitis,7,8 or contributing to tonsillar hypertrophy.10 in our cohort , mean 25-hydroxyvitamin d values were not significantly different between those with and without obstructive sleep apnea ( p = 0.17 ) , and the risk factors identified for vitamin d deficiency were generally valid for both groups ( table 4 ) . we have previously described a patient presenting with a syndrome clinically indistinguishable from idiopathic central nervous system hypersomnia whose excessive daytime sleepiness symptoms resolved following treatment of severe vitamin d deficiency,17 and we have also recently reported a relationship between epworth sleepiness scale scores and 25-hydroxyvitamin d levels.18 taken together , the evidence supports the notion that the presence of nonspecific pain in a patient with a suspected sleep disorder may be predictive of vitamin d deficiency , a problem which could act as a cofactor for perceived symptoms of a broad array of sleep disorders . although the present evidence does not warrant routine testing of all sleep clinic patients for vitamin d deficiency , a biomarker that reliably predicts vitamin d deficiency might form a useful basis for selecting patients for testing , ultimately leading to improved diagnosis and treatment . in the present study , the vitamin d status of a considerable number of our patients ( vitamin d deficiency present or absent ) was correctly identified based solely on standard demographic data ( figure 2 ) .
the presence or absence of obstructive sleep apnea did not appreciably alter the predictive value of the biomarker ( table 4 ) .
an unexpected finding in this cohort was that younger age appeared to confer a higher risk for vitamin d deficiency .
typically , older age is associated with decreased ability of the skin to produce active vitamin d. our current data do not provide a satisfactory explanation for this paradox .
age - dependent sun exposure habits , use of supplements , and use of medications ( such as anticonvulsants or steroids ) are known to decrease circulating 25-hydroxyvitamin d , and may be responsible .
it is also possible that the nonspecific physical symptoms associated with vitamin d deficiency prompt younger patients to seek specialist care for sleep disorders .
it might be argued that a potential limitation of this study was the absence of a control group without chronic nonspecific musculoskeletal pain . because our main purpose was to compare our cohort with a healthy adult population and with populations formed on the basis of musculoskeletal pain as a chief complaint
, we consider that use of historical controls was reasonable and clinically relevant for comparison purposes . notwithstanding the putative limitation of historical control groups , the consistency and size of the observed differences ( table 2 )
the reliability of this inference is further supported by our finding that two risk factors strongly associated with vitamin d deficiency , ie , race and obesity , were also associated with vitamin d deficiency in the cohort ( table 2 ) .
sleep clinic patients who incidentally disclosed chronic nonspecific musculoskeletal pain during specialist evaluation at our sleep medicine clinic had significantly lower serum levels of 25-hydroxyvitamin d and a higher prevalence of vitamin d deficiency than historical controls without pain , and had 25-hydroxyvitamin d levels and vitamin d deficiency rates similar to patient groups defined on the basis of chronic pain as a presenting complaint .
the likelihood of vitamin d deficiency in this cohort was estimated reliably using a biomarker derived from common demographic data . | backgroundthe purpose of this cross - sectional study was to test the hypothesis that serum vitamin d levels are abnormally low in sleep clinic patients admitting to chronic nonspecific musculoskeletal pain and to assess the associated risk factors .
a secondary purpose was to identify a clinical biomarker for vitamin d deficiency.methodswe enrolled 153 consecutive patients who admitted to the presence of chronic nonspecific musculoskeletal pain during a comprehensive sleep evaluation at a specialist sleep medicine clinic within an academic center .
venous blood sampling was performed for determination of serum 25-hydroxyvitamin d. risk factors for vitamin d deficiency ( 25-hydroxyvitamin d < 20 ng / ml ) were identified by odds ratios .
receiver - operating characteristic curve analysis was performed with 10-fold cross - validation to identify a biomarker for vitamin d deficiency calculated by linear discriminant analysis.resultsthe mean serum 25-hydroxyvitamin d level was 19.8 11.1 , with 54% of the study population having vitamin d deficiency .
this mean 25-hydroxyvitamin d level was lower than that observed historically in healthy controls , and was either similar or lower than in all but one representative historical cohort formed on the basis of chronic nonspecific musculoskeletal pain .
risk factors for vitamin d deficiency were black ethnicity , age < 60 years , and obesity .
these risk factors were identified both in the entire cohort and separately in subgroups with and without obstructive sleep apnea .
the biomarker ( based on race , age , and body mass index ) had a sensitivity and specificity for predicting vitamin d deficiency of 0.73 and 0.74 , respectively.conclusionvitamin d deficiency was prevalent in patients with sleep disorders and chronic nonspecific musculoskeletal pain on evaluation in a sleep medicine clinic .
vitamin d deficiency was reliably estimated in the study population using a biomarker derived from common demographic characteristics . |
in 2011 , the prevalence in the us of end - stage renal disease ( esrd ) was 507,326 , and there were 88,931 deaths attributable to esrd.1 medicare costs for esrd were $ 34.3 billion in 2011 , accounting for over 6% of the total medicare budget . on january 1 , 2011 , medicare enacted an esrd bundled prospective payment system for reimbursing dialysis units . through this payment bundle ,
medicare and beneficiaries paid approximately us$10 billion annually for dialysis services , 25% of which was due to medications used for the management of anemia.2 in 2010 , erythropoietin - alfa for the management of anemia in esrd was the highest - expenditure drug covered by medicare part b , accounting for us$2 billion in medicare expenditure.3 the most commonly prescribed medications for the management of anemia in esrd patients are the erythropoietin - stimulating agents ( esas ; epoetin - alfa and darbepoetin - alfa ) and intravenous ( iv ) iron supplements ( iron sucrose and sodium ferric gluconate complex ) .
erythropoietin produced by the kidneys stimulates bone marrow production of erythroid progenitor cells , which give rise to heme - iron carrying erythrocytes.4 as kidney function declines , renal production of erythropoietin also declines , and the prevalence of anemia increases .
consequently , esrd patients require recombinant esas in order to maintain adequate hemoglobin levels.57 iron plays a crucial role in the synthesis of heme and is embedded in the porphyrin rings of the hemoglobin molecule .
patients with advanced stages of renal disease are susceptible to iron deficiency , primarily due to inadequate gastrointestinal absorption of iron , blood loss , chronic inflammation , and iron utilization for erythropoiesis.8 as a result of this iron deficiency , iv iron supplementation is administered to maintain adequate hemoglobin levels .
the international society of nephrology s guidelines for the management of anemia in chronic kidney disease recommend the use of esas and iron supplements , albeit judiciously.9 for patients on dialysis , initiation of esa therapy may be considered when the hemoglobin level is between 9 and 10 g / dl .
undesired consequences of esa therapy include increased potential for thromboembolism and cardiovascular events , and high esa drug acquisition costs .
initiation of iron supplements in the management of anemia can reduce both the dose of esas required and the need for blood transfusions .
bone mineral disorders in advanced kidney disease also lead to hyperphosphatemia , vascular calcification , and increased mortality.10,11 phosphate binders are therefore administered to dialysis patients to reduce serum phosphate levels , thereby reducing the severity of hyperphosphatemia . in light of the multiple sequelae of esrd requiring the use of phosphate binders , esas , and iv iron , strategies are currently under development to minimize esa utilization , reduce national costs , decrease pill burden , and manage anemia and concurrent disease states in dialysis patients .
one such strategy is the development of ferric citrate coordination complex ( zenerex , keryx biopharmaceuticals , inc .
ferric citrate is a novel phosphate binder which also has the potential to reduce requirements for esas and iv iron supplementation .
a phase iii study of n=183 esrd patients compared ferric citrate to comparator groups in two phases : the first phase which compared ferric citrate to sevelamer or calcium acetate and the second phase which compared it with placebo ( unpublished , keryx biopharmaceuticals ; available from http : www.keryx.com ) .
patients treated with ferric citrate showed a phosphorus reduction from 5.2 to 4.9 mg / dl over 4 weeks , compared with an increase in the placebo - controlled comparator group from 5.3 to 7.2 mg / dl ( p<0.0001 ) .
transferrin saturation increased in the ferric citrate group from 31% to 39% over 52 weeks , while it remained largely unchanged in the comparator group , which used either sevelamer or calcium acetate as phosphate binders ( p<0.0001 ) .
ferric citrate use resulted in reduced iv iron usage by a median of 51.6% and reduced esa usage by a median of 27.1% over 52 weeks .
decline in hemoglobin level was lower in the ferric citrate arm ( 0.2 versus 0.6 , p=0.01 ) .
a phase ii randomized , placebo - controlled , double - blind , multicenter study of esrd patients receiving ferric citrate 3 g / day for 4 weeks demonstrated a change in serum phosphorus of 2.16 mg / dl , serum iron of 26.6 mg / dl , ferritin of 15.55 ng / ml , transferrin saturation of 8.19% , and hemoglobin of 0.56 g / dl.12 adverse effects in both studies were similar between groups and were gastrointestinal in nature , with no overall serious adverse events .
a meta - analysis of three clinical studies found a mean increase from baseline in serum ferritin of 44.98 ng / ml and mean transferrin saturation of 2.23% among n=265 patients treated with ferric citrate for 4 weeks.13 a study of cost savings associated with 2 months of ferric citrate use found reductions in esa dose of 500 units and in iron dose of 5.79 mg per dialysis session.14 based on the findings of these studies , ferric citrate has the potential to reduce costs of esas and iv iron by increasing iron and ferritin levels , thereby reducing esas and iv iron dose requirements .
ferric citrate is approved for anemia management in esrd in japan and is expected to be approved by the us food and drug administration ( fda ) on june 7 , 2014 as an oral treatment for hyperphosphatemia in chronic kidney disease . a cost - offset study from a managed - care perspective by mutell
et al demonstrated the potential for cost savings with the use of ferric citrate compared with other phosphate binders . in their study ,
monthly esa cost was projected to be reduced by 8.15% , and iv iron cost by 33.2%.15 a monte carlo simulation demonstrated a reduction of us$160 per month in overall dialysis cost per patient with the use of ferric citrate .
currently , the total potential health care cost savings on a national scale due to the use of ferric citrate in esrd are undetermined .
the purpose of this investigation was to model the projected us total annual costs of esas and iv iron for esrd , and the cost reduction for esas and iron for esrd , based on the use of ferric citrate as a phosphate binder agent .
we calculated per - patient - per - year ( pppy ) costs of esas and iron using red book ( truven health analytics new york , ny , usa ) values adjusted for the centers for medicare and medicaid services ( cms ) base rate utilization and actual 2011 utilization reported by cms .
monte carlo uncertainty analysis was employed to obtain median total annual cost of esas and iron , and projected cost savings of esas and iron when ferric citrate is used as a binder .
a recent report published by cms on costs of anemia - management drugs for hemodialysis ( hd ) patients provided mean per hd session doses for the esa drugs ( epogen and aranesp [ amgen inc . , ca , usa ] ) and iv iron drugs ( venofer [ american regent , inc .
, ny , usa ] and ferrlecit , [ sanofi us , bridgewater , nj , usa]).2 utilization costs of these four drugs were based on red book costs combined with cms base rate and actual usage in 2011 . regarding esas and cms base rates ,
epogen was used much more frequently than aranesp , with a calculated pppy cost of us$12,243 .
for aranesp , the calculated pppy cost was us$1,426 . for actual 2011 utilization , the pppy costs for epogen and aranesp were us$9,545 and us$543 . for iron ,
when applying the cms base rate to red book costs , venofer was used more frequently than ferrlecit , and had a calculated pppy cost of us$1,057 . on the other hand
. calculated pppy costs for venofer and ferrlecit based on actual 2011 utilization were us$1,148 and us$209 , respectively .
table 1 lists the sources of information used for determining utilization costs , and the resulting lower , middle , and upper cost boundaries .
monte carlo analysis was employed for folding together 15,000 random draws of quantiles from probability distributions simulated to represent uncertainty of the various inputs .
the annual total cost model was based on the relationship
ycost=(xesa+xfe)x#hd,(1 ) where ycost is the projected annual cost determined from the sum of randomly sampled quantiles ( x - values ) of esa and iv iron pppy costs , multiplied by a random quantile for the number of patients undergoing hd per year ( see table 1 for quantile x notation ) .
the total cost model was only used twice : once for the total annual cost based on the cms base rate , and once for the total annual cost based on the 2011 actual utilization reported by cms .
likewise , the annual cost - reduction model determined the fraction of pppy esa and iv iron cost saved by applying reduction factors which represented the assumed proportional reduction in esa and iv iron usage as a result of using ferric citrate . the cost - reduction model for ferric citrate usage
was functionally composed as
yreduction=(xesaxrf1+xfexrf2)x#hd,(2 ) where yreduction is the projected annual cost reduction due to assumed fractional reduction arising from the use of ferric citrate .
assuming ferric citrate usage reduces esa and iv iron required for therapy , we employed the cost - reduction model ( equation 2 ) using nine combinations of reduction values of 0.10 , 0.20 , and 0.30 for esas and 0.30 , 0.40 , and 0.50 for iron .
these reduction values were midpoints ( modes ) of the triangle distributions listed in table 1 .
the point estimate of the outcome for annual cost or annual cost reduction was taken to be the median value of y with subjective confidence intervals based on the 20th and 80th percentiles .
adjusted annual costs were based on subtracting the cost reduction and its confidence limits from the total cost and its confidence interval .
monte carlo analyses were run for cms base rates and actual 2011 utilization of esas and iv iron reported by cms .
two tables with nine combinations of reduction factors were generated for each source of costs ( base rate and actual usage in 2011 ) .
a second set of tables was constructed containing the adjusted total annual costs based on subtracting the nine values of cost reductions from the single total annual cost for base rate and actual usage in 2011 and its subjective confidence intervals .
the effect of correlation between esas and iv iron was assessed for both the total cost and cost - reduction models assuming only the cms base rate .
sensitivity analysis was performed for only the total cost model when esa and iv iron input distributions were based on the cms base rate .
sensitivity was determined by regressing all 15,000 realizations of output total cost on quantiles for esa pppy cost , iv iron pppy cost , and number of patients undergoing dialysis per year , and by estimating the partial coefficient of determination for each input variable .
the percentage of variance in total cost explained by each input variable is reflected by the partial coefficient of determination .
a recent report published by cms on costs of anemia - management drugs for hemodialysis ( hd ) patients provided mean per hd session doses for the esa drugs ( epogen and aranesp [ amgen inc . , ca , usa ] ) and iv iron drugs ( venofer [ american regent , inc .
, ny , usa ] and ferrlecit , [ sanofi us , bridgewater , nj , usa]).2 utilization costs of these four drugs were based on red book costs combined with cms base rate and actual usage in 2011 . regarding esas and cms base rates ,
epogen was used much more frequently than aranesp , with a calculated pppy cost of us$12,243 .
for aranesp , the calculated pppy cost was us$1,426 . for actual 2011 utilization , the pppy costs for epogen and aranesp were us$9,545 and us$543 . for iron ,
when applying the cms base rate to red book costs , venofer was used more frequently than ferrlecit , and had a calculated pppy cost of us$1,057 . on the other hand
. calculated pppy costs for venofer and ferrlecit based on actual 2011 utilization were us$1,148 and us$209 , respectively .
table 1 lists the sources of information used for determining utilization costs , and the resulting lower , middle , and upper cost boundaries .
monte carlo analysis was employed for folding together 15,000 random draws of quantiles from probability distributions simulated to represent uncertainty of the various inputs .
the annual total cost model was based on the relationship
ycost=(xesa+xfe)x#hd,(1 ) where ycost is the projected annual cost determined from the sum of randomly sampled quantiles ( x - values ) of esa and iv iron pppy costs , multiplied by a random quantile for the number of patients undergoing hd per year ( see table 1 for quantile x notation ) .
the total cost model was only used twice : once for the total annual cost based on the cms base rate , and once for the total annual cost based on the 2011 actual utilization reported by cms .
likewise , the annual cost - reduction model determined the fraction of pppy esa and iv iron cost saved by applying reduction factors which represented the assumed proportional reduction in esa and iv iron usage as a result of using ferric citrate . the cost - reduction model for ferric citrate usage
was functionally composed as
yreduction=(xesaxrf1+xfexrf2)x#hd,(2 ) where yreduction is the projected annual cost reduction due to assumed fractional reduction arising from the use of ferric citrate .
assuming ferric citrate usage reduces esa and iv iron required for therapy , we employed the cost - reduction model ( equation 2 ) using nine combinations of reduction values of 0.10 , 0.20 , and 0.30 for esas and 0.30 , 0.40 , and 0.50 for iron .
these reduction values were midpoints ( modes ) of the triangle distributions listed in table 1 .
the point estimate of the outcome for annual cost or annual cost reduction was taken to be the median value of y with subjective confidence intervals based on the 20th and 80th percentiles .
adjusted annual costs were based on subtracting the cost reduction and its confidence limits from the total cost and its confidence interval .
monte carlo analyses were run for cms base rates and actual 2011 utilization of esas and iv iron reported by cms .
two tables with nine combinations of reduction factors were generated for each source of costs ( base rate and actual usage in 2011 ) .
a second set of tables was constructed containing the adjusted total annual costs based on subtracting the nine values of cost reductions from the single total annual cost for base rate and actual usage in 2011 and its subjective confidence intervals .
the effect of correlation between esas and iv iron was assessed for both the total cost and cost - reduction models assuming only the cms base rate .
sensitivity analysis was performed for only the total cost model when esa and iv iron input distributions were based on the cms base rate .
sensitivity was determined by regressing all 15,000 realizations of output total cost on quantiles for esa pppy cost , iv iron pppy cost , and number of patients undergoing dialysis per year , and by estimating the partial coefficient of determination for each input variable . the percentage of variance in total cost explained by each input variable is reflected by the partial coefficient of determination .
figures 14 show the monte carlo input uncertainty distributions for esa and iron pppy costs .
figure 1 illustrates the uncertainty distribution for pppy esa cost ( usd ) based on cms base rate for which a triangular distribution was assumed , with a lower bound of us$1,426 , upper bound of us$13,467 , and mode of us$12,243 .
figure 2 shows the uncertainty distribution for pppy iv iron cost based on the cms base rate .
a triangular distribution was assumed , with a lower bound of us$432 , upper bound of us$1,162 , and mode of us$1,057 .
figure 3 provides the uncertainty distribution for an example reduction factor based on a triangular distribution , having a lower bound of 0.05 , upper bound of 0.15 , and mode of 0.1 .
figure 4 shows the uncertainty distribution for the number of patients undergoing dialysis per year , assuming a normal distribution , with mean of 500,000 and standard deviation of 50,000 .
figure 5 reveals the outcome from monte carlo analysis showing the distribution of total cost ( billion usd ) of esas and iv iron assuming base rate values and 500,000 patients per year without applying reductions for ferric citrate usage . as figure 5 illustrates , the annual total cost of esas and iv iron for dialysis patients , assuming the cms base rate values , determined by monte carlo analysis was 5.127 ( 3.6646.260 ) billion usd . for actual utilization in 2011 , however , the annual total cost of esas and iv iron was 3.981 ( 2.7804.930 ) billion usd ( data not shown ) .
table 2 lists the projected annual ferric citrate - based cost reductions for esas and iv iron , assuming cms base rates , which ranged from 0.578 to 1.604 billion usd . under the cms base rates ,
if ferric citrate usage resulted in a 20% reduction in esa usage and 40% reduction in iv iron usage , then the projected cost savings would be 1.089 ( 0.7961.346 ) billion usd ( table 2 ) .
this would result in a total cost change from 5.127 ( 3.6646.260 ) to 4.038 ( 2.8684.914 ) billion usd , equal to 21.2% ( table 3 ) .
table 4 lists ferric citrate - based projected cost reductions based on the 2011 actual utilization of esas and iv iron , for which the range was 0.4671.273 billion usd .
if ferric citrate reduced esa usage by 20% and iv iron usage by 40% , then under the actual utilization costs , the projected annual cost reduction would be 0.868 ( 0.6321.084 ) billion usd ( table 4 ) .
the total annual cost based on actual utilization would then be reduced from 3.981 ( 2.7804.930 ) to 3.113 ( 2.1483.845 ) billion usd , which equates to a 21.8% change ( table 5 ) .
figure 6 shows that when correlation between esas and iv iron is taken into consideration and ferric citrate assumingly reduces esa utilization by 20% and iv iron use by 40% , the quartiles of total cost and cost reduction increase slightly with increasing correlation in the range 1 to 1 .
analogously , figures 7 and 8 illustrate the standard deviation , skewness , and kurtosis of total cost and cost reduction , assuming ferric citrate reduces esa requirements by 20% and iv iron usage by 40% .
lastly , figure 9 shows the sensitivity of total cost ( equation 1 ) to esas , iv iron , and number of patients undergoing dialysis , assuming only the cms base rate in table 1 and no correlation between esas and iv iron .
the percentage variance explanation of total cost by esa , number of patients undergoing dialysis per year , and iv iron were 99% , 93.3% , and 24.8% , respectively .
the physiological effects of ferric citrate are multiple in that it reduces serum phosphorus levels while simultaneously increasing transferrin saturation .
previous literature has reported a reduction in esa dose requirements as a result of increased iron stores.16 in our investigation , we determined that cost reductions for esas and iv iron as a result of using ferric citrate as a phosphate binder suggest potentially large national cost savings .
the cost - offset analysis by mutell et al supports our findings of potential savings attributed to reduced esa and iv iron usage.15 the cms reported that actual utilization in 2011 was lower than the base rate and will likely result in future reductions in the base rate.2 a potential study bias may be that this would likely reduce overall costs of esa and iron cms reimbursement .
we also only considered the four anemia - management drugs epogen , aranesp , venofer , and ferrlecit , which were the only drugs reimbursed under the cms bundled prospective payment system that applied to the entire us .
our results would naturally not apply to institutions with contract pricing and different pppy costs .
nevertheless , if our assumptions hold , we believe that our results should reliably project reductions in esa and iron utilization cost savings for a majority of anemia - management programs in esrd .
ferric citrate is not yet approved for use in the us , so there are no national statistics for dosage and reimbursement , or cost history . hence , our cost - reduction model is based on the likely range of percentage reduction in esa and iv iron usage associated with ferric citrate usage .
there are presently no large - scale phase iii or iv investigations quantifying the reduction in esa dose as a result of ferric citrate use .
studies are also needed to determine the efficacy of ferric citrate in improving anemia via the oral route in patients with significant iron deficiency or long - standing iron deficiency .
our implementation of monte carlo analysis has the advantage of providing the uncertainty distribution of the final outcome costs .
it is inappropriate to multiply central mean values of factors together to determine the sum product of independent factors for cost benefit analysis because no information is provided regarding distributional properties of cost and associated confidence intervals .
monte carlo analysis generates thousands of realizations based on random draws from input probability distributions , which are input into the model equation during each iteration .
this approach builds a subjective empirical probability distribution for the model s outcome , along with the uncertainty from which lower and upper confidence intervals are obtained .
we used the median of each outcome distribution as the central estimate of cost , and the 20th percentile for the lower bound and the 80th percentile for the upper bound of the confidence limit .
it is well known that dependence between input factors affects the width of the outcome uncertainty during monte carlo analysis . by varying correlation between esas and iv iron
, we observed that the standard deviation , skewness , and kurtosis of model outcome were affected more than the median and confidence intervals , so our results corroborate the correlation
response relationship between esas and iv iron , we provide a combination of reductions in the usage of esas and iv iron arising from ferric citrate usage , so that the reader can identify an estimate of the likely cost reduction .
overall , it was observed that the medians of cost and cost reduction were not strongly influenced by esa
the sensitivity analysis results suggest that the majority of variance in total cost depends mostly on esa pppy and the number of patients undergoing dialysis per year .
iv iron pppy costs had a much lower contribution to the variance of total cost .
sensitivity is based on the squared partial correlation between outcome total costs and each individual input factor , assuming the other inputs are held constant .
the additional post hoc evaluation regarding sensitivity reveals another advantage of monte carlo analysis , since straightforward use of mean values to determine cost savings is much less informative .
future studies are needed to further quantify the benefit of ferric citrate usage in terms of cost reduction of anemia management for patients with esrd .
it is likely that us health care costs for anemia - management drugs associated with esrd among dialysis patients can be reduced by using ferric citrate as a phosphate binder . at present , however , fda approval of ferric citrate is pending ( target date june 7 , 2014 , http://www.keryx.com ) , and therefore , there are no phase iv post - marketing data to confirm cost - savings of esas and iv iron during esrd anemia management as a result of using ferric citrate . in the absence of phase iv post - marketing data , we performed monte carlo uncertainty analysis to gain insight into possible cost reductions arising from use of ferric citrate .
our results indicate that , if ferric citrate usage results in a 20% reduction in esa usage and 40% reduction in iv iron usage , then 0.91.1 billion usd can be saved by using ferric citrate as a phosphate binder among esrd patients . | backgroundferric citrate is a novel phosphate binder which has the potential to reduce usage of erythropoietin - stimulating agents ( esas ) and intravenous ( iv ) iron used for anemia management during hemodialysis ( hd ) among patients with end - stage renal disease ( esrd ) .
currently , the potential health care cost savings on a national scale due to the use of ferric citrate in esrd are undetermined.methodsper-patient-per-year costs of esas ( epogen and aranesp [ amgen inc . , ca , usa ] ) and iv iron ( venofer [ american regent , inc .
, ny , usa ] and ferrlecit [ sanofi us , bridgewater , nj , usa ] ) were based on red book ( truven health analytics new york , ny , usa ) costs combined with the centers for medicare and medicaid services ( cms ) base rate and actual usage in 2011 for the four drugs . the annual number of outpatients undergoing hd in the us was based on frequencies reported by the usrds ( united states renal data system ) .
monte carlo uncertainty analysis was performed to determine total annual costs and cost reduction based on ferric citrate usage.resultstotal annual cost of esas and iv iron for anemia management in esrd determined by monte carlo analysis assuming cms base rate value was 5.127 ( 3.6646.260 ) billion usd . for actual utilization in 2011 , total annual cost of esas and iv iron was 3.981 ( 2.7804.930 ) billion usd .
if ferric citrate usage reduced esa utilization by 20% and iv iron by 40% , then total cost would be reduced by 21.2% to 4.038 ( 2.8684.914 ) billion usd for the cms base rate , and by 21.8% to 3.111 ( 2.1483.845 ) billion usd , based on 2011 actual utilization.conclusionit is likely that us health care costs for anemia - management drugs associated with esrd among hd patients can be reduced by using ferric citrate as a phosphate binder . |
psychogenic polydipsia ( ppd ) , a clinical disorder characterized by polyuria and polydipsia , is defined by hyponatremia found in 10 - 20% of those presenting with compulsive drinking .
symptoms are not typically seen until the patient reaches their limit of maximal urine dilution ( 100 mosmol / kg with minimum urine osmolality ) .
once this point of water intoxication has been reached , the symptoms generally exhibited are confusion , lethargy , psychosis , cerebral edema , increased intracranial pressure ( icp ) , seizures or death .
polydipsia occurs frequently among chronic psychiatric patients , particularly those with schizophrenia . even though this phenomenon was noted three quarters of a century ago ,
meq / l ) is one of the most common electrolyte abnormalities in hospitalized patients , and therefore may be overlooked on presentation to the emergency department ( ed ) . while acute hyponatremia ( < 48 hours ) is generally hospital - acquired , chronic hyponatremia ( > 48 hours ) usually develops outside the hospital and is generally better tolerated . the clinical distinction between acute and chronic hyponatremia
, however arbitrarily defined , is crucial with regard to the optimal management of the hyponatremic patient . in the chronically hyponatremic patient
, the brain has adapted to hypo - osmolar conditions ; while in the acute hyponatremic , adaptation to osmotic swelling has not yet been completed .
the latter is most notably the case with self - induced water intoxication or ppd .
multiple factors contribute to the lack of clinical information available to make informed clinical diagnoses in these patients . with a psychiatric history ,
many times these patients are unable to give a reliable medical history , and may present obtunded or with diminished cerebral function due to the hyponatremia .
herein , we describe a case of a man who was found down after a presumed fall .
he was initially treated as a trauma patient and was noted to have severe hyponatremia associated with cerebral edema .
he underwent a surgical ventriculostomy for cerebrospinal fluid ( csf ) drainage for icp control .
although at the time of ventriculostomy the etiology of his elevated icp was not known , his condition warranted csf draining .
herein , we describe this interesting case of ppd resulting in cerebral edema severe enough to clinically require ventriculostomy placement for icp treatment .
a 47-year - old man with a history of schizophrenia presented to our ed after a fall from standing , followed by a change in mental status .
the patient was admitted to the trauma service with concern for a possible traumatic brain injury due to a history of fall with subsequent onset of mental status changes and seizure . on examination ,
his pupils were 3 mm and sluggishly reactive bilaterally , with a downward gaze preference .
corneal reflexes were absent , occulocephalic reflexes were suppressed ; however , a gag reflex was present .
routine laboratories revealed hyponatremia ( 107 mmol / l , normal 135 - 146 ) and hypochloremia ( 76 mmol / l , normal 98 - 109 ) .
he had a low serum osmolarity ( 230 mosmol / kg , normal 275 - 295 ) and urine sodium ( 10 mmol / l , normal 50 - 150 ) which supported a diagnosis of hypervolemic hyponatremia . a non - contrast ct scan of his head showed loss of gray - white differentiation and sulcal effacement , consistent with cerebral edema . given his poor neurological examination , abnormal cranial nerve function , gcs upon arrival , among various other factors , there was concern for intracranial hypertension associated with the cerebral edema .
a ventriculostomy was placed to allow for measurement of icp and treatment via csf drainage .
opening pressure was elevated ( 35 cm h20 , normal < 20 cm h20 ) . in the first 48 hours , 270 cc drained out of the ventriculostomy to maintain an icp below 15 cm h20 .
the drainage slowly tapered off with maintenance of normalized icp until the catheter was discontinued 8 days after admission .
the sodium level was corrected over the first 5 days of admission with a combination of fluid restriction and hypertonic saline .
after a detailed history was obtained from the family , it was discovered that the patient consistently consumed greater than 8 l of diet cola daily .
he had been diagnosed with schizophrenia in his 20 's after a psychotic break and had been treated with several medications with varying success , including haldol and fluoxetine .
the patient was seen by psychiatry and was diagnosed with ppd . within 2 weeks of presentation , the patient returned to a normal motor exam and was awake , alert and oriented to person , place and time .
polydipsia is a problem for 6 - 20% of psychiatric patients , but more common among those with chronic schizophrenia .
water intoxication leading to hyponatremia can result from both psychogenic and environmental fators . while hyponatremia is defined as plasma sodium levels below 135 mmol / l
, symptoms such as lethargy , restlessness and disorientation do not typically develop until plasma levels fall to the range of 115 - 120
severe hyponatremia can result in seizures , coma , permanent brain damage , respiratory arrest , brain stem herniation and possibly death .
polydipsic schizophrenics demonstrate both arginine vasopressin - dependent and independent defects in renal water excretion .
symptoms rarely occur unless the patient drinks excessively ( > 10 l per day ) after they reach their maximum urine dilution ( 100 mosm / kg with minimum osmolality ) and full antidiuretic hormone suppression .
the renal excretory capacity is 12 l per day . in our patient , treating the cerebral edema required correction of the hyponatremia .
controlled osmolar therapy was imperative to prevent over correction and central pontine myelinosis . however , fluid restriction , diuretics and hypertonic saline , in a controlled fashion were too limited in their ability to decrease icp while only slowly correcting the hyponatremia .
a clinical decision was made to perform a ventriculostomy and drain csf to control the icp .
this was done per brain trauma foundation guidelines given his low gcs and evidence of cerebral edema on head ct . while hyponatremia is associated with cerebral edema , the ability of hyponatremia - induced cerebral edema to increase icp is not well - characterized .
based on the clinical severity of our patient 's cerebral edema , he underwent early treatment with a ventriculostomy .
his icp was elevated and he required drainage of a significant amount of csf during the first two hospital days in order to maintain an appropriate icp . in this
setting of voluntary water intoxication , there have not been any cases , to our knowledge , that reported the need for external ventricular drainage in the management of the increased icp associated with hyponatremia .
ppd is a known cause of hypervolemic hyponatremia . in the acute setting , severe hyponatremia has been reported to cause elevated icp and even signs of herniation . in the absence of an accurate history , patients with water intoxication may present in a manner consistent with that of a trauma patient . while there have not been any cases to our knowledge that reported using an external ventricular drain in the management of the increased icp associated with hyponatremia , in this case it proved to be a successful treatment modality for a patient with elevated icp secondary to acute water intoxication . | psychogenic polydipsia , in its most severe form , can lead to acute water intoxication by way of extreme hyponatremia .
this results in cerebral edema , mental status deterioration and can lead to life threatening intracranial hypertension if not identified and treated urgently .
however , this treatment rarely involves surgical intervention .
herein , we describe a 47-year - old man who presented to our emergency department who was found down with a decline in mental status and generalized tonic clonic seizures .
he was comatose with glasgow coma score of 5 .
his exam was notable for sluggishly reactive pupils , absence of corneal reflexes , decorticate posturing , and globally increased tone and hyper - reflexia with upgoing toes bilaterally . lab work revealed sodium of 107
mmol / l .
ct scan of the head showed global cerebral edema with sulcal effacement .
a ventriculostomy was placed with an opening pressure of 35-cm h2o , and cerebrospinal fluid was drained to maintain normal intracranial pressure .
fluid restriction and hypertonic saline were used to carefully correct the hyponatremia .
the patient improved and at day five was neurologically intact .
his history later revealed schizophrenia and a predilection for drinking greater than 8 l of diet cola daily . |
the increase in demand for poultry meat and eggs has necessitated the establishment of new farms and slaughter houses away from their original places of production , and consequently , a considerable increase in poultry transportation arises [ 1 , 2 ] . results obtained from an increasing body of research have convincingly demonstrated that the very act of handling , crating , loading , and transportation of poultry has adverse effects on the welfare , health , and productivity of birds [ 1 , 3 , 4 ] .
the establishment of a standard transport welfare animal order by many countries [ 5 , 6 ] and its strict compliance by transporters did not eliminate completely the welfare problems encountered in transported food animals . consequently , poultry farmers during transportation of birds still incur substantial economic loses [ 1 , 7 ] . in general , there is a paucity of information on the responses of point - of - lay pullets belonging to black harco breed to long distance road transportation , and the methods of alleviating road transportation stress in poultry in the tropics with classically hot climatic conditions .
although road transportation stress can not be eliminated completely in poultry , the applications of tranquilizers , electrolytes , and amino acids have been observed to alleviate the stress .
unfortunately , the residual effects of some of these drugs contravene legislative requirements for wholesome meat [ 5 , 8 , 9 ] .
the need to seek for reliable , cheaper , easily administered , readily available , and nontoxic prophylactic agents to combat the adverse effects of road transportation stress without any negative effect has become paramount .
ascorbic acid ( aa ) and vitamin e ( e ) are known to have immunomodulating effects .
they are used as therapeutic agents against many diseases , especially heat stress in humans [ 10 , 11 ] , poultry [ 2 , 12 , 13 ] , and other livestock [ 14 , 15 ] .
the ameliorating effects of the vitamins are well manifested when the body aa or e is either overwhelmed or exhausted as a result of many stress factors that overtax the animal control systems .
heterophil / lymphocyte ratio and survivability have been used as reliable welfare indices in evaluating the adaptability of animals to various stress factors [ 2 , 12 , 13 , 16 ] .
the aims of the present study were to investigate changes in blood parameters , liveweight loss , traumatic injury , and mortality encountered by black harco pullets during road transport and to suggest the use of antioxidant vitamins aa and e as an antistress .
three hundred and eighty ( 380 ) female pullets ( black harco strain ) obtained as day - old chicks were raised first in a brooding room and later in a standard deep litter poultry house till 18 weeks ' old .
they were fed certified standard feeds obtained from feed master ltd . , kaduna , nigeria , and water was provided ad libitum .
160 apparently healthy pullets of similar body weight ( 1.0 0.1 kg ) were selected randomly and partitioned separately from the rest birds within the same pen .
the birds were stocked at a rate of 0.25 m / bird from 12 weeks old .
after the journey , the pullets were unloaded into a standard deep litter poultry house partitioned into four chambers , which housed each group at a stocking rate of 0.25 m / bird . for each chamber ,
two drinking ( 0.5 m length 4 cm width each ) and feeding ( 0.5 m 10 cm each ) troughs were provided .
deep litter system of management and noncrating of the birds during the journey were adopted in order to reduce the stress due to confinement , and also in compliance with the new eu council directive 99/74/ec to phase out the conventional layer cages by year 2012 .
all necessary vaccinations , medications , and other related management practices were strictly adhered to as recommended by the national veterinary research institute ( nvri ) , jos , nigeria .
the meteorological conditions of the study area inside and outside the pens before the experiment and at the new site where the birds were transported to were recorded for one week before and after the journey at 06:00 , 13:00 , and 18:00 hours . during the journey period , the ambient temperature ( at ) and relative humidity ( rh ) were recorded both inside and outside of the vehicle .
the meteorological data were recorded with the aid of a wet- and dry - bulb thermometer ( brannan , england ) food was withdrawn from the birds 8 hours before the journey , while water was withdrawn two hours before the journey as suggested by metheringham and hubrecht . on transportation day , the birds were randomly divided by partitioning into four groups of 40 birds each .
each group of birds was identified by pasting an adhesive plaster on the wing of each bird .
birds in group i served as control pullets ( control ) and were administered orally 2 ml / kg body weight of drinking water .
group ii pullets ( aa ) were administered orally ascorbic acid ( aa ) at a dose of 60 mg / kg body weight [ 2 , 17 ] dissolved in sterile water .
group iii ( e ) pullets were administered orally vitamin e at a dose of 30 mg / kg body weight , while group iv ( aa + e ) pullets were administered orally a combination of aa and e at the aforementioned doses , respectively .
the administration of the vitamins and water was done by gentle feeding through the beak of each bird with minimal stress .
ten birds from each group were colour marked and quickly bled just before the administration of the vitamins and the process of loading to obtain baseline values .
thirty minutes after loading , and before the start of driving , another set of 10 birds from each group were bled to evaluate the stresses imposed by handling and loading procedures .
the 30 minutes lapse between preloading and postloading sampling was allowed because it takes 2030 minutes for cortisol concentration to peak in circulation after imposing a stressor .
thereafter , no further blood sampling was done on these groups of birds again . immediately after the journey when the birds was unloaded another set of 10 birds from each group
three hours posttransportation , the remainig 10 birds from each group that were not bled before were bled .
finally , three days posttransportation period , 10 birds were selected randomly from each group and bled .
this design was adopted in order to eliminate carrying - over effect of repeated handling and blood sampling of the same birds .
the vehicle used for the journey was a modified bedford bus ( made in england ) with an internal floor dimension of 4 1.2 m. the vehicle had four windows made of louvers on both side and two from the rear side of the vehicle .
the windows ( 50 35 cm each ) were located 800 cm from the floor level of the bus which regulated and provided adequate ventilation .
the top roof of the bus was made up of a metal roof stock - pilled with heat absorbable foam materials from the inside and covered with a thick polythene ceiling .
the floor was made up of metal and was covered with rough chopped saw dust , and a thick locally woven nonslippery rubber mat was placed on top .
each chamber was stocked with 160 pullets consisting of 40 birds selected from each group .
this arrangement was done in order to provide a similar condition for all the birds during the journey .
the vehicle travelled on a tarred road for 8 hours , covering a distance of 360 km at an average speed of 45 km / h .
about two drops of blood was collected from the wing vein of each bird as quickly as possible . from each sample
, two blood smears were made on microscopic slides immediately after the blood was collected .
the blood smears were dried and stained with camco quick stain ii , buffered differential wright giemsa stain ( bayer corp .
heterophil : lymphocyte ( h / l ) ratios were determined by using a 100/1.25 oil immersion objective , and 100 cells per slide were counted using the straight edge method .
the number of heterophils was divided by the total number of lymphocytes to obtain the h / l ratio .
detection of injuries was done as earlier described by smirnov et al . and minka and ayo .
briefly , during the loading and unloading of the bird , each bird was quickly examined physically by palpation and raising the feathers with one hand against the direction of the feathers which paved way to examine the underlying skin for any injury or abnormality .
birds that sustained conspicuous injuries during the journey were calmly restrained and the injured areas were cleaned with cotton wool soaked with an antiseptic , after which an adhesive plaster marked with the nature of injury was pasted on the injured site .
injuries recorded were defined as described by shakalov et al . and their locations and severity categorized as severe ( fracture , dislocation , and wounds ) , mild ( contusions , abrasion , and laceration ) , and no injury at all .
the number of pullets found dead before , during and after transportation period was recorded .
the body weight of 20 birds from each group was recorded before , immediately after and three days posttransportation .
the liveweight was recorded using a digital weight scale ( phillip harris , england ) .
the handling , loading and transportation of the pullets were done humanely as recommended by the animal transport welfare order and the code for practice for the land transport of poultry [ 6 , 25 ] .
the results were expressed as mean s.e.m , and analysis of variance was used to separate means and result comparison to give an indication of any differences between the groups of the pullets . values of p < .05 were considered significant .
the at values recorded outside the pen before and posttransportation were significantly ( p < .05 ) higher than the corresponding values recorded inside the pen .
there were no significant ( p > .05 ) differences in the at values before and three days posttransportation at the new site .
the mean at and rh recorded inside the vehicle during the journey were significantly ( p < .05 ) higher than the corresponding values recorded outside the vehicle .
mortality of 20% was recorded in control pullets , 0% in pullets administered aa , 2.5% in e , and 5% in pullets administered aa + e. the overall percent mortality in control pullets was higher ( p < .05 ) than the values recorded for aa , e , and aa + e pullets ( table 2 ) .
80% of the mortality which occurred in the control pullets was without any signs of injury , while 20% had different types of injuries .
the pretransport h / l ratios in all the pullets were not different ( p > .05 ) from one another .
the h / l ratio obtained in aa pullets 30 minutes after loading just before the start of the journey was not different ( p > .05 ) from the pre - loading value . in control , e , and aa+e pullets the post - loading h / l ratios were significantly ( p < .05 ) higher than the pre - transport and corresponding post - transport h / l ratio values recorded in aa pullets .
the h / l ratio obtained immediately and three hours posttransportation period in aa , e and aa + e pullets were not statistically different ( p > .05 ) between the groups , but the values were significantly lower ( p < .05 ) than those recorded in control pullets .
three days posttransportation , the h / l ratio in control pullets was not statistically different ( p > .05 ) from the value recorded from pullets administered aa , e , or aa + e , and also from the corresponding pre - transport values .
the percent number of injured birds , and severity and distribution of the injuries according to affected body parts are shown in table 3 .
there was no significant difference in the values of injuries recorded in control , aa , e , and aa + e pullets . in the overall , more injuries were sustained on the head and neck regions than any other part of the body .
the most common type of injury sustained by the pullets in all the groups was mild ( lacerations ) .
the liveweights of the pullets immediately after the journey were lower than the pre - transport values in all the groups . however , in control , e , and aa + e pullets , the percent liveweight loss was significantly ( p < .05 ) higher than the corresponding posttransportation value recorded for aa pullets .
three days posttransportation period , only aa pullets regained their pre - transportation liveweight values ( table 4 ) .
the meteorological data recorded during the study period , especially during the afternoon hours of the day inside and outside the poultry house and in the vehicle during the journey period were outside the thermoneutral zone of 22.0 to 28.5c , established for chickens predominantly reared in the tropics .
the wide fluctuation in at and rh occurring during the day , especially during the journey period , when other transportation stress factors acted concomitantly on the pullets , aggravated the adverse effects of road transportation on the pullets .
studies have shown that it is not only excessively high temperatures that affect birds , but , also the fluctuations of the at and rh [ 5 , 27 ] . the meteorological result obtained in the present study did not favour transportation of the pullets .
the significant ( p < .01 ) increase in h / l ratio recorded in control pullets immediately after , three hours , and three days posttransportation period showed that the immune system of the birds were compromised as a result of transportation stress up to the third day posttransportation .
the increase in h / l ratio obtained in the present study agrees with the findings of several studies which demonstrated that stress conditions , especially thermal stress , decrease both humoral and cellular immune responses [ 16 , 23 , 28 ] , resulting into increase in h / l ratio .
furthermore , the lower h / l ratio obtained 30 minutes after loading , just before the start of the journey in aa pullets showed , for the first time , that aa abolished the stresses induced by handling and loading of pullets . handling and loading of livestock are more stressful to transported birds than the journey itself .
the h / l ratio has been accepted as the most reliable index for determining long - term effect of various stressors in poultry [ 2 , 4 , 30 ] and other livestock [ 15 , 19 ] .
the lower values of h / l ratio recorded in pullets administered aa , e , and aa + e posttransportation suggested that the vitamins reduced or eliminated the adverse effect of road transportation stress on the immune system of the pullets . both aa and
e are known to be chain - breaking antioxidants , involved in the prevention and restriction of free radical chain formation and propagation , and consequently , protecting the blood cells from oxidative damage [ 3133 ] .
similarly , aa and vitamin e are shown to inhibit the release of corticosteroid , a hormone known to destroy immune cells [ 11 , 33 , 34 ] .
the 20% mortality recorded in control pullets compared to 0% , 2.5% , and 5% recorded in pullets administered aa , e and aa + e , respectively , showed that road transportation of pullets during the hot - dry period causes economic losses , especially in birds not administered with antioxidant vitamins .
similar economic loses due to road transport stress in broilers were reported in britain , where about 600,000 broilers died annually as a result of transportation to slaughter houses .
although the proximate cause of death in the present study was not investigated , it is suggestive that heat stress was responsible .
the present finding agreed with those of bayliss and hinton , who recorded 40% of deaths in transported broilers as a result of heat stress .
the low mortality recorded in pullets administered aa or e suggested that the mortality often encountered during road transportation could be reduced to minimum or eliminated completely by the administration of antioxidant vitamins prior to transportation .
this finding is of economic importance for poultry industries because the antioxidant vitamins used in the present study were nontoxic , relatively cheap , and readily available and do not have any residual effects even at higher doses .
the present results agree with those of hicks , gill et al . , and nockels , who showed that aa and vitamin e reduce the duration of sickness , percent of morbidity and mortality in animals .
the results of the injuries indicated that transportation was associated with injuries , some of which were responsible for transport mortality .
the number of birds found dead without any sign of injury was higher ( p < .05 ) than those with injuries , which indicated that heat stress was a major factor responsible for transport mortality in the pullets .
the higher ( p < .05 ) percentage of injuries located on the head and neck regions was as a result of fighting and pecking behaviours .
the results of injuries and fractures obtained in the present study were lower than those recorded in broilers by bayliss and hinton and metheringham and hubrecht , who reported that about 35% injuries been responsible for dead - on - arrival of broilers in slaughtering plants .
even though there was no significant ( p > .05 ) effect of antioxidant vitamins on injuries sustained , the higher values of injuries recorded in aa and e pullets may be as a result of increased excitation caused by the administration of the vitamins [ 14 , 17 ] , especially aa which might have increased the pecking and fighting behaviours of the birds .
the loss in liveweight posttransportation was as a result of prolong food and water deprivation , increased muscle depletion , and elimination of the gut content brought about by increase in excitation of the nervous system and also due to heavy water loss , probably caused by panting .
the insignificant weight loss and the restoration of the initial liveweight just 3 days posttransportation in aa pullets were evidence that aa reduces liveweight losses often encountered posttransportation period .
the overall result showed that the combination of aa and e had less ameliorating effect on the transported pullets compared to when aa was administered singly .
the present result contradicts the overwhelming evidence of the synergistic role of aa and e , and also the sparing effect of aa on vitamin e [ 11 , 17 , 33 ] .
, the administration of antioxidant vitamins aa , e , and aa + e , especially aa , alleviated the risk of adverse effects of road transportation stress in pullets during the hot - dry season . | the modulating effects of ascorbic acid ( aa ) , vitamin e ( e ) , and a combination of aa and e ( aa + e ) against eight - hour road transportation stress were investigated in 120 pullets during the hot - dry season .
the result obtained showed that handling , loading and transportation induced lymphopenia , neutrophilia , liveweight loss , and mortality , which was alleviated by oral administration of aa , e , and aa + e at doses of 60 mg , 30 mg , and 60 + 30 mg per kg bodyweight , respectively , 30 minutes before being loaded and transported .
the meteorological conditions recorded during the study period were higher ( p < .05 ) than the thermoneutral values established for chickens in the zone . in conclusion , the administration of vitamins aa , e , and aa + e , especially aa , ameliorated the risk of adverse effects of handling , loading , transportation , and thermal stress in pullets during the hot - dry season . |
photobiomodulation uses lowpower , highfluence light from lasers or leds in the red to nearinfrared range ( 6201,100 nm ) to modulate mitochondrial respiration in a nondestructive and nonthermal manner 1 , 2 .
transcranial laser stimulation of the brain with nearinfrared light is a novel form of photobiomodulation , also known as lowlevel light ( laser ) therapy ( lllt ) when applied to patients 1 , 2 , 3 . in recent years , transcranial laser stimulation has gained attention for its therapeutic potential in a variety of neurological and psychological conditions . it has been shown to be effective for treating ischemic stroke patients in a few controlled clinical trials 3 , 4 .
two studies by naeser et al . reported that daily use of nearinfrared light to the forehead improved cognitive functions in patients with chronic traumatic brain injuries 5 , 6 .
schiffer et al . also found that a single nearinfrared light treatment to the forehead using leds could have psychological benefits in ten patients with major depression and anxiety 7 . stimulating with the same 0.25 w / cm irradiance as schiffer et al .
7 , but using a laser with a longer wavelength ( 1,064 nm ) , barrett and gonzalezlima conducted the first controlled study in 40 healthy human participants and demonstrated that transcranial laser stimulation improves cognitive and emotional functions 8 . a subsequent controlled study by blanco et al . 9 also demonstrated that transcranial laser stimulation with 0.25 w / cm irradiance and 1,064nm laser improves executive functions in healthy human participants .
the mechanism of action of nearinfrared light rests on photon absorption by cytochrome oxidase 10 , which is the terminal enzyme in the mitochondrial respiratory chain that plays a key role in cerebral oxygen utilization for energy metabolism 1 , 2 .
the more the activity of cytochrome oxidase increases , the more oxygen consumption and metabolic energy is produced via mitochondrial oxidative phosphorylation 11 .
this photonicsbioenergetics mechanism results in metabolic and hemodynamic alterations in the brain that facilitate both neuroprotection and cognitive enhancement 12 , 13 . in 2012 , rojas et al .
14 were the first to report that nearinfrared light increased oxygen consumption in the rat prefrontal cortex in vivo .
however , most of the human studies have evaluated the effects of lowlevel laser therapy by observing the changes in behavioral and psychological measures and postulating the underlying neurophysiological mechanism that causes them . to date , only the study by schiffer et al .
7 has looked at the effects of nearinfrared leds on human cerebral hemodynamics by measuring the total hemoglobin changes with a cerebral oximeter .
functional nearinfrared spectroscopy ( fnirs ) 15 , 16 is an emerging neuroimaging technology that measures the changes in cerebral hemodynamics and oxygenation related to neuronal activities .
because both fnirs and transcranial laser stimulation use light in the nearinfrared range , they share similar optical pathways through the tissues .
thus , fnirs is a suitable tool for in vivo mechanistic study of transcranial laser stimulation .
furthermore , both transcranial laser stimulation and fnirs are safe , compact and easy to implement . a combination of these two noninvasive , nearinfrared technologies can potentially provide an effective treatmentwithimaging approach for neurological and psychological applications .
the present study used fnirs to quantitatively assess the neurophysiological effects of a single transcranial laser stimulation session on healthy human participants .
the irradiance of the 1,064nm laser was 0.25 w / cm , same as that used by schiffer et al .
a portable fnirs system was used to measure the changes in hemoglobin concentrations at the bilateral prefrontal cortices during and shortly after the laser stimulation .
healthy human participants of either sex , any ethnic background and in an age range of 1840 years old were recruited from the local community of the university of texas at arlington .
interested individuals were screened by one of the investigators to determine whether they were eligible for the study .
the exclusion criteria included : ( i ) being diagnosed with a psychiatric disorder , ( ii ) having history of a neurological condition , history of severe brain injury , history of violent behavior , ( iii ) ever being institutionalized / imprisoned , ( iv ) currently taking any medicine or currently pregnant .
eligible participants were scheduled for two separate experiments , which would be at least two weeks apart to reduce the chance of carryover effects from experiment i to experiment ii .
the experimental protocol was approved by the university of texas at arlington 's institutional review board ( irb ) .
singlesession transcranial laser stimulation was administered with a continuouswave , 1,064nm laser ( model cg5000 laser , cell gen therapeutics llc , dallas , tx ) .
this laser is fdacleared for various uses on humans such as relief of muscle and joint pain .
it has a handheld aperture with a button on the handle to open and shut the laser beam .
the laser was operated at a constant power of 3.4 w. thus , the irradiance ( or power density ) in the 13.6cm beam area was 3.4 w/13.6 cm = 0.25 w / cm , which was the same as that used in previous studies 8 , 9 . at this irradiance ,
exposure to the laser was not deemed harmful to the tissues . a portable , continuouswave fnirs system ( cw2 , techen inc . ,
milford , ma ) was used to measure the cerebral hemodynamic changes induced by the laser stimulation .
this system has two pairs of lasers as light sources , each pair having 690 nm and 830 nm light , and four avalanche photodiodes ( apds ) as detectors .
the lasers are amplitudemodulated at the khz range to reduce optical interference from ambient light .
lowweight optical fibers were used to transmit the light between the instrument and the participants ' heads .
the four fibers from the light sources were merged into two source optodes for this study .
two experiments were conducted separately to study the cerebral hemodynamic responses to the laser stimulation , by following the same stimulation paradigm 8 , 9 .
laser stimulation was applied to the center of the forehead , aimed at the medial frontal lobes bilaterally ( fig .
laser stimulation was applied to the right side of the forehead , aimed at the right lateral frontal lobe ( fig .
1b ) in the second experiment , as previously done to improve prefrontal functions 8 . in each experiment ,
an fnirs probe was placed bilaterally and symmetrically on the participants ' foreheads ( figs .
the probe consisted of two source optodes and two detector optodes , which provided two measurement channels , one channel per cerebral hemisphere ( figs .
after the probe was in place , the participants were instructed to sit stably on a chair .
after 1minute baseline readings of fnirs were taken , the transcranial laser stimulation was administered .
the stimulation session was divided into 10 oneminute cycles , 55second stimulation laser on and 5second stimulation laser off per cycle ( fig .
2 ) . hence radiant exposure ( or energy density ) was 0.25 w / cm 55 sec = 13.75 j / cm per cycle of stimulation . during each cycle ,
an experimenter held the cg5000 aperture closely towards the participants ' foreheads and pressed the button to shine the laser beam .
then a timer of 55 seconds on the frontal panel of the cg5000 apparatus started to count down and the laser beam was automatically shut at the end .
after all of the 10 stimulation cycles were completed , the participants were asked to keep still for another 6 minutes while the fnirs readings were continuously taken .
thus , the total data acquisition time of fnirs was 17 minutes by including the 1minute baseline , 10minute transcranial laser stimulation , and 6minute recovery ( fig .
positions of the transcranial laser stimulation and configuration of the functional nearinfrared spectroscopy ( fnirs ) probe in ( a ) experiment i , and ( b ) experiment ii . in each graph
, the pink circle indicates the approximate position where the treatment laser ( in 4.16cm diameter ) was shined on . the fnirs probe consisted of two measurement channels ( ch1 and ch2 ) , one channel over each cerebral hemisphere .
schematic diagram of the transcranial laser stimulation and functional nearinfrared spectroscopy ( fnirs ) data acquisition paradigm .
the laser stimulation session was divided into 10 oneminute cycles , 55second stimulation laser on and 5second stimulation laser off per cycle .
the fnirs data acquisition included 1minute baseline , 10minute laser stimulation , and 6minute recovery .
both experiments were conducted in a locked room with no reflective surfaces . a warning sign was hung on the outer door , indicating that the laser was in use . during the experiments ,
in addition , the participants were instructed to keep their eyes closed during laser stimulation .
the raw data from each participant was first visually inspected for significant discontinuities and interference . because the stimulation laser from the cg5000 had a much higher power ( = 3.4 w ) than the light sources in cw2 ( 10 mw ) , the data acquired during the 55second stimulation periods suffered from significant light interference ( see the subgraph of fig .
alternatively , the data during each 5second intercycle interval was selected and averaged to represent the corresponding stimulation cycle .
the data during the initial baseline and poststimulation recovery were also averaged at a step of 1 minute . in this way ,
a total of 17 averaged data points were derived from the raw data of each participant .
these data points were then used to calculate the changes of oxygenated hemoglobin concentration ( [hbo2 ] ) and deoxygenated hemoglobin concentration ( [hb ] ) relative to the initial baseline based on the modified beer lambert law 17 . in this step ,
the differential pathlength factor ( dpf ) was 6.8 at 690 nm and 5.8 at 830 nm 18 .
furthermore , changes in total hemoglobin concentration ( [hbt ] = [hbo2 ] + [hb ] ) and differential hemoglobin concentration ( [hbd ] = [hbo2 ] [hb ] ) were also calculated . while [hbt ] represents the changes of total blood volume in the tissues , [hbd ]
in particular , [hbd ] is proportional to sto2 when total hemoglobin concentration maintains constant , that is , [hbd ] = 2[hbt]constant sto2 . for each experiment ,
first , onesample ttests were used to examine the significance of hemodynamic changes from each channel .
the results from these tests would show if the singlesession transcranial laser stimulation induced any type of cerebral hemodynamic change as compared to the baseline ( zero ) .
second , paired ttests were used to examine the significance of differences between two measurement channels .
the results from these tests would show if there was any regional difference ( right vs. left hemisphere ) in laserstimulated cerebral hemodynamic changes .
healthy human participants of either sex , any ethnic background and in an age range of 1840 years old were recruited from the local community of the university of texas at arlington .
interested individuals were screened by one of the investigators to determine whether they were eligible for the study .
the exclusion criteria included : ( i ) being diagnosed with a psychiatric disorder , ( ii ) having history of a neurological condition , history of severe brain injury , history of violent behavior , ( iii ) ever being institutionalized / imprisoned , ( iv ) currently taking any medicine or currently pregnant .
eligible participants were scheduled for two separate experiments , which would be at least two weeks apart to reduce the chance of carryover effects from experiment i to experiment ii .
the experimental protocol was approved by the university of texas at arlington 's institutional review board ( irb ) .
singlesession transcranial laser stimulation was administered with a continuouswave , 1,064nm laser ( model cg5000 laser , cell gen therapeutics llc , dallas , tx ) .
this laser is fdacleared for various uses on humans such as relief of muscle and joint pain .
it has a handheld aperture with a button on the handle to open and shut the laser beam .
the laser was operated at a constant power of 3.4 w. thus , the irradiance ( or power density ) in the 13.6cm beam area was 3.4 w/13.6 cm = 0.25 w / cm , which was the same as that used in previous studies 8 , 9 . at this irradiance , the laser caused negligible heat and no physical damage .
exposure to the laser was not deemed harmful to the tissues . a portable , continuouswave fnirs system ( cw2 , techen inc . ,
milford , ma ) was used to measure the cerebral hemodynamic changes induced by the laser stimulation .
this system has two pairs of lasers as light sources , each pair having 690 nm and 830 nm light , and four avalanche photodiodes ( apds ) as detectors .
the lasers are amplitudemodulated at the khz range to reduce optical interference from ambient light .
lowweight optical fibers were used to transmit the light between the instrument and the participants ' heads .
the four fibers from the light sources were merged into two source optodes for this study .
two experiments were conducted separately to study the cerebral hemodynamic responses to the laser stimulation , by following the same stimulation paradigm 8 , 9 .
laser stimulation was applied to the center of the forehead , aimed at the medial frontal lobes bilaterally ( fig .
laser stimulation was applied to the right side of the forehead , aimed at the right lateral frontal lobe ( fig .
1b ) in the second experiment , as previously done to improve prefrontal functions 8 . in each experiment ,
an fnirs probe was placed bilaterally and symmetrically on the participants ' foreheads ( figs .
the probe consisted of two source optodes and two detector optodes , which provided two measurement channels , one channel per cerebral hemisphere ( figs .
after the probe was in place , the participants were instructed to sit stably on a chair .
after 1minute baseline readings of fnirs were taken , the transcranial laser stimulation was administered .
the stimulation session was divided into 10 oneminute cycles , 55second stimulation laser on and 5second stimulation laser off per cycle ( fig .
2 ) . hence radiant exposure ( or energy density ) was 0.25 w / cm 55 sec = 13.75 j / cm per cycle of stimulation . during each cycle , an experimenter held the cg5000 aperture closely towards the participants ' foreheads and pressed the button to shine the laser beam .
then a timer of 55 seconds on the frontal panel of the cg5000 apparatus started to count down and the laser beam was automatically shut at the end .
after all of the 10 stimulation cycles were completed , the participants were asked to keep still for another 6 minutes while the fnirs readings were continuously taken .
thus , the total data acquisition time of fnirs was 17 minutes by including the 1minute baseline , 10minute transcranial laser stimulation , and 6minute recovery ( fig .
positions of the transcranial laser stimulation and configuration of the functional nearinfrared spectroscopy ( fnirs ) probe in ( a ) experiment i , and ( b ) experiment ii . in each graph
, the pink circle indicates the approximate position where the treatment laser ( in 4.16cm diameter ) was shined on . the fnirs probe consisted of two measurement channels ( ch1 and ch2 ) , one channel over each cerebral hemisphere .
schematic diagram of the transcranial laser stimulation and functional nearinfrared spectroscopy ( fnirs ) data acquisition paradigm .
the laser stimulation session was divided into 10 oneminute cycles , 55second stimulation laser on and 5second stimulation laser off per cycle .
the fnirs data acquisition included 1minute baseline , 10minute laser stimulation , and 6minute recovery .
both experiments were conducted in a locked room with no reflective surfaces . a warning sign was hung on the outer door , indicating that the laser was in use . during the experiments ,
in addition , the participants were instructed to keep their eyes closed during laser stimulation .
the raw data from each participant was first visually inspected for significant discontinuities and interference . because the stimulation laser from the cg5000 had a much higher power ( = 3.4 w ) than the light sources in cw2 ( 10 mw ) , the data acquired during the 55second stimulation periods suffered from significant light interference ( see the subgraph of fig .
alternatively , the data during each 5second intercycle interval was selected and averaged to represent the corresponding stimulation cycle .
the data during the initial baseline and poststimulation recovery were also averaged at a step of 1 minute . in this way ,
a total of 17 averaged data points were derived from the raw data of each participant .
these data points were then used to calculate the changes of oxygenated hemoglobin concentration ( [hbo2 ] ) and deoxygenated hemoglobin concentration ( [hb ] ) relative to the initial baseline based on the modified beer lambert law 17 . in this step ,
the differential pathlength factor ( dpf ) was 6.8 at 690 nm and 5.8 at 830 nm 18 .
furthermore , changes in total hemoglobin concentration ( [hbt ] = [hbo2 ] + [hb ] ) and differential hemoglobin concentration ( [hbd ] = [hbo2 ] [hb ] ) were also calculated . while [hbt ] represents the changes of total blood volume in the tissues , [hbd ] is an indicator of changes in tissue oxygen saturation ( sto2 ) .
in particular , [hbd ] is proportional to sto2 when total hemoglobin concentration maintains constant , that is , [hbd ] = 2[hbt]constant sto2 .
first , onesample ttests were used to examine the significance of hemodynamic changes from each channel .
the results from these tests would show if the singlesession transcranial laser stimulation induced any type of cerebral hemodynamic change as compared to the baseline ( zero ) .
second , paired ttests were used to examine the significance of differences between two measurement channels .
the results from these tests would show if there was any regional difference ( right vs. left hemisphere ) in laserstimulated cerebral hemodynamic changes . a significance level of p < 0.01 was applied in both analyses .
nine participants ( five males and four females , age = 24.7 5.3 years ) were successfully measured in the first experiment .
nine participants ( five males and four females , age = 24.6 5.6 years ) were successfully measured in the second experiment ; six of them had participated in the first experiment previously . for those who participated in both experiments , the two experiments were spaced at least two weeks apart .
there was no significant difference in gender and age between the two groups of participants . in both experiments ,
transcranial laser stimulation induced an increase of oxygenated hemoglobin concentration and a decrease of deoxygenated hemoglobin concentration from the baseline in both cerebral hemispheres ( figs . 3 and 4 ) .
the total hemoglobin concentration remained nearly unchanged in most cases ( figs . 3 and 4 ) . the differential hemoglobin concentration demonstrated a robust increase associated with the laser stimulation ( figs . 3 and 4 ) , which was statistically significant in all the cases ( table 1 ) .
notably , all of the hemodynamic changes were sustained during the 6minute recovery , indicating the effects of transcranial laser stimulation persisted even after the laser was turned off .
prefrontal hemodynamic responses ( mean se ) in the first experiment : ( a ) hemodynamic changes in the right prefrontal cortex and ( b ) hemodynamic changes in the left prefrontal cortex .
prefrontal hemodynamic responses ( mean se ) in the second experiment : ( a ) hemodynamic changes in the right prefrontal cortex and ( b ) hemodynamic changes in the left prefrontal cortex .
cerebral hemodynamic changes induced by transcranial laser stimulation at the group level ( mean sd ) indicate statistically nonzero changes at the group level ( onesample ttest , p < 0.01 ) . for each participant and hemoglobin species ,
the data were averaged across all of the 16 nonbaseline time points . in both experiments ,
the right and left prefrontal cortices showed approximately the same amplitudes in hemodynamic changes . particularly for the second experiment , although the laser stimulation was administered on the right side , the hemodynamic changes induced by transcranial laser stimulation did not show any significant difference between the right and left hemispheres .
previous human studies have reported that nearinfrared light benefited the neuropsychological status of patients with stroke 3 , 4 , depression 7 , and brain trauma 4 , 10 .
in particular , placebocontrolled studies of transcranial laser stimulation , with the same laser device and stimulation parameters as those used in this study , improved cognitive and executive brain functions in healthy human participants 8 , 9 . despite these promising case studies and clinical trials ,
however , there was still a lack of understanding of the neurophysiological mechanism in vivo of transcranial laser stimulation . in this study
, we aimed to determine if transcranial laser stimulation alters the cerebral hemodynamic status in healthy human adults .
we used fnirs as a measurement tool because it has similar optical pathways through the tissues to transcranial laser stimulation .
four variables , namely the changes in oxygenated , deoxygenated , total and differential hemoglobin concentrations , were quantified to comprehensively describe the cerebral hemodynamics changes during and shortly after a single transcranial laser stimulation session that was aimed at two different locations of the frontal lobe .
our results showed that the transcranial laser stimulation induced reliable hemodynamic changes in the bilateral prefrontal cortices .
this observation is consistent with a previous study that used the same irradiance of stimulation light 7 .
we also observed an increase of oxygenated hemoglobin concentration and a decrease of deoxygenated hemoglobin concentration , which together led to a significant increase of differential hemoglobin concentration in all the cases ( two stimulation locations two cerebral hemispheres ) . because the total hemoglobin concentration was relatively unchanged in general
, we believe the significant increase of differential hemoglobin concentration indicates that transcranial laser stimulation elevated the tissue oxygenation saturation in the bilateral prefrontal cortices .
this conclusion is consistent with a previous animal study showing a direct increase in oxygen consumption measured invasively with an oxygen probe inside the rat prefrontal cortex during nearinfrared light stimulation 14 .
this lightstimulated oxygen consumption also led to upregulation of cytochrome oxidase activity in the rat prefrontal cortex and improved prefrontal cortexbased memory function 14 .
furthermore , a few studies on animal models 19 and human infants 20 , 21 have shown that the differential hemoglobin concentration correlated tightly with the change in regional cerebral blood flow ( rcbf ) . since a significant increase of differential hemoglobin concentration
was consistently observed in this study , it is very likely that the singlesession transcranial laser stimulation caused an increase of rcbf to the bilateral prefrontal cortices . in the future
this conjecture needs to be verified using techniques that measure rcbf directly , such as diffuse correlation spectroscopy ( dcs ) 22 .
previous fnirs studies of human brain functions have demonstrated that neuronal activations can induce an increase of oxygenated hemoglobin concentration and a decrease of deoxygenated hemoglobin concentration 23 , 24 , 25 through neurovascular coupling 26 , 27 , which describes the tight relationship between local neuronal activations and subsequent changes in rcbf to supply oxygen and nutrients to meet energy demand .
therefore the similar increase of oxygenated hemoglobin concentration and decrease of deoxygenated hemoglobin concentration observed in our results may suggest that this single transcranial laser stimulation session improves neuronal activities in the bilateral prefrontal cortices as well .
this scenario agrees with two previous studies 8 , 9 that reported the same laser irradiance to the forehead was able to improve prefrontal cortexbased cognitive and executive functions among healthy human participants . in both experiments ,
the right and left prefrontal cortices showed approximately the same amplitudes in hemodynamic changes . particularly for the second experiment , although the laser stimulation was administered on the right side , the evoked hemodynamic changes did not show any significant difference between the two sides .
a possible interpretation of this phenomenon relies on the fact that interhemispheric cortical regions are functionally connected by commissural axons in the corpus callosum 28 , 29 , 30 .
therefore , laserstimulated neuronal activations in one side of the prefrontal cortices could automatically trigger the neuronal activities on the other side , which subsequently resulted in the same amplitudes of hemodynamic changes on both sides .
another important matter for evaluating whether transcranial laser stimulation may serve as an effective neuroenhancement or clinical treatment is the duration of its effects . if the effects of transcranial laser stimulation were shortlasting , it would prove its limited use . in this study we used continuouswave fnirs to measure the relative changes of cerebral hemoglobin concentrations from an initial baseline ; the participants were instructed to keep their bodies stable during the measurements to ensure the fnirs data were reliable . for this reason we recorded for only a 6minute recovery following the treatment as it would be difficult for the participants to hold on for longer time .
the results showed that the effects of the treatment were persistent 6 minutes after the laser was turned off , much longer than the hemodynamic effects of transcranial magnetic stimulation that lasted for about only 1 minute according to our previous study 31 .
this may be because while the transcranial electrical or magnetic interventions alter the excitability of neurons directly , the action of transcranial laser stimulation may rest on photobiomodulation of intracellular metabolism and hemodynamic processes that increase brain tissue oxygenation .
these processes are slower than the excitability of neurons and linked to metabolic cascades , making the effects of transcranial laser stimulation sustained even after the laser was off . due to the limitation in continuouswave fnirs ,
for example , barrett and gonzalezlima 8 found a significant benefit as compared to the placebo group in positive and negative affective states in healthy volunteers two weeks after a single 8minute laser stimulation as described here .
7 reported psychological benefits at 2 and 4 weeks after a single treatment in patients with anxiety and depression .
light power density ( 0.25 w / cm ) and energy density ( 60 j / cm ) used in these two studies were the same , but schiffer et al .
6 used similar leds in patients with mild traumatic brain injury for 18 treatments ( three treatments per week for 6 weeks ) , and measured cognitive performance after one week , and 1 and 2 months after the 18th treatment .
they found a significant linear trend for the effect of led treatment over time for various cognitive tests .
while these pioneering studies are promising , there are no placebocontrolled human studies investigating longterm neuronal or cognitive effects after single or repeated transcranial laser treatments . in conclusion ,
nearinfrared laser stimulation applied to the forehead can transcranially improve cerebral oxygenation in healthy humans . | background and objectivetranscranial laser stimulation of the brain with nearinfrared light is a novel form of noninvasive photobiomodulation or lowlevel laser therapy ( lllt ) that has shown therapeutic potential in a variety of neurological and psychological conditions .
understanding of its neurophysiological effects is essential for mechanistic study and treatment evaluation .
this study investigated how transcranial laser stimulation influences cerebral hemodynamics and oxygenation in the human brain in vivo using functional nearinfrared spectroscopy ( fnirs).materials and methodstwo separate experiments were conducted in which 1,064nm laser stimulation was administered at ( 1 ) the center and ( 2 ) the right side of the forehead , respectively .
the laser emitted at a power of 3.4 w and in an area of 13.6 cm2 , corresponding to 0.25 w / cm2 irradiance .
stimulation duration was 10 minutes .
nine healthy male and female human participants of any ethnic background , in an age range of 1840 years old were included in each experiment.resultsin both experiments , transcranial laser stimulation induced an increase of oxygenated hemoglobin concentration ( [hbo2 ] ) and a decrease of deoxygenated hemoglobin concentration ( [hb ] ) in both cerebral hemispheres .
improvements in cerebral oxygenation were indicated by a significant increase of differential hemoglobin concentration ( [hbd ] = [hbo2 ] [hb ] ) .
these effects increased in a dosedependent manner over time during laser stimulation ( 10 minutes ) and persisted after laser stimulation ( 6 minutes ) .
the total hemoglobin concentration ( [hbt ] = [hbo2 ] + [hb ] ) remained nearly unchanged in most cases.conclusionnearinfrared laser stimulation applied to the forehead can transcranially improve cerebral oxygenation in healthy humans .
lasers surg .
med . 48:343349 , 2016 .
2016 the authors .
lasers in surgery and medicine published by wiley periodicals , inc . |
lentiviral vectors are promising gene transfer agents for ex vivo correction of inherited or acquired genetic defects .
hematopoietic disorders are well suited as targets for this approach , due to the relative ease with which these cells are harvested , transduced ex vivo with lentivirus , and reinfused into patients .
however , even with robust gene transfer efficiencies , the modified cells and their therapeutic potential are diluted upon reinfusion into the large population of endogenous , unmodified cells .
however , few inherited hematopoietic disorders , when genetically corrected , provide an inherent survival advantage at the hematopoietic stem cell level . to overcome this limitation , genes that permit selective expansion of transduced cells in vivo
several drug resistance genes have been assessed for in vivo stem cell selection [ 14 ] .
however , the most stringent in vivo stem cell selection results have been achieved with point mutants of o - methylguanine - dna methyltransferase ( mgmt ) [ 5 , 6 ] .
agt repairs o - alkylguanine dna lesions induced by methylating and chloroethylating agents , such as , temozolomide and 1,3-bis(2-chloroethyl)-nitrosourea ( bcnu ) , respectively ( figure 1 ) .
specific agt point mutations , including p140k and g156a , are resistant to the wild - type agt inhibitor , o - benzylguanine ( bg ) [ 710 ] .
inactivation of wild - type agt with bg sensitizes untransduced bone marrow cells to o - alkylating agents , allowing the resistant mgmt mutant - transduced cells to expand and repopulate . sustained high - level expression of mgmt has been demonstrated with both single - gene retroviral and lentiviral vectors [ 5 , 6 , 12 , 13 ] .
dual - gene vectors containing mutant mgmt have also been shown to efficiently select stem cells in vivo [ 1416 ] ; however , higher mois are often required to compensate for the reduced expression efficiency of one or both genes in dual - gene lentivectors .
this strategy allows two genes to be rapidly evaluated without a need for dual gene vector construction .
cotransduction with separate vectors has been used extensively for in vitro models [ 17 , 18 ] , or for derivation of induced pluripotent stem cells [ 19 , 20 ] .
frimpong and spectro demonstrated that separate vsv - g - pseudotyped lentiviruses could be used to cotransduce cell lines or primary human neurons .
they also demonstrated efficient cotransduction of cells with two bicistronic vectors , each with a unique drug resistance gene , for in vitro selection of only dual - positive cells .
the efficiency of hematopoietic cell cotransduction , and whether the cotransduced cells can be enriched in vivo , has not been evaluated .
therefore , we evaluated whether separate single - gene lentivectors , one expressing mgmt - p140k , and the other expressing gfp , could efficiently cotransduce hematopoietic cells at low mois to produce dual - positive populations that could be enriched with bg and bcnu selection .
cotransduction efficiencies were first assessed in the human erythroleukemia k562 cell line , using various virus ratios , selection stringencies , and total mois .
this information was then applied to murine bone marrow cell cotransductions to selectively amplify dual - positive cells in vivo . since
insertional mutagenesis has been demonstrated as a potential risk associated with gene therapy , these studies involved significantly reduced mois compared to mois reported for in vivo selection with dual - gene lentiviral vectors [ 2224 ] .
our data demonstrate that cotransduction , coupled with mgmt - mediated selection , allows enrichment of dual - positive cells in vivo .
further , we show that mgmt - mediated hsc enrichment can be coupled to lineage - specific transgene expression from a separate cotransduced lentivector .
selective in vivo expansion of hematopoietic cells cotransduced with two separate single - gene lentivectors , one of which provides drug resistance , has not been evaluated . as a first approach to evaluating the efficiency of this strategy , cotransduction and selection were carried out in vitro using the human k562 erythroleukemia cell line .
a self - inactivating lentiviral vector containing the internal mnd promoter was obtained from donald kohn ( ucla , santa monica , ca ) .
the woodchuck hepatitis virus posttranscriptional regulatory element ( pre ) and a multiple cloning site were introduced for subsequent generation of vectors expressing agt - p140k or the green fluorescence protein ( gfp ) ; pmnd - mgmt and pmnd - gfp , respectively .
both vectors express at high levels in k562 cells , and distinct agt , gfp , and dual - positive populations can be detected in cotransduced k562 cells .
the cotransduction efficiency of k562 cells was first evaluated with the total moi held at 0.5 , varying the individual mgmt and gfp virus proportions ( figure 2(a ) ) .
the degree of cotransduction was proportional to the total agt and total gfp expression percentages ( total refers to both the single - positive and the dual - positive cells ) .
k562 cells cotransduced with an equivalent mgmt and gfp moi mix ( 0.25 : 0.25 ) resulted in the highest agt and gfp total expression percentages .
the degree of cotransduction was lowest ( 4% ) when an mgmt : gfp moi mix of 0.05 : 0.45 was used .
however , cells transduced with this moi mixture had the highest proportion of dual - positive cells ( 49% ) after treatment with 10 m bg and 15 m bcnu ( figure 2(b ) ) .
drug treatment enriched agt cells to 95% in each culture , with the level of enrichment inversely proportional to the moi of mgmt used .
both the agt only and agt - gfp dual - positive populations were expanded to the same extent , indicating that although both vectors utilize the same promoter , the level of agt expressed in both populations was equally protective .
the percentage of cells expressing gfp did not change after treatment , since the total proportion of gfp cells in the culture is equivalent to the proportion of gfp cells expressing agt .
although gfp expression was maintained in the gfp - only - transduced cultures after drug treatment , survival was markedly reduced and limiting cell numbers were available for analysis .
the initially high cotransduction rates achieved using an moi of 0.25 of each virus had comparatively lower percentages of dual - positive populations after selection ( 29% ) , due to the large proportion of mgmt singly transduced cells present in the culture prior to drug treatment . as expected in the setting of drug selection ,
the highest percentages of dual - positive cells were obtained with virus mixtures composed of low mgmt and high gfp moi proportions .
slightly higher than expected dual - positive percentages were obtained in the k562 cells , compared to calculated values based on the total agt and gfp expression percentages . to evaluate whether this was the result of transcomplementation of virus proteins during transduction , or the inability to completely resolve the transduced populations , k562 cells were cotransduced with gfp virions at an moi of 0.25 and mgmt virus mois of 0 to 10 .
the proportion of gfp cells was then evaluated by flow cytometry in the absence of agt staining . as shown in figure 2(c ) , the transduction efficiency of gfp is independent from the mgmt transduction levels ( determined separately by agt staining ) , indicating that the slightly elevated cotransduction levels are due to the inability to completely resolve the single- and dual - positive populations by flow cytometry .
cotransduction of k562 cells with mois greater than 1 resulted in a high proportion of dual - positive cells in the absence of selection
. however , since high mois are associated with an increased risk of insertional mutagenesis , we evaluated whether cotransduction with an optimal mgmt : gfp ( 0.05 : 0.6 ) moi ratio at a low total moi would result in higher percentages of dual - positive cells , compared to that obtained with a 1 : 1 mixture of the two viruses at a higher total moi ( = 1 ; 0.5 of each virus ) . before selection , the level of cotransduction obtained with the highest total moi was over 4 times that obtained with the 0.05 mgmt and 0.6 gfp virus moi mix , 21% versus 4.6% , respectively ( figure 3(a ) ) .
however , after selection , cultures transduced with the 0.05 mgmt and 0.6 gfp virus moi mixture had the highest percentage of dual - positive cells ( 66% ) , due to the increased rate of dual - positive cell enrichment ( figure 3(b ) ) .
these data indicate that selective expansion of cells cotransduced with optimal virus proportions can overcome the reduced transduction rates obtained with low mois
. drug selection of cells transduced with dual gene vectors can lead to preferential expression of only the drug resistance marker . to evaluate whether mgmt singly transduced cells out compete dual transduced populations under more stringent expansion conditions , the untreated cotransduction cultures from figure 3(a ) were diluted into a 50-fold excess of untransduced k562 cells and selected with two sequential rounds of 10 m bg and 15 m bcnu treatment . as shown in figure 3(c ) , the fraction of dual - positive cells in the total agt population is equivalent before and after two rounds of drug selection , demonstrating that preferential expansion of mgmt singly expressing cells did not occur .
we next evaluated the cotransduction efficiency of murine bone marrow ( bm ) cells using the single - gene mnd - mgmt and mnd - gfp vectors .
progenitor populations derived from 5-fluorouracil - treated donors , or enriched by sca / kit / lineage ( skl ) selection , were cotransduced with equal or low mgmt : gfp virus proportions at constant total mois .
higher mois were used on primary cell cultures to overcome the reduced transduction efficiencies , compared to human cell lines , but well within the range of mois used in typical hsc transduction protocols [ 2224 ] .
the transduced cells were drug treated and expanded in culture for 10 days to determine agt and gfp expression levels by flow cytometry ( figures 4(a ) and 4(b ) ) or plated in methylcellulose to calculate the survival percentages of hematopoietic progenitors ( figures 4(c ) and 4(d ) ) . although the mgmt mois used to transduce skl cells were 210-fold higher than those used for the bm cultures , the agt expression percentages obtained in the unselected skl populations were half of those observed in the bm cells .
nevertheless , increased progenitor survival percentages were obtained with skl cells , compared to that of the bm cells , at higher bcnu doses ( figures 4(c ) and 4(d ) ) .
the dual - positive percentages in both the skl and bm cultures were much higher than expected values , based on total agt and gfp cell percentages .
in addition , the progenitor survival rates obtained with equivalent or staggered mgmt and gfp moi ratios were not dramatically different in either the skl or the bm cell assays .
these data suggest that progenitor populations that are permissive to transduction at the time of virus addition are efficiently transduced with separate vectors at relatively low mois .
insertion of two large genes into the same vector can reduce titers and leave little space for other beneficial sequences , such as , posttranscriptional regulatory elements , insulators , or matrix attachment regions .
cotransduction may be particularly applicable to situations in which the transcription of two genes is targeted to different cell types . to evaluate whether codelivery of a ubiquitous mgmt expression vector and a lineage - restricted gfp virus would allow both stem cell selection and expression of gfp in the correct hematopoietic compartment , we used a modified lentiviral gfp reporter vector ( prrl - gata - gfp ) that restricts gfp expression to ter119 murine erythroblasts .
our in vitro cotransduction results demonstrated that the reduced transduction efficiency achieved with lower mois of the mgmt virus can be circumvented by increased selection stringencies .
thus , as a first approach , skl cells were cotransduced with an mnd - mgmt : gata - gfp moi mixture of 5 : 15 and transplanted into 6 lethally irradiated recipients . at five weeks
posttransplant agt pbmc percentages in the cohort of 6 untreated animals averaged 19% ( 651% ) , while gfp detection in ter119 erythroblasts averaged 18% ( 929% ) ( figure 5(a ) ) .
agt pbmc averages increased to 41% ( 1465% ) in the 4 animals selected with three rounds of bg and bcnu treatment , compared to 27% in 2 untreated controls .
detection of gfp cells in ter119 bm mononucleocytes averaged 57% ( 196% ) in the 4 drug selected animals , compared to 344% in the 2 untreated controls .
as expected , gfp expression was restricted to ter119 erythroblasts ( figure 5(b ) ) , and the animals with the highest agt cell enrichment also had the highest percentage of gfp cells in the ter119 bm fraction ( figure 5(c ) ) .
copy number analysis revealed an average of 14 copies of each vector per cell ( figure 5(d ) ) .
cotransduction with total mois equivalent to that used for dual - gene vectors , results in approximately equivalent vector insertion numbers ( data not shown ) .
these data indicate that cotransduction allows efficient lineage - specific gene expression to be coupled to progenitor selection in vivo .
a second transplant experiment was carried out to determine whether this strategy is efficient with limiting mnd - mgmt and gata - gfp mois .
whole bm harvested from 5-fu - treated donor mice was transduced with each virus at an moi of 3 . following a 12-hour transduction , 2
posttransplant , agt pbmc levels in the cohort of 6 untreated animals ranged from 627% , while little to no gfp expression was detected ( figure 6 ) .
of the four animals selected with three rounds of 30 mg / kg bg and 10 mg / kg bcnu selection , only two showed evidence of transduced cell engraftment . the agt pbmc expression in these two animals
in addition , the gfp percentage detected in ter119 pb erythroblasts was 2642% in the drug - treated animals , compared to 35% in the untreated animals .
the two - drug - treated animals had high percentages of both agt mononuclear cells ( 69% and 55% ) and gfp erythroblasts ( 74% and 56% , resp . ) .
the number of mgmt and gfp vector insertions in these two animals ranged from 13 and 14 copies per cell , respectively .
these data demonstrate that mgmt - mediated selection permits expansion of cells cotransduced with limiting mois and suggests this strategy may serve as first approach to evaluating lineage - specific therapeutic vectors in vivo .
we evaluated whether cotransduction of hematopoietic cells with two separate vectors , one of which allows selection , would provide an efficient alternative to dual - gene vectors .
these studies involved significantly reduced mois than previously reported for in vivo selection with bicistronic lentiviral vectors .
we found that 1 ) the level of cotransduction is proportional to the transduction efficiencies of each vector ; 2 ) at limiting total mois , low mgmt : gfp virus proportions resulted in the highest level of dual - positive cells after drug selection ; 3 ) cotransduction allows mgmt - mediated progenitor cell expansion to be coupled to lineage - specific transgene expression .
the use of cotransduction for dual - gene delivery eases vector insertion size limits and cis - acting complications that limit the expression efficiency of one or both genes in dual - gene constructs .
given that cotransduction involves two genes delivered with separate vectors , we evaluated in vitro the stoichiometry of the two viruses used , the total moi , and the effect of drug selection .
when the total moi was low and held constant , the level of cotransduction in k562 cells was found to be proportional to the transduction efficiency of each vector .
therefore , equivalent levels of each vector resulted in the highest percentage of dual - positive cells in the absence of selection . with drug treatment
the proportion of gfp cells in the total population is equivalent to the proportion of gfp cells in the drug - resistant population .
therefore , at a constant moi , low mgmt : gfp virus ratios resulted in the highest level of dual - positive cells after selection .
as previously reported with other vectors , the level of cotransduction was slightly higher than the expected values based on the individual transduction efficiencies .
however , in the absence of mgmt staining , the transduction efficiency of the gfp lentivirus was unaffected by increasing mois of the mgmt virus .
thus the slightly higher dual - positive values seen when agt and gfp were measured simultaneously are likely due to the inability to completely resolve the single- and dual - expressing populations by flow cytometry .
the selection stringency must be taken into account when enriching cells that are cotransduced at low mois .
the degree of expansion obtained with stringent selection conditions can overcome reduced cotransduction rates obtained with limiting mois .
low mgmt to gfp virus ratios at a low total moi resulted in higher levels of dual - positive cells after selection than that obtained with equal mixtures of the two viruses at a higher total moi . for dual - gene vectors ,
highly stringent drug treatments have been shown to preferentially select for drug resistance gene expression at the expense of the other gene [ 26 , 29 ] . however , using a two vector system , mgmt - gfp - transduced cells were enriched to the same extent as mgmt singly transduced cells , even after stringent selection conditions .
the cotransduction efficiency of primary bm cells is more difficult to predict since it consists of a mixed population of cell types that also differ in their cycling status .
higher mois were used in these studies than with human cell lines to overcome the reduced transduction rates obtained with murine bm cells .
although the initial expression percentages were low , the percentage of dual - positive cells obtained after drug treatment was over two times higher than the expected levels calculated from the individual expression percentages .
these data indicate that specific cells may be more or less susceptible to transduction and thus , the high mois used to increase transduction efficiency of primary cells will likely result in higher integration rates in the susceptible cell populations .
cotransduction may have the most potential for situations in which the two genes are transcriptionally targeted to different cell types .
this is especially true for severe hemoglobinopathies , including beta - thalassemia major and sickle cell anemia , in which bulky regulatory elements are required for lineage - restricted therapeutic gene expression [ 30 , 31 ] .
we report here the ability to couple mgmt - mediated selection to erythroblast - specific gfp expression using separate single - gene vectors .
selection for engrafted mgmt- and gata - gfp - positive cells was efficient in both skl and whole bm transplant recipients .
this strategy should be useful for evaluating the therapeutic potential of low - copy gene replacement used to correct hematopoietic disease models .
since the gene expression levels are independent with this strategy , a wide range of therapeutic vectors could be rapidly assessed by cotransduction with mgmt .
although cotransduction requires at least two insertions for dual - gene expression , the enhanced expression efficiency achieved with single - gene vectors suggests that fewer total copies may be required to achieve expression levels equivalent to that of dual - gene vectors .
the self - inactivating lentiviral vector ( pcso - rre - cppt - mcu3-luc ) containing an internal mnd promoter , and the central polypurine tract / central termination sequence ( cppt / cts ) was kindly provided by d. kohn ( ucla , santa monica , ca).the luciferase gene was removed from this vector by ncoi / ecori digestion and replaced with a multiple cloning site cassette .
the woodchuck hepatitis virus posttranscriptional regulatory element ( obtained from t. hope ) was inserted into the unique ecori site .
the resulting vector was restricted with ncoi / bamhi for insertion of mgmt - p140k or gfp .
briefly , 293 t cells were triple transfected with the packaging vector ( pcmvdeltar8.91 ) , the vsv - g pseudotyping vector ( pmd.g ) , and either the pmnd - mgmt - p140kpre , pmnd - gfppre , or prrl - gata - gfp transfer vectors at a mass ratio of 3 : 1 : 3 , using lipofectamine 2000 ( invitrogen ) according to the manufacturer 's instructions .
virus produced 2448 hours after transfection was harvested in dulbecco 's modified eagle medium ( dmem ; cellgro ) containing 10% heat - inactivated fbs ( cellgro ) and 2 mm glutamax ( invitrogen ) .
virus - enriched media was filtered through 0.45 m syringe filter units ( millipore ) and stored at 80c .
expression titers were determined on k562 cells using virus dilutions that resulted in less than 10% transduction .
titers ranged from 6 10 to 3 10 expression units / ml . virus preps were premixed at the specified moi ratios prior to the addition of cells .
k562 cells were cotransduced in iscove 's medium ( cellgro ) containing 10% heat - inactivated fbs , 2 mm glutamax , and 8 g / ml polybrene ( sigma , st .
whole bm and sorted stem cell populations were transduced for 12 hrs in alpha - mem containing 20% heat - inactivated fbs , 2 mm glutamax , 6 g / ml polybrene , in the presence of 20 ng / ml murine il-3 and 50 ng / ml of murine il-6 , and scf ( r&d systems inc . , minneapolis , mn , usa ) .
the apparent mois used for mouse cell transductions were based on expression titers established in k562 cells .
the transduced cells were transplanted immediately after transduction . for whole bm transplants , donor marrow ,
was obtained from 6- to 8-week - old c57bl/6j mice ( jackson laboratories , bar harbor , me , usa ) 2 days after treatment with 150 mg / kg 5-fu .
six - week - old recipient mice were lethally irradiated with 850 cgy using a cs source and transplanted with 2 10 5-fu enriched cells per mouse or 1,000 skl cells supported with 2 10 lineage cells per mouse .
bg was synthesized by dr robert moschel at the frederick cancer research institute ( frederick , md , usa ) , and bcnu was obtained from the drug synthesis and chemistry branch of the national cancer institute ( nci ; bethesda , md ) .
all in vitro drug treatment incubations were carried out in serum - free media at 37c .
cells were pretreated with bg for 1 hour , followed by a 2-hour treatment in bcnu .
drug treatments for in vitro murine bm selections were carried out with 25 m bg and 0 , 5 , 15 , or 30 m bcnu in alpha - mem containing 1.2% spleen - cell - conditioned media ( stem cell technologies ) .
drug - treated murine bm samples were expanded 10 days in liquid culture using the same media formulation as described for transduction , without polybrene .
progenitor survival assays were performed as previously described . for in vivo selection , bg was dissolved to 3 mg / ml in 40% polyethylene glycol ( union carbide corp . , danbury , ct , usa ) and 60% pbs (
ph 8.0 ) , and bcnu was dissolved in ethanol and diluted to 1 mg / ml in pbs .
mice were injected intraperitoneally with 30 mg / kg bg , followed by 10 mg / kg bcnu an hour later .
three rounds of selection were carried out at 3-week intervals , beginning at 3 weeks for animals transplanted with whole bm and 5 weeks for animals transplanted with skl cells .
all flow cytometry results were obtained with an lsr flow cytometer ( becton dickinson ) .
gfp expression was measured in k562 cells after a single wash in pbs . for agt detection , k562 cells
were fixed in 2% paraformaldehyde for 30 minutes at 4c , permeabilized in 1% tween-20 for 30 minutes at 37c , and blocked in 10% normal goat serum for 15 minutes at room temperature .
the cells were then immunolabeled with the mouse anti - human mgmt monoclonal antibody mt3.1 ( kamiya biomedical , seattle , wa , usa ) and an ( apc- ) conjugated goat anti - mouse secondary antibody ( caltag laboratories , burlingame , ca , usa ) . dual detection of agt and gfp expression was carried out with the same staining protocol as that used for agt alone .
red blood cells were lysed in murine pb and bm samples prior to preparation for flow cytometry .
vector insertions per cell were evaluated using a lightcycler instrument and the lightcycler faststart dna master sybr green i kit from roche diagnostics ( basel , switzerland ) .
