article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
congenital cardiovascular malformations ( chd ) are the most common group of birth defects , occurring in 6 to 8 per 1000 live births and are responsible for most deaths in the first 12 months of life
.
one quarter of these children will have critical congenital heart disease ( cchd ) , which requires surgery or catheter intervention in the first year of life .
early diagnosis of chd is important because the delayed diagnosis of cchd can lead to cardiac failure , cardiovascular collapse and even death .
pulse oximetry is a well established , exact , noninvasive test for quantification of hypoxemia .
use of this screening method for early detection of cchd is based on clinically undetectable hypoxemia in potentially life - threatening cases .
several studies have documented the lack of sensitivity of routine neonatal examination in detecting chd .
many neonates with chd have no signs that can be detected by clinical examination .
recent studies have reported a high sensitivity and specificity for pulse oximetry for early detection of chd in newborn babies .
in developing countries with inadequate medical staff
our study was designed to find the incidence of clinically unrecognized cchd by using pulse oximetry in a rural hospital .
this was a prospective hospital - based study conducted in the level ii neonatology unit of pediatric department at acharya vinoba bhave rural hospital ( avbrh ) from april 2012 to january 2013 .
avbrh is a 1206 bedded fully equipped teaching hospital attached to the medical college with state of the art facilities at sawangi meghe , wardha , india .
exclusion criteria : out - born babies and those neonates with a prenatal diagnosis of duct dependent circulation by fetal echocardiography . the measurements of spo2 were performed using a massimo single extraction technology ( set ) handheld pulse oximeter with a neonatal reusable nellcor spo2 sensor oxi - a / n probe .
for each newborn , spo2 was measured by a trained social worker on all the four limbs of the newborn within the first 4 hours of life .
the probe was held manually to the wrist or palm and to the sole of the foot , following a random order .
it usually required 5 - 6 minutes for all 4 measurements to be performed .
if the spo2 difference between the right upper limb and lower limb was 3% , then echocardiography was done .
if chd was suspected , the neonate was referred for echocardiography . if no suspicion of chd was made clinically , then measurement of spo2 was repeated after 6 hours and echocardiography done if spo2 persisted 95% .
when the spo2 reading was 90% , bedside echocardiography was done . for normal babies , a follow - up evaluation ( clinical evaluation )
if the newborn had abnormal cardiac examination including a finding of spo2 < 90% , echocardiography was done .
cchd is defined as lesions that include cyanotic defects such as tetralogy of fallot , pulmonary atresia , truncus arteriosus , transposition of the great vessels , total anomalous pulmonary venous return , and tricuspid atresia , as well as left - sided obstructive lesions , including coarctation of the aorta , critical aortic stenosis , interrupted aortic arch , and hypoplastic left heart syndrome .
all other heart disease are labelled as non - critical chd ( including patent foramen ovale or asd < 5 mm , pda < 2 mm ) .
neonates who developed signs or symptoms suggestive of a cardiac defect were evaluated , including blood pressure , electrocardiogram , chest radiograph , pulse oximetry and echocardiography .
an informed consent was obtained from one of the parents ( preferably by mother ) before initial screening .
the diagnostic accuracy of pulse oximetry was measured by computation of sensitivity , specificity , positive and negative predictive values .
during the study period there were 2110 ( male : 1071 ; female : 1039 ) live born neonates at avbr hospital .
there were eight neonates with spo2 < 90% , 102 neonates with spo2 between 90 - 95% and 2000 neonates with spo2 > 95% . seven out of eight neonate with spo2<90% had cchd , three neonates had tga , two had tricuspid atresia , one had tetralogy of fallot and one had transposition of great vessels . out of 102 with
spo2 90 - 95% , 98 neonates showed normal spo2 when repeated after 6 hours from the initial measurement .
out of these two where detected to have chd , one with vsd and one with pda .
the mean spo2 in the first four hour of life in well saturated group ( spo2 95% ) was 98.1 and 82.5% in the low saturated group ( spo2 90% ) .
there were 27 neonates with chd in this study period , the incidence was 21.85 per 1000 live births and cchd was 3.33 per 1000 .
a pulse oximetry cut - off value of below 90% for detecting cchd showed 100% sensitivity , 99.95% specificity , 87.50% positive predictive value , 100% negative predictive value .
a pulse oximetry cut - off value of below 95% showed 100% sensitivity , 95.08% specificity , 6.36% positive predictive value , 100% negative predictive value .
chd are a leading cause of infant deaths in the developed world . delayed diagnosis of chd
the incidence was 21.85 per 1000 live birth which is higher than the previous reported study .
the incidence cchd was 3.33 per 1000 live births in our study which is in agreement with a previous study .
brown kl et al
reported that 25% of infants with cchd were not diagnosed with heart disease until after discharge from the nursery .
a number of children with cchd are so severely compromised at presentation that they die before surgical intervention . screening infants with non - invasive measurement of oxygen saturation has been proposed as an aid for early detection of duct dependent circulation .
cchds are structural heart defects that often are associated with hypoxia among infants during the newborn period .
infants with cchds are at risk for significant morbidity or mortality because there circulation is duct dependent .
vaidyanathan b et al
reports a poor sensitivity for pulse oximetry , as well , for detection of chd .
this may be due to the fact that only four patients in this study had critical chd with cyanosis .
the study done by koppel ri et al
reported the effectiveness of pulse oximetry screening for chd in asymptomatic newborns ( sensitivity : 60% ; specificity : 99.95% ; positive predictive value : 75% ; negative predictive value : 99.98% ; accuracy : 99.97% ) .