vector copy numbers were determined using proviral - specific mgmt primers ; sense 5-acgtctatatcatggccg-3 , antisense 5-tgaggatcttgacaggatt-3 and gfp primers ; sense 5-acgtctatatcatggccg-3 and antisense 5-tgtgatcgcgcttctc-3. genomic copy numbers were determined using gapdl4-specific primers , as previously described .
mgmt , gfp , and gapdl4 copy numbers were assessed using a standard curve consisting of murine genomic pbmnc dna spiked with known vector copy numbers , and verified using k562 cell clones containing a single mgmt - gfp vector insertion .
one diploid copy of the mouse genome was assumed to contain two copies of gapdl4 and 5.9 pg of dna .
ten cfu were analyzed per animal and the average copy number per cfu was compared to that of total bm from each animal . | the p140k point mutant of mgmt allows robust hematopoietic stem cell ( hsc ) enrichment in vivo .
thus , dual - gene vectors that couple mgmt and therapeutic gene expression have allowed enrichment of gene - corrected hscs in animal models . however , expression levels from dual - gene vectors are often reduced for one or both genes .
further , it may be desirable to express selection and therapeutic genes at distinct stages of cell differentiation . in this regard
, we evaluated whether hematopoietic cells could be efficiently cotransduced using low mois of two separate single - gene lentiviruses , including mgmt for dual - positive cell enrichment .
cotransduction efficiencies were evaluated using a range of mgmt : gfp virus ratios , mois , and selection stringencies in vitro .
cotransduction was optimal when equal proportions of each virus were used , but low mgmt : gfp virus ratios resulted in the highest proportion of dual - positive cells after selection .
this strategy was then evaluated in murine models for in vivo selection of hscs cotransduced with a ubiquitous mgmt expression vector and an erythroid - specific gfp vector . although the mgmt and gfp expression percentages were variable among engrafted recipients , drug selection enriched mgmt - positive leukocyte and gfp - positive erythroid cell populations .
these data demonstrate cotransduction as a mean to rapidly enrich and evaluate therapeutic lentivectors in vivo . |
currently , approximately ten million people have chagas disease worldwide , with the disease burden being centered in latin america .
sleeping sickness is another serious health problem , particularly in sub - saharan countries ; in the first half of the twentieth century , this disease practically decimated entire communities in central africa .
after many surveillance programs , 2009 marked the first time in 50 years that less than ten thousand new cases of sleeping sickness were reported in africa ( http://www.who.org/ ) .
the causal agents of chagas disease and sleeping sickness are , respectively , the protozoan parasites trypanosoma cruzi and t. brucei of the kinetoplastida order .
two subspecies of t. brucei , t. b. rhodesiense , and t. b. gambiense , are responsible for acute sleeping sickness in eastern and southern africa and chronic sleeping sickness in western and central africa , respectively .
these protozoa have life cycles that alternate between a mammalian host and an insect host .
t. cruzi epimastigotes are a noninfective life cycle stage of the parasite that proliferate by binary fission in the guts of triatoma infestans insects , which are more commonly known as kissing bugs .
then , when the insect vector bites a mammalian host , they eliminate the metacyclic parasites in their feces .
this allows the parasites to penetrate the wounded skin and enter into the mammalian host 's circulatory system . within the bloodstream ,
the metacyclic parasites transform into trypomastigotes , which then infect mammalian cells and transform into amastigotes .
amastigotes are spherically shaped and proliferate inside the infected cells until transforming into nonreplicative trypomastigotes .
the life cycle is completed when an insect vector bites an infected mammalian host and takes up trypomastigotes within the blood that then transform into epimastigotes inside the insect gut .
in contrast to t. cruzi , the life cycle of t. brucei spp . is entirely extracellular . in this case ,
an infected tsetse fly ( glossina genus ) bites a mammalian host , transferring metacyclic trypomastiogte forms into the circulatory system .
metacyclic trypomastiogtes transform into bloodstream trypomastigotes that then proliferate in the hemolymphatic system as trypomastigotes , which are slender in form ; next , the parasites transform in a non - proliferative form that is stumpy in appearance .
when a new tsetse fly bites an infected mammalian host , these non - proliferative , stumpy parasites are taken up by the fly and transform into proliferating procyclic forms in the fly midgut .
parasites then migrate to the salivary glands of the insect where they transform into epimastigotes that can proliferate by binary fission .
finally , the epimastigotes transform into infective metacyclic trypomastigotes , which are then injected into a new mammalian host during the tsetse fly 's bite .
as shown above , chagas disease is transmitted through the infected feces of triatomines , whereas sleeping sickness is transmitted through the infected saliva of tsetse flies . however , other transmission modes are shared by both species , and include transmission through blood transfusions , vertical or mother - to - child transmission , and accidental infections in the laboratory .
diagnosis is based on the presentation of clinical symptoms and signs , direct parasitological testing of blood or cerebrospinal fluids ( in the case of t. brucei infection ) , serological tests and/or by parasite dna detection using polymerase chain reactions ( pcr ) . to detect t. cruzi by pcr ,
samples are assayed for the presence of minicircle kinetoplast dna and a 195-bp reiterated dna sequence [ 2 , 3 ] .
one serological test that is used for sleeping sickness diagnosis is the card agglutination test for trypanosomiasis ( catt ) ; it detects t. b. gambiense - specific antibodies . for chagas disease ,
t. cruzi - specific antibodies can be detected with assays using either crude or recombinant antigens [ 5 , 6 ] .
however , the use of serological tests to infer chagas disease cure is controversial , as antibodies against parasite antigens can remain in circulation for long periods of time .
the absence or presence of mild symptoms is associated with the chronic phases of both diseases .
however , the acute symptoms of chagas disease can be diagnosed by a trained physician and include swelling , nausea , diarrhea , vomiting , liver or spleen enlargement , fever , headaches , and chest or abdominal pain .
about 40% of patients develop chronic disease with heart or colon dilation after 1020 years of infection .
similarly , sleeping sickness is also characterized by two distinct stages . in the acute phase or hemolymphatic stage ,
symptoms include headache , malaise , weight loss , fatigue , fever , and vomiting . in the second phase ,
also known as the neurological phase , parasites are present within the cerebral spinal fluid and brain and cause many neurological and physiatric symptoms including anxiety , disruption of the sleep - wake cycle , behavior changes , and motor features such as muscle tremors and walking difficulties . if untreated , sleeping sickness is fatal . in the absence of treatment , it is estimated that t. b. gambiense infection is fatal within three years and that t. b. rhodesiense infection is fatal within six to eight months [ 10 , 11 ] .
drugs used to treat chagas disease and sleeping sickness have undesired toxic side effects and are not effective against all parasite life cycle stages or parasite strains because of drug resistance .
however , effective drugs exist to treat the acute phases of both diseases . despite the presence of numerous side effects , benznidazole ( bnz ) ( n - benzyl-2-nitroimidazole-1-acetamide ) and nifurtimox ( nf ) ( 4-([5-nitrofurfuryledene]amino)-3-methylthiomorpholine-1,1 dioxide )
while nf increases the production of free radicals believed to cause trypanosome death [ 13 , 14 ] , bnz disrupts protein synthesis and the respiratory chain of t. cruzi ( for a review see ) .
however , these drugs are ineffective during the chronic phase of the disease . in the latter phases of chagas disease , the course of treatment is dependent on the patient 's symptoms ; medicines or surgery
are recommended for patients with heart complications , while diet changes and possibly surgery are suggested for patients with digestive complications . to treat sleeping sickness ,
pentamidine has been used since 1940 and is the first - choice drug to treat the initial stages of t. b. gambiense infection ; it is administered as an intramuscular injection .
the exact antiprotozoal mechanisms of action of pentamidine are still unknown , perhaps because it acts against many targets including mitochondria and dna ( reviewed at [ 16 , 17 ] ) .
suramin has six negative charges that allow it to interact electrostatically with many trypanosomal enzymes , including enzymes involved glycolysis and the pentose phosphate pathway .
as resistance against suramin has been observed in t. b. gambiense , suramin is currently only used for cases of t. b. rhodesiense infection ( for a review see ) .
more toxic that pentamidine and suramin , melarsoprol , eflornithine , and a combination of eflornithine and nf ( for melarsoprol - refractory patients ) are used to treat patients in the neurological phase .
eflornithine , alpha - difluoromethylornithine , is administered intravenously and infusion and irreversible inhibits polyamine biosynthesis acting at ornithine decarboxylase ( ec 4.1.1.17 ) .
it is only effective against t. brucei gambiense infections . in spite of its toxic side effects
, melarsoprol is the most widely used drug during the second stage of sleeping sickness ; further , it is the only drug available to treat t. b. rhodesiense infections .
melarsoprol is derived from arsenic , and it is believed that melarsen oxide is its active metabolite in vivo .
although it is unknown how melarsoprol kills parasites , parasite lysis following melarsoprol exposure was demonstrated .
although there is a clear need for new drugs to treat trypanosome - induced diseases , few drugs and clinical trials have been initiated recently . the absence of standard protocols to evaluate drug efficacy and the absence of clinical parasitological markers contribute to the difficulty of launching new treatment initiatives . in the case of chagas disease ,
novel drugs with less toxic effects and shorter administration times and drugs to treat chronic disease should be prioritized . therefore ,
a standard protocol for drug screening against acute t. cruzi infections was proposed to evaluate drug efficacy both in in vitro and in vivo models compared to bnz .
although it is very important to evaluate the effect of these compounds during chronic infection , it is not possible due to the difficulty in evaluating parasite clearance using current methods .
most recently , studies have focused on the azolic compounds itraconazole and posaconazole that inhibit ergosterol synthesis . in mouse models , these drugs
in addition , posaconazole has activity against t. cruzi both in vivo and in vivo . regarding sleeping sickness
, new drugs should have lower toxic side effects , treat both t. b. gambiense and t. b. rhodesiense infections , and treat late - stage t. b. rhodesiense infection .
pafuramidine maleate ( db289 ) is a new drug in clinical trial for the treatment of sleeping sickness .
however , as it can not cross the blood - brain barrier , it can only be used for early stage treatment . despite this
as illustrated above , the need for new drugs and novel drug targets to treat both chagas disease and sleeping sickness is evident .
these drugs should target fundamental pathways within these parasites . in spite of the conserved nature of essential pathways among eukaryotic organisms
, we identified a trypanosome prereplication machinery component that is fundamental for replication and that is distinct from eukaryotic prereplication machinery ; this component is necessary for origin selection and the establishment of the dna replication fork .
these data indicate that this enzyme is a potential drug target for the treatment of both chagas disease and sleeping sickness .
dna replication in eukaryotes begins with the assembly of the prereplication complex on regions along chromosomes known as replication origins [ 25 , 26 ] .
the prereplication complex assembly ( depicted in figure 1 ) begins when the origin recognition complex ( orc ) , comprised of six different subunits ( orc16 ) [ 25 , 27 ] , recognizes the replication origins and allows the recruitment of cell division cycle cdc6 and cdt1 proteins to the complex .
together , the orc , cdc6 and cdt1 proteins recruit the mini - chromosome maintenance ( mcm ) complex , which is comprised of six subunits ( mcm27 ) ; the mcm complex harbors the helicase activity that is essential for dna replication .
once the prereplication machinery is bound to the replication origins , these origins are licensed , meaning that the replication process can initiate at these origins through the binding of regulatory factors and dna replication fork components during the onset of s - phase .
the orc complex was first purified from s. cerevisiae extract as proteins that bound to replication origins .
s. cerevisiae orc ( 413 kda ) is a heterohexamer that contains six proteins named according their relative molecular mass : orc1 ( 120 kda ) , orc2 ( 72 kda ) , orc3 ( 62 kda ) , orc4 ( 56 kda ) , orc5 ( 53 kda ) , and orc6 ( 50 kda ) .
orc1 - 5 orthologs were identified in a wide range of organisms , suggesting that these genes are present in all eukaryotic organisms .
of the six orcs , cdc6 is most notably similar to orc1 ( see figure 2 ) .
therefore , orc1 is more closely related to cdc6 than to any other orc component . among the orc subunits , orc1 , orc4 , and orc5
belong to the aaa+ family , proteins that exhibit atpase activity and function in multiple cellular activities .
orc2 and orc3 contain an atpase - like domain ; orc6 lacks the aaa+ domain and shows no structural similarity to the other orc proteins .
the aaa+ domain contains the walker a and walker b motifs and regions named sensor 1 and sensor 2 .
these regions are typical in proteins that act as clamp - loaders , proteins that encircle dna and bind other factors and serve as processivity - promoting factors in dna replication in an atp - dependent manner .
walker a and b motifs and sensor 1 and 2 regions are responsible for atp binding and hydrolysis ; atp binding and hydrolysis trigger a conformational change within the orc that allows for the serial recruitment of proteins during prereplication complex assembly at replication origins . cdc6 ( 58 kda in s. cerevisiae ) was first isolated from thermo - sensitive mutants and identified as an important factor during the beginning of dna replication .
cdc6 also has the aaa+ domain , containing the walker a and walker b motifs and sensor 1 and 2 regions .
the molecular bases that enable the recruitment of prereplication machinery have been described in yeast and they are dependent on atp binding and atp hydrolysis ( figure 3 ) . as mentioned previously , the first step in prereplication machinery assembly is the binding of the orc to the replication origins , a step that depends on the binding of the orc to atp .
orc - double - stranded dna interactions are specific and inhibit the atpase activity of the orc . in this way , the high atpase activity of the orc inhibits stable orc interactions with nonspecific dna . however , in the presence of a specific replication origin , the atpase activity of the orc is inhibited , and it undergoes a conformational change ; the conformation change stabilizes the orc - dna interaction and allows the orc to bind cdc6 ( reviewed in ) .
the stability of orc - cdc6-dna interactions is also regulated by the atpase activity of cdc6 , which is high in the presence of nonspecific dna , destabilizing the complex .
orc - cdc6-dna interactions trigger a conformational alteration in cdc6 that allows for the cdc6-cdt1 interaction to occur .
therefore , the atpase activity of both the orc and cdc6 work to select specific replication origins . once bound to dna ,
the orc and cdc6 are able to interact with cdt1 , which brings the mcm complex to the replication origin . at this moment
, the low activity of the cdc6 atpase that is important to establish orc - cdc6-dna interaction is also required to recruit the mcm complex onto the replication origins ( reviewed in ) .
once the mcm complex is recruited and established at the replication origins , the orc , cdc6 and cdt1 do not need to be bound to replication origin sites any longer . at this point ,
prior to the activation of dna replication , these proteins disassociate from the replication origins in an atpase - dependent manner .
these data clearly demonstrate the extreme importance of the atpase activities of the different components of the prereplication machinery in the stabilization and assembly of the prereplication machinery onto dna replication origins . in the selection of replication origins , the assembly of the prereplication complex onto replication origins , the recruitment of the mcm helicase , and in the dissociation of the prereplication complex from the replication origins to avoid a new round of dna replication in the same cell cycle , the balance between high and low atpase activity is critical for precise dna replication .
although eukaryotic cells , trypanosomes have a prereplication machinery component that is different from eukaryotes and is instead closer to archaea species .
genomic databases of trypanosomatids show that these organisms do not contain sequences in their genome that code for orc1orc6 subunits , cdc6 or cdt1 . additionally , several archaea sp .
have one or more copies of proteins that exhibit high sequence homology with both orc1 and cdc6 ; these proteins are often called orc1/cdc6 proteins [ 4042 ] ( figure 2 ) .
trypanosomatids have annotated a gene for only one of the six subunits of the orc , orc1 , which is also homologous to cdc6 .
it is annotated as orc1 and we named it orc1/cdc6 . in the tigr parasites
database ( http://www.tigr.org/ ) , two sequences were annotated as orc1 ( tc00.1047053511159.20 and tc1047053508239.10 ) in the genome of t. cruzi ( representing gene alleles ) .
single sequences were annotated as orc1 in the genomes of t. brucei ( tb11.02.5110 ) and t. brucei gambiense ( tbg972.11.8220 ) .
trypanosome orc1/cdc6 was confirmed as a prereplication machinery component because it replaced yeast cdc6 in a yeast phenotypic complementation assay ; further , the silencing of trypanosome orc1/cdc6 expression by rna interference in t. brucei impaired nuclear dna replication .
analyses of structural alignment using the phyre server , a web - based method for protein folding recognition , showed a higher structural similarity of trypanosome orc1/cdc6 to archaea orc1/cdc6 .
also , analyses of the predicted tridimensional structure of t. cruzi orc1/cdc6 by 3d - pssm ( http://www.sbg.bio.ic.ac.uk/~3dpssm/index2.html ) , which determines the most probable folds based on the occurrence of motifs present in the secondary structure , showed that the probable structural of t. cruzi orc1/cdc6 is homologous to archaea orc1/cdc6 ( figure 4 ) .
these analyses suggest that trypanosome orc1/cdc6 is closer to archaea prereplication machinery than to mammalian prereplication machinery .
primary sequences of trypanosome orc1/cdc6 also contain walker a and b motifs , related to atp / gtp binding , and sensor 1 and 2 regions that are involved in atp hydrolysis ; these features are typical of prereplication machinery components that exhibit the aaa+ atpase fold [ 44 , 45 ] . in fact , both t. cruzi and t. brucei orc1/cdc6 exhibit atpase activity , which , in the presence of increased concentrations of atp follows a michaelis - menten ( mm ) kinetic model .
this atpase activity increases in the presence of nonspecific dna , suggesting that , similar to yeast , trypanosome orc1/cdc6 atpase activity might be involved in the selection of specific replication origins .
as mentioned previously , there is no cdt1 homologous protein in the trypanosomatid genome database .
therefore , in these organisms , the prereplication machinery might be assembled by the recruitment of the mcm complex by orc1/cdc6 .
alternatively , the prereplication machinery could be assembled by an unknown protein that could bind orc1/cdc6 and recruit the mcm complex onto the replication origins .
it is important to note that further studies should confirm if this schematic representation is correct .
richard mcculloch identified at least one further orc - like factor ( pers comm . ) in t. brucei .
further studies should also be conducted to determine if orc1/cdc6 atpase activity is important for the assembly of prereplication machinery as well as for the release of the prereplication complex proteins from the replication origins .
nevertheless , the silencing of trypanosome orc1/cdc6 expression by rnai in t. brucei negative affected cell survival .
this data strongly indicates that orc1/cdc6 is extremely important for trypanosome survival and identifies orc1/cdc6 as a potential target for drug design .
different proteins harboring atpase activity are being studied as potential drug targets through the inhibition of their atpase activity [ 4649 ] .
the inhibition of the atpase activity of heat - shock protein 90 ( hsp90 ) is a main target for cancer treatment .
hsp90 is a chaperone that acts in the folding , stabilization , and assembly of several proteins that are involved in many biological processes [ 50 , 51 ] ; further , it is also responsible for the maintenance of cancer cells by facilitating the function of oncoproteins allowing malignant transformation . because hsp90 from tumor cells has a higher activity compared to hsp90 from normal cells , its inhibition effects in tumor cells are higher than in normal cells , making hsp90 a good target for drug design [ 46 , 54 ] .
geldanamycin , a natural compound , was the first compound described with antitumor effects through the inhibition of hsp90 atpase activity [ 5557 ] .
geldanamycin binds to the n - terminal atp - binding pocket of hsp90 , thereby blocking its atpase activity .
since these findings have been reported , several studies have focused on hsp90 as a target , and several drugs such as 17-dmga ( alvespimycin ) and 17-aag / tanespimycin have reached phase i and phase ii clinical trials , respectively .
different proteins with atpase activity are being targeted for high - throughput screening in order to find new inhibitors with potential antibiotic effects .
bacterial reca , dna gyrase , and essential replicative dna helicase are some of the atpase proteins upon which effort is being concentrated .
reca is a bacterial protein involved in dna repair , which interacts with single - stranded dna and through its atpase activity allows for both recombinational dna repair and horizontal gene transfer , processes that are essential for the acquisition of drug resistance genes .
inhibitors of reca atpase activity that act by binding the atp - binding site are being screened , indicating the potential development of antibiotics capable of preventing bacterial drug resistance .
dna gyrase and the replicative dna helicase are proteins involved in bacterial dna replication and are essential for bacterial survival .
dna gyrase is a type ii topoisomerase capable of introducing negative supercoils during dna replication .
although it is comprised of two subunits ( a and b ) , only b subunit has atpase activity .
the aminocoumarin antibiotic class , from which novobiocin ( 4-hydroxy-3-[4-hydroxy-3-(3-methylbut-2-enyl)benzamido]-8-methylcoumarin-7-yl3-o - carbamoyl-5,5-di - c - methyl--l - lyxofuranoside ) is licensed for treatment of human infections , binds to the b subunit inhibiting the atp hydrolysis required for dna supercoiling and preventing cell growth .
the dna replicative helicase , dna b , is responsible for opening double - stranded dna through atp hydrolysis , which makes the dna available to the replication machinery for the duplication of the bacterial genome .
two compounds , flavonoid myricetin and triaminotriazine , are able to inhibit the atpase activity of dna b helicase in escherichia coli and pseudomonas aeruginosa , respectively , preventing cell growth .
however , as these drugs exhibit some cytotoxicity in mammalian cell culture , others inhibitors are being screened as possible drug candidates .
as discussed above , inhibitors of atpase activity are being studied as possible drugs candidates ; some , such as novobiocin , are even already being used for human treatment .
this raises the possibility of searching for specific inhibitors of t. brucei and t. cruzi orc1/cdc6 , as these proteins do not have a closely related protein in humans .
in addition to its indispensable role as a dna replication initiator , the orc is known to affect diverse cell processes including chromosome segregation , cytokinesis , cell cycle regulation , and gene expression .
it is now time to analyze whether trypanosome orc1/cdc6 , and its atpase activity are also involved in non - dna replication functions .
if so , it would better justify additional efforts to search for an atpase inhibitor against trypanosome orc1/cdc6 . | approximately ten million people suffer from chagas disease worldwide , caused by trypanosoma cruzi , with the disease burden predominately focused in latin america .
sleeping sickness is another serious health problem , caused by trypanosoma brucei , especially in sub - saharan countries .
unfortunately , the drugs currently available to treat these diseases have toxic effects and are not effective against all disease phases or parasite strains .
therefore , there is a clear need for the development of novel drugs and drug targets to treat these diseases .
we propose the trypanosome prereplication machinery component , orc1/cdc6 , as a potential target for drug development . in trypanosomes
, orc1/cdc6 is involved in nuclear dna replication , and , despite its involvement in such a conserved process , orc1/cdc6 is distinct from mammalian orc1 and cdc6 proteins .
moreover , rnai - mediated silencing of trypanosome orc1/cdc6 expression in t. brucei decreased cell survival , indicating that orc1/cdc6 is critical for trypanosome survival . |
this 34-year - old man had progressive visual loss in the left eye of 2 months .
automated visual fields were symmetrically normal . after seeking a second opinion 14 days later , best - corrected visual acuity ( bcva ) of the left eye was 20/100 ( 6/30 ) with diffuse disc elevation and peripapillary nerve fiber hemorrhage ( fig .
optical coherence tomography ( oct ) demonstrated optic nerve head swelling and thickening ( fig .
visual acuity was normal in the right eye with negative findings by 90-diopter slit - lamp exam , visual acuity , oct , and fluorescein angiography .
detailed medical history was positive for a cough productive of clear sputum of recent duration , nonsmoking status , no exposure to cats , no ingestion of raw meat , and no extramarital relations .
physical exam and infectious workup were essentially negative ( hiv , vdrl , borrelia burgdorferi , brucella , angiotensin - converting enzyme ) including chest radiograph and chest ct .
ten days after the initial consult , bcva deteriorated further to 20/200 ( 6/60 ) in the left eye with increased disc swelling .
he was started on treatment for presumed optic disc tuberculoma consisting of 2 months of rifampin , isoniazid , pyrazinamide , and ethambutol ( respective doses : 150 , 75 , 400 , and 275 mg ) followed by 4 months of rifampin and isoniazid .
one week after initiation of quadruple antituberculous therapy , vision improved to 20/30 ( 6/9 ) with decreased disc swelling .
bcva in the left eye was 20/20 ( 6/6 ) 2 weeks after initiation of therapy with a marked decrease in both disc elevation ( fig .
4 months after initiation of therapy , visual fields were unchanged . at the last follow - up
optic nerve tuberculomas are rarely reported [ 1 , 2 , 3 , 4 , 5 , 6 ] , and their natural history , prognosis , and duration of required treatment remain unclear .
davis et al . gathered a large series of optic disc tuberculosis in order to delineate the progress of the disease and propose the most authoritative therapeutic regimen . in this analysis of 62 eyes from 49 patients with tuberculous optic neuropathy , papillitis was present in 51.6% , neuroretinitis in 14.5% , and optic nerve tubercle in 11.3% , with uveitis absent in 11.3% and extraocular tuberculosis absent in 63.3% of patients . in our case ,
an index of suspicion is required to diagnose ocular tuberculosis when all other systemic investigations are negative , especially in this part of the world where tuberculosis is endemic .
isolated optic disc tuberculosis [ 1 , 2 , 3 , 4 , 5 , 6 ] , similar to isolated choroidal or ciliary body tuberculosis , can be the presenting form of tuberculosis in immunocompetent subjects without extraocular clinical signs or symptoms .
positive ppd skin test and rapid response to antimycobacterial therapy confirm the clinical diagnosis of presumed ocular tuberculosis .
| we present a healthy male subject who developed progressive visual loss in the left eye initially diagnosed as optic neuritis . upon suspicion of infectious etiology , testing was positive for tuberculosis .
there were no signs or symptoms of active systemic tuberculosis infection .
the patient responded swiftly to antimycobacterial therapy with return of vision and resolution of disc swelling .
positive purified protein derivative skin test , negative chest radiograph , negative systemic workup , negative workup for other causes of unilateral optic neuritis and quick response to mycobacterial therapy reaffirm the entity of isolated optic disc tuberculosis similar to isolated choroidal tuberculosis without systemic manifestation . |
dental caries remains today the most common infectious disease which affects most of the population regardless of age .
caries prevalence is high , and oral hygiene is not good , in poor and developing countries as well as albania .
several studies have noted that children with disabilities have higher levels of caries , periodontal diseases , and much higher proportion of untreated lesions but less treatment than children without disabilities .
oral health of these children depends on age , type of disability , severity of impairment and living conditions .
other factors that cause high caries prevalence , poor oral hygiene and high proportion of untreated lesions are parents and caregivers lack of information , knowledge and care about oral health of disabled children ( 1 ) , their socio - economic status and education level .
many individuals with special needs may have great limitations in oral hygiene performance due to their manual dexterity , sensory and intellectual disabilities ( 5 ) , and so are prone to poor oral health .
different studies carried out for caries prevalence at disabled children comparing that without disabilities shows contradictory results .
the aim of this study is to determine the caries prevalence and oral hygiene status at children with various types of disabilities attending different schools for disabled children in albania .
the study population consist of 638 children aged 3 - 18 years old form 9 special schools of albania located at six ( 6 ) different cities , the survey sample comprise 599 ( 94% ) , six ( 6 ) percent were absent during the examination sessions .
informed consent of parents or guardians and school authorities was obtained before the subjects were included in the study .
children that were not cooperative or whose parents have not given consent are excluded from the study .
clinical examinations were carried out at schools , in a school medical room or classroom with natural light .
the examinations were carried out with the aid of an ordinary mouth mirror and a who ball and cpi- tip probe .
the data for each subject were recorded on the standard who , however several changes were made and special survey form has developed .
children are divided in different groups according type of disability . for each individual dental caries and treatment
need is assessed for primary and permanent dentition using deft , defs , dmft , dmfs indices .
oral hygiene status is calculated using the simplified oral hygiene index ( ohi - s ) of greene and vermillion .
fair when it was 1.213.1 and poor when it was 3.11 up to 6 .
children are visually examined for dental hygiene and by passing cpi probe parallel to the buccal and lingual surfaces for the presence of plaque .
chi square test and fisher s exact test were used to compare the proportions of categorical variables . on the other hand ,
anova ( analysis of variance ) and kruskal - wallis test were used to compare mean values of numerical variables between disability groups .
ninety - four percent ( 94% ) or 599 of 638 subjects responded to the call for screening . the mean age of population is 12.00(6.00 ) years old ( table 1 ) .
according of type of disability 84 ( 1.8% ) subject had autism specter disorder , 217 ( 36.2% ) are mental retarded , 26 ( 4.3% ) had cerebral palsy , 147 ( 24.5% ) are deaf - mute , 34 ( 5.7% ) have down syndrome , 91 ( 15.2% ) are blind ( table 1 ) .
seventy - two ( 72% ) had caries at primary dentition ( tab 2 ) .
down syndrome group has the lowest caries prevalence ( 54.5% ) and cerebral palsy group the highest ( 83.3% ) at primary dentition ( table 2 ) .
the mean deft of total sample was 3.43.5 while the mean defs was 7.0 9.1 ( table 3 ) .
there is significant statistical difference between types of disability for deft index ( deft p0.029 , defs p0.066 kruskal - wallis test ) ( tab3 ) .
children with cerebral palsy has the highest deft = 4.54 and children with down syndrome deft = 1.92.7 the lowest value ( table 3 ) .
number and percentage of participants by disability type and age group caries prevalence at primary and permanent dentition by type of disability mean values of dmf(t ) , dmf(s ) , def(t ) and def(s ) by disability type caries prevalence at permanent dentition is 85.3 % ( tab 2 ) , children with autism specter disorder has the lowest caries prevalence ( 60.0% ) and blind children has the highest ( 91.0% ) ( table 2 ) .
the mean dmft for the total sample is 4.94.6 while the mean dmfs is 9.612.9 ( table 3 ) .
mentally retarded children has the highest dmft/ dmfs index ( dmft=5.85.2 , dmfs=13.217.3 ) and children with autism specter disorder the lowest dmf / dmfs index ( dmft=2.63.2 , dmfs=4.57.8 ) ( tab 3 ) .
there is significant statistical difference between disability types for both dmft / dmfs index ( p0.001 , kruskal - wallis test ) ( table 3 ) .
the mean ohi - s index of total population is 1.9 ( table 4 ) , children with cerebral palsy has the best oral hygiene with mean ohi - s index and deaf - mute children the worst oral hygiene with mean ohi - s index 2.25 ( table 4 ) .
there is statistical significance difference among types of disability ( p0.001 , chi square test ) for ohi - s index ( tab 4 ) .
forty- three ( 43.2% ) of total sample has good oral hygiene , 49.4% fair and 7.4% bad oral hygiene ( table 4 ) .
according to recent literature , individuals with disability have poor oral health and high treatment need in comparison with people without disability . in our study
dental caries prevalence according dentition is 85.3% ( n=446 ) for permanent dentition ( table 2 ) and 72% ( n=232 ) for primary dentition ( table 2 ) .
our data show high caries prevalence for disabled children , comparing to other studies we find that our values are higher than values showed by ( 7,8,13,14 ) , similar with ( 15,16,17 ) and lower than ( 18,19,20 ) .
our results are similar to those found by ( 21 ) at a study conducted at tirana , albania with 12 years old children without disabilities and higher than values find by ( 22 ) for caries prevalence at children without disabilities aged 7 - 15 at tirana , albania . mean and detailed caries prevalence and indices are higher than results found at children without disability ( 21,22 ) , lower than that reported by ( 7,8 , 14 , 17 , 23 ) , and similar ( 13 , 19,24,25 ) .
the reasons why we have such a variance of results is because of different types of disability , age group and geographical extension selected by authors .
according of type of disability our results are similar with those found by ( 7,11,13,14,20 ) for permanent dentition . at primary dentition
our results are similar with those found by ( 14 ) and contrary to those found by ( 13,17,20,26 ) .
there is significant statistic difference for dmft and deft index according of type of disability , these result are confirmed by ( 13 , 19 , 20 , 28 ) but contrary to other authors such as ( 13,17,25 ) which did nt find statistical significance difference between types of disability
. oral hygiene status of children with disability is not good and this is in accordance with other studies ( 7,8,11,14,15,19,22 ) .
our mean ohi - s index is 1.91 ( table 4 ) which is lower than that found by ( 19 , 22 ) .
according of type of disability cerebral palsy and autistic specter disorder has the best oral hygiene and deaf - mute group the worst these results are similar with those found by ( 11 , 20 ) although our values are higher and contrary to those found by ( 14 ) .
good ( 43.2% ) and bad ( 7.4% ) ( tab 4 ) , these results are similar with that found by ( 7 ) but contrary to that found by ( 8,28 ) .
there is statistical significance difference among types of disability ( p0.001 , anova test , tab 4 ) which is in accordance of study carried out by ( 28 ) , other authors such as ( 17 ) . a very high caries experience and poor oral hygiene status demands immediate attention to increase efforts for prevention and treatment of oral diseases in these special groups of children .
from the study result that children with disability has high caries prevalence and bad oral hygiene.childrens with disability needs more dental treatment and care from their parents and caregivers .
from the study result that children with disability has high caries prevalence and bad oral hygiene .
children s with disability needs more dental treatment and care from their parents and caregivers . | introduction : this study was carried out at nine ( 9 ) special schools for disabled children in albania .
the aim of the study is to determine the caries prevalence and oral hygiene status of children with different disabilities attending different schools for disabled at albania.methods:participants are grouped according disability autistic spectrum disorder , down syndrome , cerebral palsy , mental retarded , blind , deaf - mute and age group ( 0 - 5 , 6 - 10 , 11 - 14 , 15 - 18 years old children ) .
caries and oral health status were examined and assessed according who 1997 criteria.results:overall caries prevalence at permanent dentition for all groups is 85.3% and for primary dentition 72% .
the mean deft index is 3.4 3.5(p0.029 ) , mean dmft= 4.94.6 ( p0.001 ) with significance difference across type of disability ( kruskal - wallis test ) for both dentition .
the mean ohi - s of total population is 1.91 ; there is significant difference across disability type ( p0.001 , anova test ) for ohi - s index . in total 43.2 %
have good , 49.4% fair and 7.4% bad oral hygiene.conclusions:the subjects in this study had a high prevalence of dental caries , poor oral hygiene and need for restorative care . |
a 46-year - old caucasian man presented with a 10-year history of mild gait ataxia and undirected vertigo after fast head movements .
he had a past medical history of resection of a thyroid adenoma and also for benign polyposis of the sigmoid colon . at the age of 41 years
physical inspection revealed megalocephaly , congenital facial asymmetry and left thenar aplasia . at the latest presentation , the neurological examination showed minimal intention tremor , gait ataxia without visual compensation , an undirected imbalance on romberg 's test and bradydiadochokinesia .
with approval of the local ethic committee and with the patient 's informed written consent , mri examinations of the brain were performed on a 1.5 t scanner ( avanto , siemens medical solutions , erlangen , germany ) in combination with using a vendor supplied 12-channel receive - only head coil and then mri examinations of the brain were done on a 7 t scanner ( magnetom 7 t , siemens medical solutions , erlangen , germany ) in combination with an 8-channel transmit - and - receive head coil ( rapid biomed , wuerzburg , germany ) .
the gradient - echo and turbo spin echo sequences were performed to obtain the axial proton density ( pd ) , t2 , t2 and susceptibility weighted images ( swi ) , which were optimized for each field strength ( table 1 ) .
in addition , proton ( h ) mr spectroscopy ( mrs ) was performed at 1.5 t .
the spectroscopic data was acquired from the patient 's cerebellar lesion using a single - voxel , point - resolved technique ( te = 135 ms ; tr = 1500 ms ) .
the resulting prominent resonances representing choline ( cho ) , creatine ( cr ) and n - acetylaspartate ( naa ) within the lesion were compared to the mirror image voxels on the white matter of the normal contralateral hemisphere .
spectral post - processing was performed using the software provided by the mri system manufacturer ( siemens syngo , vb 15 , siemens medical solutions , erlangen , germany ) . for 11 years
, repeated 1.5 t mri examinations revealed a slowly growing , non - enhancing tumor mass in the left cerebellar hemisphere with preservation of the gyral pattern .
thus , the present study was done without administration of contrast media . on mri at 1.5 t and 7 t , the posterior fossa tumor ( 493432 mm in size ) appeared mainly hyperintense on the t2-weighted images ( fig .
1a ) and iso - hypointense on the proton density images ( not shown ) . the characteristic striated pattern of the lesion was best displayed on the t2-weighted images at both field strengths ( fig .
the tumor caused descensus of the cerebellar tonsils , but any obstructive supratentorial hydrocephalus was absent .
due to their high sensitivity for paramagnetic substances like deoxyhemoglobin , the swi and t2 weighted images revealed thin veins running deep between the thickened folia of the cerebellar lesion in great detail ( fig .
the 7 t swi minimal intensity projection ( mip ) images depicted thin vessel branches as small as 250 m , whereas the 1.5 t swi mip images could only resolve larger vessels to a size of 450 m . compared to the 1.5 t swi images ( fig .
1c ) the medial displacement and compression of the dentate nucleus by the tumor were much better registered on 7 t swi images ( fig .
the h - mrs at 1.5 t demonstrated a reduction in naa and a prominent lactate peak .
contrary to other previous reports , the cho , cr and the resulting cho / cr ratio were slightly elevated in the lesion and the myoinositol ( mi ) levels were not changed ( 3 , 4 ) . thus far , neurosurgical therapy and histopathological examination have not been performed because the lesion exerted only mild compression of the iv ventricle without any hydrocephalus .
a dna analysis revealed a heterozygous mutation in exon 5 of the pten gene ( chromosome 10 q23 ) , and this supported the diagnosis of ldd ( c. 388c > t ; p. arg130x ) .
for 11 years , repeated 1.5 t mri examinations revealed a slowly growing , non - enhancing tumor mass in the left cerebellar hemisphere with preservation of the gyral pattern .
thus , the present study was done without administration of contrast media . on mri at 1.5 t and 7 t , the posterior fossa tumor ( 493432 mm in size ) appeared mainly hyperintense on the t2-weighted images ( fig .
1a ) and iso - hypointense on the proton density images ( not shown ) . the characteristic striated pattern of the lesion was best displayed on the t2-weighted images at both field strengths ( fig .
the tumor caused descensus of the cerebellar tonsils , but any obstructive supratentorial hydrocephalus was absent .
due to their high sensitivity for paramagnetic substances like deoxyhemoglobin , the swi and t2 weighted images revealed thin veins running deep between the thickened folia of the cerebellar lesion in great detail ( fig .
images depicted thin vessel branches as small as 250 m , whereas the 1.5 t swi mip images could only resolve larger vessels to a size of 450 m . compared to the 1.5 t swi images ( fig .
1c ) the medial displacement and compression of the dentate nucleus by the tumor were much better registered on 7 t swi images ( fig .
the h - mrs at 1.5 t demonstrated a reduction in naa and a prominent lactate peak .
contrary to other previous reports , the cho , cr and the resulting cho / cr ratio were slightly elevated in the lesion and the myoinositol ( mi ) levels were not changed ( 3 , 4 ) . thus far ,
neurosurgical therapy and histopathological examination have not been performed because the lesion exerted only mild compression of the iv ventricle without any hydrocephalus .
a dna analysis revealed a heterozygous mutation in exon 5 of the pten gene ( chromosome 10 q23 ) , and this supported the diagnosis of ldd ( c. 388c > t ; p. arg130x ) .
lhermitte - duclos disease or dysplastic cerebellar gangliocytoma is a slowly enlarging mass within the cerebellar cortex , and patients with this malady present with headaches , occlusive hydrocephalus , cranial nerve palsies , gait ataxia and other symptoms of cerebellar dysfunction ( 1 ) . beside some pediatric cases ,
the majority of patients are diagnosed in the third or fourth decade of life without a gender predilection .
histopathologically , ldd is characterized by regional enlargement of the cerebellar stratum granulosum , an absence of the purkinje cell layer and progressive hypertrophy of the granular cell neurons with increased myelination of their axons in the expanded molecular layer ( 5 ) .
mri has proven to be the best imaging modality for revealing the characteristic appearance of ldd , and mri often enables physicians to make the diagnosis of ldd even without histopathological confirmation ( 3 , 4 , 6 - 10 ) .
the striated pattern of ldd is a result of the close apposition of the thickened cerebellar folia that are lacking their secondary arborization .
a non - enhancing , unilateral cerebellar mass in a middle - aged patient , which is characterized by a ' tiger - striped ' pattern of hyperintensity on the t2-weighted mr images and this respects the cerebellar margins , is typical of ldd ( 8) . to the best of our knowledge , this is the first reported case of ldd that has been examined by 7 t mri ultrahigh field mri systems ( 7 t ) with their increased signal - to - noise ratio ( snr ) and higher sensitivity to susceptibility contrast .
these systems are currently being tested for clinical applications and they allow for imaging anatomical structures with thinner sections , larger matrices and reduced acquisition times .
however , the clinical challenges associated with 7 t mri include higher specific absorption rates ( sar ) , non - uniformity of the transmitted radiofrequency field , non - homogeneity of the static magnetic field , increased susceptibility artifacts and potential physiological side - effects . moving from 1.5 t to 7 t mri , the t2 is shortened and the susceptibility contrast of paramagnetic substances ( e.g. deoxyhemoglobin , neuromelanin , iron ) is significantly amplified , which enables a superior illustration of the venous vasculature and cerebellar nuclei .
1.5 t swi was found to be helpful for detecting deep running veins around the thickened folia of ldd ( 3 ) .
7 t swi can demonstrate in greater detail veins that are even smaller than the voxel size , due to the associated paramagnetic effect , than the corresponding 1.5 t images ( fig .
1c - f ) because the sensitivity of mri scanners for paramagnetic substances increases in proportion to the applied magnetic field .
the deoxyhemoglobin in these veins helps to resolve the outer most layer of the ldd , which consists of the outer molecular layer , the leptomeninges and the associated abnormal vessels .
( 3 ) and kulkantrakorn et al . ( 7 ) reported good correlation of this mri pattern with the histological specimen . beside the characteristic striated pattern on the t2-weighted images , these abnormal veins surrounding the thickened folia on the swi images seem to be another unique feature of ldd . beside the preoperative identification of ldd , the higher resolution of 7 t swi
their anatomical relation is of clinical importance for planning surgical procedures because lesions affecting the cerebellar nuclei are associated with more severe symptoms than are cortical lesions .
h - mrs demonstrated a prominent lactate peak , suggesting increased glycolysis and the high metabolism of this ldd lesion ( 4 , 9 ) . decreased levels of cho , cr , naa and mi and the chr / cr are normally found on the side affected by the ldd ( 9 ) .
the slightly increased cho levels in our patient suggested increased demyelination and membrane turnover , whereas the decreased cho levels in the lesion suggested a non - neoplastic etiology of this lesion ( 4 , 9 ) . making the preoperative diagnosis of ldd via mri obviates the need for biopsy and this allows surgeons to plan an appropriate therapy , which consists of decompression of the posterior fossa by total surgical resection .
tumor resection has not yet been performed in our patient due to the mild clinical symptoms . in conclusion , as seen on mri , a non - enhancing , ' tigers striped ' cerebellar lesion with unilateral hemispheric expansion and preservation of the gyral pattern should be considered specific for ldd and these findings often allow making the preoperative diagnosis .
7 t mri more precisely reveals the known morphology and microstructure of this tumor entity than can 1.5 t mri .
especially , 7 t swi enables the identification of the outermost layer of ldd due to its inherent venous vasculature , and 7 t swi better displays the iron containing dentate nuclei .
hence , 7 t mri is expected to become a valuable tool for studying the cerebral microvascularity and tumor angiogenesis not only for ldd , but also for other resectable brain tumors . | lhermitte - duclos disease ( ldd ; dysplastic cerebellar gangliocytoma ) is a rare hamartomatous lesion of the cerebellar cortex and this was first described in 1920 .
ldd is considered to be part of the autosomal - dominant phacomatosis and cancer syndrome cowden disease ( cs ) .
we examined the brain of a 46-year - old man , who displayed the manifestations of cs , with 7 tesla ( t ) and 1.5 t mri and 1.5 t mr spectroscopy ( 1h - mrs ) .
we discuss the possible benefits of employing ultrahigh - field mri for making the diagnosis of this rare lesion . |
central nervous system ( cns ) involvement is a rare complication of acute promyelocytic leukemia ( apl ) and is encountered more frequently at the relapse stage than at presentation .
the cns is the most commonly affected site of extramedullary relapse in apl [ 1 , 2 ] .
the incidence of cns relapse ranges between 0.6% and 2% [ 2 - 4 ] .
furthermore , cns involvement at the time of presentation is very rare , and only few cases have been reported in medical literature [ 5 - 9 ] . in this paper , we report 2 cases of apl with cns involvement at the time of disease presentation .
a 43-yr - old woman presented with easy bruising for a month and stuporous mentality for several hours in february 2009 .
initial laboratory evaluation showed a white blood cell ( wbc ) count of 48.610/l with 87% blasts , a hemoglobin count of 31
prothrombin time ( pt ) and activated partial thromboplastin time ( aptt ) at the time of admission were 14.5 sec ( 59% of normal ) and 28.3 sec , respectively .
the findings of other coagulation tests were as follows : fibrinogen level , 1.14 g / l ; fibrin / fibrinogen degradation product level , 546.8 mg / l ; and d - dimer level , 283,600 g / l .
numerous hypergranular promyelocytes ( 42% ) and myeloblasts ( 41% ) were visualized on bone marrow ( bm ) examination .
immunophenotyping of the bm revealed that leukemic cells were positive for cd13 , cd33 , cd117 , and cd65 and negative for cd34 , cd15 , and cd2 .
the chromosomal analysis of bm cells showed the karyotype 46,xx , t(15;17)(q22;q21)/46,xx , der(15)t(15;17)(q22;q21),ider(q10)(15;17 ) in 17 of the 20 metaphase cells .
reverse transcriptase pcr ( rt - pcr ) showed a bcr1 isoform of the pml - rar fusion transcript in the bm specimen . for rt - pcr ,
total rna was extracted from the bm cells using a high pure rna isolation kit ( roche diagnostics , mannheim , germany ) , and reverse transcription was performed using moloney murine leukemia virus transcriptase enzyme ( invitrogen , carlsbad , ca , usa ) and a hexanucleotide mixture ( roche diagnostics ) .
nested pcr was performed using geneamp pcr system 9600 ( perkin - elmer , norwalk , ct , usa ) .
a lumbar puncture was performed to investigate the cause of her stuporous mentality ; and cerebrospinal fluid ( csf ) analysis revealed a wbc count of 2.210/l , red blood cell ( rbc ) count of 0.1610/l , and leukemic promyelocyte proportion of 97% in the bloody background ( fig .
cytospins were prepared from csf cells using a shandon cytospin 3 ( shandon , astmoore , uk ) .
the loading volume was 5 drops and centrifugation was performed at 700 rpm for 5 min .
induction chemotherapy with all - trans - retinoic acid ( atra ) and idarubicin was initiated and intrathecal methotrexate ( 20 mg ) was administered simultaneously . however , the patient 's mentality and clinical condition worsened progressively and she died due to septic shock by infection and rapid disease progression only 3 days after admission . a 3-yr - old girl presented with easy bruising and epistaxis for several days in august 2007 .
her initial laboratory evaluation revealed pancytopenia with a wbc count of 3.810/l and 8% blasts , hemoglobin level of 46
immunophenotyping of bm leukemic cells showed that they were positive for cd13 , cd33 , and cd117 and negative for cd34 , hla - dr , and cd2 .
the chromosomal analysis showed the karyotype 46,xx , t(15;17)(q22;q21 ) in 7 of 20 metaphase cells .
rt - pcr of the bm specimen showed the bcr3 isoform of the pml - rar fusion transcript and the ratio of pml - rar/abl determined by with quantitative pcr was 0.33 .
csf analysis revealed 9.5% leukemic promyelocytes ( 2 of 21 cells ) with a wbc count of 0.00210/l without rbcs .
the patient received induction chemotherapy with atra , idarubicin , and cytarabine , and intrathecal cytarabine ( 40 mg ) as per the protocol .
a 43-yr - old woman presented with easy bruising for a month and stuporous mentality for several hours in february 2009 .
initial laboratory evaluation showed a white blood cell ( wbc ) count of 48.610/l with 87% blasts , a hemoglobin count of 31
prothrombin time ( pt ) and activated partial thromboplastin time ( aptt ) at the time of admission were 14.5 sec ( 59% of normal ) and 28.3 sec , respectively .
the findings of other coagulation tests were as follows : fibrinogen level , 1.14 g / l ; fibrin / fibrinogen degradation product level , 546.8 mg / l ; and d - dimer level , 283,600 g / l .
numerous hypergranular promyelocytes ( 42% ) and myeloblasts ( 41% ) were visualized on bone marrow ( bm ) examination .
immunophenotyping of the bm revealed that leukemic cells were positive for cd13 , cd33 , cd117 , and cd65 and negative for cd34 , cd15 , and cd2 .
the chromosomal analysis of bm cells showed the karyotype 46,xx , t(15;17)(q22;q21)/46,xx , der(15)t(15;17)(q22;q21),ider(q10)(15;17 ) in 17 of the 20 metaphase cells .
reverse transcriptase pcr ( rt - pcr ) showed a bcr1 isoform of the pml - rar fusion transcript in the bm specimen . for rt - pcr ,
total rna was extracted from the bm cells using a high pure rna isolation kit ( roche diagnostics , mannheim , germany ) , and reverse transcription was performed using moloney murine leukemia virus transcriptase enzyme ( invitrogen , carlsbad , ca , usa ) and a hexanucleotide mixture ( roche diagnostics ) .
nested pcr was performed using geneamp pcr system 9600 ( perkin - elmer , norwalk , ct , usa ) .
a lumbar puncture was performed to investigate the cause of her stuporous mentality ; and cerebrospinal fluid ( csf ) analysis revealed a wbc count of 2.210/l , red blood cell ( rbc ) count of 0.1610/l , and leukemic promyelocyte proportion of 97% in the bloody background ( fig .
cytospins were prepared from csf cells using a shandon cytospin 3 ( shandon , astmoore , uk ) .
the loading volume was 5 drops and centrifugation was performed at 700 rpm for 5 min .
induction chemotherapy with all - trans - retinoic acid ( atra ) and idarubicin was initiated and intrathecal methotrexate ( 20 mg ) was administered simultaneously
. however , the patient 's mentality and clinical condition worsened progressively and she died due to septic shock by infection and rapid disease progression only 3 days after admission .
a 3-yr - old girl presented with easy bruising and epistaxis for several days in august 2007 .
her initial laboratory evaluation revealed pancytopenia with a wbc count of 3.810/l and 8% blasts , hemoglobin level of 46
immunophenotyping of bm leukemic cells showed that they were positive for cd13 , cd33 , and cd117 and negative for cd34 , hla - dr , and cd2 .
the chromosomal analysis showed the karyotype 46,xx , t(15;17)(q22;q21 ) in 7 of 20 metaphase cells .
rt - pcr of the bm specimen showed the bcr3 isoform of the pml - rar fusion transcript and the ratio of pml - rar/abl determined by with quantitative pcr was 0.33 .
csf analysis revealed 9.5% leukemic promyelocytes ( 2 of 21 cells ) with a wbc count of 0.00210/l without rbcs .
the patient received induction chemotherapy with atra , idarubicin , and cytarabine , and intrathecal cytarabine ( 40 mg ) as per the protocol .
apl is a unique disease entity associated with distinctive morphology and chromosomal abnormality , and it is often accompanied by severe coagulopathy . in these cases , performing a lumbar puncture at disease presentation or induction therapy is extremely hazardous because of frequently encountered bleeding diathesis and therefore , not recommended in patients with newly diagnosed apl in general .
however , the presence of neurological symptoms such as headache , vertigo , nausea , vomiting , visual disturbance , seizure , and altered mental state [ 13 , 14 ] , necessitate a lumbar puncture both for diagnostic and therapeutic purposes [ 9 , 12 ] . in our cases ,
the first patient presented with altered mentality , and the second patient had no neurological symptoms .
however , in the hematology and oncology division of the pediatric department in our institution , all apl patients undergo prophylactic lumbar punctures irrespective of their age or presence of neurological symptoms .
recommended lumbar puncture at the time of apl diagnosis , immediately after the resolution of coagulopathy in order to diagnose cns involvement . in case 2 , the 3-yr - old girl was unable to express the disease - related symptoms accurately .
in addition , csf analysis , showed a smaller number of leukemic cells ( 2 of 21 cells , wbc count , 0.00210/l ) than that in case 1 ( leukemic promyelocytes , 97% ; wbc 2.210/l ) .
there have been several reports of patients with apl presenting with cns involvement in apl at the time of initial diagnosis ( table 1 ) .
two cases of apl with cns involvement have been reported in korea [ 13 , 15 ] , and in both of these cases , cns was affected during relapse : one showed cns involvement with molecular relapse in the bm , and the second showed cns involvement with hematologic remission in the bm . to our knowledge , our report is the first to present cases of cns involvement at the time of diagnosis of apl in korea .
treatment of cns involvement in apl can be diverse and can also be case - specific .
cns therapy comprises of intrathecal chemotherapy , for example , cytarabine , methotrexate and hydrocortisone , and cns irradiation , while systemic therapy involves the administration of atra in addition to chemotherapy [ 3 , 14 ] .
no molecular studies were performed with the csf specimen in either of the patients , because cytological examination of csf was considered sufficient to diagnose cns involvement .
however , this limited the comparison of our cases with a recently reported case , because we did not have data on the pml - rar fusion transcript in the csf leukemic cells . in summary
, we describe 2 cases of apl with cns involvement at the time of presentation .
although cns involvement is a very rare event in apl at the time of initial diagnosis , we believe that apl patients with neurological symptoms must be evaluated for cns involvement by performing a lumbar puncture . | central nervous system ( cns ) involvement in acute promyelocytic leukemia ( apl ) is rare , and the presence of cns symptoms at the time of diagnosis of apl is even rarer .
we report 2 cases of apl presenting with cns involvement . a 43-yr - old woman presented with easy bruising and stuporous mentality .
her complete blood count ( cbc ) revealed leukocytosis with increased blasts .
bone marrow ( bm ) analysis was carried out , and the diagnosis of apl was confirmed .
this was done by cytogenetic analysis and demonstration of pml - rar rearrangement by reverse transcriptase pcr in the bm cells .
a lumbar puncture was performed to investigate the cause of her stuporous mentality , and her cerebrospinal fluid ( csf ) analysis revealed 97% leukemic promyelocytes . despite systemic and cns therapy , she died due to septic shock by infection and rapid disease progression only 3 days after her admission .
another patient , a 3-yr - old girl , presented with easy bruising and epistaxis , and her cbc showed pancytopenia with increased blasts .
bm studies confirmed apl .
quantitative pcr for pml - rar in the bm cells revealed a pml - rar/abl ratio of 0.33 and csf analysis revealed 9.5% leukemic promyelocytes ( 2 of 21 cells ) .
she received induction chemotherapy and intrathecal therapy and achieved complete remission ( cr ) in the bm and cns .
she has been maintained in the cr status for the past 31 months .
thus , patients with apl must be evaluated for cns involvement if any neurological symptoms are present at the time of diagnosis . |
members of the genus trichophyton are the most common agents of dermatophytosis in humans and other animals , and are associated with a variety of clinical aspects ( 1 - 3 ) .
the most frequent species of dermatophytes are trichophyton
mentagrophytes , t. tonsurans , and t. rubrum , and these species cause a multiplicity of cutaneous disorders .
they are keratinophilic fungi that attack keratinized tissue and cause a wide spectrum of clinical manifestations that vary from mild to severe , but infections are not life - threatening . owing to the high degree of phenotypic similarity among species , identification is difficult .
conventional approaches for species - level identification in the diagnostic laboratory are based on morphological and physiological criteria , require several days or weeks to obtain results , and are frequently unspecific . to overcome these problems ,
molecular techniques have recently been developed to rapidly and precisely identify species of trichophyton that potentially cause human infection .
numerous recent articles and reviews have exhaustively discussed the various molecular techniques available for dermatophyte species identification .
molecular tools , such as sequencing of the internal transcribed spacer ( its ) region of ribosomal dna ( rdna ) , have shown promise for species identification in all genera of dermatophytes , and is relatively expensive ( 4 - 7 ) . moreover , its - based analyses have found that sequence variation is limited to only one or a few single nucleotide polymorphisms ( snps ) between certain species , e.g. , t. tonsurans and t. equinum or t. rubrum and t. soudanense ( 7 ) .
this limited genetic variation suggests that the development of alternative molecular tools with sufficient specificity , reproducibility , and sensitivity is highly necessary ( 8) .
rolling - circle amplification ( rca ) is a powerful and simple procedure for distinguishing closely related taxa at the species level ; it is based on the rolling replication of short single - stranded dna circles via specific dna polymerases under isothermal conditions .
this enables the detection of target nucleic acid sequences , including snps , with high specificity ( 9 - 12 ) .
the objective of the current study is to establish the use of rca based on its rdna to rapidly identify trichophyton species that potentially cause human and animal disorders .
in the current study , all samples were obtained from different human sources that were referred to the mycology laboratory at tooba clinic , mazandaran university of medical sciences , iran and were suspected dermatophytosis cases .
the study protocol was approved by the medical research ethics committee of mazandaran university of medical sciences ( ethical no .
90 - 2 - 28/90 - 14 ) and since the laboratory diagnosis was part of the patients routine care , informed consent for research purposes was not specifically obtained .
a total of 61 isolates belonging to three species of trichophyton including the three reference strains t. rubrum ( centraalbureau voor schimmelcultures : cbs 130927 ) , t. mentagrophytes var .
interdigitale ( national biological resource center : nbrc 5812 ) , and t. tonsurans ( nbrc 5928 ) were examined .
all clinical samples from suspected patients were cultured on plates of sabouraud glucose agar ( merck , darmstadt , germany ) , with chloramphenicol and cycloheximide ( scc ) .
the trichophyton species were identified based on microscopic morphology and in vitro tests including urease and hair perforating tests , as required .
first , trichophyton species were grown on sabouraud dextrose agar ( sda , difco , usa ) for 10 days at 24c in dark conditions .
a sterile blade was used to scrape off the hyphae from the surface of the plate , which were transferred to a 2-ml eppendorf tube containing 1 ml of lysis buffer ( 200 mm tris - hcl , ph 8.0 , with 25 mm edta , 0.5% [ wt / vol ] sodium dodecyl sulfate , and 250 mm nacl ) .
cells were mechanically disrupted with a conical grinder for approximately 1 min , and then incubated at 100c for 15 min .
next , 150 l of 3.0 m sodium acetate buffer was added , the mixture was vortexed and incubated for 10 min at -20c , and the solution was mixed and centrifuged for 5 min at 10,000 g .
the supernatant was transferred to a new tube and phenol / chloroform ( 1:1 , v / v ) was used for extraction .
dna was allowed to precipitate with an equal volume of isopropanol for 10 min at -20c and then centrifuged for 5 min at 10,000 rpm .
the pellets were washed with cold 70% ethanol , dried at room temperature , resuspended in 97.5 ml of te - buffer with 2.5 ml of rnase ( 20 u / ml ) , and incubated for 5 min at 37c .
the ribosomal dna internal transcribed spacers ( i.e. , the its region of rdna ) were amplified using the universal primers its1 ( 5-tcc - gtaggtgaacctgcgg-3 ) and its4 ( 5-tcctccgcttattgatatgc-3 ) ( 13 ) .
pcr reactions were performed on a tc-312 thermal cycler ( techne , duxford , cambridge , united kingdom ) in 25-ml volumes containing 25 ng of template dna , 2.5 ml of reaction buffer ( 0.1 m tris - hcl , ph 8.0 , 0.5 m kcl , 15 mm mgcl2 , 0.1% gelatin , and 1% triton x-100 ) , 0.2 mm of each dntp , and 2.0 u of taq dna polymerase .
amplification was performed as follows : 2 min at 94c for primary denaturation , followed by 35 cycles at 94c ( 45 s ) , 52c ( 30 s ) , and 72c ( 120 s ) , with a final 7-min extension step at 72c .
pcr products were visualized by 1.5% ( w / v ) agarose gel electrophoresis in tbe buffer , stained with ethidium bromide ( 0.5 g / ml ) , and photographed under uv transillumination .
the approximate length of the three specific circular oligonucleotide probes for t. rubrum , t. mentagrophytes
var .
interdigitale , and t. tonsurans used in this study was 96 to 102 bp , and comprised two target - complementary segments connected by a genetic linker sequence .
( 8) to minimize similarity between closely related strains and to allow primer binding during rca
. however , specific padlock probes targeting the its1 and its2 regions were modified , and rca primers designed to specifically bind the linker region of the probes were synthesized by anaspec inc .
purified pcr products ( 1 l ) were mixed with 2 u pfu ( 1 l ) dna ligase ( bioneer iso 13485 , alameda , ca , usa ) and 1 l of padlock probe in 500 mm tris - hcl ( ph 7.5 ) , 50 mm kcl , 100 mm mgcl2 , 2.5 l / ml bovine serum albumin ( ph 7.5 ) , 10 mm atp , and 50 mm dtt with a total reaction volume of 10 l .
multiple cycle ligations were conducted with one cycle of denaturation at 94c of 5 min , followed by five cycles at 94c for 30 s and 4 min of ligation at 62c .
rca reactions were performed in a 25-l volume containing 8 u of bst dna polymerase ( new england biolabs , ipswich , ma , usa ) , 200 m deoxynucleoside triphosphate mix , 1 l of each rca primer , and 2 l of ligation product .
probe signals were amplified by incubation at 65c for 60 min and 85c for 2 min , and the accumulation of double - stranded dna products was detected by electrophoresis on 1% agarose containing ethidium bromide ( sigma , st .
ladder - like patterns were interpreted as positive reactions , while negative reactions showed no illumination .
in the current study , all samples were obtained from different human sources that were referred to the mycology laboratory at tooba clinic , mazandaran university of medical sciences , iran and were suspected dermatophytosis cases .
the study protocol was approved by the medical research ethics committee of mazandaran university of medical sciences ( ethical no .
90 - 2 - 28/90 - 14 ) and since the laboratory diagnosis was part of the patients routine care , informed consent for research purposes was not specifically obtained .
a total of 61 isolates belonging to three species of trichophyton including the three reference strains t. rubrum ( centraalbureau voor schimmelcultures : cbs 130927 ) , t. mentagrophytes var .
interdigitale ( national biological resource center : nbrc 5812 ) , and t. tonsurans ( nbrc 5928 ) were examined .
all clinical samples from suspected patients were cultured on plates of sabouraud glucose agar ( merck , darmstadt , germany ) , with chloramphenicol and cycloheximide ( scc ) .
the trichophyton species were identified based on microscopic morphology and in vitro tests including urease and hair perforating tests , as required .
first , trichophyton species were grown on sabouraud dextrose agar ( sda , difco , usa ) for 10 days at 24c in dark conditions .
a sterile blade was used to scrape off the hyphae from the surface of the plate , which were transferred to a 2-ml eppendorf tube containing 1 ml of lysis buffer ( 200 mm tris - hcl , ph 8.0 , with 25 mm edta , 0.5% [ wt / vol ] sodium dodecyl sulfate , and 250 mm nacl ) .
cells were mechanically disrupted with a conical grinder for approximately 1 min , and then incubated at 100c for 15 min .
next , 150 l of 3.0 m sodium acetate buffer was added , the mixture was vortexed and incubated for 10 min at -20c , and the solution was mixed and centrifuged for 5 min at 10,000 g .
the supernatant was transferred to a new tube and phenol / chloroform ( 1:1 , v / v ) was used for extraction .
dna was allowed to precipitate with an equal volume of isopropanol for 10 min at -20c and then centrifuged for 5 min at 10,000 rpm .
the pellets were washed with cold 70% ethanol , dried at room temperature , resuspended in 97.5 ml of te - buffer with 2.5 ml of rnase ( 20 u / ml ) , and incubated for 5 min at 37c .
the ribosomal dna internal transcribed spacers ( i.e. , the its region of rdna ) were amplified using the universal primers its1 ( 5-tcc - gtaggtgaacctgcgg-3 ) and its4 ( 5-tcctccgcttattgatatgc-3 ) ( 13 ) .
pcr reactions were performed on a tc-312 thermal cycler ( techne , duxford , cambridge , united kingdom ) in 25-ml volumes containing 25 ng of template dna , 2.5 ml of reaction buffer ( 0.1 m tris - hcl , ph 8.0 , 0.5 m kcl , 15 mm mgcl2 , 0.1% gelatin , and 1% triton x-100 ) , 0.2 mm of each dntp , and 2.0 u of taq dna polymerase .
amplification was performed as follows : 2 min at 94c for primary denaturation , followed by 35 cycles at 94c ( 45 s ) , 52c ( 30 s ) , and 72c ( 120 s ) , with a final 7-min extension step at 72c .
pcr products were visualized by 1.5% ( w / v ) agarose gel electrophoresis in tbe buffer , stained with ethidium bromide ( 0.5 g / ml ) , and photographed under uv transillumination .
the approximate length of the three specific circular oligonucleotide probes for t. rubrum , t. mentagrophytes
var .
interdigitale , and t. tonsurans used in this study was 96 to 102 bp , and comprised two target - complementary segments connected by a genetic linker sequence .
( 8) to minimize similarity between closely related strains and to allow primer binding during rca
. however , specific padlock probes targeting the its1 and its2 regions were modified , and rca primers designed to specifically bind the linker region of the probes were synthesized by anaspec inc .
purified pcr products ( 1 l ) were mixed with 2 u pfu ( 1 l ) dna ligase ( bioneer iso 13485 , alameda , ca , usa ) and 1 l of padlock probe in 500 mm tris - hcl ( ph 7.5 ) , 50 mm kcl , 100 mm mgcl2 , 2.5 l / ml bovine serum albumin ( ph 7.5 ) , 10 mm atp , and 50 mm dtt with a total reaction volume of 10 l .
multiple cycle ligations were conducted with one cycle of denaturation at 94c of 5 min , followed by five cycles at 94c for 30 s and 4 min of ligation at 62c .
rca reactions were performed in a 25-l volume containing 8 u of bst dna polymerase ( new england biolabs , ipswich , ma , usa ) , 200 m deoxynucleoside triphosphate mix , 1 l of each rca primer , and 2 l of ligation product .
probe signals were amplified by incubation at 65c for 60 min and 85c for 2 min , and the accumulation of double - stranded dna products was detected by electrophoresis on 1% agarose containing ethidium bromide ( sigma , st .
ladder - like patterns were interpreted as positive reactions , while negative reactions showed no illumination .
first , trichophyton species were grown on sabouraud dextrose agar ( sda , difco , usa ) for 10 days at 24c in dark conditions .
a sterile blade was used to scrape off the hyphae from the surface of the plate , which were transferred to a 2-ml eppendorf tube containing 1 ml of lysis buffer ( 200 mm tris - hcl , ph 8.0 , with 25 mm edta , 0.5% [ wt / vol ] sodium dodecyl sulfate , and 250 mm nacl ) .
cells were mechanically disrupted with a conical grinder for approximately 1 min , and then incubated at 100c for 15 min .
next , 150 l of 3.0 m sodium acetate buffer was added , the mixture was vortexed and incubated for 10 min at -20c , and the solution was mixed and centrifuged for 5 min at 10,000 g .
the supernatant was transferred to a new tube and phenol / chloroform ( 1:1 , v / v ) was used for extraction .
dna was allowed to precipitate with an equal volume of isopropanol for 10 min at -20c and then centrifuged for 5 min at 10,000 rpm .
the pellets were washed with cold 70% ethanol , dried at room temperature , resuspended in 97.5 ml of te - buffer with 2.5 ml of rnase ( 20 u / ml ) , and incubated for 5 min at 37c .
the ribosomal dna internal transcribed spacers ( i.e. , the its region of rdna ) were amplified using the universal primers its1 ( 5-tcc - gtaggtgaacctgcgg-3 ) and its4 ( 5-tcctccgcttattgatatgc-3 ) ( 13 ) .
pcr reactions were performed on a tc-312 thermal cycler ( techne , duxford , cambridge , united kingdom ) in 25-ml volumes containing 25 ng of template dna , 2.5 ml of reaction buffer ( 0.1 m tris - hcl , ph 8.0 , 0.5 m kcl , 15 mm mgcl2 , 0.1% gelatin , and 1% triton x-100 ) , 0.2 mm of each dntp , and 2.0 u of taq dna polymerase .
amplification was performed as follows : 2 min at 94c for primary denaturation , followed by 35 cycles at 94c ( 45 s ) , 52c ( 30 s ) , and 72c ( 120 s ) , with a final 7-min extension step at 72c .
pcr products were visualized by 1.5% ( w / v ) agarose gel electrophoresis in tbe buffer , stained with ethidium bromide ( 0.5 g / ml ) , and photographed under uv transillumination .
the approximate length of the three specific circular oligonucleotide probes for t. rubrum , t. mentagrophytes
var .
interdigitale , and t. tonsurans used in this study was 96 to 102 bp , and comprised two target - complementary segments connected by a genetic linker sequence .
( 8) to minimize similarity between closely related strains and to allow primer binding during rca
. however , specific padlock probes targeting the its1 and its2 regions were modified , and rca primers designed to specifically bind the linker region of the probes were synthesized by anaspec inc .
purified pcr products ( 1 l ) were mixed with 2 u pfu ( 1 l ) dna ligase ( bioneer iso 13485 , alameda , ca , usa ) and 1 l of padlock probe in 500 mm tris - hcl ( ph 7.5 ) , 50 mm kcl , 100 mm mgcl2 , 2.5 l / ml bovine serum albumin ( ph 7.5 ) , 10 mm atp , and 50 mm dtt with a total reaction volume of 10 l .
multiple cycle ligations were conducted with one cycle of denaturation at 94c of 5 min , followed by five cycles at 94c for 30 s and 4 min of ligation at 62c .
rca reactions were performed in a 25-l volume containing 8 u of bst dna polymerase ( new england biolabs , ipswich , ma , usa ) , 200 m deoxynucleoside triphosphate mix , 1 l of each rca primer , and 2 l of ligation product .
probe signals were amplified by incubation at 65c for 60 min and 85c for 2 min , and the accumulation of double - stranded dna products was detected by electrophoresis on 1% agarose containing ethidium bromide ( sigma , st .
ladder - like patterns were interpreted as positive reactions , while negative reactions showed no illumination .
the trichophyton species were not easily differentiated from each other based on mycological criteria . of the 61 clinically isolated samples , 31
isolates ( 50.8% ) were identified as t. mentagrophytes var interdigitale , 11 isolates ( 18.2% ) as t. rubrum , 9 isolates ( 14.7% ) as t. tonsurans , and 1 isolate as ( 1.8% ) t. violaceum .
rca and subsequent detection by gel electrophoresis yielded positive results , and the test proved to be 100% specific for each species .
neither cross - reaction between the examined species of trichophyton nor false positive or false negative results were observed ( figure 1 ) .
positive rca reactions were visualized by uv irradiation as ladder - like , strongly illuminated smears on 1.2% agarose gels , while the background remained clean for negative reactions ( figure 1 ) .
rca reactions were performed for all isolates ; 45 isolates ( 73.3% ) were positive for the probe specific to t. mentagrophytes , 8 isolates ( 13.1% ) for the probe specific to t. rubrum , and 4 isolates ( 6.6% ) for the probe specific to t. tonsurans ( figure 1 ) . however , four isolates ( 8.6% ) did not test positive using any of the three species - specific padlock probes and probably represented separate dermatophyte species .
members of the genus trichophyton are the most common agents of dermatophytosis in humans and other animals .
identification of trichophyton species is essentially based on macroscopic and microscopic observations of their morphological features ; however , the identification is complicated and laborious owing to the morphological similarity , polymorphism and cultural variability of trichophyton species .
thus , accurate identification is time - consuming and requires a significant level of knowledge and technological expertise ( 4 ) .
its - based analyses have found that sequence variation is limited to only one or a few snps between certain species , such as between t. tonsurans and t. equinum , and between t. rubrum and t. soudanense ( 7 ) .
although sequencing of the its region of rdna is currently the gold standard for the identification of trichophyton species and relatives , the technique is relatively expensive and time - consuming , and is impractical for the analysis of large numbers of isolates for epidemiological studies . to overcome these problems ,
recently , isothermal techniques , such as loop - mediated amplification and rca , have been applied for rapid identification .
the use of circularizable oligonucleotides or padlock probes is based on the rolling replication of short single - stranded dna circles by certain dna polymerases under isothermal conditions to detect target nucleic acid sequences , including snps , with high specificity ( 9 - 16 ) .
such probes comprise two sequences that are complementary to the 5 and 3 termini of the target sequence joined by a genetic linker region . upon hybridization to the target
, the two probe ends become juxtaposed and are joined by dna ligase to form a closed molecule .
the intensity of the signal generated by the probe is then increased exponentially by hyper branching or rca , and 109-fold signal amplification of each circle can be achieved within 90 min ( 8 , 13 , 17 ) .
the rca technique was initially established by fire and xu ( 18 ) and liu et al .
it is one of a series of robust and simple techniques for distinguishing closely related taxa at the species as well as the strain level .
rca is a rapid ( requiring less than 1 working day ) , specific ( to the single - nucleotide level ) , and economical ( requiring minimal equipment ) tool for fungal screening ( 20 , 21 ) .
previous studies have shown that trichophyton species have several unique nucleotide positions suitable for the development of specific padlock probes for species characterization ; these can be used to distinguishing closely related species ( 8) .
in this study , species - specific padlock probes were used to distinguish three species of trichophyton , t. mentagrophytes , t. rubrum , and t. tonsurans . using species - specific probes , we correctly identified all clinical isolates . three standard species of trichophyton , t. rubrum ( cbs 130927 ) , t. mentagrophytes var .
interdigitale ( nbrc 5812 ) , and t. tonsurans ( nbrc 5928 ) were also positively identified using only the species - specific padlock probes .
the sequencing results for the its regions of rdna showed 100% concordance with the rca results . additionally , these results were perfectly concordant with phenotypic identification .
the rca procedure required less than one working day , including dna extraction , pcr amplification , hybridization , ligation of padlock probes , and rca amplification , rather than sequencing . while the results of this study can be applied generally
( 8) , the specificity of the t. tonsurans probe ( tt - its2 ) is ambiguous because t. equinum is highly closely related .
the two species differ by only a single base in the its1 region ( 7 , 22 ) ; therefore , the its region does not have sufficient discrimination ability . designing padlock probes that target other genes , such as -tubulin ( bt2 ) and translation elongation factor 1- ( tef1 ) , may be beneficial . in conclusion ,
species identification of trichophyton is important for epidemiological and phylogenetic purposes and for genotype delineation . despite the shortcomings of current molecular identification systems ,
there is a strong stimulus for the continued use of its polymorphisms to generate identification barcodes .
therefore , the rca - based assay is an alternative to dna sequencing for species identification . | background : the high degree of phenotypic similarity among trichophyton species makes their identification difficult.objectives:the current study aims to establish the use of rolling circle amplification ( rca ) based on internal transcribed spacer ribosomal dna ( its rdna ) as a powerful , simple , and rapid procedure for distinguishing closely related organisms , and specifically to identify trichophyton species , which cause human and animal disorders.materials and methods : a total of sixty - one isolates belonging to three species of trichophyton were identified to the species level based on microscopic and macroscopic examinations and their its rdna regions were sequenced .
three specific circular oligonucleotide probes targeting the its1 and its2 regions were designed to differentiate trichophyton rubrum , t. mentagrophytes , and t. tonsurans.results:of the 61 putative trichophyton clinical isolates , 52 were identified to the species level .
the most common species was t. mentagrophytes var .
interdigitale ( 31 isolates ) , followed by t. rubrum ( 11 isolates ) , t. tonsurans ( 9 isolates ) , and t. violaceum ( 1 isolates ) ; moreover , 9 isolates were identified as non - trichophyton species .
the rca method correctly identified four trichophyton species and was 100% specific for each species .
neither cross - reaction between the examined species of trichophyton nor false positive or false negative results were observed.conclusions:species identification of trichophyton is crucially important for epidemiological and phylogenetic purposes and for genotype delineation .
rca based on its polymorphisms can be used to generate identification barcodes and as an alternative to dna sequencing ; it is a very fast , specific , and economical tool for species identification . |
the appearance of multiple malignancies in the same patient is a rare occurrence , which can either be synchronous or metachronous .
the incidence of multiple malignancies varies with age , sex , geographic origin , and site and type of tumors .
the etiology is multifactorial , and some of the factors involved in the pathogenesis of these conditions include genetic predisposition , immunodeficiency , radiation therapy , chemotherapy , and various infectious agents , including epstein barr virus ( ebv ) .
there are several reports of patients with a hematologic malignancy who develop a non - hematologic cancer [ 25 ] , but only few case reports describe patients with multiple hematologic and non - hematologic malignancies [ 6 , 7 ] .
we describe here the unusual case of a patient who developed low - grade follicular lymphoma , squamous cell carcinoma of the lung , diffuse large b cell lymphoma ( dlbcl ) with a clonality distinct from the follicular lymphoma , peripheral t cell lymphoma of the skin , and systemic peripheral t cell lymphoma consistent with anaplastic lymphoma kinase ( alk)-negative anaplastic large cell lymphoma ( alcl ) that was clonally related to the cutaneous lymphoma .
we discuss the possibility of a relationship between these different neoplasms developing in the same patient and the importance of understanding various risk factors involved in the development of multiple malignancies .
in 2003 , a 62-year - old former smoker with known asbestos exposure was admitted to the hospital for chest pain and cough .
he reported a family history of malignancies , in that his father died of lip cancer , a maternal uncle from lymphoma and lung cancer , and a second cousin from lung cancer .
chest x - ray demonstrated adenopathy , and a paratracheal lymph node biopsy showed grade 1 of 3 follicular lymphoma ( table 1 ) .
conventional cytogenetics performed on the lymph node revealed a complex karyotype , with a t(14;18 ) ; flow cytometry revealed a lambda light - chain - restricted b cell population ( table 2 , fig .
he was treated with three cycles of fludarabine , cytoxan and rituxan ( fcr ) .
the patient had a partial remission and was followed up every 4 months . in late 2005
a chest x - ray showed a left hilar lesion . a subsequent pet - ct scan showed a left hilar mass , a 9-cm mass in the spleen , and additional pet avid lymph nodes in the left neck , paraesophageal region , and abdomen .
the patient then had a bronchoscopy and transbronchial biopsy ; the biopsy showed a poorly differentiated squamous cell carcinoma ( table 1 ) .
in early 2006 , a left neck lymph node was excised on which a diagnosis of dlbcl was rendered ( table 1 , fig .
cytogenetic analysis of the lymph node revealed a bcl6 gene rearrangement ( confirmed by metaphase fluorescence in situ hybridization [ fish ] ) and a complex karyotype distinct from the prior findings of 2003 , and flow cytometric analysis revealed a kappa light - chain - restricted b cell population ( table 2 , fig .
immunoglobulin heavy chain ( igh ) gene rearrangement studies by polymerase chain reaction ( pcr ) showed the presence of a clonal b cell population ( table 2 , fig .
4b d ) . since the patient was not a surgical candidate for the non - small cell lung cancer , two cycles of cisplatin and etoposide ( vp-16 ) were administered . in order to maximize the therapeutic effect on the dlbcl
, rituximab was added to the regimen . following this initial induction chemotherapy , eight cycles of rituximab , ifosfamide , carboplatin , and
the treatment course was complicated by expected myelosuppression , but he achieved a complete response . in march 2008 ,
a restaging total body pet - ct scan revealed new left retroperitoneal nodules and enlarging right internal iliac chain lymph nodes suspicious for lymphoma recurrence .
a retroperitoneal nodule was biopsied and found to contain an atypical lymphoid proliferation consistent with grade 1 of 3 follicular lymphoma ( table 1 , fig .
interestingly , flow cytometric analysis of this lymphoma revealed a clonal lambda light chain population , similar to that seen in 2003 , while the analysis of 2006 performed on the dlbcl revealed a clonal kappa light chain population ( table 2 ) .
igh gene rearrangement studies of the 2008 follicular lymphoma showed a clonal rearrangement with a different - sized pcr product from the 2006 dlbcl ( table 2 , fig .
finally , fish analysis of paraffin - embedded tissue from the 2008 follicular lymphoma demonstrated the presence of a bcl2 gene rearrangement and absence of a bcl6 gene rearrangement ( table 2 ) .
the patient was treated with four doses of rituximab administered weekly . just prior to his follicular lymphoma recurrence ,
in february 2008 , the patient developed a scalp lesion that was biopsied and showed a diffuse cd30-positive , alk - negative cutaneous t cell infiltrate ( table 1 , fig .
the lesion spontaneously resolved without further treatment , and a primary cutaneous cd30-positive t cell lymphoproliferative disorder was the presumed diagnosis .
however , in october 2008 , a restaging total body ct scan revealed progressive adenopathy and enlarging liver and spleen lesions .
biopsies of the liver and right cervical lymph node showed a peripheral t cell lymphoma consistent with alk - negative alcl ( table 1 , fig .
t cell receptor ( tcr ) gene rearrangement studies of the right cervical lymph node and scalp biopsies showed clonal t cell populations with pcr products of similar size , confirming that the two t cell lymphomas were clonally related and supporting a diagnosis of systemic alk - negative alcl with initial manifestation in the skin ( table 2 ) .
the patient was treated with six cycles of dose - reduced cyclophosphamide , doxorubicin , vincristine , and prednisone and recently underwent non - myeloablative allogeneic stem cell transplant from a matched - related donor .
table 1histological and immunohistochemical findings of hematologic and non - hematologic malignanciesmonth / yearsamplemorphologyimmunohistochemistry and in situ hybridizationdiagnosis11/2003paratracheal lymph nodenodular proliferation of predominantly small to intermediate sized lymphoid cells with irregular to cleaved nucleicd20 + , cd10 + , bcl-6 + , bcl-2 + ( subset , weak)follicular lymphoma , grade 1 of 312/2005bronchoscopic biopsynot applicablenot performedsquamous cell carcinoma poorly differentiated01/2006left neck lymph nodediffuse infiltrate of large atypical lymphoid cells with oval , irregular , and multilobated nuclei and scant cytoplasm ( fig .
2a c)pax5 + , bcl-2 + , bcl-6/+ , cyclin d1 , 90% ki67 + , eberdiffuse large b cell lymphoma02/2008skin biopsy , right scalpdense dermal and subcutaneous infiltrate of large atypical lymphoid cells with irregular nuclei ( fig .
f)cd3 + , cd30 + , alk1cd30-positive peripheral t cell lymphoma03/2008retroperitoneal lymph nodediffuse and vaguely nodular infiltrate of small atypical centrocytes ( fig .
f)pax5 + , bcl-6 + , cd10 + , bcl-2 , 510% ki-67 + , cd21 + follicular dendritic cell meshworksfollicular lymphoma , grade 1 of 310/2008right cervical lymph node and liverdiffuse proliferation of large atypical lymphoid cells with round , oval , or occasionally indented nuclei and frequent mitoses ( fig .
4a c)cd3 + , cd2 + , cd30 + ( strong and diffuse ) , alk1 , mum1 + and bcl-2 + ; cd5 , cd4 , cd8 , granzyme b , perforin , cd20 , cd79a , cd10 , bcl-6 , cd56 , > 90% ki-67 + , eberanaplastic large cell lymphoma , alk negative , t - lineageeber epstein
barr virus rna , alk anaplastic lymphoma kinasetable 2flow cytometric , cytogenetic , and molecular genetic findings of lymphomasmonth / year11/200301/200603/200802/200810/2008diagnosisfollicular lymphoma , grade 1 of 3diffuse large b cell lymphomafollicular lymphoma , grade 1 of 3cd30-positive peripheral t cell lymphomaanaplastic large cell lymphoma , alk negative , t - lineageflow cytometric findingscd19 + , cd20 + , fmc7 + , cd5 , cd10+/ b cells with monotypic expression of lambda immunoglobulin light chaincd19 + , cd20 + , cd43 + , cd5 , cd10 , cd23 b cells with monotypic expression of kappa immunoglobulin light chaincd19 + , cd20 + , cd43 , cd5 , cd10 + , cd23 + b cells with monotypic expression of lambda immunoglobulin light chainnot obtainedcd3 dim+ , cd7dim+ , cd5 , cd43 + t cellscytogenetic findings4950,xy,+x , add(1)(p36),t(2;7)(q11;q25),+7,add(12)(p13),t(14;18)(q32;q21),+mar[cp5]/49 - 50,idem , del(6)(q21)[cp3]/46,xy ( fig . 1a)49,x,y,+x,6,?del(8)(p11.2p21),+11,+12,hsr(12)(q24)x2,add(14)(q32),+15[cp3]/50,idem,+mar[cp3 ] ( fig .
1b ) metaphase fish : ish der(3)(3bcl6+),der(14)(5bcl6+)fish of paraffin - embedded tissue : bcl2 rearrangement present ; bcl6 rearrangement absentnot obtained45,xy , add(1)(p36),der(2)add(2)(p2?3),t(2;?6)(q31;?p21),add(3)(q11),del(5)(q1?5q3?1),der(6)t(2:6)(q31;p21),del(7)(q32),der(13;13)(q10;q10)molecular genetic findingsnot obtainedclonal igh gene rearrangement ( framework regions i [ 323 bp ] and ii [ 267 bp ] ; fig .
3b , d)clonal igh gene rearrangement ( framework region i only [ 319 bp ] ; fig . 3a , c)clonal tcr gene rearrangement ( 2 peaks in v1 - 8 [ 204 and 213 bp])clonal tcr gene rearrangement ( 2 peaks in v1 - 8 [ 204 and 213 bp])igh immunoglobulin heavy chain , tcr t cell receptorfig .
cytogenetic analysis of the 2003 lymph node showing grade 1 follicular lymphoma ( a ) revealed a complex karyotype ( arrows ) , with a translocation between chromosomes 14 and 18 indicating a rearrangement involving igh and bcl2 .
analysis of the 2006 lymph node with dlbcl also showed a complex karyotype ( arrows ) , which was distinct from that of the prior follicular lymphoma ( b ) .
metaphase fish analysis revealed a bcl6 rearrangement involving chromosome 3 ( not shown ) . for complete karyotypes ,
biopsy of enlarged left neck lymph node from 2006 revealed an infiltrate of large atypical lymphoid cells with oval , irregular , and multilobated nuclei and prominent nucleoli ( a ) .
the cells effaced the nodal architecture in a diffuse pattern ( b ) and were positive for pax5 ( c ) , consistent with dlbcl . in 2008 ,
a retroperitoneal lymph node core biopsy showed a proliferation of small lymphocytes with irregular nuclei , consistent with centrocytes ( d ) , forming vague follicle structures ( e ) and staining positively for pax5 ( f ) .
3histologic and immunohistochemical findings of the patient s t cell lymphomas . in 2008 , biopsy of an enlarged right neck lymph node showed a diffuse proliferation of large atypical lymphoid cells with round to irregular nuclei , sometimes reniform nuclei ; mitotic figures were readily apparent ( a ) .
the tumor cells were positive for cd3 ( b ) , strongly positive for cd30 ( c ) , and negative for alk-1 ( not shown ) .
eight months earlier , biopsy of the patient s 2008 scalp lesion revealed a dense dermal infiltrate of large atypical lymphoid cells with irregular nuclei ( d ) .
the infiltrate extended to involve subcutaneous tissue and was positive for cd3 ( e ) and cd30 ( f ) and negative for alk-1 ( not shown ) .
subsequent tcr gene rearrangement studies supported that the prior skin biopsy represented secondary cutaneous involvement by a systemic alk - negative alcl histological and immunohistochemical findings of hematologic and non - hematologic malignancies eber epstein
barr virus rna , alk anaplastic lymphoma kinase flow cytometric , cytogenetic , and molecular genetic findings of lymphomas igh immunoglobulin heavy chain , tcr t cell receptor cytogenetic analysis of the patient 's b cell lymphomas .
cytogenetic analysis of the 2003 lymph node showing grade 1 follicular lymphoma ( a ) revealed a complex karyotype ( arrows ) , with a translocation between chromosomes 14 and 18 indicating a rearrangement involving igh and bcl2 .
analysis of the 2006 lymph node with dlbcl also showed a complex karyotype ( arrows ) , which was distinct from that of the prior follicular lymphoma ( b ) .
metaphase fish analysis revealed a bcl6 rearrangement involving chromosome 3 ( not shown ) . for complete karyotypes ,
see table 2 histologic and immunohistochemical findings of the patient 's b cell lymphomas .
biopsy of enlarged left neck lymph node from 2006 revealed an infiltrate of large atypical lymphoid cells with oval , irregular , and multilobated nuclei and prominent nucleoli ( a ) .
the cells effaced the nodal architecture in a diffuse pattern ( b ) and were positive for pax5 ( c ) , consistent with dlbcl . in 2008 ,
a retroperitoneal lymph node core biopsy showed a proliferation of small lymphocytes with irregular nuclei , consistent with centrocytes ( d ) , forming vague follicle structures ( e ) and staining positively for pax5 ( f ) .
the findings were consistent with relapsed follicular lymphoma , grade 1 of 3 histologic and immunohistochemical findings of the patient s t cell lymphomas . in 2008 , biopsy of an enlarged right neck lymph node showed a diffuse proliferation of large atypical lymphoid cells with round to irregular nuclei , sometimes reniform nuclei ; mitotic figures were readily apparent ( a ) .
the tumor cells were positive for cd3 ( b ) , strongly positive for cd30 ( c ) , and negative for alk-1 ( not shown ) .
eight months earlier , biopsy of the patient s 2008 scalp lesion revealed a dense dermal infiltrate of large atypical lymphoid cells with irregular nuclei ( d ) .
the infiltrate extended to involve subcutaneous tissue and was positive for cd3 ( e ) and cd30 ( f ) and negative for alk-1 ( not shown ) .
subsequent tcr gene rearrangement studies supported that the prior skin biopsy represented secondary cutaneous involvement by a systemic alk - negative alcl
various factors may be involved in the pathogenesis of multiple malignancies such as age , gender , genetic predisposition , chemotherapy and/or radiation therapy , immunodeficiency , ebv infection , and environmental risk factors like smoking or asbestos exposure .
we report the case of a patient in whom some of these factors may have been involved in the pathogenesis of his multiple malignancies . in 2003 , the patient was diagnosed with lambda - positive , low - grade follicular lymphoma ( table 1 ) treated with three courses of fcr , resulting in a partial remission .
two years later , squamous cell carcinoma of the lung , together with dlbcl , was diagnosed ( table 1 , fig .
the cytogenetic and flow cytometric analyses in 2003 revealed different results from those performed in 2006 ( table 2 , fig .
1a b ) , supporting that the two b cell lymphomas were clonally unrelated . in 2008 , a retroperitoneal lymph node biopsy again showed the presence of low - grade follicular lymphoma ( table 1 , fig .
flow cytometry revealed this to be lambda positive , and fish analysis showed a bcl2 gene rearrangement , similar to the 2003 follicular lymphoma , while the dlbcl in 2006 was kappa positive with a bcl6 gene rearrangement , further substantiating two clonally distinct b cell neoplasms ( table 2 , fig .
finally , molecular genetic analysis confirmed that the dlbcl and the follicular lymphoma had separate clonal origins ( table 2 , fig .
interestingly , the patient also developed a cutaneous cd30-positive , alk - negative peripheral t cell lymphoma that was thought to represent a primary cutaneous cd30-positive lymphoproliferative disorder ( table 1 , fig .
however , after 8 months , biopsies of the liver and right cervical lymph node showed a peripheral t cell lymphoma consistent with alcl , alk negative ( table 1 , fig .
the skin and systemic t cell lymphomas shared the same clonal tcr gene rearrangements by pcr , suggesting that both neoplasms arose from the same cell of origin ( table 2 ) . in summary , this patient had two different b cell lymphomas , a systemic alk - negative alcl initially manifesting as a localized skin lesion , and squamous cell carcinoma of the lung .
igh gene rearrangement studies on both the 2008 lymph node showing grade 1 follicular lymphoma ( a and c ) and the 2006 lymph node showing dlbcl ( b and d ) revealed clonal b cell populations . in the 2008 case ,
the clonal igh gene rearrangement was detected with pcr primers to framework region i only ( a , 319 bp ) , whereas primers to framework region ii ( c ) showed a polyclonal b cell population .
in contrast , in the 2006 case , the clonal rearrangement was detected with primers to both framework regions i ( a , 323 bp ) and ii ( d , 267 bp ) , indicating that the two lymphomas arose from different primaries .
framework region iii primers were polyclonal in both samples ( not shown ) molecular genetic studies of the patient s b cell lymphomas .
igh gene rearrangement studies on both the 2008 lymph node showing grade 1 follicular lymphoma ( a and c ) and the 2006 lymph node showing dlbcl ( b and d ) revealed clonal b cell populations . in the 2008 case , the clonal igh gene rearrangement was detected with pcr primers to framework region i only ( a , 319 bp ) , whereas primers to framework region ii ( c ) showed a polyclonal b cell population .
in contrast , in the 2006 case , the clonal rearrangement was detected with primers to both framework regions i ( a , 323 bp ) and ii ( d , 267 bp ) , indicating that the two lymphomas arose from different primaries .
framework region iii primers were polyclonal in both samples ( not shown ) a relationship between this patient s different malignancies may be hypothesized based upon genetic predisposition , environmental risk factors , gender , age , and therapy administered for his initial low - grade follicular lymphoma .
lung cancer is reported to be the second most frequently diagnosed secondary malignancy following treatment for indolent non - hodgkin s lymphoma , after myelodysplastic syndrome or acute myeloid leukemia .
factors with a statistically significant negative impact on time free from a second tumor include age 4564 years at initial treatment , male gender and fludarabine - containing therapy .
the patient we describe is a 62-year - old male former smoker with known asbestos exposure who was treated with fludarabine and who had a family history of malignancies that included lung cancer .
in addition , prior therapy with fludarabine may have contributed to an immunodeficient state that allowed the growth of a previously undetected cancer .
therefore , it is likely that multiple factors contributed to the development of his lung cancer .
the development of this patient 's subsequent dlbcl and alk - negative alcl is more difficult to explain , but immunologic factors may have played a role .
the squamous cell carcinoma , diagnosed in 2006 , may have preceded this patient s hematologic malignancies and remained occult , resulting in an immunological imbalance that later contributed to the development of lymphoma .
therapy with fludarabine and age - related immunosenescence may lead to the development of ebv - positive b cell lymphomas [ 10 , 11 ] .
however , this patient 's dlbcl was ebv negative by in situ hybridization for ebv rna ( table 1 ) , implying that the lymphoma was unrelated to treatment with fludarabine or age .
systemic alk - negative alcl is not known to be associated with specific risk factors .
it is likely that the etiology underlying the development of multiple malignancies in this patient was multifactorial in nature and that both non - immunologic and immunologic factors ( acting through a mechanism other than ebv ) were involved .
this case illustrates the importance of obtaining an accurate history at the time of a patient s initial diagnosis and of performing appropriate immunophenotypic , cytogenetic , and molecular genetic analyses during the course of a patient 's diagnostic work - up .
these actions help to identify important risk factors and prognostic indicators that assist in determining the most appropriate treatment strategies , taking into account possible side effects and the potential development of secondary neoplasia .
close long - term follow - up of hematologic malignancies is important not only for monitoring response to therapy but also for comparing subsequent neoplasms that may develop after the initial diagnosis to the initial pathology .
the case of our patient emphasizes that new lesions developing in an individual with an established diagnosis of malignancy can not be assumed to represent relapse of the original neoplasm .
finally , cytogenetic and molecular genetic analyses of tumors from patients with multiple malignancies may help to improve our understanding of the possible relationship between multiple primary malignancies and may help to predict the risk of a second tumor before its manifestation . | multiple malignancies may occur in the same patient , and a few reports describe cases with multiple hematologic and non - hematologic neoplasms .
we report the case of a patient who showed the sequential occurrence of four different lymphoid neoplasms together with a squamous cell carcinoma of the lung . a 62-year - old man with adenopathy
was admitted to the hospital , and lymph node biopsy was positive for low - grade follicular lymphoma .
he achieved a partial remission with chemotherapy .
two years later , a pet - ct scan showed a left hilar mass in the lung ; biopsy showed a squamous cell carcinoma .
simultaneously , he was diagnosed with diffuse large b cell lymphoma in a neck lymph node ; after chemo- and radiotherapy , he achieved a complete response .
a restaging pet - ct scan 2 years later revealed a retroperitoneal nodule , and biopsy again showed a low - grade follicular lymphoma , while a biopsy of a cutaneous scalp lesion showed a cd30-positive peripheral t cell lymphoma .
after some months , a liver biopsy and a right cervical lymph node biopsy showed a cd30-positive peripheral t cell lymphoma consistent with anaplastic lymphoma kinase - negative anaplastic large cell lymphoma .
flow cytometry and cytogenetic and molecular genetic analysis performed at diagnosis and during the patient s follow - up confirmed the presence of two clonally distinct b cell lymphomas , while the two t cell neoplasms were confirmed to be clonally related .
we discuss the relationship between multiple neoplasms occurring in the same patient and the various possible risk factors involved in their development . |
saprolegnia parasitica is a fish pathogenic oomycete ( water mould ) , belonging to the saprolegniales order and known to infect a wide range of fish , amphibians , and crustaceans relevant to aquaculture and to aquatic ecosystems ( van west et al .
it causes saprolegniosis , a disease characterised by visible white or grey patches of filamentous mycelium on the body or fins of freshwater fish ( van west 2006 ; schornack et al .
gene transformation technology has been developed but its efficiency is , at present , limited to a restricted number of oomycete species ( judelson et al .