similarly , de wahl granelli a et al revealed that systematic screening for cchd with high accuracy required a new generation oximeter , and comparison of saturation values from the right hand and one foot substantially improves the detection of cchd ( sensitivity : 98.5% ; specificity : 96.0% ; positive predictive value : 89.0% ; negative predictive value : 99.5% ) . in our study , for detecting cchd , pulse oximetry ( spo2 ) cut - off value of below 90% showed 100% sensitivity , 99.95% specificity , 87.50% positive predictive value , 100% negative predictive value .
as cchd may not be apparent at the time of early discharge examination , post - ductal arterial pulse oximetry screening during the first 24 hours of life has been put forth as the most useful strategy to prevent circulatory collapse or death .
previous studies have suggested that performing pulse oximetry on all newborns before hospital discharge is an effective screening tool for detection of cchd .
mostly in institutions , pulse oximetry prior to discharge from the newborn nursery is not performed routinely .
pulse oximetry is a safe , noninvasive , inexpensive , excellent detection rate and reasonably sensitive test that will detect many cases of cchd .
the limitation of the study is that the number of screened neonates are small and no cases of coarctation of aorta were picked up to validate the difference of oxygen saturation in the right arm and leg .
the strengths of the study was that it screened large numbers of newborns to rule out cchd with the help of cheap , non - invasive , and ubiquitous pulse oximetry devices .
the weakness of the study was it would not detect all forms of congenital heart disease , and the inevitable false positives cases .
this study suggested that the pulse oximetry , which is noninvasive and cost - effective , can be used as a screening tool for detecting cchd in clinically normal newborns .
if oxygen saturation is below 90% in clinically normal newborns within first 4 hours of birth , urgent echocardiography is suggested to rule out cchd . to decrease the false - positive cases , neonatal screening for cchd | backgroundcongenital cardiovascular malformations are the most common category of birth defects and responsible for mortality in the first twelve months of life .
critical congenital heart disease ( cchd ) will be present in approximately one quarter of these children , which requires catheter or surgery intervention in the first year of life .
aimto determine the accuracy of pulse oximetry for detecting clinically unrecognized cchd in the newborns.methodspulse oximetry was performed on clinically normal newborns within first 4 hours of life .
if screening oxygen saturation ( spo2 ) was below 90% , echocardiography was then performed .
inclusion criteria : all newborns who were admitted in postnatal ward & nicu .
exclusion criteria : out born babies and babies with a prenatal diagnosis of duct dependent circulation .
resultspulse - oximetric screening was performed on 2110 clinically normal newborns .
low spo2 ( < 90% ) was found in eight babies seven of them had cchd , including three neonates with tga , two with tricuspid atresia , one with tetralogy of fallot and one with transposition of great vessels .
a pulse oximetry cut - off value of below 90% for detecting cchd showed 100% sensitivity , 99.95% specificity , 87.50% positive predictive value , 100% negative predictive value.conclusionspulse oximetry is safe , feasible and noninvasive , can be used as screening tool for detecting cchd in clinically normal newborn . if spo2 is below 90% in clinically normal newborns within 4 hours of birth , urgent echocardiography
is suggested to rule out cchd . |
in this paper , we study the global behavior of solutions of the following system :
( 1)xn+1=a+xni=1kyni , yn+1=b+yni=1kxni , n=0,1 , ,
where a , b are positive constants and initial conditions x
i , y
i ( 0 , ) , i = 0,1 , 2 , , k. a pair of sequences of positive real numbers { ( x
n , y
n ) } that satisfies ( 1 ) is a positive solution of ( 1 ) . if a positive solution of ( 1 ) is a pair of positive constants ( x , y ) , then the solution is the equilibrium solution .
a positive solution { ( x
n , y
n ) } of ( 1 ) is bounded and persists , if there exist positive constants m , n such that
( 2)mxn , ynn , n=2,1, .
in 1998 , devault et al . proved that every positive solution of the difference equation
( 3)xn+1=a+xnxn1 , n=0,1 ,
,
where a ( 0 , ) , oscillates about the positive equilibrium c = 1 + a of ( 3 ) .
moreover , every positive solution of ( 3 ) is bounded away from zero and infinity .
also the positive equilibrium of ( 3 ) is globally asymptotically stable . in 2003 , abu - saris and devault studied the following recursive difference equation :
( 4)xn+1=a+xnxnk , n=0,1 , ,
where a ( 1 , + ) , x
k , x
k+1 , , x
0 are positive real numbers .
papaschinopoulos and schinas investigated the global behavior for a system of the following two nonlinear difference equations :
( 5)xn+1=a+ynxnp , yn+1=a+xnynq , n=0,1 , ,
where a is a positive real number , p , q are positive integers , and x
p , , x
0 , y
q ,
, y
0 are positive real numbers . in 2012 , zhang et al .
investigated the global behavior for a system of the following third - order nonlinear difference equations :
( 6)xn+1=a+xnyn1+yn2 , yn+1=b+ynxn1+xn2 ,
where a , b ( 0 , ) , and the initial values x
i , y
i ( 0 , ) , i = 0,1 .
motivated by the discussion above , we study the global asymptotic behavior of solutions for system ( 1 ) . more precisely , we prove the following : if a > 1/k , b > 1/k then every positive solution { ( x
n , y
n ) } of ( 1 ) is persistent and bounded .
moreover , we prove that every positive solution { ( x
n , y
n ) } of ( 1 ) converges the unique positive equilibrium ( x , y ) as n .