1991 ; whisson et al . 2005 ; judelson & ah - fong 2009 ) .
attempts to successfully establish transformation protocols for some oomycetes have had , in some cases , little or no success .
an alternative way to functionally characterise genes , which is independent of a stable transformation protocol , can be the use of rna - interference ( rnai ) .
this technique was successfully developed for transient gene silencing of several genes in phytophthora infestans ( whisson et al .
2005 ; grenville - briggs et al . 2008 ; walker et al .
2008 ) . in the current study we performed detailed experiments to investigate whether the rnai - technique can also be employed to silence genes in s. parasitica . to select a suitable gene we searched the genome of s. parasitica of strain cbs223.65 ( jiang et al . 2013 ) and found a gene ( sprg_01728 ) that encodes for a putative tyrosinase ( sptyr ) , which is highly expressed in sporulating mycelium .
tyrosinases are mono - oxygenases ( monophenol , o - diphenol : oxygen oxidoreductases , ec 1.14.18.1 ) and bifunctional enzymes , catalysing the o - hydroxylation of monophenols and subsequent oxidation of o - diphenols to quinones ( fig 1 ) . in the catalytic cycle ,
molecular oxygen is used as an electron acceptor leading to subsequent reduction of oxygen to water ( westerholm - parvinen et al .
these enzymes are crucial not only in the biosynthesis of pigments such as melanin but also in the biosynthesis of other phenol polymers such as lignin , flavonoids , and tannins ( obata et al .
melanins are negatively charged and high molecular hydrophobic compounds . as a result of oxidative polymerisation of phenolic compounds melanin
they are insoluble in both aqueous and organic solvents and consequently difficult to study biochemically and biophysically ( casadevall et al . 2000 ) .
many of the dark pigments found in nature are considered melanins ( wheeler & bell 1988 ) and in microorganisms , melanin can be found in the extracellular or intracellular matrix , melanised cells of the fungal human pathogen cryptococcus neoformans were shown to possess a thick layer of melanin in the cell wall ( wang et al .
( 2002 ) demonstrated that melanin in the opportunistic plant pathogen alternaria alternata , is located in the septa and outer walls of conidia ( carzaniga et al . 2002 ) . in other plant pathogenic fungi like colletotrichum lagenarium and verticillium dahliae melanin has been found in layers within the cell wall and deposited as granules at the surface of the cell wall ( nosanchuk & casadevall 2003 ) .
the production of melanin has also been associated with virulence in several different microorganisms such as the pathogenic fungi c. neoformans and paracoccidioides brasiliensis and the bacterial pathogen pseudomonas aeruginosa ( nosanchuk & casadevall 2003 ) .
also , strains that do not produce melanin are unable to form functional appressoria and seem to lose their pathogenicity ( forrest 1990 ; takano et al .
melanin can also act as a protective agent against environment insults and it can bind to diverse drugs and chemicals and maintain cellular integrity ( hill 1992 ) .
melanins have a great affinity towards metal particles and react readily with free radicals protecting the organism against oxidants such as hypochlorite and permanganate ( jacobson et al .
1994 ; nyhus et al . 1997 ) but also against the oxidative burst of activated host effector cells ( nosanchuk & casadevall 2003 )
. moreover they are less susceptible to microbicidal peptides and defensins produced by phagocytic cells .
the suggested mechanism of action is the absorption of the microbicidal peptide by melanin in such a way that it can not reach its target ( nosanchuk & casadevall 2003 ) .
currently it is unclear whether oomycete tyrosinases are involved in melanin production , however it has been proposed that melanin is formed and is involved in the formation of reproductive organs and spores , in virulence , and in protection after physical damage ( lerch 1983 ) .
indeed , during microscopic analysis of sporangial development we noticed also that the sporangia from s. parasitica are slightly darker than the mycelia .
therefore we decided to investigate whether the tyrosinase gene is involved in melanin production by silencing the gene via rnai .
the strain of saprolegnia parasitica cbs 223.65 was maintained on 4 % ( w / v ) potato dextrose agar ( oxoid ) at 18 c .
mycelium from saprolegnia parasitica strain cbs 223.65 was grown in pea broth ( 125 g of boiled and filtered peas per litre ) for 2 d at 24 c , washed with sterile distilled water and collected in a 50 ml polypropylene tube ( greiner ) .
for each 1 ml of mycelium a 3 ml solution of 10 mg ml cellulase ( sigma ) and 5 mg ml of glucanase ( novozyme ) diluted in 0.5 m sorbitol was prepared and added to the corresponding mycelium .
the mixture was placed on a shaking platform for 90 min at room temperature ( rt ) to allow enzymatic cell wall degradation .
the resulting protoplasts were filtrated using a 70 m cell strainer ( fisherbrand ) and washed three times with 5 ml sorbitol ( 0.5 m ) by centrifugation ( 1200 g , 4 c , 5 min ) eliminating enzyme residues .
the protoplasts were finally resuspended in 5 ml sorbitol ( 0.5 m ) and two samples were counted two times each using a haemocytometer . to test protoplast regeneration ability 1000 protoplasts were inoculated into 20 ml pea broth and incubated at 18 c for 24 h. mycelium from saprolegnia parasitica strain cbs 223.65 was grown in pea broth for 4 d at 24 c , washed with sterile distilled water and left in 10 ml of sterile 1:1 tap : tank water to induce sporulation ; the sporulating mycelium was then collected in a 2 ml tube with 50 l glass beads , acid washed , and immediately frozen in liquid nitrogen .
the rna extraction was performed using the rneasy mini kit ( qiagen ) according to manufacturer 's protocol for fungi and plants with some modifications .
briefly , 600 l of lysis buffer ( rlt ) buffer was added to each sample which was frozen in liquid nitrogen , mycelium was disrupted using a fast prep machine ( four times , 6 ms for 45 s ) , samples were maintained on ice .
afterwards the samples were treated as described in the manufacture 's protocol . to exclude dna contamination
the samples were subjected to a dnase treatment using the turbo dnase kit ( ambion ) according to manufacturer 's protocol .
the quantity and purity of the rna was determined using the nanodrop and the quality verified by running 1 g of rna in 1 % ( w / v ) agarose gel .
subsequent cdna was produced using the first strand cdna synthesis kit ( fermentas ) according to manufacturer 's protocol .
a pcr using tyr - t7 primers ( 5-gtaatacgactcactatagggagcagctgatgttgtagagc-3 and 5- gtaatacgactcactataggggatcccgtactgggactact-3 ) was carried out using the cdna as template .
the dsrna from the green fluorescent protein encoded by gfp gene was obtained by performing colony pcr from escherichia coli transformed with pgfph ( ah - fong & judelson 2011 ) .
positive colonies were grown overnight in 5 ml lb medium supplemented with 100 mg l ampicillin . plasmid isolation and purification was carried out using the plasmid midi kit ( fermentas ) following the manufacturer 's protocol .
afterwards gfp - dsrna and sptyr - dsrna were obtained using megascript kit ( ambion ) according to manufacturer 's protocol .
three tubes were incubated at rt for 15 min : one tube with 10 l lipofectin ( invitrogen ) and 10 l gfp - dsrna , a second tube with 10 l lipofectin and 10 l sptyr - dsrna and a third tube with 10 l lipofectin and 10 l of sterile rnase free water . subsequently
10 l of protoplasts solution containing 1 10 protoplasts / ml was added to each tube and incubated at 18 c for 16 h. each experimental condition was then diluted in 200 ml pea broth and distributed in 2 ml aliquots in 24-well plates and incubated overnight at 24 c .
the mycelium of regenerated protoplasts ( of treated and non - treated with dsrna ) was then inoculated in pda ( potato dextrose agar , oxoid ) plates and incubated at 24 c overnight before further processing . for all
specific primers were designed for each gene using the primer3 tool following the manufacturer 's guidelines for primer design .
the constitutively expressed gene tubulin ( tub ) was used as an endogenous control in all qpcr reactions .
a master mix was prepared containing per well : 25 l lightcycler 480 sybr green i master ( roche ) , 2 l of each 10 mm primer [ tyr 3acctcttctacggtcagca5 and 3aggttgtgctagtggatcgg5 , tub 5-aggagatgttcaagcgcgtc-3 and 5-gatcgttcatgttggactcggc-3(van west et al .
the standard error from all qpcr reactions was calculated for all individual lines tested and used to determine the confidence intervals .
sporulating mycelium from each individual line was ground with liquid nitrogen and added to 5 ml phosphate buffer 100 mm ph 6.5 containing : 500 l pmsf 1 mm , 850 l sorbitol 0.65 m , protease inhibitor edta free ( roche ) .
samples were centrifuged ( 10 min , 2100 g , 4 c ) and the supernatant ( crude extract ) collected into 15 ml tubes . in new 1.5 ml tubes , 500 l acetate buffer 50 mm ph 5.0 , 200 l l - dopa 3.2 mm , 20 l dmf 2 % ( w / v ) and 220 l mbth 5 mm were mixed and incubated 5 min at 37 c .
thereafter 100 l of crude extract was added and incubated for a further 30 min at 37 c .
absorbance was measured at 505 nm and the activity determined using the equation below ( winder 1994 ) : rate ( nmol min ) = a505 t 10/29 10/30 , where t = time .
samples were centrifuged 10 min at 2100 g and 4 c and supernatant transferred to a new tube .
a standard curve was made using concentrations of commercial melanin ( sigma ) ranging between 0 and 2 g l. sporulating mycelium of control and putatively silenced lines were fixed in 3 % glutaraldehyde in 0.1 m phosphate buffer ( pb ) ph 7.4 for 24 h. afterwards samples were washed and stored in 0.1 m pb ph 7.4 until further processing . for transmission electron microscopy ( tem ) analysis , samples were subsequently processed in an automated routine tissue processor leica em tp ( leica microsystems , vienna , austria ) comprising following steps .
samples were post - fixed in 1 % ( v / v ) osmium tetroxide ( oso4 ; aqueous solution ; code o004 ; taab , england , uk ; batch nr 70150 ) for 1 h preceded by three 5-min washes with pb and three 5-min washes with distilled water and an extra wash step for 30 min with distilled water .
next , samples were dehydrated in increasing concentrations of ethanol ( 30 % , 70 % and 95 % , and 100 % ( v / v ) ; 30 min each ) , followed by three incubations in acetone for 1 h. samples were then incubated in increasing concentrations of epoxy / acetone ( 1/1 , 6/1 , and 100 % epoxy ) for 1 , 6 and 24
h respectively before embedding the samples in labelled capsules with freshly prepared resin , leaving the resin to polymerise for 24 h at 60 c .
ultra - thin sections ( 7080 nm ) were cut with a leica em uc6 ultramicrotome ( leica microsystems , vienna , austria ) and mounted on 200-mesh uncoated copper grids .
705631095 , laurylab , france ) and 0.5 % lead citrate ( ultrastain2 , ref . 70553022 , laurylab , france ) on an automated contrasting instrument leica em ac20 ( leica microsystems , vienna , austria ) .
finally the grids were analysed at 80 kv using a jem-1400 plus ( jeol , tokyo , japan ) transmission electron microscope equipped with an amt ultravue camera .
bioinformatic analysis of the saprolegnia parasitica genome , ( broad institute website ) , uncovered a gene that encodes a putative tyrosinase ( jiang et al . 2013 ) that , according to rna sequence data , is highly expressed in sporulating mycelium . to verify this , quantitative expression analysis by real - time quantitative pcr of the different life stages
was carried out demonstrating that the expression of sptyr gene is 30 fold higher in sporulating mycelium compared to other s. parasitica life stages , confirming the initial rna sequence data ( de bruijn et al .
one of the most efficient ones is gene silencing , where gene expression can be completely or partially abolished .
since the tyrosinase enzyme was expected to be involved in pigment formation , a decrease in gene expression would cause a visible change in the phenotype of the dsrna treated individual lines . for transient gene silencing we used rnai protocols that had already been established for phytophthora infestans ( judelson et al .
2005 ) and optimised it for silencing in s. parasitica . in order to maximize the change in gene expression of a silenced gene it is necessary to know the optimum time of silencing .
the time line for this phenomenon differs according to the organism of study . to unravel the specific silencing timeline for s. parasitica , a time course rnai assay was conducted for 12 d ( fig 2 ) and gene expression levels assessed by qpcr .
the results of this experiment suggested that at 8 d after introduction of dsrna into the cells , gene expression of sptyr is down regulated the most in the majority of the individual lines tested .
five out of six individual lines ( ty1 ty5 ) , treated with sptyr - dsrna ( fig 2 ) had less than 20 % gene expression when compared with the control lines .
individual line ty6 was silenced within the time frame ; however , the most significant decrease in gene expression occurred on day 9 post - rnai .
these results suggest that the window of opportunity for gene silencing in s. parasitica cbs 223.65 is about 89 d after dsrna uptake , which is much earlier than has been found for p. infestans where the maximum silencing was observed between 12 and 15 d after dsrna uptake ( whisson et al .
with such a short timeframe and depending on the life stage where the gene of interest is most expressed , the amount of material from each individual line for further analysis is reduced . after establishing the optimum time period for gene silencing in s. parasitica four rnai assays
were performed in order to optimise and increase the reproducibility of the technique . a final , fifth
, optimised rnai was conducted and ten individual lines treated with gfp - dsrna ( control ) and ten individual lines treated with sptyr - dsrna were analysed by qpcr on the eighth day after dsrna uptake to determine the level of silencing . out of the ten individual lines treated with sptyr - dsrna , seven were silenced with gene expression levels reduced between 25 and 80 % of the levels of individual lines treated with gfp - dsrna ( fig 3 ) .
the same individual lines used for gene expression analysis were also tested for tyrosinase activity using a spectrophotometric assay .
tyrosinase activity in the individual lines that showed most silencing was decreased when compared to the control ( fig 4 ) , while individual lines that did not present sptyr - silencing or were at a low silencing level maintained a tyrosinase activity that was similar to the control lines .
the lowest levels of tyrosinase activity were measured in the lines with the highest percentage of gene silencing .
additionally , melanin content of each individual line was determined spectrophotometrically and the concentration extrapolated from a standard curve ( fig 5a ) .
the most silenced lines ( lines ty1 to ty5 ) possessed less melanin when compared with the individual lines treated with gfp - dsrna ( fig 5b ) .
these results demonstrate that silencing the sptyr gene affects the melanin production and demonstrate that the pigments present in s. parasitica contain melanin .
furthermore , microscopic analysis revealed some altered sporangium morphology in the most - silenced lines when compared with gfp - silenced lines and the wild type strain .
sptyr - silenced lines seem to have less pigmentation , smaller sporangia and also abnormally shaped sporangia ( fig 6 ) .
we observed these differences in both young and mature sporangia ( data not shown ) .
the effect of tyrosinase silencing on sporangial morphology may be due to the pigments being deposited in or close to the cell wall , helping the structure thickness and shape .
however , we can not infer that this altered morphology is solely due to the silencing of sptyr gene .
for example it is possible that a pleiotropic effect , resulting in altered sporangial morphology , was obtained due to sptyr - silencing .
this has been described before when an rna - helicase of p. infestans was silenced with rnai ( walker et al .
transmission electron microscopy ( tem ) was used to study the effect of sptyr - silencing on sporangium morphology in more detail .
young sporangia were analysed from both gfp - dsrna - treated lines ( control ) and sptyr - silenced lines after induction of sporulation .
no significant differences in the cellular structures and organelles of control and sptyr - silenced sporangia were observed . in both control and sptyr - silenced lines ,
the sporangial cell wall of the control lines and the weakly sptyr - silenced lines are more electron dense than the most sptyr - silenced lines ( fig 8) .
these observations would suggest that melanin is located within the cell wall , which has been demonstrated in some true fungi ( wang et al .
abnormally shaped sporangia were also observed in sptyr - silenced lines using tem , whereby elongated and even triangular shaped sporangia were formed ( data not shown ) . in both types of sporangia
the increase in vacuoles could also explain the altered morphology of the sporangia observed with the light microscope .
the tyrosinase gene , sptyr , of saprolegnia parasitica is integral to the melanin biosynthetic pathway of this oomycete . after silencing the tyrosinase gene ,
microscopical analysis suggest that melanin is located in an electron - dense layer in the cell wall of sporangia of s. parasitica , since the electron dense layer was absent in the most silenced lines . with this work
, we have demonstrated for the first time that transient gene silencing through rnai is a feasible method to functionally characterise genes in s. parasitica . | here we describe the first application of transient gene silencing in saprolegnia parasitica , a pathogenic oomycete that infects a wide range of fish , amphibians , and crustaceans .
a gene encoding a putative tyrosinase from s. parasitica , sptyr , was selected to investigate the suitability of rna - interference ( rnai ) to functionally characterize genes of this economically important pathogen .
tyrosinase is a mono - oxygenase enzyme that catalyses the o - hydroxylation of monophenols and subsequent oxidation of o - diphenols to quinines .
these enzymes are widely distributed in nature , and are involved in the melanin biosynthesis .
gene silencing was obtained by delivering in vitro synthesized sptyr dsrna into protoplasts .
expression analysis , tyrosinase activity measurements , and melanin content analysis confirmed silencing in individual lines .
silencing of sptyr resulted in a decrease of tyrosinase activity between 38 % and 60 % , dependent on the level of sptyr - expression achieved .
the sptyr - silenced lines displayed less pigmentation in developing sporangia and occasionally an altered morphology .
moreover , developing sporangia from individual silenced lines possessed a less electron dense cell wall when compared to control lines , treated with gfp - dsrna . in conclusion ,
the tyrosinase gene of s. parasitica is required for melanin formation and transient gene silencing can be used to functionally characterize genes in s. parasitica . |
acute pancreatitis ( ap ) is characterized by an inflammatory affection of the exocrine pancreatic tissue and disturbances of pancreatic microcirculation.1 depending on the severity of ap , irreversible perfusion failure with consecutive tissue hypoxia and necrosis can complicate the course of the disease and trigger systemic inflammatory and septic complications.2 the pathophysiology of ap has been investigated with regard to microcirculatory changes in several studies.15 attention was paid especially to erythrocyte flow patterns , leukocyte endothelium interaction , and rheological approaches to improve perfusion and inhibit irreversible tissue damage.1,35 leukocyte
endothelium interaction as an early event of the inflammatory response has been characterized as a key step in the pathophysiology of ap.6 besides , activation of the humoral coagulation cascade plays an important role in the development of microcirculatory disorders in ap.7,8 however , the role of platelets as the cellular elements of hemostasis that can functionally link inflammatory cells and humoral coagulation factors has not been investigated . the aim of this study was to investigate platelet activation and function in experimental ap .
animals the experiments were performed in 54 male wistar rats weighing 270 to 335 g. animals were fasted overnight with free access to water before the experiments .
care was provided in accordance with the guidelines published in the guide for care and use of laboratory animals
surgical anesthesia was induced with intraperitoneal injection of pentobarbital ( 25 mg / kg ) and intramuscular injection of ketamine ( 40 mg / kg ) for the procedures of catheter placement and induction of pancreatitis .
anesthesia during intravital microscopy was induced by intravenous injection of pentobarbital ( 10 mg / kg ) .
polyethylene catheters ( inner diameter 0.5 mm ) were placed in the right jugular vein and left carotid artery , tunneled subcutaneously to the suprascapular area , and brought out through a steel tether that allowed the animals free movement and access to water during the experiments .
monitoring blood samples mean arterial pressure and heart rate were monitored during intravital microscopy by an electromechanical pressure transducer ( baxter uniflow , baxter healthcare cooperation , deerfield , il , usa ) .
arterial blood samples for determination of serum amylase were obtained before ( baseline ) and 24 h after ( end point ) pancreatitis was induced .
serum amylase was determined by standard laboratory methods ( hitachi automatic analyzer , boehringer mannheim , germany ) .
, pancreatic microcirculation was evaluated in 12 animals by intravital microscopy , and morphological changes were assessed in six animals by histology . in the control group ,
acute pancreatitis of graded severity was induced in the other groups either as mild or severe ap .
mild ap was induced by intraarterial infusion of cerulein ( 5 g kg h ) for over 6 h. cerulein was reconstituted in saline solution , and infusion volume was 4 ml / kg / h .
severe necrotizing pancreatitis was induced by infusion of bile salt ( glycodeoxycholic acid [ gdoc ] 2.5
mm / l ) into the pancreatic duct in combination with intraarterial infusion of cerulein ( 5 g kg h ) for over 6 h as described by schmidt et al.9 in detail .
bile - salt infusion into the pancreatic duct was performed in a volume- ( 1.2 ml / kg ) , time- ( 5 min ) , and pressure- ( 30 mmhg ) controlled manner.in each of the models , animals received saline solution during the observation period ( 0.9% , 4 ml kg h ) .
intravital microscopy was performed 12 h after the induction of pancreatic injury , and histological changes and blood samples were assessed 24 h after the infusions were started .
platelets were separated and stained according to the method originally described by massberg et al.10 briefly , platelets were stained by rhodamine 6 g and separated by 2 cycles of centrifugation under the addition of prostacyclin . after suspending and washing the separated platelets , blood cell count was performed to calculate the number of platelets per microliter and to rule out animal - specific differences in the number of platelets .
intravital microscopy the abdomen was reopened , and the pancreas was carefully exteriorized in a horizontal position through the midline incision after the animal was placed on the right side . the duodenal loop with the head of the pancreas was carefully fixed on an anatomically designed stage in a temperature - controlled ( 37c ) ringer s bath . afterward , intravital microscopy was performed as described below .
erythrocyte and leukocyte assessment a 0.5 ml / kg of erythrocytes ( hematocrit 50% ) labeled with fluorescein isothiocyanate ( fitc ) as described before11 was applied intravenously . in addition , 1 ml / kg of rhodamine-6 g solution was applied intravenously to label leukocytes in vivo.12 intravital microscopy was performed after an equilibration period of 15 min using a fluorescent microscope ( leitz , wetzlar , germany ) with a 20-fold water immersion objective .
an epi - illuminescent xenon lamp with an excitation filter of 450490 nm was used for visualization of fitc - labeled erythrocytes and an excitation filter of 540630 nm for rhodamine - labeled leukocytes . platelet assessment after platelet reinjection , intravital microscopy was performed by an epi - illuminescent xenon lamp with an excitation filter of 540630 nm . off - line analysis images were transferred to a monitor and simultaneously recorded on a videotape recorder . in each animal , five capillary fields of the exocrine pancreas and five postcapillary venules ( 2040 m ) were recorded for 1 min .
off - line analysis was performed using a specially designed computer program ( capimage , dr .
erythrocyte velocity and platelet velocity were determined for 10 cells in each capillary field and venule . additionally , temporarily ( rolling ) and
permanently ( sticking ) adherent leukocytes and platelets were determined in pancreatic venules and capillary fields .
rolling cells were defined as cells with less than 66% of red blood cell velocity , whereas sticking cells are those that were adherent to the vessel wall for the whole observation period.13 edema a portion of pancreatic tissue was trimmed of fat and weighed .
pancreatic water content was determined by the ratio of the initial weight ( wet weight ) of the pancreas to its weight after incubation at 60c for 72 h ( dry weight ) .
histology the pancreas was immediately removed after killing and was fixed in 4% buffered formalin solution .
for quantification of edema , inflammation , and necrosis , a modification of the scoring system originally described by schmidt et al.9 was used , ranging from 0 to 3 ( no pathological changes to severe injury ) .
assessment of thromboxane a2 thromboxane a2 was measured in frozen serum by commercially available enzyme - linked immunosorbent assay ( university of freiburg , germany ) .
student s t test was used when the data had a normal distribution , whereas kruskal wallis and mann whitney tests were utilized when the distribution was not normal .
statistical significance was accepted at the 5% level ( p < 0.05 ) .
serum amylase twelve hours after the induction of ap , serum amylase increased significantly compared to control animals .
hyperamylasemia was comparable in both mild and severe ap indicating the presence of pancreatic cell damage .
however , amylase was not a marker for the extent of tissue damage or disease severity ( table 1 ) .
table 1serum parameters , wet dry ratio , and histopathology controlmild apsevere apserum parametersamylase ( u / l)586 11627,200 4,012 * 27,317 3,220*thromboxane a2 [ pg/50 l]15.3 10.347.8 12.1 * 61.9 15.8*wet dry ratio2.87 0.796.96 0.95 * 4.77 0.70histopathologyinflammation0.25
0.421.31 0.08 * 1.95 0.17*necrosis0.08 0.201.10 0.11 * 1.70
0.23**p < 0.05 vs control groupp < 0.05 vs mild acute pancreatitis serum parameters , wet dry ratio , and histopathology * p < 0.05 vs control group p < 0.05 vs mild acute pancreatitis serum thromboxane a2 thromboxane a2 , as a marker of platelet activation , showed significantly higher levels in both ap groups compared to control animals after 24 h. thromboxane liberation correlated with severity of ap , with the highest levels being present in animals with necrotizing ap ( table 1 ) .
intravital microscopy erythrocyte velocity decreased significantly in mild as well as severe ap in both capillaries and venules compared to control animals .
flow velocity decreased under both ap conditions , with a highly significant decrease in severe ap in venules and capillaries ( table 2 ) .
these changes were paralleled by increased interaction between leukocytes and endothelium ( table 2 ) .
platelet adhesion in capillaries and venules increased significantly in both mild and severe ap ( figs . 1 and 2 ) .
reversible adhesion ( rolling platelets ) were comparable during both forms of ap , whereas the increase in irreversible adhesion ( sticking platelets ) depended on the severity of ap and showed peak platelet
endothelium adherence in necrotizing ap ( figs . 1 and 2 ) .
table 2results of the intravital microscopyintravital microscopycontrolmild apsevere aperythrocyte velocity ( capillary ) ( mm / s)0.65/0.020.42/0.01 * 0.36/0.01*erythrocyte velocity ( venule ) ( mm / s)0.93/0.110.77/0.170.58/0.10*platelet velocity ( capillary ) ( mm / s)0.54 0.040.35 0.03 * 0.29 0.03*platelet velocity ( venule ) ( mm / s)0.67 0.050.63 0.020.53 0.05*rolling leukocytes ( capillary)1.3 0.24.5 1.4 * 9.0 1.7*rolling leukocytes ( venule)1.3 0.214.8 1.2 * 18.9 1.9*sticking leukocytes ( capillary)1.1 0.310.2 1.8 * 7.2 0.7*sticking leukocytes ( venule)0.7 0.15.6 0.9 * 13.5 2.0**p < 0.05 vs control groupp < 0.05 vs mild acute pancreatitisfigure 1intravital microscopy , capillary platelet adhesion ( one per field ) . control group ( gray ) , mild acute pancreatitis ( white ) , and severe acute pancreatitis ( striped ) .
reversible platelet adhesion in mild and severe acute pancreatitis ( left columns ) ; irreversible platelet adhesion ( right columns ) . * p < 0.05 vs control group , p < 0.05 vs mild acute pancreatitis.figure 2intravital microscopy , venular platelet adhesion ( one per 100 m ) .
control group ( gray ) , mild acute pancreatitis ( white ) , and severe acute pancreatitis ( striped ) .
reversible platelet adhesion in mild and severe acute pancreatitis ( left columns ) ; irreversible platelet adhesion ( right columns ) . * p < 0.05 vs control group , p < 0.05 vs mild acute pancreatitis
. results of the intravital microscopy * p < 0.05 vs control group p < 0.05 vs mild acute pancreatitis intravital microscopy , capillary platelet adhesion ( one per field ) .
control group ( gray ) , mild acute pancreatitis ( white ) , and severe acute pancreatitis ( striped ) .
reversible platelet adhesion in mild and severe acute pancreatitis ( left columns ) ; irreversible platelet adhesion ( right columns ) . * p < 0.05 vs control group , p < 0.05 vs mild acute pancreatitis .
control group ( gray ) , mild acute pancreatitis ( white ) , and severe acute pancreatitis ( striped ) .
reversible platelet adhesion in mild and severe acute pancreatitis ( left columns ) ; irreversible platelet adhesion ( right columns ) . * p < 0.05 vs control group , p < 0.05 vs mild acute pancreatitis .
tissue edema ( wet / dry ratio ) supramaximal cerulein stimulation induced a significant increase in pancreatic water content compared to control animals .
in contrast , there was only a slight increase in tissue edema after gdoc treatment ( table 1 ) .
histopathology control animals showed no histopathological changes after sham operation and 24 h infusion therapy .
histopathology of mild ap was characterized by significant edema formation , inflammatory tissue infiltration , and acinar cell necrosis . in severe ap ,
the changes regarding inflammation and necrosis were significantly more pronounced ( table 1 ) .
in the present study , we have investigated platelet function in experimental models of ap .
we chose two animal models to induce a mild edematous or a severe necrotizing course of ap .
both models are established , well characterized , and have been used in numerous studies.9,14,15 the induction of ap in these models results in a standardized grade of tissue damage , either mild or severe , with very little variance within each group . therefore , the use of these models allows us to rule out the significant influence of preparatory or other methodological problems on the comparability of the results .
analysis of platelet function by intravital microscopy has been established and standardized for examination of liver and small bowel perfusion by massberg et al.10 we have modified this method to investigate the pancreas.15 in the present study , we could demonstrate that this method is not only suitable for the examination of healthy pancreas but also for the detailed analysis of pancreatic microcirculation in mild and severe ap .
acute pancreatitis is characterized by an impairment of microcirculation due to an activation of inflammatory cells with a consecutive increase of leukocyte
while the inflammatory response is well investigated , the platelet function and the role of the coagulation cascade have not yet been investigated in detail .
it is well known that the inhibition of certain coagulatory steps , e.g. , by applying hemodiluting or anticoagulatory substances , improves the outcome of ap.16,17 coagulation and hemostasis comprise two interacting pathways : humoral coagulatory factors leading to the activation of fibrinogen as the final step of the coagulation cascade and cellular factors , which are represented by activated platelets .
different mechanisms of platelet interaction are responsible for their physiological function , namely , interactions with endothelium , leukocytes , and humoral coagulatory and inflammatory proteins.18,19 in the present study , we could demonstrate that the platelet
comparable to leukocyte endothelium interaction , temporary and permanent adhesions of platelets to the vessel wall were evident in our experiments .
this correlates with the activation patterns that have been observed in vivo in ischemia models of the liver and the pancreas,15,20 as well as in vitro.21 therefore , it seems likely that these activation patterns reflect the severity of the pancreatic affection , leading to reversible adhesion in mild ap and irreversible adhesion in more severe organ affection .
especially , the firm adhesion of platelets contributes to microcirculatory disturbances and may induce perfusion failure and tissue necrosis in the progression to severe ap .
the significantly elevated thromboxane levels correlate well with platelet activation and microcirculatory failure observed during intravital microscopy .
the increase in serum thromboxane elucidates one mechanism of our results as it executes a direct platelet stimulation and leads to the conversion of resting to activated platelets with the consecutive adhesive action .
furthermore , thromboxane does not only activate platelets but also acts as a complex pathophysiological mediator with multiple other targets .
its effects include leukocyte activation , upregulation of proinflammatory cytokines , and strong vasoconstricting effects .
these are mediated via phosphatidylcholine and phosphatidylcholine - specific phospholipase - c pathway leading to a tonic contraction in smooth muscles and upregulating other vasoactive substances.22,23 especially , this vasoconstrictor mechanism may additionally contribute to perfusion failure in the course of ap as observed in our study .
how far platelet inhibition itself could be an approach to attenuate the course of ap experimentally or clinically is hypothetical but should certainly be addressed to in further studies .
possible aims could be adhesion molecules such as selectins or platelet receptors and also synthesis of thromboxane and prostaglandins .
an interaction between these two cell types has been demonstrated by the different authors in the past.2426 among others , p - selectin seems to be one of the most important adhesion molecules , which links the inflammatory and procoagulatory cascades and has the potency to activate leukocytes and platelets as the cellular elements of either pathway.18,19,25,26 besides their adherence to endothelial cells , activated platelets form stable aggregates with leukocytes .
this results in a combined inflammatory and coagulatory contribution to thrombus formation and is also mediated by p - selectin and beta - integrins.2729 especially , the formation of microthrombotic vessel occlusion with microcirculatory perfusion failure and consequent ischemia , hypoxia , and tissue necrosis was reflected by the intravital microscopic results in the present study .
the results of the present study show that activation and adhesion of platelets play an important role during ap .
platelet endothelium and platelet leukocyte interactions as well as thromboxane liberation show a correlation with the severity of experimental ap and seem to be of distinct importance in the progression from mild to severe necrotizing ap . | acute pancreatitis ( ap ) is characterized by disturbances of pancreatic microcirculation .
it remains unclear whether platelets contribute to these perfusion disturbances .
the aim of our study was to investigate platelet activation and function in experimental ap .
acute pancreatitis was induced in rats : ( 1 ) control ( n = 18 ; ringer s solution ) , ( 2 ) mild ap ( n = 18 ; cerulein ) , and ( 3 ) severe ap ( n = 18 ; glycodeoxycholic acid ( gdoc ) + cerulein ) . after 12 h , intravital microscopy was performed .
rhodamine - stained platelets were used to investigate velocity and endothelial adhesion in capillaries and venules .
in addition , erythrocyte velocity and leukocyte adhesion were evaluated .
serum amylase , thromboxane a2 , and histology were evaluated after 24 h in additional animals of each group .
results showed that 24 h after cerulein application , histology exhibited a mild ap , whereas gdoc induced severe necrotizing ap .
intravital microscopy showed significantly more platelet
endothelium interaction , reduced erythrocyte velocity , and increased leukocyte adherence in animals with ap compared to control animals .
thromboxane levels were significantly elevated in all ap animals and correlated with the extent of platelet activation and severity of ap . in conclusion
, platelet activation plays an important role in acute , especially necrotizing , pancreatitis .
mainly temporary platelet
endothelium interaction is observed during mild ap , whereas severe ap is characterized by firm adhesion with consecutive coagulatory activation and perfusion failure . |
dichelobacter nodosus is a gram - negative anaerobic bacterium and the main causative organism of ovine foot rot .
foot rot is a contagious and crippling disease affecting the feet of sheep , characterized by a range of symptoms depending on severity , from a nonprogressive interdigital dermatitis ( in benign foot rot ) to extensive foot infection and separation of hoof from underlying soft tissue , as in case of virulent foot rot [ 24 ] .
the extent of severity depends on the nature of the particular isolate and the climatic conditions .
the disease has significantly affected the sheep industry due to morbidity and decline in wool and meat production .
the treatment of foot rot generally involves foot - paring and washing with antiseptic solutions such as 10% zinc - sulphate .
foot - paring is generally carried out to remove the diseased tissue and promote healthy foot - structure ; however the effectiveness of paring in treatment of foot rot is questionable [ 79 ] and has been shown to be associated with increased incidences of infection .
the application of antibiotics , antibacterial sprays , and solutions has seen much better recovery of affected sheep .
although a number of vaccination programs have been successful in nepal , bhutan , and australia , these are examples where only a single serogroup of d. nodosus was infecting the flock . while efforts are underway to develop effective monovalent / bivalent vaccines that can provide adequate cross - protection against multiple strains of d. nodosus[14 , 15 ] , it is also necessary to develop effective drug - based strategies for the effective treatment of infected flocks .
large scale sequencing of complete genomes of various pathogens and their hosts has provided a large amount of sequence data at our disposal which could be of much help in identification of drug targets and development of antibiotics .
the genomes of d. nodosus and the host organism , ovis aries , have been sequenced completely and form the basis of the current in silico analysis . subtractive genomics approach has been used previously for identification of potential drug targets in different pathogenic bacteria such as helicobacter pylori , pseudomonas aeruginosa [ 17 , 18 ] , mycobacterium tuberculosis , aeromonas hydrophila , and clostridium perfringens .
ideally , a drug target should be nonhomologous with host proteins as this would decrease the chances of nonspecific interactions with host proteins and associated side - effects .
it is also advantageous if the target protein is known to be essential for bacterial survival ; any disruption in the functioning of such a protein would lead to death of the bacterial cell .
an additional resource that has aided the in silico identification of essential genes in pathogenic organisms is the database of essential genes ( deg ) .
this database contains records for all the essential genes that are currently known and the records are updated as new essential genes are identified and characterized . at present , the deg consists of essential genes data for 37 pathogenic bacterial species . in the present work
, we performed in silico analysis utilizing the blast utility and deg to identify putative drug targets in d. nodosus .
further , we have carried out multiple analyses on the list of putative drug targets to classify them on the basis of the pathway / biological process they are involved in and their subcellular localization .
choke - point analyses of the metabolic pathways are a very good method to identify proteins that could be effective drug targets and have been used previously for drug target identification [ 2426 ] .
the main objective of this study is to identify prioritized groups of proteins which could be attractive drug targets and can be investigated further using computational and experimental drug discovery methods .
for the purpose of analysis , complete genome of d. nodosus ( strain vcs1703a17 ) and its associated annotation data file were downloaded from ncbi database .
essential genes in d. nodosus were predicted by using the database of essential genes ( deg ) server .
d. nodosus whole genome sequence along with the annotation data was given as input to the server .
the server uses the annotation data to identify the genes and performs blast search against deg .
based on previous studies using similar workflow , an expectation value cut - off of 10 and a minimum bit score of 100 were used to shortlist the essential genes [ 27 , 28 ] .
the corresponding protein sequences of all the essential genes were obtained from ncbi and a blastp search was performed against a database of sheep protein sequences using an expectation value cut - off of 10 for filtering significant hits .
essential genes that were found to be nonhomologous were shortlisted as the putative drug targets .
the putative drug targets that were shortlisted were further analyzed using kaas ( kegg automated annotation server ) to obtain information about the different biological processes and metabolic pathways in which the putative drug targets were involved .
this online utility provides rapid and high performance functional annotations of genes by performing blast comparison against the kegg genes database .
choke - point analysis of the metabolic pathways of d. nodosus was conducted using the biocyc database which analyzes the pathways information for d. nodosus to provide a list of choke - point reactions and the respective protein catalyzing the reaction .
the list of potential drug targets obtained for dichelobacter was cross - referenced against this list of choke - point reactions to identify those drug targets that were choke - point proteins in addition to being essential and nonhomologous with host proteins .
psortb server was used to predict the subcellular localization of the potential drug targets in order to analyze the distribution of the drug targets into different compartments of the cell .
putative drug targets were analyzed to identify the ones that are also essential to 12 other pathogenic bacterial species , namely , helicobacter pylori 26695 , acinetobacter baylyi adp1 , haemophilus influenzae rd kw20 , bacillus subtilis 168 , mycobacterium tuberculosis h37rv , staphylococcus aureus n315 , campylobacter jejuni subsp .
jejuni atcc 700819 , francisella novicida u112 , salmonella enterica serovar typhimurium sl1344 , mycobacterium tuberculosis h37rviii , streptococcus pneumoniae , and vibrio cholerae n16961 .
blastp was performed against the protein sequence database of the aforementioned species present in deg .
an e - value of 10 and a bit score of 100 were used for the analyses .
a flowchart of the workflow employed for the present study is depicted in figure 1 .
in silico subtractive genomic analysis is a very fast and efficient method for identifying proteins in pathogenic species that are absent in the host .
these proteins could serve as potential drug targets against the pathogens infecting the host tissues .
essential proteins are those which are believed to be critical for the survival of a cell .
although the essentiality of a gene is dependent on specific environment and cellular conditions , in general , the essentiality of a protein target is a positive indicator for druggability of the target .
therefore , we have identified a subset of proteins in dichelobacter nodosus that are both essential to the pathogen and nonhomologous with ovine proteins .
the 1.39 mb genome of d. nodosus vcs1703a is the smallest known genome of an anaerobe , containing 1354 annotated genes that encode for 1280 proteins .
blast analysis of the genome using deg server gave a list of 787 protein coding genes that were predicted to be essential for the survival of d. nodosus .
thereafter , blastp analysis was performed for these 787 protein sequences against the sheep protein sequence database to identify 410 proteins that gave no significant hits ; that is , they do not have a significant homology with any of the host proteins . out of these protein sequences ,
a final list of 361 proteins was obtained that were most likely to be ideal drug targets against d. nodosus .
out of 361 proteins , pathway annotation for 297 proteins was reported by the kaas ; the remaining 64 proteins had no pathway annotation information .
the distribution of these 297 proteins into different metabolic pathways is depicted in figure 2 .
pathway annotation data file for the 297 drug targets is provided as supplementary material available online at http://dx.doi.org/10.1155/2016/7361361 .
the majority of the targets are involved in transcription and translations ( 60 proteins ) and transport / secretion pathways ( 49 proteins ) , accounting for approximately 33% of the drug targets .
amino acid metabolism and replication and repair pathways each account for roughly 10% of the total drug targets .
it should be noted that the 64 proteins which had no pathway annotation information are also potential drug targets that may be taken up for analysis and drug discovery studies .
hereafter , we have performed various analyses on this core set of 297 drug targets to identify subset of proteins with specific characteristics that may be relevant to specific drug development projects .
the bacterial pathways can be divided into two groups : ( 1 ) the pathways that are unique to bacteria only and are completely absent in mammalian host termed unique bacterial pathways and ( 2 ) the pathways that are common to both bacteria and the mammalian host termed common pathways .
the unique bacterial pathways include 67 proteins annotated to the ( i ) two - component system , ( ii ) peptidoglycan biosynthesis , ( iii ) lipopolysaccharide biosynthesis , ( iv ) microbial metabolism in diverse environments , ( v ) photosynthesis , ( vi ) bacterial secretion systems , and ( vii ) d - alanine metabolism .
the proteins belonging to the unique pathways are an ideal group of drug targets that are completely absent in host cell ; host cell lacks the complete pathway and its associated proteins .
we also performed a choke - point analysis on the list of 297 proteins to identify choke - point proteins .
a reaction of metabolic network of a given organism which either consumes a specific substrate or produces a specific product is defined as a choke - point reaction .
inhibiting a choke - point reaction / protein may lead to cell toxicity and death due to accumulation of an intermediate metabolite ( in case of a protein utilizing a unique substrate ) or due to paucity of one or more essential downstream metabolites ( in case of a protein producing a unique product ) .
out of the 297 drug targets that were analyzed , 138 were identified as choke - point proteins . out of the total identified choke - point proteins , 29 proteins belong to the unique pathways and the rest are part of common pathways ( see table 1 ) .
table 2 lists a subset of 29 choke - point proteins that belong to unique pathways in bacterial system .
proteins belonging to this subset will be ( a ) safer targets as the complete pathway is absent in the host and , therefore , probability of cross - interaction of drugs is further reduced , ( b ) druggable targets due to presence of substrate - binding pockets , which may be gainfully exploited for drug development , and ( c ) effective targets because inhibition of these choke - point proteins is expected to produce a blockade in the pathway which may create an unsustainable condition inside the bacterial cell . hence , this group of proteins are predicted to be attractive candidates in their respective pathways for the design of potent inhibitors .
determination of subcellular localization of proteins is useful in genome / proteome analysis and annotation . especially in case of pathogenic species , knowledge of subcellular localization of proteins is particularly useful in revealing cell surface and extracellularly secreted proteins that may be involved in pathogenesis .
since these proteins are the most accessible to any form of external intervention , hence they are considered attractive vaccine as well as drug targets .
the distribution of the predicted subcellular localization for the 297 putative drug targets is depicted in figure 3 ( see supplementary material for raw data ) . while none of the proteins were predicted to be extracellular ,
89 were predicted to be membrane - associated proteins , out of which 76 were inner membrane - associated , 9 were periplasmic , and 4 were outer membrane - associated proteins .
a total of 187 proteins were predicted to be cytoplasmic proteins and for the remaining 21 the subcellular localization was unknown .
it should be noted that the absence of any predicted extracellular protein could be a consequence of the workflow employed in the present study that biases the obtained results towards cytoplasmic and membrane proteins . since extracellular proteins are generally not essential for the survival of the pathogen
, they would not appear in the list of targets identified based on a homology with known essential proteins .
however , many of them may be critical for promoting pathogenicity and survival of the pathogen inside the host tissues . such secreted effector proteins can also be attractive targets for drug as well as vaccine development
. it may therefore be useful to carry out subcellular localization prediction without incorporating a priori essentiality criteria for shortlisting protein targets , thereby allowing the identification of pathogen - specific extracellular proteins .
the 21 protein targets for which no localization prediction was obtained could also be considered for further investigations to identify correct localization and prioritized accordingly towards drug development studies . experimental localization studies using fluorescent tags
may be performed for this set of protein targets ; this would aid in uncovering novel drug targets that are specific to the pathogen of interest .
since ovine foot rot is characterized by lesions at the hoof that are largely exposed , there is a possibility of multiple infections developing at the lesion .
proteins that are essential in multiple pathogens can be ideal drug targets for designing of broad - spectrum antibiotics that can be used for treating difficult cases of mixed infections .
therefore , we analyzed the 297 drug targets to look for conservation across 12 pathogenic bacterial species ( see section 2.5 for the list ) by performing a blastp analysis against the deg database for these 12 species .
out of the 297 drug targets , we found 259 proteins to be essential and similar in at least 1 species . on the other hand ,
none of the proteins of d. nodosus were found to be essential and similar in all 12 species ; only a single protein was found to have a similar match in 11 species .
the 13 drug targets that were essential and conserved in at least 10 pathogenic bacterial species are tabulated in table 3 .
these proteins candidates could potentially be targeted for drug development for treating infections caused by multiple pathogens and can be studied further for development of broad - spectrum antibiotics .
further , we find that , out of these 13 proteins , 5 proteins are choke - points within pathways that are unique to bacterial cells ( indicated with in table 3 ) .
these proteins include ftsi and penicillin - binding protein 2 that are targets for broad - spectrum -lactam antibiotics .
the other three ( mura , murc , and murg ) are proteins that are essential for peptidoglycan biosynthesis ; while mura is already a target for fosfomycin , murc and murg could be explored further using computational and experimental methods as targets for design of broad - spectrum antibiotics .
computational studies may include development of homology - based protein models , virtual screening , and simulation studies of targets for drug discovery . using sequence homology information , it is also possible to predict drug molecules that are likely to be good inhibitors of the candidate protein . for novel targets with no significant homology to available structures
, crystallographic studies can be performed to aid the computational efforts for designing novel drugs .
in silico comparative genomics and bioinformatics approaches allow us to rationally narrow down the number of targets that may be considered for drug discovery workflows .
we have identified a set of 361 proteins that are essential for dichelobacter nodosus and are nonhomologous with the sheep proteome .
the prediction of essential genes in the present study is based on the assumption that proteins homologous with known essential genes should also be essential .
it is therefore recommended that , before selecting a final list of targets for drug development , experimental studies are conducted to validate the essentiality of the target proteins .
essentiality of a protein may be assayed in bacteria using conditional or temperature - sensitive mutants . from this set ,
297 proteins with associated pathway annotations were examined further for subcellular localization , conservation in multiple pathogens , and so forth .
such analyses allow the identification of a specialized set of targets that are suitable for drug discovery approaches . in summary ,
the present study has resulted in the generation of a list of proteins that may be considered for target - based drug discovery .
in addition , the results also suggest that essentiality - based selection criteria of putative drug targets may not be suitable for detection of novel extracellular effectors of dichelobacter ; perhaps , consideration of this aspect will facilitate future computational studies that focus on identification of putative bacterial effector proteins .
in general , the work lays down the foundation for future computational and experimental studies on the identified drug targets for design of novel drugs against ovine foot rot . | ovine foot rot is an infection of the feet of sheep , mainly caused by dichelobacter nodosus . in its virulent form ,
it is highly contagious and debilitating , causing significant losses in the form of decline in wool growth and quality and poor fertility .
current methods of treatment are ineffective in complete eradication .
effective antibiotic treatment of foot rot is hence necessary to ensure better outcomes during control phases by reduction in culling count and the possibility of carriers of the infection . using computational approaches ,
we have identified a set of 297 proteins that are essential to the d. nodosus and nonhomologous with sheep proteins .
these proteins may be considered as potential vaccine candidates or drug targets for designing antibiotics against the bacterium .
this core set of drug targets have been analyzed for pathway annotation to identify 67 proteins involved in unique bacterial pathways .
choke - point analysis on the drug targets identified 138 choke - point proteins , 29 involved in unique bacterial pathways .
subcellular localization was also predicted for each target to identify the ones that are membrane associated or secreted extracellularly .
in addition , a total of 13 targets were identified that are common in at least 10 pathogenic bacterial species . |
the most outstanding feature of cells is that they produce a large amount of insulin , the only hormone that lowers blood glucose , and secrete it continuously in response to changes in the extracellular glucose concentration .
insulin secretion from pancreatic cells also is modified by a variety of nutrients , hormones and neuronal signals in the maintenance of systemic glucose homeostasis1 . for treatment of diabetes with absolute insulin deficiency
normal pancreatic cells adjust insulin secretion continually in response to varying blood glucose levels ; exogenous insulin administration can not maintain blood glucose levels within the narrow physiological range that protects from development of various diabetic complications .
although transplantation of the pancreas or pancreatic islets has been an efficient therapeutic option for cure of patients with insulindeficient diabetes , the chronic shortage of donor organs limits widespread application of such transplantation .
thus , regenerative medicine , including generation of pancreatic cells , pancreatic islets or whole pancreas , is an intriguing approach to the development of future therapy for diabetes2 . in the present review ,
we discuss functional differentiation of native pancreatic cells as the scientific basis of regenerative medicine in the field of diabetes , and introduce approaches to regeneration of cells ( figure 1 ) .
new pancreatic cells could be generated by induction of selfreplication ( proliferation ) of preexisting islet cells or differentiation / transdifferentiation of adult stem / progenitor cells ( neogenesis ) in vivo .
in addition , the new cells could also be obtained by forced proliferation of isolated preexisting cells or differentiation / transdifferentiation of embryonic stem cells ( escs)/inducedpluripotent stem cells ( ipscs ) or adult stem / progenitor cells in vitro .
pancreatic cells secrete adequate amounts of insulin in response to extracellular glucose concentration so that blood glucose levels are controlled within a narrow physiological range ; severe hypoglycemia or hyperglycemia seldom occurs in healthy subjects .
this is because the cell has properties of : ( i ) insulin biosynthesis ; ( ii ) glucose sensing ; ( iii ) metabolismsecretion coupling ; and ( iv ) regulated exocytosis ( figure 2 ) .
glucose entering cells through glucose transporters is metabolized , leading to an increase in the adenosine triphosphate ( atp ) concentration , closure of the atpsensitive k ( katp ) channels , depolarization of the cell membrane and opening of the voltagedependent ca channels , which allows ca influx .
the resultant rise in intracellular ca concentration triggers soluble nethylmaleimidesensitive factor attachment protein receptor ( snare)dependent exocytosis of insulin granules .
cells thus must possess functions of : ( i ) insulin biosynthesis ; ( ii ) glucose sensing ; ( iii ) metabolismsecretion coupling ; and ( iv ) regulated exocytosis .
pc1/3 , prohormone convertase 1/3 ; pc2 , prohormone convertase 2 ; snap25 , synaptosomalassociated protein 25 ; stx , syntaxin ; vamp2 , vesicleassociated membrane protein 2 .
although our knowledge of the development of wellregulated insulin secretion is limited , analyses of developing and differentiating pancreatic cells provide clues .
it is known that fetal and neonatal pancreatic cells lack glucose responsiveness3 . by using rat models
, it was found that fetal pancreatic cells show lower facilitation of glucose oxidation than adult cells4 . as forced depolarization
can stimulate insulin secretion similarly in both fetal and adult cells4 , fetal cells seem to show insulin biosynthesis , granule formation and expression of soluble nethylmaleimidesensitive factor attachment protein receptor ( snare ) proteins .
thus , immaturity in glucose metabolism might account for the lack of glucose responsiveness in fetal pancreatic cells .
in fact , expression levels of key enzymes [ mitochondrial glycerol3phosphate dehydrogenase ( mgpdh ) and mitochondrial malate dehydrogenase ] in nadh ( the reduced form of nicotinamide adenine dinucleotide ) shuttles , which have an important role in adenosine triphosphate ( atp ) production , are significantly lower in fetal than in adult cells , and forced expression of mgpdh improves glucoseinduced insulin secretion in fetal pancreatic islets6 .
immaturity of glucose metabolism in fetal pancreatic cells is also supported by a study using human and porcine fetuses7 , and by a recent dna microarray study in fetal rat cells8 . however , the mechanism of cell acquisition of glucoseresponsiveness during growth is still largely unknown .
it has been reported that addition of glucagonlike peptide1 ( glp1 ) , an incretin hormone , induces both first and second phase glucoseinduced insulin secretion in human fetal isletslike cell clusters ( immature islets)9 .
although this finding reflects an acute effect of glp1 on the function of immature cells , glp1 also has roles in differentiation of pancreatic cells .
a study has shown by using fetal pig islets that glp1 facilitates differentiation of the immature precursor of pancreatic cells to mature cells10 . because glp1 begins to secret from lcells on the gut tube by intake of foods after delivery , it is possible that glp1 has physiological roles in functional differentiation of pancreatic cells .
in contrast , it is known that terminal differentiation of pancreatic cells requires expression of the transcription factor vmaf musculoaponeurotic fibrosarcoma oncogene homolog a ( mafa ) , which regulates expression of genes participating in glucoseinduced insulin secretion including glut2 , glucokinase , sur1 and kir6.211 .
a recent report showed the possibility that mafa is involved in the acquisition of glucose responsiveness in neonatal rat pancreatic cells12 , an important role in functional maturation of the cells .
although the relationship between mafa and incretins is unknown , as mafa increases the expression of the glp1 receptor13 , their interaction or cooperation in differentiation of pancreatic cells seems likely
most studies on regeneration of pancreatic cells in vivo have been carried out in rodents using pancreatic injury models .
nicotinamide , an inhibitor of poly(adenosine diphosphateribose ) synthethase / polymerase , prevents the development of diabetes in experimental animals after administration of the cell toxins , streptozotocin and alloxan14 . in vitro studies
have shown that the agent has beneficial effects on proliferation and differentiation of pancreatic endocrine cells15 , but the mechanism is not known .
exendin4 , an analog of glp1 , has been reported to enhance both proliferation and neogenesis of pancreatic cells in rats with 90% pancreatectomy17 .
betacellulin , a growth factor belonging to the epidermal growth factor ( egf ) family , has been shown to promote neogenesis of cells and ameliorate glucose intolerance in mice with selective alloxan perfusion18 , and is also reported to enhance proliferation of cells in 90% pancreatectomized rats19 .
the reg gene , which is induced in regenerating pancreatic islets , has been identified20 .
there are several lines of studies suggesting the cell origin of regenerated pancreatic cells . in transgenic mice expressing interferongamma specifically in pancreatic cells , a dramatic proliferation of pancreatic ductal cells , and the appearance of primitive endocrine cells and their subsequent differentiation into endocrine cells has been reported21 . during regeneration ,
transitional intermediate cells expressing both carbonic anhydrase ii and amylase22 , and bearing both endocrine and exocrine granules23 appear .
the authors speculate from these findings that pancreatic duct cells represent facultative progenitors in adult pancreas .
however , their results also suggest that pancreatic acinar cells give rise to intermediate cells that have characteristics of pancreatic duct cells , and then differentiate into endocrine cells .
it has been reported that overexpression of transforming growth factor induces expansion of pancreatic and duodenal homeobox 1 ( pdx1)expressing ductal epithelium in the pancreas , and that focal areas of islet neogenesis can be observed24 . as pancreatic acinar cells isolated from transforming growth factor transgenic mice
convert into ductal cells25 , the expanded pancreatic ductal cells expressing pdx1 in these mice might well be derived from pancreatic acinar cells . in addition , some pancreatic injury models have been shown to exhibit pancreas regeneration .
after ligation of the pancreatic duct in rats , replacement of exocrine acini by ductlike structures is observed27 .
this acinoductal metaplasia has been thought to be at least in part the result of transdifferentiation of amylasepositive pancreatic acinar cells into amylasenegative and cytokeratinpositive ductlike cells28 . by treating the rats with dexamethasone to inhibit loss of amylase expression , transitional cells coexpressing amylase and cytokeratin 20 were detected28 , supporting the notion of acinartoductal transdifferentiation .
furthermore , insulinpositive cells that also express amylase have been found , indicating acinartoendocrine transdifferentiation .
although histological analysis has shown that neogenesis or regeneration of pancreatic cells occurs in certain conditions , the cellular origin of the new cells has not been shown .
recent studies using genetic cell lineage tracing or other cell labeling methods suggest that adult pancreatic cells are not derived from noncells29 .
using genetic cell lineage tracing , dor et al.29 showed that adult pancreatic cells in mice are maintained predominantly by selfreplication of preexisting cells .
they labeled pancreatic cells selectively with human alkaline phosphatase by creloxpbased conditional recombination in adult pancreas , and chased the fate of preexisting cells . in this system ,
when new cells in an adult pancreas are generated from noncells , such as stem / progenitor cells , the frequency of the labeled cells should decrease after a chase period .
the results showed that the labeling frequency of the cells remained unchanged , indicating that the new cells were generated primarily from preexisting cells .
they concluded that terminally differentiated cells retain proliferative capacity , and cast doubt on a significant role for adult stem cells in cell replenishment29 .
georgia and bhushan30 reported that during neonatal development , cyclin d2 expression in the endocrine pancreas coincided with the replication of endocrine cells and a massive increase in islet mass .
cyclin d2 is not required for exocrine and ductal cell proliferation , but is required for replication of endocrine cells . in cyclin d2 mice , pancreatic islets are much smaller and cell mass
thus , cyclin d2 plays a key role in cell replication , which might be the primary mechanism for maintaining postnatal cell mass30 .
furthermore , teta et al.31 showed by using a dna analogbased lineagetracing technique that unlike gastrointestinal and skin epithelia , specialized progenitors do not contribute to adult cell mass , not even during acute cell regeneration .
instead , adult cells exhibit equal proliferation potential , and expand from within a vast and uniform pool of mature cells32 .
thus , it is likely that pancreatic cell mass is maintained primarily by selfreplication of preexisting cells in adult mice , although the existence of pancreatic tissuespecific stem / progenitor cells can not be excluded .
the turnover rate of pancreatic cells in adult is generally low , expansion of the cells being detected only in several conditions including neonate , pregnancy and obesity .
the mass of pancreatic cells increases in the neonatal period as the body and organs grow .
however , the increases in cell number and the weight of the whole pancreas are not a coincidence33 , suggesting different mechanisms in the regulation of the mass of pancreatic endocrine and exocrine cells .
we have recently shown that noncells contribute to an increase in mass expansion of pancreatic cells from neonate through to youth34 .
although the signals leading to proliferation of pancreatic cells are not yet well characterized , a recent study has shown that egfreceptor signaling is required for expansion of cells in mice under highfat diet conditions and pregnancy35 .
in addition , during pregnancy , an increase in insulin resistance in pregnant mothers maintains the nutrient flow to the growing fetus .
prolactin and placental lactogen counterbalance this resistance , and prevent maternal hyperglycemia by driving expansion of the maternal population of insulinproducing cells .
it should be noted that hepatic activation of extracellular regulated kinase signaling induces proliferation of pancreatic cells through a neuronalmediated relay of metabolic signals36 .
in addition , there are several reports showing identification of functional pancreatic adult stem / progenitor cells in vivo .
it has been shown that progenitors for cells are activated in injured adult mouse pancreas , and are located in the ductal lining .
differentiation of the adult progenitors is ngn3 dependent , and gives rise to all islet cell types both in situ and cultured in embryonic pancreas explants37 .
that study strongly suggests that adult cells can be generated not only from preexisting cells , but also from noncells . however , because such progenitors can be detected only when the cells begin to express ngn3 , their precise origin and properties are not ascertained .
although inada et al.38 reported that by using lineage tracing utilizing human carbonic anhydrase ii ( caii ) promoter a subset of adult cells are generated from pancreatic duct cells , solar et al.39 showed that the duct cells ( hnf 1 as the marker ) lose potential for differentiation into cells after birth .
thus , the origin of newly formed cells in the adult pancreas remains to be identified .
in vitro expansion of pancreatic cells represents an attractive strategy for obtaining a large amount of cells for transplantation . indeed ,
human cells possess proliferation capacity when cultured on extracellular matrices with growth factors and hormones40 .
however , the capacity is very limited while preserving the cell phenotype43 , expansion of cells often occurs along with loss of the cell phenotype ( i.e. , expression and secretion of insulin)44 .
emt was originally defined in the context of developmental stages : a biological process that allows a polarized epithelial cell to undergo multiple biochemical changes that enable it to assume a mesenchymal cell phenotype45 .
the first report that referred phenotypic changes of pancreatic cells to the emt was carried out by gershengorn et al.46 , and a similar phenomenon was observed by others47 .
however , other studies using lineage tracing showed that murine cells do not undergo emt48 .
they found that most proliferative mesenchymal cells migrating out from pancreatic islets in vitro were not derived from cells , and suggested that these cells do not represent a useful source for the generation of physiologically competent cells for treatment of diabetes48 . at that time , the journal , diabetes , stated that emt participation in mechanism of cell expansion has been preempted51 .
nevertheless , we and others have shown direct evidence of emtlike phenotypic changes in mouse and human pancreatic cells52 .
we have established a culture system using fetal pancreatic cells as feeder cells that induce dedifferentiation of adult cells , and we have developed a method whereby preexisting pancreatic cells can be traced throughout the culture process , even when the cells lose insulin expression53 .
we showed that pancreatic cells of adult mice undergo dedifferentiation into mesenchymelike fibroblastoid cells ( i.e. , emt ) , and that the process is associated associated with the progression of the cell cycle .
human pancreatic cells were also reported to have the potential to proliferate on emt and redifferentiate into islet progenitorlike cells54 .
these studies suggest the feasibility of the generation of a large amount of insulinsecreting cells by in vitro expansion of pancreatic cells .
the first report of the in vitro generation of like cells from mouse es cells was by lumelsky et al.55 in 2001 .
however , as these insulinpositive cells showed low insulin production capacity and poor insulin secretory response , the cells could not be identified as cells .
in fact , later studies showed that es cellderived insulinpositive cells can be generated as a result of uptake of exogenous insulin57 . in 2006 , a new protocol was developed to generate insulinsecreting cells , in which differentiation processes mimic pancreatic organogenesis by directing cells through stages resembling definitive endoderm , guttube endoderm , pancreatic endoderm and endocrine precursor59 . however , the insulinsecreting cells made by this method showed poor glucose responsiveness and appeared immature . a later study made by
the same group showed that glucoseresponsive insulinsecreting cells can be generated by transplantation of the cells at the stage of pancreatic endoderm60 .
insulinsecreting cells have also been generated from inducedpluripotent stem ( ips ) cells61 , but precise analysis of the insulin secretion has not been carried out .
cmet , cmet positive ; ckit , ckit negative ; cd45 , cd45 negative ; dna , deoxyribonucleic acid ; egf , epidermal growth factor ; es , embryonic stem ; facs , fluorescenceactivated cell sorting ; gck , glucokinase ; glp1 , glucagonlike peptide1 ; glut , glucose transporter ; iapp , islet amyloid polypeptide ; ipc , isletproducing stem cells ; ips , iduced pluripotent ; kgf , keratinocyte growth factor ; kir , inwardrectifier potassium ion channel ; lif , leukemia inhibitory factor ; mafa , musculoaponeurotic fibrosarcoma oncogene homolog a ; mrna , messenger ribonucleic acid ; na , not applicable ; neurod , neurogenic differentiation ; nkx2.2 , nk2 homeobox 2 ; nod , nonobese diabetic ; pdx1 , pancreatic and duodenal homeobox 1 ; sur1 , sulphonylurea receptor 1 ; ter119 , ter119 negative . calculation based on our own measurement of insulin content of normal islet : 250 g / mg protein [ 75 ng / islet , 3 g ( 500 pmol)/g dna ] .
insulin secretion was measured as accumulation for 24 h. several studies have attempted to identify stem / progenitor cells in the adult pancreas .
zulewski et al.16 showed that cells expressing the neural stem cell marker nestin occur in human and rat pancreatic islets , and that these cells can be isolated and cultured for a long time .
it has been shown that cultured nestinpositive cells can be differentiated into insulinproducing cells16 , and that such cells from human fetal pancreas when transplanted can be expanded and differentiated into isletlike cell clusters , which can reverse hyperglycemia in diabetic mice65 .
these candidate progenitor cells proliferate in the serumfree conditions used for neural stem cell ( nsc ) culture and form spherical cell clusters like nscs by floating culture .
interestingly , the cells in the spherical clusters show characteristics of both pancreatic and neural precursors . furthermore
, the potential progenitors give rise to multiple types of neural cells , including neurons and glial cells , and also differentiate into insulinproducing ( ) cells , glucagonproducing ( ) cells , and somatostatinproducing ( ) cells .
the insulinproducing cells derived from these progenitors are glucosecompetent in terms of ca responsiveness and insulin secretion .
suzuki et al.67 reported isolation of pancreatic progenitor cells from adult mouse by using fluorescenceactivated cell sorting .
the isolated cells express cmet , the receptors for hepatocyte growth factor , but do not express hematopoietic and vascular endothelial antigens , such as cd45 , ter119 , ckit and flk1 .
thus , hepatocyte growth factor / cmet signaling might play an important role in the maintenance of these progenitorlike cells .
the cells formed clonal colonies in vitro , and differentiated into multiple pancreatic lineages from single cells . however , no functional analysis has been carried out for the differentiated pancreatic cells induced from these candidate progenitors . taken together , these findings suggest that although stem / progenitorlike cells might be obtained from the adult pancreas , it is not yet clear that such isolated stem / progenitorlike cells have the full potential to differentiate into native pancreatic cells and function as stem / progenitors in the pancreas in vivo .
peck et al.68 isolated and cultured pancreatic ductal cells from prediabetic nonobese diabetic mice , and induced isletlike cell clusters containing insulinproducing cells .
although the insulin secretory capacity of the induced cells was extremely low , transplantation of the cells to diabetic mice could lead to normalization of blood glucose levels .
it is possible that these insulinproducing cells further differentiate in vivo , but no relevant functional analyses after transplantation have been carried out .
the ductal cells were expanded as a monolayer , and the cells were then overlaid with a thin layer of matrigel . the cells formed 3d structures of ductal cysts from which isletlike clusters budded .
however , they reported the possibility in a later study that contaminated cells in the starting material underwent dedifferentiation and redifferentiation during the culture72 .
in contrast , bouwens et al.73 have claimed the importance of transdifferentiation of pancreatic exocrine cells in regeneration of pancreatic cells .
they reported that pancreatic exocrine cells can be converted into insulinproducing cells by culturing with egf and leukemia inhibitory factor74 .
they isolated pancreatic acinar cells from adult rats , and cultured the cells in suspension without adding any growth factor or cytokines .
insulinpositive cells were detected at the periphery of the spherical cell clusters derived from the acinar cells76 . although these studies suggest transdifferentiation of pancreatic acinar cells into insulinproducing cells , neither direct evidence of the origin of these cells nor their precise insulin secretory properties were identified . at the same time , we also reported transdifferentiation of pancreatic acinar cells , and utilized the method of cell lineage tracing based on the creloxp system to determine the origin of the newlymade insulinsecreting cells77 .
cell adhesion in pancreatic acinar cells induces dedifferentiation , and the subsequent activation of the phosphoinositide 3kinase / akt pathway recovers the cell
cell adhesion , which induces redifferentiation into endocrine or ductal cells ( figure 3)78 .
this explains the rarity of in vivo transdifferentiation of acinar cells into endocrine cells , as even in severe cases of pancreatitis or cancer , cell cell contacts are not completely destroyed .
the acinar cellderived insulinsecreting cells secreted insulin in response to a variety of stimuli , including glucose and glp1 . however , insulin production of the cells was lower than that of native islets .
as the newlymade cells expressed genes , such as hnf6 and pgp9.5 , which are not expressed in native cells , but did not express mafa , which regulates the expression of genes that participate in glucoseinduced insulin secretion77 , the cells were thought to be in an immature state .
cell adhesion , which causes dedifferentiation of the acinar cells . meanwhile , epidermal growth factor receptors are activated , which is followed by activation of the phosphoinositide 3kinase pi3k / akt pathway . within a few days of culture , cadherinmediated cell
cell adhesion is recovered by the enhanced expression of ecadherin , which is essential for redifferentiation of the dedifferentiated cells into insulinsecreting cells .
thorel et al.83 reported that cells transdifferentiate into cells under conditions of severe loss of cells .
they generated mice carrying a transgene containing the diphtheria toxin receptor under the control of the insulin promoter ( ripdtr ) .
in male ripdtr mice , more than 99% of the cells in the adult pancreas can be destroyed by injection of diphtheria toxin .
when such mice were kept alive for up to 10 months with insulin treatment during the initial 5 months , the cell mass increased to 10% of normal animals on average , and glycemic control improved in some of the mice . by using a conditional cell lineage tracing method , the origin of the regenerated cells was shown not to be surviving preexisting cells , but rather glucagonexpressing cells .
although their findings suggest the usefulness of cells as a source of new cells , the conversion of cells to cells decreases the cell population , which might cause the loss of glucagon action in the maintenance of glucose homeostasis . however , they later reported that neartotal ablation of cells did not affect the insulin counterregulatory response and glucose homeostasis in mice84 .
talchai et al.85 recently showed that pancreatic cell dedifferentiation rather than cell death is responsible for diabetic cell failure in several different diabetic mouse models . in their experiments
, adult mouse cells underwent dedifferentiation and reverted to progenitorlike cells expressing ngn3 , oct4 , nanog and lmyc under conditions of physiological stress , such as cellspecific disruption of foxo1 .
it has also been shown that ectopic expression of certain transcription factors can change the fate between and cells86 .
these studies suggest an attractive future therapeutic strategy for diabetes in which pancreatic cells can be generated from cells by inducing their transdifferentiation in vivo .
there are many different approaches towards the development of cell replacement therapy for insulindeficient diabetes mellitus
. however , in vivo regeneration of cells in humans is not realistic at present from both efficacy and safety points of view , and most newly generated insulinsecreting cells in vitro are not fully differentiated cells , as assessed by both insulin secretory properties and gene expression profile .
another unique and intriguing strategy of regenerative medicine for diabetes has recently been proposed by kobayashi et al.87 , who made use of the technique of blastocyst complementation , which enables in vivo generation of organs derived from pluripotent stem cells ( pscs : es cells or ips cells ) , and generated a rat pancreas in a mouse by injecting wildtype rat pscs into a pdx1 ( pancreatogenesisdisabled ) mouse blastocyst .
thus , a human pancreas might be generated from human pscs in a pig for use in organ transplantation , although many issues of concern must be addressed to bring this principle into clinical use .
human pancreatic cells have recently been shown to express glp1 and prohormone convertase 1/3 ( pc1/3 ) , as well as glucagon and pc288 .
in addition , a recent study showed ectopic expression of glucosedependent insulinotropic polypeptide ( gip ) in pancreatic cells in mice with the complete absence of proglucagonderived peptide89 .
we must expand our knowledge of the physiological processes of differentiation , proliferation and regeneration of pancreatic cells as an essential step on the path to cell therapy to cure patients with absolute insulin deficiency .
this work was supported by a crest grant from the japan science and technology agency , and grantinaid for scientific research and grants for the global center of excellence ( coe ) programs global center of excellence for education and research on signal transduction medicine in the coming generation , global center for education and research in integrative membrane biology , and kobe translational research cluster , the knowledge cluster initiative from the ministry of education , culture , sports , science and technology , japan . | abstractnewly generated insulinsecreting cells for use in cell therapy for insulindeficient diabetes mellitus require properties similar to those of native pancreatic cells .
pancreatic cells are highly specialized cells that produce a large amount of insulin , and secrete insulin in a regulated manner in response to glucose and other stimuli .
it is not yet explained how the cells acquire this complex function during normal differentiation .
so far , in vitro generation of insulinsecreting cells from embryonic stem cells , inducedpluripotent stem cells and adult stem / progenitorlike cells has been reported .
however , most of these cells are functionally immature and show poor glucoseresponsive insulin secretion compared to that of native pancreatic cells ( or islets ) .
strategies to generate functional cells or a whole organ in vivo have also recently been proposed . establishing a protocol to generate fully functional insulinsecreting cells that closely resemble native cells
is a critical matter in regenerative medicine for diabetes .
understanding the physiological processes of differentiation , proliferation and regeneration of pancreatic cells might open the path to cell therapy to cure patients with absolute insulin deficiency . |
in the last decade , the use of 3d image processing has been increased especially for medical applications ; this leads to increase the qualified radiologists ' number who navigate , view , analyse , segment , and interpret medical images .
the analysis and visualization of the image stack received from the acquisition devices are difficult to evaluate due to the quantity of clinical data and the amount of noise existing in medical images due to the scanners itself . computerized analysis and automated information systems can offer help dealing with the large amounts of data , and new image processing techniques may help to denoise those images
. multiresolution analysis ( mra ) [ 13 ] has been successfully used in image processing specially with image segmentation , wavelet - based features has been used in various applications including image compression , denoising , and classification .
recently , the finite ridgelet and curvelet transforms have been introduced as a higher dimensional mra tool [ 7 , 8 ] .
image segmentation requires extracting specific features from an image by distinguishing objects from the background .
the process involves classifying each pixel of an image into a set of distinct classes , where the number of classes is much smaller .
medical image segmentation aims to separate known anatomical structures from the background such cancer diagnosis , quantification of tissue volumes , radiotherapy treatment planning , and study of anatomical structures .
segmentation can be manually performed by a human expert who simply examines an image , determines borders between regions , and classifies each region .
this is perhaps the most reliable and accurate method of image segmentation , because the human visual system is immensely complex and well suited to the task .
curvelet transform is a new extension of wavelet transform which aims to deal with interesting phenomena occurring along curved edges in 2d images .
it is a high - dimensional generalization of the wavelet transform designed to represent images at different scales and different orientations ( angles ) .
it is viewed as a multiscale pyramid with frame elements indexed by location , scale , and orientation parameters with needle - shaped elements at fine scales .
curvelets have time - frequency localization properties of wavelets but also shows a very high degree of directionality and anisotropy , and its singularities can be well approximated with very few coefficients
. this paper is focusing on a robust implementation of mra techniques for segmenting medical volumes using features derived from the wavelet , ridgelet , and curvelet transforms of medical images obtained from a ct scanner .
the rest of this paper is organised as follow : section 2 illustrates the proposed medical image segmentation system using mra techniques .
the mathematical background and the methodology for the proposed mra techniques have been explained in section 3 .
the results and analysis of the implemented wavelet , ridgelet , and curvelet transforms for medical image segmentation are illustrated in section 4 .
the main aim of this research is to facilitate the process of highlighting roi in medical images , which may be encapsulated within other objects or surrounded by noise that make the segmentation process not easy .
wavelet , ridgelet , and curvelet transforms are applied on medical images with other pre- and postprocessing techniques to present segmented outputs and detected roi in an easier and more accurate way .
image segmentation using mra such as wavelets has been widely used in recent years and provides better accuracy in segmenting different types of images .
many recent developments in mra have taken place , while wavelets are suitable for dealing with objects with point singularities .
wavelets can only capture limited directional information due to its poor orientation selectivity . by decomposing the image into a series of high - pass and low - pass filter bands ,
the wavelet transform extracts directional details that capture horizontal , vertical , and diagonal activity .
however , these three linear directions are limiting and might not capture enough directional information in noisy images , such as medical ct scans , which do not have strong horizontal , vertical , or diagonal directional elements .
ridgelet improves mra segmentation ; however , they capture structural information of an image based on multiple radial directions in the frequency domain .
one limitation to use ridgelet in image segmentation is that ridgelet is most effective in detecting linear radial structures , which are not dominant in medical images .
the curvelet transform is a recent extension of ridgelet transform that overcome ridgelet weaknesses in medical image segmentation .
curvelet is proven to be particularly effective at detecting image activity along curves instead of radial directions which are the most comprising objects of medical images . in the last decade , wavelet transform has been recognized as a powerful tool in a wide range of applications , including image / video processing , numerical analysis , and telecommunication .
the advantage of wavelet is that wavelet performs an mra of a signal with localization in both time and frequency [ 10 , 11 ] .
in addition to this , functions with discontinuities and functions with sharp spikes require fewer wavelet basis vectors in the wavelet domain than sine cosine basis vectors to achieve a comparable approximation .
wavelet operates by convolving the target function with wavelet kernels to obtain wavelet coefficients representing the contributions in the function at different scales and orientations .
wavelet or multiresolution theory can be used alongside segmentation approaches , creating new systems which can provide a segmentation of superior quality to those segmentation approaches computed exclusively within the spatial domain .
discrete wavelet transform ( dwt ) can be implemented as a set of high - pass and low - pass filter banks . in standard wavelet decomposition , the output from the low - pass filter can be then decomposed further , with the process continuing recursively in this manner . according to , dwt can be mathematically expressed by
( 1)aj(n)=i=0l1l(i)aj1(2ni ) , 0n < nj , dj(n)=i=0l1h(i)dj1(2ni ) , 0n < nj .
the coefficients a(n ) and d(n ) refer to approximation and detailed components in the signal at decomposition level j , respectively . the l(i ) and h(i ) represent the coefficients of low - pass and high - pass filters , respectively .
the wavelet decomposition of an image creates at each scale j a set of coefficient values wj with an overall mean of zero .
wj contains the same number of voxels as the original image ; therefore , this wavelet transform is redundant [ 14 , 15 ] . for images , 1d - dwt can be readily extended into 2d . in standard
2d wavelet decomposition , the image rows are fully decomposed , with the output being fully decomposed columnwise . in nonstandard wavelet decomposition
, all the rows are decomposed by one decomposition level followed by one decomposition level of the columns .
wavelet uses a set of filters to decompose images depending on filter coefficients and the number of those coefficients .
the most popular wavelet filter is haar wavelet filter ( hwf ) which takes the averages and differences from the low- and high - pass filters , respectively .
figure 3 illustrates an example of applying 2d - dwt using hwf on an image for 2 levels of decompositions . in 1998 , donoho introduced the ridgelet transform continuous ridgelet transform ( crt ) can be defined from a 1d wavelet function oriented at constant lines and radial directions .
ridgelet transform [ 1719 ] has been generating a lot of interest due to their superior performance over wavelets . while wavelets have been very successful in applications such as denoising and compact approximations of images containing zero dimensional or point singularities .
wavelets do not isolate the smoothness along edges that occurs in images , and they are thus more appropriate for the reconstruction of sharp point singularities than lines or edges .
these shortcomings of wavelet are well addressed by the ridgelet transform ; the functionality of wavelet has been extended to higher dimensional singularities and becomes an effective tool to perform sparse directional analysis [ 3 , 21 ] .
generally speaking , wavelets detect objects with point singularities , while ridgelets are able to represent objects with line singularities .
the finite ridgelet transform ( frit ) was computed in two steps : a calculation of discrete radon transform and an application of a wavelet transform .
the finite radon transform ( frat ) is computed in two steps : a calculation of 2d fast fourier transform ( fft ) for the image and an application of a 1d inverse fast fourier transform ( ifft ) on each of the 32 radial directions of the radon projection .
1d wavelet is applied restricted to radial directions going through the origin for three levels of decompositions . applying frat on image
can be presented as a set of projections of the image taken at different angles to map the image space to projection space .
its computation is important in image processing and computer vision for problems such as pattern recognition and the reconstruction of medical images . for discrete images ,
a projection is computed by summation of all data points that lie within specified unit - width strips ; those lines are defined in a finite geometry .
depending on , frat of a real function on the finite grid zp is defined in
( 2)rk[l]=fratf(k , l)=1p(i , j)l(k , l)f(i , j ) .
here ,
l(k , l ) denotes the set of points that make up a line on the lattice zp as in
( 3)l(k , l)={(i , j):j = ki+l(mod p),izp } , 0k <
p , l(p , l)={(l , j):jzp}.
to compute the kth radon projection ( i.e. , the kth row in the array ) , all pixels of the original image need to be passed once and use p histogrammers : one for every pixel in the row . at the end , all p histogrammed values are divided by k to get the average values . according to alzu'bi and amira in ,
once the wavelet and radon transforms have been implemented , the ridgelet transform is straightforward .
each output of the radon projection is simply passed through the wavelet transform before it reaches the output multiplier .
as shown in figure 4 , ridgelets use frat as a basic building block , where frat maps a line singularity into point singularity , and the wavelet transform has used to effectively detect and segment the point singularity in radon domain .
figure 5 shows a clinical chest slice from a ct scanner in the last step of ridgelet transform before image reconstruction at different block sizes .
continuous ridgelet transform is similar to the continuous wavelet transform except that point parameters ( x , y ) in the cartesian grid ( figure 6(a ) ) which perform pixels in the image or an entry in a 2d matrix are now replaced by line parameters ( , ) , where is the intercept and is the angle .
figure 6(b ) illustrates the radial grid in ridgelet transform ; however , straight lines evaluate the image in the frequency domain .
medical images comprised from curves which are still not singularity points after applying radon transform .
wavelet transform can not detect those singularities properly , since it still not singularity points , resulting that ridgelet transformation is not suitable for segmenting these images .
ridgelet transform can be used in other applications , where images contain edges and straight lines .
curvelet transform has been introduced to solve this problem ; it deals with higher singularities compared to wavelet and ridgelet transforms .
it was first introduced in [ 25 , 26 ] by cands and donoho in 2000 , which used a complex series of steps involving the ridgelet analysis of the radon transform of an image .
their performance was very slow ; hence , researchers developed a new version which is easier to use and understand . in this new method ,
the use of the ridgelet transform as a preprocessing step of curvelet was discarded , thus reducing the amount of redundancy in the transform and increasing the speed considerably .
curvelet aims to deal with interesting phenomena occurring along curved edges in a 2d image .
as illustrated in figure 7 , curvelet needs fewer coefficients for representation , and the edge produced from curvelet is smoother than wavelet edge .
the newly constructed and improved version of curvelet transform is known as fast discrete curvelet transform ( fdct ) .
this new technique is simpler , faster and less redundant than the original curvelet transform which based on ridgelets . according to candes et al . in , two implementations of fdct
are proposed : unequally spaced fast fourier transforms ( usfft ) , both implementations of fdct differ mainly by the choice of spatial grid that used to translate curvelets at each scale and angle .
both digital transformations return a table of digital curvelet coefficients indexed by a scale parameter , an orientation parameter , and a spatial location parameter .
wrapping - based transform is based on wrapping a specially selected fourier samples , and it is easier to implement and understand .
curvelet transform works in two dimensions with spatial variable x , frequency domain variable , and the frequency - domain polar coordinates r and . curvelet transform can be defined by a pair of windows , radial window { w(r ) } , and angular window { v(t ) } . as illustrated in ( 4 ) , these windows will always obey the admissibility conditions .
( 4)j=w2(2jr)=1 , r(34,32),j=v2(tl)=1 , t(12 , 12 ) .
a polar
wedge represented by uj is supported by the radial window { w(r ) } and angular window { v(r)}. equation ( 5 ) defines uj in the fourier domain
( 5)uj(r,)=23j/4w(2jr)v(2j/22 ) .
equation ( 6 ) defines the curvelet transform as a function of { x = ( x1 , x2 ) } at scale 2 , orientation l and position xk(j , l ) , where r is the rotation in radians .
figure 8 illustrates the induced tiling of the frequency plane and the spatial cartesian grid associated with a given scale and orientation , and shaded area represents the polar wedge by uj(6)j , l , k(x)=j(rl(xxk(j , l ) ) ) .
the new implementation of curvelet transform based on wrapping of fourier samples takes a 2d image as an input in the form of a cartesian array f[m , n ] , where 0 m < m , 0 n < n where m and n are the dimensions of the array . as illustrated in ( 7 )
, the outputs will be a collection of curvelet coefficients c(j , l , k1k2 ) indexed by a scale j , an orientation l and spatial location parameters k1 and k2 .
each j , l , k1k2 is a digital curvelet waveform , superscript d stands for digital .
these approach implementations are the effective parabolic scaling law on the subbands in the frequency domain to capture curved edges within an image in more effective way .
as mentioned earlier , wrapping based curvelet transform is a multiscale pyramid which consists of several subbands at different scales consisting of different orientations and positions in the frequency domain . at a high frequency level , curvelets are so fine and looks like a needle shaped element and they are non - directional coarse elements at low frequency level .
figure 9 illustrates the whole image represented in spectral domain in the form of rectangular frequency tiling by combining all frequency responses of curvelets at different scales and orientations .
it can be seen from figure 9 that curvelet becomes finer and smaller in the spatial domain and shows more sensitivity to curved edges as the resolution level is increased , thus allowing to effectively capturing the curves in an image , and curved singularities can be well - approximated with fewer coefficients . in order to achieve a higher level of efficiency , curvelet transform
this means that a 2d fft is applied to the image . for each scale and orientation , a product of ujl
wedge is obtained ; the result is then wrapped around the origin , and 2d ifft is then applied resulting in discrete curvelet coefficients .
describe the discrete curvelet transform in as illustrated in
( 8)curvelet transform = ifft[fft(curvelet)fft(image ) ] .
the difficulty behind this is that trapezoidal wedge does not fit in a rectangle of size 2 2 aligned with the axes in the frequency plane in which the 2d ifft could be applied to collect curvelet coefficients .
wedge wrapping procedure proposed in uses a parallelogram with sides 2 and 2 to support the wedge data .
the wrapping is done by periodic tiling of the spectrum inside the wedge and then collecting the rectangular coefficient area in the centre .
the centre rectangle of size 2 2 successfully collects all the information in that parallelogram .
figure 10 illustrates the process of wrapping wedge where the angle is in the range ( /4 , 3/4 ) and the rectangles have the same width and length as the parallelogram is centred at the origin .
step 1apply the 2d fft to an image to obtain fourier samples
( 9)f^[m , n ] , n2m , n < n2 .
apply the 2d fft to an image to obtain fourier samples
( 9)f^[m , n ] , n2m , n < n2 .
step 2for each scale j and angle l , form the product
( 10)uj , l[m , n]f^[m , n ] .
for each scale
j and angle l , form the product
( 10)uj , l[m , n]f^[m , n ] .
step 3wrap this product around the origin and obtain
( 11)fj , l[m , n]=w(uj , lf^)[m , n ] ,
where the range for m , n , and is now 0 m < 2 , 0 n < 2 , and /4 < /4 .
wrap this product around the origin and obtain
( 11)fj , l[m , n]=w(uj , lf^)[m , n ] ,
where the range for m , n , and is now 0 m < 2 , 0 n < 2 , and /4
step 4apply ifft to each fj , l , hence collecting the discrete coefficients c(j , l , k1k2 ) .
apply ifft to each fj , l , hence collecting the discrete coefficients c(j , l , k1k2 ) .
the curvelet transform is a multiscale transform such as wavelet , with frame elements indexed by scale and location parameters .
wavelets are only suitable for objects with point singularities , ridgelets are only suitable for objects with line singularities , while curvelets have directional parameters and its pyramid contains elements with a very high degree of directional specificity .
the elements obey a special scaling law , where the length and the width of frame elements support are linked using
( 12)widthlength2
discrete curvelet transform in the spectral domain utilizes the advantages of fft . during fft ,
both image and curvelet at a given scale and orientation are transformed into the fourier domain .
the convolution of the curvelet with the image in the spatial domain then becomes their product in the fourier domain . at the end of this computation process
, a set of curvelet coefficients are obtained by applying ifft to the spectral product .
( a ) optimally sparse representation of objects with edgescurvelets provide optimally sparse representation of objects which display curve - punctuated smoothness except for discontinuity along a general curve with a bounded curvature .
such representations are nearly as sparse as if the object were not singular and turn out to be far sparser than other transforms decomposition of the object .
curvelets provide optimally sparse representation of objects which display curve - punctuated smoothness except for discontinuity along a general curve with a bounded curvature .
such representations are nearly as sparse as if the object were not singular and turn out to be far sparser than other transforms decomposition of the object .
( b ) optimal image reconstruction in severely ill - posed problemscurvelets also have special microlocal features which make them especially adapted to certain reconstruction problems with missing data .
for example , in many important medical applications , one wishes to reconstruct an object f(x1 , x2 ) from noisy and incomplete tomographic data .
because of its relevance in biomedical imaging , this problem has been extensively studied , yet curvelets offer surprisingly new quantitative insights .
for example , an application of the phase - space localization of the curvelet transform allows a very precise description of those features of the object of function ( f ) which can be reconstructed accurately from such data and how well , and of those features which can not be recovered .
curvelets also have special microlocal features which make them especially adapted to certain reconstruction problems with missing data .
for example , in many important medical applications , one wishes to reconstruct an object f(x1 , x2 ) from noisy and incomplete tomographic data .
because of its relevance in biomedical imaging , this problem has been extensively studied , yet curvelets offer surprisingly new quantitative insights .
for example , an application of the phase - space localization of the curvelet transform allows a very precise description of those features of the object of function ( f ) which can be reconstructed accurately from such data and how well , and of those features which can not be recovered .
as illustrated in ( 8) , the data acquisition geometry separates the curvelet expansion of the object into two pieces as illustrated in
( 13)f=ngoodf,nn+ngoodf,nn .
the first part of ( 13 )
what is interesting here is that one can provably reconstruct the recoverable part with an accuracy similar to that one would achieve even if one had complete data .
there is indeed a quantitative theory showing that for some statistical models which allow for discontinuities in the object to be recovered , there are simple algorithms based on the shrinkage of curvelet biorthogonal decompositions , which achieve optimal statistical rates of convergence .
figure 11 illustrates the frequency response of curvelets at different scales and orientations for some test images using curvelab ( version : 2.1.2 ) in both spatial and frequency domain .
figures 11(a ) , 11(c ) , 11(e ) , 11(g ) , and 11(i ) are the spatial representation of curvelet at scales 1 to 5 . and figures 11(b ) , 11(d ) , 11(f ) , 11(h ) , and 11(j ) are the frequency domain representation of curvelet that is modulus of fft .
figure 12 illustrates a clinical data for human chest from ct scanner in spatial domain and its curvelet coefficients . in figure 12 , the low frequency coefficients ( coarse scale )
the concentric coronae ( formed by black strips ) show coefficients at different scales and the outer coronae correspond to higher frequencies .
each corona has four strips further subdivided in angular panels ; each panel represents coefficients at a specified scale and orientation suggested by the position of the panel .
wedge wrapping is done for all the wedges at each scale in the frequency domain to obtain a set of subbands or wedges at each curvelet decomposition level , and these subbands are the collection of discrete curvelet coefficients .
the aim is to identify the most effective texture descriptor for medical images to capture edge information more accurately .
the discrete curvelet transform can be calculated to various resolutions or scales and angles ; the maximum number of resolution depends on the original image size and the angles .
number of angles at the second coarsest level must be at least eight and a multiple of four ; that is , 512 512 image has five maximum possible resolution levels containing structural information of the image .
figure 13 illustrates how curvelet - based edge reconstruction in medical imaging differs from other transforms methods .
the end users of the proposed system are the radiologists and specialists who analyse medical images for cancer diagnosis .
after several meetings with those people in the radiology departments in some hospitals , the main goal that they are working is to detect the accurate cancer size in medical images with the least error .
this process may be affected by the noise surrounding roi , which make the process of measuring the exact dimensions of the lesion so hard .
different datasets have been carried out with the proposed system to validate it for clinical applications .
the first one is nema iec body phantom which consists of an elliptical water filled cavity with six spherical inserts suspended by plastic rods of inner diameters : 10 , 13 , 17 , 22 , 28 , and 37 mm [ 25 , 26 ] .
real clinical human images acquired by a ct scanner have also been used to experiment the proposed approaches , this data has been previously analysed by the radiologists and the provided reports explains that the patients are diagnosed by cancer .
table 1 illustrates the snr values of extracted features from nema iec data set in spatial domain , different levels of decomposition of wavelet domain and at different block sizes in ridgelet domain .
it can be seen from table 1 that small values of snr have been obtained for all techniques ; this is due to the noise from the acquisition systems itself .
this noise will be a part of the medical image after the reconstruction of all slices .
relatively , better snr values can be achieved with the second level of wavelet decomposition and as the block size ( p ) is getting bigger with the ridgelet transform , where the transformed image is getting more similar to the original image .
this can be assigned to the major limitation of using ridgelet transformation in medical image segmentation , where ridges rarely exist in such data .
thresholding technique has been applied as a preprocessing step on the original images at threshold value ( t = 35 ) to remove as much artificial spam sequel produced from the scanners .
the transform then applied to effectively represent objects with edges which are the contours of the medical images followed by another thresholding at ( t = 7 ) to remove most of the remaining noise and facilitate the measurement process .
figures 14(a ) and 14(c ) illustrate the original images from a ct scanner , and figures 14(b ) and 14(d ) illustrate the segmented phantom image and real chest image , respectively , using curvelet transform .
as illustrated in figure 15 , results of the proposed segmentation technique are vary in terms of smooth reconstruction of the spheres .
curvelet transform segments the input image and removes artifacts from the image to exhibit smooth and optimal segmentation of nema phantom .
ridgelet transform detect roi but does not give promising segmentation results due to the lack of ridges or straight lines in the tested data set .
wavelet quadrants are varying also in their quality ; relatively , the best results have been achieved with the ll - filter output .
table 2 illustrates nema spheres diameters error percentages measured using different multiresolution analysis techniques and compared to previously implemented techniques .
ed has been used to measure the spheres diameters and calculate the error percentages for each technique , and sphere diameter error percentages have been calculated as follows :
( 14)error % = measured diameteractual diameteractual diameter100% . from table 2 , in the case of k - means clustering , tumor volumes are underestimated by approximately 5%-6% in most cases ; however , for the two smaller spherical inserts , with diameter of 10 mm and 13 mm , respectively , these underestimations are significantly greater . for the smallest sphere ,
more than a 13% volume discrepancy is recorded , with the k - means algorithm finding it difficult to quantify the tumor accurately .
k - means clustering , mrfm tends to overestimate the volumes of the spherical inserts , with the exception of spheres 1 and 2 .
three decomposition levels of dwt have been applied on nema phantom [ 25 , 26 ] using two different filters ( haar , daubechies ) , and the measured diameters were doubled at each level to produce a fair comparison with the other available techniques .
it can be seen that most of the error percentages were decreasing while the spheres diameter increasing ; it is worth mentioning that there is no upper bound of the spheres diameters to keep the errors decreasing , because the roi becomes clearer and easier to be detected and measured properly . but tumours in real life are usually very small in the early stage cancer , and the problem is to detect those turnouts ' tumours as soon as possible .
the two smallest spherical inserts are still underestimated in most of the techniques and got the largest error percentages .
the large volumetric errors encountered using this acquisition exist as a consequence of the poor slice thickness setting selected for the scan .
the 4.25 mm slice thickness causes large fluctuations in transaxial tumour areas to occur between image slices .
this problematic characteristic occurs most notably with the smallest spherical inserts , where single voxel reallocation causes a large deviation in percentage error . in figure 16 ,
the percentage error computed between the actual sphere volume and the volumes obtained using all methodologies for each of the six tumours inserts is plotted .
it can be seen that all techniques are settled down according to the error percentages as the sphere diameters increased .
it can be also seen from table 2 that acceptable error percentages have been achieved using ridgelet transform for the big spheres ( 22 mm , 28 mm , and 37 mm ) , where the curves are not sharp and ridgelet detect it accurately as it close to be ridges .
but for the small spheres , ridgelet weakness for medical image segmentation start appears clearly .
curvelet transform overcomes the weakness of wavelet for segmenting sharp curves and detect the small spheres accurately with error percentages ( 0.82%2.65% ) . for the big spheres , errors achieved using wavelet transform are still better than those achieved using curvelet transform due to the sharpness of that spheres . but still very good results using curvelet transform and acceptable for clinical applications .
psnr and mse have been also used to evaluate the quality of the proposed techniques .
the original image has been contaminated with gaussian white noise at = 20% of the maximum intensity .
table 3 illustrates a comparison study of curvelet transform with the other traditional transforms , and comparison terms psnr and mse have been used to test the quality of the transformed image . from table 3
, it can be seen that the best results according to both psnr and mse have been achieved using curvelet transform .
figure 17 illustrates two noisy images and the denoised outputs using both wavelet and curvelet .
according to a study done by dettori and semler , the ridgelet - based descriptors had significantly higher performance measures in comparison to wavelet - based descriptors , with accuracy rates higher than any other wavelet - based feature set for all individual organs .
this is not surprising given the fact that the ridgelet transform is able to capture multidirectional features , as opposed to the wavelet transform which focus mainly on horizontal , vertical , and diagonal features .
this can be generalized to most of the images except for medical scanners , where the weakness of wavelet is not dominant in such images .
curvelet - based descriptors had an even higher performance in comparison to both the wavelet and ridgelet , with accuracy rates higher , respectively .
the accuracy rate using curvelet transform is better ; this is expected , since the curvelet transform is able to capture multidirectional features in wedges , as opposed to lines or points as in the ridgelet or wavelet transform .
the multidirectional features in curvelets are very effective in extracting the important features from medical images and then segmented accurately .
as illustrated in the previous tables and figures , it can be seen that more efficient and smooth image reconstruction is achieved using curvelet transform . in terms of optimal reconstruction of the objects with edges and curves ,
the algorithm presented in this chapter is able to classify normal tissues in ct scans with high accuracy rates .
these hypotheses will be further tested and validated on different predefined clinical data sets in chapter 8 of this thesis .
segmentation using curvelet transform has been chosen for experimenting the pet scanner sensitivity variables , curvelet was applied in parallel with multithresholding and classification techniques to classify the spheres in a separate class from the other comprising objects at least noise included .
the experiment was evaluated based on the ratio between the spheres area to the other area of the scanned slice .
the actual spheres area can be calculated according to ( 15 ) , given that the spheres diameters are 10 , 13 , 17 , 22 , 28 , 37 mm
( 15)soriginal=12r{a}r2 , { a}={10,13,17,22,28,37 } ,
where soriginal is the actual area of all six spheres together .
the scan resolution can be acquired from amide software where each pixel size is 4.6875 4.6875 mm and each slice size is 128 128 pixels .
the overall slice area and the ratio between both areas can be calculated according to ( 16 ) , respectively , where sbr is the spheres to background ratio
( 16)aoriginal=1281284.68754.6875=360000 mm2,sbr = soriginalaoriginalsoriginal100%=0.702%.table 4 illustrates the results for a sample data provided from the collaborator for different scanner variables .
it can be seen that the sbr percentages varies based on the scanner variables used .
to explain the effects of those variables on the output image , figure 18 illustrates the changes in the quality of the segmented image based on the scanners variables .
it can be seen from figure 18 that 3d scans produce closer sbr percentages than 2d for all iterations except at it = 1 .
it can be noticed that the area evaluating the spheres decreases as the it value increases for both 2d and 3d and for all bed section scanning times .
a predefined clinical dataset comprised of 217 slices , with slice thickness of 3.0 mm has been tested on the proposed system .
based on the provided report , the patient is affected by multiple bilateral renal cortical cysts ; the largest one is seen in the lower pole of the right kidney , measuring about 47 45 mm . a snapshot taken for a dicom viewer window and
the roi has been located by the red lines in three different orientations of the patient 's body scan ( figure 20 ) .
it can be seen that roi appears more clearly in its biggest illustration in slice 198 ; this slice is illustrated in figure 21 , and the roi ( kidney cancer ) has been highlighted by red colour .
mra have been applied on the medical image to segment it and detect roi .
the performance of the proposed techniques for segmenting the illustrated slice in figure 21 is explained in table 5 .
the area of the cancer has been measured and compared to the provided report and then used to qualify the performance of each technique as well as mse , data loss , and psnr .
the clinical datasets have been segmented also using 3d segmentation techniques , and the lesions were detected accurately .
curvelet transform has been used before 3d segmentation to achieve a denoised ct output and ensure smoother edges .
patient data which includes lesions in liver , kidney and lung has been segmented and visualized in figures 23 , 24 , and 25 , where the oois are located .
due to the changing shapes of organs in medical images , segmentation process using multiresolution analysis combined with thresholding as pre- and postprocessing step allows accurate detection of rois .
multiresolution analysis such as wavelet transform is extensively used in medical image segmentation and provides better accuracy in results .
curvelet and ridgelet transforms are new extension of the wavelet transform that aims to deal with interesting phenomena occurring along higher dimensional singularities .
though wavelets are well suited to point singularities , they have limitations with orientation selectivity hence do not represent changing geometric features along edges effectively .
curvelet transform exhibits good reconstruction of the edge data by incorporating a directional component to the traditional wavelet transform .
experimental study in this report has shown that curvelet - based segmentation of the medical images not only provide good - quality reconstruction of detected roi , promising results are also achieved in terms of accurately detecting roi and denoising process .
curvelet transform is a new tool and utilization of this technique ; it is far from sufficient in the medical image processing area .
the future work related to this is the implementation of 3d mra transform which can be applied directly on medical volumes to detect obstacle and objects of interest . | the experimental study presented in this paper is aimed at the development of an automatic image segmentation system for classifying region of interest ( roi ) in medical images which are obtained from different medical scanners such as pet , ct , or mri .
multiresolution analysis ( mra ) using wavelet , ridgelet , and curvelet transforms has been used in the proposed segmentation system .
it is particularly a challenging task to classify cancers in human organs in scanners output using shape or gray - level information ; organs shape changes throw different slices in medical stack and the gray - level intensity overlap in soft tissues .
curvelet transform is a new extension of wavelet and ridgelet transforms which aims to deal with interesting phenomena occurring along curves .
curvelet transforms has been tested on medical data sets , and results are compared with those obtained from the other transforms .
tests indicate that using curvelet significantly improves the classification of abnormal tissues in the scans and reduce the surrounding noise . |
duck virus hepatitis ( dvh ) is one of the most economic import diseases to all duck - growing farms because of its high potential mortality if the infection is not controlled .
the morbidity is 100% and the mortality may reach 95100% , in the first week of age .
survived ducklings after dhv infection have a solid immunity , but it is necessary to protect the duck industry against such fatal disease using the potent - specific vaccine .
live attenuated dvh-1 vaccine which could be administrated through the intramuscular route in breeder ducks 2 - 3 weeks before lying allowing the transmission of high maternal immunity to the offspring providing them with passive immunity that is able to protect the new hatched birds up to 15 days of age .
also , it could be injected in 2-day - old ducklings followed by a booster dose 2 - 3weeks later . in egypt , duck farms
are routinely protected against dvh following a vaccination program employing dvh-1 which is the only vaccine recorded in egypt .
unfortunately , some duck farms stopped vaccination against dvh causing the recurrence of disease outbreaks .
glycyrrhizin ( gl ) is the major active component extracted from licorice ( glycyrrhiza glabra ) roots .
gl has anti - inflammatory and antiviral effects that have been used in the treatment of patients with chronic hepatitis b and c [ 37 ] .
gl enhances the production of antibodies through the production of interleukin- 1 ( il-1 ) , il-2 , and il-12 .
recorded that gl possesses a good immunostimulant and synergistic effect to dvh vaccine through activation of t lymphocyte proliferation .
gl with vaccine enhances higher antibody titer against dhv than vaccine alone and high immunity protection .
the present study was conducted to investigate the protective effect of glycyrrhizin injected alone or in combination with live attenuated dhv vaccine against experimental infection of ducklings with virulent duck hepatitis virus through the assessment of some haematological and biochemical parameters .
the experiment was done according to guidelines for animal experimentations and approved by the institutional animal care and use committee , national research center , animal care unite , dokki , giza , egypt .
two kg of licorice root ( glycyrrhiza glabra l. ) was obtained from haraz , abdeen , cairo , egypt , for extraction of glycyrrhizin ( gl ) .
the extracted and purified substances were identified using thin layer chromatography ( tlc ) according to the method of cui et al . .
it consists of purified glycyrrhizin 2% + cysteine 0.2% + glycine 2% dissolved in physiological saline .
cysteine and glycine were added to avoid side effect of glycyrrhizin by increasing glutathione synthesis and prevent the sodium and water retention effect .
one hundred and sixty white pekin domestic ducklings one day old , obtained from a private nonvaccinated parent flock without maternal immunity were used in this study .
ducklings were housed under hygienic measures in separate isolators receiving a balanced growing broiler ration , containing protein 21% , fats 3.6% , and fibers 3.4% according to nrc .
ducklings were kept for 4 days for acclimatization and were allocated into 4 equal groups .
group ( 1 ) was kept as normal control ( without glycyrrhizin treatment or vaccination ) .
group ( 2 ) was inoculated intraperitoneally ( i / p ) with 10 mg of glycyrrhizin / kg bw as snmc ( 3 times weekly for 4 weeks ) .
group ( 3 ) was inoculated intramuscularly ( i / m ) with 0.5 ml of live attenuated dhv vaccine ( obtained kindly from vet serum and vaccine research institute , abbassia , cairo ) .
group ( 4 ) was inoculated with glycyrrhizin as snmc ( 10 mg / kg bw , i / p , 3 times weekly for 4 weeks ) and live attenuated dhv vaccine ( 0.5 ml ) i / m . at the end of the 3rd week , all groups were challenged except 20 ducklings from the normal control group were continued to be kept as negative control .
blood samples were collected from each duckling by jugular vein puncture before the challenge test at the end of the 1st , 2nd , and 3rd weeks and after the challenge at the 4th week of the beginning of the experiment .
each blood sample was divided into two portions ; the first one was anticoagulated by disodium salt of ethylene diamine tetra acetic acid ( edta ) for determination of hemogram .
the second portion was placed in a plain centrifuge tube for serum separation and determination of biochemical constituents ; total proteins , albumin , activities of aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , alkaline phosphatase ( alp ) , glucose , creatinine , uric acid , and cholesterol .
the ducklings of each group at the end of the 3rd week of treatment ( at the 25th day of age ) were challenged i / m with 0.5 ml virulent dhv containing 10 tcid50 per duckling .
the strain was kindly supplied from vet serum and vaccine research institute , abassia , cairo .
differences between control and treated groups and differences between control - infected group and other groups after challenge were tested for significance using a one - way analysis of variance followed by least significant difference ( lsd ) .
differences were considered significant at p < 0.05 level using spss version 10 computer program .
before the challenge , ducklings of normal control and glycyrrhizin - treated groups ( 1 and 2 ) appeared healthy during the experimental period . however , vaccinated group ( 3 ) showed signs of illness in the form of depression , decreased food intake , ruffled feather , and dullness at the 2nd and 3rd days .
these signs started to disappear at the 4th and 5th days after vaccination . on the other hand , ducklings of treated and vaccinated group ( 4 ) were slightly depressed , mildly anorexic at the 2nd and 3rd days after vaccination , and returned to normal at the 4th and 5th days .
after the challenge test ( at the 25th day of age ) , control infected group of ducklings showed severe depression , ruffled feather , and off food .
some ducklings were lying on their sides or breast with leg extended backward and head drown over the back with spasmodic paddling leg movement on the 3rd , 4th , 5th , and 6th days after challenge .
glycyrrhizin group ( 2 ) showed slight depression and general signs of illness at the 2nd day after challenge ; one duckling had spasmodic paddling leg movement but returned healthy at the 3rd day .
in addition , ducklings of vaccinated group ( 3 ) showed moderate depression and general signs of illness at the 2nd day after challenge ; one duckling died at the 3rd day after challenge .
in contrast , high protection rate ( 100% ) , healthy appearance , normal growth , and size were observed in glycyrrhizin - treated and -vaccinated ducklings ( group 4 ) as shown in table 1 .
compared to normal control group ( 1 ) before challenge , red blood cell count ( rbc ) , packed cell volume ( pcv ) % , and haemoglobin ( hb ) concentration showed significant increase in glycyrrhizin - treated group ( 2 ) from the 1st till the 3rd week .
glycyrrhizin - treated and vaccinated group ( 4 ) showed significant increases in rbcs count and pcv % at the 2nd week .
vaccinated group ( 3 ) showed significant decreases in the rbcs count , pcv % , and hb concentration at the 1st and 2nd weeks . at the 4th week after challenge , rbcs count , pcv % , and hb concentration showed significant decrease in all groups compared to the normal control group ( table 2 ) .
vaccinated group ( 3 ) showed significant an increase in mean corpuscular volume ( mcv ) and a significant decrease in mean corpuscular haemoglobin concentration ( mchc ) at the 1st week before challenge in comparison with normal control group ( 1 ) . at the 4th week after challenge , significant increase in mcv with marked decrease in mchc was demonstrated in control - infected and vaccinated groups , while no significant changes were observed in glycyrrhizin - treated group ( 2 ) and glycyrrhizin - treated and -vaccinated group ( 4 ) .
this data revealed the presence of macrocytic hypochromic anemia at the 1st week in vaccinated group and at the 4th week ( after challenge ) in control - infected and vaccinated group ( table 2 ) . before challenge ,
compared to normal control group ( 1 ) , glycyrrhizin - treated group ( 2 ) showed significant leukocytosis all over the experimental period with lymphocytosis started from the 1st week and monocytosis started from the 2nd week till the end of the experiment .
vaccinated group ( 3 ) showed significant leukopenia at the 1st week associated with significant lymphocytosis at the 3rd week and monocytosis from the 1st week till the end of experiment , while significant decreases in heterophil and eosinophil count were detected from the 1st week till the end of the experiment .
glycyrrhizin - treated and -vaccinated group ( 4 ) showed leukocytosis , lymphocytosis , and monocytosis from 1st week till the end of the experiment ( table 3 ) . at the 4th week ( after challenge ) , compared to control negative group , significant leukopenia , heteropenia , and eosinopenia were detected in control - infected , vaccinated , treated and vaccinated , and treated groups , respectively , with significant lymphocytosis and monocytosis in glycyrrhizin - treated and -vaccinated , control - infected , and treated groups , respectively ( table 3 ) . before challenge , compared to normal control group ( 1 ) , glycyrrhizin - treated group ( 2 ) showed significant increases in total proteins and globulins at the 2nd week with significant increases in albumin at the 2nd and the 3rd weeks .
vaccinated group ( 3 ) showed significant increase in total proteins with significant hyperglobulinemia at the 2nd week , while significant hypoalbuminemia was observed at the 1st and 2nd weeks with significant decrease in a / g ratio from 1st week till the end of the experiment .
glycyrrhizin - treated and -vaccinated group ( 4 ) showed significant increase in total proteins with significant hyperglobulinemia at the 2nd and 3rd weeks , while significant decreases were observed in a / g ratio from the 1st week till the end of the experiment except for significant increase at the 3rd week with no significant changes in albumin concentration ( table 4 ) . at the 4th week ( after challenge ) , control - infected group showed significant hypoproteinemia , hypoalbuminemia , and significant decreases in a / g ratio compared to normal control group ( 1 ) .
glycyrrhizin - treated group ( 2 ) showed significant increase in total proteins with hyperglobulinemia and significant decrease in a / g ratio at the 4th week and no significant changes in albumin .
vaccinated group ( 3 ) and treated and vaccinated group ( 4 ) showed significant hyperglobulinemia , hypoalbuminemia , and significant decrease in a / g ratio at the 4th week ( table 4 ) . before challenge , compared to normal control group ( 1 ) serum total cholesterol showed significant increase in vaccinated group ( 3 ) at the 1st week and significant decreases in glycyrrhizin - treated group ( 2 ) at the 3rd week , while no significant changes were noticed in glycyrrhizin - treated and -vaccinated group ( 4 ) ( table 4 ) . at the 4th week
( after challenge ) , compared to normal control group ( 1 ) , control - infected group and vaccinated group ( 3 ) showed significant increase , and treated and vaccinated group ( 4 ) showed marked decrease , while treated group ( 2 ) showed no significant change in serum total cholesterol ( table 4 ) . before challenge ,
compared to normal control group ( 1 ) , there is a significant hyperglycemia in vaccinated and treated and vaccinated groups at the 1st week , while significant hypoglycemia was noticed in treated and treated and vaccinated groups at the 3rd week . at the 4th week
( after challenge ) compared to control group ( 1 ) , there is a significant hyperglycemia in vaccinated , control - infected , treated and vaccinated , and treated groups , respectively ( table 4 ) . before challenge ,
compared to normal control group ( 1 ) , activities of ast and alt showed significant increases in vaccinated groups ( 3 ) at the 1st and 2nd weeks .
alp activities showed significant increase in vaccinated group ( 3 ) from the 1st week till the 3rd week , and treated and vaccinated group ( 4 ) showed significant increase at the 1st week , while no significant change was observed in treated group ( 2 ) . at the 4th week after challenge , compared to control group ( 1 ) there is a significant increase in ast , alt , and alp activities in control - infected group , vaccinated group ( 3 ) , and treated and vaccinated group ( 4 ) as shown in table 5 . before challenge ,
compared to normal control group ( 1 ) , vaccinated group ( 3 ) showed significant increase in uric acid and creatinine at the 1st week and at the 1st and 2nd weeks , respectively . on the other hand ,
no significant changes were noticed in treated group ( 2 ) and treated and vaccinated group ( 4 ) .
after challenge , compared to control group ( 1 ) , control - infected group and vaccinated group ( 3 ) showed significant increases in uric acid and creatinine at the 4th week . treated and vaccinated group ( 4 ) showed significant increase in uric acid at the 4th week , while treated group ( 2 ) showed no significant changes ( table 5 ) .
the present work was adopted to investigate the effect of gl as an antiviral and immunostimulant against dhv .
glycyrrhizin ( gl ) , the active principle of licorice ( glycyrrhiza glabra ) has antiviral , anti - inflammatory , and immunostimulant effects . in the present study ,
most of vaccinated group and treated & vaccinated group showed symptoms of depression , loss of appetite , ruffled feather , and dullness at the 2nd and 3rd days after vaccination and began to disappear at the 4th and 5th days after vaccination .
this period gets along with the incubation period of the dvh which varied from 2 to 7 days and stress effect of vaccination .
the symptoms which were observed in treated & vaccinated group were less severe than those of vaccinated group may be referred to the immunostimulant and hepatoprotective effect by gl which might decrease the undesirable effect of live attenuated vaccine . regarding the results of the challenge test at the 25 day of age , the mortality rate was the highest in control - infected group as 70% of ducklings died at the 3rd , 4th , 5th , and 6th days after inoculation which could be attributed to the immunosuppressive and deteriorated effect of the virus on the liver , kidneys , and thymus gland .
these results were parallel to these reported by saif et al . and mahdy .
vaccinated group showed 10% mortality which may be attributed to the protective effect of the vaccine , while treated group showed no mortality which may be due to the enterohepatic cycle of gl , antiviral , immunostimulant , anti - inflammatory , and antioxidant effects . treated and vaccinated group ( 4 ) showed no mortality or morbidity due to both efficiency and potancy of gl and vaccine in controlling the virus . before challenge , results of erythrogram showed significant decrease in vaccinated group ( 3 ) at the 1st week and macrocytic hypochromic anemia then normocytic normochromic anemia at the 2nd week .
this result could be attributed to loss of rbcs due to extravasation in different organs particularly in the liver and spleen of ducklings as mentioned by mahdy .
erythrogram of treated and treated and vaccinated groups showed significant increase which could be attributed to the hepatostimulatory and hepatoprotective effect of gl leading to production of more rbcs by the bone marrow under control of erythropoietic factors released by hepatic cells .
after challenge , results of erythrogram showed varying types of anemia in all groups which may be attributed to hemorrhage effect of dhv and vaccine on liver and spleen as reported by campbell and coles and mahdy .
the presence of different types of anemia may be due to bone marrow response to these hemorrhages .
results of leukogram revealed leukocytosis in treated group ( 2 ) and treated and vaccinated group ( 4 ) before challenge .
these results are similar to those of al - okbi et al . , who reported that licorice extract increased the total leukocytic count in rat .
leukopenia was demonstrated at the 1st week in vaccinated group ( 3 ) before challenge and in all groups after challenge which may be due to the depressing effect of dhv on leukopoietic parameters or the severe leukocytic infiltration in different organs .
these results were in agreement with latimer and bienzle and mahdy who reported that leukopenia may be due to some viral infections or live vaccine .
leukopenia was less significant in treated group ( 2 ) and treated and vaccinated group ( 4 ) which may be due to the immunostimulant effect of gl [ 9 , 31 ] .
the observed lymphocytosis with monocytosis in treated group ( 2 ) and treated and vaccinated group ( 4 ) may be due to the antigenic stimulation of gl through its stimulation to the mononuclear cells .
moreover , lymphocytosis in ducklings may be secondary to antigenic stimulation by the virus , and also monocytosis may be observed in association with antigenic agent ( infection ) as it has phagocytic function .
results of proteins profile revealed significant hyperproteinemia due to hyperglobulinemia at the 2nd week with significant hypoalbuminemia at the 1st and 2nd weeks in vaccinated group ( 3 ) before challenge .
after challenge , significant hyperproteinemia due to hyperglobulinemia was observed at the 4th week which may be due to the effect of the virus or vaccine on the proliferation of b lymphocyte , while hypoalbuminemia may be due to the adverse effect of vaccine or virus on liver and kidneys .
the hyperproteinemia may occur due to the effect of gl to preserve the normal functional status of liver [ 29 , 34 , 35 ] .
after challenge , it showed significant hyperproteinemia with hyperglobulinemia which may be due to the immunopotentiating action of gl through activation of t cell and the effect of gl as an immune modulating and biological response modifier activities .
gl - treated and -vaccinated group showed significant hyperproteinemia at the 2nd week before challenge which may be attributed to the compensatory effect of gl on the deteriorating action of vaccine .
after challenge , significant increased hypoalbuminemia was detected at the 4th week due to the effect of dhv infection .
the hyperglobulinemia could be attributed to the immunopotentiating effect of gl and vaccine related to the proliferation of b lymphocyte which were converted to plasma cells producing immunoglobolins as a result of vaccine or viral infection [ 28 , 33 ] .
furthermore , the control - infected group showed significant hypoproteinemia and hypoalbuminemia at the 4th week which may be attributed to the damaging effect of the virus on the liver and kidneys .
the observed results in control - infected and vaccinated groups ( 3 ) get on the same hand with those obtained by ahmed et al .
serum total cholesterol showed significant increase in vaccinated group ( 3 ) at the 1st and 4th weeks and in the control - infected group at the 4th week which may be attributed to the hepatic injury caused by the dhv or vaccine .
gl - treated group ( 2 ) showed significant decrease in total cholesterol at the 3rd week which may be due to the antioxidant effect of gl or the effect of gl on increasing the lipid peroxides in liver .
nonsignificant changes after challenge may be due to the hepatoprotective action and antiviral effect of gl [ 7 , 40 ] .
gl - treated and -vaccinated group ( 4 ) showed no significant changes in total cholesterol all over the experimental period except significant decrease at the 4th week which may be attributed to the damage of hepatocytes caused by dhv which bounds to lipids and proteins through subcellular fraction . before challenge
, significant hyperglycemia was noticed in vaccinated and treated and vaccinated groups at the 1st week which may be attributed to the stress effect of vaccination which increases gluconeogenesis in the liver . treated and treated and vaccinated
groups showed significant hypoglycemia at the 3rd week which may be due to the inhibitory action of licorice extract on the activity of 11 beta - hydroxysteroid dehydrogenase which converts cortisol to cortisone .
after challenge , significant hyperglycemia was observed at the 4th week in all groups which may be attributed to the stress factor of infection which enhances the gluconeogenes and glycogenolysis in the liver .
these results disagree with mahdy who reported that dhv or vaccine causes hypoglycemia due to damage of liver which resulted in decreased hepatic gluconeogenesis .
regarding liver enzymes , vaccinated group ( 3 ) showed significant increase in the activity of alt and ast at the 1st and 2nd weeks with significant increase in the activity of alp at the 1st , 2nd , and the 3rd weeks ( before challenge ) which may be due to the damaging effect of vaccine on liver as hepatic degeneration or necrosis causes leakage of these enzymes , so elevation of the serum levels of ast and alt were noticed , while the obstruction in bile duct associated with bile duct hyperplasia causes elevation in alp .
after challenge , vaccinated group ( 3 ) and control infected groups showed significant increase in the activity of ast , alt , and alp at the 4th week which may be attributed to the damaging effect of dhv on liver hepatocyte and biliary canaliculi .
this result was rather similar to that of hochleithner , ellakany et al . , and mahdy .
treated group ( 2 ) showed normal ast , alp , and alt patterns ; which may be attributed to the antiviral , antioxidant , and hepatoprotective effects of gl as it enters the enterohepatic loop , excreted in bile then reabsorbed in the gut to recycle repeatedly through liver or the action of gl in inhibiting the activation of phospholipase a2 . treated and vaccinated group ( 4 ) showed no significant changes in the activity of alt and ast all over the experiment except a significant increase which was noticed at the 4th week .
the increases in liver enzymes may be attributed to the damage effect of dhv on liver cells and canaliculi .
results were less severe than that recorded in both vaccinated and control - infected groups .
these results agreed with al - qarawi et al . who reported hepatoprotective effect of gl in rat .
vaccinated group showed significant increase in uric acid at the 1st and 4th weeks and in creatinine at the 1st , 2nd , and 4th weeks .
control - infected group showed significant increase in uric acid and creatinine at the 4th week . treated and vaccinated group ( 4 ) showed no significant changes in uric acid and creatinine at the 1st week but significant increase in uric acid at the 4th week .
the increase in uric acid may be due to the damaging effect of dhv or vaccine on kidneys [ 1 , 37 ] .
finally , dhv infection caused some pathognomonic clinicopathological changes ( macrocytic hypochromic anemia , leukopenia , hypoproteinemia , hypoalbuminemia , hyperglobulinemia , hyperglycemia , hypercholesterolemia , and marked elevation of liver enzymes and renal parameters .
live attenuated vaccine gives high protection against dhv but causes some deleterious effects on liver and kidneys .
gl has the ability to reduce the adverse changes associated with vaccine or infection through reduction of severity of the clinical signs associated with duck hepatitis vaccine or infection , minimizing the mortalities by the virus , gl alone , or with vaccine can reduce the drastic elevation of liver enzymes with considerable improvement in erythrogram , protein pattern , total cholesterol and glucose , and duckling general health condition .
glycyrrhizin injected alone or in combination with dhv vaccine protected or ameliorated the deteriorating effects induced by dhv vaccine and/or duck hepatitis virus infection by improvement of erythrogram and leukogram , as well as liver and kidney functions . | the present study aimed to investigate the protective effect of glycyrrhizin ( locally isolated and purified from licorice root ) against duck hepatitis virus through the assessment of some hematological and biochemical parameters .
one hundred and sixty white pekin ducklings
one day old were randomly divided into four equal groups .
group ( 1 ) was kept as normal control .
group ( 2 ) was inoculated i / p with 10 mg glycyrrhizin / kg bw , three times per week for four weeks .
group ( 3 ) was inoculated i / m with 0.5 ml of live attenuated dhv vaccine . group ( 4 ) was inoculated with both glycyrrhizin ( 10 mg / kg bw i / p , three times per week for four weeks ) and live attenuated dhv vaccine ( 0.5 ml , i / m ) . then , all groups of treatment were challenged using virulent dhv except for 20 ducklings from the normal control group which were continued to be kept as negative control .
the results revealed that duck hepatitis virus ( dhv ) caused macrocytic hypochromic anemia , leukopenia , hypoproteinemia , hypoalbuminemia , hyperglycemia , hypercholesterolemia , and marked elevation of liver enzymes and renal parameters . in conclusion ,
glycyrrhizin injected alone or in combination with dhv vaccine protected or ameliorated the deteriorating effects induced by dhv vaccine and/or duck hepatitis virus infection by improvement of erythrogram and leukogram , as well as liver and kidney functions . |
since 2011 , pneumonia has overtaken cerebrovascular disorders as the third leading cause of death in japan .
elderly people are particularly prone to developing severe pneumonia because of various underlying conditions ( 1 ) .
nutritional support plays an integral role in the treatment of critically ill patients and the enteral route is always preferred over the parenteral route ( 2 - 4 ) .
enteral nutrition usually starts with gastric feeding by a nasogastric tube because it is easier to achieve but feeding intolerance , commonly defined as large gastric residual volumes ( nasogastric aspirate of > 350 - 400 ml ) along with gastrointestinal symptoms , can be as high as 40% in severely ill patients ( 5 ) .
the common solution for gastric feeding intolerance is the use of post - pyloric ( duodenal or jejunal ) feeding .
however , delayed gastric emptying and large gastric residual volumes that persist may still lead to microaspiration and pneumonia . here
, we report the successful use of a newly developed nasojejunal tube with gastric decompression function in a patient with septic shock due to severe pneumonia .
an 84-year - old japanese man with dementia in a nursing home developed fever and received treatment for upper respiratory infection from a nearby clinic . however , the fever persisted and two days later he was referred to our hospital because of a decline in blood pressure , a decrease in spo2 ( saturation of peripheral oxygen ) and loss of consciousness . on admission ,
his blood pressure was 77/48 mmhg , pulse rate was 107 beats per minute ( regular ) , spo2 was 84% even with oxygen administration of 10 l / min by reservoir mask and respiratory rate was 32 breaths per minute .
his body temperature was 38.3 and coarse crackles were audible on bilateral lung fields ( right > left ) .
his level of consciousness was altered at japan coma scale ( jcs ) iii-200 or glasgow coma scale 3 ( e1v1m1 ) .
a chest radiograph and ct scan showed diffused consolidation in both lungs consistent with acute pneumonia ( fig .
1 ) . chest radiograph and ct scan on admission reveal diffuse consolidation in both lungs ( right > left ) .
laboratory findings ( table ) on admission demonstrated leukocytosis ( 27,180 /l ) with neutrophilia ( 98% ) and a high c - reactive protein level ( 19.30 mg / dl ) , strongly suggesting the presence of inflammation . a slight elevation of liver and biliary enzyme levels , hypoproteinemia and renal dysfunction with high creatine kinase levels were also observed .
abnormalities in coagulation parameters , such as thrombocytopenia , prolonged prothrombin time and elevated fibrin degradation products also indicated the possibility of disseminated intravascular coagulopathy ( dic ) .
wbc : white blood cells , rbc : red blood cell , hb : hemoglobin , ht : hematocrit , plt : platelets , crp : c - reactive protein , abga : arterial blood gas analysis , tp : total protein , alb : albumin , t - bil : total bilirubin , amy : amylase , ck : creatine kinase , bun : blood urea nitrogen , cr : creatinine , pt - inr : international normalized ratio of prothrombin time , aptt : activated partial thromboplastin time , fdp : fibrinogen degradation products .
the patient was diagnosed with septic shock from severe aspiration pneumonia and was treated in our high care unit .
his apacheii score was 30 and sequential organ failure assessment ( sofa ) score 15 , reflecting the severity of disease and multiple organ dysfunction .
therapy was initiated with meropenem hydrate ( 1.5 g / day ) , dopamine hydrochloride ( 3 g / kg / min ) and nafamostat mesylate ( 0.07 mg / kg / hr ) . as his condition stabilized , a 12fr size nasogastric feeding tube was inserted on day 2 and enteral nutrition using a standard polymeric formula ( 5 kcal / kg / day at 30 ml / hr ) was started the next day .
the polymeric formula used had a caloric density of 1 kcal / ml , with 58% of calories as carbohydrates , 25% as lipids and provided 4 grams of protein for every 100 kcal administered .
the infusion dose and speed increased gradually until 900 kcal / day ( 15 kcal / kg / day at 80 ml / hr ) on day 9 , when he developed a 39.5 fever with persistent decrease in spo2 ( < 90% ) .
his white blood cell count increased to 39,020 /l and a chest radiograph revealed fresh infiltrations in the right lower field .
aspiration from gastric feed reflux ( gastric feeding intolerance ) was suspected and enteral feeding was discontinued . on day 10 , a newly developed 16fr size nasojejunal feeding tube with gastric decompression function ( njt / gd , fig .
a small amount of contrast medium ( gastrografin 10 ml ) was infused into the gastric lumen before removing the nasogastric feeding tube in order to ascertain the orientation of the stomach and duodenum .
the njt / gd was then inserted so that the tip was placed beyond the ligament of treitz with the radiopaque marker positioned before the pylorus ( fig .
3 , right ) . the newly developed nasojejunal feeding tube with gastric decompression function ( njt / gd ) . placement of njt / gd with the use of fluoroscopy
enteral feeding was recommenced on the same day of tube placement at 800 kcal / day ( 13 kcal / kg / day at 60 ml / hr ) while simultaneously draining any residual gastric contents ( fig .
the feeding dose was gradually increased until 1,500 kcal / day ( 25 kcal / kg / day , without pump ) from day 15 . during the course of jejunal feeding with the njt / gd
no drainage of enteral feed was observed and there was no recurrence of high grade fever or persistent decrease in spo2 during the use of the njt / gd , implying that enteral nutrition was well tolerated . simultaneous gastric decompression ( drainage ) with jejunal feeding .
although the patient 's condition improved , an evaluation by our dysphagia team showed that oral intake was not yet safe and long term enteral nutrition through a percutaneous route was indicated . by day 22
upper gastrointestinal endoscopy performed before the procedure did not reveal any abnormalities ( such as hiatal hernia etc . ) that may have impeded enteral nutrition .
postoperative clinical course was uneventful and on day 30 , he was transferred to our rehabilitation ward . swallowing therapy enabled him to be discharged from our hospital on day 43 with some oral intake .
penicillin - susceptible streptococcus pneumoniae ( pssp ) was isolated from the patient 's aspirated sputum during admission .
meropenem hydrate was used until day 14 , after which sulfamethoxazole ( administered through the njt / gd ) was employed .
middle : endoscopic view ( taken before peg tube insertion ) of njt / gd with the radiopaque marker ( arrow head ) correctly placed before the pylorus .
right : gastric decompression holes of njt / gd ( arrow heads ) . clinical course and enteral nutrition provision ( ngt : nasogastric tube , njt / gd : nasojejunal tube with gastric decompression function , peg : percutaneous endoscopic gastrostomy , transfer : transfer to rehabilitation ward ) .
on day 10 , a newly developed 16fr size nasojejunal feeding tube with gastric decompression function ( njt / gd , fig . 2 ) was inserted into the jejunal lumen under fluoroscopic guidance .
a small amount of contrast medium ( gastrografin 10 ml ) was infused into the gastric lumen before removing the nasogastric feeding tube in order to ascertain the orientation of the stomach and duodenum .
the njt / gd was then inserted so that the tip was placed beyond the ligament of treitz with the radiopaque marker positioned before the pylorus ( fig .
3 , left ) . after the procedure , tube placement was confirmed using contrast medium again ( fig .
3 , right ) . the newly developed nasojejunal feeding tube with gastric decompression function ( njt / gd ) .
placement of njt / gd with the use of fluoroscopy . left : positioning of radiopaque marker ( arrow head ) before the pylorus .
enteral feeding was recommenced on the same day of tube placement at 800 kcal / day ( 13 kcal / kg / day at 60 ml / hr ) while simultaneously draining any residual gastric contents ( fig .
the feeding dose was gradually increased until 1,500 kcal / day ( 25 kcal / kg / day , without pump ) from day 15 . during the course of jejunal feeding with the njt / gd
no drainage of enteral feed was observed and there was no recurrence of high grade fever or persistent decrease in spo2 during the use of the njt / gd , implying that enteral nutrition was well tolerated . simultaneous gastric decompression ( drainage ) with jejunal feeding .
although the patient 's condition improved , an evaluation by our dysphagia team showed that oral intake was not yet safe and long term enteral nutrition through a percutaneous route was indicated . by day 22
upper gastrointestinal endoscopy performed before the procedure did not reveal any abnormalities ( such as hiatal hernia etc . ) that may have impeded enteral nutrition .
postoperative clinical course was uneventful and on day 30 , he was transferred to our rehabilitation ward . swallowing therapy enabled him to be discharged from our hospital on day 43 with some oral intake .
penicillin - susceptible streptococcus pneumoniae ( pssp ) was isolated from the patient 's aspirated sputum during admission .
meropenem hydrate was used until day 14 , after which sulfamethoxazole ( administered through the njt / gd ) was employed .
middle : endoscopic view ( taken before peg tube insertion ) of njt / gd with the radiopaque marker ( arrow head ) correctly placed before the pylorus .
right : gastric decompression holes of njt / gd ( arrow heads ) . clinical course and enteral nutrition provision ( ngt : nasogastric tube , njt / gd : nasojejunal tube with gastric decompression function , peg : percutaneous endoscopic gastrostomy , transfer : transfer to rehabilitation ward ) .
this case illustrates the successful provision of enteral nutrition , which is integral to mainstream therapy , in a severely ill patient .
as the patient 's pneumonia was classified as severe , our mainstream therapy included the use of meropenem , a broad spectrum antibacterial agent which has been demonstrated to be very effective and tolerable in elderly patients with potentially fatal aspiration pneumonia ( 6 ) .
enteral nutrition ( via tube feeding ) has been established as the preferred way of feeding the critically ill patient and is often associated with favorable outcomes ( 2 - 4 ) . not only is it more physiological , enteral nutrition may also preserve mucosal architecture and immune function while reducing inflammation response ( 7 ) .
the initiation of enteral nutrition has been demonstrated to be feasible and safe even within 6 hours of admission into the intensive care unit ( 8) .
although some earlier studies concluded that post - pyloric feeding has no clear advantages over gastric feeding in terms of overall nutrition received and complications ( 9,10 ) , this may be influenced by the differences in severity of illness ( 11 ) .
recent systemic reviews and meta - analyses suggest that post - pyloric feeding may reduce the incidence of feeding - related pneumonia but does not necessarily improve clinically important outcomes , such as mortality or length of stay ( 12 - 15 ) .
furthermore , procedural challenges of post - pyloric tube insertion makes it difficult to recommend routine placement in all critically ill patients .
the current consensus is still to initiate enteral nutrition by the nasogastric route , such as in this case , and then move to post - pyloric feeding only when gastric feeding intolerance occur ( 16 ) .
however , post - pyloric feeding does not actually address the problem of delayed gastric emptying and large gastric residual volumes that may persist may still lead to microaspiration or pneumonia .
the ideal solution in severely ill patients with gastric feeding intolerance would then be to feed them post - pyloric while simultaneously decompressing the stomach .
although the concept and design of a dual - purpose nasogastrojejunal tube with gastric decompression capacity have been described recently ( 17,18 ) , we are not aware of any recorded clinical use of such a tube in the literature .
the njt / gd used in this case was developed by create medic ( yokohama , japan ) with some design input from the corresponding author . to the best of our knowledge
, this is the first reported use of a nasojejunal feeding tube with gastric decompression function in a patient .
the use of the njt / gd enabled the almost continuous ( interruption of less than 24 hours ) provision of enteral nutrition to the patient until he was well enough to undergo peg .
it also enabled the gradual increase of enteral feeding dose to 67% more than what was accomplished using a nasogastric tube .
a question that should be addressed is whether a similar outcome was achievable using a regular nasojejunal tube ( without any gastric decompression function ) in this case .
although there is no clear answer , seeing that gastric drainage volume reached 450 ml / day throughout the course of jejunal feeding , we believe that the njt / gd was the best transitory option to effectively deliver enteral nutrition . in conclusion , we reported the successful use of a newly developed nasojejunal feeding tube with gastric decompression function in a severely ill patient .
the use of this tube improved the delivery of enteral nutrition when gastric feeding was not well tolerated .
we consider the njt / gd to be instrumental in clinical practice as we strive to meet the nutritional and therapeutic needs of individual patients .
mohammad shukri jahit from hospital sungai buloh , who is also the current president of the parenteral and enteral nutrition society of malaysia .
| for nutritional support of critically ill patients , the enteral route is preferred over the parenteral route .
although nasojejunal feeding can be superior to gastric feeding when gastrointestinal symptoms occur , it does not necessarily solve the problem of large gastric residual volumes .
we report the successful use of a newly developed nasojejunal feeding tube with gastric decompression function in an 84-year - old man with severe pneumonia .
after gastric feeding was considered not well tolerated , the use of this tube improved the delivery of nutrition until the patient was stable enough to undergo percutaneous endoscopic gastrostomy . |
over the past decades , considerable advances have been made in the use of long - course crt in rectal cancer .
based on a number of pivotal studies in the us which demonstrated positive effects on local control ( lc ) and overall survival ( os ) with the addition of rt and chemotherapy following surgical resection in locally advanced rectal cancer , most clinicians initially favored the use of adjuvant 5-fu based crt ( krook et al .
theoretically , rt should be delivered neo - adjuvantly rather than adjuvantly since poor cell oxygenation in the healing tumor bed potentially decreases radiosensitivity .
secondary , as the small bowel is not trapped in the pelvic bay by postoperative adhesions , fewer enteric complications are expected with neo - adjuvant rt , where moving loops of small bowel are located on different positions from day to day .
lastly , neo - adjuvant downstaging may positively influence the surgical margin status and sphincter preservation rate .
strong evidence of the superiority of neo - adjuvant to adjuvant crt in stage ii / iii rectal cancer patients undergoing total mesorectal excision ( tme ) was provided by the 5-year results of the randomized german rectal cancer study ( cao / aro / aio 94 ) , with a significant lower rate of pelvic recurrence in favor of neo - adjuvant crt as compared to adjuvant crt ( 6 versus 13% ) .
moreover , the data also showed significant lower rates of toxicity with the use of neo - adjuvant crt ( sauer et al . , 2004 ) .
the addition of 5-fu to long - course neo - adjuvant rt is considered standard of care in locally advanced rectal cancer by the evidence of two important phase iii trials , eortc 22921 and ffcd 9203 , which demonstrated the advantages of neo - adjuvant 5-fu based crt over rt alone with respect to pathologic complete remission ( pcr ) and lc , but not with respect to the rate of sphincter - sparing surgery , occurrence of distant metastases , or os ( bosset et al . , 2006 ; grard et al . ,
those findings led to a shift in the european and us policy of adjuvant crt to neo - adjuvant 5-fu crt , which is now standard of care in stage ii / iii rectal cancer .
recently , a non - inferiority phase iii trial of the mannheimer arbeitsgruppe fr gastrointestinale tumoren ( margit ) which compared capecitabine to 5-fu in ( neo-)adjuvant crt of locally advanced rectal cancer provided a growing body of evidence for using capecitabine ( hofheinz et al . , 2011 ) . besides a non - inferiority to 5-fu regarding 5-year os ( 76 versus 67% with 5-fu , p < 0.05 ) , patients receiving capecitabine experienced equal lc . in concordance with the toxicity profile of capecitabine in the adjuvant treatment of colorectal cancer ( crc ) , less leukopenia but more hand - foot skin reactions and proctitis were recorded compared to 5-fu ( hofheinz et al . , 2011 ) . in view of its advantageous administration profile ( no need for catheter placement and infusion pump )
, those encouraging findings may impact the current standard of administrating 5-fu intravenously during neo - adjuvant rt . despite those improvements ,
more than one third of the patients undergoing curative treatment of rectal cancer have distant recurrence of this disease . in an effort to further improve the pcr rate , which is considered as a surrogate end point for lc and os , and to decrease the high incidence of distant recurrences , several phase ii and iii trials investigated in addition to neo - adjuvant 5-fu based crt the use of induction chemotherapy and multi - agent systemic therapy by means of other chemotherapeutical drugs ( oxaliplatin ) or biologic agents such as cetuximab and bevacizumab , which are epidermal growth factor receptor ( egfr ) and vascular endothelial growth factor ( vegf ) directed monoclonal antibodies , respectively .
an attempt to enhance the outcome after neo - adjuvant crt and tme includes the concept of induction chemotherapy , which has been reported so far only in phase ii setting ( chua et al .
, 2010 ; fernandez - martos et al . , 2010 ) . a randomized phase ii spanish trial observed no differences in pcr and r0 resection rate between patients receiving neo - adjuvant crt with capecitabine and oxaliplatin ( capox ) and those receiving induction capox followed by crt with capox ( fernandez - martos et al . , 2010 ) .
after a median follow - up of 39 months , similar 3-year disease - free survival ( dfs ) and os rates were recorded in the two treatment arms ( fernandez - martos et al . , 2011 ) .
the expert trial , carrying out four cycles of neo - adjuvant capox followed by concomitant capecitabine based crt prior to tme in magnetic resonance imaging ( mri ) defined high - risk rectal cancer patients , reported a promising 20% pcr and 4% r1 rate , with acceptable safety ( chua et al . , 2010 ) .
one should however notice the 9 clinically significant cardiotoxic events in 8 out of 77 enrolled patients , of which 4 patients died , before protocol amendment of this trial in january 2004 to exclude patients with recent cardiac morbidity ( chau et al . , 2006 ) .
although the impressive number of early fatal events in this trial is not observed in other studies evaluating the safety of induction chemotherapy , acute toxicity is considerable with reported rates of grade 3 acute diarrhea and lymphocytopenia of 20 and 43% , respectively , according to a phase ii study where patients received one cycle of capox followed by capox based crt and surgery ( koeberle et al . , 2008 ) .
based on those phase ii data , induction chemotherapy does not seem to be safe and should therefore not be recommended outside clinical trials .
four randomized phase iii studies , the studio terapia adiuvante retto ( star)-01 trial , prodige 2-accord-12/405 trial , the national surgical adjuvant breast and bowel project ( nsabp ) r-04 trial and the german cao / aro / aio-04 trial evaluated the tolerability and efficacy of the addition of oxaliplatin to 5-fu based crt as neo - adjuvant treatment of locally advanced rectal cancer ( grard et al . , 2010 ; aschele et al . , 2011 ; roedel et al . , 2011 ; roh et al . ,
no improvement in the pcr rate was noted as compared to 5-fu based crt alone in the star-01 trial , with reported rates of 16% in both arms ( aschele et al . , 2011 ) .
furthermore , no differences in r0 resection rates circumferential resection margin ( crm ; > 1 mm ) were observed with the addition of oxaliplatin ( 93 versus 96% ; aschele et al . , 2011 ) .
longer follow - up is needed in this study to assess the impact on the primary endpoint , os . in similarity , the prodige 2-accord-12/405 trial displayed no differences in pcr ( 19 versus 14% , p = 0.09 ) , the primary endpoint , or crm involvement ( 7.7 versus 12.7% , p = 0.17 ) with the addition of oxaliplatin to capecitabine based crt ( grard et al .
those findings were confirmed by first results from the nsabp r-04 trial , randomizing 1680 rectal cancer patients between four treatment groups : neo - adjuvant continuous infusion 5-fu crt with or without oxaliplatin or neo - adjuvant capecitabine crt with or without oxaliplatin , showing no differences in downstaging , sphincter preservation rate or pcr ( roh et al . , 2011 ) .
the cumulative incidence of distant recurrence of 36% in the neo - adjuvant arm of the german rectal cancer study ( sauer et al . , 2004 ) led to a comparison of this regimen to an arm that incorporates oxaliplatin during both neo - adjuvant 5-fu crt and 5-fu adjuvant chemotherapy in the german cao / aro / aio - o4 randomized phase iii trial , which was powered to detect a 7% difference in 3-year dfs as primary endpoint ( roedel et al . , 2011 ) .
first results of this trial showed no significant differences in grade 3 acute toxicity ( 22% for 5-fu versus 23% for 5-fu / oxaliplatin arm ) , rates of sphincter preserving surgery , and r0 resection , whereas a slight but significant improvement was found in terms of pcr with the addition of oxaliplatin ( 17 versus 13% , p = 0.045 ; roedel et al . , 2011 ) .
it should be noticed that their regimen , unlike the other trials , included a chemotherapy gap during the third week of rt which may explain the similar toxicity rates and improved compliance rates ( roedel et al . , 2011 ) .
2012 ) presented the clinical outcomes after a median follow - up time of 36 months of the 598 patients included in the prodige 2-accord-12/405 trial , and they observed no differences in lc , dfs , or os between the group of patients who received neo - adjuvant capox based crt as compared to those who underwent neo - adjuvant capecitabine crt .
not surprisingly with intensified multi - agent chemotherapy , side effects may be enhanced significantly .
first results from the nsabp r-04 trial displayed a more than twofold excessive risk of grade 3 diarrhea with the addition of oxaliplatin to 5-fu based crt ( roh et al .
the star-01 and prodige 2-accord-12/405 trial reported a significant increase in grade 3 acute toxicity , with reported rates of 25% in patients receiving oxaliplatin compared to 811% for the groups receiving 5-fu based crt alone ( grard et al . , 2010 ; aschele et al . , 2011 ) .
given the activity of oxaliplatin in combination with 5-fu based chemotherapy in the adjuvant and metastatic setting of colon cancer and the well established radiosensitizing effects of another platinum - based drug , cisplatin , in the treatment of lung cancer and cervical cancer , its clinical additive effect to 5-fu based crt in the neo - adjuvant setting of rectal cancer is disappointing .
regarding its active launch into clinical combined modality trials , with the first phase i study of oxaliplatin in neo - adjuvant crt of rectal cancer already 11 years ago ( freyer et al . , 2001 ) , solid biological data with respect to the radiosensitizing activity of oxaliplatin are quite limited and not conclusive . only in abstract form ,
oxaliplatin was shown to sensitize crc cell cultures to radiation in vitro ( blackstock et al . ,
2000 , 2002 ) . in combination with 5-fu in vitro , exposure of human crc cell line ht29 to oxaliplatin indicated synergistic effects to radiation , whereas in vivo it failed to improve the growth inhibitory response induced by fractionated radiation doses of 2 gy plus capecitabine in ht29 colorectal tumor xenografts ( folkvord et al . , 2008 ) .
on the basis of the scarcity of this preclinical evidence , further experimental in vivo studies are warranted to determine the radiosensitizing properties of oxaliplatin in neo - adjuvant crt of rectal cancer and to provide a strong preclinical knowledge which is critical before moving on to further phase iii trials . moreover ,
the primary goal in those phase iii trials is of crucial concern in the era of 5-fu based crt , where local recurrences after tme are already reported to occur in less than 5% of the patients and where surrogate end points such as pcr are debatable . given that one third of the patients with resected rectal cancer develop metastatic disease despite the very high lc after neo - adjuvant crt and tme , the focus should be on the eradication of subclinical metastatic disease .
however , with current clinical end points such as dfs and os , the large number of patients to be enrolled and long time period before analysis within phase iii studies do not allow a quick answer on the systemic efficacy of a new medical treatment in the neo - adjuvant setting of rectal cancer . in conclusion ,
the addition of oxaliplatin to 5-fu based crt can not be considered a standard approach in the neo - adjuvant management of locally advanced rectal cancer , but the long - term follow - up data of those phase iii trials should be awaited .
in a randomized phase ii study , the expert - c trial addressed the addition of weekly cetuximab to the concept of induction capox and concurrent capecitabine crt , as used in the expert trial ( chua et al . , 2010 ) , in high - risk rectal cancer patients ( dewdney et al . , 2011 ) .
no differences were found in pcr , progression - free survival ( pfs ) and os for the all treated population ( dewdney et al . , 2011 ) . in subgroup analysis , kras and
braf wild type patients displayed significantly improved 3-year os with the addition of cetuximab once per week throughout treatment compared to those who received induction chemotherapy and crt alone ( 96 versus 81% , p = 0.04 ; dewdney et al . ,
interestingly , there was no significant difference in pcr ( 7 versus 11% ) in the wild type patients receiving cetuximab compared to those not receiving cetuximab ( dewdney et al . , 2011 ) .
the low pcr rate may in part be explained by the eight patients displaying a pcr but with insufficient tissue for kras and braf analysis , of which six patients received cetuximab .
grade 3 + skin rash was , as expected , increased with the use of cetuximab as well as the rates of diarrhea in patients receiving cetuximab , the latter only during crt ( dewdney et al . , 2011 ) .
in a pooled analysis of 10 phase i / ii trials incorporating cetuximab in neo - adjuvant crt of rectal cancer , an overall pcr rate and r1 resection rate of 9 and 7% were reported ( glynne - jones et al . , 2010 ) .
based on those first results , adding cetuximab to neo - adjuvant crt does not seem to improve pcr , with respect to an overall pcr rate of 13% seen after 5-fu based crt ( glynne - jones et al . , 2010 ) .
possible reasons for the disappointing results on the early endpoint of pcr include a less crucial role for repopulation in adenocarcinoma of the rectum in the presence of continuous exposure to 5-fu and rt ( brierley et al . , 1996 ; glynne - jones et al . , 2010 )
in addition , cetuximab could potentially abolish the additive effects of 5-fu by blockade of s phase entry , as cells which fail to progress through s phase do not accumulate additive effects from the combination of 5-fu and radiation ( lawrence et al .
the optimum sequence of cetuximab in addition to 5-fu crt remains unclear and should be explored before moving on to phase iii trials .
furthermore , biomarkers such as kras and braf mutational status , which are predictive for lack of response to anti - egfr therapy in metastatic crc , have to be integrated in those trials , finally to help us in selecting out appropriate patients which may benefit from neo - adjuvant crt in combination with cetuximab .
in a phase i / ii trial in rectal cancer patients receiving bevacizumab and crt , willett et al . ( 2004 ) provided direct evidence of the antivascular effect of anti - vegf treatment by functional , cellular , and molecular investigations . briefly
, bevacizumab decreases the tumor vascular density , tumor perfusion , tumor interstitial fluid pressure , and the number of viable circulating endothelial and progenitor cells , which results into a significant increase in apoptosis of cancer cells ( willett et al . , 2004 ) .
several phase i / ii trials reported on the feasibility of adding bevacizumab to 5-fu based crt in the neo - adjuvant setting of locally advanced rectal cancer , and provided encouraging pcr rates with moderate toxicity ( willett et al . , 2009 ; crane et al . ,
the reported incidence of postoperative wound complications in up to 36% of the patients is however concerning and consistent with other reports utilizing bevacizumab with crt before a major surgical procedure ( dipetrillo et al . , 2012 ) .
recently , a systematic review identified between 2000 and 2011 15 trials which incorporated bevacizumab in neo - adjuvant crt and calculated a pooled pcr rate of 21% , which is not superior than those reported with 5-fu based crt ( shaalan beg et al . ,
taking into account the lack of phase iii data in the neo - adjuvant setting of rectal cancer , the similar response rates as compared to 5-fu based crt alone and the considerable treatment - related toxicities , bevacizumab as a radiation sensitizer in combination with 5-fu based crt does not seem to provide additional benefits in the neo - adjuvant treatment of locally advanced rectal cancer .
in conclusion , 5-fu based crt still remains the standard of care in the neo - adjuvant treatment of locally advanced rectal cancer .
intensifying this regimen by the concept of induction chemotherapy , concurrent multi - agent chemotherapy or the addition of biologic agents does not seem to improve treatment efficacy in terms of pcr , sphincter preservation , or crm negative resection rate , and is therefore not recommended outside clinical trials in locally advanced rectal cancer .
the impact of those strategies on the occurrence of distant metastases and os remains unclear until additional follow - up is achieved .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the addition of 5-fluorouracil ( 5-fu ) or its prodrug capecitabine to radiotherapy ( rt ) is a standard approach in the neo - adjuvant treatment of patients with rectal tumors extending beyond the muscularis propria ( stage ii ) and/or with clinical evidence of regional lymph node metastases ( stage iii ) . according to european randomized trials ,
the combined treatment modality resulted in favorable local control rates as compared with radiotherapy ( rt ) alone , but no improvement was found regarding the occurrence of distant metastases or overall survival . in an effort to further enhance the response rates and to decrease the high incidence of distant metastases in locally advanced rectal cancer patients , the addition of other chemotherapeutical drugs and biologic agents as radiation sensitizers to neo - adjuvant 5-fu based chemoradiotherapy ( crt ) has been recently investigated .
the role of those agents is however questionable as first results from phase iii data do not show improvement on pathologic complete remission and circumferential resection margin negative resection rates as compared to 5-fu based crt , nevertheless an increased toxicity . |
the short - wave near - infrared ( sw - nir ) region , 7001100 nm , is suitable for nondestructive or noninvasive analysis of biological and biomedical materials [ 13 ] . compared with long - wave nir region ( 11002526 nm ) ,
the short - wave near - infrared can penetrate more deeply into a sample with less heating effect and in particular the interference arising from the intense water bands can be diminished . in practical , the low cost of sw - nir technology is a big advantage .
the inexpensive tungsten lamps , leds , or the sunlight can be utilized as the sw - nir light source and the light can be transmitted through inexpensive glass optical fibers . moreover , the price of multichannel detectors , such as silicon charge - coupled device ( ccd ) and photo - diode array ( pda ) , is getting lower and lower with the increment of performances .
ccd detector is a solid - state device , and the geometry and stability of the pixels are ultrastable .
ccd - based spectrometers have advantages in terms of size , robustness ( no moving parts ) , and acquisition rate [ 5 , 6 ] .
some commercial spectrometers are based on ccd technology ( e.g. , ocean optics and boston advanced technologies , inc . ) .
thus , the sw - nir system based on ccd is cost effective for the comprehensive industry applications . in the wine industry ,
the alcohol content level needs to be determined continually to resolute the end point of fermentation .
alcohol meters are commonly used for this purpose . although the method is simple , inexpensive and free of other chemical , the disadvantages are obvious : ( 1 ) the required distillation is time consuming ; ( 2 ) a carefully calibration is needed according to temperature tables ; ( 3 ) it is sample consuming .
the nir methods developed for alcohol determination have been reported in terms of beverages [ 7 , 8 ] , beer , and fuels .
however , the nir method for alcohol determination in aqueous samples must take into account the influence of external variables such as temperature [ 11 , 12 ] . since the temperature can lead a change in the vibration spectra , a multivariable calibration model will not have good prediction ability without the temperature correction .
several kinds of calibration strategies were reported for this purpose , such as global model building and simulated annealing . some spectra standardization method , such as piecewise direct standardization ( pds ) , orthogonal signal correction ( osc ) , dynamic orthogonal projection ( dop ) , and generalized least squares weighting ( glsw ) , can also be utilized .
these methods provide means to mitigate the effect of interference arising from background chemical or physical species , systematic sampling errors , and instrumental drift . in this paper ,
a low cost and compact prototype of short - wave nir spectrometer module has been designed for the alcohol determination during wine fermentation .
the testing results of signal - to - noise ratio , stray light level , and baseline stability were presented .
the designed system was applied for alcohol determination in combination with partial least square ( pls ) calibration .
ethanol aqueous solutions were prepared in concentration range from 30% to 70% ( v / v ) and determined at different temperatures .
glsw method was utilized to correct the temperature effect and compared with the direct transfer calibration .
the schematic diagram and the operation principle of the transmittance measurement were illustrated in figure 1 .
as shown , the light source is located at the focus point of a concave mirror .
the radiation from the light source is paralleled and directed to the sample cell ( 10 mm optical length ) to illuminate the sample .
after that , the light is transmitted through a long - pass filter ( cut - off wavelength of 650 nm ) , focused , and transferred out through an exit slit .
the output light is directed to a fixed grating monochromator , positioned to give the required wavelength scale , and then reflected accurately to the ccd .
the led - enhanced light source was designed by assembling a tungsten lamp with two narrow - band leds centered at the wavelengths of 920 nm and 1020 nm . during operation
the control electronics drive the tungsten lamp and the leds independently to enhance the long - wavelength intensity .
they contain a convex lens , entrance slit , concave grating , and a reflectance mirror .
the main optical specifications are a focal length of 48 mm , a grating groove frequency of 1200 mm , a numerical aperture of 0.6 , and detection array width of 24 mm . by using a si ccd ( model ilx511 ) , the maximum optical resolution is obtained of 0.24 nm with wavelengths ranging from 650 to 1100 nm . the typical integration time is 2 ms and can be regulated from 1 ms to 10 seconds .
20 samples were prepared at 25c in the concentration range of 30%70% ( v / v ) .
they were split into two subsets , 10 pieces for calibration and 10 for validation .
each sample in the validation set was split into 4 portions and saved at 15c , 25c , 35c , and 40c , respectively .
transmittance nir spectra were recorded with an optical resolution of 1 nm and at the integration time of 20 ms , accumulating 16 scans .
total 50 spectra were recorded , 10 for calibration set at 25c , 10 for validation set at 15c , 25c , 35c , and 40c , respectively .
alcohol meter ( lm79-j10 , beijing , china ) was used for the reference method .
the temperature was kept constant by using a thermometer immersed in the samples with a precision of 0.1c , and the samples were placed in water bath .
matlab7.9 ( mathworks , inc . , natick , ma , usa ) with pls_toolbox 6.2 from eigenvector research inc .
( 3905 west eaglerock drive , wenatchee , wa 98801 , usa ; http://www.eigenvector.com/ ) was used for data processing .
signal - to - noise ratio is the most important parameter of an nir spectrometer .
it can be improved by enhancing the signal intensity or reducing the noise level . in this paper , the signal intensity was improved by controlling the ccd integration time and changing the light source spectrum characteristics . as shown in figure 2 , the signal intensity increased with the integration time .
the intensity in some wavelengths reached maximum with the 500 ms integration time . in practical
, the appropriate integration time can be resolved when any of the ccd pixels provided the maximum signal output . and the spectrum recorded in this integration time can be used as the background . however , as shown in figure 2 , the signal intensity was not consistent in the whole wavelength range . to enhance the signal level , especially in the region after 900 nm ,
it can be seen that the signal was significantly enhanced in the long - wavelength region ( the shadow region ) .
the signal - to - noise ratio in the whole wavelength range was calculated and compared by recording the same spectrum for 20 times .
the average intensity was calculated as the signal value and the variance as the noise level . as shown in figure 3(b ) and
figure 3(c ) , the signal - to - noise level increased in the shadow region . the average signal - to - noise ratio of the whole spectrum rose from 460 to 500 , getting 9% increase .
the spectrometer was calibrated by using lasers at 808 nm and 960 nm .
monochromatic lights centered at 718 nm , 820 nm , 902 nm , 992 nm , and 1078 nm were used to test the wavelength accuracy and stray light of the spectrometer module .
the typical band widths at half maximum of the five monochromatic lights were 8 nm .
as seen in table 1 , standard deviations of the tested five wavelengths were under 0.22 nm ( n = 20 ) .
the stray light was calculated as maximum value outside the 18 nm region , centered at the pass - band and presented in percent , relative to the peak of the spectrum .
the stray light was found to range from 0.03% to 0.65% depending on the wavelength , as listed in table 1 .
the unit - to - unit repeatability of stray light was better than 0.1% ( 2 ) for the tested wavelengths .
the baseline stability of the developed spectrometer was tested by recording the baseline every five minutes during 100 minutes .
the baseline was defined as the absorbance spectrum of air with itself as the background .
it increased from 0.07 db to 0.12 db near 700 nm , while the shifting became very tiny in the region around 1000 nm .
the variance of the recorded baselines ranged from 0.0087 db at 1017.2 nm to 0.0705 db at 641.8 nm with an average value of 0.0296 db .
the main specifications of the developed sw - nir spectrometer were listed in table 2 .
the nir spectra of ethanol aqueous solutions for various alcohol contents and temperatures were shown in figure 4 .
the original spectra of four alcohol contents at 25c were illustrated in figure 4(a ) and in figure 4(b ) was the smoothed spectra based on a savitsky - golay filter .
as shown , an increase in the alcohol content leads to increase of the intensity of the small band around 900 nm and decrease at 9501000 nm absorbance .
as seen , the increase of temperature leads to increase of 9501000 nm absorbance and a shift to the short wavelength .
figure 4(d ) shows the temperature effect to higher alcohol content ( 75% v / v ) at four temperatures .
the analysis shows that there is a dependence of the bands on alcoholic content and that a temperature correction seems to be necessary for a more general calibration model .
models at 25c were cross - validated by leave - one - out strategy , tested by using the 25c validation set , and then used to predict the validation set at other temperatures .
the latent variable ( lv ) number was selected according to root mean square error of cross - validation ( rmsecv ) and the optimized value was 2 .
as shown in table 3 , the two latent variables were selected , because more lvs did not produce significant differences in rmsecv but lead to a higher rmsep .
the coefficient of determination ( r ) for 25c was 0.99 , which showed a quite satisfactory correlation .
however , as shown , results were poor for the same validation set at other temperatures .
it was possible to see in figure 6 the presence of systematic errors due to changes of temperature ( b , c , d , and e denote temperature of 15 , 25 , 35 , and 40c , resp . ) .
as shown , a positive systematic error was found when the validation set was at the lower temperature than the calibration set , while a negative systematic error was found when the validation set temperature was higher .
a transfer calibration method , glsw , was applied to arrange the temperature correction . calculating a filter matrix based on the differences between groups of samples which should otherwise be similar
, glsw helps to downweight the differences and make the spectra of the same sample at different temperatures appear more similar .
the glsw procedure was performed by building a glsw model using selected samples in every temperature .
five samples were selected in each validation set according to the euclidean distance to build the glsw model .
after that , all the samples were filtered by the glsw model , and a model was rebuilt using the filtered 25c calibration set .
larger values decrease the effect of the filter , while smaller applies more filtering . as shown in table 4 , 0.01 was the best value in this case , providing rmsep of 0.74 , 0.55 , 0.82 , and 0.89 ( % v / v ) for 15 , 25 , 35 , and 40c , respectively . as shown in figure 7 , after the glsw filter , good corrections for all the four temperatures were obtained , r for 15 , 25 , 35 , and 40c was 0.997 , 0.997 , 0.996 , and 0.996 , respectively . in terms of rmsep for 15 , 25 , 35 and 40c validation sets , 3.39% , 0.52% , 2.77% and 5.57% were obtained for no - temperature corrected model , respectively . while , for the model using glsw filter , far more superior results were obtained , 0.74% , 0.55% , 0.82% , and 0.89% , respectively , as shown in table 4 . and
with this correction , the previously appeared systematic errors disappeared , as shown in figure 8 , indicating the use of glsw in this case , a good method to correct for eventual problems related to temperature effect .
a multichannel short - wave nir spectrometer was developed based on ccd detection and tested for performance evaluation . by optimizing the light source design , the signal - to - noise ratio , which is the most important parameter of an nir spectrometer , kept higher values in the whole wavelength range .
the possibility and accuracy for alcohol determination in wine industry by using this inexpensive spectrometer were verified . to avoid errors raised by different temperatures ,
the glsw was proved to be a satisfactory method with a view to decreasing errors in relation to direct transfer calibration . | a multichannel short - wave near - infrared ( sw - nir ) spectrometer module based on charge - coupled device ( ccd ) detection was designed .
the design relied on a tungsten lamp enhanced by light emitting diodes , a fixed grating monochromator and a linear ccd array .
the main advantages were high optical resolution and an optimized signal - to - noise ratio ( 0.24 nm and 500 , resp . ) in the whole wavelength range of 650 to 1100 nm .
an application to alcohol determination using partial least squares calibration and the temperature correction was presented .
it was found that the direct transfer method had significant systematic prediction errors due to temperature effect .
generalized least squares weighting ( glsw ) method was utilized for temperature correction .
after recalibration , the rmsep found for the 25c model was 0.53% v / v and errors of the same order of magnitude were obtained at other temperatures ( 15 , 35 and 40c ) .
and an r2 better than 0.99 was achieved for each validation set .
the possibility and accuracy of using the miniature sw - nir spectrometer and glsw transfer calibration method for alcohol determination at different temperatures were proven .
and the analysis procedure was simple and fast , allowing a strict control of alcohol content in the wine industry . |
charcot spinal arthropathy ( csa ) is a rare , progressive vertebral joint degeneration that occurs in the setting of any preexisting condition characterized by decreased afferent innervation severe enough to impair the normal protective sensation of joints of the vertebral column1 ) .
historically , csa occurs most commonly in the setting of tertiary syphilis , but more contemporary csa case series almost exclusively comprise patients with traumatic spinal cord injury1 - 5 ) .
we report on a case of charcot arthropathy of the lower lumbar spine mimicking a spinal tumor following cervical cord injury .
a 38-year - old man was admitted to our department with a one - month history of back pain radiating from the right flank and abdomen that had recently worsened .
the patient presented at our institute to check a lumbosacral osteolytic mass found by computed tomography ( ct ) at another institute during an investigation of growing back pain .
clinical examination showed a complete , flaccid , and areflexic paralysis of both lower limbs , with no sensation below t2 .
the patient had limitations of motion with no significant contractures at the right hip , and no palpable masses , fluid collections , or appreciable lymphadenopathy .
plain radiography revealed erosion and destruction of l5 and the sacral vertebral body and the presence of paravertebral hypertrophic ossification with a pseudotumoral appearance around the l5-s1 joint ( fig .
a three dimensional ct scan highlighted the severity of the intervertebral dislocation in the lying position ( fig .
3 ) , and magnetic resonance imaging ( mri ) showed peripheral and paravertebral gadolinium uptake by the osteolytic lesion at l5 and s1 vertebrae ( fig .
the possibility of a chronic infection or a cancerous process was envisaged , and this prompted us to perform a vertebral needle biopsy .
cultures of central / disc liquid samples were negative , and histological findings revealed extensive fibrotic change but no evidence of an infective or neoplastic process .
based on clinical history , laboratory finding , and histologic features the lesion was consistent with csa . in terms of therapeutic options ,
the extensive spinal ankylosis and widespread para - osteoarthropathy around hips meant that stabilization surgery would probably have resulted in a poor functional outcome .
moreover , the patient refused a surgery because of the absence of malignancy . an external support with a body jacket molded for sitting
hence , we were only able to implement regular clinical and radiological monitoring . during follow - up
neuropathic spinal arthropathy is rare and was first described in 1868 by jean - martin charcot in patients with tertiary syphilis1 ) .
however , any disease process that destroys deep joint sensation and leads to continued activity despite injury or inflammation within the joint , is capable of producing charcot arthropathy5 ) .
recently , the condition is encountered more commonly as a result of traumatic spinal injuries , spinal tumors , or syringomyelia , or secondary to diabetes1 - 5 ) .
the mechanisms underlying the occurrence of charcot spine include excessive loading of the thoracolumbar and lumbar spine during transfer activities in paraplegic patients coupled with impaired pain and proprioceptive sensations1 - 6 ) . in paraplegic patients , spinal stress in the position sitting and during transfer is significant .
furthermore , the risk of the early occurrence of charcot spine is greater in active spinal cord injured patients .
other mechanisms may include iatrogenic instability due to laminectomy and the concentration of loads on lower adjacent segments fused by previous operation6 ) . in cord injury patients with complete neurologic impairment ,
the most frequent symptoms of csa are a feeling of instability in the sitting position and spinal deformity ( usually with thoracolumbar gibbosity and an audible cracking noise)4,5 ) .
spinal pain is also frequent , and may be mechanical or inflammatory in nature and sometimes difficult to differentiate from neuropathic pain .
changes in the neurological picture have also been described , such as , accentuated spasticity in partial paraplegics , decreased spasticity in complete paraplegics , and changes in bladder and bowel disorders .
the time lag between the onset of neurological impairment and a diagnosis of csa is usually long ( 17.3 years , on average ) , and in our case was about 20 years to diagnosis .
the time lag between the first symptoms of csa and its diagnosis is also long in many cases , due to the relatively non - specific nature of the apparent symptoms .
uncommonly , csa manifests as a paravertebral , pseudotumoral mass , as in our case .
the differential diagnosis involves consideration of progressive spinal destructive lesions , such as , pyogenic spondylitis and metastatic spinal tumor .
the diagnostic criteria for charcot spine are as follows : 1 ) the presence of underlying disease causing impairment of deep pain sensation and proprioception .
2 ) massive bone destruction and resorption coupled with equally profuse new bone formation on simple radiographs .
3 ) histopathological findings of nonspecific chronic inflammation , which rules out other inflammatory diseases and tumorous conditions6 ) .
the radiological aspects of the charcot spine reflect the disease mechanism and usually combine the following features : 1 ) significant disc degeneration ; 2 ) destruction / erosion of the vertebral body , associated with osteosclerosis or osteolysis , and occasionally , the presence of sequestra or debris resulting from fragmentation of subchondral bone ; 3 ) hypertrophic osteophytosis within paravertebral soft tissue with a markedly pseudotumoral appearance ; and 4 ) early - onset damage to facet joints1 ) .
ct is useful for assessing the severity of vertebral body bone destruction and the extent of paravertebral bone formation , whereas mri frequent exhibits peripheral contrast uptake ( attesting to the chronic inflammation that accompanies the disc and vertebral damage ) and more occasionally , paravertebral gadolinium uptake .
although natural progression of the disease is slow , it is clearly related to the aggravation of disc / vertebral lesions .
it is also important to emphasize the risk of secondary neurological aggravation in incompletely paraplegic patients .
the various therapeutic options consist of monitoring , immobilization with a body jacket , or surgery1 ) .
if patient 's general conditions are favorable , the optimal treatment is surgical reduction of the deformity and permanent stabilization of the spine .
bone fusion should be achieved ideally by a posterolateral graft and an anterior graft using a combined approach or an extensive posterior approach2 - 6 ) .
however , indications for surgery must be discussed on a case - by - case basis according to clinical context ( age , severity of spinal deformation , pain , etc . ) and the potential functional impact of the surgical procedure .
we considered our patient an inappropriate candidate for surgical management , given his relatively poor general health , the care goals of personal and family member , and the substantial bone destruction present at the time of diagnosis .
we report a case of csa and describe the main clinical , radiological , and therapeutic aspects of this rare and probably overlooked pathology . if patient 's general conditions are favorable , surgical reduction of the deformity and permanent stabilization of the spine could be recommended .
however , indications for surgery must be considered on a case - by - case basis according to clinical context and potential functional impact . | charcot spinal arthropathy is a rare , progressive type of vertebral joint degeneration that occurs in the setting of any preexisting condition characterized by decreased afferent innervation to the extent that normal protective joint sensation in the vertebral column is impaired .
the authors report on a case of charcot arthropathy of the lower lumbar spine mimicking a spinal tumor following cervical cord injury . |
according to the world health organization ( who ) , approximately 5% of the world population or 365 million people has either moderate or severe hearing loss of either congenital or acquired etiology . in korea ,
some 300,000 people are believed to have some hearing loss , which is the second highest of 15 disabilities .
recently , health care professionals are most concerned about noise - induced and age - related hearing loss . who reported that nearly 1.1 billion teens and young adults between 12 and 35 years of age are exposed to excessive noise through their personal listening devices and by riding off - road vehicles , motorboats and sporting airplanes .
such activities can result in having irreversible and permanent hearing loss and also incur that middle - aged people are vulnerable to earlier age - related hearing loss .
furthermore , the number of elderly people with hearing loss is rapidly increasing as the population ages .
statistics korea published a prediction index in which the percentages of people aged 65 years and older are 13.1% , 24.3% , and 40.1% of the total population in 2015 , 2030 , and 2060 , respectively . in short , given that hearing loss is the third - most chronic condition of the elderly people and since 40% of the population older than 75 years have hearing loss , the increasing number of people with hearing impairment needs more professional services in the near future .
nowadays , screening all newborns for hearing loss and offering aural rehabilitation as soon as indicated are supported by professional organizations and governments worldwide .
the korean ministry of health and welfare provides financial support for early detection of hearing loss in high - risk babies and extends its support to all newborns .
in contrast to systematic medical management for infants and young children with congenital hearing loss , there is a no comparable system for korea 's hearing - impaired adults and elderly .
fortunately , the korean government now reimburses a portion of patients ' hearing aid costs and will provide free hearing tests to lower - income families in 2017 .
as results of this change in the welfare policy , we might expect more people with hearing impairments to purchase hearing aids and to consult audiologists .
however , it is not easy for people who suspect hearing loss to contact a professional audiologist .
table 1 shows that the searches for " hearing aid " on the most popular websites in korea , naver corporation ( www.naver.com ) and daum corporation ( www.daum.net ) turned up 177,069 and 131,000 hits , respectively . when " hearing - impaired " and " hearing loss " were searched , naver showed 164,410 and 49,404 documents and daum revealed 115,000 and 18,000 . for the word of " tinnitus , " 243,119 and 227,000 advertisements were displayed on naver and daum
thus , these general online searching systems can not protect the patients from inaccurate information and have a limitation of helping them find professional audiologists who can help them .
the website of audiological testing service which is one of representative professional organizations only provides a few lists of registered audiologists in korea ( www.audiologykorea.or.kr ) .
the information that it contains is limited to the name of members ( audiologists ) , state ( location ) , title of hearing center , phone number , and email address . also , two hearing aid companies , starkey korea ( http://www.starkey.co.kr/ ) and phonak korea ( http://www.phonak.co.kr/home/index.php?src=naver_br&kw=00000b ) display a list of centers . in sum
, none of them offer the information that patients most need to know and the websites are not user - friendly .
again , to find an audiology clinic and the best audiologists , a hearing - impaired person in korea needs the kind of systematic method that is found in developed countries .
organizations such as the american academy of audiology and the american speech - language - hearing association list certified professionals who have undergone continuing education .
this paper will suggest a systematic way to find a professional audiology clinic based on the recommendations of several authentic audiology organizations and will compare them from a patient 's perspective .
for the best selecting audiology organization , number of members , credential certificates , authority , representativeness , expertise , and independence were considered , resulting in including three audiology organizations , i.e. , american academy of audiology , american speech - language - hearing association , healthy hearing , in the united states for the current report .
the aaa is an independent and freestanding national organization run for clinical and research audiologists .
although the first national convention of the academy was attended by about 600 people in 1,989 , the 13th annual convention in 2001 hosted more than 7,300 .
its more than 12,000 active members are dedicated to providing high - quality hearing care services through professional development , education , research , and public awareness of hearing and balance disorders . in addition , aaa has offered patients with hearing loss an opportunity to meet certified audiologists .
when visitors go to aaa website ( http://www.audiology.org/ ) , they can find a large symbol on the right side : " find an audiologist " ( fig .
after clicking the symbol , they can filter audiologists by location ( i.e. , city , zip code , country ) and specialty ( fig .
1b ) . in the specialty for the professionals , the patients select from among lists , such as auditory brainstem response ( abr ) , electronystagmography , hearing aid dispensing , intraoperative monitoring , vestibular testing , hearing conservation , cochlear implants , auditory processing , tinnitus , and newborn hearing screening .
1c ) or " rehabilitation " ( fig , 1d ) , they can choose specialists in pediatric and/or adult hearing loss .
for example , if the patients want to be physiologic tested and to have abr examination in los angeles , they click la and a check box for abr and then get a list of 20 certified professionals ( fig .
as the first audiologist listed , kimberly allred , aud , faaa was found . on the next page
, the patient can continue to see her full name and certifications , the name , address , and phone number of her clinic , and a list of her specialties ( fig .
the last line of the address information is linked to mapquest , the most popular online mapping service in the united states . through the mapquest
since having an informal meeting of 25 members in 1925 , the american speech - language - hearing association ( asha ) has continued to educate and manage speech - language pathologists , audiologists , and speech and hearing scientists .
asha is defined as a professional , credentialing , and scientific organization for these professions , while leading the development of national standards for clinical speech - language pathologists and audiologists and certifying related professionals .
asha is open to both speech - language pathologists and audiologists ; aaa is limited to certified audiologists .
when patients need a specialist in communication disorders , they can go to the asha website ( http://www.asha.org/ ) ( fig .
2a ) . a button in the middle of web page says " find a professional " ( fig .
clicking the button leads to the next page where there is a list of 15,000 certified audiologists and speech - language pathologists ( fig .
professional " is " for certified professionals " where professionals can add or to update their profile . in the asha profind page , the patients type in the search terms ( e.g. , specialty , city , language ) in the search engine ( fig .
for example , by typing " hearing orientation " into the search engine , they find a list of information by type ( 892 audiologists and 107 speech - language pathologists ) , ages treated ( 0 - 6 months , 7 months-2 years , 3 - 5 years , 6 - 11 years , 12 - 17 years , 18 - 64 years , 65 - 74 years , 75 years and older ) , areas of expertise , bilingual service provider , and city ( fig .
on the left side of the page , they can click a check box 18 - 64 years in the ages treated and hearing aid orientation in the areas of expertise , then get 852 certified professionals on the right side . among them , for instance , let 's select jackie j lee , ccc - a ( fig .
on the next page , the patients see her certification status , area of certification , and when it expires , and contact information ( fig .
the page also gives her areas of expertise , ages treated , education and employment history , and whether or not she is a bilingual service provider ( fig .
the healthy hearing ( hh ) website was created to educate people with hearing loss and their families and to encourage them to find help .
hh has a president , director , customer support manager , senior developer , assistant editor , and staff writer in its team , and provides news and articles , especially for the usa and canada .
although hh does not sell any products or run any hearing aid clinics or provide medical advice , it informs the public about hearing loss and hearing aids in layman 's language .
hh wants to be a leading information portal where patients can receive professional and useful content . like the other two websites
, hh clearly displays " find a professional " on its main page ( http://www.healthyhearing.com/ ) .
a visitor can type in a city , state , or zip code or click an area on a map of the united states ( fig .
the patients are taken to the " hearing aids in urbana , il " page ( fig .
, they also refine their search result using six check boxes : five or more reviews , clinic website , evening or weekend hours , insurance accepted , adult hearing testing , and adult hearing aid fitting .
they can also select one of the hearing centers from the list on that page ( fig .
, they read its information : the name of the center , its phone number , address , and location on google maps ( fig .
3 g ) . at the bottom of the page , are clinic reviews by previous patients ( fig .
one - fourth of people with hearing loss who own hearing aids claim that the recognition of their disorder was higher than any other hearing loss groups . among them
, new hearing aid users might express high satisfaction of their hearing aid when they meet the professional audiologist and have excellent counseling and rehabilitation .
for example , new users depend on orientation books of hearing aid and were more likely to attend an aural rehabilitation group than the experienced users who are more satisfied with their hearing aids . on the other hand ,
moreover , one in four new users wear their hearing aids less than two hours a day although experts agree that the users who wear their hearing aids at least four hours a day tend to be more successful .
this rate of users having negative perception of their hearing aids is a serious problem that can not be ignored .
that is , whether or not new hearing aid users succeed depends on the availability of good audiologists .
this brief paper presents a way to find a professional audiology clinic though three professional organizations in the united states .
although those organizations are similar , there are differences in the patient - based information that they provide ( table 2 ) .
visual explanation lets the patients locate a clinic in the hh website , and aaa help the patients find the most suitable professionals by choosing very detailed information .
asha gives the number of professionals in each category and allows professionals to maintain their own profiles ( fig .