in the following lemma , we show boundedness and persistence of the positive solutions of ( 1 ) .
then , every positive solution ( x
n , y
n ) of ( 1 ) is satisfied , for n = k + 1 , k + 2, (8)axn1kbnkxkkabkb1+kabkb1byn1kankykkabka1+kabka1 .
consider ( 1 ) .
then , every positive solution ( x
n , y
n ) of ( 1 ) is satisfied , for n = k + 1 , k + 2, (8)axn1kbnkxkkabkb1+kabkb1byn1kankykkabka1+kabka1 .
prooflet { ( x
n , y
n ) } be a positive solution of ( 1 ) .
since x
n > 0 and y
n > 0 for all n 1 , ( 1 ) implies that
( 9)xna , ynb , n=1,2,3 ,
moreover , using ( 1 ) and ( 9 ) , we have
( 10)xna+1kbxn1 , ynb+1kayn1,n = k+1,k+2, .
let v
n , w
n be the solution of the system , respectively ,
( 11)vn = a+1kbvn1 , wn = b+1kawn1 , nk+1 ,
such that
( 12)vi = xi , wi = yi , i=1,2, ,k .
we prove by induction that
( 13)xnvn , ynwn , nk+1 .
suppose that ( 13 ) is true for n = m k + 1 .
then , from ( 10 ) , we get
( 14)xm+1a+1kbxma+1kbvm = vm+1 , ym+1b+1kaymb+1kbwm = wm+1 .
( 11 ) and ( 12 ) , we have
( 15)vn=1kbnkxkkabkb1+kabkb1,wn=1kankykkabka1+kabka1,nk .
then , from ( 9 ) , ( 13 ) , and ( 15 ) , the proof of the relation ( 8) follows immediately .
let { ( x
n , y
n ) } be a positive solution of ( 1 ) . since x
n > 0 and y
n > 0 for all n 1
, ( 1 ) implies that
( 9)xna , ynb , n=1,2,3 ,
moreover , using ( 1 ) and ( 9 ) , we have
( 10)xna+1kbxn1 , ynb+1kayn1,n = k+1,k+2, .
let v
n , w
n be the solution of the system , respectively ,
( 11)vn = a+1kbvn1 , wn = b+1kawn1 , nk+1 ,
such that
( 12)vi = xi , wi = yi , i=1,2, ,k .
we prove by induction that
( 13)xnvn , ynwn , nk+1 .
suppose that ( 13 ) is true for n = m k + 1 .
then , from ( 10 ) , we get
( 14)xm+1a+1kbxma+1kbvm = vm+1 , ym+1b+1kaymb+1kbwm = wm+1 .
( 11 ) and ( 12 ) , we have
( 15)vn=1kbnkxkkabkb1+kabkb1,wn=1kankykkabka1+kabka1,nk .
then , from ( 9 ) , ( 13 ) , and ( 15 ) , the proof of the relation ( 8) follows immediately .
consider the system of difference equation ( 1 ) . if relation ( 7 ) is satisfied , then the following statements are true.(i)equation ( 1 ) has a unique positive equilibrium ( x , y ) given by
( 16)x = k2ab1kkb1 , y = k2ab1kka1 .
( ii)every positive solution ( x
n , y
n ) of system ( 1 ) tends to the positive equilibrium ( x , y ) of ( 1 ) as n .
consider the system of difference equation ( 1 ) . if relation ( 7 ) is satisfied , then the following statements are true.(i)equation ( 1 ) has a unique positive equilibrium ( x , y ) given by
( 16)x = k2ab1kkb1 , y = k2ab1kka1 .
( ii)every positive solution ( x
n , y
n ) of system ( 1 ) tends to the positive equilibrium ( x , y ) of ( 1 ) as n .
equation ( 1 ) has a unique positive equilibrium ( x , y ) given by
( 16)x = k2ab1kkb1 , y = k2ab1kka1 .
every positive solution ( x
n , y
n ) of system ( 1 ) tends to the positive equilibrium ( x , y ) of ( 1 ) as
n .
proof(i ) let x and y be positive numbers such that
( 17)x = a+xky , y = b+ykx .
then , from ( 7 ) and ( 17 ) , we have that the positive solution ( x , y ) is given by ( 16 ) .
this completes the proof of part ( i).(ii ) from ( 1 ) and ( 8) , we have
( 18)limnsupxn = l1 , limninfxn = l1,limnsupyn = l2 , limninfyn = l2 ,
where l
i , l
i ( 0 , ) , i = 1,2 . then , from ( 1 ) and ( 18 ) , we get
( 19)l1a+l1kl2 , l1a+l1kl2 , l2b+l2kl1 , l2b+l2kl1 ,
from which we have
( 20)l1kb1l2ka1 , l2ka1l1kb1 .
then , relations ( 7 ) and ( 20 ) imply that l
1
l
2 l
1
l
2 , from which it follows that
( 21)l1l2=l1l2 .
< l
1 . then , from ( 21 ) , we have l
1
l
2 < l
1
l
2 and so l
2 < l
2 which is a contradiction .
l
2 = l
2 . therefore , ( 22 ) is true .
hence , from ( 1 ) and ( 22 ) , there exist the limx
n and limy
n , as n and
( 23)limnxn = x , limnyn = y ,
where ( x , y ) is the unique positive equilibrium of ( 1 ) .
( i ) let x and y be positive numbers such that
( 17)x = a+xky , y = b+ykx .
then , from ( 7 ) and ( 17 ) , we have that the positive solution ( x , y ) is given by ( 16 ) .