, we can offer more useful information for the hearing - impaired people in korea .
kochkin , et al . insisted that professional quality of the hearing aids dispensed and audiological counseling have not kept pace with technological improvements in hearing aids during the past decade .
it means that little progress has been made in increasing the proportion of patients who are " satisfied " or " very satisfied " with their hearing aids .
it is estimated that the number of patients who do not wear their hearing aids increased from 11.7% to 17.9% accounting for more than 1 million patients in the united states .
many experts argued that there is great variability in the way that hearing aids fit , and it appears that critical aspects of the fitting protocol are not always followed .
the manufacturer 's initials fit algorithm often is an inadequate amplification prescription , sometimes providing less - than - prescribed gain in the high frequencies by as much as 20 db .
although the greatest advantage of digital hearing aid technology is the flexibility in programming the sound quality and many other electro - acoustic characteristics of the hearing aids highly sophisticated , the computer software that is used to program the hearing aids is getting stick to ask the audiologists their specialty as years go by .
audiologists need to assess patients ' hearing difficulties in several ways and define individual goals for them since speech perceptual ability and benefits from hearing aids are highly individualized . after a professional evaluation
, the patients can hear many of the changes and actually report high satisfaction with their audiological treatment and services .
again , we expect professional organizations to adopt this system as soon as possible and link hearing - impaired patients with professional audiologists in korea . | this brief communication introduced a systematic way to find a professional audiology clinic developed for patients and professionals by the american academy of audiology , american speech - language - hearing association , and healthy hearing .
patients can access each organization 's website to find professionals and/or clinics based on criteria such as location , hours , special areas , types of service , reviews and rating by previous patients , and kinds of insurance accepted .
such a system may protect the patients from information overload , guarantee accurate information , and help them find themselves professional audiologists who can assist them .
we expect professional organizations to adopt this system as soon as possible and link hearing - impaired patients with professional audiologists in korea . |
therefore , the first and the most important strategy to confront this is the comprehensive implementation of tobacco control programs . however , this implementation can not be easily achieved because tobacco companies try their best to seek new customers for their products and replace those who quit smoking or died of it . in this regard , the world health organization ( who ) negotiated the framework convention on tobacco control treaty in 2004 , and so far ,
, a package was proposed to be implemented and included six main components , namely , monitoring tobacco use and prevention policies , protecting people from tobacco smoke , offering help to quit tobacco use , warning people about the dangers of tobacco , enforcing bans on tobacco advertising , promotion , and sponsorship , and raising taxes on tobacco .
global experiences have revealed that implementation of the above - mentioned six strategies can effectively decrease the rate of consumption and resultantly the consequences and complications of tobacco use .
the who publishes a report of the activities of countries worldwide with regard to the six aforementioned strategies once every 2 years .
the aim of our study was to compare mpower programs among the countries of the six who regions to highlight what has been achieved and what till needs to be addressed by the countries to strengthen these programs and also to find the best parties on it .
this was a cross - sectional study by filling out a validated checklist from the data on pages 118129 of the 2015 who mpower report .
a checklist of ten indicators such as six plus one policy in mpower , one adult daily smoking prevalence , and two compliance was initially designed by the iranian and international tobacco control specialists , which was validated in two studies .
there were seven indicators with five possible scores ranging from minimum 0 to maximum 4 .
hence , the possible total score is 37 ( 7 4 + 3 3 ) as shown in table 1 .
the scores were given by two raters separately and compared and confirmed by a third person as acting supervisor .
two raters administered the assessment , and the interclass correlation confidence = 0.85 was used to assess agreement between the two raters .
the checklist of ten indicators and its scores based on the world health organization mpower report measures 2015
countries which had at least 85% of total score ( 32 from 37 ) and percentage by the regions are as follows :
africa : mauritius 32 , 1 from 47 countries , 2.1% of regionamerica : panama 35 , brazil and uruguay 34 , argentina and costa rica 33 , canada 32 , 6 from 35 countries , 17.1% of regionsoutheast asia : nepal and thailand 32 , 2 from 11 countries , 18.1% of regioneurope : turkey 35 , ireland and the united kingdom 33 , 3 from 53 countries , 5.6% of regioneastern mediterranean regional office : iran 33 , 1 from 22 countries , 4.5% of regionwestern pacific regional office : brunei 33 , australia 32 , 2 from 27 countries , 7.4% of region .
africa : mauritius 32 , 1 from 47 countries , 2.1% of region america : panama 35 , brazil and uruguay 34 , argentina and costa rica 33 , canada 32 , 6 from 35 countries , 17.1% of region southeast asia : nepal and thailand 32 , 2 from 11 countries , 18.1% of region europe : turkey 35 , ireland and the united kingdom 33 , 3 from 53 countries , 5.6% of region eastern mediterranean regional office : iran 33 , 1 from 22 countries , 4.5% of region western pacific regional office : brunei 33 , australia 32 , 2 from 27 countries , 7.4% of region . as shown in table 2 , the highest mean points were scored by europe ( 24.35 ) , and the other regions were west pacific ( 23.29 ) , southeast asia ( 22.36 ) , america ( 20.37 ) , east mediterranean region ( 19.45 ) , and africa ( 16.29 ) ; there was a significant difference ( p < 0.05 ) for means in this regard .
this study showed that none of the countries scored full in the tobacco control programs ; however , mauritius , panama , nepal , thailand , turkey , iran , and brunei were superior status in each region .
for the eastern mediterranean countries , showing that although iran and egypt acquire high scores , they still face weaknesses in raising the tax on tobacco ( iran ) and banning tobacco use in public places ( egypt ) .
europe gained the highest mean score and it might be from high scored for raising taxes on tobacco and enforcing bans on tobacco advertisement .
in contrast , africa gained the lowest mean score and acquired the least points in the two above - mentioned policies .
the superior position of european countries in this regard has also been mentioned in a study by joossens .
in addition to the aforementioned two policies , he mentioned , offering help to quit tobacco use and enforcing bans on tobacco use in public places to be among the most influential policies .
this kind of comparison could create a strong incentive for tobacco control policymakers in different countries to adopt the mpower package policy more strictly in the future .
the results of this study and a similar one indicate that the implementation of tobacco control programs can substantially reduce tobacco - related mortality and morbidity .
these 15 countries may indicate as the best model for other parties to implementation and enforcement of tobacco control program .
comparison of scores of different countries in this respect can be beneficial since it creates a challenge for the health policymakers to find weakness of the tobacco control programs to work on it .
| background : a report of the activities of countries worldwide for six main policies to control tobacco use is published once every 2 years by the world health organization ( who ) .
our objective was to perform a quantitative analysis for it in countries and regions to make a simple view of its programs.methods:this was a cross - sectional study by filling out a validated checklist from the 2015 who report ( mpower ) .
all ten mpower measures got scores and were entered independently by two individuals and a third party compared the values.results:fifteen countries , which acquired the highest scores ( 85% of total 37 ) , included panama and turkey with 35 , brazil and uruguay with 34 , ireland , united kingdom , iran , brunei , argentina , and costa rica with 33 , and australia , nepal , thailand , canada , and mauritius with 32 points.conclusions:comparison of scores of different countries in this respect can be beneficial since it creates a challenge for the health policymakers to find weakness of the tobacco control programs to work on it . |
apart from use in operative cases and cardiac laboratories , transesophageal echocardiography ( tee ) in now being increasingly used in critical care units . the complications with its use are primarily related to gastrointestinal , cardiovascular , and respiratory systems along with some miscellaneous problems related to probe insertion , drugs , and inexperience of the operator .
our case report does not describe a complication due to tee per se , but a unique clinical situation , which has not been reported previously .
a 55-year - old male , with chronic liver disease , long - standing diabetes mellitus , and obesity ( body mass index of 30 ) , was admitted to the intensive care unit ( icu ) with altered sensorium , upper gastrointestinal bleed , and hemodynamic instability .
his hemoglobin was stabilized to 12 g% after transfusion of packed red blood cells . despite control of bleed ,
he developed a temperature of 39c ( axillary temperature ) with circulatory shock and increasing lactate levels .
his 24 h culture ( blood , urine , and mini bronchoalveolar lavage ) reports sent on icu admission were sterile .
his bedside echocardiogram showed a very poor window with a provisionally normal report . in view of long - standing diabetes
mellitus , obesity , and poor transthoracic images , a bedside tee was planned to rule out a cardiac cause of poor hemodynamics .
after appropriate consent , the transesophageal probe ( mylab 30gold esaote , te 022 ) was inserted orally into the esophagus .
it was examined physically for any defects before insertion . within seconds of the probe insertion ,
the examination was withheld and a cold saline lavage was given through the nasogastric tube to reduce the local temperature .
the lavage reduced the local temperature down to 38c after which examination was resumed . after obtaining images for 5 min ,
there was a rise in temperature and the above procedure was repeated twice before we could satisfactorily complete the examination .
esophageal heating and potential injury can occur from piezoelectric crystal vibration within the transesophageal probe tip or by direct tissue heating from absorbed ultrasound energy .
esophageal thermal injury has been reported in patients with severe atherosclerotic cardiovascular disease in whom the esophageal circulation was presumed to be compromised . therefore , tee probes have a thermocouple to monitor transducer tip temperature and an automatic shutdown mechanism when a critical preset temperature ( 42 - 46c ) has been reached .
tee has been described in literature in patients with fever , most commonly in suspected bacterial endocarditis .
the manufacturer guide does mention that the thermal limit can be reached in patients with fever .
however to our knowledge , this is the first case report describing shutdown of the probe due to increased body temperature of the patient . in our patient ,
the probe stopped functioning immediately on entering the esophagus in the presence of high temperature and resumed functioning after a cold saline lavage .
the stomach lies in close proximity to the liver and inferior vena cava , gastric lavage is a reasonable method to rapidly cool hyperthermic patients .
a core temperature reduction of approximately 0.15c / min can be achieved using this method .
we could complete our examination because of intermittent cold saline lavages which were given through the nasogastric tube .
it would have been ideal if we had anticipated such a problem before probe insertion .
active measures would have reduced the body temperature , and we could have completed our examination within a shorter period of time .
we would recommend that tee in a critically ill patient with fever should consider such a possibility and appropriate preventive measures should be taken .
future attempts should be made for refinement of probe technology so that the machine is able to differentiate in temperature rise within the probe versus the surroundings .
| the use of transesophageal echocardiography ( tee ) has been increasing over the past few years .
it is considered a semi - invasive monitor and a safe diagnostic device .
though complications are rare , they must be known to operators who frequently perform tee .
tee probes are known to cause tissue heating and damage on prolonged use . in this case report , we describe shutdown of the transesophageal probe in our patient with high - grade fever . |
influenza , an infectious respiratory disease caused by influenza viruses , is one of the main causes of excess winter deaths ( ewds ) in europe [ 1 - 3 ] .
annual flu epidemics are associated with high morbidity and mortality rates , especially among the elderly and those with underlying health conditions ; these groups are particularly at risk of developing influenza complications , such as bacterial pneumonia [ 3 , 4 ] . during the last winter season ( 2014/2015 ) , the excess of deaths due to all causes observed in fourteen european countries among people 65 years old coincided with an increase in the detection of influenza a(h3n2 ) viruses by the european influenza surveillance system . in particular , in england and wales the highest number of ewds since 1999/2000 was recorded , while in italy a 13% rate of ewds was reported [ 6 , 7 ] .
influenza vaccination is the most important public health intervention to prevent seasonal influenza transmission and infection [ 3 , 4 ] . in europe ,
guidelines and preventive policies for influenza vaccination are primarily focused on protecting individuals at higher risk , both directly by vaccinating these subjects and indirectly by vaccinating those who could infect them .
this review aims to analyze international and european guidelines on influenza vaccination and the rationale that underlies evidence - based public health intervention for the prevention of influenza .
in particular , we will discuss the evidence regarding influenza vaccination among the four principal groups at risk , which constitute key target for preventive strategies : the elderly ( subjects aged 65 years or older ) , subjects with underlying health conditions , pregnant women and healthcare workers .
in the temperate zones , an increase in expected mortality levels is frequently observed among the elderly during the winter season ; this increase , however , largely depends on the season or country [ 5 , 8 , 9 ] .
excess mortality may be related to two main factors : a ) seasonal influenza , especially during seasons with a prevalent circulation of influenza a(h3n2 ) , and other respiratory tract infections ; b ) environmental conditions ( e.g. cold spells ) [ 6 , 9 ] . in recent years
, several studies have shown the worldwide impact of influenza infection on excess winter mortality rates in the elderly ( tab .
i ) [ 5 - 11 ] . influenza - attributable excess winter mortality ( ewds ) in the elderly . in europe ,
a network named euromomo ( european monitoring of excess mortality for public health action network ) monitors weekly and " real - time " all - cause age - specific excess mortality in european countries through a standardized approach that allows pooling of results . in february and march 2012 , an increased number of excess deaths among the elderly was observed in european member countries of the euromomo .
this reported excess mortality coincided with late increased influenza activity and was related to a prevalent detection of influenza a(h3n2 ) by both sentinel and non - sentinel sources ( approximately 95% ) .
this profile of isolation was very different from previous influenza seasons , when influenza a(h1n1 ) was predominantly isolated ; in these seasons , only a minor impact on mortality among the elderly was observed in countries of the northern hemisphere [ 6 , 11 ] .
more recently , a greater number of excess deaths among the elderly was observed during the last winter season ( 2014/15 ) and was strongly related to the intensity of influenza circulation , showing a correlation between weeks with excess mortality and medium or high influenza activity ( 80% ) [ 5 - 7 ] .
moreover , the last influenza season in the northern hemisphere was similar to the 2011/2012 season , in that a(h3n2 ) virus was predominant ( 56% of detections across the european community ) .
it is expected that a winter season in which influenza a(h3n2 ) is predominant will have a higher impact on mortality among the elderly than a season with predominant influenza a(h1n1 ) or a season with low influenza a transmission [ 5 , 9 ] .
influenza a(h3n2 ) virus has been recognized as having a noticeably greater effect on the elderly than influenza virus a(h1n1 ) , which is particularly virulent in younger people .
in addition , in the 2014/15 influenza season , most influenza a(h3n2 ) viruses characterized in europe exhibited antigenic differences in comparison with those included in the vaccine formulation ; higher morbidity and mortality rates were observed in vaccinated populations [ 14 , 15 ] .
finally , during the last influenza season in europe , a lineage b mismatch of the influenza vaccine was frequently observed , which contributed to reducing vaccine efficacy [ 16 , 17 ] .
these data provide strong support for the inclusion of both influenza b lineages in seasonal influenza vaccines .
trends in influenza circulation are strongly correlated with excess winter mortality among the elderly in the northern hemisphere and europe , highlighting the heavy burden of disease . in this context ,
influenza vaccination guidelines issued by the principal public health authorities recommend 75% coverage of seasonal influenza vaccination for individuals aged 65 years [ 18 - 20 ] .
however , in the 2011/2012 and 2012/2013 seasons , vaccination coverage in the elderly reached this threshold only in two european countries ( the united kingdom and the netherlands ) .
all other eu member states reported lower vaccination coverage , varying from 60% ( italy and spain ) to 5 - 10% ( estonia and latvia ) [ 21 , 22 ] .
in italy during the last influenza season , influenza vaccination coverage was estimated to have decreased by 25 - 30% from the overall 2014 level [ 7 , 22 ] .
these data suggested that only high vaccination coverage rates can reduce influenza circulation , the impact of infection and possible variations in vaccine effectiveness among the elderly [ 18 , 19 ] .
every disease exacerbates the risk of influenza infection and , in particular , of influenza complications or death .
the association of several chronic diseases could constitute a serious risk factor for unvaccinated subjects during the influenza season . according to public health guidelines ,
all individuals aged > 6 months with at least one chronic illness that constitutes a risk factor for influenza or its complications should be vaccinated [ 20 , 21 ] .
chronic diseases that increase the risk of contracting influenza , for which influenza vaccination is strongly recommended ( mod . from
ministero
della salute , 2016 ) . despite the strong recommendation to vaccinate subjects with comorbidities ,
indeed , there is great debate inside the scientific community , especially among general practitioners and medical specialists , regarding the efficacy and safety of influenza vaccines in chronically ill subjects .
one concern regards vaccine efficacy ( ve ) , as such comorbidities are claimed to determine a lower immunological response .
however , research has demonstrated a good efficacy profile of influenza vaccines among these population groups [ 22 - 25 ] . an extensive review and meta - analysis published in 2012 assessed influenza vaccination among immuno - compromised patients .
the study demonstrated that transplant recipients and patients with human immunodeficiency virus ( hiv ) infection or cancer had significantly lower odds of contracting influenza - like illness after vaccination .
moreover , compared with patients receiving placebo or no vaccination , vaccinated hivpositive patients had lower odds of laboratory - confirmed influenza .
another prospective , non - interventional cohort study was conducted during the 2010/2011 influenza season among more than 800 adult cancer patients in israel . a lower mortality rate was observed among vaccinated cancer patients than unvaccinated ones , even though a statistical association with complications due to influenza infection was not demonstrated .
furthermore , a large ( 7,772 subjects with copd aged 55 years ) cohort study conducted from 1996 to 2008 in taiwan by sung et al . found a reduction in hospitalizations for acute coronary syndrome among vaccinated people .
the protective effects were observed in both sexes and all age - groups examined ( 55 - 64 , 65 - 74 , 75 ) , regardless of influenza seasonality . when the patients were stratified according to the total number of vaccinations , the adjusted hazard ratios ( hrs ) for acute coronary syndrome hospitalization were 0.48 for patients who received 2 - 3 vaccinations and 0.20 for patients who received 4 vaccinations .
influenza vaccination was also associated with a 24% reduction in stroke risk in a case - control study conducted in the uk from 2001 to 2009 .
specifically , stroke risk was significantly lower following early ( september to mid - november ) , but not later , influenza vaccination ( mid - november onwards ) .
in particular , pregnant women appear to have an increased risk of severe disease , especially during annual epidemics and pandemics [ 32 , 33 ] . as reported by louie et al . , the pandemic influenza a(h1n1 ) in 2009 caused severe illness and death especially among
pregnant and postpartum women .
conducted in california , their study analyzed all women hospitalized during the first wave of pandemic influenza ( from april to august 2009 ) , 42.6% ( n = 102/239 ) of whom were pregnant or in postpartum .
overall , 18 pregnant and 4 postpartum women ( 22% ) required intensive care , while 8% died .
the severity of influenza among pregnant women observed in california is consistent with an increased risk of severe disease and the disproportionate number of influenza - associated deaths that has been documented for seasonal influenza and previous pandemics [ 35 - 37 ] the main difference was the rapid clinical deterioration observed in some patients in comparison with the typical course of seasonal influenza .
moreover , in the hungarian case - control surveillance of congenital abnormalities conducted from 1980 to 1996 , nandor et al . found a higher prevalence of maternal influenza during the second and/or third month of pregnancy in newborns with cleft lip - palate , neural - tube defects and cardiovascular malformations .
the authors supposed that the teratogenic effect due to influenza viruses was probably associated with fever , as this risk was reduced by the use of antifever drugs . on the other hand ,
several studies have demonstrated the efficacy and safety of influenza vaccination during the second and third trimesters of pregnancy . with regard to efficacy ,
thompson et al . conducted a population - based case - control study during two consecutive influenza seasons ( 2010 - 2011 and 2011 - 2012 ) and showed a lower risk of acute respiratory illness ( ari ) associated with laboratory - confirmed influenza in vaccinated pregnant women .
the reported ve was similar to that observed among all adults during these seasons ( ve against influenza a and b : 44% ; 95% confidence interval 5 - 67% ) [ 35 , 36 ] . moreover
, a double - blind , randomized , placebo - controlled trial of influenza vaccine conducted in south africa in 2011 demonstrated that influenza vaccine was immunogenic in both hiv - uninfected and hiv - infected pregnant women and provided partial protection for infants who were not exposed to hiv . with regard to safety , ludvigsson et al . found no excess mortality in the offspring of women who had been vaccinated against influenza a(h1n1)pdm09 during pregnancy .
moreover , the authors noted that maternal a(h1n1 ) vaccination during any trimester of pregnancy had no adverse effects on children in either the early neonatal period or early childhood . in 2015 , mcmillan et al .
published a review on safety outcomes of influenza vaccination during pregnancy . in their quantitative analysis ,
maternal influenza vaccination was not associated with an increased risk of fetal death , spontaneous abortion or congenital malformations .
for all these reasons , international and national guidelines now strongly recommend influenza vaccination for all pregnant women in the second and third trimesters , in order to protect them and their children during late pregnancy and to protect their infants during the first six months after birth through the induction of immunity that would otherwise not be achievable [ 19 - 21 ] .
influenza vaccination among health - care workers ( hcws ) is considered to be the most important strategy for preventing the transmission of influenza viruses to vulnerable patients and minimizing absenteeism among hcws during annual epidemics [ 19 , 41 , 42 ] . indeed , hospitalized patients may acquire influenza not only from other patients or visitors but also from hospital employees .
many hcws continue working while infected , thereby spreading the virus . therefore , vaccinating medical personnel against influenza is the most effective strategy for preventing nosocomial influenza transmission and reducing influenza - like illness ( ili ) mortality among elderly and high - risk patients [ 42 , 44 ] .
although this is recognized and emphasized by all public health agencies worldwide , influenza vaccination coverage among hcws remain lower than 75% [ 19 - 21 ] .
adherence to influenza vaccination does not seem to depend on physicians ' age or specialty [ 45 - 48 ] . in some non - european countries ,
mandatory vaccination plays a decisive role in the vaccination of hcws , and the immunization rates observed in such countries are very far from those observed in europe [ 49 , 50 ] . however , it is difficult to apply mandatory vaccination in the european context , for such reasons as staff morale , civil liberty and professional autonomy .
indeed , some studies have reported that hcws prefer other strategies for promoting influenza vaccination ; specifically , it has been demonstrated that appropriate training through multidisciplinary courses , adequate university education and proactive attitudes on the part of coworkers can improve influenza vaccination coverage [ 51 , 52 ] .
one of the main goals of public health authorities should be to promote proper attitudes towards and knowledge of influenza vaccination among hcws , since this is the best means of protecting both them and their patients .
moreover , hcws should have appropriate skills in counseling patients with regard to the importance of influenza vaccination , especially among the high - risk classes of individuals analyzed in this review .
on the basis of the winter mortality rates observed in recent years both in countries of the northern hemisphere and in italy , influenza is one of the leading causes of death . in particular , the elderly
, subjects with comorbidities , pregnant women and hcws are at higher risk of contracting influenza and its complications . worldwide , vaccination is the only recognized strategy for preventing influenza circulation , transmission and infection , and all principal sanitary authorities recommend vaccination for these high - risk groups . in the future , the most important target for preventive medicine will to achieve the recommended influenza vaccination coverage in all european countries , in order to reduce the burden of disease and minimize mortality [ 5 - 7 , 53 ] . | summaryinfluenza , an infectious respiratory disease , is one of the main causes of excess winter deaths ( ewds ) in europe .
annual flu epidemics are associated with high morbidity and mortality rates , especially among the elderly , those with underlying health conditions and pregnant women.health care workers ( hcws ) are also considered at high risk of both contracting influenza and spreading the virus to vulnerable patients.during the 2014/2015 season , the excess winter mortality rates observed in countries of the northern hemisphere ( euromomo network ) and in italy ( + 13% ) were strongly related to the intensity of influenza circulation.influenza vaccination is the most important public health intervention to prevent seasonal influenza transmission and infection .
however , to date , influenza vaccination coverage reported in europe ( including high - risk groups ) is still largely unsatisfactory .
this study analyzes some international and european guidelines on influenza vaccination and the rationale that underlies evidence- based public health intervention for the prevention of influenza among the principal high - risk groups : a ) the elderly ( subjects aged 65 years or older ) ; b ) subjects with underlying health conditions ; c ) pregnant women ; d ) healthcare workers.only by achievement recommended influenza vaccination coverage among high - risk groups in all european countries can we reduce the burden of disease . |
functionalized , nitrogen - containing heterocycles constitute a widespread structural motif in biologically active compounds(1 ) and an invaluable template for chiral auxiliaries(2 ) in asymmetric synthesis.(3 ) in particular , tetrahydroisoquinolines ( thiqs ) and indoles are common structural motifs in important compounds such as natural products(4 ) as well as pharmaceuticals(5 ) and display significant antitumor activities.(6 ) 1-arylated thiqs have been demonstrated to have interesting pharmacological properties,(7 ) including anti - hiv(8 ) and neuroprotective activity.(9 ) due to the broad application possibilities of these compounds , methods for their ever more efficient preparation are continuously sought after . in this respect ,
transition - metal - catalyzed cross - coupling reactions of various reactive functional groups have been developed as powerful methods for constructing c
c bonds.(10 ) however , it would be even more desirable to use c h bonds directly for c c bond formation .
such transformations are usually termed c h activation reactions.(11 ) in the case of sp c
h bonds adjacent to a nitrogen could be efficiently activated , and several protocols were reported.(12 ) such reactions display much better atom efficiency in comparison to traditional cross - coupling reactions , since prefunctionalization of building blocks for later c c bond formation can be avoided .
h bonds of two substrates to be coupled directly with each other for c c bond formation .
this was realized in cross dehydrogenative coupling ( cdc ) reactions , which are defined as the cross - coupling of two different c
h bonds of pronucleophiles and proelectrophiles.(14 ) using thiq as substrate it was reported that n - arylated thiqs can be coupled to a series of nucleophiles , such as nacn , nitroalkanes , terminal alkynes , malonates , malononitriles , pyrroles , 2-naphthol , and phenylboronic acids , as well as morita baylis hillman ( mbh ) adducts .
such reactions have been reported by murahashi et al.,(16 ) li et al.,(17 ) and others.(18 ) one inspiration for the research published within this contribution was a recent report by the group of li on the cdc between functionalized indoles and position 1 of n - arylated thiqs .
the presence of tert - butyl hydroperoxide ( tbhp as a solution in decane ) as oxidant proved to be necessary , but no additional solvent was needed using copper(i ) bromide as catalyst.(19 ) however , there is one significant limitation of this protocol , the removal of the n - phenyl group , which would allow further functionalization of the thiq on its amine group .
although the removal of phenyl from amines was reported , it required conditions which are only tolerated by a small set of organic compounds ( 100 equiv of li / nh3/thf/40 c , 3 h).(20 ) alternatively , the authors used the p - methoxyphenyl group ( pmp ) , which should be removable in principle ; however , using standard deprotection conditions(21 ) we were unable to deprotect the indolated thiqs .
using a generally removable protecting group ( pg ) instead would open the possibility to perform further transformations after the initial c c bond forming step
. this would be highly desirable if a cheap and readily available catalyst could be used for the cdc reaction .
copper catalysts are highly attractive , since they are significantly cheaper and environmentally more benign compared to noble metal catalysts such as pd , ru , and rh .
an early example of a c c bond forming process using cu catalysts was the ullmann coupling reaction.(22 ) in recent years copper catalysis has regained much attention and several interesting contributions have been reported.(23 ) an even more attractive metal for catalytic systems would be iron , since it is environmentally and economically superior to copper and there are already many literature reports where iron catalysts show promising properties in many synthetically valuable transformations .
also , our group contributed to this field by disclosing an improved protocol for the direct indolation and methoxyarylation of protected thiqs and isochroman by employing cheap iron salts as catalysts.(25 ) even more importantly , removable protecting groups such as the boc group could be used instead of phenyl or pmp , and these were easily cleaved under very mild reaction conditions in most cases in quantitative yield . within this contribution
, we report a method for the indolation , pyrrolation , and methoxyphenylation of thiqs and isochroman under copper catalysis in the absence of any protecting group on thiq .
additionally , iron- and copper - catalyzed protocols for the transformations of protected thiqs and isochroman were investigated .
initially , various protected thiqs were synthesized according to literature protocols to identify protected thiqs suitable for the proposed transformations . they were then submitted to standard indolation conditions(19 ) using copper(i ) bromide as catalyst and tbhp as oxidizing agent at 50 c .
copper(i ) bromide was chosen , since indolation of n - phenyl - thiq was reported in the presence of this catalyst ( table 1 )
cu(no3)23h2o employed . the starting material carrying the boc protecting group ( 1h ) afforded the best product yield ( 79% , entry 15 ) , followed by ac - protected 1a ( 47% , entry 2 ) , cbz - protected 1e ( 41% , entry 10 ) , and benzyl - protected 1c ( bn , 36% , entry 6 ) .
the benzoyl - protected substrate 1d ( bz , 10% , entry 8) was less efficient . in the case of piv - protected 1b ( 21% , entry 2 )
heterocyclic substituents such as 2-pyridinyl ( 1 g ) gave the indolated product in 44% yield ( entry 14 ) ; however , this group requires a two - step protocol for cleavage .
only the tosyl pg ( substrate 1f ) seemed to be ineffective in this transformation ( entry 16 ) . in summary ,
the copper - catalyzed indolation is not limited to protective groups carrying a carbonyl function as was the case for our previously disclosed iron - catalyzed protocol.(25 ) since the boc group ( substrate 1h ) turned out to be the most suitable pg using copper(i ) bromide as catalyst , this substrate was selected for a subsequent round of parameter optimizations , starting with the catalyst species .
interestingly , copper(ii ) nitrate ( entry 11 ) showed the best conversion ( 82% ) , closely followed by copper(ii ) acetate ( entry 18 ) and copper halide salts ( entries 1922 ) . in the case of copper(i ) iodide ( entry 19 ) significant byproduct formation ( oxidized thiq 4h and other unidentified byproduct , scheme 1 ) could be monitored by hplc , resulting in a decrease in conversion to the desired product , whereas cleaner conversions were achieved when employing copper(i ) chloride ( 74% , entry 21 ) or copper(ii ) fluoride ( 76% , entry 22 ) .
such a benzylic oxidation was already reported in the literature under related conditions ( 82 c , excess tbhp , iron(iii ) chloride hexahydrate).(28 ) double substitution at the c3 and n1 positions of the indole with 1h was not observed , as was reported in a similar cdc reaction of n , n - dimethylanilines with indoles.(29 ) to confirm that copper(ii ) nitrate is the catalyst of choice in combination with boc as the best pg , the other protected thiqs were also submitted to the indolation process using copper(ii ) nitrate as catalyst .
generally , all yields obtained with copper(ii ) nitrate were slightly higher in comparison to the corresponding transformation catalyzed by copper(i ) bromide , and again the best yield of the desired product ( 79% , entry 15 ) was obtained using 1h as starting material .
cbz ( 1e , 60% , entry 10 ) , bn ( 1c , 60% , entry 5 ) , and 2-pyridinyl ( 1 g , 61% , entry 13 ) also performed well .
with bz as the pg ( 1d ) , the yield could be significantly increased from 10% ( entry 8) to 40% ( entry 7 ) .
again , tos - protected starting material 1f was not accepted in this transformation ( entry 11 ) .
finally , the role of the oxidant was examined : tbhp without catalyst ( entry 28 ) or stoichiometric amounts of copper in absence of an oxidant failed to perform the reaction , independent of the oxidation state of the copper salt ( entries 23 and 24 ) .
hence , it seems that the oxidizing agent is not only required to reoxidize the copper salt from copper(i ) to copper(ii ) in the catalytic cycle .
this result supports the proposed mechanism of li et al . , which suggests that a peroxide is required as oxidant to convert copper to the oxy - copper species b2 , which then coordinates to the nitrogen of thiq and forms the iminium - type intermediate c2 by elimination of water , which is then attacked by a nucleophile to form the desired product ( scheme 2).(30 ) in contrast to the iron - catalyzed transformation , a carbonyl group adjacent to the nitrogen of the thiq is not mandatory for the copper - catalyzed reaction , indicating a complexation of the copper with the nitrogen to form species a2 rather than with the oxygen of the carbonyl group . in the copper(ii )
nitrate catalyzed transformation addition of tempo , a radical scavenger , did not result in a decrease in product formation , in contrast to our results when employing iron salts as catalysts.(25 ) this indicates that the product is formed by an ionic mechanism rather than through a radical pathway .
other oxidants such as hydrogen peroxide ( entry 25 ) and mcpba ( entry 26 ) only showed traces of the desired product .
thus , tbhp seems to be mandatory as the oxidant in this reaction . in scheme 2 the proposed mechanism for the iron- and copper catalyzed transformations
after we established optimized reaction conditions , a set of various functionalized indoles was reacted with n - boc thiq .
the results of the copper - catalyzed variant are compared with the results of our previously disclosed iron - catalyzed protocol in table 2 .
conditions : ethylene glycol , 250 c , microwave , 30 s. yyield after deprotection of the boc pg ; np = not performed .
it was found that , depending on the indole derivative applied , either iron or copper gave better results , whereas the latter metal was favored in most cases .
simple indole ( table 2 , entry 1 ) gave good yields in both the copper- and iron - catalyzed processes ( 3h , 79% and 54% respectively ) .
n - methylindole ( table 2 , entry 2 ) was also well tolerated by both catalysts ; however , copper performed slightly better than the iron catalyst ( 3i , 70% vs 65% yield ) . a significant difference in substrate conversion
was observed when employing 2-methylindole : in the copper - catalyzed reaction the desired product 3j was obtained in 67% yield ( table 2 , entry 3 ) .
this good yield is especially remarkable , since it shows that sterically hindered indoles can also be applied in this transformation ; this was not the case for the iron catalyst , where only 23% of 3j could be obtained .
this result is in line with our proposed mechanism for the iron - catalyzed indolation process , where the iron species coordinates to the carbonyl group of the boc pg as well as to the nitrogen of the indole.(25 ) thus , complexation might be hindered due to the methyl group at position c-2 of indole , resulting in a decreased yield . on the other hand , a free amine functionality ( table 2 , entry 4 )
was not tolerated at all in copper catalysis and only 16% of 3k could be isolated when using iron(iii ) nitrate as catalyst . in copper catalysis
both electron - withdrawing ( 3m o ) and electron - donating ( 3l ) substituents are well tolerated at position c-5 of indole .
substituents at positions 6 ( table 2 , entry 9 ) and 7 ( table 2 , entry 10 ) were also tolerated ( 3p , q ) .
the picture completely changes when looking at the iron - catalyzed yields : with 5-nitro ( table 2 , entry 6 ) , 5-chloro ( table 2 , entry 8) , and 7-nitro substituents ( table 2 , entry 10 ) even better yields were obtained in comparison to the case for the copper - catalyzed reactions ( 3 m , 66% vs 59% ; 3o , 72% vs 66% ; 3q , 70% vs 46% ) . in these cases , the oxidized n - boc thiq byproduct 4h that always formed
was formed to a lesser extent compared to the case for the copper - catalyzed protocol . since iron has a high affinity toward oxygen,(31 ) it was not surprising that the 5-methoxy - substituted product 3l was obtained in a notably lower yield ( table 2 , entry 5 ) , and the ester substituent ( table 2 , entry 7 ) was even less tolerated as a functional group ( 3n ) .
in addition to indole , also other ring systems could be applied as coupling partners , such as 7-azaindole ( 3r , 42% and 44% ) and 6-chlorodeazapurine ( table 2 ,
entry 12 ) . in the case of 7-azaindole ( table 2 , entry 11 ) comparably mediocre yields were achieved with copper as well as with iron catalysis . using copper(ii )
on the other hand , the desired product was only observed in traces on tlc when using iron(iii ) nitrate .
having established two protocols for the indolation of n - boc - thiq , we finally attempted to cleave the boc protecting group in order to obtain the free nh 1-indolated nh - thiqs .
initially , standard acidic deprotection conditions(32 ) were used however decomposition of the starting material 3h was observed .
only in refluxing acoh was a mediocre yield of 40% of 5h obtained , in addition to decomposition products . in the search for milder conditions we found that using tmscl in meoh at room temperature gave excellent results ( table 2).(33 ) in most cases quantitative yields of the deprotected products
the deprotection in the presence of 6-cl - indole toward compound 5p gave the lowest but still satisfactory yield of 86% ( table 2 , entry 21 ) .
a second alternative thermal deprotection of the boc group under microwave irradiation(34 ) would be an operationally simple alternative strategy to classical deprotection .
it was found that starting materials 3h , i could be deprotected in excellent yield to afford 5h ( 89% , table 2 , entry 13 ) and 5i ( 97% , table 2 , entry 14 ) on heating to 250 c under microwave irradiation .
this method proved to be very time efficient , since 30 s of hold time was sufficient for complete deprotection .
unfortunately , in other cases decomposition of the starting materials was observed and the protocol was hence not generally applicable .
overall , a three - step procedure for the synthesis of 1-indolated thiqs was developed which delivers high yields due to the high - yielding introduction and cleavage of a versatile protecting group .
however , cdc of unprotected thiq and substituted indoles would represent an even more atom efficient transformation .
in such a process , two reaction steps ( installation and cleavage of the protecting group ) could be circumvented , which also saves time and material resources otherwise needed for purification of the intermediate products . to our delight ,
indolation of thiq 6 toward products 5 could be achieved in good yields ( table 3 ) even without n - protection using copper(ii ) nitrate as catalyst . when standard conditions were applied for indolation from the above series of experiments on boc - protected precursors , thiq ( 1.0 equiv of indole , 0.8 equiv of thiq ) could be indolated in approximately 50% yield , independent of the functional group of the indole ( table 3 , entries 4 , 7 , 9 , 11 , 14 , 16 , and 17 ) .
3,4-dihydroisoquinoline ( dhiq ) was also formed as a byproduct via oxidative dehydrogenation to approximately the same extent as the desired products.(35 ) changing the ratio of substrates to 2 equiv of thiq and 1.0 equiv of indole resulted in an increased yield of the desired product 5h of 74% ( table 3 , entry 3 ) .
a further improved yield of 5h of 85% ( table 3 , entry 2 ) was achieved when 4 equiv of 6 was employed .
these results indicate that dhiq byproduct formation occurs at approximately the same reaction rate as the desired product formation .
an even higher excess of thiq ( 8 equiv ) did not improve the yield further ( table 3 , entry 1 ) .
also in other cases an excess of 2 equiv of thiq ( table 3 , entries 10 , 12 , and 18 ) gave better yields .
it has to be pointed out , that 1-methyl- ( table 3 , entry 6 ) , 3-methyl- ( table 3 , entry 8) , and 7-nitroindoles ( table 3 , entry 15 ) are ineffective substrates in this particular transformation .
the failure of 1-methylindole might indicate that a free indole nh group is mandatory for complexation with the copper catalyst and that this step is important for initiating the reaction . in the case of 3-methylindole , the c2 position of the indole is probably not sufficiently electron rich to undergo this type of transformation ( table 3 , entry 8) . on the other hand ,
7-nitroindole competes with the free nh group for complexation with the copper - species , and therefore no desired product is formed.(36 ) reaction time : 2 days .
also , iron catalysis was investigated for this transformation but did not give any indolated product .
thus , protection of nitrogen with a carbonyl pg is mandatory for this metal , since only thiqs with a pg containing a carbonyl group showed successful indolation , due to coordination of the iron species with the oxygen of the carbonyl group.(25 ) on comparison of the two outlined methods , reaction of the unprotected thiq is superior with regard to atom efficiency , even though an excess of thiq is required in order to obtain high yields ( scheme 3 ) .
the same is true regarding time efficiency , since two reaction steps can be avoided .
still , the iron- and copper - catalyzed protocols can be useful alternatives in cases where the free nh of thiq is not tolerated .
two such examples were encountered : i.e. , 1-methyl- ( table 2 , entry 2 ) and 7-nitroindole ( table 2 , entry 10 ) . in these cases the protocol employing fe(no3)3 as catalyst gave 57% and 63% yields over three steps and the cu(no3)2-catalyzed method gave 63% and 41% yields , respectively , again over three steps .
generally , when the overall yield over three steps is compared to the yield of the direct protocol , higher yields are obtained in the direct method when 2 equiv of thiq is applied .
when only 1 equiv of this substrate is used , the three - step protocol including protection and deprotection compares favorably .
hence , it can be concluded that all three protocols ( copper - catalyzed indolation of unprotected thiq , copper - catalyzed indolation of n - protected thiq , and iron - catalyzed indolation of n - protected thiq ) can be of value , depending on the synthetic problem . the protection
deprotection pathway might be of special value when more elaborate and , hence , more expensive thiq derivatives are used as substrates .
after we established the principal reactivity on indole , it was further investigated whether pyrroles can also undergo a cdc with thiq .
thus , pyrrole 7a was reacted with 2 equiv of thiq 6 , which afforded the desired product 8a in 44% yield ( scheme 4 ) .
the new carbon carbon bond was formed in this case between c1 of thiq and c2 of pyrrole , so again the more electron rich position of the pronucleophile reacts .
conditions : cu(no3)23h2o ( 5 mol % ) , tbhp ( 1.3 equiv ) , 50 c , 15 h. the yield dropped dramatically when the pyrrolation was performed on boc - protected 1h : only traces of the desired product 8d were observed employing copper catalysis and only 11% of the desired product could be isolated in the iron - catalyzed reaction ( see the supporting information ) .
thus , the scope of the pyrrolation was investigated on 6 : also 4,5,6,7-tetrahydroindole gave the desired product in 41% yield .
electron - poor pyrroles such as 2-acetylpyrrole did not show any conversion according to gc / ms .
notably , also 1-methylpyrrole was ineffective , which is in line with results obtained for 1-methylindole ( table 3 , entry 6 ) ; we understand this as further evidence of the importance of a free nh group in the pronucleophile .
interestingly , the reaction was also successful when using 2,5-dimethylpyrrole 7b as substrate , this time leading to c c bond formation at c3 of pyrrole , affording product 8b
on the basis of the above results , we became interested in extending the substrate scope of the transformation to other coupling partners in addition to ( aza)indoles and pyrroles .
since the pronucleophile needs to be electron rich , high electron density arenes were submitted to the reaction conditions with thiqs .
gratifyingly , boc - protected 1h ( table 4 , entry 1 ) , bz - protected 1d ( table 4 , entry 2 ) , and cbz - protected 1e ( table 4 , entry 3 ) were found to be suitable substrates for methoxyarylation with 1,3,5-trimethoxybenzene .
in marked contrast to the indolation reactions , unprotected thiq 6 , bn - protected 1c ( table 4 , entry 4 ) and pmp - protected thiq ( table 4 , entry 5 ) were inefficient under both copper and iron catalysis .
the best yield in this methoxyarylation reaction was obtained using 1,3,5-trimethoxybenzene as the most electron rich aryl coupling partner and boc - protected 1h as substrate , where a good yield of 81% in iron catalysis and 76% ( table 4 , entry 1 ) in copper catalysis was obtained .
decreasing the electron density on the aryl coupling partner as in 1,3-dimethoxybenzene also showed product formation of 10f but , as could be expected , with a lower yield of 34% ( copper ) and 41% ( iron ) ( table 4 , entry 9 ) . also , a less favorable arrangement of three methoxy groups led to decreased product yield : 1,2,4-trimethoxybenzene led to 47% ( table 4 , entry 7 , fe ) and 23% ( table 4 , entry 7 , cu ) 10d , respectively .
it has to be noted that only arylation product deriving from a reaction at position 5 of 1,2,4-trimethoxybenzene was observed .
principally , position 3 would be activated to a similar extent but is sterically less favored .
the presence of four methoxy groups in the aryl coupling partner gave , especially in the cu - catalyzed protocol , again a higher yield ( 10e , table 4 , entry 8) .
next , we investigated possible extensions to other proelectrophiles ; therefore , isochroman 9 was tested as the starting material as well ( table 4 , entries 1013 ) .
attempts to use 9 as starting material for indolations unfortunately failed , leading rather to bis - indolation via c h bond oxidation and c o cleavage , which is in line with recent reports by li et al.(37 ) however , 1,3,5-trimethoxybenzene also reacted with 9 as coupling partner to afford the desired product 11a in 55% and 51% yields , respectively ( table 4 , entry 10 ) .
this confirms that this arylation reaction is not limited to thiq but also isochroman can be used as substrate ; however , lower yields were obtained for both metal catalysts in comparison to the case for thiq substrates .
still , this is an interesting extension to existing protocols , since it demonstrates that the transformation is limited neither to thiq starting materials nor to indole or pyrrole coupling partners , consequently broadening the substrate scope considerably .
comparable less electron rich 1,3-dimethoxybenzene also showed product formation , but again with lower yields of 12% ( 11c , entry 12 , fe ) and 23% ( 11c , entry 12 , cu ) .
with regard to 1,2,4-trimethoxybenzene ( 11d , entry 13 ) and 1,2,3,5-tetramethoxybenzene ( 11b , entry 11 ) the same trends in yield were observed as for the corresponding reactions on thiq 1h . for both starting materials 1h and 9 anisole
in summary , an alternative copper- and iron - catalyzed method for the indolation , pyrrolation , and methoxyphenylation of thiqs and for the methoxyphenylation of isochroman was developed .
most importantly , cleavable n - protecting groups can be applied using the outlined protocols , which represents a significant extension of this methodology in comparison to previous reports .
the boc group can be removed under mild conditions with tmscl or within seconds in excellent yield using high - temperature microwave conditions .
it could be demonstrated that unprotected thiq could be directly functionalized with indoles and pyrroles in a copper - catalyzed reaction .
general notes and instrumentation are provided in the supporting information . protected thiqs and 4,5,6,7-tetrahydro-1h - indole
were synthesized according to literature procedures.(26 ) a mixture of protected thiq ( 0.857 mmol , 1.0 equiv ) , catalyst ( cu(no3)23h2o , 10.4 mg ; fe(no3)39h2o , 17.3 mg ; 42.9 mol , 0.05 equiv ) , and indole ( 1.03 mmol , 1.2 equiv ) was placed into a 5 ml glass vial in air .
tbhp ( 203 l , 5.5 m in decane , 1.3 equiv ) was added dropwise at 0 c in air , and the dark greenish slurry was stirred for 10 min at 0 c .
the neat mixture was then slowly heated to 50 c , whereupon the color changed to dark brown , and stirring was continued for 15 h in a heating block .
the dark brown slurry was diluted with dcm ( 3 ml ) and directly subjected to flash column chromatography ( 100 g of sio2 ) , applying the solvent mixture used for tlc .
yield for cu 134 mg ( 54% ) and for fe traces ; pale yellow solid ; mp 208211 c ; tlc rf ( pe / etoac 1/1 ) = 0.18 ; gc / ms ( ei+ ) m / z ( rel intensity ) 290 ( m , 50 ) , 273 ( 14 ) , 248 ( 18 ) , 247 ( 100 ) , 232 ( 29 ) , 230 ( 14 ) , 218 ( 28 ) , 217 ( 28 ) , 132 ( 16 ) , 131 ( 24 ) , 130 ( 50 ) , 117 ( 25 ) , 115 ( 27 ) , 103 ( 21 ) , 89 ( 12 ) , 77 ( 12 ) ; h nmr ( 200 mhz , dmso- d6 ) mixture of rotamers 1:0.17 , 2.10 ( s , 3h ) , 2.25 ( s , 0.51h ) , 2.742.90 ( m , 1.30h ) , 3.02 ( ddd , j = 17.2 hz , j = 11.6 hz , j = 5.8 hz , 1h ) , 3.243.45 ( m , 1.30h ) , 3.77 ( dd , j = 13.7 hz , j = 5.4 hz , 1h ) , 4.26 ( bs , 0.16h ) , 6.40 ( bs , 0.17h ) , 6.58 ( d , j = 2.0 hz , 1h ) , 6.897.27 ( m , 8h ) , 7.34 ( d , j = 7.9 hz , 1.35h ) , 7.57 ( d , j = 7.8 hz , 1h ) , 10.93 ( s , 1h ) , 11.10 ( s , 0.17h ) ; c nmr ( 50 mhz , dmso - d6 ) : mixture of rotamers 1:0.17 , 21.4 ( q ) , 28.4 ( t ) , 39.1 ( t , overlap with dmso signal ) , 47.9 ( d ) , 111.4 ( d ) , 117.1 ( s ) , 118.7 ( d ) , 119.2 ( d ) , 121.3 ( d ) , 125.4 ( d ) , 125.7 ( d ) , 126.1 ( s ) , 126.5 ( d ) , 128.2 ( d ) , 128.8 ( d ) , 134.4 ( s ) , 136.2 ( s ) , 136.3 ( s ) , 167.7 ( s ) .
yield for cu 73 mg ( 26% ) and for fe traces ; off white powder ; mp 184186 c ; tlc rf ( pe / etoac 2/1 ) = 0.27 ; gc / ms ( ei+ ) m / z ( rel intensity ) 332 ( m , 27 ) , 248 ( 19 ) , 247 ( 100 ) , 232 ( 35 ) , 231 ( 14 ) , 218 ( 25 ) , 217 ( 23 ) , 144 ( 11 ) , 132 ( 26 ) , 130 ( 28 ) , 117 ( 10 ) , 115 ( 17 ) , 57 ( 24 ) ; h nmr ( 200 mhz , cdcl3 ) 1.24 ( s , 9h ) , 2.73 ( ddd , j = 16.4 hz , j = 4.1 hz , j = 0.9 hz , 1h ) , 3.04 ( ddd , j = 17.0 hz , j = 12.4 hz , j = 6.1 hz , 1h ) , 3.44 ( ddd , j = 13.9 hz , j = 12.6 hz , j = 4.2 hz , 1h ) , 4.05 ( ddd , j = 13.6 hz , j = 6.2 hz , j = 1.4 hz , 1h ) , 6.56 ( d , j = 2.3 hz , 1h ) , 6.97 ( ddd , j = 8.0 hz , j = 7.1 hz , j = 1.1 hz , 1h ) , 7.047.16 ( m , 5h ) , 7.167.21 ( m , 1h ) , 7.25 ( d , j = 8.0 hz , 1h ) , 7.50 ( d , j = 7.9 hz , 1h ) , 8.06 ( s , 1h ) ; c nmr ( 50 mhz , cdcl3 ) 28.4 ( 3c , q ) , 29.2 ( t ) , 39.1 ( s ) , 39.6 ( t ) , 50.4 ( d ) , 110.9 ( d ) , 119.1 ( s ) , 119.8 ( d ) , 120.4 ( d ) , 122.2 ( d ) , 125.6 ( d ) , 125.9 ( d ) , 126.4 ( s ) , 126.6 ( d ) , 128.6 ( d ) , 128.7 ( d ) , 133.7 ( s ) , 136.4 ( s ) , 136.5 ( s ) , 175.7 ( s ) .
yield for cu 181 mg ( 60% ) and for fe 20 mg ( 7% ) ; pale yellow solid ; mp 5560 c ; tlc rf ( pe / et2o 1/1 ) = 0.45 ; gc / ms ( ei+ ) m / z ( rel intensity ) 338 ( m+ , 75 ) , 337 ( 56 ) , 247 ( 32 ) , 245 ( 16 ) , 231 ( 22 ) , 219 ( 50 ) , 218 ( 100 ) , 217 ( 35 ) , 130 ( 11 ) , 106 ( 15 ) , 91 ( 31 ) ; hrms ( esi+ ) : exact mass calculated for c24h22n2 339.1856 , found : 339.1852 [ m + h ] ; h nmr ( 200 mhz , dmso - d6 ) 2.322.47 ( m , 1h ) , 2.702.88 ( m , 1h ) , 2.923.12 ( m , 2h ) , 3.26 ( d , j = 13.7 hz , 1h ) , 3.81 ( d , j = 13.7 hz , 1h ) , 4.88 ( s , 1h ) , 6.757.39 ( m , 13h ) , 7.45 ( d , j = 7.8 hz , 1h ) , 10.97 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 28.8 ( t ) , 47.1 ( t ) , 58.2 ( t ) , 61.2 ( d ) , 111.4 ( d ) , 116.4 ( s ) , 118.2 ( d ) , 120.2 ( d ) , 120.9 ( d ) , 125.3 ( d ) , 125.49 ( d ) , 125.53 ( d ) , 125.9 ( s ) , 126.5 ( d ) , 127.9 ( d ) , 128.0 ( d , 2c ) , 128.1 ( d ) , 128.4 ( d , 2c ) , 134.3 ( s ) , 136.9 ( s ) , 138.7 ( s ) , 139.6 ( s ) .
yield for cu 120 mg ( 40% ) and for fe 67 mg ( 22% ) ; brown solid ; mp 226228 c ; tlc rf ( pe / etoac 2/1 ) = 0.29 ; gc / ms ( ei+ ) m / z ( rel intensity ) 352 ( m , 40 ) , 248 ( 20 ) , 247 ( 100 ) , 232 ( 32 ) , 218 ( 21 ) , 217 ( 21 ) , 130 ( 18 ) , 115 ( 12 ) , 105 ( 56 ) , 77 ( 44 ) ; hrms ( esi ) exact mass calculated for c24h20n2o 353.1648 , found 353.1639 [ m + h ] ; h nmr ( 400 mhz , cdcl3 ) 2.75 ( d , j = 14.6 hz , 1h ) , 2.973.11 ( m , 1h ) , 3.47 ( dt , j = 13.4 hz , j = 3.3 hz , 1h ) , 3.66 ( dd , j = 13.2 hz , j = 5.7 hz , 1h ) , 6.68 ( s , 1h ) , 7.13 ( t , j = 7.3 hz , 1h ) , 7.187.54 ( m , 12h ) , 7.85 ( d , j = 7.6 hz , 1h ) , 8.34 ( bs , 1h ) ; h nmr ( 200 mhz , dmso - d6 ) 2.75 ( d , j = 16.0 hz , 1h ) , 2.863.10 ( m , 1h ) , 3.203.60 ( m , 2h ) , 6.64 ( bs , 1h ) , 6.897.51 ( m , 13h ) , 7.65 ( d , j = 7.9 hz , 1h ) , 11.03 ( s , 1h ) ; c nmr ( 101 mhz , cdcl3 ) 29.5 ( t ) , 40.6 ( t ) , 49.0 ( d ) , 111.1 ( d ) , 118.6 ( s ) , 120.0 ( d ) , 120.3 ( d ) , 122.3 ( d ) , 125.7 ( d ) , 126.1 ( d ) , 126.4 ( 2d ) , 126.9 ( d ) , 127.3 ( s ) , 128.5 ( 4c , d ) , 128.8 ( d ) , 128.9 ( d ) , 129.4 ( d ) , 133.8 ( s ) , 135.7 ( s ) , 136.4 ( s ) , 136.6 ( s ) , 169.9 ( s ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 28.6 ( t ) , ( ch2 group at 40.6 ppm in cdcl3 overlaps with dmso signal ) , 48.4 ( d ) , 111.6 ( d ) , 116.8 ( s ) , 118.9 ( d ) , 119.0 ( d ) , 121.4 ( d ) , 125.8 ( d ) , 125.9 ( s ) , 126.1 ( d ) , 126.8 ( d ) , 128.2 ( d ) , 128.5 ( 4c , d ) , 128.9 ( d ) , 129.3 ( d ) , 134.0 ( s ) , 135.6 ( s ) , 136.4 ( 2c overlapping , s ) , 168.6 ( s ) .
yield for cu 171 mg ( 60% ) and for fe 135 mg ( 41% ) ; white powder ; mp 6264 c ; tlc rf ( pe / etoac 5/1 ) = 0.55 ; gc / ms ( ei+ ) m / z ( rel intensity ) 382 ( m ,
3 ) , 292 ( 7 ) , 291 ( 40 ) , 248 ( 20 ) , 247 ( 100 ) , 218 ( 8) , 217 ( 7 ) , 130 ( 12 ) , 103 ( 5 ) , 91 ( 6 ) ; hrms ( esi ) exact mass calculated for c25h22n2o2 383.1754 , found 383.1722 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.73 ( dd , 1h , j = 16.7 hz , j = 2.7 hz , 1h ) , 2.903.36 ( m , 2h ) , 3.804.30 ( m , 1h ) , 5.105.46 ( m , 2h ) , 6.486.84 ( m , 2h ) , 6.887.82 ( m , 13h ) , 8.19 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.6 ( t ) , 37.4 ( t ) , 51.5 ( d ) , 67.1 ( t ) , 111.0 ( d ) , 118.5 ( s ) , 119.8 ( d ) , 120.2 ( d ) , 122.2 ( d ) , 125.0 ( d ) , 125.8 ( d , 2c ) , 126.4 ( s ) , 126.7 ( d ) , 127.7 ( d ) , 128.0 ( d ) , 128.4 ( d ) , 128.5 ( d , 2c ) , 129.0 ( d ) , 134.6 ( s ) , 136.0 ( s ) , 136.3 ( s ) , 136.7 ( s ) , 154.9 ( s ) .
yield for cu 171 mg ( 61% ) ; pale yellow powder ; mp 177178 c ; tlc rf ( pe / etoac 2/1 ) = 0.51 ; gc / ms ( ei+ ) m / z ( rel intensity ) 325 ( m 40 ) , 248 ( 19 ) , 247 ( 100 ) , 232 ( 24 ) , 230 ( 15 ) , 218 ( 24 ) , 217 ( 27 ) , 195 ( 12 ) , 130 ( 17 ) , 117 ( 14 ) , 115 ( 15 ) ; hrms ( esi ) exact mass calculated for c22h19n3 326.1652 , found 326.1652 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.80 ( dt , j = 16.1 hz , j = 3.9 hz , 1h ) , 3.12 ( ddd , j = 16.3 hz , j = 10.7 hz , j = 5.6 hz , 1h ) , 3.63 ( ddd , j = 13.6 hz , j = 10.7 hz , j = 4.4 hz , 1h ) , 3.98 ( td , j = 13.6 hz , j = 4.3 hz , 1h ) , 6.58 ( dd , j = 7.0 hz , j = 5.0 hz , 1h ) , 6.65 ( d , j = 2.2 hz , 1h ) , 6.76 ( d , j = 8.6 hz , 1h ) , 7.04 ( t , j = 7.1 hz , 1h ) , 7.107.23 ( m , 5h ) , 7.277.35 ( m , 2h ) , 7.47 ( ddd , j = 8.8 hz , j = 7.2 hz , j = 2.0 hz , 1h ) , 7.70 ( d , j = 7.8 hz , 1h ) , 8.06 ( s , 1h ) , 8.28 ( dd , j = 4.9 hz , j = 1.9 hz , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 26.9 ( t ) , 38.9 ( t ) , 52.2 ( d ) , 106.5 ( d ) , 111.0 ( d ) , 112.0 ( d ) , 119.2 ( s ) , 119.5 ( d ) , 120.1 ( d ) , 122.0 ( d ) , 124.4 ( d ) , 125.6 ( d ) , 126.5 ( d ) , 126.6 ( s ) , 128.3 ( d ) , 128.8 ( d ) , 135.4 ( s ) , 136.5 ( s ) , 137.4 ( s ) , 137.5 ( d ) , 148.1 ( d ) , 157.9 ( s ) .
yield for cu 235 mg ( 79% ) and for fe 160 mg ( 54% ) ; off white powder ; mp 137139 c ; tlc rf ( pe / et2o 2/1 ) = 0.18 ; gc / ms ( ei+ ) m / z ( rel intensity ) 248 ( 46 ) , 247 ( 91 ) , 245 ( 100 ) , 230 ( 18 ) , 218 ( 53 ) , 130 ( 52 ) , 121 ( 46 ) , 117 ( 38 ) , 108 ( 50 ) , 103 ( 21 ) ; hrms ( esi ) exact mass calculated for c22h24n2o2 371.1735 . found 371.1730 [ m + na ] ; h nmr ( 400 mhz , dmso - d6 ) 1.46 ( s , 9h ) , 2.77 ( d , j = 15.8 hz , 1h ) , 2.842.96 ( m , 1h ) , 3.07 ( dt , j = 12.8 hz , j = 4.3 hz , 1h ) , 3.94 ( bs , 1h ) , 6.376.85 ( m , 2h ) , 6.96 ( t , j = 7.4 hz , 1h ) , 7.08 ( t , j = 7.6 hz , 1h ) , 7.15 ( bs , 2h ) , 7.22 ( d , j = 3.1 hz , 2h ) , 7.36 ( d , j = 8.1 hz , 1h ) , 7.58 ( bs , 1h ) , 10.95 ( s , 1h ) ; h nmr ( 200 mhz , cdcl3 ) 1.55 ( s , 9h ) , 2.632.85 ( m , 1h ) , 2.923.27 ( m , 1h ) , 4.05 ( bs , 1h ) , 6.60 ( bs , 1h ) , 6.75 ( bs , 1h ) , 7.067.25 ( m , 6h ) , 7.35 ( d , j = 7.7 hz , 1h ) , 7.80 ( bs , 1h ) , 8.14 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.4 ( 3c , q ) , 28.5 ( t ) , 37.6 ( t ) , 50.5 ( d ) , 79.7 ( s ) , 111.1 ( d ) , 118.6 ( s ) , 119.5 ( d ) , 119.9 ( d ) , 122.0 ( d ) , 125.0 ( d ) , 125.6 ( d ) , 126.4 ( s ) , 126.5 ( d ) , 128.3 ( s ) , 128.3 ( d ) , 129.0 ( d ) , 134.8 ( s ) , 136.3 ( s ) , 136.4 ( s ) , 154.3 ( s ) .
yield for cu 218 mg ( 70% ) and for fe 203 mg ( 65% ) ; white powder ; mp 7072 c ; tlc rf ( pe / etoac 3/1 ) = 0.78 ; gc / ms ( ei+ ) m / z ( rel intensity ) 262 ( 48 ) , 261 ( 100 ) , 259 ( 33 ) , 245 ( 12 ) , 232 ( 22 ) , 217 ( 20 ) , 157 ( 6 ) , 130 ( 22 ) , 103 ( 7 ) , 77 ( 5 ) ; hrms ( esi ) exact mass calculated for c23h26n2o2 363.2067 , found 363.2072 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.58 ( s , 9h ) , 2.682.88 ( m , 1h ) ,
2.963.30 ( m , 2h ) , 3.70 ( s , 3h ) , 3.884.32 ( m , 1h ) , 6.49 ( s , 1h ) , 6.74 ( bs , 1h ) , 7.087.36 ( m , 7h ) , 7.82 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.4 ( t ) , 28.6 ( 3c , q ) , 32.6 ( q ) , 37.5 ( t ) , 50.4 ( d ) , 79.5 ( s ) , 109.1 ( d ) , 117.4 ( s ) , 119.2 ( d ) , 120.4 ( d ) , 121.8 ( d ) , 125.6 ( d ) , 126.5 ( d ) , 127.0 ( s ) , 128.4 ( d ) , 129.0 ( d ) , 129.4 ( d ) , 135.0 ( s ) , 136.5 ( s ) , 137.1 ( s ) , 154.2 ( s ) .
yield for cu 209 mg ( 67% ) and for fe 72 mg ( 23% ) ; pale yellow powder ; mp 8184 c ; tlc rf ( pe / etoac 2/1 ) = 0.69 ; gc / ms ( ei+ ) m / z ( rel intensity ) 262 ( 62 ) , 261 ( 100 ) , 245 ( 61 ) , 244 ( 37 ) , 219 ( 21 ) , 218 ( 44 ) , 131 ( 34 ) , 130 ( 85 ) , 103 ( 18 ) , 77 ( 20 ) ; hrms ( esi ) exact mass calculated for c23h26n2o2 385.1886 , found 385.1896 [ m + na ] ; h nmr ( 200 mhz , cdcl3 ) 1.49 ( s , 9h ) , 2.24 ( s , 3h ) , 2.78 ( dd , j = 16.7 hz , j = 3.0 hz , 1h ) , 3.003.80 ( m , 2h ) , 4.14 ( dd , j = 11.8 hz , j = 3.5 hz , 1h ) , 6.66 ( s , 1h ) , 6.836.94 ( m , 1h ) , 6.987.13 ( m , 4h ) , 7.177.26 ( m , 3h ) , 7.91 ( bs , 1h ) ; h nmr ( 200 mhz , dmso - d6 ) 1.44 ( s , 9h ) , 2.19 ( s , 3h ) , 2.743.28 ( m , 3h ) , 4.01 ( dd , j = 13.3 hz , j = 3.3 hz , 1h ) , 6.50 ( s , 1h ) , 6.676.78 ( m , 1h ) , 6.817.02 ( m , 3h ) , 7.057.15 ( m , 1h ) , 7.157.28 ( m , 3h ) , 10.95 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 12.6 ( q ) , 28.5 ( 3c , q ) , 28.6 ( t ) , 38.3 ( t ) , 51.0 ( d ) , 79.7 ( s ) , 110.1 ( d ) , 113.3 ( s ) , 119.3 ( d ) , 119.5 ( d ) , 120.9 ( d ) , 126.3 ( d ) , 126.5 ( d ) , 128.3 ( d ) , 128.5 ( s ) , 129.0 ( d ) , 133.9 ( s ) , 134.9 ( s ) , 134.9 ( s ) , 137.0 ( s ) , 154.2 ( s ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 11.9 ( q ) , 27.9 ( t ) , 28.0 ( 3c , q ) , 37.8 ( t ) , 50.3 ( d ) , 78.9 ( s ) , 110.4 ( d ) , 111.6 ( s ) , 118.1 ( d ) , 118.4 ( d ) , 119.9 ( d ) , 126.0 ( d ) , 126.4 ( d ) , 127.7 ( s ) , 127.8 ( d ) , 128.8 ( d ) , 134.2 ( s ) , 134.4 ( s ) , 134.8 ( s ) , 136.7 ( s ) , 153.3 ( s ) .
yield for cu no conversion and for fe 50 mg ( 16% ) ; dark brown solid ; mp 9698 c ; tlc rf ( pe / et2o 1/1 ) = 0.31 ; gc / ms ( ei+ ) m / z ( rel intensity ) 263 ( 48 ) , 262 ( 30 ) , 258 ( 40 ) , 246 ( 75 ) , 245 ( 100 ) , 233 ( 13 ) , 218 ( 17 ) , 132 ( 23 ) , 130 ( 20 ) ; hrms ( esi ) exact mass calculated for c22h25n3o2 386.1839 , found 386.1854 [ m + na ] ; h nmr ( 400 mhz , cdcl3 ) 1.48 ( s , 9h ) , 2.82 ( dd , j = 16.4 hz , j = 2.9 hz , 1h ) , 3.093.22 ( m , 1h ) , 3.41 ( dt , j = 13.3 hz , j = 3.6 hz , 1h ) , 4.07 ( dd , j = 13.6 hz , j = 5.7 hz , 1h ) , 6.66 ( s , 1h ) , 5.13 ( s , 1h ) , 6.68 ( d , j = 8.6 hz , 1h ) , 6.78 ( t , j = 2.7 hz , 1h ) , 7.03 ( d , j = 7.7 hz , 1h ) , 7.10 ( t , j = 7.3 hz , 1h ) , 7.14 ( d , j = 8.6 hz , 1h ) , 7.197.24 ( m , 2h ) , 7.86 ( s , 1h ) , nh2 group gives a broad signal between 2 and 5 ppm ; c nmr ( 101 mhz , apt , cdcl3 ) 28.4 ( q , 3c ) , 28.5 ( t ) , 39.2 ( t ) , 53.8 ( d ) , 80.2 ( s ) , 101.3 ( d ) , 111.7 ( d ) , 113.8 ( d ) , 116.0 ( s ) , 123.7 ( d ) , 126.3 ( d ) , 126.5 ( d ) , 128.4 ( s ) , 128.9 ( d ) , 128.9 ( d ) , 130.8 ( s ) , 134.8 ( s ) , 137.4 ( s ) , 139.9 ( s ) , 155.5 ( s ) .
yield for cu 174 mg ( 52% ) and for fe 140 mg ( 43% ) ; off - white powder ; mp 6972 c ; tlc rf ( pe / etoac 5/1 ) = 0.27 ; gc / ms ( ei+ ) m / z ( rel intensity ) 278 ( 59 ) , 277 ( 100 ) , 261 ( 53 ) , 249 ( 22 ) , 248 ( 24 ) , 233 ( 12 ) , 218 ( 10 ) , 204 ( 10 ) , 132 ( 10 ) , 130 ( 14 ) ; hrms ( esi ) exact mass calculated for c23h26n2o3 401.1836 , found 401.1822 [ m + na ] ; h nmr ( 200 mhz , dmso - d6 ) 1.46 ( s , 9h ) , 2.633.19 ( m , 3h ) , 3.69 ( s , 3h ) , 3.88 ( bs , 1h ) , 6.52 ( bs , 2h ) , 6.73 ( dd , j = 8.8 hz , j = 2.1 hz , 1h ) , 7.017.32 ( m , 6h ) , 10.78 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.8 ( t ) , 28.0 ( 3c , q ) , 37.0 ( t ) , 50.1 ( d ) , 55.0 ( q ) , 78.8 ( s ) , 100.7 ( d ) , 111.5 ( d ) , 112.2 ( d ) , 116.8 ( s ) , 125.6 ( d ) , 126.4 ( s ) , 126.5 ( d ) , 127.9 ( d ) , 128.9 ( d ) , 131.4 ( s ) , 134.4 ( s ) , 136.0 ( s ) , 153.1 ( s ) , 153.4 ( s ) .
yield for cu 200 mg ( 59% ) and for fe 222 mg ( 66% ) ; bright yellow solid ; mp 219221 c ; tlc rf ( pe / etoac 3/1 ) = 0.22 ; gc / ms ( ei+ ) m / z ( rel intensity ) 393 ( 43 ) , 292 ( 100 ) , 276 ( 10 ) , 263 ( 24 ) , 246 ( 34 ) , 217 ( 30 ) , 189 ( 8) , 146 ( 6 ) , 132 ( 6 ) , 130 ( 12 ) ; hrms ( esi ) exact mass calculated for c22h23n3o4 416.1581 , found 416.1589 [ m + na ] ; h nmr ( 200 mhz , dmso - d6 ) 1.50 ( s , 9h ) , 2.633.07 ( m , 3h ) , 3.764.09 ( m , 1h ) , 6.62 ( s , 1h ) , 6.80 ( s , 1h ) , 7.097.29 ( m , 4h ) , 7.55 ( d , j = 9.0 hz , 1h ) , 8.02 ( dd , j = 9.0 hz , j = 2.2 hz , 1h ) , 8.73 ( s , 1h ) , 11.5011.86 ( m , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.7 ( t ) , 27.9 ( q , 3c ) , 37.0 ( t ) , 49.9 ( d ) , 79.5 ( s ) , 112.1 ( d ) , 116.4 ( d ) , 116.8 ( d ) , 119.9 ( s ) , 125.3 ( s ) , 125.7 ( d ) , 126.8 ( d ) , 128.0 ( d ) , 128.9 ( d ) , 129.0 ( d ) , 134.5 ( s ) , 135.1 ( s ) , 139.6 ( s ) , 140.6 ( s ) , 153.3 ( s ) .
yield for cu 175 mg ( 50% ) and for fe 17 mg ( 5% ) ; pale yellow powder ; mp 221224 c ; tlc rf ( pe / et2o 1/1 ) = 0.18 ; gc / ms ( ei+ ) m / z ( rel intensity ) 306 ( 45 ) , 305 ( 100 ) , 289 ( 12 ) , 276 ( 18 ) , 247 ( 8) , 244 ( 8) , 217 ( 15 ) , 189 ( 6 ) , 144 ( 8) , 130 ( 16 ) ; hrms ( esi ) exact mass calculated for c24h26n2o4 429.1785 , found 429.1771 [ m + na ] ; h nmr ( 200 mhz , cdcl3 ) 1.62 ( s , 9h ) , 2.602.83 ( m , 1h ) , 2.903.18 ( m , 2h ) , 3.90 ( s , 3h ) , 3.934.27 ( m , 1h ) , 6.58 ( d , j = 1.9 hz , 1h ) , 6.616.89 ( m , 1h ) , 7.087.24 ( m , 4h ) , 7.34 ( d , j = 8.6 hz , 1h ) , 7.91 ( dd , j = 8.6 hz , j = 1.2 hz , 1h ) , 8.58 ( bs , 1h ) ; 8.63 ( s , 1h ) , h nmr ( 200 mhz , dmso - d6 ) 1.52 ( s , 9h ) , 2.643.10 ( m , 3h ) , 3.82 ( s , 3h ) , 3.90 ( bs , 1h ) , 6.58 ( bs , 1h ) , 6.63 ( bs , 1h ) , 7.077.30 ( m , 4h ) , 7.45 ( d , j = 8.6 hz , 1h ) , 7.75 ( d , j = 8.6 hz , 1h ) , 8.49 ( s , 1h ) , 11.34 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.6 ( t ) , 27.9 ( 3c , q ) , ( ch2 group at 36.2 ppm in cdcl3 overlaps with dmso signal ) , 50.4 ( d ) , 51.4 ( q ) , 79.5 ( s ) , 111.5 ( d ) , 118.6 ( s ) , 120.3 ( s ) , 121.9 ( d ) , 122.4 ( d ) , 125.57 ( s ) , 125.61 ( d ) , 126.7 ( d ) ,
127.0 ( d ) , 127.9 ( d ) , 129.1 ( d ) , 134.5 ( s ) , 135.6 ( s ) , 139.0 ( s ) , 153.4 ( s ) , 167.1 ( s ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.1 ( t ) , 28.4 ( q , 3c ) , 36.2 ( t ) , 51.2 ( d ) , 51.6 ( q ) , 80.7 ( s ) , 111.0 ( d ) , 120.1 ( s ) , 121.5 ( s ) , 122.7 ( d ) , 123.7 ( d ) , 125.6 ( d ) , 126.0 ( s ) , 126.4 ( d ) , 126.8 ( d ) , 128.2 ( d ) , 129.1 ( d ) , 134.9 ( s ) , 135.8 ( s ) , 139.2 ( s ) , 154.2 ( s ) , 168.2 ( s ) .
yield for cu 215 mg ( 66% ) and for fe 236 mg ( 72% ) ; pale pink powder ; mp 202204 c ; tlc rf ( pe / etoac 3/1 ) = 0.56 ; gc / ms ( ei+ ) m / z ( rel intensity ) 284 ( 13 ) , 283 ( 38 ) , 282 ( 42 ) , 281 ( 100 ) , 279 ( 14 ) , 265 ( 9 ) , 253 ( 21 ) , 252 ( 22 ) , 217 ( 30 ) , 216 ( 11 ) , 164 ( 8) , 130 ( 26 ) , 103 ( 9 ) ; hrms ( esi ) : exact mass calculated for c22h23n2o2cl 405.1340 ; found 405.1350 [ m + na ] ; h nmr ( 200 mhz , dmso - d6 ) 1.49 ( s , 9h ) , 2.653.09 ( m , 3h ) , 3.91 ( bs , 1h ) , 6.50 ( s , 1h ) , 6.63 ( bs , 1h ) , 7.09 ( dd , j = 8.6 hz , j = 1.9 hz , 1h ) , 7.137.26 ( m , 4h ) , 7.38 ( d , j = 8.6 hz , 1h ) , 7.66 ( d , j = 1.8 hz , 1h ) , 11.15 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.7 ( t ) , 28.0 ( q , 3c ) , ( ch2-group at 37.7 ppm in cdcl3 overlaps with dmso signal ) , 50.1 ( d ) , 79.3 ( s ) , 113.1 ( d ) , 117.0 ( s ) , 118.3 ( d ) , 121.2 ( d ) , 123.4 ( s ) , 125.6 ( d ) , 126.7 ( d ) , 126.8 ( d ) , 127.0 ( s ) , 127.9 ( d ) , 129.0 ( d ) , 134.4 ( s ) , 134.8 ( s ) , 135.6 ( s ) , 163.4 ( s ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.3 ( t ) , 28.6 ( 3c , q ) , 37.7 ( t ) , 51.0 ( d ) , 79.3 ( s ) , 112.0 ( d ) , 118.9 ( s ) , 119.7 ( d ) , 122.6 ( d ) , 125.5 ( s ) , 125.7 ( d ) , 126.1 ( d ) , 126.8 ( d ) , 127.5 ( s ) , 128.3 ( d ) , 129.1 ( d ) , 134.7 ( s ) , 135.0 ( s ) , 135.8 ( s ) , 154.2 ( s ) yield for cu 245 mg ( 75% ) and for fe 184 mg ( 56% ) ; white powder ; mp 8385 c ; tlc rf ( pe : etoac=3:1 ) = 0.63 ; gc / ms ( ei+ ) m / z ( rel intensity ) 284 ( 14 ) , 283 ( 33 ) , 282 ( 40 ) , 281 ( 100 ) , 279 ( 22 ) , 265 ( 22 ) , 253 ( 35 ) , 252 ( 25 ) , 217 ( 30 ) , 216 ( 16 ) , 130 ( 27 ) , 103 ( 12 ) ; hrms ( esi ) : exact mass calculated for c22h23n2o2cl 405.1340 ; found 405.1339 [ m + na ] ; h nmr ( 200 mhz , cdcl3 ) 1.52 ( s , 9h ) , 2.632.81 ( m , 1h ) , 2.903.20 ( m , 2h ) , 4.07 ( bs , 1h ) , 6.526.75 ( m , 2h ) , 7.05 ( dd , j = 8.6 hz , j = 1.8 hz , 1h ) , 7.107.23 ( m , 4h ) , 7.31 ( d , j = 1.7 hz , 1h ) , 7.68 ( bs , 1h ) , 8.19 ( bs , 1h ) ; h nmr ( 200 mhz , dmso - d6 ) 1.45 ( s , 9h ) , 2.663.12 ( m , 3h ) , 3.90 ( bs , 1h ) , 6.50 ( s , 1h ) , 6.68 ( bs , 1h ) , 7.00 ( dd , j = 8.5 hz , j = 1.9 hz , 1h ) , 7.067.27 ( m , 4h ) , 7.41 ( d , j = 1.8 hz , 1h ) , 7.54 ( d , j = 7.5 hz , 1h ) , 11.09 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.8 ( t ) , 28.0 ( 3c , q ) , ch2 group at 37.5 ppm in cdcl3 overlaps with dmso signal , 50.2 ( d ) , 79.1 ( s ) , 111.2 ( d ) , 117.3 ( s ) , 119.0 ( d ) , 120.3 ( d ) , 124.8 ( s ) , 125.7 ( d ) ,
126.0 ( s ) , 126.2 ( d ) , 126.6 ( d ) , 127.9 ( d ) , 128.9 ( d ) , 134.4 ( s ) , 135.8 ( s ) , 136.7 ( s ) , 153.4 ( s ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.4 ( t ) , 28.5 ( 3c , q ) , 37.5 ( t ) , 50.5 ( d ) , 79.8 ( s ) , 110.9 ( d ) , 119.2 ( s ) , 120.5 ( d ) , 121.2 ( d ) , 125.1 ( s ) , 125.4 ( d ) , 125.7 ( d ) , 126.7 ( d ) , 128.2 ( s ) , 128.3 ( d ) , 129.1 ( d ) , 134.9 ( s ) , 135.9 ( s ) , 136.8 ( s ) , 154.4 ( s ) .
yield for cu 155 mg ( 46% ) and for fe 235 mg ( 70% ) ; bright yellow powder ; mp 8891 c ; tlc rf ( pe / etoac 5/1 ) = 0.45 ; gc / ms ( ei+ ) m / z ( rel intensity ) 293 ( 56 ) , 292 ( 100 ) , 291 ( 17 ) , 290 ( 38 ) , 264 ( 15 ) , 263 ( 24 ) , 246 ( 20 ) , 244 ( 16 ) , 217 ( 32 ) , 216 ( 20 ) , 189 ( 13 ) , 188 ( 10 ) , 132 ( 21 ) , 130 ( 27 ) , 121 ( 16 ) , 108 ( 26 ) , 103 ( 13 ) ; h nmr ( 200 mhz , dmso - d6 ) 1.46 ( s , 9h ) , 2.663.13 ( m , 3h ) , 3.92 ( d , j = 12.1 hz , 1h ) , 6.60 ( s , 1h ) , 6.73 ( bs , 1h ) , 7.067.29 ( m , 5h ) , 8.018.13 ( m , 2h ) , 11.80 ( s , 1h ) ; c
nmr ( 50 mhz , apt , dmso - d6 ) 27.7 ( t ) , 28.0 ( q , 3c ) , 37.0 ( t ) , 49.8 ( d ) , 79.3 ( s ) , 118.7 ( d ) , 118.9 ( d ) , 119.2 ( s ) , 125.8 ( d ) , 126.9 ( d ) , 127.6 ( d ) , 127.9 ( d ) , 128.2 ( d ) , 128.5 ( s ) , 129.1 ( d ) , 130.3 ( s ) , 132.6 ( s ) , 134.5 ( s ) , 135.2 ( s ) , 153.5 ( s ) .
yield for cu 133 mg ( 44% ) and for fe 126 mg ( 42% ) ; white powder ; mp 8486 c ; tlc rf ( pe / et2o 1/1 ) = 0.11 ; gc / ms ( ei+ ) m / z ( rel intensity ) 249 ( 56 ) , 248 ( 100 ) , 245 ( 36 ) , 244 ( 57 ) , 219 ( 50 ) , 190 ( 10 ) , 144 ( 14 ) , 132 ( 24 ) , 130 ( 28 ) , 119 ( 34 ) , 109 ( 27 ) , 103 ( 18 ) , 95 ( 16 ) ; hrms ( esi ) exact mass calculated for c21h23n3o2 350.1863 ; found 350.1871 [ m + h ] ; h nmr ( 200 mhz , dmso - d6 ) 1.45 ( s , 9h ) , 2.683.15 ( m , 3h ) , 3.92 ( d , j = 11.2 hz , 1h ) , 6.50 ( s , 1h ) , 6.77 ( bs , 1h ) , 7.03 ( dd , j = 7.9 hz , j = 4.7 hz , 1h ) , 7.097.28 ( m , 4h ) , 7.82 ( bs , 1h ) , 8.20 ( dd , j = 4.6 hz , j = 1.4 hz , 1h ) , 11.54 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 27.8 ( t ) , 28.0 ( q , 3c ) , 37.1 ( t ) , 50.4 ( d ) , 79.1 ( s ) , 115.3 ( d ) , 115.9 ( s ) , 118.2 ( s ) , 125.1 ( d ) , 125.7 ( d ) , 126.7 ( d ) , 127.1 ( d ) , 127.9 ( d ) , 128.9 ( d ) , 134.5 ( s ) , 135.4 ( s ) , 142.7 ( d ) , 148.4 ( s ) , 153.4 ( s ) .
yield for cu 145 mg ( 44% ) and for fe no conversion ; white powder ; mp 8791 c ; tlc rf ( pe / et2o 1/5 ) = 0.28 ; gc / ms ( ei+ ) m / z ( rel intensity ) 286 ( 14 ) , 285 ( 35 ) , 284 ( 41 ) , 283 ( 100 ) , 254 ( 26 ) , 219 ( 11 ) , 191 ( 11 ) , 166 ( 6 ) , 130 ( 14 ) , 103 ( 8) ; hrms ( esi ) exact mass calculated for c20h21n4o2cl 385.1426 ; found 385.1423 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.42 ( s , 9h ) , 2.75 ( d , j = 16.2 hz , 1h ) , 2.943.38 ( m , 2h ) , 4.10 ( bs , 1h ) , 6.81 ( bs , 1h ) , 6.86 ( bs , 1h ) , 7.127.28 ( m , 4h ) , 8.64 ( s , 1h ) , 11.02 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.0 ( t ) , 28.4 ( 3c , q ) , 38.2 ( t ) , 50.6 ( d ) , 80.2 ( s ) , 115.6 ( s ) , 119.0 ( s ) , 126.0 ( d ) , 127.0 ( d ) , 128.1 ( d ) , 129.3 ( d ) , 134.6 ( s ) , 135.8 ( s ) , 150.3 ( d ) , 152.4(s ) , 152.6 ( s ) , 155.0 ( s ) .
3h ( 150 mg , 0.450 mmol ) or 3i ( 50 mg , 0.138 mmol ) was suspended in ethylene glycol ( 3h , 20 ml ; 3i , 10 ml ) and microwaved at 250 c for 30 s ( hold time ) .
the combined organic layers were washed twice with brine , dried over sodium sulfate , filtered , and evaporated .
the crude product was purified by flash column chromatography ( 100 g of sio2 , pe / etoac 100/0 0/100 ( 30 min ) , etoac / etoh 95/5 60/40 ( 30 min ) ) .
in the case of 3i the reaction mixture was diluted with water , chilled with liquid nitrogen , and lyophilized to afford the desired product as a pale brown solid .
tmscl ( 272 mg , 2.50 mmol , 5.0 equiv ) was added dropwise to an argon - degassed solution of the corresponding boc - protected amine ( 0.5 mmol , 1.0 equiv ) in dry meoh ( 4 ml ) at room temperature , and the reaction mixture was stirred for 4 to 24 h under argon . after the reaction mixture was cooled to 0 c , it was poured into ice cold 2 n aqueous naoh .
the suspension was extracted three times with etoac , and the combined organic layers were washed once with 2 n naoh .
the combined organic layers were then dried over sodium sulfate , filtered , and evaporated to afford the desired product in quantitative yields .
thiq ( 200 mg , 1.50 mmol , 1.0 equiv ) , catalyst ( 18.1 mg , 75 mol , 0.05 equiv ) , and the corresponding indole ( 1.80 mmol , 1.2 equiv ) were placed into a 5 ml glass vial in air and stirred for 10 min at 0 c .
tbhp ( 390 l , 5.5 m in decane , 1.3 equiv ) was added dropwise at 0 c in air and the dark greenish slurry was stirred for 1 h at 0 c .
the neat mixture was then slowly heated to 50 c ( within 1 h ) , whereupon the color changed to black and stirring was continued for 15 h in a heating block .
the mixture was diluted with dcm ( 3 ml ) and directly subjected to flash column chromatography , using pe / etoac as eluent to afford the desired product .
method a 95 mg ( 89% ) , method b 124 mg ( 100% ) , method c 179 mg ( 48% ) ; brown solid ; mp 4446 c ; tlc rf ( etoac / etoh 5/1 ) = 0.20 ; gc / ms ( ei+ ) m / z ( rel intensity ) 248 ( m , 38 ) , 247 ( 100 ) , 231 ( 15 ) , 219 ( 22 ) , 218 ( 32 ) , 217 ( 19 ) , 130 ( 20 ) ; hrms ( esi ) exact mass calculated for c17h16n2 249.1398 , found 249.1386 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.02 ( bs , 1h ) , 2.803.37 ( m , 4h ) , 5.51 ( s , 1h ) , 6.88 ( d , j = 1.9 hz , 1h ) , 6.957.23 ( m , 6h ) , 7.33 ( d , j = 8.0 hz , 1h ) , 7.49 ( d , j = 7.8 hz , 1h ) , 8.34 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.4 ( t ) , 41.5 ( t ) , 53.6 ( d ) , 111.3 ( d ) , 118.6 ( s ) , 119.1 ( d ) , 119.3 ( d ) , 121.8 ( d ) , 124.1 ( d ) , 125.6 ( d ) , 126.1 ( d ) , 126.2 ( s ) , 127.8 ( d ) , 128.8 ( d ) , 134.9 ( s ) , 136.5 ( s ) , 138.1 ( s ) . method a 35 mg ( 97% ) , method b 131 mg ( 100% ) , method c 4 mg ( 1% ) ; pale yellow solid ; mp 5558 c ; tlc rf ( etoac / etoh / tea 10/1/1 ) = 0.57 ; gc / ms ( ei+ ) m / z ( rel intensity ) 262 ( m , 60 ) , 261 ( 100 ) , 245 ( 6 ) , 233 ( 14 ) , 232 ( 24 ) , 217 ( 12 ) , 131 ( 22 ) , 130 ( 29 ) , 115 ( 11 ) , 108 ( 14 ) ; h nmr ( 200 mhz , cdcl3 ) 2.52 ( s , 1h ) , 2.833.17 ( m , 3h ) , 3.193.35 ( m , 1h ) , 3.73 ( s , 3h ) , 5.52 ( s , 1h ) , 6.79 ( s , 1h ) , 6.977.36 ( m , 7h ) , 7.51 ( d , j = 7.9 hz , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.7 ( t ) , 32.7 ( q ) , 41.5 ( t ) , 53.6 ( d ) , 109.3 ( d ) , 118.1 ( s ) , 119.1 ( d ) , 119.4 ( d ) , 121.7 ( d ) , 125.6 ( d ) , 126.1 ( d ) , 126.9 ( s ) , 127.9 ( d ) , 128.5 ( d ) , 128.9 ( d ) , 135.2 ( s ) , 137.2 ( s ) , 138.3 ( s ) .
method b 131 mg ( 100% ) , method c 170 mg ( 43% ) ; pale yellow solid ; mp 6870 c ; tlc rf ( etoac / etoh 10/1 ) = 0.14 ; gc / ms ( ei+ ) m / z ( rel intensity ) 262 ( m , 86 ) , 261 ( 100 ) , 247 ( 24 ) , 245 ( 60 ) , 244 ( 37 ) , 233 ( 22 ) , 230 ( 21 ) , 218 ( 38 ) , 217 ( 41 ) , 130 ( 46 ) ; hrms ( esi ) exact mass calculated for c18h18n2 263.1543 , found 263.1548 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.94 ( bs , 1h ) , 2.35 ( s , 3h ) , 2.793.00 ( m , 1h ) , 3.033.46 ( m , 3h ) , 5.43 ( s , 1h ) , 6.797.28 ( m , 8h ) , 7.99 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 11.9 ( q ) , 29.8 ( t ) , 43.3 ( t ) , 53.6 ( d ) , 110.2 ( d ) , 113.6 ( s ) , 118.8 ( d ) , 119.2 ( d ) , 120.8 ( d ) , 125.9 ( d ) , 126.0 ( d ) , 127.3 ( s ) , 127.4 ( d ) , 128.8 ( d ) , 133.3 ( s ) , 134.9 ( s ) , 135.4 ( s ) , 138.5 ( s ) .
method b 137 mg ( 99% ) , method c 202 mg ( 48% ) ; light brown solid ; mp 7476 c ; tlc rf ( etoac / etoh 5/1 ) = 0.11 ; gc / ms ( ei+ ) m / z ( rel intensity ) 278 ( m , 62 ) , 277 ( 100 ) , 261 ( 49 ) , 249 ( 26 ) , 248 ( 26 ) , 234 ( 10 ) , 233 ( 8) , 217 ( 7 ) , 132 ( 9 ) , 130 ( 12 ) ; hrms ( esi+ ) exact mass calculated for c18h18n2o 279.1492 ; found 279.1499 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.98 ( bs , 1h ) , 2.793.36 ( m , 4h ) , 3.76 ( s , 3h ) , 5.47 ( s , 1h ) , 6.796.88 ( m , 2h ) , 6.91 ( d , j = 2.3 hz , 1h ) , 6.957.18 ( m , 4h ) , 7.22 ( d , j = 8.7 hz , 1h ) , 8.18 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 27.8 ( t ) , 40.5 ( t ) , 52.9 ( d ) , 55.6 ( q ) , 100.8 ( d ) , 112.1 ( d ) , 112.2 ( d ) , 115.0 ( s ) , 126.1 ( d ) , 126.2 ( d ) , 126.6 ( s ) , 126.8 ( d ) , 128.1 ( d ) , 128.7 ( d ) , 131.5 ( s ) , 133.6 ( s ) , 135.8 ( s ) , 153.8 ( s ) . method b 146 mg ( 100% ) , method c 233 mg ( 53% ) ; shining dark yellow solid ; mp 8385 c ; tlc rf ( etoac / etoh 5/1 ) = 0.21 ; gc / ms ( ei+ ) m / z ( rel intensity ) 293 ( m , 43 ) , 292 ( 100 ) , 276 ( 12 ) , 263 ( 22 ) , 246 ( 31 ) , 218 ( 14 ) , 217 ( 27 ) , 130 ( 12 ) ; hrms ( esi ) exact mass calculated for c17h15n3o2 294.1237 ; found 294.1239 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.93 ( bs , 1h ) , 2.803.34 ( m , 4h ) , 5.51 ( s , 1h ) , 6.92 ( d , j = 7.6 hz , 1h ) , 6.977.23 ( m , 4h ) , 7.32 ( d , j = 9.0 hz , 1h ) , 8.06 ( dd , j = 9.0 hz , j = 2.1 hz , 1h ) , 8.51 ( d , j = 2.0 hz , 1h ) , 8.91 ( bs , 1h ) ; c nmr ( 50 mhz , cdcl3 ) 29.4 ( t ) , 41.6 ( t ) , 53.5 ( d ) , 111.2 ( d ) , 117.1 ( d ) , 117.7 ( d ) , 121.9 ( s ) , 125.8 ( d ) , 125.9 ( s ) , 126.6 ( d ) , 127.0 ( d ) , 127.5 ( d ) , 129.3 ( d ) , 135.1 ( s ) , 137.2 ( s ) , 139.6 ( s ) , 141.5 ( s ) .
method c 321 mg ( 58% ) ; pale yellow solid ; mp 195197 c ; tlc rf ( etoac / etoh 5/1 ) = 0.17 ; gc / ms ( ei+ ) m / z ( rel intensity ) 306 ( m , 41 ) , 305 ( 100 ) , 289 ( 8) , 276 ( 16 ) , 253 ( 20 ) , 244 ( 8) , 217 ( 14 ) , 191 ( 16 ) , 144 ( 8) , 130 ( 12 ) ; hrms ( esi ) exact mass calculated for c19h18n2o2 307.1441 , found 307.1446 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.77 ( bs , 1h ) , 2.793.33 ( m , 4h ) , 3.90 ( s , 3h ) , 5.55 ( s , 1h ) , 6.987.20 ( m , 5h ) , 7.36 ( d , j = 8.6 hz , 1h ) , 7.90 ( dd , j = 8.6 hz , j = 1.5 hz , 1h ) , 8.37 ( bs , 2h ) ; h nmr ( 200 mhz , dmso - d6 ) 2.573.21 ( m , 5h ) , 3.78 ( s , 3h ) , 5.31 ( s , 1h ) , 6.79 ( d , j = 7.6 hz , 1h ) , 6.97 ( dt , j = 7.3 hz , j = 1.9 hz , 1h ) , 7.037.17 ( m , 2h ) , 7.19 ( d , j = 1.9 hz , 1h ) , 7.42 ( d , j = 8.6 hz , 1h ) , 7.69 ( dd , j = 8.6 , j = 1.4 hz , 1h ) , 8.19 ( d , j = 1.1 hz , 1h ) , 11.30 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 25.8 ( t ) , 40.0 ( t ) , 51.8 ( q ) , 51.9 ( d ) , 111.5 ( d ) , 113.0 ( s ) , 121.6 ( d ) , 121.6 ( s ) , 123.2 ( d ) , 125.8 ( s ) , 126.8 ( d ) , 127.8 ( d ) , 128.0 ( d ) , 128.1 ( d ) , 128.7 ( d ) , 132.1 ( s ) , 132.9 ( s ) , 138.9 ( s ) , 168.1 ( s ) .
method b 141 mg ( 100% , reaction time 7 h ) ; pale yellow solid ; mp 148151 c ; tlc rf ( etoac / et3n 11/1 ) = 0.29 ; gc / ms ( ei+ ) m / z ( rel intensity ) 284 ( 19 ) , 283 ( 38 ) , 282 ( m , 57 ) , 281 ( 100 ) , 254 ( 12 ) , 253 ( 19 ) , 252 ( 27 ) , 217 ( 30 ) , 131 ( 14 ) , 130 ( 26 ) , 109 ( 17 ) ; hrms ( esi ) : exact mass calculated for c17h15n2cl 283.0997 , found 283.0998 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.93 ( bs , 1h ) , 2.793.34 ( m , 4h ) , 5.43 ( s , 1h ) , 6.91 ( s , 1h ) , 6.94 ( d , j = 8.0 hz , 1h ) , 6.997.19 ( m , 4h ) , 7.23 ( d , j = 8.7 hz , 1h ) , 7.46 ( d , j = 1.8 hz , 1h ) , 8.36 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.4 ( t ) , 41.7 ( t ) , 53.6 ( d ) , 112.3 ( d ) , 118.7 ( s ) , 118.8 ( d ) , 122.3 ( d ) , 125.1 ( s ) , 125.4 ( d ) , 125.7 ( d ) , 126.4 ( d ) , 127.3 ( s ) , 127.6 ( d ) , 129.0 ( d ) , 134.9 ( s ) , 134.9 ( s ) , 137.7 ( s ) .
method b 122 mg ( 86% , reaction time 4 h ) , method c 197 mg ( 46% ) ; off white powder ; mp 146148 c ; tlc rf ( etoac / etoh 5/1 ) = 0.15 ; gc / ms ( ei+ ) m / z ( rel intensity ) 284 ( 18 ) , 283 ( 38 ) , 282 ( m , 56 ) , 281 ( 100 ) , 265 ( 10 ) , 253 ( 22 ) , 252 ( 28 ) , 217 ( 29 ) , 132 ( 19 ) , 131 ( 19 ) , 130 ( 35 ) , 123 ( 13 ) , 109 ( 29 ) ; hrms ( esi ) exact mass calculated for c17h15n2cl 283.0997 , found 283.1000 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.23 ( s , 1h ) , 2.793.37 ( m , 4h ) , 5.44 ( s , 1h ) , 6.87 ( s , 1h ) , 6.93 ( d , j = 7.6 hz , 1h ) , 6.967.09 ( m , 2h ) , 7.137.21 ( m , 2h ) , 7.25 ( d , j = 1.7 hz , 1h ) , 7.32 ( d , j = 8.5 hz , 1h ) , 8.61 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 20.3 ( t ) , 32.8 ( t ) , 45.1 ( d ) , 102.6 ( d ) , 109.7 ( s ) , 110.8 ( d ) , 111.7 ( d ) , 116.6 ( s ) , 117.1 ( d ) , 117.2 ( d ) , 117.9 ( d ) , 118.8 ( s ) , 119.4 ( d ) , 120.3 ( d ) , 126.4 ( s ) , 129.1 ( s ) , 129.5 ( s ) .
method b 145 mg ( 99% , reaction time 6 h ) , method c : 7 mg ( 2% ) ; shining dark yellow solid ; mp 5861 c ; tlc rf ( etoac / meoh 11/1 ) = 0.35 ; gc / ms ( ei+ ) m / z ( rel intensity ) 293 ( m , 57 ) , 292 ( 100 ) , 264 ( 15 ) , 263 ( 23 ) , 246 ( 18 ) , 217 ( 26 ) , 189 ( 10 ) , 132 ( 10 ) , 131 ( 8) , 130 ( 14 ) , 109 ( 11 ) ; h nmr ( 200 mhz , cdcl3 ) 1.87 ( bs , 1h ) , 2.793.36 ( m , 4h ) , 5.48 ( s , 1h ) , 6.90 ( d , j = 7.5 hz , 1h ) , 6.967.22 ( m , 5h ) , 7.84 ( d , j = 7.7 hz , 1h ) , 8.13 ( d , j = 8.1 hz , 1h ) , 9.86 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.6 ( t ) , 42.0 ( t ) , 53.8 ( d ) , 119.0 ( d ) , 119.3 ( d ) , 121.1 ( s ) , 125.7 ( d ) , 126.1 ( d ) , 126.5 ( d ) , 127.5 ( d ) , 128.4 ( d ) , 129.1 ( d ) , 130.0 ( s ) , 130.2 ( s ) , 132.9 ( s ) , 135.1 ( s ) , 137.6 ( s ) .
method b 124 mg ( 100% ) , method c 160 mg ( 43% ) ; light brown solid ; mp 172174 c ; tlc rf ( etoac / etoh 5/1 ) = 0.11 ; gc / ms ( ei+ ) m / z ( rel intensity ) 249 ( m , 36 ) , 248 ( 100 ) , 232 ( 7 ) , 220 ( 18 ) , 219 ( 30 ) , 218 ( 11 ) , 131 ( 8) , 130 ( 10 ) , 119 ( 12 ) ; hrms ( esi ) exact mass calculated for c16h15n3 250.1339 ; found 250.1352 [ m + h ] ; h nmr ( 200 mhz dmso - d6 ) 2.633.24 ( m , 4h ) , 3.70 ( s , 1h ) , 5.30 ( s , 1h ) , 6.80 ( d , j = 7.6 hz , 1h ) , 6.857.02 ( m , 2h ) , 7.037.18 ( m , 2h ) , 7.27 ( d , j = 1.3 hz , 1h ) , 7.66 ( dd , j = 7.8 hz , j = 1.3 hz , 1h ) , 8.15 ( d , j = 3.6 hz , 1h ) , 11.48 ( s , 1h ) ; c nmr ( 50 mhz , apt , dmso - d6 ) 29.0 ( t ) , 41.7 ( t ) , 53.9 ( d ) , 114.8 ( d ) , 116.8 ( s ) , 118.4 ( s ) , 124.8 ( d ) , 125.2 ( d ) , 125.8 ( d ) , 127.0 ( d ) , 128.0 ( d ) , 128.7 ( d ) , 135.0 ( s ) , 138.5 ( s ) , 142.3 ( d ) , 148.9 ( s ) .
method c 189 mg ( 48% ) ; pale brown solid ; mp 141144 c ; tlc rf ( etoac / etoh 5/1 ) = 0.12 ; gc / ms ( ei+ ) m / z ( rel intensity ) 262 ( m , 56 ) , 261 ( 100 ) , 245 ( 11 ) , 233 ( 14 ) , 232 ( 21 ) , 217 ( 12 ) , 132 ( 9 ) , 131 ( 12 ) , 130 ( 20 ) , 115 ( 10 ) ; h nmr ( 200 mhz , cdcl3 ) 2.08 ( bs , 1h ) , 2.48 ( s , 3h ) , 2.813.37 ( m , 4h ) , 5.51 ( s , 1h ) , 6.87 ( d , j = 2.3 hz , 1h ) , 6.947.22 ( m , 6h ) , 7.307.41 ( m , 1h ) , 8.26 ( bs , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 16.6 ( q ) , 29.6 ( t ) , 41.7 ( t ) , 53.9 ( d ) , 117.0 ( d ) , 119.8 ( d ) , 120.5 ( s ) , 122.6 ( d ) , 123.7 ( d ) , 125.6 ( d ) , 125.9 ( s ) , 126.1 ( d ) , 127.9 ( d ) , 128.9 ( d ) , 135.0 ( s ) , 136.1 ( s ) , 138.2 ( s ) .
thiq ( 999 mg , 7.50 mmol , 2.0 equiv ) , catalyst ( 45.3 mg , 0.188 mmol , 0.05 equiv ) , and the corresponding pyrrole ( 3.75 mmol , 1.0 equiv ) were placed in a 5 ml glass vial in air and cooled to 0 c and stirred for 10 min .
tbhp ( 975 l , 5.5 m in decane , 1.3 equiv ) was added dropwise at 0 c in air and the dark greenish slurry stirred for 1 h at 0 c .
the neat mixture was then slowly heated to 50 c ( within 1 h ) , upon which the mixture turned black , and stirred for 15 h in a heating block .
the mixture was diluted with dcm ( 3 ml ) and directly subjected to flash chromatography , using etoac / etoh as eluent .
due to polar unidentified impurities , the desired product was further purified by preparative hplc .