( ii ) from ( 1 ) and ( 8) , we have
( 18)limnsupxn = l1 , limninfxn = l1,limnsupyn = l2 , limninfyn = l2 ,
where l
i , l
i ( 0 , ) , i = 1,2 . then , from ( 1 ) and ( 18 ) , we get
( 19)l1a+l1kl2 , l1a+l1kl2 , l2b+l2kl1 , l2b+l2kl1 ,
from which we have
( 20)l1kb1l2ka1 , l2ka1l1kb1 .
then , relations ( 7 ) and ( 20 ) imply that l
1
l
2 l
1
l
2 , from which it follows that
( 21)l1l2=l1l2 .
< l
1 . then , from ( 21 ) , we have l
1
l
2 = l
1
l
2 < l
1
l
2 and so l
2
hence , from ( 1 ) and ( 22 ) , there exist the limx
n and limy
n , as n and
( 23)limnxn = x , limnyn = y ,
where ( x , y ) is the unique positive equilibrium of ( 1 ) .
consider the system of difference equation ( 1 ) . if relation ( 7 ) is satisfied and assuming that
( 24)k2ab1ka1+k2ab1kb1<1 ,
then the unique positive equilibrium ( x , y ) is locally asymptotically stable .
consider the system of difference equation ( 1 ) . if relation ( 7 ) is satisfied and assuming that
( 24)k2ab1ka1+k2ab1kb1<1 ,
then the unique positive equilibrium ( x , y ) is locally asymptotically stable .
prooffrom theorem 2 , the system of difference equation ( 1 ) has a unique equilibrium ( x , y ) .
the linearized equation of system ( 1 ) about the equilibrium point ( x , y ) is
( 25)n+1=bn ,
where n = ( x
n , , x
nk , y
n , ,
y
nk ) , and(26 ) let
1 ,
2 , ,
2k+2 denote the eigenvalues of matrix b and let d = diag(d
1 , d
2 ,
, d
2k+2 ) be a diagonal matrix , where d
1 = d
k+2 = 1 , d
i = d
k+1+i = 1 i ( i = 2 , , k + 1 ) , and
( 27)0< < min1k+11x+yky2 , 1k+11x+ykx2 .
computing matrix dbd
, we obtain that(28)from d
1 > d
2 >
>d
k+1 > 0 and d
k+2 > d
k+3 > >d
2k+2 > 0 , imply that
( 29)d2d11<1 , d3d21<1, ,dk+1dk1<1 , dk+3dk+21<1, ,d2k+2d2k+11<1 .
furthermore , noting ( 7 ) , ( 24 ) , and ( 27 ) , we have
( 30)1ky+xk2y2d1dk+31++xk2y2d1d2k+21 = 1ky+xk2y2112++11(k+1) < 1ky+xky211k+1<1,1kx+yk2x2dk+2d21++yk2x2dk+2dk+11 = 1kx+yk2x2112++11(k+1) < 1kx+ykx211k+1<1 .
it is well known that b has the same eigenvalues as dbd
; we have that
( 31)max1i2k+2idbd1=max+yk2x2112++11(k+1)d2d11, ,dk+1dk1,dk+3dk+21, ,d2k+2d2k+11,1ky + xk2y2112++11k+1,1kx + yk2x2112++11(k+1)<1 .
this implies that the equilibrium ( x , y ) of ( 1 ) is locally asymptotically stable .
from theorem 2 , the system of difference equation ( 1 ) has a unique equilibrium ( x , y ) .
the linearized equation of system ( 1 ) about the equilibrium point ( x , y ) is
( 25)n+1=bn ,
where n = ( x
n ,
, x
nk , y
n , , y
nk ) , and(26 ) let
1 ,
2 , ,
2k+2 denote the eigenvalues of matrix b and let d = diag(d
1 , d
2 ,
, d
2k+2 ) be a diagonal matrix , where d
1 = d
k+2 = 1 , d
i = d
k+1+i = 1 i ( i = 2 , , k + 1 ) , and
( 27)0< < min1k+11x+yky2 , 1k+11x+ykx2 .
clearly , d is invertible .
computing matrix dbd
, we obtain that(28)from d
1 > d
2 >
>d
k+1 > 0 and d
k+2 > d
k+3 > >d
2k+2 > 0 , imply that
( 29)d2d11<1 , d3d21<1, ,dk+1dk1<1 , dk+3dk+21<1, ,d2k+2d2k+11<1 .
furthermore , noting ( 7 ) , ( 24 ) , and ( 27 ) , we have
( 30)1ky+xk2y2d1dk+31++xk2y2d1d2k+21 = 1ky+xk2y2112++11(k+1) < 1ky+xky211k+1<1,1kx+yk2x2dk+2d21++yk2x2dk+2dk+11
it is well known that b has the same eigenvalues as dbd
; we have that
( 31)max1i2k+2idbd1=max+yk2x2112++11(k+1)d2d11, ,dk+1dk1,dk+3dk+21, ,d2k+2d2k+11,1ky + xk2y2112++11k+1,1kx + yk2x2112++11(k+1)<1 .
this implies that the equilibrium ( x , y ) of ( 1 ) is locally asymptotically stable . combining theorem 2 with theorem 3
consider the system of difference equation ( 1 ) . if relations ( 7 ) and ( 24 ) are satisfied , then the unique positive equilibrium ( x , y ) is globally asymptotically stable .
if relations ( 7 ) and ( 24 ) are satisfied , then the unique positive equilibrium ( x , y ) is globally asymptotically stable .
in order to illustrate the results of the previous sections and to support our theoretical discussions , we consider several interesting numerical examples in this section .
these examples represent different types of qualitative behavior of solutions to nonlinear difference equations and system of nonlinear difference equations .
consider the following difference equations :
( 32)xn+1=0.8+xnyn1+yn2+yn3 , yn+1=0.6+ynxn1+xn2+xn3 ,
with the initial values x
i = y
i = 0.5 ( i = 1,2 , 3 ) .
then , the solution ( x
n , y
n ) of system ( 32 ) is bounded and persists and the system has a unique equilibrium ( x , y ) = ( 1.3833,0.7905 ) which is globally asymptotically stable ( see figure 1 ) .
consider the following difference equations :
( 32)xn+1=0.8+xnyn1+yn2+yn3 , yn+1=0.6+ynxn1+xn2+xn3 ,
with the initial values x
i = y
i = 0.5 ( i = 1,2 , 3 ) . then , the solution ( x
n , y
n ) of system ( 32 ) is bounded and persists and the system has a unique equilibrium ( x , y ) = ( 1.3833,0.7905 ) which is globally asymptotically stable ( see figure 1 ) .
consider the following difference equations :
( 33)xn+1=0.8+xnyn1+yn2+yn3+yn4 , yn+1=0.6+ynxn1+xn2+xn3+xn4 ,
with the initial values x
i = y
i = 1.5 ( i = 1,2 , 3,4 ) .
then , the solution ( x
n , y
n ) of system ( 33 ) is bounded and persists and the system has a unique equilibrium ( x , y ) = ( 1.1929,0.7591 ) which is globally asymptotically stable ( see figure 2 ) .
consider the following difference equations :
( 33)xn+1=0.8+xnyn1+yn2+yn3+yn4 , yn+1=0.6+ynxn1+xn2+xn3+xn4 ,
with the initial values x
i = y
i = 1.5 ( i = 1,2 , 3,4 ) . then , the solution ( x
n , y
n ) of system ( 33 ) is bounded and persists and the system has a unique equilibrium ( x , y ) = ( 1.1929,0.7591 ) which is globally asymptotically stable ( see figure 2 ) .
in this paper , we study the dynamics of a system of high order difference equation
( 34)xn+1=a+xni=1kyni , yn+1=b+yni=1kxni n=0,1 , , k1,2, .
it concluded that , under condition a > 1/k , b > 1/k , the positive solution ( x
n , y
n ) of this system is bounded and persists ; moreover , if ( ( k
ab 1)/(ka 1 ) ) + ( ( k
ab 1)/(kb 1 ) ) < 1 , it converges asymptotically the unique equilibrium ( x , y ) .
consider the system of difference equation ( 1 ) with a 1/k and b 1/k . | this paper is concerned with the boundedness , persistence , and global asymptotic behavior of positive solution for a system of two rational difference equations x
n+1 = a + ( x
n/i=1
k
y
ni ) , y
n+1 = b + ( y
n/i=1
k
x
ni ) , n = 0,1 , , k { 1,2 , } , where a , b ( 0 , ) , x
i ( 0 , ) , and y
i ( 0 , ) , i = 0,1 , 2 , , k. |
the developmental disturbances affecting the shape of tooth include gemination , fusion , and concrescence .
gemination is an attempt at division of a single tooth bud by an invagination with incomplete formation of two teeth whereas fusion is union of two or more teeth .
the number of teeth is reduced by one or more in fusion and the same remains unaltered in gemination .
concrescence is cemental union of teeth which affects only the mesodemal layer and may be diagnosed only post - extraction .
these may be joined through fusion , gemination , concrescence or a combination of fusion and gemination .
although , union of two teeth by concrescence is reported in permanent and primary teeth , three such teeth , involving primary maxillary incisors and a supplemental incisor , are very rare .
a 7-year - old boy complained of palatally erupting upper front tooth and a retained primary tooth .
an examination revealed palatal eruption of permanent maxillary left central incisor . also , visible was an erupted supplemental tooth bearing resemblance to a miniature incisor .
it was present between the deciduous maxillary left central and lateral incisors ( 61 and 62 respectively fdration dentaire internationale ( fdi ) notation ) .
the teeth 61 and 62 were carious and lacked mobility . also , the tooth 61 was black in color .
history revealed trauma to the upper anterior region when the child was 1 year of age .
a radiograph revealed cariously infected 61 and 62 with a supplemental tooth in between [ figure 1 ] .
it was decided to extract all the three teeth taking into consideration age of the child , presence of infected teeth and eruptive status of succedaneous teeth .
attempts at removal of a single tooth resulted in extraction of all the three teeth en bloc .
examination revealed that these teeth were joined together by the roots [ figures 2 and 3 ] .
an intra - oral periapical radiograph showing carious 61 , 62 and the supplemental tooth labial aspect of concrescent teeth-61 , supplemental tooth , 62 lingual aspect of three concrescent teeth the specimen was thereafter , sent for histopathology .
the teeth were decalcified in 3% nitric acid and the prepared sections ( 5 m ) stained with hematoxylin and eosin .
the sections revealed the union of teeth by cementum [ figures 4 and 5 ] .
dentin and cementum ( decalcified section [ h and e , 40 ] ) union of teeth by cementum ( decalcified section [ h and e , 40 ] )
a missing permanent tooth is suggestive of partial anodontia ; or fusion of primary incisors and a permanent tooth .