327 mg ( 44% ) ; white solid ; mp 117118 c ; tlc rf ( etoac / etoh 5/1 ) = 0.11 ; gc / ms ( ei+ ) m / z ( rel intensity ) 198 ( m , 50 ) , 197 ( 100 ) , 182 ( 99 ) , 169 ( 36 ) , 168 ( 95 ) , 167 ( 40 ) , 132 ( 46 ) , 131 ( 28 ) , 130 ( 60 ) , 115 ( 21 ) , 103 ( 21 ) , 77 ( 22 ) ; hrms ( esi ) exact mass calculated for c13h14n2 199.1230 , found 199.1223 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.07 ( s , 1h ) , 2.76 ( dt , j = 16.4 hz , j = 5.3 hz , 1h ) , 2.843.26 ( m , 3h ) , 5.14 ( s , 1h ) , 6.06 ( dd , j = 3.3 hz , j = 2.5 hz , 1h ) , 6.14 ( dd , j = 5.7 hz , j = 2.8 hz , 1h ) , 6.68 ( dd , j = 4.1 hz , j = 2.5 hz , 1h ) , 6.957.04 ( m , 1h ) , 7.057.23 ( m , 3h ) , 9.11 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.2 ( t ) , 41.9 ( t ) , 55.1 ( d ) , 107.4 ( d ) , 107.9 ( d ) , 117.6 ( d ) , 125.6 ( d ) , 126.5 ( d ) , 127.6 ( d ) , 129.1 ( d ) , 133.7 ( s ) , 134.8 ( s ) , 137.0 ( s ) .
230 mg ( 27% ) ; off - white crystals ; mp 127129 c ; tlc rf ( etoac / etoh / tea 10/1/1 ) = 0.53 ; gc / ms ( ei+ ) m / z ( rel intensity ) 226 ( m , 100 ) , 225 ( 96 ) , 209 ( 79 ) , 208 ( 56 ) , 196 ( 38 ) , 194 ( 32 ) , 182 ( 39 ) , 167 ( 28 ) , 132 ( 24 ) , 130 ( 36 ) , 94 ( 78 ) , 91 ( 28 ) ; hrms ( esi ) exact mass calculated for c15h18n2 227.1543 ; found 227.1544 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.84 ( s , 1h ) , 2.13 ( s , 3h ) , 2.15 ( s , 3h ) , 2.713.15 ( m , 3h ) , 3.32 ( dt , j = 15.9 hz , j = 7.0 hz , 1h ) , 5.01 ( s , 1h ) , 5.51 ( d , j = 2.3 hz , 1h ) , 6.90 ( d , j = 6.9 hz , 1h ) , 6.987.13 ( m , 3h ) , 7.74 ( s , 1h ) ; c nmr ( 50 mhz , cdcl3 ) 11.1 ( q ) , 12.9 ( q ) , 29.9 ( t ) , 42.6 ( t ) , 54.1 ( d ) , 105.9 ( d ) , 122.5 ( s ) , 123.2 ( s ) , 125.1 ( s ) , 125.5 ( d ) , 125.6 ( d ) , 127.7 ( d ) , 128.7 ( d ) , 135.0 ( s ) , 139.8 ( s ) .
387 mg ( 41% ) ; pale yellow solid ; mp 115117 c ; tlc rf ( etoac / etoh 5/1 ) = 0.14 ; gc / ms ( ei+ ) m / z ( rel intensity ) 252 ( m , 46 ) , 251 ( 52 ) , 236 ( 56 ) , 223 ( 44 ) , 222 ( 39 ) , 194 ( 31 ) , 180 ( 39 ) , 132 ( 43 ) , 131 ( 65 ) , 130 ( 100 ) , 105 ( 32 ) , 103 ( 31 ) , 93 ( 72 ) , 77 ( 31 ) ; hrms ( esi ) exact mass calculated for c17h20n2 253.1699 , found 253.1692 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.681.88 ( m , 4h ) , 2.21 ( s , 1h ) , 2.442.55 ( m , 4h ) , 2.683.30 ( m , 4h ) , 5.10 ( s , 1h ) , 5.76 ( d , j = 2.3 hz , 1h ) , 7.037.21 ( m , 4h ) , 8.27 ( s , 1h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 22.7 ( t ) , 22.8 ( t ) , 23.4 ( t ) , 23.8 ( t ) , 29.3 ( t ) , 41.6 ( t ) , 55.1 ( d ) , 107.1 ( d ) , 116.1 ( s ) , 125.5 ( d ) , 126.4 ( d ) , 126.8 ( s ) , 127.8 ( d ) , 129.0 ( d ) , 131.8 ( s ) , 134.9 ( s ) , 137.1 ( s ) .
55 mg ( 11% ) ; yellow oil ; tlc rf ( pe / etoac 5/1 ) = 0.53 ; gc / ms ( ei+ ) m / z ( rel intensity ) 298 ( m , 8) , 242 ( 49 ) , 198 ( 30 ) , 197 ( 100 ) , 182 ( 42 ) , 168 ( 26 ) , 167 ( 15 ) , 132 ( 10 ) , 130 ( 18 ) , 57 ( 20 ) ; h nmr ( 200 mhz , cdcl3 ) 1.51 ( s , 9h ) , 2.703.03 ( m , 2h ) , 3.26 ( bs , 1h ) , 3.98 ( bs , 1h ) , 5.58 ( bs , 1h ) , 6.02 ( dd , j = 5.0 hz , j = 2.5 hz , 1h ) , 6.30 ( bs , 1h ) , 6.73 ( dd , j = 4.1 hz , j = 2.5 hz , 1h ) , 7.147.23 ( m , 4h ) , 9.14 ( s , 1h ) ; c nmr ( 101 mhz , cdcl3 ) 28.6 ( q , 3c ) , 28.7 ( t ) , 39.1 ( t ) , 51.6 ( d ) , 80.2 ( s ) , 107.1 ( d ) , 107.7 ( d ) , 117.7 ( d ) , 125.9 ( d ) , 127.0 ( d ) , 128.5 ( d ) , 128.6 ( d ) , 134.1 ( s ) , 134.3 ( s ) , 135.2 ( s ) , 156.2 ( s ) .
2-protected 1,2,3,4-tetrahydroisoquinoline ( pg = boc , 200 mg ; pg = bz , 203 mg ; pg = cbz ; 229 mg ; 0.857 mmol , 1.0 equiv ) , catalyst ( cu(no3)23h2o , 10.4 mg ; fe(no3)39h2o , 17.3 mg ; 42.9 mol , 0.05 equiv ) , and the methoxybenzene derivative ( 1.03 mmol , 1.2 equiv ) were placed into a 5 ml glass vial .
tbhp ( 203 l , 5.5 m in decane , 1.3 equiv ) was added dropwise at 0 c in air and the reaction mixture stirred for 10 min at 0 c .
the neat mixture was then slowly heated to 50 c and stirred for 15 h in a heating block .
the reaction mixture was diluted with dcm ( 3 ml ) and directly subjected to flash column chromatography .
the desired product was obtained after mplc , where the solvent mixture used for tlc was also used for column chromatography ( 100 g of sio2 ) . if necessary , the product was finally purified by preparative hplc . yield for cu 260 mg ( 76% ) and for fe 278 mg ( 81% ) ; white solid ; mp 109111 c ; tlc rf ( pe / et2o 1/1 ) = 0.10 ; gc / ms ( ei+ ) m / z ( rel intensity ) 348 ( 24 ) , 299 ( 60 ) , 298 ( 100 ) , 282 ( 26 ) , 268 ( 90 ) , 239 ( 14 ) , 180 ( 18 ) , 179 ( 20 ) , 151 ( 16 ) , 132 ( 9 ) ; hrms ( esi ) : exact mass calculated for c23h29no5 400.2118 , found 400.2122 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.28 ( s , 9h ) , 2.733.01 ( m , 2h ) , 3.49 ( ddd , j = 12.6 hz , j = 10.6 hz , j = 4.5 hz , 1h ) , 3.69 ( s , 6h ) , 3.81 ( s , 3h ) , 4.304.45 ( m , 1h ) , 6.12 ( s , 2h ) , 6.45 ( s , 1h ) , 6.80 ( d , j = 7.2 hz , 1h ) , 6.957.16 ( m , 3h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.3 ( 3c , q ) , 30.5 ( t ) , 39.4 ( t ) , 49.4 ( d ) , 55.2 ( q ) , 55.5 ( 2c , q ) , 79.1 ( s ) , 90.5 ( 2c , d ) , 114.0 ( s ) , 125.4 ( d ) , 125.8 ( d ) , 126.3 ( d ) , 127.9 ( d ) , 135.2 ( s ) , 137.2 ( s ) , 155.4 ( s ) , 158.8 ( 2c , s ) , 160.1 ( s ) .
yield for cu 159 mg ( 46% ) and for fe 187 mg ( 54% ) ; white solid ; mp 6769 c ; tlc rf ( pe / et2o 1/1 ) = 0.09 ; gc / ms ( ei+ ) m / z ( rel intensity ) 403 ( m , 7 ) , 373 ( 26 ) , 372 ( 100 ) , 299 ( 4 ) , 298 ( 13 ) , 282 ( 6 ) , 105 ( 10 ) , 77 ( 9 ) ; hrms ( esi ) exact mass calculated for c25h25no4 404.1856 , found 404.1852 [ m + h ] ; h nmr ( 400 mhz , dmso - d6 , 80 c ) 2.86 ( bs , 1h ) , 3.61 ( s , 6h ) , 3.633.74 ( m , 1h ) , 3.78 ( s , 3h ) , 4.07 ( bs , 1h ) , 6.21 ( s , 2h ) , 6.64 ( bs , 1h ) , 6.72 ( d , j = 7.5 hz , 1h ) , 7.04 ( t , j = 7.4 hz , 1h ) , 7.10 ( t , j = 7.2 hz , 1h ) , 7.137.26 ( m , 3h ) , 7.317.44 ( m , 3h ) ; c nmr ( 101 mhz , dmso - d6 , 80 c ) 29.5 ( t ) , 49.2 ( s ) , 54.8 ( q ) , 55.4 ( q , 2c ) , 91.4 ( d , 2c ) , 112.4 ( s ) , 125.1 ( d ) , 125.4 ( d , 2c ) , 126.0 ( d , 2c ) , 127.4 ( d ) , 127.5 ( d , 2c overlapping ) , 128.3 ( d ) , 134.3 ( s ) , 136.5 ( s ) , 137.3 ( s ) , 158.4 ( s ) , 159.9 ( s , 2c ) , 169.2 ( s ) . yield for cu 190 mg ( 51% ) and for fe 215 mg ( 58% ) ; pale yellow solid ; mp 115116 c ; tlc rf ( pe / et2o 1/1 ) = 0.32 ; gc / ms ( ei+ ) m / z ( rel intensity ) 433 ( m , 1 ) , 342 ( 3 ) , 299 ( 20 ) , 298 ( 100 ) , 283 ( 5 ) , 282 ( 17 ) , 90 ( 6 ) ; hrms ( esi ) exact mass calculated for c26h27no5 434.1962 , found 434.1966 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.753.06 ( m , 2h ) , 3.293.79 ( m , 7h ) , 3.83 ( s , 3h ) , 4.46 ( d , j = 11.0 hz , 1h ) , 5.03 ( d , j = 16.7 hz , 1h ) , 5.09 ( d , j = 17.4 hz , 1h ) , 6.08 ( s , 2h ) , 6.56 ( s , 1h ) , 6.79 ( d , j = 7.3 hz , 1h ) , 6.967.41 ( m , 8h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 30.4 ( t ) , 39.9 ( t ) , 49.3 ( d ) , 55.2 ( q ) , 55.4 ( q , 2c ) , 66.8 ( t ) , 90.8 ( d , 2c ) , 113.3 ( s ) , 125.5 ( d ) , 125.9 ( d ) , 126.2 ( d ) , 127.5 ( d ) , 127.8 ( d ) , 127.9 ( d , 2c ) , 128.2 ( d , 2c ) , 134.7 ( s ) , 136.0 ( s ) , 137.0 ( s ) , 155.6 ( s ) , 158.9 ( s ) , 160.2 ( s , 2c ) . yield for cu 80 mg ( 23% ) and for fe 160 mg ( 47% ) ; white solid ; mp 8486 c ; tlc rf ( pe / et2o 3/1 ) = 0.13 ; hrms ( esi ) exact mass calculated for c23h29no5 400.2118 , found 400.2123 [ m + h ] ; gc / ms ( ei+ )
m / z ( rel intensity ) 399 ( m , 4 ) , 343 ( 5 ) , 299 ( 58 ) , 298 ( 100 ) , 284 ( 24 ) , 268 ( 73 ) , 253 ( 12 ) , 239 ( 12 ) , 168 ( 8) , 132 ( 15 ) ; h nmr ( 200 mhz , cdcl3 ) 1.40 ( s , 9h ) , 2.753.07 ( m , 2h ) , 3.353.55 ( m , 1h ) , 3.69 ( s , 3h ) , 3.77 ( s , 3h ) , 3.87 ( s , 3h ) , 4.034.24 ( m , 1h ) , 6.53 ( s , 1h ) , 6.42 ( s , 1h ) , 6.56 ( s , 1h ) , 7.017.17 ( m , 4h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.3 ( 3c , q ) , 29.0 ( t ) , 39.1 ( t ) , 53.0 ( q ) , 56.0 ( q ) , 56.1 ( d ) , 56.7 ( q ) , 79.4 ( s ) , 97.5 ( d ) , 113.8 ( d ) , 124.2 ( s ) , 125.9 ( d ) , 126.2 ( d ) , 127.8 ( d ) , 128.4 ( d ) , 134.8 ( s ) , 136.7 ( s ) , 142.4 ( s ) , 148.8 ( s ) , 151.5 .
yield for cu 170 mg ( 46% ) and for fe 190 mg ( 52% ) ; pale yellow solid ; mp 116118 c ; tlc rf ( pe / et2o 2/1 ) = 0.17 ; gc / ms ( ei+ ) m / z ( rel intensity ) 429 ( m , 8) , 329 ( 27 ) , 328 ( 100 ) , 299 ( 10 ) , 298 ( 49 ) , 183 ( 10 ) , 132 ( 20 ) , 130 ( 10 ) , 57 ( 12 ) ; hrms ( esi ) : exact mass calculated for c24h31no6 430.2224 , found 430.2230 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 1.33 ( s , 9h ) , 2.743.03 ( m , 2h ) , 3.403.61 ( m , 4h ) , 3.75 ( s , 3h ) , 3.75 ( s , 3h ) , 3.88 ( s , 3h ) , 4.36 ( d , j = 12.3 hz , 1h ) , 6.29 ( s , 1h ) , 6.48 ( s , 1h ) , 6.80 ( d , j = 6.9 hz , 1h ) , 6.967.16 ( m , 3h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.3 ( q , 3c ) , 30.2 ( t ) , 39.4 ( t ) , 49.8 ( d ) , 55.7 ( q ) , 55.9 ( q ) , 59.8 ( q ) , 60.7 ( q ) , 79.2 ( s ) , 91.7 ( d ) , 118.9 ( s ) , 125.6 ( d ) , 125.7 ( d ) , 126.5 ( d ) , 128.1 ( d ) , 135.1 ( s ) , 136.5 ( s ) , 137.3 ( s ) , 152.6 ( s ) , 152.7 ( s ) , 153.6 ( s ) , 155.1 ( s ) . yield for cu 131 mg ( 41% ) and for fe 108 mg ( 34% ) ; white solid ; mp 3637 c ; tlc rf ( pe / et2o 1/1 ) = 0.33 ; hrms ( esi ) exact mass calculated for c22h27no4 370.2013 , found 370.2010 [ m + h ] ; gc / ms ( ei+ ) m / z ( rel intensity ) 269 ( 46 ) , 268 ( 100 ) , 252 ( 22 ) , 239 ( 12 ) , 238 ( 32 ) , 132 ( 15 ) , 130 ( 10 ) ; h nmr ( 200 mhz , cdcl3 ) 1.42 ( s , 9h ) , 2.81 ( dt , j = 16.0 hz , j = 3.9 hz , 1h ) , 2.99 ( ddd , j = 15.9 hz , j = 10.3 hz , j = 5.6 hz , 1h ) , 3.293.48 ( m , 1h ) , 3.78 ( s , 3h ) , 3.82 ( s , 3h ) , 3.994.22 ( m , 1h ) , 6.34 ( dd , j = 8.4 hz , j = 2.4 hz , 1h ) , 6.47 ( s , 1h ) , 6.48 ( s , 1h ) , 6.83 ( d , j = 8.3 hz , 1h ) , 7.007.18 ( m , 4h ) ; c nmr ( 101 mhz , cdcl3 ) 28.3 ( q , 3c ) , 28.8 ( t ) , 38.6 ( t ) , 52.6 ( d ) , 55.15 ( q ) , 55.19 ( q ) , 79.3 ( s ) , 98.4 ( d ) , 103.4 ( d ) , 125.1 ( s ) , 125.9 ( d ) , 126.2 ( d ) , 127.9 ( d ) , 128.5 ( d ) , 130.0 ( d ) , 135.0 ( s ) , 136.8 ( s ) , 154.7 ( s ) , 158.0 ( s ) , 159.9 ( s ) .
isochroman 9 ( 200 mg , 1.49 mmol , 1.0 equiv ) , catalyst ( cu(no3)23h2o , 18.0 mg ; fe(no3)39h2o , 30.1 mg ; 74.5 mol , 0.05 equiv ) , and the corresponding methoxybenzene ( 1.79 mmol , 1.2 equiv ) were placed into a 5 ml glass vial .
tbhp ( 352 l , 5.5 m in decane , 1.3 equiv ) was added dropwise at 0 c in air and the reaction mixture stirred for 10 min at 0 c .
the neat mixture was then slowly heated to 50 c and stirred for 15 h in a heating block .
finally , the reaction temperature was raised to 80 c , and the reaction mixture was stirred for another 24 h. the reaction was monitored by tlc and/or gc - ms .
the reaction mixture was diluted with dcm ( 3 ml ) and directly subjected to flash column chromatography .
the desired product was obtained after mplc , where the solvent mixture used for tlc was also used for column chromatography ( 100 g of sio2 ) . if necessary , the product was finally purified by preparative hplc . yield for cu 230 mg ( 51% ) and for fe 246 mg ( 55% ) ; white solid ; mp 118120 c ; tlc rf ( pe / et2o 1/1 ) = 0.32 ; gc / ms ( ei+ ) m / z ( rel intensity ) 300 ( m , 50 ) , 282 ( 22 ) , 272 ( 50 ) , 269 ( 100 ) , 251 ( 26 ) , 241 ( 98 ) , 239 ( 48 ) , 208 ( 23 ) , 195 ( 27 ) , 181 ( 35 ) , 168 ( 22 ) , 139 ( 28 ) ; hrms ( esi ) exact mass calculated for c18h20o4 301.1434 ; found 301.1442 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.66 ( d , j = 15.9 hz , 1h ) , 3.093.35 ( m , 1h ) , 3.61 ( s , 6h ) , 3.80 ( s , 3h ) , 3.93 ( dt , j = 11.2 hz , j = 3.1 hz , 1h ) , 4.30 ( ddd , j = 11.1 hz , j = 5.6 hz , j = 1.9 hz , 1h ) , 6.12 ( s , 2h ) , 6.30 ( s , 1h ) , 6.67 ( d , j = 7.6 hz , 1h ) , 6.927.12 ( m , 3h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 29.0 ( t ) , 55.2 ( q ) , 55.9 ( 2c , q ) , 65.3 ( t ) , 70.2 ( d ) , 91.4 ( 2c , d ) , 111.7 ( s ) , 124.2 ( d ) , 125.1 ( d ) , 125.5 ( d ) , 127.8 ( d ) , 133.8 ( s ) , 139.7 ( s ) , 159.9 ( 2c , s ) , 161.2 ( s ) .
yield for cu 190 mg ( 39% ) and for fe 85 mg ( 17% ) ; white solid ; mp 5558 c ; tlc rf ( pe / etoac 5/1 ) = 0.19 ; gc / ms ( ei+ ) m / z ( rel intensity ) 330 ( m , 100 ) , 315 ( 23 ) , 312 ( 14 ) , 299 ( 99 ) , 284 ( 10 ) , 271 ( 18 ) , 238 ( 16 ) , 198 ( 24 ) , 195 ( 16 ) , 183 ( 23 ) ; hrms ( esi ) exact mass calculated for c19h22o5 331.1540 , found 331.1544 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.69 ( d , j = 16.0 hz , 1h ) , 3.46 ( s , 3h ) , 3.143.35 ( m , 1h ) , 3.69 ( s , 3h ) , 3.78 ( s , 3h ) , 3.88 ( s , 3h ) , 3.914.02 ( m , 1h ) , 4.32 ( ddd , j = 11.1 hz , j = 5.6 hz , j = 1.7 hz , 1h ) , 6.25 ( s , 1h ) , 6.30 ( s , 1h ) , 6.69 ( d , j = 7.3 hz , 1h ) , 6.967.17 ( m , 3h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.9 ( t ) , 55.9 ( q ) , 56.3 ( q ) , 60.5 ( q ) , 60.8 ( q ) , 65.3 ( t ) , 70.8 ( d ) , 92.7 ( d ) , 116.8 ( s ) , 124.5 ( d ) , 125.4 ( d ) , 125.6 ( d ) , 128.1 ( d ) , 133.8 ( s ) , 136.7 ( s ) , 139.6 ( s ) , 153.5 ( s ) , 153.8 ( s ) , 154.5 ( s ) . yield for cu 92 mg ( 23% ) and for fe 48 mg ( 12% ) ; colorless oil ; tlc rf ( pe / et2o 1/1 ) = 0.28 ; gc / ms ( ei+ ) m / z ( rel intensity ) 270 ( m , 65 ) , 255 ( 100 ) , 239 ( 43 ) , 225 ( 16 ) , 209 ( 16 ) , 194 ( 13 ) , 178 ( 8) , 165 ( 24 ) , 104 ( 10 ) , 77 ( 8) ; hrms ( esi ) exact mass calculated for c17h18o3 271.1329 ; found 271.1324 [ m + h ] ; h nmr ( 200 mhz , cdcl3 ) 2.84 ( dt , j = 16.3 hz , j = 4.4 hz , 1h ) , 3.013.22 ( m , 1h ) , 3.81 ( s , 3h ) , 3.88 ( s , 3h ) , 3.904.03 ( m , 1h ) , 4.18 ( dt , j = 11.0 hz , j = 5.0 hz , 1h ) , 6.22 ( s , 1h ) , 6.43 ( dd , j = 8.4 hz , j = 2.4 hz , 1h ) , 6.55 ( d , j = 2.4 hz , 1h ) , 6.80 ( d , j = 7.4 hz , 1h ) , 6.96 ( d , j = 8.4 hz , 1h ) , 7.037.21 ( m , 3h ) ; c nmr ( 50 mhz , apt , cdcl3 ) 28.8 ( t ) , 55.3 ( q ) , 55.6 ( q ) , 63.3 ( t ) , 72.2 ( d ) , 98.4 ( d ) , 104.2 ( d ) , 123.3 ( s ) , 125.8 ( d ) , 126.2 ( d ) , 126.6 ( d ) , 128.5 ( d ) , 130.7 ( d ) , 134.2 ( s ) , 137.9 ( s ) , 158.6 ( s ) , 160.5 ( s ) yield for cu 145 mg ( 32% ) and for fe 67 mg ( 15% ) ; white solid ; mp 4648 c ; tlc rf ( pe / etoac 5/1 ) = 0.39 ; gc / ms ( ei+ ) m / z ( rel intensity ) 300 ( m , 100 ) , 285 ( 35 ) , 269 ( 39 ) , 257 ( 9 ) , 239 ( 26 ) , 225 ( 9 ) , 208 ( 12 ) , 195 ( 14 ) , 168 ( 25 ) , 153 ( 13 ) ; hrms ( esi ) exact mass calculated for c18h20o4 301.1434 , found 301.1436 [ m + h ] ; h nmr ( 400 mhz , cdcl3 ) 2.80 ( dt , j = 16.2 hz , j = 3.2 hz , 1h ) , 3.21 ( ddd , j = 16.0 hz , j = 10.0 hz , j = 5.8 hz , 1h ) , 3.73 ( s , 3h ) , 3.89 ( s , 3h ) , 3.93 ( s , 3h ) , 3.99 ( dt , j = 11.1 hz , j = 3.8 hz , 1h ) , 4.27 ( ddd , j = 11.2 hz , j = 5.6 hz , j = 3.1 hz , 1h ) , 6.20 ( s , 1h ) , 6.61 ( s , 1h ) , 6.66 ( s , 1h ) , 6.78 ( d , j = 7.6 hz , 1h ) , 7.057.12 ( m , 1h ) , 7.147.21 ( m , 2h ) ; c nmr ( 101 mhz , apt , cdcl3 ) 28.8 ( t ) , 56.0 ( q ) , 56.4 ( q ) , 56.8 ( q ) , 64.4 ( t ) , 72.6 ( d ) , 97.4 ( d ) , 113.0 ( d ) , 122.2 ( s ) , 125.8 ( d ) , 126.2 ( d ) , 126.5 ( d ) , 128.5 ( d ) , 133.9 ( s ) , 138.0 ( s ) , 143.2 ( s ) , 149.4 ( s ) , 151.9 ( s ) . | a highly facile , straightforward synthesis of 1-(3-indolyl)-tetrahydroisoquinolines was developed using either simple copper or iron catalysts .
n - protected and unprotected tetrahydroisoquinolines ( thiq ) could be used as starting materials .
extension of the substrate scope of the pronucleophile from indoles to pyrroles and electron - rich arenes was realized .
additionally , methoxyphenylation is not limited to thiq but can be carried out on isochroman as well , again employing iron and copper catalysis . |
asthma is a chronic inflammatory disease of the airways affecting over 300 million people worldwide , and its prevalence is rising , especially in children and within developing countries .
new studies indicated that in allergic disorders , including asthma , innate immunity is deregulated by allergens that promote sensitization .
however , the underlying immunological processes are still not fully understood as asthma is a complex multifactorial disease in which both innate and adaptive immune responses are involved .
in addition , asthma is considered as a complex syndrome with different clinical phenotypes in children and adults .
eosinophils and neutrophils play a key role in the cellular airway inflammation [ 4 , 5 ] .
mild asthma is characterized by chronic inflammation of the airways that is mostly eosinophilic in nature and allergic sensitization .
the resulting airway inflammation is thought to be caused by a breakdown of immune tolerance toward environmental antigens and leads to a t helper type 2(th2)-biased immune response . on the contrary ,
neutrophil accumulation in the bronchial mucosa is an important feature of severe asthma and frequently includes a t helper type 1(th1 ) component as well as a th2 immune response [ 4 , 6 ] .
this heterogeneity highlights the importance of more specific treatment approaches based on asthma phenotypes .
pattern recognition receptors ( prrs ) , like the toll - like ( tlrs ) and nod - like ( nlrs ) families of receptors , are key components of the innate immune system .
these prrs exhibit different cell and stimulus - specific patterns of expression . in the human airways ,
tlrs are expressed in and on dendritic cells ( dcs ) , epithelial cells , eosinophils , macrophages , and mast cells .
nod1 and nod2 are intracellular pattern recognition molecules ( prms ) expressed in various human epithelial cells including lung cells .
multiple dc functions are controlled by prrs and , ultimately , modulate the resulting adaptive immune response [ 8 , 10 ] .
upon prr activation in the lung , various chemokines and cytokines are produced by mast cells and eosinophils that recruit activated b - lymphocytes and th lymphocytes to the lung , starting the inflammation process in the airways .
mast cells express the high - affinity receptors ( fcri ) for immunoglobulin e ( ige ) on their surface , and animal studies have demonstrated that mast cells play an important role in the induction of allergic airway inflammation .
in addition , asthmatic patients have been shown to have an increased number of lung mast cells and allergen - specific ige , a phenomenon of allergic asthma shared with mouse models for this disease . in order to reproduce more of the clinical features of severe asthmatic patients ,
there has been a focus on using ige immune complexes as inducers of immune responses in the murine lung .
trinitrophenyl-(tnp- ) ovalbumin-(ova- ) ige immune complexes have been shown to be more potent inducers of immune responses than antigens alone , since challenge of sensitized mice with these complexes resulted in an increased migration of mast cell progenitors to the lung [ 12 , 13 ] .
the expression and function of prrs have been linked to susceptibility towards allergic asthma [ 2 , 14 ] .
functional genetic variations in tlr1 , tlr6 , and tlr10 genes affecting gene and protein expression have been shown to be associated with increased mrna expression of these tlrs and to protect against atopic asthma in humans .
single nucleotide polymorphisms ( snps ) in the tlr2 gene that led to decreased mrna expression were positively associated with asthma susceptibility .
cord blood cd34 ( + ) cells from high - atopic - risk infants exhibited low tlr2 , tlr4 , and tlr9 expressions .
additionally , amino acid changes in the tlr2 gene have been linked to reduced tlr2 receptor function and to increase in atopy risk in humans .
a study in a murine macrophage cell line suggested a proinflammatory role of tlr4 and 5 in the disease .
animal studies have demonstrated that the dose of the tlr4 ligand , lipopolysaccharide ( lps ) , determines the type of inflammatory response generated and that lung epithelial cells activation by tlr4 is crucial for induction of airway inflammation via activation of mucosal dcs [ 2022 ] .
tlr9 is one of the most extensively studied tlrs in asthma , and it is currently thought to modulate allergic responses by skewing the balance from a th2 towards a th1 response .
in addition , snps in the tlr9 gene were associated with increased risk of asthma .
tlr11 , 12 , and 13 are not encoded in the human genome , and there are currently no data on associations with asthma in mice .
insertion - deletion polymorphisms in the nod1 gene have been associated with increased risk of developing asthma , and genetic variations in nod1 that affected microbial recognition were positively associated with disease susceptibility and pathogenesis [ 26 , 27 ] .
polymorphisms in nod2 , that affected lps recognition and tlr4 function , were associated with atopic diseases and were suggested to indirectly increase the severity of asthma . in asthma , over 50 cytokines have now been identified to determine disease outcome .
proinflammatory and th2-associated cytokines , including interleukin-4 ( il-4 ) , il-5 , il-6 , il-13 , and tumor necrosis factor ( tnf- ) , are reported to enhance the disease . on the other hand , interferon- ( ifn ) , a th1-associated cytokine ,
in addition , asthmatic patients have been shown to have reduced levels of the anti - inflammatory cytokine il-10 in the sputum .
il-10 is produced by macrophages and by a subset of regulatory t cells ( tregs ) and exerts its effects by inhibiting the synthesis of inflammatory cytokines ( including asthma - associated cytokines such as tnf- and il-5 ) and gene presentation .
th2 cells play a key role in asthma , and asthmatic subjects have been reported to have th1/th2 imbalances as well as disturbed t helper type 17 ( th17)/treg balances .
each th cell type is regulated by a specific transcription factor : tbet for th1 cells , gata-3 for th2 cells , retinoic acid orphan receptor-t ( rort ) for th17 cells , and forkhead box p3 ( foxp3 ) for tregs .
animal and human studies have demonstrated that alterations in expression and/or of functions of these transcription factors can contribute to asthma pathogenesis [ 32 , 33 ] .
the aim of this current study is to explore the innate and adaptive immune responses and inflammation in allergic asthma by investigation of the mrna expression profiles of the different prrs , t cell - related cytokines , and transcription factors . to this end , we have used a mouse model for both mild allergy and severe asthma with similar pathological characteristics seen in humans .
findings from this observational study may contribute to elucidating the underlying mechanisms of mild and severe asthma and the involved inflammatory markers , as a first step in the development of phenotype - directed treatment approaches .
male balb / c mice ( 68 weeks ; charles river laboratories , france ) were acclimated to their new environment for at least 1 week before the start of the experiment .
all in vivo experiments were approved by and were in accordance with the guidelines of the local dutch committee of animal experimentation .
mice were sensitized to ovalbumin ( ova ; chicken egg albumin , grade v , sigma , st .
louis , mo , usa ) by intraperitoneal injections of 0.1 ml alum - precipitated antigen , comprising 10 g ova absorbed into 2.25 mg alum ( imject alum ; pierce , rockford , il , usa ) .
control animals received 0.1 ml saline only ( nacl 0.9% ; b. braun medical bv , oss , the netherlands ) ( figure 1 ) . mice were exposed to 10 mg / ml ova aerosol in saline using pari lc star nebulizer ( pari gmbh , starnberg , germany ) in an aerosol cabin for 30 min on days 35 , 38 , and 41 .
mice were sensitized with trinitrophenyl-(tnp- ) conjugated ova by intraperitoneal injections of 0.1 ml alum - precipitated antigen , comprising 10 g tnp - ova absorbed into 2.25 mg alum .
control animals received 0.1 ml saline only ( figure 1 ) . from day 14 up to and including day 20 , mice were challenged daily by intranasal administration of a tnp - ovalbumin / ige immune complex ( 2 g tnp - ova plus 20 g dnp - specific ige ( clone h1 26.82 ) ) , as described previously .
after sacrifice , on day 42 ( mild model ) or 21 ( severe model ) , lungs were first washed through a tracheal cannula with 1 ml saline containing protease inhibitor cocktail ( complete mini , roche diagnostics , mannheim , germany ) and prewarmed at 37c .
cytospin cell preparations were made by cytospinning the cells onto glass for 5 min ( 400 g , 4c ) , and cytospins were stained by diff - quick ( merz and dade ag , ddingen , switzerland ) .
numbers of eosinophils , macrophages , neutrophils , and lymphocytes were scored by light microscopy .
after mice were sacrificed , on day 42 or 21 , the lungs were dissected , and mrna was isolated from whole lung tissue . messenger rna isolation ( n
= 3 mice per group ) was carried out according to the qiagen rneasy mini kit protocol ( qiagen benelux bv , venlo , the netherlands ) .
reverse transcriptase pcr was performed using an iscript cdna synthesis kit ( bio - rad laboratories , hercules , ca , usa ) .
the reactions were performed in a ptc-100tm programmable thermal controller ( m. j. research inc . ,
cdna was amplified using iq sybr green supermix in a 96-well pcr plate and run in a cfx96 real - time pcr detection system ( bio - rad ) .
primers for tlrs , nlrs , ribosomal protein s13 ( rps13 , reference gene ) , and t - cell transcription factors were purchased by isogen ( isogen life science , de meern , the netherlands ) .
the sequences are listed in supplementary table 1 available online at http://dx.doi.org/10.1155/2013/808470 . for mouse t - cell cytokines ,
the protocol used for amplification was 94c for 3 min , 94c for 10 sec , and specific melt temperature for 45 sec , followed by 39 cycles of 94c for 10 sec and 95c for 10 sec
. normalized gene expression ( ct ) was calculated using the built - in gene expression analysis module in cfx manager software ( cfx manager software version 1.6 ) .
data analysis was performed using a 1-way analysis of variance ( one - way anova ) with the bonferroni 's post hoc test . in some studies
all statistical analyses were performed using the graphpad prism software program ( graphpad prism software version 5.03 ) .
mice were rendered asthmatic following the scheme presented in figure 1 . to examine the extent of pulmonary inflammation in the asthmatic mice , bronchoalveolar lavage ( bal ) fluid was examined for leukocyte accumulation ( figure 2 ) . in mild asthma ,
allergen - sensitized and challenged mice showed a significant increase in the total inflammatory cell number ( figure 2(a ) ) which was due to a relative increase in the number of lymphocytes and eosinophils ( figure 2(c ) ) in bal fluid compared to challenged only mice . in severe asthma , a significantly higher total inflammatory cell number ( figure 2(b ) ) was observed in allergen - sensitized and challenged mice compared to challenged only mice , and this was due to a relative increase in the number of eosinophils ( figure 2(d ) ) .
as prrs in the lung can modulate ongoing chronic inflammation during asthma , the mrna expression of tlr1 - 13 and nod1 and 2 was measured ( figure 3 ) . in the mild model , tlr2 expression
was significantly increased in control mice when compared to sensitized only , challenged only , and sensitized and challenged mice ( figure 3(a ) ) . in the severe model , tlr2 expression
was significantly increased in challenged only mice when compared to control , sensitized only , and allergen - sensitized and challenged mice ( figure 3(a ) ) .
in addition , sensitized and challenged mice showed significantly higher tlr1 expression when compared to sensitized only mice and significantly lower nod1 expression in comparison to control mice ( figure 3(a ) ) . in mild asthma , tlr3 expression was significantly decreased in allergen - sensitized and challenged mice when compared to control mice ( figure 3(b ) ) . in severe asthma ,
tlr3 expression was significantly lower in sensitized and challenged mice but not in control , sensitized only , and challenged only mice ( figure 3(b ) ) .
in addition , tlr7 expression was significantly higher in challenged only mice when compared to control and sensitized only mice ( figure 3(b ) ) .
the expression of tlr11 and tlr12 remained unchanged in both models ( figures 3(c ) and 3(d ) ) .
interestingly , in the severe model , the mrna expression of tlr1 , tlr3 , tlr6 , tlr9 , tlr11 , tlr13 , nod1 , and nod2 was significantly correlated with the total inflammatory cell number in bal fluid ( table 1 ) . to determine the extent of inflammation in the lung , the mrna expression of various cytokines was measured ( table 2 ) . in the severe model ,
the expression of almost all cytokines tended to be increased in tnp - ova - sensitized and tnp - ova / ige - challenged mice when compared to ova - sensitized and challenged mice in the mild model .
an 8 and 33-times higher il5 and il6 expressions , respectively , was observed in allergen - sensitized and challenged mice but not in control , sensitized only , and challenged only mice . in mild asthma
, il10 showed the largest change in expression followed by ii5 , ii4 , tnf , il6 , il2 , il13 , and ifn , respectively , ( figure 4(a ) ) . in severe asthma , the largest change ( 110-fold ) is observed in ifn expression followed by il13 , il2 , il4 , il10 , il6 , il5 , and tnf , respectively ( figure 4(b ) ) . to examine the t cell responses in the lung ,
the mrna expression of t cell - specific transcription factors was measured , and to determine the extent of th response skewing in the lung , ratios for gata3/tbet ( th2/th1 ) , foxp3/rort ( treg / th17 ) , foxp3/gata3 ( treg / th2 ) , and foxp3/tbet ( treg / th1 ) mrna expressions were calculated ( table 3 ) .
the expression of tbet and foxp3 was 7 and 2-times higher , respectively , in allergen - sensitized and challenged mice in the severe model when compared to allergen - sensitized and challenged mice in the mild model .
in severe asthma , sensitized and challenged mice showed 16 and 17-times higher tbet and foxp3 expression , respectively , when compared to control , sensitized only and challenged only mice .
most interestingly , allergen sensitization and challenge resulted in a significant decrease in gata3/tbet ratio as compared to control and sensitized only mice in both models .
the ratio of foxp3/rort was 12-times higher in the severe model in comparison to the mild model , and this ratio was significantly increased in allergen - sensitized and challenged mice when compared to control , sensitized only , and challenged only mice in both models . in the mild model ,
the ratio of foxp3/gata3 in allergen - sensitized and challenged mice was significantly increased when compared to control , sensitized only , and challenged only mice , and this ratio was almost 4-times higher than the mild model . in mild asthma , the largest change ( 9-fold ) was observed in foxp3 expression followed by tbet , gata3 , and rort ( figure 5(a ) ) .
tbet showed the largest change in expression in severe asthma followed by foxp3 , gata3 , and rort ( figure 5(b ) ) .
as imbalances in t cell responses can also be detected using t cell - specific transcription factors , the correlations between the mrna expression of t cell transcription factors and t cell - specific cytokines were calculated ( table 4 ) . in mild asthma , tbet expression was significantly correlated with il2 , il4 , il5 , il6 , il13 , and tnf expression .
rort expression showed a significant correlation with il10 expression , and foxp3 expression was significantly correlated with and il2 , il4 , il5 , il6 , il10 , and tnf expression . in severe asthma ,
rort expression was significantly correlated with il2 , il4 , il5 , il6 , il10 , and il13 expression .
interestingly , foxp3 expression was strongly correlated with il2 , il4 , il5 , il6 , and il13 and significantly correlated with il10 and ifn expression .
the aim of this study was to explore the innate and adaptive immune responses and inflammation in mouse models for mild and severe allergic asthma .
our results clearly show that pulmonary inflammation is differentially regulated in mild and severe experimental asthma . in the severe asthma model , a higher ( 3-fold ) cell influx in bal fluid
was seen compared to the mild model . as expected , tnp - ova - sensitized and tnp - ova / ige - challenged mice showed significantly higher total inflammatory cell number and a relative increase in the number of eosinophils , lymphocytes , and neutrophils as compared to challenged only mice .
these findings are in accordance with other animal studies in which ige immune complexes have been used as inducers of airway inflammation [ 12 , 13 , 34 ] . besides being key components of the innate immunity , prrs are also involved in the activation and shaping of adaptive immunity .
the function and expression of prrs have been linked to susceptibility towards allergic asthma . in mild asthma ,
tlr2 expression was lower in sensitized only , challenged only and ova - sensitized and challenged mice , when compared to the control mice .
previous human studies have demonstrated that decreased tlr2 mrna expression and receptor function due to snps in the tlr2 gene are positively associated with asthma susceptibility , and high - atopic - risk infants have been reported to have low tlr2 expression on their cord blood cd34 ( + ) cells [ 1517 ] . in severe asthma
, allergen challenge only increased the expression of tlr2 and allergen sensitization and challenge significantly increased tlr1 expression when compared to sensitized only mice .
these results are supported by data from animal and human studies which have shown that tlr2/tlr1 heterodimers can play both pro- and anti - inflammatory roles in allergic asthma [ 16 , 35 ] .
previous in vitro studies have demonstrated that upon the activation of tlr3 by its ligand , this prr induces upregulation of its own expression as well as expression of other tlrs and various cytokines and chemokines and thereby contributes to exacerbation of inflammation .
however , no direct associations between tlr3 expression and function and asthma have been reported yet , and whether the decreased mrna expression of tlr3 caused by the chronic inflammatory status of the animals is proinflammatory or anti - inflammatory is also unknown . in severe asthma ,
this could be due to a response of plasmacytoid dcs to the inhaled antigen as these cells strongly express tlr7 .
in addition , allergen sensitization and challenge decreased nod1 expression when compared to control mice .
single nucleotide polymorphisms in the nod1 gene were positively associated with susceptibility towards asthma in children living on farms , and this prr has been reported to be necessary for neutrophil function in mice [ 26 , 27 , 37 ] .
however , no direct associations between nod1 expression and function and asthma have been reported yet .
interestingly , tlr1 , tlr3 , tlr6 , tlr9 , tlr11 , tlr13 , nod1 , and nod2 expression was significantly correlated with the total inflammatory cell number in bal fluid in the severe model .
these correlations might be explained by the increase in the number of inflammatory cells which express these receptors , as is the case for tlr1 and nod1 .
additionally , these receptors could also contribute to the increased sensitivity to inflammation / exacerbation since a small trigger can lead to an inflammatory cascade .
however , the link between these correlations and asthma pathogenesis remains to be investigated .
different mrna expression profiles of t cell - related cytokines are observed in the mild and severe models for allergic asthma . to our knowledge , this is the first report in which cytokine mrna expression is measured in mouse whole lung tissue . in severe asthma ,
of particular interest , il10 showed the largest change in mrna expression in mild asthma .
this profound 13-fold change in il10 expression might be necessary to limit the inflammation in the airways and to counter the effects of the other cytokines on disease progression as previously described .
this hypothesis is supported by the findings in the severe model , in which ifn showed the largest change in expression suggesting a th1-skewed response .
th2 cells play a key role in the pathogenesis of allergic asthma , and asthmatic patients have been reported to have th1/th2 imbalances as well as disturbed th17 ( th17)/treg balances . in mild asthma ,
in severe asthma , foxp3 and tbet showed the highest expression in lungs of allergen - sensitized and challenged mice .
these findings are in line with our cytokine expression data ( described above ) and are supported by the proposed role of tregs and il10 in the airways .
intriguingly , allergen sensitization and challenge resulted in a strong treg response in both models .
accordingly , foxp3 showed the largest change in expression in the mild model . in severe asthma ,
the largest change in expression was found in the th1-related transcription factor , tbet , and this result is in contrast with data obtained from asthmatic patients [ 30 , 32 , 33 ] , possibly due to measurement of mrna expression in mouse whole lung tissue instead of in pbmcs of asthmatics and/or measurement of mrna expression instead of protein expression .
it has been reported that both in vivo and in vitro gata3 can inhibit foxp3 gene induction by directly binding to the foxp3 promoter in mice .
an opposite action of foxp3 might also be possible , and our results could be explained by a counter - regulatory mechanism of treg / th1 to suppress the th2 immune response .
interestingly , the mrna expression of tbet was strongly correlated with the expression of innate cytokines ( il2 , il6 , and tnf ) and th2 cytokines ( il4 , il5 , and il13 ) , but not with th1 cytokine ( ifn ) . in severe asthma ,
il2 , il4 , il5 , il6 , il13 , and tnfhave been reported to enhance asthma in humans , and th1 cells have been shown to suppress th2 cells through the release of ifn-. additionally , tregs suppress other th cell effector functions through the release of il-10 .
no correlations were found between gata3 and th2 cytokines expression suggesting a counter - regulatory mechanism of treg / th1 to suppress the th2 immune response as described previously . to our knowledge
, our results demonstrated for the first time that in mild and severe models for experimental asthma , immune and inflammatory responses are regulated differently .
we showed that in mild and severe allergic asthma different mrna expression of tlrs , nlrs and t cell - specific cytokines and transcription factors is observed .
this study adds to our understanding of the allergic characteristics of mild and severe allergic asthma which can contribute to the identification of phenotype - specific therapeutic targets . | this study aimed at exploring innate and adaptive immunity in allergic asthma by investigation of mrna expression of pattern recognition receptors , t - cell - specific cytokines , and transcription factors .
mouse models for mild and severe asthma , with similar pathological characteristics observed in humans , were used to study the involved inflammatory markers as a first step in the development of phenotype - directed treatment approaches . in the mild model , mice were sensitized to ovalbumin - imject alum and challenged with ovalbumin . in the severe model , mice were sensitized to trinitrophenyl - conjugated ovalbumin and challenged with trinitrophenyl - ovalbumin / ige immune complex .
pulmonary airway inflammation and mrna expression of toll - like receptors ( tlrs ) , nod - like receptors ( nlrs ) , t cell cytokines , and transcription factors in lung tissue were examined .
different mrna expression profiles of tlrs , nlrs , t cell cytokines , and transcription factors were observed . in the mild model ,
il10 showed the largest increase in expression , whereas in the severe model , it was inf with the largest increase .
expression of tbet was also significantly increased in the severe model . inflammation and immunity
are differentially regulated in mild and severe experimental asthma .
this preclinical data may help in directing clinical research towards a better understanding and therapy in mild and severe asthmatic patients . |
to report a rare case of extreme leukocytosis and leukemoid reaction associated with lung sarcomatoid carcinoma ( lsc ) and increase people s awareness of the disease .
a 58-year - old male patient was diagnosed with lsc ; however , after the end of the second course of chemotherapy , his white blood cells increased gradually without fever or use of medications such as granulocyte colony - stimulating factor and steroids .
when a patient s white blood cells are extremely elevated , we should think of the possible causes of the tumor itself and identify it with other diseases . however , more data and evidence are still needed to find an effective adjuvant therapy for these patients .
lung sarcomatoid carcinomas ( lscs ) are very rare , mostly reported in the form of case reports , and leukemoid reactions has rarely been described in patients with lsc , to the best of our knowledge .
, we discuss an unusual case of extreme leukocytosis and a leukemoid reaction associated with the lsc .
we summarize the relevant reports , hoping to provide some help for other clinicians when they encounter similar disease or symptoms .
a 58-year - old male patient had symptoms of intermittent cough and hemoptysis with no incentives in june 2014 , and accompanying chest tightness and shortness of breath .
he was first admitted to a local hospital , where computed tomography of the chest showed a left lung mass , suggesting a probability of tuberculosis .
therefore , he was treated for tuberculosis , but had no significant relief of symptoms .
he then visited our hospital , where he underwent computed tomography - guided biopsy ; the pathology results showed poorly differentiated adenocarcinoma ( left lung ) .
he then underwent surgery for resection of the mass ; pathological examination showed poorly differentiated peripheral pulmonary carcinoma with the tumor being composed of mononuclear and multinucleated tumor giant cells with significant atypia .
immunohistochemistry showed : creatine kinase ( ck ) ( ) , p63 ( ) , thyroid transcription factor ( ttf)-1 ( ) , ck18 ( + ) , napsin a ( ) , ck ( + ) , vimentin ( + ) , smooth muscle actin ( sma ) ( ) , desmin ( ) , epidermal growth factor receptor ( egfr ) ( + + ) , ki-67 ( + 60% ) , epithelial membrane antigen ( ema ) ( + ) ; the consideration is sarcomatoid carcinoma ( giant cell carcinoma ) .
the patient received two courses of chemotherapy in our hospital after surgery , gemcitabine 1.4 d1and 8 + cisplatin 30 mg d14 and tolerated it well .
however , the patient s white blood cells ( wbcs ) increased gradually without fever or use of medications , such as granulocyte colony - stimulating factor ( g - csf ) and steroids , after the end of the second course ( figure 1 ) , and neutrophils accounted for ~93% . while his hemoglobin and platelets were within the normal range .
next , a bone marrow biopsy was performed ; the results showed myeloid and erythroid focal hyperplasia and significant partial immature myeloid cell proliferation ( figure 2 ) .
immunohistochemistry showed individual lymphocytes cd3 ( + ) , individual lymphocytes cd20 ( + ) , erythroid cd235a ( + ) , megakaryocytes cd61 ( + ) , cd34 ( ) , individual monocytes cd14 ( + ) , individual plasma cells cd138 ( + ) , a large number of myeloid myeloperoxidase ( mpo ) ( + ) ( figure 3 ) .
finally , the patient was diagnosed with leukocytosis , then he and his family refused further chemotherapy , so we put the patient on hydroxyurea to control the leukocytosis .
this study was approved by the ethics committee of the affiliated cancer hospital of zhengzhou university .
sarcomatoid carcinoma is a poorly differentiated malignant cancer , which is composed of both carcinomatous and sarcomatous elements .
it can occur in many parts of the body , but most commonly affects the respiratory tract , lungs , breasts , and kidneys .
clinically , sarcomatoid carcinoma originating in the lung ( lsc ) is very rare , accounting for 0.3%4.7% of all lung malignancies.1 lsc is a non - small - cell lung carcinoma , which has a high degree of malignancy , and is more aggressive than the average lung cancers .
the effects of radiotherapy and chemotherapy are not very good ; therefore , the prognosis of lsc is poor.24 leukemoid reaction is defined as a wbc count > 5010/l without evidence of leukemia or infection.5 leukemoid reaction is a potential cause for leukocytosis , especially in the presence of predominately mature granulocytic leukocytosis .
a leukemoid reaction is caused by an exaggerated myeloid ; it has been associated with infections , allergies , burns , intoxications , acute hemorrhage , malignant neoplasms , and several other stimuli.69 lsc associated with leukemoid reaction is very rare .
cancer - related symptoms , may be caused by g - csf secreted by the tumor cells.1012 chen et al13 indicated that , in cases of leukemoid reaction , leukocytosis is frequently mediated by tumor - related cytokines and csf including g - csf , granulocyte - macrophage csf , interleukin 6 or 1. jardin et al14 have reported a case with lung sarcoma and leukemoid reaction .
the patient s g - csf concentration increase was observed after the first cycle of chemotherapy ( > 20,000 pg / ml ) .
dramatically , the highest g - csf concentration level was observed when the wbc count was lowest , suggesting that a massive cytokine release appeared after tumor lysis related to chemotherapy.14 we also observed a similar phenomenon in our report ; after chemotherapy , the patient s wbc experienced dramatic increases . for various reasons ,
we have not measured g - csf concentration level , but we can speculate that perhaps the reason was the same .
leukemoid reaction always indicates a high degree of malignancy , high probability of metastasis , and recurrence and wretched prognosis . in our report
, the patient died of multiple organ failure 2 months after being diagnosed with leukocytosis .
this is consistent with other reports correlating leukemoid reactions with advanced and aggressive tumor cell growth and poor outcome.6,15 in conclusion , lsc associated with leukemoid reaction is very rare and the prognosis is poor .
when a patient s wbc is extremely elevated , we should think of possible causes of the tumor itself and identify it with other diseases .
however , more data and evidence are still needed to find an effective adjuvant therapy for these patients . | purposeto report a rare case of extreme leukocytosis and leukemoid reaction associated with lung sarcomatoid carcinoma ( lsc ) and increase people s awareness of the disease.patients and methodsa 58-year - old male patient was diagnosed with lsc ; however , after the end of the second course of chemotherapy , his white blood cells increased gradually without fever or use of medications such as granulocyte colony - stimulating factor and steroids .
a bone marrow biopsy then confirmed it to be a leukemoid reaction.resultsthe patient died of multiple organ failure 2 months after being diagnosed with leukocytosis.conclusionlsc associated with leukemoid reaction is very rare and the prognosis is poor .
when a patient s white blood cells are extremely elevated , we should think of the possible causes of the tumor itself and identify it with other diseases . however , more data and evidence are still needed to find an effective adjuvant therapy for these patients . |
the age of smoking onset is decreasing in both developed and developing countries and most of the developed countries have implemented several policies in order to reduce smoking rates , more specifically among adolescents .
this is because the age at initiation of cigarette smoking is one of the important determinants of tobacco dependence possibility , likelihood of smoking cessation , and the risk of unwilling health consequences .
many researchers have considered smoking behavior in adolescents as a transition or movement in some stages .
although , smoking onset and continuation are connected processes per se , in several studies it has been attempted to make this process into several stages so that primary and secondary prevention could be included . in the study conducted by leventhal and cleary in 1980s , it was suggested that smoking includes a complex continuum and in order to a person to be a smoker , different stages should be passed .
( 1987 ) accepted the multistage nature of smoking and proposed stages in a more sophisticated way .
the following six stages were illustrated by myhew et al . in 2000 using previous studies : percontemplation , contemplation or preparatory stage , tried or initiation , experimenter , regular , and established or daily smoker .
( 2001 and 2004 ) showed that nonsmokers in the percontemplation stage are not homogeneous and they can be included in three groups of committers , immotives , and progressives .
the second group does not plan to start smoking in the future ( they do not have any definite program to do so ) , and the third group want to smoke , but not in the next six months .
in addition , for the measurement of smoking stages and cessation , an algorithm has been proposed by pallonen et al .
( 1998 ) , which is commonly used in the studies related to smoking stages in the adolescents . however , it is not a comprehensive method for the measurement of the smoking stages .
understanding the process of adolescent smoking and identifying the predictors of passing through smoking stages are of great importance for policy makers in the development of effective strategies that prevent cigarette smoking . notwithstanding the importance of smoking stages evaluation in adolescents , there is not an appropriate instrument for its measurement .
this study aimed to design a suitable tool for this purpose and to assess its validity by latent class analysis ( lca ) model , which is an appropriate technique for the evaluation of staging algorithm validity .
the lca tests this hypothesis whether individual responses to the algorithm questions can be identified by smoking stage ( latent variable ) by examining the response patterns .
considering the measurement algorithm for the smoking stages and cessation in adolescents proposed by pallonen et al . , and based on the smoking stages suggested by myhew et al . and kremers et al .
then , to evaluate its content validity , the designed questionnaire attached with an answer sheet for the opinions on relevancy and clarity of the algorithm were sent to the following people : 5 experts in the field of adolescence smoking ( content expert ) , 6 experts on the questionnaire designing and methodology ( methodology expert ) , 4 teachers and education experts in the field of student consulting and training and 5 alert students ( lay expert ) .
for the purpose of assessing the relevancy of the questionnaire , individuals were asked to answer the following question : how much this question is associated with the measured parameter ? in other words , how appropriate is this question ?
the proposed answers were ranked as follows : 1-not suitable , 2-moderately suitable , 3-suitable and 4-completely suitable . for examining the clarity of the questionnaire ,
they were asked to answer the following question : how clear is the meaning of this question ?
the proposed answers were categorized as follows : 1-ambiguous , 2-moderately ambiguous , 3-clear and 4-completely clear .
answers 3 and 4 were considered as favorable and answers 1 and 2 were considered as unfavorable , then the relevancy and clarity percentages for two groups ( experts and lay experts ) were separately measured .
after gathering answer sheets and performing the modifications , the questionnaires were presented to 154 grade 10 high school students within a two - week interval so that its reliability could be determined in terms of repeatability dimension using icc . in order to evaluate the validity of the measured stages through the designed algorithm ,
the questionnaires were distributed to 4903 students in grade 10 with a mean age of 15.7 0.73 years ( range : 14 - 19 ) in tabriz ( a big city in north - west of iran ) .
they were sampled using a stratified method according to the number of students in each region , number of students in school and type of school followed by cluster sampling ( each class was one cluster ) .
the subjects were consisted of 2799 females and 2104 males . to enhance the validity of student 's self - reports ,
they were assured strict confidentiality of their responses and they could not be recognized by their answers . also , they were informed about the voluntary nature of their participation in the study and their right to refuse or skip any questions .
the ethics committee of tabriz university of medical sciences and research committee of the east azarbaijan province education organization approved the questionnaire .
instead , it is measured indirectly by means of two or more observed variables . by analyzing given answers to the categorical observed variables
it assumes that besides the measurement error , whether the correlation between observed variables could be justified by latent variable categories .
the input data in lca is response patterns and their frequencies . by various iterations for the number of identified classes of the latent variable and comparing the frequencies of the observed response patterns with the expected ones , the lca determines the best model and
calculates a statistics similar called g. the distribution of g is similar to the distribution of if degree of freedom is less than 60 .
the significance of g indicates the great difference between observed response pattern frequencies and the expected ones , as well as unfit of the model . in other words
, it suggests that this number of the classes of latent variables is not fit for the observed response patterns . for performing lca , four observable variables ( i.e. , indicators )
were extracted from the questionnaire so that smoking stages could be studied as a latent variable .
these indicators were as follows : smoking status with five categories , tendency to smoking in the future with five categories , smoking in the last month with two categories and smoking in the last week with two categories .
furthermore , to examine the validity of smoking cessation stages , four observable variables were extracted from the questionnaire : intention to quit smoking in the next 6 months with two categories , thinking about quitting in the next month with two categories , last time trying for smoking cessation with three categories , and smoking cessation status with three categories .
considering the measurement algorithm for the smoking stages and cessation in adolescents proposed by pallonen et al . , and based on the smoking stages suggested by myhew et al . and kremers et al .
then , to evaluate its content validity , the designed questionnaire attached with an answer sheet for the opinions on relevancy and clarity of the algorithm were sent to the following people : 5 experts in the field of adolescence smoking ( content expert ) , 6 experts on the questionnaire designing and methodology ( methodology expert ) , 4 teachers and education experts in the field of student consulting and training and 5 alert students ( lay expert ) .
for the purpose of assessing the relevancy of the questionnaire , individuals were asked to answer the following question : how much this question is associated with the measured parameter ? in other words , how appropriate is this question ?
the proposed answers were ranked as follows : 1-not suitable , 2-moderately suitable , 3-suitable and 4-completely suitable . for examining the clarity of the questionnaire ,
they were asked to answer the following question : how clear is the meaning of this question ?
the proposed answers were categorized as follows : 1-ambiguous , 2-moderately ambiguous , 3-clear and 4-completely clear .
answers 3 and 4 were considered as favorable and answers 1 and 2 were considered as unfavorable , then the relevancy and clarity percentages for two groups ( experts and lay experts ) were separately measured .
after gathering answer sheets and performing the modifications , the questionnaires were presented to 154 grade 10 high school students within a two - week interval so that its reliability could be determined in terms of repeatability dimension using icc .
in order to evaluate the validity of the measured stages through the designed algorithm , the questionnaires were distributed to 4903 students in grade 10 with a mean age of 15.7 0.73 years ( range : 14 - 19 ) in tabriz ( a big city in north - west of iran ) .
they were sampled using a stratified method according to the number of students in each region , number of students in school and type of school followed by cluster sampling ( each class was one cluster ) .
the subjects were consisted of 2799 females and 2104 males . to enhance the validity of student 's self - reports ,
they were assured strict confidentiality of their responses and they could not be recognized by their answers . also , they were informed about the voluntary nature of their participation in the study and their right to refuse or skip any questions .
the ethics committee of tabriz university of medical sciences and research committee of the east azarbaijan province education organization approved the questionnaire .
instead , it is measured indirectly by means of two or more observed variables . by analyzing given answers to the categorical observed variables
it assumes that besides the measurement error , whether the correlation between observed variables could be justified by latent variable categories .
. by various iterations for the number of identified classes of the latent variable and comparing the frequencies of the observed response patterns with the expected ones , the lca determines the best model and calculates a statistics similar called g. the distribution of g is similar to the distribution of if degree of freedom is less than 60 .
the significance of g indicates the great difference between observed response pattern frequencies and the expected ones , as well as unfit of the model . in other words
, it suggests that this number of the classes of latent variables is not fit for the observed response patterns . for performing lca , four observable variables ( i.e. , indicators )
were extracted from the questionnaire so that smoking stages could be studied as a latent variable .
these indicators were as follows : smoking status with five categories , tendency to smoking in the future with five categories , smoking in the last month with two categories and smoking in the last week with two categories .
furthermore , to examine the validity of smoking cessation stages , four observable variables were extracted from the questionnaire : intention to quit smoking in the next 6 months with two categories , thinking about quitting in the next month with two categories , last time trying for smoking cessation with three categories , and smoking cessation status with three categories .
final algorithm is presented in the figure 1 . first , the adolescents chose one of the main six options in the left .
in fact , this algorithm was constructed according to the algorithm proposed by pallonen et al .
algorithm for the acquisition and cessation stages in the examining of content validity of this algorithm , the percentage of questionnaire relevancy for both groups was 100% .
the clarity percent of the experts and lay experts were obtained 75% and 100% , respectively . through assessment of smoking stages reliability [ 9 stages , table 1 ] , which was performed in 154 students with a two - week interval , the mean of intra - class correlation coefficient ( icc ) of the questions was obtained 0.929 ( ci 95% : 0.903 - 0.948 ) .
probability of endorsing particular responses to the aqusision staging algorithm conditional upon stage membership for identifying the smoking stages , by using lca and considering two other questions ( smoking in the last month and last week ) , validity of the algorithm was studied in 4834 students ( 69 subjects were excluded due to the lack of data on any of 5 observable variables ) , so that result of lca model for the whole sample demonstrated nine interpretable classes ( g = 0.051 , df = 1 , p = 0.821 ) . moreover ,
the obtained results of lca with nine interpretable classes in females ( n = 2796 ) ( g = 0.026 , df = 1 , p = 0.803 ) and males ( n = 2038 ) were valid ( g = 0.003 , df = 1 , p = 0.956 ) .
these findings indicate that the model is excellent fit to the data . in other words ,
as it was shown in table 1 , both male and female students could be categorized in 9 classes ( 9 smoking stages ) comprehensively based on the observed response patterns . in order to determine the smoking cessation stages , validity of the algorithm
the lca model demonstrated five interpretable valid classes ( g = 0.001 , df = 1 , p = 0.975 ) .
that is , with respect to the observed response patterns for 4 observable variables related to smoking cessation , students could be categorized in 5 classes ( 5 stages of smoking cessation ) .
table 3 shows labels and descriptions of smoking stages , smoking cessation , and their measurements regarding to the algorithm .
probability of endorsing particular responses to the cessation staging algorithm conditional upon stage membership ( n=218 ) names , definations and measurements of smoking acquisition stages and cessation stages
final algorithm is presented in the figure 1 . first , the adolescents chose one of the main six options in the left .
in fact , this algorithm was constructed according to the algorithm proposed by pallonen et al .
in the examining of content validity of this algorithm , the percentage of questionnaire relevancy for both groups was 100% .
the clarity percent of the experts and lay experts were obtained 75% and 100% , respectively . through assessment of smoking stages reliability [ 9 stages , table 1 ] , which was performed in 154 students with a two - week interval ,
the mean of intra - class correlation coefficient ( icc ) of the questions was obtained 0.929 ( ci 95% : 0.903 - 0.948 ) .
for identifying the smoking stages , by using lca and considering two other questions ( smoking in the last month and last week ) , validity of the algorithm was studied in 4834 students ( 69 subjects were excluded due to the lack of data on any of 5 observable variables ) , so that result of lca model for the whole sample demonstrated nine interpretable classes ( g = 0.051 , df = 1 , p = 0.821 ) . moreover , the obtained results of lca with nine interpretable classes in females ( n = 2796 ) ( g = 0.026 , df = 1 , p = 0.803 ) and males ( n = 2038 ) were valid ( g = 0.003 , df = 1 , p = 0.956 ) .
these findings indicate that the model is excellent fit to the data . in other words , as it was shown in table 1 , both male and female students could be categorized in 9 classes ( 9 smoking stages ) comprehensively based on the observed response patterns . in order to determine the smoking cessation stages , validity of the algorithm
the lca model demonstrated five interpretable valid classes ( g = 0.001 , df = 1 , p = 0.975 ) .
that is , with respect to the observed response patterns for 4 observable variables related to smoking cessation , students could be categorized in 5 classes ( 5 stages of smoking cessation ) .
table 3 shows labels and descriptions of smoking stages , smoking cessation , and their measurements regarding to the algorithm .
probability of endorsing particular responses to the cessation staging algorithm conditional upon stage membership ( n=218 ) names , definations and measurements of smoking acquisition stages and cessation stages
the reliability of the algorithm was also proved high within a two - week interval .
it should be noted that most of their studied subjects , as well as previous studies conducted on smoking stages in adolescents who were the in the precontemplation stage . in addition ,
in contrast to our study , they have not considered students in precontemplation stage in three groups which proposed by kremers et al .
therefore , the inclusion of majority of sample in one group and integrating three groups in one group cause the reliability to be increased . in our study , although we considered individuals in precontemplation stage in three separated groups , 65 percent of the sample was in the committer stage , which could increase the reliability .
the large sample size , the test - retest method for assessment of reliability and possibility of a change in smoking stage of adolescents in a two - week interval were strengths of this study in identifying the algorithm reliability .
we used the lca to examine if the adolescents in the smoking and cessation stages could be classified based on their responses to the stage algorithm .
the results of the lca suggested that response patterns to this algorithm highly corresponded with 9 smoking and 5 smoking cessation stages .
as reported in table 1 , all of the smoking stages ( 9 stages ) could be interpreted with respect to item - response probabilities .
for example , in the first stage ( committer ) those who have never smoked with probability of 0.983 , they were confident ( 0.997% ) that they will never start smoking in the future , and those who have not smoked in the last month ( 0.997% ) and they have not smoked in the last week ( 0.999 ) .
another interesting example is the individuals in stage 5 ( preparator ) who have never smoked ( 0.963% ) .
they plan to start smoking in the next month with probability of 0.985 and they have smoked neither in the last month nor in the last week ( 100% ) .
it can be seen in table 2 that according to item - response probabilities , smoking cessation stages can be interpreted .
for example , individuals in the first stage ( precontemplation ) do not think about quitting in the next 6 months ( 0.834% ) and they do not intend to quit smoking with 100% probability in the next month .
another example in this table is the individuals in the second stage ( contemplation ) who 100% intend to quit smoking in the next 6 months and with 0.906% probability do not think about quitting in the next month and with 0.927% probability have never gave up smoking completely .
although the questions of this algorithm assess current behavior , quitting attempts , intention to change , and time since quitting , none of them are measured completely .
more specifically , they demonstrated that the transition across the stages is not sequential . in terms of staging assessment ,
even though our designed algorithm is comprehensive than the previous one , it does not measure behaviors and intentions comprehensively .
moreover , due to the cross - sectional nature of the present study , it can not be claimed about the sequential nature of transition across the stages . also , our method was confirmatory , not exploratory .
it means that we did not want to study how individuals could be classified based on their responses to this algorithm , rather we aimed to study whether response patterns to this algorithm corresponds to our stages ( 9 stages for smoking and 5 stages for smoking cessation ) .
it should be mentioned that although all of the stages could be interpreted according to item - response probabilities , large number of the stages cause the non - significant result of the test .
however , the reliability was studied only in smoking stages and not for cessation stages .
a longitudinal study to assess the transition across the stages and their sequential nature are needed . | background : notwithstanding the importance of smoking stages evaluation in adolescents , there is not an appropriate instrument for its measurement . this study aims to introduce an appropriate instrument for measurement of smoking stages in adolescents and to examine its validity using latent class analysis ( lca ) model.methods:we designed an algorithm to measure the smoking stages .
the relevancy and clarity of the algorithm was examined by experts and lay experts .
we assessed the reliability of our algorithm using test - retest method .
moreover , using the lca , we studied the validity of the stages measured by the designed algorithm in 4903 students ( ages 14 - 19 ) , who were randomly selected from grade 10 high school students in tabriz ( north - west of iran).results : the algorithm content validity indicates high relevancy and clarity percentages .
intra - class correlation of 0.929 was found in the assessment of the reliability of smoking stages ( 9 stages ) in 154 students within a two - week interval .
the lca model revealed nine interpretable classes ( g2 = 0.051 , df = 1 , p = 0.821 ) for the measurement of smoking stages .
examination of the smoking cessation stages in a sample of 218 students in the cessation stage demonstrated that the results for five classes could be interpreted ( g2 = 0.001 , df = 1 , p = 0.975).conclusions : the results suggested that this algorithm is clear , valid , and reliable . |
coracoid fractures can be missed and the treatment for coracoid process fractures is still controversial . the case presented here is of an isolated coracoid process fracture which was treated surgically .
a 15-years old male presented after 4 days of injury complaining of persistent pain in the right shoulder following a jerk during bowling .
osseous avulsion of the distal tip of the coracoid process was confirmed by ct and mri .
the short head of the biceps and coracobrachialis was attached to the avulsed tip , while the pectoralis minor was attached to the coracoid base .
the case was managed by open reduction and fixation with a 3.5 mm cannulated screw and washer .
it can be diagnosed more accurately by mri scan and ct scan . in case of young highly demanding individuals like athletes surgical management
may be a better option as compared to conservative treatment to achieve early use of the extremity , good radiological union and clinical function .
coracoid process fractures generally accompany dislocation of the acromioclavicular ( ac ) joint or glenohumeral joint , scapula corpus fracture , clavicular fracture , humerus proximal end fracture or rotator cuff tear .
the incidence has been estimated to be between 3% and 13% of all scapular fractures , these constitute 1% of all fractures and 5% of those of the shoulder .
isolated injuries of coracoid are a rare occurrence with few scattered reports in literature [ 4 - 6 ] .
coracoid fractures can be missed and the treatment for coracoid process fractures is still controversial . the case presented here is of an isolated coracoid process fracture which was treated surgically .
a 15-years old male , professional cricket player ( spin bowler ) , presented at the emergency department after 4 days of injury complaining of persistent pain in the right shoulder following a jerk during bowling .
mri impression was : 1.3 x 0.4 x 0.9 cm osseous avulsion of the distal tip of the coracoid process .
the short head of the biceps and coracobrachialis was attached to the avulsed tip , while the pectoralis minor was attached to the coracoid base ( fig .
the mri showing osseous avulsion of the distal tip of the right coracoid three dimensional ct scan was done to confirm the diagnosis , and fixation was planned .
a fragmented fracture was observed at the base of the coracoid process by ct images ( figs . 2 and 3 ) .
the patient was admitted for surgery taking consideration of the age and profession of the patient . after making the incision along the langer s line on the coracoid process
after open reduction , fixation was made with a 3.5 mm cannulated screw with a washer ( fig .
three dimensional reconstruction of the ct image showing minimally displaced fracture of the right coracoid three dimensional reconstruction of the c t image in medio - lateral view showing minimally displaced fracture of the right coracoid intra operative fluoroscopy picture in immediate post operative x - ray , both screw & the fragment were found to be in proper position ( fig . 5 ) .
immediate post operative x ray postoperatively , the patient was followed up for 2 weeks with the application of a simple shoulder sling .
passive joint exercises were allowed in the first 2 weeks ; from the 3rd postoperative week , active joint movement exercises were started and 5th week onwards shoulder strengthening exercises were commenced .
the bone was united and fracture had healed as there was no pain at the fracture site and also muscle strength was adequate at the end of 6th post operative week .
the patient returned to his previous occupation pain free and with a full range of joint movement ( fig .
the patient was followed up for next 6 months and there was no complaint of pain and difficulties in bowling .
all coracoid process fractures constitute approximately 1% of all fractures and 213% of scapula fractures [ 79 ] .
fractures are often seen at the base of the coracoid process and are generally minimally displaced and associated with ac joint injuries .
lal et al . , in a case report where surgery had not been applied and vaienti and pogliacomi in a series of 9 cases with delayed diagnosis , applied conservative treatment and clearly demonstrated this situation [ 11 , 12 ] . in cases which can not be clarified with direct radiographs , the use of ct may be necessary . in a study by botchu et al .
of 7 cases , it was shown that coracoid process fractures can be diagnosed with ultrasonography . in the case presented here , diagnosis was made with ct . an important point related to coracoid fractures is the neurological injury which may accompany the fracture .
neer stated that in fractures involving the coracoid process , there may be compression on the brachial plexus and suprascapular nerve paralysis and therefore evaluation with electromyography prior to exploration is recommended .
there are no clear cut guidelines about the preferred modality of treatment of coracoid process fractures .
most of the previous studies on this subject were in the form of case reports or limited case series with no definite determination of the best treatment modality .
the study in literature with the largest number of recruited patients with coracoid process fractures was conducted by anavian et al .
surgery was applied to 14 coracoid process fractures of 26 patients including scapula fractures and successful results were obtained for all patients .
indications for surgical treatment were painful nonunion , > 1 cm displacement , concomitant scapula fracture on the same side and the presence of superior shoulder suspensory complex injuries . in a study by lal and bansal of 22 patients ,
all with coracoid fractures and various shoulder girdle injuries , 10 patients were treated conservatively and nonunion was encountered in 1 patient .
again successful results were obtained from surgical treatment applied bysubramanian et al . of an isolated coracoid fracture in an unstable shoulder .
garcia - elias and salo applied sling in a patient with a fractured coracoid process in association with shoulder dislocation and reported nonunion of the coracoid process . in studies by guttentag and rechtine and goos , conservative treatment was done to coracoids fractures in athletes and patients who were engaged in heavy manual work , however poor results were obtained [ 19 , 20 ] in such cases . in coracoid fractures ,
surgical fixation can be applied with open reduction and internal fixation with screws . even though the most frequently used method
is the anterior approach , indirect reduction and fixation may be applied with a posterior approach . in a study by bhatia ,
fluoroscopy - guided percutaneous fixation was applied to a coracoid process fracture which was accompanied by ac joint dislocation . in the current case ,
fixation was achieved with 1 screw and a washer following open reduction with an anterior approach . in the current case of isolated fragmented coracoid process fracture showing minimal displacement in a spin bowler cricket player
, surgery was preferred as it was thought that nonunion might be encountered particularly because of the effect of forces around the coracoid .
multicentre , randomized controlled studies would give clearer ideas about the choice of treatment alternatives .
it can be diagnosed more accurately by mr i scan and c t scan . in case of young athletes surgical management
may be a good option to achieve early use of the extremity , good radiological union and better clinical function .
displaced , isolated fracture of the coracoid can be treated with open reduction and osteosynthesis in young athletes to achieve early use of the extremity , good radiological union and clinical function . | introduction : isolated coracoid fractures are rare and few scattered cases are reported in literature .
coracoid fractures can be missed and the treatment for coracoid process fractures is still controversial . the case presented here is of an isolated coracoid process fracture which was treated surgically.case report : a 15-years old male presented after 4 days of injury complaining of persistent pain in the right shoulder following a jerk during bowling .
physical examination revealed tenderness in the left shoulder .
there was pain on abduction and external rotation .
the neurovascular examination was normal .
osseous avulsion of the distal tip of the coracoid process was confirmed by ct and mri .
the short head of the biceps and coracobrachialis was attached to the avulsed tip , while the pectoralis minor was attached to the coracoid base .
the case was managed by open reduction and fixation with a 3.5 mm cannulated screw and washer.conclusion:isolated coracoid fracture is a rare entity causing impairment of upper limb movement .
it can be diagnosed more accurately by mri scan and ct scan . in case of young highly demanding individuals like athletes surgical management
may be a better option as compared to conservative treatment to achieve early use of the extremity , good radiological union and clinical function . |
trabeculectomy remains the surgery of choice in patients with advanced glaucomatous optic neuropathy ( gon ) . in conventional trabeculectomy ,
efforts have been made to improve the outcomes and reduce the complications of trabeculectomy . in this regard ,
the ex - press glaucoma implant was introduced as a nonvalved miniature stainless steel device , designed with the intent of offering a simple and safe alternative to classic trabeculectomy , obviating the need for tissue excision or removal .
express is easier than but not superior to trabeculectomy ; the problem is , that it is a very expensive alternative which the majority of patients in developing countries can not afford .
therefore , we tried to use a low cost alternative which is universally available and can function as an alternative to classic trabeculectomy without the need for tissue excision or removal .
herein , we describe an innovative , simple and cost effective technique using a 24 gauge ( 24 g ) polytetrafluoroethylene ptfe ) intravenous cannula ( ivc ) as an alternative to the classic trabeculectomy .
the first patient was a 50-year - old man with intraocular pressure ( iop ) of 16 mmhg and 32 mmhg on maximal tolerable medical therapy in his right and left eyes , respectively .
best corrected visual acuity ( bcva ) was 20/20 and light perception in his right and left eyes .
the second patient was a 72-year - old male subject with iop of 12 mmhg and 38 mmhg on four topical ocular hypotensive medications , in his right and left eyes , repectively .
bcva of the second patient was 20/20 and no light perception in the right and left eyes , respectively .
both patients underwent glaucoma filtering surgery using a 24 g intravenous cannula ( ivc ) together with application of 0.1 mg / ml mitomycin - c subconjunctivally for 3 min under peri - bulbar anaesthesia .
we specifically selected these end - stage patients due to unknown long - term results and complications of the surgery .
an 8 - 0 polyglactin ( vicryl ) traction suture on a spatulated needle was placed through the superficial cornea near the superior limbus .
consequently , a standard fornix - based conjunctival incision was made to gain exposure to the scleral bed adjacent to the limbus .
gentle cautery was performed in this area . a limbus - based rectangular scleral flap ( 4 mm 4 mm ) of about half scleral thickness
mitomycin - c ( mmc ) 0.1 mg / ml soaked pledgets were applied subconjunctivally for 3 min after coating the cornea with viscoelastic .
a rectangle of deep sclera ( deep scleral groove ) measuring 1 mm 4 mm was made perpendicular to the limbus , leaving a thin layer of deep sclera covering the choroids [ figure 1 ] .
a 24 g ivc with an internal diameter of 0.7 mm ( bd neoflon iv cannula , becton dickinson , helsingborg , sweden ) with bevel of the trocar facing up , was inserted into the anterior chamber ( ac ) at the limbal end of the deep scleral groove and at the center of the blue line , parallel to the iris plane and directed towards the pupil [ figure 2 ] .
the trocar was completely withdrawn when the cannula was 1 mm inside the ac and the ptfe cannula was cut 4 mm from the site of insertion .
the tube was then secured in the preformed deep scleral groove using 10 - 0 nylon sutures [ figure 3 ] .
the function of the tube was ensured by noting the dilution of trypan blue dye applied over the cut end of the cannula .
the scleral flap was sutured using four 10 - 0 nylon sutures and the conjunctiva was repaired meticulously with 8 - 0 polyglactin sutures .
intra - operative photograph showing the 24 g cannula inserted into the anterior chamber ( ac ) through the centre of the blue line at an angle parallel to the iris plane and directed towards the pupil .
intra - operative photograph showing the 24 g cannula placed in the preformed deep scleral groove , secured to the scleral bed using 10 - 0 nylon sutures .
postoperatively , iop of the first patient at 3 , 6 and 9 months ranged from 12 mmhg to 15 mmhg with a well formed anterior chamber and a functioning diffuse bleb .
gonioscopy and anterior segment oct showed the presence of the tube [ figure 4 ] .
iop of the second patient at 6 weeks and 3 months ranged from 12 to 14 mmhg .
anterior segment oct at 9 months follow - up , showing the presence of the tube ( 24 g cannula ) in situ .
however , some of the problems associated with trabeculectomy are attributed to the need for tissue excision and lack of standardization of filtration .
new drainage devices such as the express shunt are being used in an attempt to standardize the technique .
the restricted internal diameter of these devices provides certain consistency and standardization of the filtration procedure and flow regulation is largely governed by the sutures applied to close the scleral flap .
tissue excision or removal is not required , thereby reducing inflammation and complications associated with trabeculectomy .
the major disadvantage of these devices is the added cost of surgery , especially in developing countries like ours .
therefore , we present the use of an inexpensive and widely available 24 g intravenous cannula made of ptfe which is known to entail no toxicity in humans to date . the cannula functions by diverting aqueous humor through the implant from the ac to the intrascleral and subconjunctival spaces , similar to the express device , and offers the advantages of standardization of filtration without the need for any tissue excision , unlike in trabeculectomy where a sclerostomy and an iridectomy are mandatory .
our technique is a simple modification of conventional trabeculectomy aimed at making the surgery simpler and reducing immediate postoperative complications by using a small ostium without any need for iridectomy .
we have introduced a low cost innovation which will help standardize surgery , make it easier and also decrease its learning curve ; this procedure also avoids the need for a sclerostomy or iridectomy thereby minimizing tissue injury . in summary ,
the use of a 24 g intravenous cannula is a cost effective and simple alternative to glaucoma drainage devices in developing countries like ours , alongwith decreased learning curve of the procedure .
we recommend further studies to evaluate the long - term safety and efficacy of this technique . | we describe an innovative technique for performing standardized low cost glaucoma filtration surgery using a polytetrafluoroethylene ( ptfe ) intravenous cannula .
the trocar of a 24 gauge ( 24 g ) ptfe intravenous cannula was used to create a trabeculectomy ostium and its tube was inserted under a partial thickness scleral flap in 2 patients with advanced glaucomatous optic neuropathy , in whom intraocular pressure ( iop ) was not controlled on maximal tolerable hypotensive therapy .
postoperatively , iop of the operated eyes at 3 , 6 and 9 months follow - up ranged from 12 to 15 mmhg with a well formed anterior chamber and a diffuse bleb . |
periodontal disease may present a wide variation of its appearance , which brings lack of uniformity on the criteria that define its aspects .
conventional dental radiography , widely employed as a tool to determine the situation ( presence and extension ) of periodontal disease , is considered adequate to surveys of periodontal bony loss , although it may underestimate the actual alveolar bone loss .
despite the fact that progresses on the standardization of radiographs have been achieved , their use to qualify the periodontal disease still depends on subjective interpretation .
therefore , measurements of alveolar bone loss have a low level of reproducibility , mainly because of the difficulty to visualize the cementoenamel junctions ( cejs ) and alveolar crests ( ac)1,4,6,16,17 . according to some authors7,11,12,19 , digital manipulation of the radiographic images
may improve the reproducibility and the diagnostic value of radiographic interpretation , as the structures are better visualized . once the radiographs are digitalized , filters may be readily applied to enhance visualization of the bone architecture for the measurements of bone loss .
researches on density , contrast and edge enhancement have already proved their usefulness to the diagnosis of caries and alterations of the alveolar bone15,18 . in 1990 , hildebolt , et al.10 assessed the measurements of alveolar bone loss of human skulls on digitized and manipulated interproximal radiographs .
the measurements were done by two examiners with more than 15 years of clinical experience .
he concluded that the digital manipulation technology is highly trustable to establish indices of morbidity of the periodontal disease . according to akesson ,
et al.1 ( 1992 ) , the interpretation of radiographs may be influenced by their quality , the method of diagnosis , and by the operator .
therefore , they studied the influence of different observers on the accuracy of measurements of the bone level using three radiographic methods .
a systematic and substantial inter - examiner variation was observed , even with experienced examiners who received basic trainings from the same school .
this demonstrates the importance of relying the exams and the diagnostic comparisons on the evaluations of various examiners . in 1999 , eickholz , et al.5 assessed the measurements of alveolar bone loss and the depth of the bony defect on nonmanipulated and manipulated digitized interproximal radiographs .
they concluded that the digital manipulation did not improve the efficacy of the evaluation of bone loss when compared to the non - manipulated images .
they concluded that two of the filters reduced the validity of measurements . after comparing the image quality of six digital radiography systems , borg , et al.2 ( 2000 ) observed that manipulation of images by the histogram did not improve their quality .
wolf , et al.19 ( 2001 ) evaluated the reproducibility of linear measurements of interproximal bone loss on digitized radiographs after application of several methods of magnification and manipulation .
they observed that the agreement of identification of the apical aspect of bone defects was lower than the identification of alveolar crests with non - manipulated images .
the intra - examiner reproducibility for assessment of the distance between the cej and the alveolar crest of examiners was different , being higher for the most experienced one .
in general , the intra- and inter - examiner reproducibility of linear measurements on radiographic images was not increased by the manipulation tools of the study ( grayscale manipulation and magnification ) . on the contrary , under certain circumstances
as stated by mol14 ( 2004 ) , and oppositely to what manufacturers say , the digital images do not improve the efficacy of diagnosis if compared to conventional intraoral images . according to the author
the film - based images continue to be technically equivalent , if not superior to the digital images . based on the previous information ,
the aim of the present research paper was to assess the inter- and intra - examiner reproducibility of linear measurements of interproximal bone losses on digital images that were not manipulated and images that suffered different types of manipulation ( brightness - contrast adjustment , negative and pseudocolor ) .
twelve interproximal radiographs of the molar and bicuspid regions of both sides of a dry human skull were used in this study .
since the image receptor is smaller than a conventional number 2 intraoral film , each tooth of these two groups of teeth and their antagonists were radiographed separately . a film holder ( rinn corporation , elgin , il , usa ) , adapted to the size of the sensor
gendex 765dc - gendex dental systems , milan , italy ) , operating at 65 kvp and 7 ma , and a digital radiography system ( radiovisiography - trophy radiology , toulouse , france ) were used .
this time was determined on a pilot study in which the best exposure time would be the one that provided the best image contrast .
all images were saved on non - compressed tiff ( tagged image file format ) format and analyzed by 5 examiners , all oral radiologists , on a computer with a flat , 17-inch screen ( lg studioworks 710e - lg electronics corp . , taubat
the training for utili\ation of image filters was given by the same institution for all examiners .
the examiners had to identify the distance from the cementoenamel junction ( cej ) to the alveolar crest ( ac ) or to the deepest extension of the bony defect ( bd ) .
the digital manipulations and the linear measurements from the cej to the ac or from the cej to the bd were done on the trophy windows ( radiovisiography trophy radiology , toulouse , france ) software which is part of the digital radiographic system .
six different versions were created : 1 ) non - manipulated ; 2 ) brightness - contrast adjustment ; 3 ) negative ; 4 ) negative with brightness - contrast adjustment ; 5 ) pseudo - colored ; 6 ) pseudo - colored with brightness - contrast adjustment .
the distances that represent the mesial and distal bone loss of the mandibular first and second bicuspids , and of the mandibular first and second molars were measured by the five examiners on each version of the twelve images .
each measurement was redone after a two - week interval . to prevent bias of the same measurement ,
each examiner measured the nonmanipulated version of one image , then the brightness - contrast version of a second image , then the negative version of a third image , and so on .
in order to check the error of the method , the measurements from the first and second readings of each examiner were analyzed by linear regression analysis . as long as there were no significant errors in the method ( r=0.9 ) , that means , differences between the first and the second readings were not significant , the mean between the first and the second measurements could be used for statistical analysis . in order to verify
if there were any significant differences among the mean values of the measurements of one same examiner with each filter , data were analyzed using two - way anova test ( 5% level ) .
although the mean values of examiners could be equivalent , the measurements of each region could vary according to each examiner .
this could happen because of the higher or lesser difficulty of each observer to measure a certain region with aid of one or another image filter .
this was the reason why the authors decided to use the two - way anova .
in other words , with this statistical analysis , it would be possible to determine if one specific image filter would facilitate the reading of one specific region .
therefore , it was necessary to determine the influence of each region over the mean values of the measurements of each examiner .
table 1 displays the mean and standard deviation ( sd ) of the measurements taken by each examiner applying each image filter .
table 2 presents the p - value for the comparisons among filters and the p - value for the interaction between the variable " region " and the variable " filter " .
brightness - contrast adjustment d negative with brightness - contrast adjustment f pseudo - color with brightness - contrast adjustment p<0,05 - significant intra - examiner differences .
p<0,05 - influence of the region on the results of the readings by each filter .
the one - way anova test was used to compare the measurements of examiners using one specific image filter . in this case , it was not necessary to verify the influence of the variable " region " over the variable " examiner " .
table 3 shows the mean and sd of the measurements of the 5 examiners using the same filter .
table 4 demonstrates the p - value of the comparison among means of measurements of each examiner using one specific image filter .
a - non - manipulated image b - brightness - contrast adjustment d - negative with brightness - contrast adjustment e - pseudo - color f - pseudo - color with brightness - contrast adjustment p>0,05 - no significant inter - examiner diferences for each filter .
the periodontal disease is clinically diagnosed by assessment of the probing depth and clinical attachment level , which ranges between 1 and 3 millimeters .
the radiographic examination is a complement to clinical diagnosis , since they provide parameters for an adequate treatment planning for each case and helps in the evaluation of alveolar bone response to treatment .
nevertheless , one of the limitations of radiographs is the fact that they are 2d representations of 3d structures and therefore superimposition of images that may mask the actual condition of the alveolar bone may occur8,9,12 .
the height of the alveolar bone may be determined either surgically or in a non - invasive manner by radiographs .
however , there is a tendency of underestimation of bone loss with the non - invasive method1,4,6,17 .
morbidity indices based on radiographs are also limited by the variations of densities of the oral structures , which reduces the accuracy of differentiation of the buccal and the lingual alveolar bone heights , especially when the alveolar crests have lower density or are superimposed by the teeth . in the presence of a non - treated intra - bony defect , it is more difficult to find its apical portion because the bone structure is diffuse
. that may be the explanation for the high prevalence of underestimation or overestimation of bone loss during measurements of distances from the cej to the bd10 .
such obstacles may bring differences on the judgments of the examiner , and are a problem for comparisons among distinct epidemiological surveys17 .
therefore , for many authors3,5,7 the digital radiography has many favorable characteristics for the diagnostic procedure when compared to conventional radiography .
one of them is the possibility to make digital adjustments to increase the image quality , which facilitates the detection of structures on the image .
a number of softwares offer a tool to adjust the gray scale , brightness , contrast , edge sharpening , color modification and grayscale inversion to improve visualization by examiners .
however , some authors like kullendorff and nilsson13 ( 1996 ) , eickholz , et al.5 ( 1999 ) , borg , et al.2 ( 2000 ) , wolf , et al.19 ( 2001 ) and mol14 ( 2004 ) stated that the image filters do not influence the diagnostic process . considering the importance of reproducibility of measurements of bone loss on epidemiological surveys of periodontal disease , the aims of the present research were to verify the intra- and inter - examiner differences regarding linear measurements of periodontal disease on digital radiographs and if the application of image filters affects this reproducibility .
the linear regression analysis did not demonstrate significant differences between the first and second readings of examiners . comparing the six measurements of the same examiner ( table 2 ) , each corresponding to one version of the images ,
the readings of four out of the five examiners were significantly different ( p<0,05 ) .
in general , the use of image filters did not increase the reproducibility of measurements of the examiners .
nevertheless , these authors stated that the lack of experience of one of the observers of their study was the cause of the low reproducibility of measurements , since the most experienced observer presented a high reproducibility level . in the present study ,
the measurements of the most experienced observers ( 1 , 2 e 4 ) were not reproducible ( p<0.05 ) .
the inter - examiner results were compared ( table 4 ) and the p - values demonstrated high level of reproducibility among them using the same image filter ( p>0.05 ) .
it is clear that even with the non - manipulated image ( filter a ) , a high p - value was observed ( p=0.843 ) .
nonetheless , the filters b ( brightness / contrast ) and e ( pseudo - color ) reduced the reproducibility level of measurements .
the results of statistical analyses indicated that application of certain types of image filters affect the radiographic interpretation .
nevertheless , since it was not the aim of the present paper to analyze the validity of measurements , we can not state that the filters improved the diagnostic process . in this study , it was observed that the filters do negatively affect the readings of the same operator . analyzing the measurements of the five examiners ,
it was observed that the negative filter and negative with brightness / contrast adjustment provided better results , since the p - values for those comparisons were higher .
however , we found p>0.05 for all image filters . therefore , in general there was no improvement in inter - examiner reproducibility of measurements of alveolar bone loss with the application of image filters .
it is possible to state , as did akesson , et al.1 ( 1992 ) , that the radiographic interpretation was influenced not only by the radiographs or the method of diagnosis , but also by the examiner .
reliable comparisons of intra - examiner results can be obtained with an index of well - established criteria .
based on the results , we concluded that : in general , the use of image filters did not improve the reproducibility of intra - examiner results .
four out of five examiners presented statistically significant differences ( p<0.05 ) among their measurements regarding the six image filters ; there were no significant differences among the mean values of measurements of examiners using the same image filter .
therefore , a high level of inter - examiner reproducibility was found , independently from the image filter ; the negative filter and the negative with brightness / contrast adjustment filter provided higher p - values to the inter - examiner reproducibility . | the reproducibility of measurements of alveolar bone loss on radiographs may be a problem on epidemiologic studies , as they are based on comparisons of the diagnosis of various examiners .