absence of any missing tooth is indicative of fusion involving primary incisors and a supernumerary tooth ; or a combination of fusion and gemination of primary teeth .
gemination is seen as a bifid crown but usually has a single pulp chamber and a single identifiable root canal . in the present case , well - demarcated grooves separated the crowns of incisors and supernumerary tooth when viewed from the labial and lingual aspect of extracted triple teeth . moreover , mesial caries on both the incisors made it difficult to evaluate enamel fusion , if any .
a radiographic image also confirmed separate pulp chambers and root canals of all the three teeth . also , there was no missing primary or permanent tooth .
fusion and gemination involve a confluence of dentin whereas concrescence involves union by cementum only . in our case ,
union was by cementum in the cervical - middle third of the roots and dentin of the teeth was separate . also , morphological topography of the roots of triplets was distinguishable post - extraction which is indicative of complete root formation prior to union .
the union by cementum was also confirmed histologically . although , the etiology of concrescence is largely unclear , trauma , crowding of teeth , excessive occlusal forces , periradicular infection , proximity of roots , systemic diseases , and genetic factors are some of the factors .
concrescence is classified as developmental or true if it occurs before root formation when roots of the adjacent teeth are in close proximity ; and post - inflammatory or acquired if it occurs after chronic inflammation in relation to a non - vital tooth .
clinical detection of concrescent teeth is often difficult as radiographs usually fail to detect them .
it is unusual to find the union of primary maxillary incisors and a supplemental incisor by cementum .
the reported prevalence of a supplemental tooth in the deciduous dentition is 0.3 - 0.8% .
the present case had carious infected teeth and the etiology of concrescence is likely post - inflammatory in nature .
the close proximity of roots of triple teeth along with an excessive cementum formation during repair of periradicular lesions might have resulted in resorption of the interdental bone thus , triggering union by cementum .
also , trauma sustained to the tooth 61 in early life , during the period of root formation , might have resulted in early cemental union of these three teeth .
triple teeth complicate endodontics , oral surgical procedures , and periodontal treatment apart from being unaesthetic .
primary triple anterior teeth may prevent or delay eruption of succedaneous and adjacent teeth , cause ectopic eruption , root deviation or root resorption of adjacent teeth . in the present case ,
the permanent tooth bud was displaced palatally , thus increasing the possibility of anterior cross bite .
attempts at removal of a single tooth will facilitate removal of other teeth involved by concrescence which was so in this case as well .
the heroic efforts to extract triple teeth , particularly when permanent molars are affected can lead to jaw fractures or oro - sinus communications .
concrescence should be suspected if the roots of retained primary anteriors are in close proximity and are accompanied by a cariously infected pulp with or without a previous history of trauma .
a clinical and multiple - angled radiographic examination of the conjoined triplets may establish the diagnosis .
an appropriate treatment plan has to be decided thereafter , to minimize the risk of complications . | odontogenesis is a complex process wherein more than 200 genes are known to play a significant role in tooth development .
an imbalance can lead to an abnormality in the number , size , shape or structure of the developing tooth / teeth .
the presence of an extra dental lamina forms a supernumerary tooth .
the supernumerary teeth are of two types : a rudimentary tooth where the supernumerary tooth does not resemble any tooth in the normal series or a supplemental tooth in which this anomalous tooth resembles one in the normal series .
it is also very rare to encounter triple teeth in primary dentition .
the union of these teeth may be through fusion , gemination , concrescence or a combination of fusion and gemination .
presented is a rare case of concrescence involving maxillary deciduous incisors and a supplemental tooth in a 7-year - old boy .
the differential diagnosis , etiology , and complications of primary anterior triple teeth are discussed . |
the study was approved by the mayo clinic institutional review board . after obtaining informed consent ,
screening tests were performed at the mayo center for translational science activities , clinical research unit ( cru ) , to ensure that subjects were healthy , not pregnant , and met enrollment criteria .
subjects with a history of diabetes , glucose intolerance , or family history of diabetes in first - degree members were excluded .
subjects were admitted to the cru at 1600 h , consumed a standard 10 kcal / kg evening meal at 1700 h , and remained npo except water for the remainder of the study . at 0600
h the next morning , the heated hand vein method was used to periodically draw arterialized venous blood for glucose and tracer concentrations ( 13 ) .
four microdialysis catheters ( cma 63 , 20-kda molecular mass ; cma microdialysis , north chelmsford , ma ) were inserted , under local anesthesia and aseptic precautions , into subcutaneous abdominal fat , two on each side of the anterior abdomen , and were infused with cma perfusion fluid through a cma 107 microdialysis pump at a constant rate of 1 l / min for the study period . at periodic intervals , timed pooled microdialysate effluent and blood samples were collected for glucose and tracer measurements simultaneously .
four microdialysis catheters were necessary to collect adequate sample volumes for analyses at the end of each collection point .
after insertion , the catheters were allowed to stabilize and reach steady state for at least 1 h before tracer administration . at 0800 h ( 0 min ) , an intravenous bolus of [ 1-c ] glucose
was administered over 10 s. starting 4 min before the [ 1-c ] glucose bolus , microdialysate samples were collected every 5 min for the next 30 min and periodically thereafter until 0957 h ( 117 min ) .
subsequent tracer glucose boluses and sequential timing of microdialysate and blood sample collections are depicted in fig .