the aim of the present research paper was to assess the inter- and intra - examiner reproducibility of measurements of the interproximal alveolar bone loss on non - manipulated digital radiographs and after the application of image filters .
five oral radiologists measured the distance between the cementoenamel junction ( cej ) to the alveolar crest or to the deepest point of the bony defect on 12 interproximal digital radiographs of molars and bicuspids of a dry human skull .
the digital manipulation and the linear measurements were obtained with the trophy windows software ( throphy ) . for each image ,
six different versions were created : 1 ) non - manipulated ; 2 ) bright - contrast adjustment ; 3 ) negative ; 4 ) negative with brightness - contrast adjustment ; 5 ) pseudo - colored ; 6 ) pseudo - colored with brightness - contrast adjustment . in order to prevent interpretation bias because of the repetition of measurements , the examiners measured the radiographs in a random sequence .
the two - way anova test at 5% level of significance to compare the means of readings of the same operator with each filter indicated p<0.05 for the majority of operators , while the comparison between the mean values of operators using the same filter indicated p>0.05 for all filters .
based on the results , we concluded that linear measurements of interproximal alveolar bone loss on digital radiographs are highly reproducible among examiners .
nevertheless , the application of image filters significantly influenced the degree of intra - examiner reproducibility .
some filters even reduced the reproducibility of intra - examiner readings . |
since it has been introduced by yasargil in the 1970s11 ) , the pterional or the fronto - temporo - sphenoidal approach has been widely used to approach lesions of the sellar or suprasellar region , circle of willis and sylvian fissure . although the standard pterional approach has been accepted as a safe and appropriate method for various intracranial lesions , several modified approaches , such as the supraorbital eyebrow incision approach9 ) , the mini - pterional approach1 ) , the mini - supraorbital approach2 ) , and the lateral supraorbital approach3 ) , have been recently introduced and used as an alternative for the purpose of reduction in brain exposure to the non - physiological surroundings , such as room air , irrigation media , and accidental surgical trauma .
the lateral supraorbital approach was proposed for operation on intracranial lesions located not only in the sellar and suprasellar regions , but also in the sylvian fissure and retro - sellar regions3 ) .
this modified approach requires much shorter skin incision and much smaller craniotomy than the standard pterional approach .
furthermore , it causes less trauma to the temporalis muscle and no injury to the upper branch of the facial nerve .
this study aimed to compare the lateral supraorbital approach with the pterional approach in the surgical treatment of unruptured aneurysms in the anterior circulation .
between august 2010 and april 2011 , we clipped 86 intracranial aneurysms of the anterior circulation . among them , 68 aneurysms in 61 patients were clipped via the lateral supraorbital ( lso ) approach were enrolled as the lso group .
then , we enrolled the same number of patients ( n=61 ) with 69 aneurysms clipped via the pterional approach between july 2009 and may 2010 as the pterional group . in both groups , all operations with two different approach methods were performed by a single surgeon , at a single institute , over 2-year period .
patients with ruptured aneurysms or multiple aneurysms of more than 3 were excluded from this study .
all data in the present study were based on the medical records and radiologic findings of the patients .
we analyzed the two groups and compared demographic , radiologic and clinical variables , including age , sex , duration of hospitalization , operation time , craniotomy size , aneurysm location , and postoperative complications .
the statistical significance of observed differences between the variables was assessed by the student 's t - test and the chi - square test .
the lateral supraorbital approach conducted in the present study was described in detail by hernesniemi et al.3 ) the patient was placed in the supine position , with the head slightly elevated above the cardiac level . the head is fixed with three pins in the mayfield head frame and was rotated about 30 degrees towards the opposite side and tilted slightly depending on the precise location of the aneurysm .
the skin incision was usually behind the hair line and did not descend in front of the ear to the level of the zygomatic arch ( fig .
the one layer skin - galea - muscle flap was dislocated after detachment from the bone by periosteal elevator and diathermy , thus avoiding any injury of the branches of the facial nerve , and the flap was retracted anteriorly with spring hooks , until the superior orbital rim and the anterior zygomatic arch were exposed .
only one burr hole was made posteriorly , just below the insertion line of the temporalis muscle .
the bone flap was detached mainly by side - cutting craniotome , but the basal part was drilled off before lifting the flap ( fig .
the dura mater was opened in a curvilinear incision pointing anterolaterally and elevated with stitches ( fig .
after minimally opening the sylvian fissure , the dissection was made toward the aneurysm site .
after aneurysm clipping , the bone flap was secured using one skull fixator and two plate and screw systems ( fig .
between august 2010 and april 2011 , we clipped 86 intracranial aneurysms of the anterior circulation . among them , 68 aneurysms in 61 patients were clipped via the lateral supraorbital ( lso ) approach were enrolled as the lso group .
then , we enrolled the same number of patients ( n=61 ) with 69 aneurysms clipped via the pterional approach between july 2009 and may 2010 as the pterional group . in both groups , all operations with two different approach methods were performed by a single surgeon , at a single institute , over 2-year period .
patients with ruptured aneurysms or multiple aneurysms of more than 3 were excluded from this study .
all data in the present study were based on the medical records and radiologic findings of the patients .
we analyzed the two groups and compared demographic , radiologic and clinical variables , including age , sex , duration of hospitalization , operation time , craniotomy size , aneurysm location , and postoperative complications .
the statistical significance of observed differences between the variables was assessed by the student 's t - test and the chi - square test .
the lateral supraorbital approach conducted in the present study was described in detail by hernesniemi et al.3 ) the patient was placed in the supine position , with the head slightly elevated above the cardiac level . the head is fixed with three pins in the mayfield head frame and was rotated about 30 degrees towards the opposite side and tilted slightly depending on the precise location of the aneurysm .
the skin incision was usually behind the hair line and did not descend in front of the ear to the level of the zygomatic arch ( fig .
the one layer skin - galea - muscle flap was dislocated after detachment from the bone by periosteal elevator and diathermy , thus avoiding any injury of the branches of the facial nerve , and the flap was retracted anteriorly with spring hooks , until the superior orbital rim and the anterior zygomatic arch were exposed .
only one burr hole was made posteriorly , just below the insertion line of the temporalis muscle .
the bone flap was detached mainly by side - cutting craniotome , but the basal part was drilled off before lifting the flap ( fig .
the dura mater was opened in a curvilinear incision pointing anterolaterally and elevated with stitches ( fig .
after minimally opening the sylvian fissure , the dissection was made toward the aneurysm site .
after aneurysm clipping , the bone flap was secured using one skull fixator and two plate and screw systems ( fig .
thirteen of the 122 patients ( 6 from the lso group and 7 from the pterional group ) had two aneurysms simultaneously at different locations , and they were treated via a single surgical approach .
two of the 122 patients ( one from the lso group and the other from the pterional group ) had mirror aneurysms at both mca bifurcations , and they were clipped consecutively under a single general anesthesia .
one of 61patients of the lso group had re - operation after surgical treatment for the anterior communicating artery ( aca ) aneurysm , because a residual sac was detected at the postoperative radiologic evaluation .
operation time was estimated from the moment of skin incision to that of skin closure .
craniotomy size was calculated by the equation , { ( long axis diameter+short axis diameter)/2/2}3.14 , and the axis diameters were obtained from postoperative computed tomography ( ct ) images .
the two groups showed similar distributions of aneurysm location and the anterior communicating artery and mca bifurcation were the major aneurysm locations found in both groups ( 60.3% in the lso group and , 73.9% in the pterion group ) .
the number of patients with gyrus rectus partially removed in each group was 11 out of 16 in the lso group and 14 out of 20 in the pterional group . in the lso group ,
the mean operation time of the patients with gyrus rectus removed was 116.2 minutes , which was shorter than ( 129.0 minutes ) in the patients with gyrus rectus preserved .
in contrast , in the pterional group , the mean operation time of the patients with gyrus rectus removed ( 194.5 minutes ) was longer than in patients with gyrus rectus preserved .
several complications were noted postoperatively ( table 2 ) , with low incidence of postoperative complications in both groups and no significant difference between the groups .
not only the improvement of operating microscopes and refined instrumentation but also the development of diagnostic imaging tools focusing on certain intracranial lesions currently allows minimal invasive surgery for the treatment of intracranial aneurysms , instead of the conventional pterional approach , which requires relatively extensive skin , bone , and brain exposure6 ) .
most keyhole approaches , such as the frontolateral , frontolaterobasal , supraorbital and transorbital keyholes , can provide access to various pathologies in the suprasellar and parasellar regions ; however , they have limited working angle , which makes it difficult for the surgeon to manipulate and observe the lesions4,8 ) .
the lateral supraorbital approach was introduced by hernesniemi and is a modified version of the classic pterional approach . when compared with the pterional approach ,
the lateral supraorbital approach provides more anterior trajectory , and consequently offers lesser exposure of the origin of the posterior communicating artery and the anterior choroidal artery . because the origin of posterior communicating artery arises from the posteromedial surface of internal carotid artery and the anterior choroidal artery makes a medial curve initially , the pterional approach with more lateral trajectory has advantage in surgical clipping of these distal interal carotid artery aneurysms . in this study , these aneurysms were successfully clipped via lateral supraorbital approach with no additional difficulties , comparing with clipping via pterional approach .
when the origins of these arteries were not identified , the patency of these arteries after clipping was confirmed by both intraoperative doppler sonography and indocyanine green fluorescence angiography , and motor function of the patient was checked using motor evoked potential ( mep ) monitoring device during operation . when specific surgical approach is selected , the decision - making process must be considered various factors such as surgeon 's experience , anatomic consideration of the aneurysm , and the status of the aneurysm ( ruptured or unruptured ) .
low - lying , broad - neck , and ruptured distal internal carotid artery aneurysm may be obliterated more safely by pterional approach .
the lateral supraorbital approach provides a longer route to the basilar tip and a lesser exposure volume , and consequently needs more frontal lobe retraction before reaching the chiasmatic and carotid cisterns7 ) .
however , in the lateral supraorbital approach , the temporal muscle splitting is limited to its superior and anterior part , because the small skin incision never descends in front of the ear to the level of the zygomatic arch ; thus , any injury of the upper branches of the facial nerve can be avoided by detaching the one layer skin - galea - muscle flap from the bone .
temporalis muscle atrophy caused by denervation , loss of blood supply or inappropriate muscle tension , may be serious cosmetic and functional complications5 ) .
furthermore , the small craniotomy made with only one burr hole in the lso approach can shorten the overall operation time and reduce craniotomy - related complications , such as csf leak , postoperative epidural hematoma and infection ; the size of craniotomy , of course , is sufficient to reach the whole anterior part of the circle of willis , sellar , and suprasellar region3 ) . in this study ,
the operation time in the lso approach was significantly shorter than that of the pterional approach .
for the pterional approach , the long and downward extending skin incision , more splitting of the temporalis muscle , large craniotomy with several burr holes and drilling of the sphenoid ridge could increase both operation time and surgical morbidity3,10 ) .
the limitation of this study is that we did not focus on the postoperative cosmetic and functional results , such as chewing discomfort , temporal muscle atrophy and hyposmia , which may influence the quality of life of our patients .
in our experience , the lateral supraorbital approach provides adequate exposure of the lesion and allows safe neurosurgical manipulation , with much shorter operation time and much smaller craniotomy , thereby decreasing surgical morbidity .
thus , the lateral supraorbital approach for clipping of unruptured intracranial aneurysm could be a good alternative to the classic pterional approach . | objectivethe lateral supraorbital ( lso ) approach is a modified method of the classic pterional approach and it has advantages of short skin incision and small craniotomy compared with the pterional approach .
this study was designed to compare the two approaches in the surgical treatment of unruptured intracranial aneurysms.methodswe retrospectively reviewed 122 patients with 137 unruptured intracranial aneurysms treated by clipping , from july 2009 to april 2011 . between august 2010 and april 2011 ,
61 patients were treated by clipping via the lateral supraorbital approach and the same number of patients treated by clipping via the pterional approach were retrospectively enrolled .
we analyzed the two groups and compared demographic , radiologic and clinical variables.resultsthe mean age of patients in the two groups was 54.6 years ( lso group ) and 55.7 years ( pterion group ) .
the mean duration of hospitalization was shorter in the lso group than in the pterion group ( 7.9 days vs. 9.0 days , p=0.125 ) and the mean operation time was also significantly shorter in the lso group ( 117.1 minutes vs. 164.3 minutes , p<0.001 ) .
furthermore , the mean craniotomy area was much smaller in the lso group ( 1275.4 mm2 vs. 2858.9 mm2 , p<0.001 ) .
the two groups showed similar distributions of aneurysm location and postoperative complications.conclusionthe lateral supraorbital approach for the clipping of unruptured intracranial aneurysm could be a good alternative to the classic pterional approach . |
the finding of a renal mass on imaging is suggestive of metastatic non - small cell lung cancer in the presence of a lung tumor but can also have another origin .
we describe the case of a patient diagnosed with stage iv lung cancer based on a renal metastasis . a second opinion including review of histopathological data and additional imaging followed by lung surgery and cryoablation of the kidney lesion revealed two tumors of different origins , non - small cell lung cancer and a renal cell carcinoma .
the presence of a renal mass diagnosed on a ct scan in a patient with lung cancer is not always synonymous with metastatic disease .
confirmation of diagnosis by tissue sampling is mandatory , especially if a synchronous primary tumor is possible .
the presence of metastatic non - small cell lung cancer ( nsclc ) can be suspected by imaging .
however , tissue sampling is required to confirm the diagnosis , especially if a synchronous primary tumor is possible . in this case report , we present a case with stage iv lung cancer based on a renal metastasis .
a 48-year - old female received palliative radiotherapy ( 30 gy ) directed to vertebrae th9-th12 and 4 cycles of chemotherapy [ gemcitabin 1,200 mg / m ( on days 1 and 8) , carboplatin 80 mg / m ] for an 18-fdg - pet avid , thyroid transcription factor-1 ( ttf-1 ) positive adenocarcinoma of the right lower lobe invading the thoracic vertebrae 10 , and an additional 18-fdg - pet negative lesion in the right kidney , cytology - confirmed adenocarcinoma , considered as a distant metastasis ( ct4nxm1 ) .
therapy resulted in a slight reduction of both lesions . due to the determined stage ( iv )
the patient 's data were reviewed and additional 18-fdg - pet and ct scans were performed . except for the presence of the lesion in the kidney , no signs of metastases were found .
therefore , the initial diagnosis was reconsidered as two primary tumors : an adenocarcinoma of the lung , stage iiib ( ct4n0m0 ) and an adenocarcinoma of the right kidney ( ct1a ) .
two cycles of neo - adjuvant chemotherapy ( cisplatinum 80 mg / m , pemetrexed 500 mg / m on days 1 and 21 ) were administered prior to lung surgery . surprisingly , no tumor was found in the right lower lobe perioperatively .
a hemicorporectomy of th10 and a resection of the processus transversus of th10 and th11 were performed , followed by spine stabilization . with regard to the lesion of the right kidney , an expectative approach
was agreed because of stable disease ( no growth ) , its localization ( in the mid pole of the kidney ) and small size ( 2.3 cm ) .
eleven months later , cryoablation was ultimately performed because the patient insisted on removal of the tumor , which revealed a papillary renal cell carcinoma .
this case report emphasizes the importance of differentiating a primary from metastatic disease when a renal mass is diagnosed on a ct scan in a patient with lung cancer .
although metastases to the kidneys are very uncommon , differentiation between these two entities is crucial for further management and prognosis ( palliative approach vs. curative intent ) [ 1 , 2 ] . on ct scan ,
a solitary metastasis to the kidney is more likely to be found in patients with higher tumor stage of the nonrenal malignancy or when other viscera are also affected .
usually , the metastasis is an asymptomatic , small , endophytic , and solid mass .
the finding of a corresponding hotspot on fdg - pet scan is suggestive of a metastasis , even if it appears to be benign on ct .
however , if the primary tumor is not fgd - avid , this might not be the case .
the possibility of a primary renal neoplasm should also be considered , but with caution , since the low sensitivity of detection of fdg - pet scans .
histology obtained by percutaneous biopsy confirms or strengthens the diagnosis in case of small masses and doubts about performing a nephrectomy .
ttf-1 is a typical marker for adenocarcinoma in the lung , while negative in primary renal neoplasms , as illustrated in fig .
patients with localized lung cancers may obtain long - term survival with surgery . in case of a primary renal neoplasm ,
| backgroundthe finding of a renal mass on imaging is suggestive of metastatic non - small cell lung cancer in the presence of a lung tumor but can also have another origin.case reportwe describe the case of a patient diagnosed with stage iv lung cancer based on a renal metastasis .
a second opinion including review of histopathological data and additional imaging followed by lung surgery and cryoablation of the kidney lesion revealed two tumors of different origins , non - small cell lung cancer and a renal cell carcinoma.discussionthe presence of a renal mass diagnosed on a ct scan in a patient with lung cancer is not always synonymous with metastatic disease .
confirmation of diagnosis by tissue sampling is mandatory , especially if a synchronous primary tumor is possible . |
different etiologies for cystic lesions in the lumbar spinal canal have been reported in the literature , among them hemorrhagic cysts , perineural cysts , dermoid cysts , and parasitic cysts .
the most common lesion seems to originate from the facet joints : the synovial cyst , which represents a protrusion of the synovial membrane into the surrounding tissue .
the literature remains imprecise about the histopathologic nature of cystic lesions in the lumbar region of the spine .
some authors differentiate between the terms synovial cyst ( with a synovial lining ) and ganglion pseudocyst
ligamentum flavum pseudocyst , as a cystic lesion in the lumbar spine , has only rarely been mentioned [ 4 , 5 , 7 , 25 , 28 , 29 ] .
a 70-year - old woman presented with 5-year history of gradually developing gait disturbance as well as pain in the lumbar area , buttock , and right leg , particularly the right knee , involving mostly the l4 distribution .
in the meantime an artificial knee joint was implanted with inadequate recovery of the pain .
motor function was normal and there was no sensory disturbance on examination of the legs .
magnetic resonance imaging revealed at l3l4 level a right - sided voluminous epidural cystic lesion , 10 mm in diameter , which was hypointense on t1-weighted images and hyperintense on t2-weighted images and its wall was enhanced with contrast material .
the mass displaced the dural sac anteriorly and resulted in marked stenosis of the spinal canal .
the mass was surgically resected together with the hypertrophied ligamentum flavum after partial l3l4 hemilaminectomy ( fig . 1 ) . a round , yellowish cyst of about 10 mm in diameter filled with somewhat gelatinous fluid and barely adhered to the dura mater
pathological examination of the cyst revealed myxoid and pseudocystic degeneration of the ligamentum flavum ( fig . 2 ) .
intraoperative view via the surgical microscope showing part of the cyst and degenerated ligamentum flavum ( arrow ) , regular ligamentum flavum ( notched arrow ) , and dura mater spinalis ( arrowhead ) histopathologic section of operative specimen reveals degenerative changes in the ligamentum flavum with infiltration of inflammatory cells and no synovial cell lining ( hematoxylin and eosin )
several studies have shown that the usual aging process of the ligamentum flavum causes thickening and loss of elasticity .
change in proteoglycans , loss of elastic fibers , and increase in collagen tissue and chondroid metaplasia due to mechanical stress have been described . additionally and closely related to age
this amyloid deposition has been reported in only a few cases to be associated with systemic amyloidosis .
a diffuse form of calcification contributing to the loss of elasticity and the thickening and a focal form of calcified material accumulation as well as granulomatous inflammation and tophaceous depositions of calcium pyrophosphate crystals can occur .
these depositions have been ascribed to decreasing cellularity of the ligamentum flavum with age and resultant diminished calcification inhibiting factor production by fibroblastic - like cells .
the tophaceous type of lesion seems to be closely related to previous degeneration of the affected ligament by minor trauma predisposing to calcium deposition .
activity of proteolytic enzymes within the ligament , produced by neutrophils localizing to calcified nodules , has been found .
. found only four patients with calcium pyrophosphate depositions , suggesting that they play a minor role in the pathogenesis of ligamentum flavum pseudocysts .
this seems to follow a sequential process of chondroid metaplasia and eventual enchondral ossification mainly at the insertion site of the ligament .
all these factors , resulting partially from mechanical stress , seem to contribute to loss of the natural structure of the ligamentum flavum , making them again susceptible to new mechanical stress , forming a vicious circle .
the degenerated bony structure of the lumbar spine and the facet joints suggest a major pathogenic role of degenerative segmental instability in pseudocyst formation of the ligamentum flavum , as found by other authors too .
most ligamentum flavum cysts reported in the literature were also located laterally within the spinal canal . while possibly a consequence of chronic bony degenerative disease , this phenomenon may be further elucidated in certain cases by the observation that the yellow ligaments are not as thick laterally as they are medially .
these recesses are filled with epidural fat and offer an area of decreased resistance and may , as a result , tolerate cyst formation .
the pathogenesis of ligamentous degeneration remains to be elucidated , but it may be considered in the context of degenerative spinal changes . the spine is divided into alternating mobile and fixed segments , and the transitional zones between the mobile and fixed regions incur the most severe stress during motion .
the anatomic disposition , histologic characteristics , and biomechanical properties of the ligamentum flavum indicate that it is markedly different from other spinal ligaments .
the ligamentum flavum is a well - defined elastic structure composed of 80% elastic and 20% collagen fibers .
this composition of dense connective tissue with elastic fiber predominance is rarely seen in other tissues , although it can be seen in the vestibular folds of the larynx and the media of large arteries .
when a change occurs in the ligamentum flavum , regeneration of elastic fibers that includes the formation of collagen fibers and degenerative changes occurs , and this regenerative process leads to decrease in elasticity .
moreover , this process in the ligamentum flavum is markedly different from other spinal ligamentous reactions .
thus , chronic irritative or degenerative changes of the ligamentum flavum in the area of the cyst could predispose it to mechanical stress , even after a minor repeated injury .
cysts of the ligamentum flavum have myxoid degeneration and arise from or are partially embedded in the inner surface of this ligament , and in contrast to juxta - articular cysts , are not related to the facet joint cavity .
pathogenesis of the cyst formation is secondary to ligamentous and fibrocollagenous tissue degeneration and hypermobility of the spinal segment , mainly at the transitional zones between the mobile and the fixed segments of the spine .
pathologic ligamentum flavum cysts can contain hemorrhage , and previous degeneration of the ligament may create conditions for the formation of hematoma .
rupture of vessels in degenerated lumbar ligamentum flavum may develop secondary to stretching forces on the back .
the pathogenesis of the hematoma may originate from minor acute or chronic trauma such as minor back injury , physical exertion or heavy lifting [ 20 , 26 ] .
intraspinal ligamentum flavum cysts are rare ; they occur preferentially in the lower lumbar region [ 5 , 15 , 32 ] , while cervical localization is uncommon . in
most of the cases , ligamentum flavum cysts in the lumbar spine occur at l4l5 , the most mobile segment within the lumbar spine , and are frequently associated with lumbar degenerative spondylolisthesis .
continuous stress to the ligamentum flavum due to minor chronic trauma such as listhesis may predispose to the formation of the cyst . only in a few cases
no reports have described the appearance of these cysts in any region other than the mobile spine .
the t210 vertebrae mainly act with the ribs to form the thorax and are not generally considered to be part of the mobile spine ( table 1).table 1reported cases of ligamentum flavum cysts occurring in the spineliterature
n
cervical takano et al . 1 yamamoto et al .
1lumbar haase 1 abdullah et al . 4 vernet et al . 6 savitz et al . 6 baker and hanson 1 bloch et al . 6 mahallati et al . 1 brlocher and seiler 1 terada et al
33 dimario et al . 4 asamoto et al . 1 gazzeri et al
. 2 our case1 reported cases of ligamentum flavum cysts occurring in the spine there are no specific clinical symptoms for ligamentum flavum cyst .
cysts in the spinal canal can impinge upon and displace neural structures and can lead to neurologic symptoms .
the majority of symptomatic cysts usually presents with radiculopathy , such as sciatica in the case of lumbar cysts , and can mimic symptoms related to intervertebral disc herniation . in the study of wildi et al .
, 97% patients complained of radicular pain , 39% showed motor deficits , 55% had sensory changes , 18% had abnormal reflexes , and 33% showed a positive lasque sign .
our patient presented with gradually developing right - sided radicular pain involving mostly the l4 distribution with patellar reflex loss on the same side .
on myelography , these lesions are recognized as intraspinal extradural masses and on postmyelogram computed tomography as a faint cyst adjacent to the ligamentum flavum .
magnetic resonance imaging provides the best images [ 14 , 20 , 25 , 28 ] : on t1-weighted images , the cysts have a variable signal , and on t2-weighted images , the cysts have a high - intensity signal [ 20 , 28 ] .
differential diagnosis of imaging studies between ligamentum flavum cysts and synovial cysts is useful to the surgeon , as the latter are more difficult to resect , requiring exploration of the facet joint .
magnetic resonance imaging , in some cases of synovial cysts , reveals demonstrable communication with the facet joint with enhancement of the synovial cyst wall and of the adjacent facet joint .
synovial cysts often have a calcified rim , while ligamentum flavum cysts do not . in our study ,
magnetic resonance imaging revealed at l3l4 level a right - sided voluminous epidural cystic lesion , 10 mm in diameter , which was hypointense on t1-weighted images ( fig .
3a , b ) and hyperintense on t2-weighted images ( fig . 4 ) and
the computed tomography appearance of synovial cysts is often diagnostic and correlates well with pathologic findings .
they typically consist of a cystic formation whose walls show calcification , and are located adjacent to facet joints that frequently show signs of degeneration .
juxtafacet cysts appear as well - delineated cystic masses ; the rim of synovial cysts is typically isointense to slightly hyperintense compared with cerebrospinal fluid in t1 and hypointense in t2 , and its contents have variable intensities and several classifications have been proposed . in the case of ligamentum
flavum cysts , they are seen adjacent to the ligamentum flavum and there is no observable communication with the spinal facet joint . when intraluminal hemorrhage occurs in a minority of cases , they are easier to distinguish from herniated disk fragments and most neoplasms .
in addition to other cystic lesions that may affect the lumbar spine , calcium pyrophosphate dihydrate deposits have been observed in the ligamentum flavum among patients presenting with lumbar pain and/or radiculopathy , and typically are hypointense on magnetic resonance imaging and show calcifications on computed tomography imaging.fig . 3t1-weighted magnetic resonance image demonstrating a hypointense intraspinal extradural right - sided ligamentum flavum cyst ( white arrow ) : a sagittal pre - gadolinium , b axial pre - gadolinium , c sagittal post - gadolinium , d axial post - gadoliniumfig . 4t2-weighted magnetic resonance image showing a hyperintense signal of the above - mentioned cyst ( white arrow ) : a sagittal , b axial t1-weighted magnetic resonance image demonstrating a hypointense intraspinal extradural right - sided ligamentum flavum cyst ( white arrow ) : a sagittal pre - gadolinium , b axial pre - gadolinium , c sagittal post - gadolinium , d axial post - gadolinium t2-weighted magnetic resonance image showing a hyperintense signal of the above - mentioned cyst ( white arrow ) : a sagittal , b axial differential diagnosis of intraspinal extradural mass lesions includes ligamentum flavum cyst , juxta - articular cysts ( ganglion and synovial cysts ) , arachnoid cyst , perineural cyst , dermoid cyst , infectious cyst , schwannoma , meningioma , and metastasis or nontumorous - type mass lesions including neurofibromas , fibrous dysplasia , ependymal cyst , and rheumatoid arthritis pannus [ 15 , 20 , 23 ] .
ligamentum flavum and juxta - articular cysts can be definitely distinguished only by their pathological findings .
the goal of surgery is spinal decompression as well as resection of the cyst and affected ligamentum flavum .
complete excision at the base of the ligamentous insertion of the cyst assures a minimal rate of recurrence .
reported recurrence of the cyst in the remaining ligamentum flavum in two patients 1 year after surgery .
while nearly 95% of all operated cysts can be removed in their entirety , a major reported intraoperative difficulty lies in the presence of adhesions to the dural wall , which is the main causative factor of incomplete resection .
complete removal of pseudocystic lesions generally has excellent results [ 2 , 9 , 14 , 27 , 28 , 30 ] .
ligamentum flavum cysts represent a rare cause of lumbar nerve root compression or spinal stenosis .
histologically , these degenerative changes represent a distinct entity different from ganglion or synovial cysts .
radical removal of pseudocyst guarantees in nearly all cases complete relief of radiculopathy and seems to prevent recurrence of such a lesion at the same level . | degenerative changes in the lumbar spine can be followed by cystic changes .
most reported intraspinal cysts are ganglion or synovial cysts .
ligamentum flavum pseudocyst , as a cystic lesion in the lumbar spine , is a rare and unusual cause of neurologic signs and symptoms and is usually seen in elderly persons ( due to degenerative changes ) .
they are preferentially located in the lower lumbar region , while cervical localization is rare .
complete removal of the cyst leads to excellent results and seems to preclude recurrence .
we report the case of a right - sided ligamentum flavum cyst occurring at l3l4 level in a 70-year - old woman , which was surgically removed with excellent postoperative results and complete resolution of symptoms .
in addition , we discuss and review reports in the literature . |
the relationship between autism and imitation deficits was envisaged long time ago by ritvo and province , short after autism was originally described in the work of kanner .
the imitative ability has been acknowledged to play an essential role in normal development , as it can be used by infants to acquire and master new behaviors [ 3 , 4 ] . in recent years
, the relationship between autism and voluntary imitation has been investigated more systematically . in their review , for instance , williams et al . concluded that children with an autism spectrum disorder ( asd ) are consistently impaired in performing imitative tasks relative to children with other developmental delays ( matched for chronological age , verbal iq - mental age and expressive language ( see [ 6 , 7 ] ) , or to normal controls matched for mental age [ 7 , 8 ] .
asd children performed more poorly on imitation tasks than matched - to - language controls or younger children matched for receptive language and mental age , thus ruling out the interpretation that the imitation impairment is due to a linguistic deficit .
neither can the imitative deficit of asd individuals be attributed to a defective gesture recognition [ 6 , 8 ] , since they recognized gestures without any trouble . moreover , asd individuals ' fine grained motor skills , even when reduced , did not correlate with their observed imitation and praxis deficits .
moreover , irrespective of whether they are low or high functioning , children with autism seem to have difficulties in imitating gestures that disable children and typically developing children do not show .
this finding supports the view that imitation deficits are specific to asd ( see also ) . whether the reduced ability to imitate of asd children is a true deficit or a delay in development is still under debate .
this deficit seems to be already present in children as young as 20 months and is , in general , more apparent in children than in adults .
consistently , an improvement in performance was observed when young asd children , with a mean age of 31 months , were retested about one year later .
williams et al . proposed that observing a meaningful ( mf ) object or gesture triggers the release of a previously rehearsed program or that observing a desired outcome might lead the observers to reach this goal by applying their own problem solving ability .
hence , imitation itself would be especially required for copying meaningless ( ml ) gestures that do not have an obvious goal or associated knowledge .
this would explain why in some studies asd children were reported to experience more difficulty when imitating ml compared with mf gestures involving objects [ 6 , 7 ] .
it has been shown that asd children imitate goal - directed actions as well as healthy children with the same verbal mental age do .
argued that the ability to imitate ( and understand ) the goal of hand actions is intact in asd children who , however , might fail to perform the imitation tasks in which they can not rely on a hand - goal strategy as in the case of ml actions .
they also suggested that it is unlikely that a unique neurocognitive mechanism underlies imitative behavior in either the typical or autistic brain .
consistently with this view , hamilton put forward a dual - route model for emulation and planning versus mimicry ( ep - m model ) and proposed that the latter is impaired in children with autism . according to this model ,
the mirror neuron system is fractioned into an indirect , parietal route for goal emulation and planning and a direct occipitofrontal route for mimicry . in the case of the e - p route
, the presence of an object or goal allows an individual to extract the teleological understanding of the action and to reconstruct the same action by his / her own means .
the m - route is based on the analysis of low level kinematics of an action and allows the formation of direct associations from visual input to motor output .
however , whether children with asd are able to imitate communicative gestures ( such as waving a hand for goodbye ) is still debated .
communicative gestures , even though they have been included in the assessment of more than one study , have either been analysed together with other gesture types ( e.g. , ) or , when analysed as a separate class , they were found to be imitated normally .
this latter result is difficult to interpret because , in addition to the instruction to imitate , participants were also provided with verbal encouragement ( e.g. ,
moreover , different studies used different tasks and included participants of different ages ( for children see ; for adolescents see ; for adults see ) .
if , according to the ep - m model , children with autism have a selective damage to the mimicry route [ 10 , 11 ] , one would predict that they should be equally impaired at imitating novel as well as symbolic , communicative gestures .
in fact , as these two types of gestures do not have an obvious outcome , children can not rely on an emulation and/or problem solving .
a different set of predictions can be drawn based on a dual - route model of action imitation ( see also [ 13 , 14 ] ) that is also consistent with the conclusions reached by williams et al . .
the key feature of tessari and rumiati 's model is the presence of two different mechanisms subserving imitation : a direct route necessary for reproducing novel , ml actions , as it translates the visual input into a motor output and an indirect route that can be used only for imitating over - learned , mf actions , as it accesses the stored representations of the motor act . since both symbolic communicative ( i.e. ,
intransitive ) and transitive gestures ( i.e. , actions that involve the use of objects ) are already known by the subjects , imitation of either type of gestures should be comparable in terms of accuracy . after brain damage , each mechanism can be selectively impaired , giving rise to different imitation deficits affecting either known or novel actions [ 1518 ] .
in particular , when the direct route is damaged , patients can not imitate novel actions , while when the indirect route is damaged , they can not use it to imitate known actions .
these findings were observed when known , and novel actions were presented in separate lists . in the present study
, we aimed to clarify how high - functioning autistic ( hfa ) children imitated different types of actions ( i.e. , known mf symbolic communicative , pantomime of object use , and novel ml actions ) and to test which of the available models best accounts for their impaired - preserved imitative pattern .
importantly , we consider that investigating imitation performance in asd is highly valuable as it allows testing current theoretical models of imitation .
thirteen high - functioning children with autism ( m = 7.31 years old , sd = 1.79 ; all males ) and 14 typically developing children ( m = 7.00 years old , sd = 1.71 ; all males ) participated in the study .
age did not differ between the two groups ( t(26 ) = 0.46 , p > 0.1 ) .
all children were right - handed ( average on the percentage of right hand use hfa : m = 90.91% , sd = 15.02 , controls : m = 89.89% , sd = 16.62 ) .
all autistic participants were clinically diagnosed as having a pervasive development disorder not otherwise specified according to dsm - iv .
none of the patients had comorbid attention deficit and hyperactivity disorder ( adhd ) , seizure disturbance , or any other associated disorder known to cause autism .
high - functioning autistic participants were selected if they had a full scale iq > 70 and they scored above threshold for autistic spectrum disorder on the children autistic rating scale ( cars ) or ados ( see table 1 ) . children with autism
typically , developing children were recruited from local schools and were administered an intelligence scale ( wisc , verbal subscale ) by the experimenter .
ethical permission for the study was granted by sissa ethical committee , and informed consent was given by one parent of each child .
stimuli consisted of five sets of 12 simple , nonsequential gestures each . of these ,
three sets included mf gestures : 12 transitive gestures without objects like , for instance , pretending to pour from an imagined bottle ( all taken from ) , 12 intransitive symbolic gestures like , for instance , waving goodbye ,
( all taken from ) , and 12 transitive gestures performed with an object like , for instance , pouring from a real bottle .
the remaining two sets included 24 meaningless ( ml ) gestures , obtained by modifying the relationship between hand , arm , and trunk of the mf transitive and intransitive gestures .
each action was displayed up to two times for 3 seconds on a computer screen using presentation software ( neurobs ) .
all actions were modelled by a female adult using her right hand arm ; subjects were only given the instruction do what she does without mentioning the hand they should use .
when performing the gestures , the model kept the gaze fixed straight ahead , thus avoiding confound effects regarding the possibility of reading intentions from gaze .
participants ' performance was video - recorded and scored offline by a rater , blind to the predictions of the study and to group membership , who was instructed to code each action using a 3-point scale system : 0 for totally incorrect , 1 partially correct , and 2 for correct imitation . for the partially incorrect imitative performance ,
the rater was asked to code the errors with one of 15 a priori defined error - types ( see the appendix ) and report the hand used in each trial .
participants could begin the experimental session either with mf ( 3 blocks ) or ml gestures ( 2 blocks ) , and this order was counterbalanced across participants .
an additional rater scored the performance of approximately 30% of the participants , and a good interraters agreement was obtained ( cohen 's kappa = 0.65 , s.e .
two types of assessment were carried out in order to ascertain what participants knew about the intransitive and transitive gestures employed in the study .
for the symbolic intransitive actions , participants were asked to say whether they knew the meaning of each action ( n = 12 ) ; for the transitive gestures , participants were presented with the corresponding object and asked to demonstrate how it is normally used .
this latter task allowed us also to evaluate participants ' hand dominance , given that no instructions were provided to the children as to which hand they should use with the object placed on the table in front of them .
the order of the imitative tasks and of the knowledge assessment tasks was counterbalanced across subjects .
for each participant , mf ( transitive or intransitive ) gestures that were not recognized were not included in the analysis .
hfa children were able to recognize on average 74.36% ( sd = 14.22 ) and control children 85.61% ( sd = 5.16 ) of the intransitive gestures .
hfa children were able to demonstrate the use of objects ( transitive actions ) on average 98.71% ( sd = 3.13 ) and control children 100% .
a repeated - measures anova on percentage of imitative correct responses with meaning ( ml , mf ) and context ( transitive , intransitive ) as within - subjects independent variables and with group ( hfa , controls ) as a between - subjects variable ( see figure 1 ) was performed .
overall , the hfa group imitated more poorly ( m = 73.26 , se = 3.96 ) than the control group ( m = 90.10 , se = 3.82 ) ; meaningful actions ( m = 89.10 , se = 2.22 ) were performed better than meaningless ( m = 74.28 , se = 3.54 ) , and the accuracy with intransitive actions ( m = 82.33 , se = 2.72 ) and transitive actions was comparable ( m = 81.01 , se = 3.32 ) .
main effects of group and meaning were found to be significant ( f(1 , 26 ) = 9.355 , p = 0.005 ; f(1 , 26 ) = 45.84 , p < 0.001 , resp . ) but not the main effect of context ( f(1 , 26 ) = 0.26 , p > 0.05 ) . as predicted , the two - way interactions group meaning ( f(1 , 26 ) = 6.21 , p < 0.05 ) were significant but not the two - way interaction group context ( f(1 , 26 ) = 0.26 , p > 0.05 ) nor the 3-way interaction ( group context meaning : f(1 , 26 ) = 0.35 , p > 0.05 ) .
context meaning interactions were also found significant ( f(1 , 26 ) = 14.59 , p = 0.001 resp . ) . in order to better understand the interactions , we performed subsequent post hoc analysis .
as to the meaning group interaction , no differences were found between hfa and control children in imitation of mf actions ( tukey , p > 0.1 ) , whereas differences were found for imitation of ml actions ( tukey , p < 0.05 ) . the difference between imitation of mf and ml actions
is driven mostly by hfa children who imitated ml actions more poorly ( tukey , p < 0.001 ) .
control children imitated mf actions somewhat better than ml actions ( tukey , p = 0.024 , see figure 1 ) .
regarding the context meaning interaction , no significant differences were found in imitating transitive and intransitive ml actions ( tukey , p > 0.1 ) , while intransitive mf actions were found to be better imitated than transitive mf actions ( tukey , p = 0.019 ) .
however , the context meaning interaction seems to be mostly driven by differences in imitating intransitive actions : imitation of intransitive mf actions and imitation of intransitive ml actions were highly significant ( tukey , p < 0.001 ) ( with bonferroni correction for p values ) . the two groups did not significantly differ as far as imitation of actions involving real objects was concerned ( f(1 , 26 ) = 1.59 , p > 0.05 ) .
importantly , we found no significant correlation between individual iq quotients and the imitative performance on neither ml actions ( r = 0.34 , p > 0.05 ) nor mf actions
( r = 0.32 , p > 0.05 ) . in order to assess whether children iq level influenced their individual imitative performance , we computed an analysis of covariance ( ancova ) with group ( hfa , controls ) and iq scores as predictors .
the covariate variable ( iq ) was standardized prior to performing the analysis , by centering the mean ( see ) .
consistent with the correlational analysis , we found that overall iq level did not influence participants imitative performance ( f(1 , 24 ) = 2.362 , p > 0.1 ) , not even when the meaning of actions was taken into account ( iq meaning interaction : f(1 , 24 ) = 0.232 , p > 0.6 ) .
we correlated the performance on imitation of mf and ml actions , regardless of whether they were transitive or intransitive , with the age of the control participants and of the hfa children , respectively ( see figure 2 ) .
we found that the imitative performance of the control group on ml actions ( but not that of meaningful actions , r = 0.51 , p > 0.05 ) significantly correlated with increasing subjects ' age ( r = 0.56 , p < 0.05 ) , while the imitative performance of the hfa group on either type of gestures significantly correlated with their increasing age ( mf : r = 0.72 , p < 0.05 ; ml : r = 0.79 , p < 0.001 ) . due to a clear outlier in the control group ( a child with 4 years old ) , we have recalculated the correlations regarding the control group excluding this participant .
in contrast with the hfa group , the results show now that neither the performance of ml actions nor of mf actions correlated with the age of participants ( mf : r = 0.06 , p > 0.55 ; ml : r = 0.29 , p > 0.05 ) .
participants could imitate a gesture by selecting the same limb used by the model ( i.e. , anatomical imitation ) or by using the one on the same side of the model 's body as if they were looking in a mirror ( i.e. , specular imitation ) .
it has often been claimed that typically developing children at a young age tend to prefer specular over anatomical imitation and that the preference becomes apparent when they are about 12 years old .
which kind of imitation asd children prefer is still not clear . in one study , unlike controls , adults with autism did not benefit from viewing other person 's mirror - image movements , while in another one , both control and asd children showed a preference for mirror imitation of hand actions . in these studies , since the model performed the action using the left hand in half of the trials while the imitator tended to use predominantly the dominant right hand , it is difficult to establish whether participants preferred the specular to the anatomical imitation .
figure 3 plots the percentage of trials in which participants used the left hand ( specular imitation ) to imitate the different types of gestures .
although the autistic group made more use than the control group of specular imitation in all imitative tasks , on the mann - whitney u test for independent samples , no significant differences were found between the two groups on imitation of transitive ( u = 0.46 , p > 0.1 ) and intransitive ml gestures ( u = 0.20 , p > 0.1 ) , transitive with ( u = 1.6 , p > 0.1 ) and without ( u = 0.23 , p > 0.1 ) the actual object at hand , and intransitive mf gestures ( u = 0.41 , p > 0.1 ) .
in the current study we aimed to understand whether children with autism have a generalized deficit in imitating all gesture types or they only fail with object nonrelated gestures .
we therefore tested a sample of high - functioning children with a clinical diagnosis of autism and an age - matched sample of typically developing children for their ability to imitate either novel or known gestures .
gestures could , or could not , involve the presence of an object ( transitive or intransitive ) . in agreement with williams et al .
view , we found that , relative to control children , high - functioning autistic children were more impaired in imitating novel than known actions .
in addition , we found that the imitative performance of either group of participants was not dependent on whether the gesture implied the use of an object or not ( transitive versus symbolic communicative ) , as both mf transitive and symbolic communicative gestures were imitated equally well by both groups .
in particular , the finding that imitation of object - related actions as well as symbolic communicative gestures is preserved in asd children is inconsistent with the hypothesis put forward by hamilton . according to this author 's proposal ,
children with autism are able to imitate only gestures that imply the use of an object ( or include a clear goal ) as its presence allows the emulation of the action instead of mimicry .
an individual emulates an observed action by first extracting the goal of the action and then planning and reconstructing it by its own means .
the fact that hfa and control children imitate equally well mf actions that do not have an object associated ( i.e. , symbolic communicative gestures ) challenges the view that autistic children are only able to emulate .
the finding that , in hfa children , imitation of both transitive and intransitive mf actions is intact while imitation of ml actions is impaired strongly suggests that they suffer from a selective damage to one of the two putative mechanisms for action imitation hypothesised by tessari and rumiati : the direct route .
the access to the representational system for actions stored in memory appears to be intact in these children .
our results could possibly have useful implications for an early diagnose of the disorder , in that , we suggest that only the use of ml actions is appropriate for assessing imitation skills . due to several factors ,
the diagnosis of autism is still often made quite belatedly ( around 6 years of age ) because it is based on the assessment of language skills that do not develop before the first year of life .
our study suggests that testing imitation could be used for identifying the eventual presence of the disorder without having to wait for the emergence of linguistic abilities , particularly in high - functioning children . the fact that hfa children imitated mf actions that convey a communicative meaning just like the control group did is apparently in contrast with the view that autism is primarily associated with social deficits ( e.g. , ) . according to this position , and in contrast to our data
, it should be expected that the stimuli that pose difficulties for autistic children are those that carry emotional or social content .
although any type of imitation procedure involves the interaction between the child and another person , not all imitation procedures seem to be impaired in asd children .
what is striking about our results is that , while the gestures that explicitly carried social or communicative content were correctly imitated by the asd children , the gestures that did not have any special social content were not correctly imitated . as imitation processes
have been acknowledged to play an important role in empathy , for they promote shared mutuality in social interactions and force social bonding , the social deficits in autism , such as poor interaction with others or retraction from social interaction , might be secondary to and develop as in consequence of the imitation deficit described in asd .
regarding imitation of both ml and mf gestures , the accuracy of autistic children tended to improve with participant 's increasing age .
the recovery of symptoms in asd has long been debated and mechanisms that might promote it have been systematically scrutinized ( see for a review ) . although our results can not be taken as definitive evidence , they are in agreement with the hypothesis that the imitative asd children 's difficulties might not represent a true deviance but rather a delay in development , as they ameliorate as children get older . therefore , the imitative deficit could be expected to back down as the child gets older . in the present study
, we evaluated the ability to imitate of high - functioning autistic children using a voluntary imitation procedure rather than an automatic imitation paradigm ( see e.g. , ) , whereby participants show a facilitation effect ( shorter reaction times , rt ) when executing a prefixed movement at the same time as they observe the same movement ( compatible trials ) ; in contrast , observing a movement incompatible with the preinstructed one leads to an interference ( longer rt ) .
this paradigm has been suggested to tap the mirror neuron system in humans ; as performance on it has been found to be preserved in asd , it is not clear whether asd individual performs poorly on imitation tasks due to a malfunctioning mirror neuron system .
although we do not directly tackle automatic imitation in the present study , we predict that an abnormal mirror neuron system would affect primarily actions that are already present in one 's own repertoire ( known actions ) .
we failed to find any difference between specular and anatomical imitation . in approximately half of the trials
, participants did prefer to imitate with their nondominant hand , mirroring the observed movement .
overall , our results suggest that , for both autistic and typically developing children , imitating an observed movement in a specular manner might be beneficial . in conclusion ,
our main findings on the imitative performance of hfa children inform us of a dissociation between imitation of mf actions and imitation of ml novel actions .
this fact is rather suggestive of a preserved indirect memory - based mechanism to imitation together with a potentially malfunctioning direct route to imitation . | it has been suggested that children with autism are particularly deficient at imitating novel gestures or gestures without goals . in the present study , we asked high - functioning autistic children and age - matched typically developing children to imitate several types of gestures that could be either already known or novel to them .
known gestures either conveyed a communicative meaning ( i.e. , intransitive ) or involved the use of objects ( i.e. , transitive ) .
we observed a significant interaction between gesture type and group of participants , with children with autism performing known gestures better than novel gestures .
however , imitation of intransitive and transitive gestures did not differ across groups .
these findings are discussed in light of a dual - route model for action imitation . |
the den2-s2 virus used in the primary screen was isolated via serial passage of den2-ngc ( a gift from dr .
a. de silva unc - ch ) in d.mel-2 cells ( invitrogen ) . the experimental schedule for the primary and secondary screens is outlined in fig .
the human screen was done with huh-7 cells treated independently with two sirnas ( qiagen ) for each gene product and den2-ngc according to the schedule outlined in fig .
infected cells were labeled with the anti - e , 4g2 primary antibody ( isolated from the di-4g2 - 4 - 15 hybridoma ( atcc#hb-112 ) ) and alexa-488 anti - mouse secondary ( invitrogen ) , and counterstained with hoescht 33342 ( sigma ) . imaging and analysis of infection was done with a cellomics arrayscan vti hcs machine .
selection of candidates from the primary screen was done using a nonparametric approach , the sum rank algorithm , in order to produce an appropriate summary statistic of each dsrna tested in duplicate . briefly , within each plate
, wells were ranked by the percentage of infected cells , with the well with the lowest percentage infected cells given rank = 1 . for each dsrna tested in duplicate , we calculated a sum rank ( sr ) statistic using the formula : sr = rank on plate # 1 + rank on plate # 2 .
the number of times a given sr is expected to occur near the lower extreme ( sr = 2 ) for a single pair of duplicate plates is given by : e[sr ] = ( sr - 1 ) / ( # valid wells ) .
srs were calculated for every dsrna in the drosophila genome , with e[sr ] scores below 0.065 used to select potential targets ( 218 dsrnas ) for further analysis ( see supplementary fig .
| dengue fever ( df ) is the most frequent arthropod - borne viral disease of humans , with almost half of the world 's population at risk of infection1 .
the high prevalence , lack of an effective vaccine , and absence of specific treatment conspire to make df a global public health threat1 , 2 .
given their compact genomes , dengue viruses ( denv 1 - 4 ) and other flaviviruses likely require an extensive number of host factors ; however , only a limited number of human , and an even smaller number of insect host factors have been identified3 - 10 . to discover insect host factors required for denv-2 propagation , we carried out a genome - wide rna interference screen in drosophila melanogaster cells using a well - established 22,632 dsrna library .
this screen identified 116 candidate dengue virus host factors ( dvhfs ) ( supplementary fig .
1 ) .
while some were previously associated with flaviviruses ( e.g. , v - atpases and alpha - glucosidases)3 - 5 , 7 , 9 , 10 , most dvhfs were newly implicated in denv propagation .
the dipteran dvhfs had eighty - two readily recognizable human homologues and , using a targeted sirna screen , we showed that forty - two of these are human dvhfs .
this indicates remarkable conservation of required factors between dipteran and human hosts .
this work suggests novel approaches to control infection in the insect vector and the mammalian host . |
standing from a seated position and walking are basic components of many daily activities
and have been analyzed using various methods .
the sit - to - walk ( stw ) task involves the
sequential motions occurring from standing to initiating gait .
magnan1
and kerr2 , 3 examined the stw task using a three - dimensional motion analysis
system and ground reaction force plates .
these authors analyzed the timing of defined events
such as task onset , seat off , and toe off in movements and in phases divided by these events
during the stw task while focusing on the velocity of the body s center of gravity and the
ground reaction force , and revealed that seat - off and gait initiation were executed
simultaneously in healthy participants .
kouta4 showed that the forward and vertical speeds of the center of gravity
during the stw task were lower in elderly adults than in younger adults .
similarly , most
other studies of the stw task have focused on the transition between standing and gait
initiation .
dion5 defined this
transitional ability or strategy as fluidity or a fluid strategy , and developed a
fluidity assessment scale known as the fluidity index ( fi ) .
fi was shown to associate with
general clinical measurements and decreasing fluidity among patients with hemiplegia5 .
fi is calculated using the change in forward momentum of the center of
gravity , and thus can objectively and sensitively evaluate fluidity .
however , large
equipment , such as a motion analysis system , is required to calculate fi ; therefore , the
fields in which fi can be used are limited . to address this problem , malouin7 developed the fluidity scale ( fs ) , in which
fluidity is assessed on a four - point graded ordinal scale .
this grade is determined using
the timings of trunk extension completion and first toe off .
these devices are sufficiently small
and lightweight to be carried by a subject without hindering motion . therefore ,
accelerometers enable measurements not only in laboratory settings , but also in clinical
settings , which are not equipped with motion analysis systems .
these devices have been
widely used in various contexts , including gait analysis8,9,10,11,12,13 and sit - to - stand
tasks14 , 15 .
the timed up - and - go test , which includes elements of the stw task ,
has been analyzed using accelerometers16,17,18,19 .
weiss16 examined healthy participants and patients with parkinson s disease
and showed that an accelerometer - based assessment was better than an assessment based only
on a stopwatch .
although it is feasible to use an accelerometer to evaluate fluidity in the
stw task , this application has not previously been reported .
the aim of this study was to evaluate the possibility of an accelerometer - based fluidity
evaluation .
we compared event timings in the stw task calculated with an accelerometer to
those calculated using a three - dimensional motion analysis system and foot pressure sensing
system .
we have also discussed the possibility of estimating fi from the timing of these
events and the magnitude of acceleration .
the participants were 16 healthy young males ( mean age : 23.7 2.2 years , mean height :
174.2 3.7 cm , mean weight : 67.5 8.1 kg ) without any disabilities that would restrict
performance of the stw task .
the epidemiologic research ethics committee of gunma university
faculty of medicine approved this study ( no .
the stw task was performed under conditions based on those reported by malouin et al7 .
participants sat on a chair without a back
support or armrests and with a seat height standardized to 100% of the individual
participant s leg length .
participants were instructed to look forward and , during the task ,
to fold their arms on their chest . after the start of the data collection
, participants
remained in a stationary position for 3 s , and upon hearing an auditory cue were required to
stand up and walk toward a target placed 2 m in front of the chair .
participants practiced the task at each speed until
they could reproduce the movements smoothly and naturally .
each trial was then recorded
simultaneously using a three - axial piezoelectric acceleration sensor ( ta-513 g , nihon khoden ,
tokyo , japan ) , a motion capture system ( ma3000 , anima , tokyo , japan ) with six infrared
cameras , and a foot pressure sensing system ( walk way , anima ) .
the sampling frequency was
100 hz . the acceleration sensor was directly attached to the skin between the l3 and l4
vertebrae13 , 18 , 19 and was orientated to
measure the sagittal , frontal ( medial - lateral ) , and vertical planes . in this study , only
sagittal data were analyzed .
reflective markers were attached to the acromion , anterior
superior iliac spine , greater trochanter , knee joint , lateral malleolus , and head of the
fifth metatarsal on both sides of the body .
acceleration and kinematic data were filtered
using a zero - phase low - pass filter with a cut - off frequency of 8 hz . a typical acceleration waveform and definitions of the events
1.a typical acceleration waveform and definitions of the events from acceleration and
reference dataa negative change indicates anterior trunk inclination or backward acceleration .
a
positive change indicates posterior trunk inclination or forward acceleration . when
the trunk inclines , the accelerometer detects gravitational acceleration .. the onset of the stw task was defined as the point at which the acceleration
exceeded two standard deviations ( sd ) of the mean of data from the 3-s stationary period
this was compared to the onset time of the stw task calculated as the initiation of forward
acromion motion as recorded by the motion capture system .
after initiation of the stw task ,
sagittal plane acceleration was negative and reached a local minimum .
this was defined as
the first peak , and the timing of the first peak was compared to the timing of maximum trunk
inclination recorded by the motion capture system .
the last positive peak , which was followed by rapid negative
acceleration , was defined as the second peak .
the timing of the second peak was then
compared to the timing of the first heel strike determined using the foot pressure sensing
system . for each comparison ,
a bland - altman plot was generated by plotting the difference
between the two measures against the mean of the two measures to provide a visual
representation of heteroscedasticity .
, a simple linear regression analysis was performed using the accelerometer - measured
event timing as the independent variable and the motion analysis system- or foot pressure
sensor - measured event timing as the dependent variable .
phase 1 was defined as the onset of the stw task to the first peak ,
phase 2 as the first peak to the second peak , and phase 1 + 2 as the onset of the stw task
to the second peak .
a typical acceleration waveform and definitions of the events from acceleration and
reference data a negative change indicates anterior trunk inclination or backward acceleration .
this index corresponds to the percent
change in the body forward momentum , which is calculated from motion capture system data . in
a typical trial ,
the forward body momentum increases immediately after the peak initiation
of motion and subsequently decreases to the lowest value .
fi is calculated as the ratio of the lowest to the peak value . in a fluid
motor strategy ,
the body forward momentum is maintained or slightly decreased after the
first peak , and this is reflected by a higher fi .
simple and multiple linear regression
analyses were performed to estimate the fi from acceleration data . in these analyses ,
the
durations of phase 1 , phase 2 , and phase 1 + 2 and the magnitude of the second acceleration
peak were used as independent variables . in all statistical analyses ,
all statistical analyses were performed using spss statistics 22.0
( ibm , armonk , ny , usa ) . statistical significance was set at p < 0.05 .
differences in the timing of events calculated using either accelerometer or reference data
( motion analysis system or foot pressure sensor ) are shown in table 1table 1.differences of event timings measured by two systemsspeed conditiononset of stwaccelerometer -motion analysis system1st peak -maximum trunk inclination2nd peak -heel strikemean sd 95% cimeansd95% cimeansd95% cicomfortable0.200.140.070.470.100.050.20 0.00 0.040.070.180.09maximum0.270.160.050.590.050.040.14 0.04 0.050.050.140.04stw : sit - to - walk , sd : standard deviation , ci : confidence interval .
accelerometer - defined stw task initiation appeared sooner than did motion
analysis data - defined task initiation under both speed conditions .
the second acceleration peak
and first heel strike were also simultaneous . according to the bland - altman analysis ,
the results of a
simple linear regression analysis to estimate the timing of events from the acceleration
data are shown in table 2table 2.results of a single regression analysis to predict event timing from acceleration
dataspeed conditionregression equationrcomfortableonset = 2.11 + 0.59 ( timing of onset defined by
acceleration)0.36*maximum trunk inclination = 1.29 + 0.81 ( timing of 1st peak)0.61***heel strike = 0.73 + 0.90 ( timing of 2nd peak)0.96***maximumonset = 1.56 + 0 .67 ( timing of onset defined by
acceleration)0.56**maximum trunk inclination = 0.05 + 1.02 ( timing of 1st
peak)0.88***heel strike = 0.22 + 0.97 ( timing of 2nd peak)0.95 * * * * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . for all events ,
fi , the
duration of each phase , the magnitude of the second acceleration peak , and the results of a
simple linear regression analysis to estimate fi are shown in table 3table 3.results of a single regression analysis to predict fi from the duration of each
phase and the degree of second peak accelerationmeansdregression equationrfi ( % ) comfortable70.717.5maximum95.75.4phase 1 ( s)comfortable0.550.15fi=81.76 20.06 ( phase 1)0.03maximum0.410.15fi=96.96 2.95 ( phase 1)0.01phase 2 ( s)comfortable0.850.17fi = 142.10 83.63 ( phase 2)0.64**maximum0.560.08fi = 118.85 2.95 ( phase 2)0.34*phase 1 + 2 ( s)comfortable1.40.24fi=140.81 49.96 ( phase 1 + 2)0.46**maximum0.970.15fi=108.84 13.56 ( phase 1 + 2)0.14magnitude of 2nd peak acceleration
( m / s)comfortable2.251.36fi=77.13 0.28 ( 2nd peak)0.05maximum2.511.79fi=93.25 + 0.98 ( 2nd peak)0.11 * p < 0.05 , * * p < 0.01 .
phase 1 :
duration from the onset of the sit - to - walk task to the first peak .
phase 1 + 2 : duration from the onset of the
sit - to - walk task to the second peak . under the comfortable speed condition , the durations of phase 2 and phase 1 +
2
similarly , in the multiple regression analysis , only the
duration of phase 2 was retained for both speed conditions .
stw : sit - to - walk , sd : standard deviation , ci : confidence interval .
2nd peak : the last positive peak followed by
rapid negative acceleraiton * p < 0.05 , * * p < 0.01 , * * * p < 0.001 * p < 0.05 , * * p < 0.01 .
phase 1 :
duration from the onset of the sit - to - walk task to the first peak .
phase 1 + 2 : duration from the onset of the
sit - to - walk task to the second peak
the acceleration waveform recorded during the stw task was similar to that reported by
mellone et al.19 for the timed up - and - go
test .
to evaluate the events identified using the acceleration waveform , we compared the
event timings with those of events identified using other data , namely motion analysis
system and foot pressure sensor data .
some differences between the two measurements were
apparent from the results ; however , bland
altman plots indicated that these differences were
random and small , yet sufficient to identify specific events .
the timing of the first
acceleration peak agreed with the timing of maximum trunk inclination .
therefore , the first
acceleration peak can be used to identify the completion of trunk inclination and the switch
to an extension movement .
the second acceleration peak was similar to that observed by
zijlstra9 and mellone19 in accelerator - based gait analyses .
these
authors defined the timing of the second peak using a peak detection method and equated this
peak to the heel strike . in the present study
, we used the same method to identify the
second peak and found that the outcome compared well with the heel strike determined from
foot pressure sensor data .
events such as the maximum trunk inclination and first heel
strike have been used in kinematic analyses .
fs , which evaluates whether the first
toe off occurs before the completion of trunk extension , correlates with the fi .
therefore , in this study we used
the timing of the first heel strike , which appears clearly on the acceleration waveform and
exhibits a similarly high correlation with the fi .
phase 2 is defined as the period from
maximum trunk inclination to the first heel strike and therefore includes the transition
from sitting to standing to gait initiation . during this phase ,
motor control is important
for maintaining a high momentum . in addition , in the maximum speed condition , phase 2 was
the best predictor of fi , but the coefficient of determination was slightly lower than that
observed in the comfortable speed condition . in the maximum speed condition ,
this finding might explain why the
determination was lower at the maximum speed than at a comfortable speed .
in the present
study , it was difficult to estimate the fi from the magnitude of the second acceleration
peak .
, we clarified that accelerometer data could be used to conveniently and
precisely estimate the fi .
it must be considered , however , that all study participants were
healthy young individuals .
the acceleration waveforms in elderly individuals or patient
populations are not necessarily identical to those in healthy young individuals . in
addition
a
peculiarity of this sensor renders it difficult to distinguish between dynamic acceleration
and gravitational acceleration ( static acceleration ) .
in other words , it is difficult to
identify precisely whether the waveform indicates anteroposterior movement or accelerometer
inclination .
, this method should be
used for the clinical analysis of elderly individuals or patient populations . to improve the
precision of this method
, it might be useful to test other types of accelerometers such as
capacitance - type or equipping gyroscope accelerometers . | [ purpose ] the purpose of this study was to clarify the validity of accelerometer data for
quantifying fluidity during the sit - to - walk task .
[ subjects ] the participants were 16
healthy young males . [ methods ] the timing of events ( task onset , maximum trunk
inclination , and first heel strike ) was determined from the acceleration waveform and
compared to the timing determined from a three - dimensional motion analysis ( task onset ,
maximum trunk inclination ) or foot pressure sensor data ( first heel strike ) .
regression
analysis was used to estimate the fluidity index ( fi ) from the duration between events and
the magnitude of the acceleration peak .
the task was performed at two speeds ( comfortable
and maximum ) .
[ results ] a comparison of the timings from two different systems indicated
no systematic bias .
specific events could be identified from acceleration data using
regression analysis under both speed conditions . in addition
, significant regression
equations predictive of fi were constructed using the duration between events under both
speed conditions .
the duration from the maximum trunk inclination to the first heel strike
was the best predictor of fi .
[ conclusion ] accelerometer data may be used to precisely and
conveniently evaluate fluidity .
the clinical utility of these data should be tested in
elderly individuals or patient populations . |
gangliocytic paragangliomas ( gps ) are rare and peculiar benign tumors , encountered mostly in the periampullary area of the duodenum and much less frequently in the jejunum or third part of the duodenum .
some studies have reported that approximately 90% of gps are found in the second part of the duodenum , from where the tumor can invade the ampulla of vater ( aov ) .
gps of the duodenum may present as incidental endoscopic and radiologic findings or as gastrointestinal bleeding due to ulceration of the overlying mucosa .
gastrointestinal bleeding is the most common clinical presentation , followed by abdominal pain and anemia .
we present the case of a 41-year - old female with gp of the duodenum , along with the clinical data , histology , and immunohistochemical staining results that correlated well with previously reported characteristics of duodenal gps .
a 41-year - old female was admitted due to a history of abdominal pain . on admission ,
contrast - enhanced computed tomography ( ct ) revealed a well - defined , enhancing , 2-cm , oval - shaped mass in the second portion of the duodenum , adjacent to the aov .
magnetic resonance cholangiopancreatography showed a well - defined , 2-cm , oval - shaped subtle t2 hyperintense lesion in the second portion of the duodenum , adjacent to the aov , as well as a normal common bile duct .
upper gastrointestinal endoscopy revealed a 2-cm subepithelial tumor in the ampullary portion of the duodenum ( fig .
histopathology revealed spindle cells , ganglion - like cells , and epithelioid cells in the submucosal layer of the duodenum ( fig .
this case showed characteristic histologic features of a tumor composed of three cell types ( epithelioid , spindle , and ganglion ) , which classified the tumor as a gp .
4 ) . histology showed a well - demarcated lesion in the submucosal layer of the duodenum ( fig .
a follow - up upper gastrointestinal endoscopy performed 2 months later revealed scar formation in the resection site with convergence of the surrounding folds .
various theories of the pathogenesis of duodenal gps have been proposed , but the histogenesis of these tumors is uncertain .
a gp is known as a " 10% tumor , " based on the frequency of the inherited forms of the disease .
approximately 30% of gps show 10 types of susceptibility gene ( " 10-gene tumor " ) .
advances in the genetic studies of paragangliomas will have important consequences for the monitoring of patients , from genetic counseling to personalized clinical management .
typical histologic patterns of gp include an admixture of ganglion - like cells , carcinoid tumor - like areas , and spindle cell proliferation .
immunohistochemical staining of this tumor showed a strong positive reaction for the s-100 protein in the spindle cells , while the epithelioid and ganglion - like cells expressed synaptophysin ( fig .
several authors have reported that the epithelioid and ganglion cells are positive for neuroendocrine peptides , such as somatostatin , pancreatic peptide , and serotonin .
the incidence of gps is slightly higher in males than in females ( 1.8:1 ) , and the mean age of appearance is 54 years ( range , 17 to 83 ) .
gps are considered benign even though they occasionally involve the regional lymph nodes and display distant metastasis or tumor recurrence , features suggestive of malignancy .
the characteristic ulceration and bleeding of the overlying mucosa lead to the usual clinical manifestations of melena and sometimes massive hematemesis and unexplained anemia .
approximately 50% of patients seek medical attention for gastrointestinal bleeding , but this case did not have a history of gastrointestinal bleeding episodes .
duodenal gps are larger than 1.5 cm in at least one dimension and tend to be ulcerated and to bleed .
obstructive jaundice is less common in ampullary gp , but obstructive jaundice due to paragangliomas has been reported .
the majority of reported duodenal gp cases have been benign in nature , and simple excision of the tumor is deemed sufficient . the emr procedure is safe and easy to perform , because the tumor protrudes into the duodenum . when endoscopic resection is not possible , surgical resection is indicated , and when regional lymph nodes are positive for metastasis , pancreaticoduodenectomy followed by local radiotheraphy is recommended . because the possibilities of recurrence and metastasis can not be excluded completely , decisions on the treatment method to use must be made after careful preoperative staging of the disease prior to local treatment .
furthermore , continuous follow up at the outpatient department for early detection of recurrence is necessary . | gangliocytic paragangliomas ( gps ) are rare tumors of the duodenum , presenting as single sessile or pedunculated polypoid masses .
clinical manifestations of duodenal gps can vary from an incidental finding at endoscopy to frequent upper gastrointestinal bleeding caused by mucosal ulceration and abdominal pain .
gps are considered benign , but the disease can recur and spread to regional lymph nodes . a 41-year - old female presented with abdominal pain .
upper gastrointestinal endoscopy revealed a subepithelial tumor of the ampulla of vater in the second portion of the duodenum .
the tumor was resected using the endoscopic mucosal resection technique .
the tumor was diagnosed as benign gp of the duodenum using histological and immunohistochemical staining procedures . |
block copolymers self - assemble
on the 10100 nm length scale
and are attractive materials to structure direct inorganic components
into materials with mesoscale features .
one route to such materials involves the use of block copolymers
as sacrificial templates .
this strategy
involves selective degradation of one polymer block to form ordered
mesoporous structures and deposition of inorganic materials into the
open mesopores . in particular , this approach has been used for the
synthesis of inorganic network structures for metals and metal oxides .
the incorporation of two distinct inorganic components into
the
same block copolymer template enables the fabrication of previously
unknown classes of complex , multifunctional materials for a wide range
of potential applications .
thomas and co - workers reported coassembly of a binary mixture
of sio2 and au nanocrystals of different sizes with a lamellar - forming
diblock copolymer .
the segregation of the nanocrystals to different
areas within the structure was based primarily on entropic contributions .
alternatively , li et al . demonstrated synthesis
of ordered metal networks from coassembly of abc triblock terpolymers
and a mixture of pt and au nanoparticles , where the pt and au nanoparticles
localized in specific areas within the structure based on ligand chemistry .
stamm and co - workers reported orthogonal deposition
of two different metal nanoparticles into different domains of block
copolymer thin films .
this process was achieved through a combination
of coassembly with the first polymer domain and nanoparticle deposition
using adsorption to the second polymer domain in a separate processing
step .
furthermore , in no previous
examples have two inorganic components been orthogonally deposited
into two different domains of bulk block copolymer films via an etching
and backfilling mechanism . using
a templating approach would require
block copolymers that can be orthogonally degraded and backfilled .
with orthogonality here we mean that two of the three blocks of the
abc terpolymer can be degraded and backfilled independently from one
another , without interference from the other .
abc triblock terpolymers
where two different blocks could be removed
orthogonally would enable fabrication of composites constituted by
two distinct inorganic materials in two different domains separated
by a third polymer domain .
in the case of triply periodic network
structures , two separate networks could be sequentially degraded and
the resulting porous structures backfilled , providing access to triply
periodic composite structures .
abc triblock terpolymers and their
composites benefit from the formation of triply periodic network morphologies
over larger composition regions than diblock copolymers . in addition , their use opens potential pathways to remove the remaining
third block after orthogonal backfilling to produce porosity in the
final composite structure . to that end ,
we synthesized a series
of new triblock terpolymers
of polyisoprene - block - polystyrene - block - poly(propylene carbonate ) ( pi - b - ps - b - ppc ) that self - assemble into cocontinuous network morphologies including
the q alternating gyroid , o orthorhombic
network , and q core shell double gyroid morphologies
and have orthogonal degradability of the polyisoprene ( pi ) and poly(propylene
carbonate ) ( ppc ) end blocks in bulk films .
the pi block was degraded
using irradiation with uv light , and the ppc block was labile in basic
solutions . via electroless plating and seeded growth deposition au ,
ni , and cu metals were deposited into the mesoporous channels produced
by degradation of either the pi or ppc blocks , as evidenced by transmission
electron microscopy ( tem ) .
as a proof of principle , we report the
orthogonal deposition of au and cu metal into a single polymer template
through sequential degradation and backfilling of the pi and ppc blocks ,
respectively .
incorporation of au and cu metal was characterized using
high - angle annular dark field scanning transmission electron microscopy
( haadf stem ) and haadf stem tomography .
the polystyrene ( ps ) block
could be removed from the final composite structures by pyrolysis
or dissolution to remove any remaining organic material .
salen co(iii ) complex ( 1 ) was prepared according to
previous literature procedures .
pi - b - ps - oh ( supporting information ) , 1 , and [ ppn]cl were added to a 150 ml fischer porter
bottle in a glovebox . propylene oxide was added to the reactor to
produce the following concentrations : [ pi - b - ps - oh ]
= 14 mm , = 1.4 mm , [ ppn]cl = 1.4 mm .
the reactor
was sealed in the glovebox , removed and pressurized to 6.8 atm with
co2 .
the
length of the poly(propylene carbonate ) ( ppc ) block produced is proportional
to the reaction time .
after the desired chain length is achieved ,
the reactor was depressurized , and the polymerization was quenched
by adding methanol .
a small amount of ppc homopolymer is produced
during the rapid chain - shuttling polymerization of ppc due to initiation
from the pentafluorobenzoate and chloride anions on the catalyst and
cocatalyst , respectively .
the pi - b - ps - b - ppc triblock terpolymer was purified
by dissolving precipitated polymer in minimal amounts of thf , and
adding methanol to precipitate the polymer from solution .
the dissolution
and precipitation process was repeated a total of three times to remove
residual 1 , [ ppn]cl salt , and ppc homopolymer from the
pi - b - ps - b - ppc .
polymer overlayers were removed from
the film surfaces using air
plasma in a harrick plasma cleaner .
films were plasma cleaned for
10 min and removed from the plasma cleaner and turned over a total
of four times for a total of 40 min of plasma treatment .
uv
degradation was performed using a uvp el - series 8w lamp with
a wavelength of 302 nm .
plasma - cleaned polymer films were irradiated
with 302 nm uv light to selectively degrade the pi block .
the polymer
films were placed at a distance of 3 in . under an 8w 302 nm uv lamp
for 72 h.
the polymer films were soaked in methanol for 48 h to remove
any small molecule degradation products .
the uv treatment cross - links
the ps block slightly , which appears as a broadening of the molar
mass distribution of the polymers from dissolved films by gpc after
uv treatment .
cross - linking of the ps to the point of insolubility
was observed only for the top surface of the polymer film ; the amount
of insoluble material was too small to be quantified by mass .
plasma - cleaned
polymer films were soaked in a solution of 1.25
m naoh : methanol at a 1:2 ratio by volume for 60 h to selectively degrade
the ppc block .
small - molecule degradation products were removed by
soaking the degraded films in methanol for 48 h. no adverse effects
on the ps or pi blocks were observed after degradation with naoh .
rather
than the degradation sequence pi first and then ppc , the degradation
order can be reversed , degrading the ppc block first and then the
pi block ( i.e. , naoh first , followed by uv degradation ) .
electroless
and seeded growth deposition procedures can be found
in the supporting information .
we synthesized a series of new orthogonally degradable
pi - b - ps - b - ppc triblock terpolymers
using a combination of anionic and rapid chain - shuttling polymerization
( figure 1a ) . in rapid chain - shuttling
polymerization (
also called immortal polymerization ) , the polymerization
reaction is catalyzed using a lewis acid catalyst in the presence
of chain - shuttling agents ( csas ) such as alcohols . when the rate of
chain - shuttling between csas is faster than the rate of monomer incorporation ,
controlled molar masses and narrow molar mass distributions result .
rapid chain - shuttling polymerization is the catalytic variant of
a living polymerization , requiring substoichiometric amounts of catalyst
relative to the number of chains produced in the polymerization , rather
than stoichiometric amounts of an initiator .
polyisoprene - b - polystyrene diblock copolymers were synthesized using
the sequential living anionic polymerization of isoprene and styrene
and terminated with a hydroxyl group ( pi - b - ps - oh )
to act as macro - chain - shuttling agents .
poly(propylene carbonate ) was grown off of the macro - chain - shuttling
agents via the alternating copolymerization of propylene oxide and
co2 by a salen co(iii ) complex ( 1 ) and a bis(triphenylphosphine)iminium
chloride ( [ ppn]cl ) cocatalyst .
we chose a polycarbonate block to potentially tune the block chemistry
through functionalized terminal epoxides and for potential resistance
of the polycarbonate block to oxidative conditions .
we designed the
new pi - b - ps - b - ppc triblock terpolymer
to have orthogonal degradability and found the pi and ppc blocks could
be removed via irradiation with 302 nm uv light and naoh , respectively
( figure 1b ) .
synthesis and orthogonal degradation schemes
of abc triblock terpolymer
pi - b - ps - b - ppc .
( a ) synthesis of
pi - b - ps - oh using anionic polymerization and synthesis
of pi - b - ps - b - ppc triblock terpolymers
from the parent pi - b - ps - oh diblock copolymer using
rapid chain - shuttling polymerization of propylene oxide and co2 using 1 .
( b ) schematic illustrating orthogonal
degradation of pi and ppc blocks of pi - b - ps - b - ppc from a q core
we mapped out sections of the pi - b - ps - b - ppc phase space to locate compositions where
the triblock terpolymers self - assembled into cocontinuous network
structures such as the cubic q alternating gyroid , the
orthorhombic o network , and the cubic q core
the structure is made
up of two chemically distinct minority gyroid networks of pi and ppc ,
respectively , embedded in a matrix of the ps block .
similarly , in the o network structure , the
structure consists of two chemically distinct orthorhombic continuous
minority networks of pi and ppc , respectively , embedded in a matrix
of ps . finally , in
the q core
shell double gyroid the structure
is made up of two gyroid minority networks of ppc coated with a shell
of ps . in this case
different pi - b - ps - b - ppc triblock terpolymers and their compositions for which we identified
these self - assembled network structures are summarized in table 1 .
pi - b - ps - b - ppc
terpolymers from table 1 will be referred to
as pi - b - ps - b - ppc - x , where x denotes
table 1 entry number . determined by h nmr
spectroscopy in cdcl3 ( 400 mhz ; n = 8 , d1 = 10s , pw = 45 ) .
subscripts denote number
of monomers in each block determined by gpc in thf at 30 c
vs ps standards .
the structure of
terpolymer 1 was
assigned to a o network structure with orthorhombic lattice
and lattice parameters of a = 33.9 nm , b = 49.4 nm , and c = 82.1 nm ( vide infra ) .
film structures formed during self - assembly
of pi - b - ps - b - ppc triblock terpolymers
were characterized
using a combination of small - angle x - ray scattering ( saxs ) as well
as transmission and scanning electron microscopy ( tem and sem ) .
saxs
patterns for the polymers from table 1 and
analysis can be found in the supporting information ( figure s6s8 ) .
selective polymer degradation
of one block has been
reported for block copolymers containing polyesters , poly(methyl methacrylate ) ,
polyisoprene , polybutadiene , poly(ethylene oxide ) and polysiloxanes .
hillmyer and co - workers reported the synthesis of mesoporous polylactide
through selective degradation of polybutadiene with internal olefin
metathesis .
emrick and co - workers reported
orthogonal degradation of disulfide and phosphoester - functionalized
polyolefin triblock terpolymers dissolved in solution but did not
backfill nor characterize resulting porous solids .
hillmyer and co - workers reported orthogonal degradation
of abc triblock terpolymer thin films of polyisoprene - block - polystyrene - block - polylactide , where the polyisoprene
block was degraded using ozonolysis , and the polylactide block was
degraded using sodium hydroxide .
however ,
ozonolysis of the triblock partially degraded the polylactide block
in addition to the polyisoprene block , and removal in bulk polymer
films was not demonstrated . additionally , hawker and co - workers reported
the orthogonal degradation of thin films of a supramolecular complex
of poly(ethylene oxide)-trityl - b - poly(styrene - r-4-hydroxystyrene ) and poly(styrene - r-4-vinylpyridine)-b - poly(methyl methacrylate ) .
orthogonal degradation was demonstrated by acid cleavage of the
trityl ether linkage and uv degradation of the poly(methyl methacrylate )
blocks .
in contrast , the pi and ppc blocks of pi - b - ps - b - ppc triblock terpolymers were orthogonally
degradable in bulk films .
the pi block was degraded using 302 nm uv
light , and the ppc block was degraded by soaking the polymer film
in a solution of naoh .
irradiation of the block copolymers with 302
nm uv light in the presence of oxygen resulted in degradation of the
pi blocks and cross - linking of the ps blocks with no apparent effects
on the ppc blocks as evidenced by gel - permeation chromatography ( gpc ,
figure 2 ) and h nmr spectroscopy
( supporting figures s9s12 ) .
after each subsequent
degradation step , in gpc we observed a clear shift of the polymer
to lower molar mass ( figure 2a , b ) .
orthogonal
degradability was demonstrated on pi - b - ps - b - ppc-1 ( o network structure ) and
pi - b - ps - b - ppc-3 ( q core
shell double gyroid ) using gel permeation chromatography
( gpc , figure 2 ) and scanning electron microscopy
( sem , figure 3 ) . in the experiment leading
to gpc traces in figure 2a ,
the pi block was
degraded first , resulting in a shift in the gpc trace to lower molar
mass and broadening of the molar mass distribution , especially on
the high molar mass side .
this broadening is due to weak cross - linking
of the ps block still allowing gpc analysis .
polymer films retained
their network structure after removal of the pi blocks as evidenced
by sem ( figure 3a ) .
next , the ppc block was
degraded using naoh solution ; as a result , we observed a further shift
in the broadened gpc trace to lower molar mass .
after removal of the
pi and ppc blocks ( 51 vol % ) , the periodic network structures
were retained as suggested by the sem micrograph in figure 3c .
alternatively , in experiments leading to the
traces in figure 2b , the ppc block was degraded
first , resulting in a shift to lower molar mass and retention of the
narrow molar mass distribution .
structures were retained after ppc
block removal as evidenced by sem ( figure 3b ) .
next , the pi block was degraded using uv light resulting in a
further shift of the gpc trace to lower molar mass as well as broadening
of the molar mass distribution due to weak ps cross - linking ( vide
supra ) .
the ps domains also retained their original structure after
removal of the two end blocks in sequence : ppc first and then pi ,
as suggested by the sem micrograph in figure 3d . from the sem and gpc data sets , we demonstrated that degradation
of the pi and ppc blocks can be performed orthogonally with retention
of the original block copolymer structure .
orthogonal degradation
of pi - b - ps - b - ppc polymer films ( q and o ) as evidenced
by gpc .
( a , b ) gpc traces of pi - b - ps - b - ppc-1 polymer films after ( a ) degradation of the pi ( matrix ) blocks
followed by degradation of the ppc ( gyroid minority networks ) blocks ;
( b ) degradation of the ppc blocks followed by degradation of the pi
blocks .
orthogonal degradation of pi - b - ps - b - ppc polymer films ( q and o ) as evidenced
by sem micrographs of the corresponding polymer film cross sections
after ( a ) degradation of pi blocks only ( pi - b - ps - b - ppc-3 ) ; ( b ) degradation of ppc blocks only ( pi - b - ps - b - ppc-3 ) ; ( c ) degradation of pi blocks
followed by degradation of ppc blocks ( pi - b - ps - b - ppc-1 ) ; ( d ) degradation of ppc blocks followed by degradation
of the pi blocks ( pi - b - ps - b - ppc-1 ) .
the sem micrographs in figure 3 are high - magnification
images showing local structure retention after different sequences
of pi and ppc block removal .
a low - magnification sem micrograph showing
mesoporosity over the entire field of view for a film cross - section
can be found in the supporting information ( figure s13a ) .
furthermore , sem micrographs of film surfaces after
removal of the pi and ppc blocks ( figure s13b
and s13c , respectively ) demonstrate that the film surfaces
were porous after degradation , allowing for diffusion of metal plating
solutions into the mesoporous polymer templates ( vide infra ) .
we used electroless and seeded growth
deposition to backfill au , cu , and ni metal into mesoporous templates
produced by orthogonally degrading the pi and ppc blocks of the networked
pi - b - ps - b - ppc templates .
electroless
and seeded growth deposition were used , as they do not require conducting
substrates and have been demonstrated to be effective for block copolymer
template systems .
mesopores from both pi and ppc degradation were presumed
to be hydrophilic from a mixture of carboxylic acids and hydroxyl
groups formed by pi degradation and from ppc degradation ,
respectively .
electroless deposition of ni metal into gyroidal mesoporous
templates has been reported by hashimoto and co - workers , hsueh et al . , and
du sart et al .
au metal was backfilled
using a seeded growth process adapted from work reported by ho and
co - workers .
sita and co - workers demonstrated
cu metal deposition into lamellar block copolymer templates using
electroless deposition .
tem micrographs
of resulting structures after deposition of au , ni , and cu metal separately
into the pi and ppc pores from various pi - b - ps - b - ppc terpolymer templates are shown in figure 4 .
au , ni , and cu metal appear dark in the tem micrographs ,
providing contrast in the images .
we backfilled the pi matrix pores
of pi - b - ps - b - ppc-4 ( q core
shell double gyroid ) with au ( figure 4a ) , ni ( figure 4c ) , and cu ( figure 4e ) , demonstrating that three different metals can
be deposited into a single template . additionally , for au , we also
deposited metal into the gyroid minority ppc pores of the q core shell double gyroid structure of pi - b - ps - b - ppc-3 ( figure 4b ) ,
demonstrating that orthogonal degradation can be used to fabricate
metal networks with different structures .
we backfilled ni metal into
the ppc minority network of the o template ( pi - b - ps - b - ppc-1 , figure 4d ) and backfilled cu metal into the pi minority network pores from
the q template ( pi - b - ps - b - ppc-2 , figure 4f ) , verifying metal backfilling
is not specific to only the q core
deposition of au metal into the polymer templates
resulted in patchy coverage of areas 1001000 nm in size , depending
on distance of the au gyroid from the film surface .
patchy deposition
of au metal could be the result of the use of sodium borohydride rather
than hydrazine as a reducing agent or
the result of decomposition of the plating solution .
we expect future
optimization of the au plating solutions would result in more uniform
deposition of au metal throughout the mesoporous template .
alternatively ,
ni and cu metal both resulted in more uniform metal deposition throughout
the film . with this work
, we demonstrated that three different metals
could be deposited into the pi and ppc pores of the various networked
templates .
sem micrographs of freestanding au and ni networks after
removal of the remaining organic material are available in supporting figures s14s16 .
tem micrographs
of metal deposited into networked porous templates
using electroless deposition ( cu , ni ) , and seeded growth deposition
( au ) .
( a ) deposition of au in pi pores ( pi - b - ps - b - ppc-4 ) and ( b ) ppc pores ( pi - b - ps - b - ppc-3 ) .
( c ) deposition of ni metal into pi pores ( pi - b - ps - b - ppc-4 ) and ( d ) ppc pores ( pi - b - ps - b - ppc-1 ) .
( e ) deposition of cu metal
into matrix pi pores ( pi - b - ps - b - ppc-4 )
and ( f ) minority network in pi pores ( pi - b - ps - b - ppc-2 ) . as a proof of principle
, we demonstrated
first steps of the orthogonal
deposition of au and cu metal networks into a single polymer template
using sequential degradation and backfilling of the resulting mesopores .
although seeded growth deposition of au metal was the least uniform
throughout the templates , we used au deposition due to the chemical
resistance of au metal to acidic and basic conditions as well as other
metal precursor solutions .
after degradation of the pi block ,
au metal was deposited into the mesoporous templates of pi - b - ps - b - ppc-4 . following au deposition ,
the ps block was left behind in the
template and was unaffected by the degradation or backfilling process .
because of the incomplete backfilling of the
pi pores with au , we expected that electroless deposition would deposit
cu metal not only into the ppc pores of the structure but rather into
any remaining void space not occupied by au , including the remaining
matrix pi pores .
although the micrograph from figure 5a is consistent with deposition of metal into both the matrix
and gyroid minority networks of the structure , such micrographs alone
were insufficient to elucidate exactly where each metal was located
within the structure .
as a first effort along these lines , the ps
block was removed using dissolution in thf to leave behind freestanding
au and cu metal networks , which were then imaged using sem ( figure 5b ) . while sem micrographs were consistent with both
sets of pores being filled , they also did not further elucidate exact
metal locations .
orthogonal deposition of au and cu metal into pi - b - ps - b - ppc-4 triblock terpolymer templates .
( a ) tem
micrograph of au and cu metal networks ; dark regions indicate the
presence of metal .
( b ) sem micrograph ( secondary electron detector )
of au and cu metal networks ; ps block was removed using dissolution
in thf .
therefore , we turned our attention
to high - angle annular dark field
scanning transmission electron microscopy ( haadf stem ) to distinguish
the au and cu networks due to increased contrast between the two metals .
in haadf stem imaging , contrast between two materials is proportional
to roughly the square of the atomic number , z. haadf
stem micrographs of two different projections of the same hybrid imaged
in figure 5 are shown in figure 6a , b .
the stem micrograph
in figure 6a is consistent with the projection
of the q core
likewise ,
the stem micrograph in figure 6b is consistent
with the projection of the q double gyroid structure .
bright regions correspond to higher atomic number au networks , while
lighter gray regions correspond to cu gyroid networks .
figure 6 clearly demonstrates that orthogonally degrading
and backfilling the different pore spaces with two different inorganic
( metal ) compounds was successful .
this is corroborated by basic stem
projection simulations of the and projections with au
metal in double - gyroid majority network ( matrix pi derived ) pores
only ( figure 6c , e ) and cu metal in both gyroid
majority and minority network ( pi and ppc derived ) pores ( figure 6d , f ) , which are consistent with the experimental
stem micrographs in figure 6a , b .
one detail
that became evident from analyzing these images is that the gold strut
size appears bigger than that of the cu deposits .
this may be attributed
to distortions of the block copolymer template structure during or
after deposition of au .
the fact that we saw this only for au and
not for cu is consistent with higher surface mobility of au at moderate
temperatures , particularly in nanostructures .
the stem projection simulations in figure 6c f were generated to reflect the differences in strut size
between au and cu metals . finally , in order to further elucidate the
three - dimensional ( 3d ) character of both networked metal deposits ,
we reconstructed a 3d model of the sample using haadf stem tomography
( figure 7a and 7b ) .
the reconstruction clearly shows that both metals , au ( yellow ) and
cu ( red ) are network structures .
a movie created from the haadf stem
tilt series is available in the supporting information .
haadf stem micrographs of au and cu metal networks from pi - b - ps - b - ppc-4 terpolymer templates .
( a , b )
haadf stem micrographs of au and cu networks in single template ; bright
regions indicate au metal , while gray regions indicate cu metal .
( c f ) incoherent
stem simulations of q double gyroid metal structures .
( c , e )
simulations of projections in ( a , b ) with au metal only in the matrix
( majority ) network pores .
( d , f ) simulations of projections in ( a , b )
with cu metal in both majority network and minority network pores .
3d reconstruction of au and cu metal networks
from pi - b - ps - b - ppc-4 terpolymer
templates .
( a , b ) 3d reconstruction
with haadf stem tomography of au ( yellow isosurface rendering ) and
cu ( red volume rendering ) metal networks where red regions indicate
cu metal and yellow regions indicate au metal .