doses of the stable isotopes ( [ 1-c ] , [ 6,6-h2 ] , [ 2-c ] glucose ) were estimated to achieve plasma enrichment of 4% , and [ 3-h ] glucose ( 100 ci ) was used as the fourth tracer .
subjects 14 were infused with all four tracers , and subjects 58 were infused with only stable tracers , eliminating the [ 3-h ] glucose and replacing it with saline in a different order . experimental design showing the sequence of tracer glucose boluses and sampling intervals .
subjects 14 received [ 1-c ] , [ 6,6-h2 ] , [ 3-h ] , and [ 2-c ] glucose , whereas subjects 58 received [ 1-c ] glucose , saline , [ 6,6-h2 ] glucose , and [ 2-c ] glucose .
samples were placed on ice , divided into aliquots , and stored at 20c until assayed .
selected ion monitoring was used to monitor fragments with a mass / charge ratio of 160 and 161 for [ 1-c ] glucose and [ 2-c ] glucose and 319 and 321 for [ 6,6-h2 ] glucose ( 16 ) .
first , the timings of sample collection were reindexed to represent time from infusion to appearance at the microdialysis catheter on the basis of infusion setting and tubing volume to account for the time to cover the catheter dead space .
the second step was to provide descriptive statistics and concentration profiles and use a kaplan - meier product limit curve to estimate the time to detectable levels in the isf , which was defined as enrichment molar ratios ( mrs ) > 0.3% .
this corresponds to three times the upper limit of the mass spectroscopy assay noise ( mr 0.1% ) . in the time - to - event analysis ,
the time from infusion to appearance at the catheter with an enrichment of at least 0.3% was used in the modeling .
the 95% ci upper limit of the 75th percentile of the failure distribution ( i.e. , the estimated time for which 75% of the subjects had detectable isotope levels beyond mr > 0.3% ) was used as a conservative estimate of the time required for appearance in the isf .
spearman rank order correlation was used to explore the association of time to appearance ( appearance being quantified as the time from bolus to the time of highest observed concentration ) with anthropometric measurements .
[ 2-c ] glucose data were not used because of interference from the [ 1-c ] glucose given at 0800 h. the glucose derivative uses a fragment with a mass / charge ratio of 160 and 161 for the determination of [ c ] glucose enrichment that contains both the c1 and the c2 carbons of glucose .
[ 1-c ] glucose tracer enrichments were still above the baseline value at the time the [ 2-c ] glucose tracer was administered , indicating that the [ 1-c ] glucose was not totally cleared in 360 min .
statistical analyses were conducted with sas version 9.3 software ( sas institute , inc . , cary , nc ) .
samples were placed on ice , divided into aliquots , and stored at 20c until assayed .
selected ion monitoring was used to monitor fragments with a mass / charge ratio of 160 and 161 for [ 1-c ] glucose and [ 2-c ] glucose and 319 and 321 for [ 6,6-h2 ] glucose ( 16 ) .
first , the timings of sample collection were reindexed to represent time from infusion to appearance at the microdialysis catheter on the basis of infusion setting and tubing volume to account for the time to cover the catheter dead space .
the second step was to provide descriptive statistics and concentration profiles and use a kaplan - meier product limit curve to estimate the time to detectable levels in the isf , which was defined as enrichment molar ratios ( mrs ) > 0.3% .
this corresponds to three times the upper limit of the mass spectroscopy assay noise ( mr 0.1% ) . in the time - to - event analysis ,
the time from infusion to appearance at the catheter with an enrichment of at least 0.3% was used in the modeling .
the 95% ci upper limit of the 75th percentile of the failure distribution ( i.e. , the estimated time for which 75% of the subjects had detectable isotope levels beyond mr > 0.3% ) was used as a conservative estimate of the time required for appearance in the isf .
spearman rank order correlation was used to explore the association of time to appearance ( appearance being quantified as the time from bolus to the time of highest observed concentration ) with anthropometric measurements .
[ 2-c ] glucose data were not used because of interference from the [ 1-c ] glucose given at 0800 h. the glucose derivative uses a fragment with a mass / charge ratio of 160 and 161 for the determination of [ c ] glucose enrichment that contains both the c1 and the c2 carbons of glucose . [ 1-c ] glucose tracer enrichments were still above the baseline value at the time the [ 2-c ] glucose tracer was administered , indicating that the [ 1-c ] glucose was not totally cleared in 360 min .
statistical analyses were conducted with sas version 9.3 software ( sas institute , inc . , cary , nc ) .
subject characteristics plasma glucose concentrations were normal before the start of the study ( 5.15 0.45 mmol / l ) and remained unchanged for the duration of the study ( fig .
figure 3a illustrates the subject - specific profiles for [ 1-c ] glucose and [ 6,6-h2 ] glucose over the entire sampling period , and fig .