( a ) large - area reconstructed
region and ( b ) close up of region contained in white box in ( a ) revealing
both cu and au networks .
in summary , we report the synthesis of
a new orthogonally degradable
pi - b - ps - b - ppc triblock terpolymer
and the deposition of multiple metals into the resulting porous structures
using sequential degradation and backfilling . we synthesized the pi - b - ps - b - ppc triblock terpolymers using a
combination of anionic and rapid chain - shuttling polymerization and
identified regions in the phase space where the triblock terpolymers
self - assembled into cocontinuous network morphologies .
we orthogonally
degraded the pi and ppc blocks of various networked terpolymers to
yield ordered mesoporous templates .
we deposited au , ni , and cu metal
separately into porous networks produced from degradation of the pi
and ppc blocks .
finally , we sequentially degraded the pi and ppc blocks
and backfilled the structure with au and cu metal to show proof - of - principle
for the fabrication of three - component polymer inorganic hybrid
materials where the au and cu metals form separate continuous networks .
we anticipate the deposition of multiple materials can
be expanded to include different combinations of metals , metal oxides ,
and ceramic materials for a variety of applications including tandem
and size - selective catalysis . | selective
degradation of block copolymer templates and backfilling
the open mesopores is an effective strategy for the synthesis of nanostructured
hybrid and inorganic materials .
incorporation of more than one type
of inorganic material in orthogonal ways enables the synthesis of
multicomponent nanomaterials with complex yet well - controlled architectures ;
however , developments in this field have been limited by the availability
of appropriate orthogonally degradable block copolymers for use as
templates .
we report the synthesis and self - assembly into cocontinuous
network structures of polyisoprene - block - polystyrene - block - poly(propylene carbonate ) where the polyisoprene and
poly(propylene carbonate ) blocks can be orthogonally removed from
the polymer film . through sequential block etching and backfilling
the resulting mesopores with different metals ,
we demonstrate first
steps toward the preparation of three - component polymer inorganic
hybrid materials with two distinct metal networks .
multiblock copolymers
in which two blocks can be degraded and backfilled independently of
each other , without interference from the other , may be used in a
wide range of applications requiring periodically ordered complex
multicomponent nanoarchitectures . |
in the previous issue of critical care , kushimoto and colleagues reported on the clinical usefulness of transpulmonary thermodilution - derived extravascular lung water ( evlw ) and the pulmonary vascular permeability index ( pvpi ) in the diagnosis of acute respiratory distress syndrome ( ards ) . in an observational multi - institutional study ,
266 mechanically ventilated patients with hypoxemic respiratory failure and bilateral infiltration on chest radiography were retrospectively allocated by three experts into three pathophysiological diagnostic categories : ards ( including acute lung injury , or ali ) , cardiogenic edema , and pleural effusion with atelectasis . as a first step in identifying true ards ,
a threshold value of evlw of greater than 10 ml / kg ( of predicted body weight ) was used to exclude patients who had no pulmonary edema at all ( the ' atelectasis and pleural effusion ' group ) . as a second step ,
the pvpi , which is the ratio of the evlw to the pulmonary blood volume ( pbv ) , was used to separate patients with true ards from those with cardiogenic edema , achieving a very high specificity in the overall diagnosis or exclusion of ards .
the concept of the pvpi is based on the fact that although evlw may be elevated in both permeability and cardiogenic edema , the latter will also be characterized by increased preload and , as a result , a lower pvpi ratio .
the pvpi was originally described in an experimental study as the ratio of the evlw to the intrathoracic blood volume ( itbv ) and was found to be significantly higher in permeability compared with hydrostatic pulmonary edema . in a more recent clinical study ,
pvpi values were significantly higher in ali / ards compared with hydrostatic pulmonary edema , and a pvpi value of at least 3 allowed the diagnosis of ali / ards with high sensitivity and specificity .
this pvpi value is similar to the one found in the study by kushimoto and colleagues in a larger group of patients .
however , the study by kushimoto and colleagues does have a number of limitations .
the most disturbing one is that 14 patients , who were judged by the attending experts to have respiratory failure secondary to sepsis - induced increased pulmonary vascular permeability , were excluded from the study because ' their evlw was less than 10 ml / kg due to hypovolemia ' .
this somewhat unclear exclusion is seemingly unjustified and , as the authors themselves readily admit , may have biased the results of the study .
the authors claim that the experts were blinded to the pvpi but not to the evlw and the itbv .
however , since the pbv is simply one fifth of the itbv and since the evlw / itbv ratio itself was originally used to calculate pvpi , one can not exclude the possibility that the experts may have had some idea of the pvpi value during the exclusion and allocation processes . other limitations of this study include the inclusion of mechanically ventilated patients only , the small size of the non - ards groups , the unclear pathophysiology of the atelectasis and pleural effusion group , and the absence of a calculated predictive validity of evlw and pvpi regarding mortality . despite its limitations , this study presents an important addition to the mounting body of recent evidence showing that evlw improves the diagnostic accuracy of lung injury and that it is a good predictor of mortality in ali / ards [ 6 - 9 ] .
moreover , evlw can predict progression to ali more than 2 days before patients at increased risk for development of ali meet american - european consensus conference ( aecc ) criteria , providing an early opportunity to initiate lung - protective ventilation and negative fluid balance .
the findings of these and other studies have already led to the suggestion that evlw ( > 10 ml / kg ) should be included in the definition of ards [ 9 - 11 ] .
the study of kushimoto and colleagues seems very relevant to the recent ( ' berlin ' ) definition of ards , which was aimed at overcoming the limitations of the 1994 aecc definition [ 10,12 - 16 ] .
the most important aspects of the new ' berlin ' criteria include the introduction of three categories of ards ( mild , moderate , severe ) , abandoning the term ' acute lung injury ' and removing the ' wedge pressure ' criterion [ 12 - 14 ] .
although these changes add a modicum of evidence and some simplification to the aecc definition , its concepts and components , including the reliance on the arterial partial pressure of oxygen / fraction of inspired oxygen ( pao2/fio2 ) ratio as the major tool for identifying and stratifying patients with ards , remain practically unchanged . as a result , none of the key criteria of the new definition does directly reflect its conceptual model , namely that ' ards is a type of acute diffuse , inflammatory lung injury , leading to increased pulmonary vascular permeability , increased lung weight , and loss of aerated lung tissue ' .
therefore , it is no wonder that neither the aecc nor the berlin definition was found to be a particularly good predictor of death , with the berlin definition offering only marginal improvement .
the berlin task force did indeed consider a number of additional measures to improve specificity and face validity for the increased pulmonary vascular permeability , including evlw .
the panel concluded that although evlw has improved face validity and higher values are associated with mortality , it is infeasible to mandate since ( a ) its technology is costly , invasive , and not widely available ; ( b ) it has significant methodological limitations ; and ( c ) it does not distinguish hydrostatic from inflammatory pulmonary edema .
this last reservation , at least , has now been refuted by kushimoto and colleagues and by others .
previously , the aecc had used the pulmonary artery catheter ( pac ) in the diagnosis of ards , even though it was ( still is ! ) also invasive , costly , and not widely available and certainly had significant methodological limitations .
compared with the pac , transpulmonary thermodilution is less invasive but provides better parameters for the diagnosis and management of ards .
the technology has also become more available since it is not limited to one vendor anymore .
the expanded rationale of the berlin definition of ards concludes by saying that the direct measurement of pulmonary vascular permeability or evlw will be an important advance over current methods of assessing the presence and origin of lung edema and could be incorporated into the future definition of ards .
aecc : american - european consensus conference ; ali : acute lung injury ; ards : acute respiratory distress syndrome ; evlw : extravascular lung water ; itbv : intrathoracic blood volume ; pac : pulmonary artery catheter ; pbv : pulmonary blood volume ; pvpi : pulmonary vascular permeability index .
ap is a member of the medical advisory board of pulsion medical systems , munich , germany . | the recent berlin definition has made some improvements in the older definition of acute respiratory distress syndrome ( ards ) , although the concepts and components of the definition remained largely unchanged . in an effort to improve both predictive and face validity
, the berlin panel has examined a number of additional measures that may reflect increased pulmonary vascular permeability , including extravascular lung water .
the panel concluded that although extravascular lung water has improved face validity and higher values are associated with mortality , it is infeasible to mandate on the basis of availability and the fact that it does not distinguish between hydrostatic and inflammatory pulmonary edema .
however , the results of a multi - institutional study that appeared in the previous issue of critical care show that this latter reservation may not necessarily be true . by using extravascular lung water and the pulmonary vascular permeability index ,
both of which are derived from transpulmonary thermodilution , the authors could successfully differentiate between patients with ards and other patients in respiratory failure due to either cardiogenic edema or pleural effusion with atelectasis .
this commentary discusses the merits and limitations of this study in view of the potential improvement that transpulmonary thermodilution may bring to the definition of ards . |
amino acid substitution is known as an important strategy to detect , and to analyze key residues in the structural and functional properties of proteins , and in the protein - ligand interactions ( yang et al . , 1997 ;
chiaoto et al . , 2007 ; bogan and thorn , 1998 ; lo conte et al .
it has also been used in a number of studies with the aim of improving rational designs of drugs and of engineered peptides for various aspects ( susankova et al .
furthermore , this strategy has employed as a powerful tool to clarify the structure - activity relationships of those proteins that are involved in the neurodegenerative amyloid diseases ( williams et al .
, 2006 ; lund et al . , 2007 ; gu et al . , 2003 ) . in more detail
, this method is based on the substitution of a certain residue in the protein backbone by another one in order to identify the role of the eliminated residue in the physicochemical properties of the wild type structure ( grant et al . , 1999 , 2001 ) .
it is generally accepted that alanine amino acid plays a neutral role in the physicochemical properties of proteins .
consequently , this has made it feasible for researchers to probe the role each residue plays in the protein backbone simply by substituting the desired residue with an alanine amino acid ( prilla et al .
2001 ) . while such replacements may modify the size , acidity , hydrogen - bonding character , hydrophobic properties , nucleophilicity of an amino acid side chain or the protein backbone itself ( mendel et al . , 1995 )
, on the other hand , there is no systematic strategy to evaluate the impact of the newly inserted amino acid on the physicochemical properties of proteins .
frequently , circular dichroism spectroscopy is used to prove that the observed physicochemical properties of the mutant protein are not side effects of the structural alterations due to the amino acid replacements ( renauld - mongnie et al . , 2004 ) .
however , circular dichroism analyses of the native and mutated mammalian metallothionein revealed no changes in the conformational properties of these structures , while nmr studies detected significant differences in the chemical shifts between wild type and the mutant protein ( pan et al . , 1994 ) .
in this study , using molecular dynamics simulations as a powerful computational tool to investigate the dynamical behavior of proteins ( pikkemaat et al . , 2002 ;
demarco and daggett , 2004 ) , we tried to obtain an assessment of the contributions of newly substituted amino acids to the structural fluctuations of the protein backbone of the human prion protein prp as our model structure . according to previous results ,
two of them ( asparg and arg asp ) are supposed to be responsible for the early stages of conformational changes in the disease - associated mutations ( arghis and aspasn ) ( zuegg and gready , 1999 ) .
other lines of evidence have led to the opposite interpretation on the role of such electrostatic interactions in the structural stability of human prp ( speare et al .
in the present work , we tried to elucidate this conflicting situation by studying the role of asparg in the structural stability of human prp . in one simulation ,
similar to the amino acid substitution approach , the arginine residue at position 208 was substituted by alanine ( hereafter prpala ) , which removes the salt bridge between asp and arg .
this construct served to identify the consequences of amino acid substitution on the structural changes of the protein .
a second situation was considered , where the deprotonated state of arg ( hereafter prpsb ) was employed in order to break the salt bridge .
the latter situation had been used to impose weak steric perturbations as it is the case by amino acid replacement .
the conformational changes of these two model structures have been compared to the native prion protein ( hereafter prpn ) . in the present work , for the first time ,
a comparative molecular dynamics study on the human prion protein has been performed to assess the contribution of two types of elimination of a salt bridge mediated by arg .
the nmr structure of the c terminal domain ( 125228 ) of human prion protein in solution ( protein data bank accession code : 1hjm ) was chosen as the initial structure for the wild - type protein ( calzolai and zahn , 2003 ) .
based on this structure we have built a model structure for prpala by means of the swiss - pdb viewer ( guex and peitsch , 1997 ) , which introduced the corresponding mutation into the wild - type structure . in order to break the salt bridge connecting asp and arg , we have designed the deprotonated state of arg using the interactive feature of the package . in order to obtain a locally minimized conformation of the new structure , the imposed local constraints were relaxed by energy minimization .
each model structure was solvated in a cubic box containing ~10,000 of spc ( berendsen et al . , 1981 ) water molecules and simulated employing periodic boundary conditions . to obtain an electro - neutralized simulation system ,
randomly selected water molecules were replaced by appropriate numbers of na and cl ions . using the berendsen algorithm ( berendsen et al . , 1984 ) ,
bond lengths were constrained to their equilibrium values by the settle algorithm ( miyamoto and kollman , 1992 ) for water and the lincs algorithm ( hess et al . , 1997 ) for protein molecules .
electrostatic interactions were computed using the particle - mesh ewald method ( darden et al . , 1993 ) .
non - bonded interactions were truncated at a cut - off radius of 1.0 nm . all systems were initially equilibrated with an energy minimization of 1200 steps using the steepest descent method and 10 ps of position restraint md on the protein structure before the start of the simulation run .
the integration time step was set at 2.0 fs and the energies and atomic coordinates were saved every 2 ps for analysis . all calculations and data analysis were performed using gromacs 3.3.1 package ( van der spoel et al . , 2005 ) , with the united - atom protein force field for md simulations ( schuler et al . , 2001 ) .
analysis of the secondary structure was done with the dssp program ( kabsch and sander , 1983 ) .
average molecular structure of the native human prion protein after 10 ns molecular dynamics simulation is presented in figure 1(fig . 1 ) .
furthermore , to analyze the flexibility of the model constructs during the simulation time , root mean square deviations ( rmsds ) of the c-positions for three analog structures including the native protein ( prpn ) , the alanine substituted model ( prpala ) at position 208 , and the analog form comprising the neutralized state of arginine residue ( prpsb ) at the same position have been extracted ( figure 2(fig .
increased sharply from 0.10 nm to around 0.20 nm for the first 0.5 ns . between 0.5 and 2 ns ,
generally , the same pattern of rmsd values ( ~0.21 nm ) for three model structures has been detected . between 2 and 6 ns , the rmsd values of the model structures
the average rmsd for prpala is approximately 0.27 nm , while a lower average value of 0.23 nm achieved for both of prpsb and prpn .
the rmsd pattern from 6 ns until the end of the run is clearly different for each structure .
the rmsd of prpala exhibits a maximum of 0.35 nm around 8 ns with a sharp increase between 6 and 8 ns , while the rmsd for prpsb and prpn have maxima of about 0.29 nm and 0.27 nm , respectively .
these results indicated that prpala exhibits large conformational flexibility due to the amino acid substitution , which is not observed in prpsb and prpn during 10 ns simulation .
pattern of the structural stability for three constructs indicates that the conformational instability of the protein backbone due to the charge neutralization of arg is less significant to the dynamical properties of the protein backbone . however , substitution of alanine residue at position 208 imposed higher instabilities to the conformational dynamics of prpala model structure .
although , based on these data , it is not possible to ascertain the contribution of different regions of the backbone to the observed structural flexibility .
2 ) ) can not be a result of the elimination of the putative salt bridge between asp and arg , but might rather be related to the imposed local steric constraints due to the insertion of the ala residue instead of arg at position 208 .
thus , the replacement of arg by ala at position 208 causes an increased dynamical flexibility of the protein backbone , which may lead to the high structural instability triggering the initial steps of conformational rearrangements .
however , the elimination of the salt bridge , which is supposed to be the main reason of the creutzfeldt - jakob disease in arghis mutation , has no significant effect on the dynamical behaviors of the protein backbone .
therefore , our results seem to disagree with the proposed role of this salt bridge as a putative disease - associated electrostatic interaction in human prion protein ( zuegg and gready , 1999 ) . on the other hand ,
our findings are in good agreement with other theoretical and experimental investigations , which showed that the contribution of these types of solvent - exposed salt bridges to the overall stability of prion proteins is negligible ( speare et al . , 2003 ; bamdad and naderimanesh , 2007).in summary , data indicates that the substitution of arginine by the neutralized state of this residue at position 208 in the human prion protein induced some reversible structural dynamics to the backbone that is comparable to the recorded pattern of the native protein construct . however , substitution of arginine residue by alanine at the same position imposed higher dynamical perturbation to the protein backbone , which is mainly related to the steric constraints due to the residue replacement .
it could be supposed that mutation of arg to his residue in prion protein , which is the main reason for cjd in human , is mainly related to the imposed spatial constraints to the protein backbone because of the amino acid substitution rather than the elimination of the salt bridge between asp and arg . in order to have a better insight to the most sensitive regions of the protein backbone to the residue modifications , root mean square fluctuations ( rmsfs ) of three model constructs have been analyzed and presented in figure 3(fig .
3 ) . according to the results , the difference between the fluctuations of prpsb and prpn is generally very small , except in a small part of the loop area including residues 167171 , where prpsb experiencing higher fluctuations in comparison to prpn .
the recorded fluctuations are mainly due to the deprotonation of arginine at position 208 . according to the average pka ( around 12.5 ) value for this residue , the neutralized arginine in prpsb
construct can be considered as a significant change to the ph value in the microenvironment of this residue , which can promote conformational fluctuations .
it may be concluded that breakage of the salt bridge between asp and arg due to the neutralization of the arg , alternates some geometrical constraints in the protein backbone that induced fluctuations on the loop region including residues 167171 .
since loops are generally considered to be potential reservoirs of structural entropy , the release of the salt bridge leads to the recorded fluctuations in that area .
3 ) ) also indicates that the detected conformational changes of prpsb ( figure 2(fig .
2 ) ) mainly originate from the entropic fluctuations of the loop region comprising residues 167171 . in order to demonstrate the relevant geometrical shapes and orientations of the modified residue at position 208 ,
a small part of the helix 3 comprising the native arginine , neutralized state of this residue , and the alanine substituted amino acid , have been presented in figure 4(fig .
these spatial and geometrical alterations are the main reason for the observed patterns in the structural fluctuations of the protein backbone ( figures 2(fig .
2 ) ) and reach to a maximum value of ~0.47 nm ( figure 3(fig .
the large fluctuations of residues 190195 are the main contribution to the observed rmsd of prpala after 6 ns ( figure 2(fig .
thus it can be concluded that this segment is the most flexible region of the backbone to the structural modifications .
these data are also in good agreement with the results of other theoretical and experimental investigations ( bamdad and naderimanesh , 2007 ; zahn et al . , 2000 ) . in summary ,
the conformational fluctuations of three model constructs show three different patterns with the increasing order of magnitude : prpn < prpsb < prpala .
it means that a single residue substitution may play as a molecular switch that consequently can alter the structural and functional properties of the protein .
the experimental studies are also in good agreement with this conjecture ( solano et al . , 1997 ) .
our data also indicate that the breakage of the salt bridge alone does not lead to the significant structural and dynamical changes as compared to the native form of the human prion protein . based on the data from structural fluctuations of three model constructs ( figure 3(fig .
accordingly , the most portion of the structural instabilities of the alanine substituted analog ( figure 2(fig .
2 ) ) have to be mainly related to a short segment ( figure 3(fig .
3 ) shows , the area around position 208 is experiencing the lowest structural fluctuations during the time period of simulation , which implies that the modification of arg residue has no effects to the protein backbone at this position .
however , another area of the backbone at the c terminal part of helix 2 with at least thirteen residues distance has been mainly affected .
thus , it could be concluded that spatial interactions must be responsible for the structural fluctuations , which are localized in a short hot segment of the protein backbone including residues 190195 due to the residue substitution at position 208 . in order to assign the contribution of different parts of the backbone to the structural rearrangements ,
secondary structure fluctuations as a function of time for three model structures are shown in figure 5(fig . 5 ) .
comparison of the results shows that there is no significant difference in the secondary structure rearrangements of prpsb and prpn , whereas these fluctuations are significant in prpala .
the only part of prpsb with observable changes in the secondary structure is located at around residues 167171 . although these structural rearrangements started at around 6 ns , they returned to the previous structure at around 8 ns . during this period ,
the secondary structure of the relevant area had changed from turn to bend/3-helix , and from 8 ns until the end of the simulation returned to the previously turn structure .
2 ) ) are related to the dynamical fluctuations of the loop area ( figure 3(fig .
3 ) ) , which originate from the reversible secondary structure changes during 68 ns ( figure 5(fig .
, prpala is experiencing higher alterations for the secondary structure , which can not be observed in prpsb and prpn during a 10 ns simulation .
these structural changes are localized at around the c terminal part of helix 2 and helix 3 .
unlike prpsb , the observed structural rearrangements of prpala were stable and did not return to the original structure during the simulation .
right at the start of the simulation , the c terminal end of helix 3 changed to a turn structure .
subsequent alterations in the c terminal part of helix 2 started at around 6 ns and induced a helix - to - turn / coil transition .
this implies that the structural instability of prpala , particularly after 6 ns ( figure 2(fig .
2 ) ) , is mostly associated with the transition of the secondary structure elements at the c terminal part of helix 2 ( figure 5(fig .
5 ) ) , which is accompanied by dynamical fluctuations of ~0.47 nm ( figure 3(fig .
our results show that under the same conditions , slight alterations to the protein backbone such as arg neutralization ( prpsb ) do not impose significant structural perturbations , whereas the amino acid replacement ( prpala ) causes an irreversible impact on the secondary and tertiary structure of the protein .
the substitution of arginine by alanine at position 208 leads to the significant dynamical instabilities and a permanent structural change in the remote hot region ( 190195 ) of the backbone .
the replacement of the arginine residue by its uncharged state , however , induces only reversible structural changes in the intrinsically flexible loop area ( 167171 ) .
based on these data , the origin of the observed structural instabilities ( figure 2(fig .
2 ) ) due to the arg replacement by ala at position 208 could be dedicated to a short segment of the protein backbone comprising residues 190195 ( figure 3(fig .
3 ) ) in the c terminal part of the helix 2 ( figure 1(fig .
it may be concluded that this residue modification imposed structural alterations to a specific sensitive segment of the human prion protein that is sequentially far from the position 208 .
in addition , it could be supposed that the detected structural changes ( figure 5(fig .
4 ) ) are the main reason for triggering of the initial steps of the subsequent structural transitions .
it seems that these structural changes arise because of the steric perturbations due to the residue replacement rather than the elimination of the electrostatic charge between asp and arg .
average molecular structure of the native human prion protein after 10 ns molecular dynamics simulation is presented in figure 1(fig . 1 ) .
furthermore , to analyze the flexibility of the model constructs during the simulation time , root mean square deviations ( rmsds ) of the c-positions for three analog structures including the native protein ( prpn ) , the alanine substituted model ( prpala ) at position 208 , and the analog form comprising the neutralized state of arginine residue ( prpsb ) at the same position have been extracted ( figure 2(fig .
increased sharply from 0.10 nm to around 0.20 nm for the first 0.5 ns . between 0.5 and 2 ns ,
generally , the same pattern of rmsd values ( ~0.21 nm ) for three model structures has been detected . between 2 and 6 ns , the rmsd values of the model structures
the average rmsd for prpala is approximately 0.27 nm , while a lower average value of 0.23 nm achieved for both of prpsb and prpn .
the rmsd pattern from 6 ns until the end of the run is clearly different for each structure .
the rmsd of prpala exhibits a maximum of 0.35 nm around 8 ns with a sharp increase between 6 and 8 ns , while the rmsd for prpsb and prpn have maxima of about 0.29 nm and 0.27 nm , respectively .
these results indicated that prpala exhibits large conformational flexibility due to the amino acid substitution , which is not observed in prpsb and prpn during 10 ns simulation .
pattern of the structural stability for three constructs indicates that the conformational instability of the protein backbone due to the charge neutralization of arg is less significant to the dynamical properties of the protein backbone . however , substitution of alanine residue at position 208 imposed higher instabilities to the conformational dynamics of prpala model structure .
although , based on these data , it is not possible to ascertain the contribution of different regions of the backbone to the observed structural flexibility .
2 ) ) can not be a result of the elimination of the putative salt bridge between asp and arg , but might rather be related to the imposed local steric constraints due to the insertion of the ala residue instead of arg at position 208 .
thus , the replacement of arg by ala at position 208 causes an increased dynamical flexibility of the protein backbone , which may lead to the high structural instability triggering the initial steps of conformational rearrangements .
however , the elimination of the salt bridge , which is supposed to be the main reason of the creutzfeldt - jakob disease in arghis mutation , has no significant effect on the dynamical behaviors of the protein backbone .
therefore , our results seem to disagree with the proposed role of this salt bridge as a putative disease - associated electrostatic interaction in human prion protein ( zuegg and gready , 1999 ) . on the other hand ,
our findings are in good agreement with other theoretical and experimental investigations , which showed that the contribution of these types of solvent - exposed salt bridges to the overall stability of prion proteins is negligible ( speare et al . , 2003 ; bamdad and naderimanesh , 2007).in summary , data indicates that the substitution of arginine by the neutralized state of this residue at position 208 in the human prion protein induced some reversible structural dynamics to the backbone that is comparable to the recorded pattern of the native protein construct . however , substitution of arginine residue by alanine at the same position imposed higher dynamical perturbation to the protein backbone , which is mainly related to the steric constraints due to the residue replacement .
it could be supposed that mutation of arg to his residue in prion protein , which is the main reason for cjd in human , is mainly related to the imposed spatial constraints to the protein backbone because of the amino acid substitution rather than the elimination of the salt bridge between asp and arg .
in order to have a better insight to the most sensitive regions of the protein backbone to the residue modifications , root mean square fluctuations ( rmsfs ) of three model constructs have been analyzed and presented in figure 3(fig .
3 ) . according to the results , the difference between the fluctuations of prpsb and prpn is generally very small , except in a small part of the loop area including residues 167171 , where prpsb experiencing higher fluctuations in comparison to prpn .
the recorded fluctuations are mainly due to the deprotonation of arginine at position 208 . according to the average pka ( around 12.5 ) value for this residue , the neutralized arginine in prpsb
construct can be considered as a significant change to the ph value in the microenvironment of this residue , which can promote conformational fluctuations . it may be concluded that breakage of the salt bridge between asp and arg due to the neutralization of the arg , alternates some geometrical constraints in the protein backbone that induced fluctuations on the loop region including residues 167171 .
since loops are generally considered to be potential reservoirs of structural entropy , the release of the salt bridge leads to the recorded fluctuations in that area .
3 ) ) also indicates that the detected conformational changes of prpsb ( figure 2(fig .
2 ) ) mainly originate from the entropic fluctuations of the loop region comprising residues 167171 . in order to demonstrate the relevant geometrical shapes and orientations of the modified residue at position 208 ,
a small part of the helix 3 comprising the native arginine , neutralized state of this residue , and the alanine substituted amino acid , have been presented in figure 4(fig .
4 ) . as it is depicted in this figure , these spatial and geometrical alterations are the main reason for the observed patterns in the structural fluctuations of the protein backbone ( figures 2(fig .
2 ) ) and reach to a maximum value of ~0.47 nm ( figure 3(fig .
the large fluctuations of residues 190195 are the main contribution to the observed rmsd of prpala after 6 ns ( figure 2(fig .
thus it can be concluded that this segment is the most flexible region of the backbone to the structural modifications .
these data are also in good agreement with the results of other theoretical and experimental investigations ( bamdad and naderimanesh , 2007 ; zahn et al . , 2000 ) . in summary ,
the conformational fluctuations of three model constructs show three different patterns with the increasing order of magnitude : prpn < prpsb < prpala .
it means that a single residue substitution may play as a molecular switch that consequently can alter the structural and functional properties of the protein .
the experimental studies are also in good agreement with this conjecture ( solano et al . , 1997 ) .
our data also indicate that the breakage of the salt bridge alone does not lead to the significant structural and dynamical changes as compared to the native form of the human prion protein . based on the data from structural fluctuations of three model constructs ( figure 3(fig . 3 ) ) , the origin of the recorded conformational instabilities ( figure 2(fig .
accordingly , the most portion of the structural instabilities of the alanine substituted analog ( figure 2(fig .
2 ) ) have to be mainly related to a short segment ( figure 3(fig .
3 ) shows , the area around position 208 is experiencing the lowest structural fluctuations during the time period of simulation , which implies that the modification of arg residue has no effects to the protein backbone at this position .
however , another area of the backbone at the c terminal part of helix 2 with at least thirteen residues distance has been mainly affected .
thus , it could be concluded that spatial interactions must be responsible for the structural fluctuations , which are localized in a short hot segment of the protein backbone including residues 190195 due to the residue substitution at position 208 .
in order to assign the contribution of different parts of the backbone to the structural rearrangements , secondary structure fluctuations as a function of time for three model structures are shown in figure 5(fig .
comparison of the results shows that there is no significant difference in the secondary structure rearrangements of prpsb and prpn , whereas these fluctuations are significant in prpala .
the only part of prpsb with observable changes in the secondary structure is located at around residues 167171 . although these structural rearrangements started at around 6 ns , they returned to the previous structure at around 8 ns . during this period ,
the secondary structure of the relevant area had changed from turn to bend/3-helix , and from 8 ns until the end of the simulation returned to the previously turn structure .
2 ) ) are related to the dynamical fluctuations of the loop area ( figure 3(fig .
3 ) ) , which originate from the reversible secondary structure changes during 68 ns ( figure 5(fig .
, prpala is experiencing higher alterations for the secondary structure , which can not be observed in prpsb and prpn during a 10 ns simulation .
these structural changes are localized at around the c terminal part of helix 2 and helix 3 . unlike prpsb , the observed structural rearrangements of prpala were stable and did not return to the original structure during the simulation .
right at the start of the simulation , the c terminal end of helix 3 changed to a turn structure .
subsequent alterations in the c terminal part of helix 2 started at around 6 ns and induced a helix - to - turn / coil transition .
this implies that the structural instability of prpala , particularly after 6 ns ( figure 2(fig .
2 ) ) , is mostly associated with the transition of the secondary structure elements at the c terminal part of helix 2 ( figure 5(fig .
5 ) ) , which is accompanied by dynamical fluctuations of ~0.47 nm ( figure 3(fig .
our results show that under the same conditions , slight alterations to the protein backbone such as arg neutralization ( prpsb ) do not impose significant structural perturbations , whereas the amino acid replacement ( prpala ) causes an irreversible impact on the secondary and tertiary structure of the protein .
the substitution of arginine by alanine at position 208 leads to the significant dynamical instabilities and a permanent structural change in the remote hot region ( 190195 ) of the backbone .
the replacement of the arginine residue by its uncharged state , however , induces only reversible structural changes in the intrinsically flexible loop area ( 167171 ) .
based on these data , the origin of the observed structural instabilities ( figure 2(fig .
2 ) ) due to the arg replacement by ala at position 208 could be dedicated to a short segment of the protein backbone comprising residues 190195 ( figure 3(fig .
3 ) ) in the c terminal part of the helix 2 ( figure 1(fig .
it may be concluded that this residue modification imposed structural alterations to a specific sensitive segment of the human prion protein that is sequentially far from the position 208 .
in addition , it could be supposed that the detected structural changes ( figure 5(fig .
4 ) ) are the main reason for triggering of the initial steps of the subsequent structural transitions .
it seems that these structural changes arise because of the steric perturbations due to the residue replacement rather than the elimination of the electrostatic charge between asp and arg .
amino acid substitution is a powerful strategy , which has been widely used for probing the forces that govern protein structure and folding , biorecognition , catalysis , and structure - activity relationships of disease - associated proteins as well ( knowles , 1987 ) .
such replacements may modify the size , acidity , hydrogen - bonding character , nucleophilicity , or hydrophobic properties of the amino acid side chain or the protein backbone itself ( mendel et al . , 1995 ) .
hence , it is of considerable importance to identify the impact of modifications on the structural and functional properties of protein ( taverna and goldstein , 2002 ; wang and chou , 2009 , 2012 ) .
however , there is no systematic approach to monitor or to predict consequences of amino acid substitution .
the main aim of this study is to investigate the effects of the amino acid modification at position 208 of the human prion protein that a certain electrostatic interaction is also mediating by arg ( asparg ) .
this position was studied because it is supposed that arginine 208 to histidine mutation is the main reason for the conformational change of the native form of human prion protein to the pathogenic isoform causing creutzfeldt - jakob disease ( cjd ) .
we tried to show the significant differences between dynamical features of the native and the amino acid - substituted analog of this protein at the above mentioned position . in order to remove the salt bridge between aspartate and arginine , which is considered to be
a weaker perturbation than an amino acid substitution , a computationally neutralized form of arginine at position 208 ( prpsb ) was employed .
in addition , we have also considered the case of the amino acid substitution , where arginine was replaced by alanine residue ( prpala ) at the same position .
comparison of the results from the molecular dynamics simulations on two modified protein constructs including prpsb and prpala , and the native form ( prpn ) revealed that dramatic structural alterations to the native structure can be expected if arginine is substituted by alanine residue at position 208 of the protein backbone , especially in the c terminal part of helix 2 comprising residues 190195 .
these data are also in agreement with the experimental investigation carried out by hosszu and coworkers ( hosszu et al . , 2010 ) indicating that region 186194 from the c terminal part of helix 2 is under structural alterations due to the substitution of histidine by arginine residue at position 187 ( h187r ) of the human prion protein .
we think that they have employed this mutation strategy in order to impose permanent positively charge at position 187 of the backbone , while eliminating the unpredictable effects of acidic ph on physiochemical properties of the system under study to simulate the native physiological situation of the mutated protein .
however , to have a better insight on the importance of the positive charge on the oligomerization process of the human prion protein due to the h187r mutation , a control construct including histidine to alanine substituted analog ( h187a ) at this position could also take into account .
otherwise , h187r mutation could generally be considered as a perturbing factor in the protein backbone , which increases the propensity to oligomerization that is not necessarily related to the direct effects of the positive charge imposition at position 187 of the human prion protein .
this idea is also in agreement with the view of marginal stability of proteins ( taverna and goldstein , 2002 ) , in that , induced perturbations to short segments of the protein backbone may trigger large - scale alterations to the native state of proteins , which could start relevant conformational transitions in the protein structure .
furthermore , if we hold it true that each amino acid in the sequence of the protein backbone has been selected for that position by an evolutionary background ; it is not surprising that the observed structural changes due to the residue replacements may also be related to the orientation / geometrical / spatial constraints of the substituted residue at that place .
the authors ( hosszu et al . , 2010 ) have also mentioned that ph induced protonation of key histidine residues 155 and 187 induced conformational flexibility especially in the c terminal part of helix 2 , while , other regions of the backbone remain almost unchanged .
this is in agreement with our data that the maximum flexibility of the structure was localized around region 190195 at the end part of helix 2 due to the residue replacement at position 208 .
it seems that this region is intrinsically sensitive to the induced perturbations , which candidates this part of the human prion protein as a hot structural segment to trigger conformational transitions .
however , introducing the neutralized state of arginine residue at position 208 caused only some reversible structural changes in the intrinsically flexible loop area comprising residues 167171 of the human prion protein .
we would like to thank the research center jlich , and payame noor university for supporting this work . | technical strategies like amino acid substitution and residue modification have been widely used to characterize the importance of key amino acids and the role that each residue plays in the structural and functional properties of protein molecules . however , there is no systematic approach to assess the impact of the substituted / modified amino acids on the conformational dynamics of proteins . in this investigation to clarify the effects of residue modifications on the structural dynamics of human prion protein ( prp ) , a comparative molecular dynamics simulation study on the native and the amino acid - substituted analog at position 208 of prp has been performed .
it is believed that arginine to histidine mutation at position 208 is responsible for the structural transition of the native form of human prion protein to the pathogenic isoform causing creutzfeldt - jakob disease ( cjd).so , three 10 ns molecular dynamics simulations on three model constructs have been performed .
simulation results indicated considerable differences of conformational fluctuations for alanine substituted construct ( prpala ) and the analog form ( prpsb ) comprising the neutralized state of the arginine residue at position 208 of the human prion protein .
according to our data , substitution of the arginine residue by the uncharged state of this residue induces some reversible structural alterations in the intrinsically flexible loop area including residues 167171 of prp .
thus , deprotonation of arg208 is a weak perturbation to the structural fluctuations of the protein backbone and the resulting construct behaves almost identical as its native form .
otherwise , alanine substitution at position 208 imposed an irreversible impact on the secondary and tertiary structure of the protein , which leads to conformational instabilities in the remote hot region comprising residues 190195 of the c terminal part of helix 2 .
based on the results , it could be deduced that the observed conformational transitions upon arg208 to his point mutation , which is the main reason for cjd , may be mainly related to the structural instabilities due to the induced - conformational changes that caused alterations in local / spatial arrangements of the force distributions in the backbone of the human prion protein . |
adaptive radiation requires organismal evolvability , ecological opportunities , and diversifying selection which create new niches in terms of physical space and new interactions between organisms and environment or allow empty ones to be colonised by adaptive lineages [ 14 ] .
this process is directly relevant to the bacterial colonisation of natural and engineered environments , affecting final population sizes ( productivity ) and other ecosystem processes , host survival , efficiency , and output , and can be investigated in experimental evolution studies using simple microcosms in which biotic and abiotic factors and parameters can be manipulated [ 58 ] .
one particularly successful system has used pseudomonas fluorescens sbw25 populations grown in small glass vials containing nutritionally rich king 's b medium .
these microcosms can be incubated statically to produce a heterogeneous environment with spatial structure and , in these , p. fluorescens sbw25 populations rapidly diversify over 310 days and accumulate mutants such as the wrinkly spreader .
this class of adaptive mutant or morphotype produces distinctive wrinkled colonies on agar plates and a robust , well - attached biofilm at the air - liquid ( a - l ) interface of static microcosms ( sometimes referred to as pellicles , but see ) ( figure 1 ) .
it is the ecosystem engineering by the early p. fluorescens sbw25 colonists that generates an o2 gradient in these microcosms and produces the ecological opportunity for wrinkly spreader colonisation of the a - l interface ( opportunity and niche are interlinked ; see [ 8 , 12 , 13 ] ) .
a range of mutations associated with diguanylate cyclases ( dgcs ) result in the wrinkly spreader ( ws ) phenotype through upregulation of c - di - gmp levels and the overproduction of partially acetylated cellulose ( the primary extracellular polymeric substance ( eps ) or matrix component ) and attachment factor essential for colony morphology and biofilm structure [ 1418 ] .
this influential but simple experimental evolution model has been used to investigate aspects of adaptive radiation , including the importance of spatial structure ( with high- and low - o2 zones ) and resource competition ( for o2 and nutrients ) , and of the emergence and maintenance of diversity [ 6 , 8 ] which can be readily measured by determining the frequencies and final population sizes ( productivity ) of wrinkly spreaders and other morphotypes on agar plates ( e.g. , [ 9 , 19 , 20 ] ) .
our interests are more focussed on developing a mechanistic explanation of how environmental parameters influence wrinkly spreader biofilm formation and fitness in this simple microcosm system .
colonisation of the a - l interface by the wrinkly spreader allows better access to o2 diffusing into the liquid column from the air above , providing a competitive fitness ( w ) advantage over the ancestral wild - type p. fluorescens sbw25 and other non - biofilm - forming mutants whose growth is o2-limited deeper into the microcosm [ 9 , 11 , 14 , 21 ] .
this advantage may reflect a significant change of physiology , as biofilm - isolated cells growing in the high - o2 zone can be differentiated from those recovered immediately below the biofilm by raman spectral profiling ( p. fluorescens sbw25 can form a different type of biofilm when induced with fe which also provides a fitness advantage ) . in the related pseudomonad , p. aeruginosa pa01 ,
cells grow aerobically in a - l interface biofilms and , like the wrinkly spreader , these have a growth advantage over non - biofilm - forming competitors which are o2-stressed .
furthermore , eps production may be altruistic to cells as it pushes later generations into better o2 conditions above and helps suffocate non - eps producers and cells lower down in the biofilm ( ancestor 's inhibition ) .
o2 levels and the lack of physical disturbance ( i.e. , random knocks and vibrations ) are probably the most important factors driving wrinkly spreader biofilm formation and longevity .
however , the advantage the wrinkly spreader has in static microcosms does not translate to other environments , as it is at a disadvantage in shaken microcosms and on agar plates where the ws phenotype is irrelevant and costly , and the ancestor effect may not be effective [ 9 , 14 , 21 , 26 ] . as wrinkly spreaders are an adaptive morphotype in static microcosms
( and because ecological opportunity and niche are interlinked ) , we expect that a goldilocks effect should be apparent in these simple microcosms , and if environmental parameters differed , perhaps the wrinkly spreaders would not have the competitive fitness advantage they have over non - biofilm - forming competitors
. in particular , there should be a tight link between the potential growth achievable at the a - l interface and ws fitness .
however , the role of o2 is complex as the amount available , considered in terms of local concentration , during biofilm formation provides the ecological opportunity and reward for ws colonisation of the a - l interface , but o2 flux or supply ( determined by the diffusion from the air above and uptake by the bacteria in the liquid column below ) may have a more immediate impact on the developing ws biofilm and competitors .
furthermore , the importance of o2 also depends on nutrient levels and other factors , as if these became growth - limiting , o2 would no longer be a reward for colonisation of the a - l interface . in this work ,
we manipulate several environmental parameters predicted to alter o2 levels in static microcosms in order to investigate how competition for this growth - limiting resource affects ws fitness in more detail and to further our understanding of the mechanisms underlying this commonly used model system .
the bacterial strains used in this work were wild - type pseudomonas fluorescens sbw25 and the archetypal wrinkly spreader ( p. fluorescens sbw25 wspf a901c ) [ 14 , 17 ] .
bacteria were cultured at 1820c in modified king 's b ( kb ) medium ( 20 g proteose peptone ( oxoid , uk ) , 10 g glycerol , 1.5 g k2hpo4 , and 1.5 g mgso4 per litre with 1.5% ( w / v ) agar added for plates ) and maintained at 80c as 15% ( w / v ) glycerol stocks .
the quantities of peptone and glycerol were reduced appropriately to produce media with 0.1x and 0.01x normal levels of nutrients .
standard microcosms were 30 ml universal glass vials containing 10 ml kb and were incubated statically or with shaking at 150 rpm using a stuart s150 orbital incubator ( bibby scientific ltd . , uk ) .
mineral oil ( fisher bioreagents , uk ) overlays of 1040 mm were added to microcosms to reduce o2 flux .
glass conical flasks and test tubes with 2.515 ml kb were used to produce microcosms with different surface area / volume ratios . a 14 cm diameter petri dish containing 100 ml kb
universal vials were filled to the brim with 37 ml and 39.5 ml kb to produce microcosms with concave- ( normal ) and convex - shaped a - l interfaces , respectively . in order to minimise evaporation during the convex - concave experiments
, microcosms were incubated in sealed containers with a dish of water to maintain humidity , and fresh medium was added every ~12 hr to maintain the convex shape ( equal additions were also made to the concave microcosms ) . a spectronic helios epsilon spectrophotometer ( thermo fisher scientific , uk ) was used for absorbance and optical density measurements using 1 cm optical - pathway cuvettes after zeroing using the appropriate sterile growth medium or solvent .
preliminary tests were made to determine whether reduced - nutrient or oil - overlay microcosms impacted p. fluorescens sbw25 growth and ws biofilm formation .
microcosms were inoculated with 100 l aliquots of overnight static ws or shaken wt cultures as appropriate .
growth differences were assessed by optical density ( od600 ) measurements after 24 hr incubation .
oil toxicity was tested by comparing growth ( od600 ) between shaken kb microcosms with and without 100 l oil after 24 hr incubation . for these
, microcosms were left to stand for 30 min after vigorous mixing to avoid the transfer of emulsion or oil to the sample used for od600 measurement .
the competitive fitness of the wrinkly spreader ( ws ) was determined relative to wild - type p. fluorescens sbw25 ( wt ) .
replicate microcosms were inoculated with 100 l ( per 10 ml ) aliquots of a 1 : 1 mixture of overnight static ws and shaken wt cultures and incubated for 3 days before assay .
the initial and final ws and wt viable cell numbers were determined by sampling the 1 : 1 mixture and 3-day microcosms after vigorous mixing , serial dilution , and enumeration on kb plates .
competitive fitness ( w ) was calculated as the mean w = ln[final ws / initial ws]/ln[final wt / initial wt ] .
relative fitness ( w / wr ) is reported where r refers to the reference microcosms used for each assay .
n = 8) were inoculated with 100 l ( per 10 ml ) aliquots of overnight static wrinkly spreader culture and incubated for 3 days before sequential assay to determine growth , biofilm strength , and attachment levels . briefly
, biofilm strength ( s ) was first measured using the maximum deformation mass ( grams ) assay with small glass balls .
the microcosm contents were then transferred to another vial and , after vigorous mixing , used to determine growth ( g ) by optical density ( od600 ) measurements .
the empty vial was then stained with crystal violet and the absorbance ( a570 ) measurements of the eluted dye were used to determine the attachment levels ( a ) in the meniscus region .
it was necessary to wipe the outside rim of the vials to remove excess stain from the concave and convex microcosms before elution and measurement .
relative growth , biofilm strength , and attachment levels were calculated as for relative fitness ( e.g. , g / gr , where r refers to the reference microcosms used in that assay ) .
normal quantile plots of the residuals were inspected with outliers removed if required and normality was assessed using the shapiro - wilk w goodness - of - fit test ( p > 0.05 ) . in large experiments , individual treatments were processed as single batches and , as a result , batch and treatment effects are combined .
comparison of means was by t - test and anova , with post hoc comparisons made by dunnett 's test with control and tukey - kramer hsd tests .
as ws fitness is negatively frequency dependent , competition between wrinkly spreaders and the non - biofilm - forming p. fluorescens sbw25 competitor used in this work will vary depending on the relative starting ratio of strains . when the wrinkly spreader is rare
, competition will primarily occur between the two strains and ws fitness will be high , but as the wrinkly spreaders become dominant , within - ws competition will increase and ws fitness will fall . in this work ,
we have balanced experimental workloads with the range of environmental parameters that could be investigated .
we have chosen test ws fitness using a 1 : 1 starting ratio of strains at a standard cell density from which the wrinkly spreaders are expected to become rapidly dominant and produce a biofilm when conditions are favourable . under similar starting conditions , changes in ws biofilm characteristics can be quantified [ 15 , 29 , 30 ] , giving us confidence in linking ws fitness with biofilm formation . however , we note that alterations in these starting conditions will alter the dynamics of the system and possibly final outcomes . finally , as in many of our experiments we observed relatively small fitness changes , we have chosen to report relative fitness ( w / wr ) using the appropriate reference microcosms , to reflect the magnitude of change rather than absolute competitive fitness ( w ) values .
we predict that the competitive success of the wrinkly spreader in colonising the a - l interface of static microcosms is influenced by the physical size of the niche space available for ws colonisation compared to that available to the competitor .
ws biofilms develop across the a - l interface before developing in depth and strength .
this suggests that the residents of the ws biofilm benefit by the biofilm spreading out across the a - l interface first to intercept o2 diffusion into the liquid column , and their growth subsequently becomes limited by reduced o2 and nutrient diffusion into the biofilm as it matures and thickens .
as this area expansion - first strategy also has the effect of limiting o2 diffusion lower down into the liquid column , we do not expect that non - biofilm - forming competitors would be advantaged by deeper microcosms with greater nutrient resources as growth will still be o2-limited .
we therefore expect to find that ws fitness will fall in microcosms with smaller a - l interface surface areas ( sa ) and fixed volumes ( v ) but will remain unchanged in microcosms with a fixed sa and increasing v. we used a series of flasks , vials , and test tubes to produce microcosms with a range of sa / v ratios but with a fixed volume , from 0.15 to 1.02 cm . as the sa was reduced relative to v in these
, the physical dimensions of the niche available for ws colonisation fell , and a small but significant decrease in relative fitness to 0.944 0.006 ( w / wr ) was observed in the microcosms with a sa / v ratio of 0.15 cm compared to the reference microcosms with a sa / v ratio of 0.45 cm , though not between the microcosms with sa / v ratios of 0.45 cm and 1.02 cm ( tk - hsd , = 0.05 ) ( figure 2 ) .
however , no significant differences in relative fitness were observed in fixed sa microcosms containing 2.515 ml kb ( tk - hsd , = 0.05 ) .
these findings suggest that competitive interaction between the wrinkly spreaders and the non - biofilm - forming competitor is an inhibitory one that involves the wrinkly spreaders preventing competitors access to o2 which slows their growth and reduces maximal population size .
we note that the wrinkly spreader can produce a biofilm in a 14 cm diameter container within three days , suggesting that biofilm formation is not limited by the need to be in close proximity to the vial walls .
however , wrinkly spreaders may also have a maximal population size ; as wrinkly spreader numbers grow in the maturing biofilm , only the top ~300 m layer of the biofilm remains o2-rich and lower regions of the biofilm become increasingly o2-limited .
in this situation , wrinkly spreaders start to compete with one another within the biofilm itself , with different ws mutants showing substantial morphological , metabolic , and fitness variation [ 17 , 3133 ] .
we are , however , surprised that in deep microcosms the volume of media beneath the biofilm does not become increasingly attractive for colonisation by wild - type p. fluorescens sbw25 or a low - o2-adapted mutant , as we assume that this volume represents an ecological opportunity for an appropriately adaptive strain , as much as the a - l interface does for the wrinkly spreaders .
early work had suggested that the fuzzy spreader might be a bottom dweller , but this class of mutant has subsequently been shown to be a failed biofilm former which forms a sediment after physical disturbance . in the case of p. aeruginosa pa01 , supplementation with the alternative electron - acceptor nitrate facilitated the anaerobic growth of non - biofilm - forming competitors , suggesting that cells growing in the a - l interface biofilm face a trade - off between o2 and nutrient acquisition .
similarly , in komagataeibacter xylinus ( formerly acetobacter xylinum ) a - l interface biofilms , growth is limited to a top layer of 50100 m by o2 diffusion from above and nutrient diffusion from below .
although p. fluorescens sbw25 is regarded by some as an obligate aerobe , this has yet to be established and we have not yet tried supplementing kb with nitrate ( or nitrite ) to investigate the impact this would have on ws fitness or the colonisation of the low - o2 region of our microcosms .
earlier work had shown that o2 availability , considered in terms of local concentration , affected ws competitive fitness as ws competitive fitness ( w ) fell from 1.23 under normal o2 conditions to 0.12 when o2 levels were reduced to ~0.05% of normal levels
. however , o2 flux or supply ( measured in terms of quantity / time / area ) to the a - l interface is also likely to be a significant factor contributing to resource scarcity .
flux to the thin layer of liquid at the a - l interface where the ws biofilm is formed ( the physical niche space ) is dependent on the diffusion rate of o2 through air and water and on the uptake of o2 by bacteria at the a - l interface and lower down in the liquid column . whilst flux differences affecting local o2 concentrations might alter growth rates ,
the total amount of o2 made available in these two regions will determine maximal population sizes over the 13 days in which ws biofilms form and our fitness assays are undertaken .
we have used mineral oil overlays to reduce the diffusion of o2 to the oil - aqueous interface to investigate how changes in flux might affect ws fitness . an oil layer lying between
the air and the kb liquid column represents a diffusivity barrier to o2 , as diffusion in light oil is lower than that in water and air ( approx . 1 10 , 2 10 , and 2 10 cm / s , resp .
, at 2537c ) . as a result , o2 flux or supply to the top of the kb liquid column
will be lowered by an intervening oil layer in an inverse proportional depth manner once the bacteria begin to take up o2 .
preliminary experiments showed that the mineral oil used here had no toxic effect on p. fluorescens sbw25 growth in shaken microcosms ( one - tailed t - test , p = 0.9993 ) and that ws biofilms formed immediately below the oil layer at the oil - aqueous interface of static microcosms containing 1040 mm oil .
however , although ws biofilms were produced in these oil - overlay microcosms , they were significantly reduced in terms of growth , strength , and attachment levels compared to the reference microcosms without oil ( table 1 ) , suggesting that wrinkly spreader colonisation of the oil - aqueous interface was less successful . however
, a small but significant increase in relative fitness up to 1.096 0.008 ( w / wr ) was observed in microcosms with 20 and 40 mm oil overlays compared to the reference microcosms with no oil ( tk - hsd , = 0.05 ) ( figure 3 ) , suggesting that the value of colonising the oil - aqueous interface increased with reduced o2 flux .
although we initially struggled to resolve the apparent conflict between our oil - overlay fitness results with that of earlier work , we can propose a model which links both experimental results through an understanding of how local o2 concentrations and o2 flux to the a - l interface influence ws biofilm formation and fitness . at very low o2 levels and negligible flux , as provided by the sealed anaerobic bags used in the earlier experiments , the cost of biofilm formation by the wrinkly spreader was higher than the limited and short - term growth advantage achieved under these conditions , and , as a result , the wrinkly spreader had no fitness advantage over the non - biofilm - forming competitor ( we calculate relative fitness of 0.12 ( w / wr ) in the low - o2 conditions compared to normal o2 levels from ) .
in contrast , although o2 flux was reduced in our oil - overlay experiments and impacted the growth and maximal population sizes of both the wrinkly spreader and the competitor , local o2 concentrations and the continued supply of o2 from the atmosphere allowed further growth and provided the ecological reward for ws biofilm formation . we might expect that if a higher - density starting inoculum was used , sufficient o2 might be removed from the kb liquid column such that the reduced o2 flux could never supply sufficient additional o2 to allow the development of a biofilm .
similarly , a shorter incubation period should reduce ws performance as we expect that the maximum growth in wrinkly spreader populations occurs once the biofilm has been established in the high - o2 region of the microcosm , whilst longer incubation with a sufficiently high - o2 flux should improve matters whilst the biofilm develops in size and until within - ws competition begins to dominate .
bacterial behaviour is controlled by interacting regulatory systems to alter taxis towards energy sources or specific nutrients , o2 , and so forth , the uptake of resources , and metabolism to maximise energy production and growth ( e.g. , [ 3739 ] ) , and , in p. fluorescens sbw25 populations , diversification and final population sizes are dependent on nutrient levels [ 20 , 40 ] .
however , although o2 levels might be the dominating factor affecting growth , diversification , and fitness in normal static microcosms , we predict that the importance of o2 to ws fitness will decrease as other factors become progressively growth - limiting , and we have used microcosms with reduced - nutrient levels to test this prediction .
preliminary tests were used to establish the notion that p. fluorescens sbw25 could grow in microcosms containing 0.1x and 0.01x normal nutrient levels , but not at 0.001x ( dunnett 's test with control , = 0.05 ) .
this is in agreement with other studies in which the impact of reduced - nutrient levels on the growth rate of p. fluorescens sbw25 , carrying capacity , and time lag under similar conditions has been investigated .
further tests showed that ws biofilms were produced under these conditions , but , like those in the oil - overlay experiments , they were significantly reduced in terms of growth , strength , and attachment levels compared to the reference microcosms containing normal nutrient levels ( table 1 ) .
similarly , a large significant decrease in relative fitness to 0.096 0.019 ( w / wr ) was observed in reduced - nutrient microcosms compared to the reference microcosms with normal nutrient levels ( tk - hsd , = 0.05 ) ( figure 4 ) .
this confirms that ws fitness is sensitive to nutrient levels but , more specifically , indicates that the effect of o2 on ws fitness depends on the availability of other resources which might become growth - limiting , revealing more complexity in this simple model system . from other work ,
both absolute nutrient levels and complexity are known to affect the adaptive radiation of p. fluorescens sbw25 populations , with reduced levels and single nutrient sources resulting in a lower frequency of wrinkly spreaders [ 19 , 20 , 40 ] .
we can confirm this as , under the conditions used here , ~60% of the cells sampled after three days from microcosms with normal nutrient levels inoculated with wild - type p. fluorescens sbw25 were wrinkly spreaders ; in contrast , none were observed in reduced - nutrient microcosms after the same time .
however , we have not investigated how changing the inoculum size , growth rates , or final population sizes might also interact with reduced - nutrient levels to affect the appearance of wrinkly spreaders in radiating populations of p. fluorescens sbw25 . collectively , the oil - overlay and reduced - nutrient experiments demonstrate the hidden complexity in this seemingly simple model system where ws fitness is affected predominantly by o2 levels , but also by o2 and nutrient interactions .
we predict that , under sufficiently low o2 conditions , nutrient levels would begin to dominate , and , under optimal o2 and nutrient conditions , the physical dimensions of the microcosm would become important with large sa / v ratios favouring the wrinkly spreader and low ratios possibly selecting for low - o2-adapted mutants .
clearly , any response to altered resource levels or physical dimensions will be sensitive to the cell densities and relative numbers of wrinkly spreaders and non - biofilm - forming competitors used for inoculation as well as the length of incubation .
the meniscus trap is a feature of the physicality of microcosms which we speculate aids ws biofilm formation and fitness .
although the progression of ws biofilm formation has yet to be recorded , it is likely that individual cells or rafts of cells first attach to the vial walls at the meniscus before growing outwards to cover the a - l interface .
we expect that the acute angle formed at the meniscus by the air - liquid - solid surface ( a - l - s ) interface will form a high - o2 trap for cells ( figure 5 ) which might be recruited to the a - l interface by swimming motility , bioconvection cells , and penetration of the interface by a combination of cellulose , attachment factor , and surfactant expression [ 16 , 23 , 4143 ] .
this model is based on sessile drops where a hydrodynamic vortex is created by bacterial o2 taxis and the downward gravitational effect due to cell density which enhances o2 diffusion into the liquid and traps cells near the a - l - s interface .
we overfilled microcosms to produce convex - shaped a - l interfaces lacking meniscus traps to investigate the impact this would have on ws biofilm formation and fitness ( figure 5 ) .
preliminary experiments showed that ws biofilms formed in convex microcosms , though they were reduced in terms of growth , strength , and attachment levels compared to the reference microcosms with normal concave a - l interfaces ( table 1 ) .
although relative microcosm growth and biofilm strengths increased similarly in concave and convex microcosms over three days of incubation , relative attachment levels in convex microcosms were found to be significantly reduced by ~0.6x compared to concave microcosms after three days ( tk - hsd , = 0.05 ) ( figure 6 ) .
this suggests that the meniscus trap supports better growth of attached cells and the early establishment of the ws biofilm in concave microcosms .
a corresponding small but significant reduction in relative fitness to 0.959 0.004 ( w / wr ) was found in convex microcosms compared to concave microcosms after one day ( figure 7 ) , but not after the third day at which point relative fitness had dropped to ~0.9 ( w / wr ) in both types of microcosm ( tk - hsd , = 0.05 ) , perhaps as the result of the unintentional damage of the biofilms caused by the daily additions of media required to maintain a - l interface shapes .
experimental populations of p. fluorescens sbw25 in simple microcosms have proved to be a useful model system for investigating bacterial adaptive radiation and allowed mechanistic links to be made between mutation , the wrinkly spreader morphotype , and ws fitness advantage .
although this system is simple , our results provide new insight into the effects of several environmental parameters on the relative fitness of this numerically dominant class of evolved niche specialist . as such
, the work represents an advance in our understanding of this influential model system , highlighting the way in which o2 and other factors interact , increasing complexity , and impacting ws fitness .
further manipulation of the system to enhance the development of low - o2 adaptive morphotypes colonising the liquid column below the ws biofilm would allow a more comprehensive understanding of the adaptive radiation of an ancestral genotype into interlinked niches with quite different selective pressures . | adaptive radiation in bacteria has been investigated using wrinkly spreaders ( ws ) , a morphotype which colonises the air - liquid ( a - l ) interface of static microcosms by biofilm formation with a significant fitness advantage over competitors growing lower down in the o2-limited liquid column . here ,
we investigate several environmental parameters which impact the ecological opportunity that the wrinkly spreaders exploit in this model system .
manipulation of surface area / volume ratios suggests that the size of the ws niche was not as important as the ability to dominate the a - l interface and restrict competitor growth .
the value of this niche to the wrinkly spreaders , as determined by competitive fitness assays , was found to increase as o2 flux to the a - l interface was reduced , confirming that competition for o2 was the main driver of ws fitness .
the effect of o2 on fitness was also found to be dependent on the availability of nutrients , reflecting the need to take up both for optimal growth . finally , the meniscus trap , a high - o2 region formed by the interaction of the a - l interface with the vial walls , was also important for fitness during the early stages of biofilm formation .
these findings reveal the complexity of this seemingly simple model system and illustrate how changes in environmental physicality alter ecological opportunity and the fitness of the adaptive morphotype . |
the age - standardized incidence is approximately 1 per 100,000 women in the united states and few cases have been reported since 1957.2-
4 hcc is aggressive during pregnancy and has a poor prognosis with an overall one - year survival of 23% , which could be explained by two main etiologies : estrogen elevation which accelerates the evolution of hcc and immune suppression during pregnancy .
we present a case of hcc in a 41-year - old pregnant patient who referred to our academic hospital with abdominal pain , icter , laboratory features of microangiopathic hemolytic anemia and low alpha fetoprotein ( afp ) .
a 41-year - old pregnant woman referred to our hospital in the 22nd week of gestational age with right upper abdominal pain and jaundice .
she had mild abdominal pain six weeks before presentation which was aggravated one week before admission .
four days before admission , she had icter , tea colored urine and edema in her lower extremities .
she had nausea and vomiting but no headache , blurred vision or bleeding was mentioned .
a past history was remarkable for two abortions and one live birth prior to this pregnancy .
she took only ferrous sulfate and aspirin in this pregnancy and no other drugs , herbal medicines or oral contraceptives ( ocps ) .
there was no history of blood transfusion , hepatitis or exposure to aflatoxin in her past history however her father died from hcc due to hepatitis b virus ( hbv ) .
laboratory investigations showed features of microangiopathic hemolytic anemia that included schistocytes , elevated prothrombin time and erythrocyte sedimentation rate ( esr ) , and negative viral markers(negative hbsag and hbcab ) .
differential diagnoses of hellp syndrome , thrombotic thrombocytopenic purpura ( ttp ) or acute fatty liver of pregnancy ( aflp ) were made for further evaluation and management .
her blood pressure was 110/70 mmhg with a pulse rate of 110 beats / min , respiratory rate about 18/min and oral temperature of 37c .
her abdomen was tender , particularly in the right upper quadrant , but without rebound and guarding .
lower extremities had 3 + pitting edema and there were ecchymotic lesions at previous injection sites .
blood electrolytes were normal but there was direct hyperbilirubinemia and liver enzymes showed a cholestatic pattern .
peripheral blood smear showed features of microangiopathic hemolytic anemia that included target cells , tear drop and nucleated rbcs , and numerous schistocytes .
urine analysis was positive for microscopic hematuria and proteinuria.a 24-hour urine collection showed 226 milligrams of protein .
viral markers of hbv and hcv , autoantibodies and adisintegrin - like and metalloproteinase with thrombospondin type 1 motif ( adamts)-13 antigen and antibody ( markers for thrombotic thrombocytopenic pupura = ttp ) were all negative .
afp level was 90.7 and cancer antigen 125 ( ca125 ) titer was > 1000 .
transabdominalsonography showed a normal fetus with a gestational age of about 23 weeks and normal amniotic fluid in the breech position .
no lesion was noted in the portal vein , which had a diameter of 10 mm .
a possible diagnosis of hellp was made and supportive care for correction of coagulation disorder with fresh frozen plasma ( ffp ) and corticosteroids were administrated .
because of deterioration in her mental state in conjunction with an increased bilirubin level and international normalized ratio ( inr ) , the pregnancy was terminated .
vaginal delivery was not possible because of the patient s decreased mental state so a cesarean section was performed .
the fetus was delivered and transferred to nicu but expired because of immaturity . at laparotomy ,
approximately one liter of ascitic fluid was noted in the abdomen and the liver had multiple malignant appearing mass lesions , which were biopsied with wedge resection .
surgical specimen of the liver showed pleomorphic appearances that confirmed hepatocellular carcinoma ( hcc ) ( arrows ) .
after delivery the patient experienced progressive loss of conscious along with multi - organ failure and unfortunately died after a few days .
hcc during pregnancy is very rare and only 48 cases have been reported since roddie s first report in 1957 until 2010 according to a pubmed literature review .
the incidence of hcc in pregnant women is about 1 per 100,000 , of which most reside in africa and asia .
according to the literature , the mean age of pregnant women with hcc was 28.94.4 years after 1995 .
these women had fewer pregnancies , fewer signs and symptoms , and higher survival rates compared to women diagnosed before 1995 who were older ( 31.47.2 years ) , diagnosed late in pregnancy and many of whom received no curative treatment .
choi et al . have shown that in the african or asian race , particularly among the chinese , hbv and ocps are the main etiologies for hcc during pregnancy .
our case had negative hbsag , hbcab , and hcv ab levels and had no past history of ocp consumption .
our case was 41 years old and diagnosis was made in during the fourth pregnancy .
the risk of hcc increases with parity4 as shown in the present case but is very low in those who are hbsag non - carriers , with an incidence of 0.55 per 100,000 in women reported by fwuet al .
hcc is rare during pregnancy because of the lower incidence of hcc in women during the reproductive years and infertility that is due to cirrhosis .
pregnancy may have an adverse effect on the progression of hcc because of the effects of estrogen viral hepatitis carcinogenesis , however some authors disagree .
late menopause , early menarche , ocps and multiparity have been reported as risk factors for hcc , again suggestive of the negative impact of pregnancy on hcc .
estrogen can increase hepatocyte mitosis , hypervascularity , free radicals , reactivate hbv and decrease humoral immunity.11 ,
12
hcc is asymptomatic in its early stages during pregnancy but right upper quadrant pain or the presence of a mass , weight loss and hepatomegaly have been the most frequent presentations , however our case presented with nausea and vomiting and abnormal liver enzymes which have been rare in reported cases ( each , 6.4% in the literature ) .
our patient had hemolytic microangiopathic anemia , which was not found in previous cases and had no history of weight loss .
in addition , a family history of hcc was only found in 8% of cases3 , which again was present in our case .
in our case , the afp level was about 90ng / ml and unusual for hcc .
maternal afp levels are used to screen for down syndrome or neural tube defects and it has been suggested that elevated afp in a pregnant patient with a normal fetus is indicative of maternal disease , particularly hcc .
however afp screening for hcc lacks sensitivity because it depends on maternal weight , age , diabetes and ethnicity .
previous studies have shown that 10% of pregnant women can have hcc with normal afp levels and 55.3% have afp levels less than 400 ng / ml , thus afp alone has a high positive predictive value .
ca 125 , which is primarily used for ovarian cancer could be rarely elevated in hcc ; elevations more than 1000ng / dl as seen in our patient have been previously reported .
other laboratory abnormalities that include hyperbilirubinemia , prolonged of prothrombin time and hypoalbuminemia , which were present in this case have been reported in less than 10% of previous studies .
our patient also had multiple lesions and her barcelona clinic liver cancer staging system ( blcl staging ) was stage 4 .
choi et al . reported 33.3% of their patients had multiple lesions and 21.7% were blcl stage 4 .
liver resection is the best management if possible but in cases such as ours termination of pregnancy as soon as possible is recommended.1
,
3 improvement in the surgery methods would result in a three - year survival rate of 62.5% and the potential for uneventful pregnancy in such cases .
hcc during pregnancy has a poor outcome and 20% of patients have distant metastasis at presentation according to previous reports , however fibrolamellar hcc has a better prognosis .
delivery was by cesarean section in 44.82% and live births were present in only 58.7% cases .
unfortunately our patient and her fetus both died soon after diagnosis and cesarean section .
as conclusion ,
those with a family history of cancer should be more closely worked up , even if they present with unusual manifestations .
| hepatocellular carcinoma ( hcc ) is very rare during pregnancy and has a worse prognosis in pregnant women compared to those who are not pregnant .
we present a case of hcc in a 41- year - old pregnant patient who was referred to our academic hospital.the patient presented with chief complaints of abdominal pain , jaundice , edema and hypertension .
laboratory results were notable for elevated liver enzymes and features of microangiopathic hemolytic anemia with normal alpha fetoprotein ( afp ) and elevated cancer antigen 125 ( ca125 ) .
at laparotomy for termination of pregnancy , multiple massive lesions were detected in the liver .
histologic evaluation showed features of hcc.hcc must be included in the differential diagnosis of any pregnant patient who presents with elevated liver enzymes and hemolysis . |
systemic lupus erythematosus ( sle ) is an autoimmune disease that may involve multiple organs .
herein , we report a case of fatal gastrointestinal vasculitis as a rare presentation of systemic lupus erythematosus in a 34-year - old woman .
a 34-year - old woman was admitted to our hospital because of progressive lower abdominal pain for duration of two weeks .
she developed a few episodes of non - bloody , loose stool along with constant lower abdominal pain .
she did not experience any fever , anorexia , or weight loss.on physical examination she was conscious , mildly pale , and afebrile with pulse rate : 100 beats / min , blood pressure : 120/80 mmhg , respiratory rate : 14/min , mild diffuse abdominal tenderness , and mild abdominal distension along with shifting dullness .
laboratory data showed white blood count ( wbc):4700/mm ( neutrophil : 80% , lymphocyte : 9% , monocyte : 1% , eosinophil : 10% ) , hemoglobin : 12.8 g / dl , platelet count : 84,000/mm , esr : 11 mm , crp : 24 mg / dl , ldh : 610 iu / l ( nl<460 ) , ast : 20
iu / l , alt : 13 iu / l , alp : 165 iu / l , total bilirubin : 0.3 g / dl , direct bilirubin : 0.1 g / dl , pt : 12 sec , inr : 1 , ptt : 25 sec , total protein : 6.4 g / dl , albumin : 3.2 g / dl , bun : 23 mg / dl , creatinin : 0.7 ng / ml .
peripheral blood smear showed low platelet , as well as hypochromia , anisocytosis , and microcytosis in red blood cells .
a diagnostic paracentesis was done , which showed : total protein : 5.1 g / dl , albumin : 2.6 g / dl , wbc : 160/mm with 55% lymphocytes , rbc : 3700/mm .the serum - ascites albumin gradient ( saag ) was 0.5 .
bacterial evaluation , acid fast staining , and cultures of the fluid were all negative .
abdominopelvic computed tomography showed diffused wall thickening in the colon along with thickening of a loop in the small intestine at the left upper quadrant .
marked ascites and small left pleural effusion were also seen but no evidence of vascular thrombosis was detected .
platelet count rapidly dropped to 20,000 during the next few days but reticulocyte count , d - dimer and coomb s test were normal .
the patient remained in good condition and her diarrhea and abdominal pain improved with supportive treatment .
five days after taking biopsy samples , the patient s condition deteriorated as she complained of vomiting and diarrhea , yet again . at the same day she underwent another abdominopelvic computed tomography that showed wall thickening of the colon and target sign in the small intestine .
upper pole of the left kidney showed heterogeneous enhancement of suspected ischemic changes but no evidence of vascular thrombosis was detected again ( figure 1 ) .
abdominal and pelvic tomogram with intravenous and oral contrast showed target sign ( narrow arrows ) and ischemic changes in left kidney ( thick arrows ) .
initial investigations for infectious agents including strongyloides stercoralis and neoplasms such as lymphoma were negative . however , antinuclear antibody was elevated to 100 ( nl<10 eu ) .
intravenous hydrocortisone 300 mg / day was started immediately and anti ds - dna and complements ( c3 , c4 , ch50 ) were requested to be tested . despite the use of high dose intravenous steroid therapy , the patient s symptoms did not improve .
the patient underwent diagnostic laparoscopy after 3 days of corticosteroid therapy because of the new changes in her condition .
a few minutes after the procedure , abundant pinkish discharge was noted via the endotracheal tube and the patient also developed hypoxemia and tachycardia . on examination she had bilateral diffuse rales and ronchi along with a distended abdomen .
her death was due to disseminated intravascular coagulation ( dic ) and subsequent respiratory failure .
laboratory data later showed high titer of anti ds - dna [ 150 ( nl<35 iu / ml ) ] and low complement levels .
gi sample biopsies through laparoscopy and after death ( open laparotomy ) from intestine did not show any histological abnormality .
sle enteritis is one of the most common causes of abdominal pain in sle .
some laboratory data used to detect sle activity such as anti phospholipid antibody ( apl ) , do not correlate with lupus enteritis except leucopenia .
computed tomography can show and monitor pathological abnormalities in the abdomen . in one study target sign
was reported in 90% of patients with sle who complained of acute abdominal pain . in all cases ,
bowel wall thickening was circumferential and symmetric and the most common sites of involvement were the jejunum and ileum .
double halo or target sign , can be seen due to submucosaledema of the small bowel . in our
case diffuse wall thickening was seen in the colon and rectum in early phase , which extended to the small intestine with target sign view .
we performed diagnostic laparoscopy due to the rapid deterioration of her condition to detect any complications ; however no macroscopic or microscopic abnormalities were found in the bowel and finally she died as a result of dic .
although complications of diagnostic laparoscopy are rare , we can not rule out the positive pressure effects on small vessels through gas insufflations .
small vessels are involved during gi vasculitis and even minimal positive pressure might lead to reduce visceral perfusions in this setting .
we could not find the reason for the patient 's rapid deterioration and death after diagnostic laparoscopy .
clinicians can prevent morbidity and mortality of sle related gi vasculitis if they can recognize and treat it as early as possible .
abdominal computed tomography is a useful tool for detecting some abnormalities in abdominal pain of patients with sle .
| this case report demonstrates fatal gastrointestinal vasculitis as a rare presentation of systemic lupus erythematosus . a 34-year - old woman presented with abdominal pain and diarrhea .
anti nuclear antibody was positive and high titre of anti - ds dna antibody was also reported .
treatment with corticosteroid and supportive cares were started ; however , her condition worsened .
eventually , she was considered as a candidate for diagnostic laparoscopy .
immediately after laparoscopy , she developed respiratory distress along with upper gastrointestinal bleeding . soon after , the patient died because of disseminated intravascular coagulation . |
primary tumors of the trachea are rare , occurring in less than 2 out of 1,000,000 persons per year representing less than 0.1% of cancer death .
adenoid cystic carcinoma ( acc ) is the second most common primary malignant tracheal neoplasm after squamous cell carcinoma .
acc commonly arises at the distal portion of the trachea and its laryngeal involvement is extremely rare .
multidetector helical computed tomography ( mdct ) and magnetic resonance imaging ( mri ) may help in early diagnosis of this tumor .
plain lateral radiograph of the neck revealed a broad - based polypoidal mass arising from the posterior wall of the proximal trachea [ figure 1 ] .
histopatholgical examination of the mass confirmed it to be an acc [ figure 2 ] .
patient suddenly developed severe respiratory distress and change of voice for which emergency tracheostomy was performed .
mdct [ figures 3 and 4 ] revealed a broad - based polypoidal soft tissue mass arising from the posterior wall of the proximal end of the trachea just below the cricoid cartilage and extending to involve the subglottis resulting in near total luminal obstruction .
the tracheal mass eroded the tracheal cartilage and was abutting the right lobe of the thyroid .
metastatic work up which included ct thorax , abdominal ultrasound , and bone scan were normal .
because of laryngeal extension , total laryngectomy and end - tracheostomy was performed in addition to resection of the tracheal segment .
follow - up of the patient after 18 months post - treatment did not reveal local recurrence or distant metastases .
lateral radiograph of neck shows a broad - based polypoidal mass arising from the posterior wall of proximal end of trachea causing luminal narrowing ( arrows ) .
high magnification ( hematoxylin and eosin , 100 ) photomicrograph of stained biopsy specimen shows neoplastic , moderately uniform round cells with hyperchromatic nuclei arranged in typical cribriform pattern of growth ( arrows ) .
( a ) contrast - enhanced axial computed tomography ( ct ) scan of neck shows a broad - based soft tissue mass ( arrows ) arising from posterior wall of upper end of trachea with both intraluminal and extraluminal components .
( b ) ct scan obtained at the level of cricoid cartilage shows extension of tumor to subglottis ( arrow ) . a 42-year - old man diagnosed with adenoid cystic carcinoma .
serial sagittal reformatted ct images ( a - c ) of neck show longitudinal extent of tumor ( arrows ) located at upper end of trachea extending to subglottis with both intraluminal and extraluminal components .
tracheostomy tube is seen inferior to the mass ( arrowhead ) . 42-year - old man diagnosed with adenoid cystic carcinoma .
( a ) axial magnetic resonance post - contrast t1-weighted image of neck shows broad - based soft tissue mass ( arrow ) arising from posterior wall of upper end of trachea causing near total luminal narrowing and having both intraluminal and extraluminal components .
( b ) magnetic resonance image obtained at the level of cricoid cartilage shows extension of tumor to subglottis .
sagittal magnetic resonance short tau inversion recovery image of neck shows longitudinal extent of tumor ( arrow ) located at the level of upper end of trachea extending to subglottis causing almost complete luminal narrowing .
acc is predominantly a malignant tumor of the salivary glands and most common in the parotid gland representing about 10% of head and neck tumors .
acc of the trachea is a rare neoplasm originating from submucosal glands of the tracheobronchial tree .
it is most common in patients in their 4 and 5 decades of life . in the study by calzada
the laryngeal subsite was defined as the area between epiglottis superiorly and the cricoid cartilage inferiorly .
acc is a low malignancy neoplasm having prolonged clinical course with late onset of metastases and late local recurrence .
it has a tendency to spread by direct extension , submucosally or along perineural planes and distant hematogenous spread .
pulmonary metastases are the most common distant metastases and may occur many years after treatment .
however , occasional metastases have been reported to organs like liver , brain , bony skeleton , etc .
our patient did not have evidence of metastases at the time of diagnosis and 18 months after follow - up .
most of the adult primary tracheal tumors arise in the distal third region of the trachea . in our patient
symptoms associated with acc are usually related to airway obstruction and these are dyspnea , cough , stridor , hemoptysis , wheezing , and change in voice .
unfortunately , many patients with acc are mistakenly diagnosed and treated as asthma patients for months or years . early diagnosis of acc is important as it may improve surgical resectibility and thereby improve prognosis .
routine chest x - rays and plain radiograph of neck are relatively insensitive in detecting tracheal lesion . however , sometimes plain radiograph of the neck maybe very helpful in detecting tracheal tumor as shown in our patient . on plain lateral radiograph , acc of trachea may appear as broad - based or pedunculated polypoid mass .
these two modalities help to demonstrate the primary tumor , its extent , and delineation of its relation to adjacent structures .
mdct has revolutionized the radiological assessment of the central airways with better quality of multiplanar and three - dimensional reconstruction images .
ct is considered to be the standard imaging modality for assessment of tracheal tumor and the reformatted images demonstrate both intraluminal and extraluminal extent of the tumor in addition to evaluation of its relationship to adjacent structures .
acc has a tendency toward submucosal extension and on ct it appears as an intraluminal mass of soft tissue attenuation with extension through tracheal wall .
sometimes , the lesion may present as diffuse or circumferential wall thickening , a soft tissue mass filling the tracheal lumen , or thickened tracheal wall encircled by soft tissue mass in the transverse and longitudinal planes .
these tumors are variable in shape ( broad - based or polypoid ) and margins ( irregular , smooth , or lobulated ) .
mri is also useful for assessment of tracheal tumor and its extent just like mdct .
however , mri does not have distinct advantage over ct in the evaluation of tracheal tumors .
our case highlights the importance of both imaging modalities in preoperative assessment of tracheal acc .
however , recommended treatment consists of surgical resection with postoperative radiotherapy . early diagnosis and treatment by surgery with radiation therapy provide significantly prolonged survival or even the possibility of complete remission .
our patient is doing very well 18 months after surgery and postoperative radiotherapy without any evidence of local recurrence or distant metastases .
long - term survival of patients of acc depends on the presence of distant metastases .
mdct is the imaging modality of choice for assessment of the tumor , its extension , and distant metastases .
surgical resection followed by radiotherapy is widely recommended protocol for treatment and provides the best chance of prolonged survival .
radiologists should be aware of this rare neoplasm as early diagnosis and treatment are essential for its improved prognosis . | primary malignant tracheal tumors are not common and adenoid cystic carcinoma ( acc ) of trachea is rare . we report an extremely rare case of acc of proximal trachea , which was diagnosed in a 42-year - old male who presents with 6-month history of dyspnea .
lateral skiagram of neck , computed tomography , and magnetic resonance imaging revealed a broad - based polypoidal soft tissue mass arising from posterior wall of the proximal trachea .
biopsy confirmed the diagnosis of acc .
the patient was treated by surgical resection followed by radiotherapy and is on regular follow - up .
follow - up at 18 months post - treatment showed no local recurrence or distant metastases .
the literature on tracheal acc is reviewed .
image findings are briefly discussed . |
cases evaluated in this study were selected from patients who underwent biopsies during a 12-month period .
two hundred ninety three female patients with 314 lesions underwent us - guided biopsies at a single facility .
the mean patient age was 39.9 years with a range of 17 - 81 years .
the vast majority of the masses had diameters in the range of 0.4 - 2.6 cm .
the diameters measured were 0.4 - 1 cm in 112 ( 36% ) cases , 1.1 - 1.5 cm in 101 ( 32% ) cases , and 1.6 - 2.6 cm in 101 ( 32% ) cases .
the pre - biopsy final assessments were performed by a single radiologist with five years of experience in breast imaging .
seven cases were category 2 , 104 cases were category 3 , 158 cases were category 4 , and 45 cases were category 5 .
of the 314 lesions , 88 ( 28% ) were confirmed to be malignant by histology . of the malignant lesions ,
the most common diagnosis was invasive ductal carcinoma , which was found in 77 of the 88 cancer cases .
other diagnoses included tubular carcinoma ( 3/88 ) , mucinous carcinoma ( 3/88 ) and ductal carcinoma in situ ( 5/88 ) .
the remaining 226 ( 72% ) of the 314 total lesions were benign , including eight lesions associated with atypical ductal hyperplasia .
follow - up ultrasonography was performed for 117 of the 226 benign cases and the mean duration time was 15 months ( range : 3 to 24 months ) .
four cases in category 2 had a mean duration time of 11 months ( range : 6 - 17 months ) , 58 cases in category 3 had a mean duration time of 15 months ( range : 4 - 24 months ) , and 55 cases in category 4 had a mean duration time of 14 months ( range : 3 - 24 months ) .
the lesions were stable in 65 cases ( 56% ) and decreased in size in 52 ( 54% ) cases .
two radiologists at one facility performed a us - guided percutaneous biopsy or localization , and pre - biopsy static sonographic images of each breast lesion were acquired .
all images were obtained with high - resolution us equipment ( hdi 5000 or hdi 3000 , advanced technology laboratories , bothell , wa ) using a 12 mhz linear transducer .
four radiologists with experience in breast imaging ( 3 - 11 years ) and who work at outside hospitals reviewed the images .
for each case , at least two static images including radial and antiradial images or transverse and longitudinal images with and without caliper measurements were provided .
other us images including doppler , color doppler , and power doppler images were not provided .
mammographic imaging and medical histories were also not provided to eliminate the possibility of introducing bias into the description and assessment of the us images .
the bi - rads - us included the assessment of masses , calcification , special cases and the final assessment .
however , we focused on us features of masses such as shape , orientation , margin , lesion boundary , echo pattern and posterior acoustic features in this study .
each of the four radiologists independently evaluated all of the cases and selected the most suitable single term from each group of the lexicon , and then decided the final category of the lesion . to assess intraobserver variability ,
one of the four radiologists with experience in breast imaging for four years re - evaluated all cases one month after the initial evaluation .
the sensitivity and specificity was calculated for each radiologist by means of a binary outcome ; categories 2 - 3 were grouped as negative , and categories 4 - 5 were grouped as positive .
inter- and intraobserver variabilities in choosing sonographic descriptors and final assessment according to the bi - rads - us lexicon were determined using cohen 's kappa statistics ( 13 ) .
cohen 's kappa statistics measures the proportion of decisions where observers agree while accounting for the possibility of agreements based on chance alone .
perfect agreement results in a kappa value of 1.0 , and a kappa value of 0 indicates the level of agreement expected based on chance alone .
although no definitive scale exists , prior reports have suggested a scale for kappa values and their level of agreement between observers : 0.2 indicates slight agreement , 0.21 - 0.40 fair agreement , 0.41 - 0.60 moderate agreement , 0.61 - 0.80 substantial agreement , and 0.81 - 1.00 indicates almost perfect agreement ( 14 ) .
cases evaluated in this study were selected from patients who underwent biopsies during a 12-month period .
two hundred ninety three female patients with 314 lesions underwent us - guided biopsies at a single facility .
the mean patient age was 39.9 years with a range of 17 - 81 years .
the vast majority of the masses had diameters in the range of 0.4 - 2.6 cm .
the diameters measured were 0.4 - 1 cm in 112 ( 36% ) cases , 1.1 - 1.5 cm in 101 ( 32% ) cases , and 1.6 - 2.6 cm in 101 ( 32% ) cases .
the pre - biopsy final assessments were performed by a single radiologist with five years of experience in breast imaging .
seven cases were category 2 , 104 cases were category 3 , 158 cases were category 4 , and 45 cases were category 5 .
of the 314 lesions , 88 ( 28% ) were confirmed to be malignant by histology . of the malignant lesions ,
the most common diagnosis was invasive ductal carcinoma , which was found in 77 of the 88 cancer cases .
other diagnoses included tubular carcinoma ( 3/88 ) , mucinous carcinoma ( 3/88 ) and ductal carcinoma in situ ( 5/88 ) .
the remaining 226 ( 72% ) of the 314 total lesions were benign , including eight lesions associated with atypical ductal hyperplasia .
follow - up ultrasonography was performed for 117 of the 226 benign cases and the mean duration time was 15 months ( range : 3 to 24 months ) .
four cases in category 2 had a mean duration time of 11 months ( range : 6 - 17 months ) , 58 cases in category 3 had a mean duration time of 15 months ( range : 4 - 24 months ) , and 55 cases in category 4 had a mean duration time of 14 months ( range : 3 - 24 months ) .
the lesions were stable in 65 cases ( 56% ) and decreased in size in 52 ( 54% ) cases .
two radiologists at one facility performed a us - guided percutaneous biopsy or localization , and pre - biopsy static sonographic images of each breast lesion were acquired .
all images were obtained with high - resolution us equipment ( hdi 5000 or hdi 3000 , advanced technology laboratories , bothell , wa ) using a 12 mhz linear transducer .
four radiologists with experience in breast imaging ( 3 - 11 years ) and who work at outside hospitals reviewed the images .
evaluation and designations were made according to the bi - rads - us . for each case
, at least two static images including radial and antiradial images or transverse and longitudinal images with and without caliper measurements were provided .
other us images including doppler , color doppler , and power doppler images were not provided .
mammographic imaging and medical histories were also not provided to eliminate the possibility of introducing bias into the description and assessment of the us images .
the bi - rads - us included the assessment of masses , calcification , special cases and the final assessment .
however , we focused on us features of masses such as shape , orientation , margin , lesion boundary , echo pattern and posterior acoustic features in this study .
each of the four radiologists independently evaluated all of the cases and selected the most suitable single term from each group of the lexicon , and then decided the final category of the lesion . to assess intraobserver variability , one of the four radiologists with experience in breast imaging for four years re - evaluated all cases one month after the initial evaluation .
the sensitivity and specificity was calculated for each radiologist by means of a binary outcome ; categories 2 - 3 were grouped as negative , and categories 4 - 5 were grouped as positive .
inter- and intraobserver variabilities in choosing sonographic descriptors and final assessment according to the bi - rads - us lexicon were determined using cohen 's kappa statistics ( 13 ) .
cohen 's kappa statistics measures the proportion of decisions where observers agree while accounting for the possibility of agreements based on chance alone .
perfect agreement results in a kappa value of 1.0 , and a kappa value of 0 indicates the level of agreement expected based on chance alone .
although no definitive scale exists , prior reports have suggested a scale for kappa values and their level of agreement between observers : 0.2 indicates slight agreement , 0.21 - 0.40 fair agreement , 0.41 - 0.60 moderate agreement , 0.61 - 0.80 substantial agreement , and 0.81 - 1.00 indicates almost perfect agreement ( 14 ) .
the sensitivity and specificity of the us interpretations by the four radiologists are summarized in table 1 .
the sensitivities of observers were high ( 96 - 100% ) , but the specificities were low and variable ( 8 - 43% ) .
statistical analysis of agreement among observers when choosing lesion descriptions showed a range from fair to substantial concordance .
the greatest reproducibility was found among observers determining the mass orientation ( k = 0.61 ) .
however , only moderate levels of interobserver agreement were found for three of the six descriptive groups : mass shape , boundary and posterior feature ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) .
the lowest levels of concordance occurred when observers determined the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) ( table 2 ) .
figure 1 shows an image for which observers used variable terms to describe the margin but had good agreement for the final assessment .
the reproducibility of the final assessment when assigning lesions as category 2 , 3 , 4 , or 5 was moderate ( k = 0.49 ) ( table 2 ) .
when assigning lesions as category 2 , the greatest reproducibility was found ( k = 0.66 ) and moderate agreement degree was found for category 5 ( k = 0.54 ) .
only fair reproducibility was found for determining category 3 ( k = 0.26 ) and for category 4 ( k = 0.30 ) . when choosing between a follow - up evaluation ( category 2 and 3 ) or recommending a biopsy ( category 4 and 5 ) , the level of agreement was lower ( k = 0.33 ) than when assigning lesions as category 2 , 3 , 4 , or 5 .
figure 2 shows a lesion for which the observers disagreed on the final assessment and recommendation .
substantial intraobserver agreement was found in selecting all of the morphologic features ( table 3 ) .
substantial agreement was achieved for the final assessment category ( k = 0.74 ) with all final categories ( 2 , 3 , 4 and 5 ) .
perfect agreement was found with lesions categorized as category 2 ( k = 1.0 ) .
substantial agreement was obtained for categories 3 and 5 ( k = 0.61 and k = 0.68 , respectively ) .
there was moderate agreement among observers for category 4 ( k = 0.59 ) . when choosing between follow - up care or recommending a biopsy , for all final categories the level of agreement was lower ( k = 0.62 ) than the assessment category ( k = 0.74 ) .
the degrees of agreements for all descriptors except echo pattern were similar to the study of baker et al .
( 9 ) ; in the current study , the degree of agreement for the final assessment was higher .
statistical analysis of agreement among observers when choosing lesion descriptions showed a range from fair to substantial concordance .
the greatest reproducibility was found among observers determining the mass orientation ( k = 0.61 ) .
however , only moderate levels of interobserver agreement were found for three of the six descriptive groups : mass shape , boundary and posterior feature ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) .
the lowest levels of concordance occurred when observers determined the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) ( table 2 ) .
figure 1 shows an image for which observers used variable terms to describe the margin but had good agreement for the final assessment .
the reproducibility of the final assessment when assigning lesions as category 2 , 3 , 4 , or 5 was moderate ( k = 0.49 ) ( table 2 ) . when assigning lesions as category 2 , the greatest reproducibility was found ( k = 0.66 ) and moderate agreement degree was found for category 5 ( k = 0.54 ) .
only fair reproducibility was found for determining category 3 ( k = 0.26 ) and for category 4 ( k = 0.30 ) .
when choosing between a follow - up evaluation ( category 2 and 3 ) or recommending a biopsy ( category 4 and 5 ) , the level of agreement was lower ( k = 0.33 ) than when assigning lesions as category 2 , 3 , 4 , or 5 .
figure 2 shows a lesion for which the observers disagreed on the final assessment and recommendation .
substantial intraobserver agreement was found in selecting all of the morphologic features ( table 3 ) .
substantial agreement was achieved for the final assessment category ( k = 0.74 ) with all final categories ( 2 , 3 , 4 and 5 ) .
perfect agreement was found with lesions categorized as category 2 ( k = 1.0 ) .
substantial agreement was obtained for categories 3 and 5 ( k = 0.61 and k = 0.68 , respectively ) .
there was moderate agreement among observers for category 4 ( k = 0.59 ) . when choosing between follow - up care or recommending a biopsy , for all final categories the level of agreement was lower ( k = 0.62 ) than the assessment category ( k = 0.74 ) .
the degrees of agreements for all descriptors except echo pattern were similar to the study of baker et al .
( 9 ) ; in the current study , the degree of agreement for the final assessment was higher .
many studies have reported significant inter- and intraobserver variabilities in lesion description and assessment on mammography ( 4 - 8 ) . for us , baker et al .
( 9 ) reported a lack of uniformity among observers use of descriptive terms for breast masses using the lexicon described and further defined by stavros et al .
a standardized lexicon similar to that of the bi - rads was proposed ( 9 ) .
recently , a study by lazarus et al . examined observer variability using the new bi - rads lexicon ( 12 ) . in spite of using a standardized lexicon
, these investigators showed a similar level of consistency using terminology and lower level of consistency for final assessment among observers compared to the baker et al .
( 12 ) , degrees of agreement for shape , margin and boundary were lower and higher for posterior features , echo pattern and final categories , and were similar for orientation ( table 2 ) . in the baker et al .
study ( 9 ) , a greater reproducibility was obtained in determining the shape , margin , echo pattern , posterior feature and final category of a mass ( k = 0.8 , k = 0.43 , k = 0.4 , k = 0.55 and k = 0.51 , respectively ) than in the lazarus et al .
( 12 ) study and our study ( table 2 ) . in our study ,
the greatest consistency was found in determining the orientation of a mass ( k = 0.61 ) . in the lazarus et al .
study ( 12 ) , good consistency was also seen ( k = 0.61 ) .
the determination of parallel or not parallel orientation is generally easily measured , explaining the high degree of observer agreement .
moderate agreement was obtained for shape , boundary , and posterior feature . for shape , some difficulties arose when trying to classify abnormalities containing five or six more gentle lobulations as oval or irregular , which may have contributed to the inter - observer variability ( fig .
, questions arose among the observers when the lesion was elliptical - shaped with not - parallel orientation as to whether it could be deemed as having an " oval shape .
" this situation is not trivial as the designation of an oval shape can influence a radiologist to conclude that the lesion is benign . when determining the posterior acoustic feature , we also had some difficulties because four observers evaluated only static images
furthermore , the use of good us equipment can compensate for posterior acoustic features and posterior shadowing becomes less conspicuous .
we could not find out why the agreement for cho pattern was so low , but it seems to have little effect on determining a final category .
the greatest variation amongst observers was found when labeling a mass margin ( k = 0.32 ) . as mass margin
is a critical feature for determining whether a lesion should be biopsied or not , this determination alone can have a substantial effect on the final assessment .
the margins of a lesion may be heterogeneous , which may make it difficult to accurately label it using only one term . in this study when more than one type of margin existed in a lesion
, we resolved this issue by choosing the term having the greatest positive predictive value , according to stavros and colleagues criteria ( 10 , 11 ) .
the variability in the observers description of breast masses resulted in an inconsistent final assessment using bi - rads - us .
only a moderate level of agreement ( k = 0.49 ) was found for the final assessment . when assigning lesions category 2 , negative for malignancy and category 5 , highly suggestive of malignancy , greater agreements were achieved ( k = 0.66 and k = 0.54 , respectively ) .
this means that observers have similar conceptions for benign ( category 2 ) and malignant lesions ( category 5 ) and variable for probably benign ( category 3 , k = 0.26 ) and suspicious abnormalities ( category 4 , k = 0.3 ) .
thus , the numbers of category 3 or 4 lesions will influence observer variability for each study .
the level of agreement in determining a lesion as belonging to category 2 to 5 ( k = 0.40 ) was higher than when trying to determine whether close follow - up or a biopsy would be recommended ( k = 0.33 ) .
this inconsistency is expected to have a negative effect on patient management . as expected , the agreement of evaluation within a single observer is better than that among multiple observers .
we believe that radiologists have their own internally established standardization of lesion descriptions and criteria of the final categorization , but that the difference in choosing from a fixed set of lesion descriptors between observers may be the result of each individual having different cut - off points for determining whether one description or another is applicable .
first , the number of category 2 or 3 lesions was small and the radiologists may have had a greater tendency to interpret a lesion as being worrisome as the cases of this study were selected from those performed for biopsy .
second , observers did not perform and evaluate real time us , but interpreted only static images .
thus the observers in this study did not have the opportunity to take advantage of certain real time us benefits such as manual compensation of the posterior feature .
third , the radiologists studied bi - rads - us by themselves and made their own criteria .
if they had had a more standardized education for bi - rads - us , we assume that interobserver reproducibility would be higher than reported . upon issuing bi - rads - us ,
the acr states that agreement on terminology and assessment categorization was reached by consensus of an expert working group and agreement among both experienced and novice breast imagers for most terms ( 1 ) .
yet our study shows only moderate agreement for most descriptive terms and the final assessment , although the accuracies of observers were similar with one another .
of special note , the level of agreement in determining the margin and echo patterns was commonly low in our study , as well as in studies by others . in conclusion , although the use of acr bi - rads - us as a unified descriptor system was made , observer agreements were only fair to substantial in the mass description and final assessment of breast abnormalities .
the achievement of better agreement will ultimately require specialized education , as well as periodic performance assessments and self - auditing practice tests . | objectivethis study aims to evaluate the degree of inter- and intraobserver agreement when characterizing breast abnormalities using the breast imaging reporting and data system ( bi - rads)-ultrasound ( us ) lexicon , as defined by the american college of radiology ( acr).materials and methodstwo hundred ninety three female patients with 314 lesions underwent us - guided biopsies at one facility during a two - year period .
static sonographic images of each breast lesion were acquired and reviewed by four radiologists with expertise in breast imaging .
each radiologist independently evaluated all cases and described the mass according to bi - rads - us . to assess intraobserver variability , one of the four radiologists reassessed all of the cases one month after the initial evaluation .
inter- and intraobserver variabilities were determined using cohen 's kappa ( k ) statistics.resultsthe greatest degree of reliability for a descriptor was found for mass orientation ( k = 0.61 ) and the least concordance of fair was found for the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) .
others descriptive terms : shape , lesion boundary and posterior features ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) and the final assessment ( k = 0.51 ) demonstrated only moderate levels of agreement . a substantial degree of intraobserver agreement was found when classifying all morphologic features : shape , orientation , margin , lesion boundary , echo pattern and posterior feature ( k = 0.73 , k = 0.68 , k = 0.64 , 0.68 , k = 0.65 and k = 0.64 , respectively ) and rendering final assessments ( k = 0.65).conclusionalthough bi - rads - us was created to achieve a consensus among radiologists when describing breast abnormalities , our study shows substantial intraobserver agreement but only moderate interobserver agreement in the mass description and final assessment of breast abnormalities according to its use .
a better agreement will ultimately require specialized education , as well as self - auditing practice tests . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.