3b also illustrates the same data with more resolution over the first 10 min after isotope infusion . shown is the time to appearance in the interstitial catheter , with estimated transit time subtracted from the time at which the sample was collected . from fig . 3a and b , the time from isotope bolus infusion to appearance in the isf beyond mr > 0.3% appeared to be 46 min for [ 6,6-h2 ] glucose and slightly longer for [ 1-c ] glucose . from the kaplan - meier survival curve , the mean ( se ) time to appearance for [ 6,6-h2 ] glucose and [ 1-c ] glucose were 5.4 ( 0.6 ) and 6.2 ( 1.2 ) min , respectively .
the 95% ci upper limits for the 75th percentiles of the time - to - appearance distributions were 6.8 ( 5.86.8 ) and 9.8 ( 4.89.8 ) min , respectively .
note that the upper limits of the cis equal the point estimates because all subjects had detectable values by 6.8 and 9.8 min for [ 6,6-h2 ] glucose and [ 1-c ] glucose , respectively .
thus , 9.8 min is a conservative estimate of the maximum overall time to appearance in the isf .
a : temporal profiles of microdialysate tracer glucose mrs obtained in each subject over the sampling period of 120 min after the tracer bolus dose at time 0 .
b : temporal profiles of microdialysate tracer glucose mrs obtained in each subject over the first 10 min after the tracer bolus dose at time 0 .
the timed isf collection included a correction of 6.2 min to allow for transit from the catheter to the collection vial .
figure 4a illustrates the subject - specific profiles for [ 1-c ] glucose and [ 6,6-h2 ] glucose over the entire sampling period , and fig .
bmi and waist and hip circumferences showed preliminary evidence of an inverse relationship with time to appearance ( i.e. , the larger the measure of central obesity , the faster the isotope s peak concentration was observed ) .
the spearman correlations for these three measures were 0.34 ( p = 0.41 ) , 0.59 ( p = 0.12 ) , and 0.70 ( p = 0.054 ) , respectively .
the correlation with weight ( 0.31 , p = 0.45 ) and waist - to - hip ratio ( 0.31 , p = 0.47 ) demonstrated similar patterns of association .
these findings , however , are exploratory and require further evaluation . a : temporal profiles of plasma tracer glucose mrs obtained in each subject over the sampling period of 120 min after the tracer bolus dose at time 0 .
b : temporal profiles of plasma tracer glucose mrs obtained in each subject over the first 10 min after the tracer bolus dose at time 0 .
plasma glucose concentrations were normal before the start of the study ( 5.15 0.45 mmol / l ) and remained unchanged for the duration of the study ( fig .
figure 3a illustrates the subject - specific profiles for [ 1-c ] glucose and [ 6,6-h2 ] glucose over the entire sampling period , and fig .
3b also illustrates the same data with more resolution over the first 10 min after isotope infusion . shown is the time to appearance in the interstitial catheter , with estimated transit time subtracted from the time at which the sample was collected . from fig . 3a and b , the time from isotope bolus infusion to appearance in the isf beyond mr > 0.3% appeared to be 46 min for [ 6,6-h2 ] glucose and slightly longer for [ 1-c ] glucose . from the kaplan - meier survival curve ,
the mean ( se ) time to appearance for [ 6,6-h2 ] glucose and [ 1-c ] glucose were 5.4 ( 0.6 ) and 6.2 ( 1.2 ) min , respectively .
the 95% ci upper limits for the 75th percentiles of the time - to - appearance distributions were 6.8 ( 5.86.8 ) and 9.8 ( 4.89.8 ) min , respectively .
note that the upper limits of the cis equal the point estimates because all subjects had detectable values by 6.8 and 9.8 min for [ 6,6-h2 ] glucose and [ 1-c ] glucose , respectively .
thus , 9.8 min is a conservative estimate of the maximum overall time to appearance in the isf .
a : temporal profiles of microdialysate tracer glucose mrs obtained in each subject over the sampling period of 120 min after the tracer bolus dose at time 0 .
b : temporal profiles of microdialysate tracer glucose mrs obtained in each subject over the first 10 min after the tracer bolus dose at time 0 . the timed isf collection included a correction of 6.2 min to allow for transit from the catheter to the collection vial .
figure 4a illustrates the subject - specific profiles for [ 1-c ] glucose and [ 6,6-h2 ] glucose over the entire sampling period , and fig .
bmi and waist and hip circumferences showed preliminary evidence of an inverse relationship with time to appearance ( i.e. , the larger the measure of central obesity , the faster the isotope s peak concentration was observed ) .
the spearman correlations for these three measures were 0.34 ( p = 0.41 ) , 0.59 ( p = 0.12 ) , and 0.70 ( p = 0.054 ) , respectively .
the correlation with weight ( 0.31 , p = 0.45 ) and waist - to - hip ratio ( 0.31 , p = 0.47 ) demonstrated similar patterns of association .
these findings , however , are exploratory and require further evaluation . a : temporal profiles of plasma tracer glucose mrs obtained in each subject over the sampling period of 120 min after the tracer bolus dose at time 0 .
b : temporal profiles of plasma tracer glucose mrs obtained in each subject over the first 10 min after the tracer bolus dose at time 0 .
with the application of glucose isotope infusion and frequent sequential sampling of isf through microdialysis catheters , we have demonstrated that the mean time to appearance of tracer glucose in the abdominal subcutaneous isf after an intravenous bolus is between 5 and 6 min in the resting , overnight fasted state .
to eliminate mass spectroscopic assay noise , we were stringent in selecting a detectability cutoff that was threefold that of the sensitivity of the assay .
the time to appearance of tracer glucose in the isf may have been even shorter had we sampled isf more frequently during the first 10 min and used a less stringent detectability cutoff . however , because the sensitivity of mass spectroscopy to detect tracer glucose concentrations is considerably higher than unlabeled glucose measured by conventional means , we believe that our approach using frequent sampling of tracer glucose provides accurate estimates of the physiological time lag of glucose transport from the vascular to the isf compartment . to provide the cleanest initial approach to estimate tracer glucose kinetics , we decided on the intravenous ( as opposed to intra - arterial ) route for tracer glucose bolus because the intravenous bolus would traverse the right side of the heart and the pulmonary circulation before appearing in the systemic circulation , similar to the route taken by ingested glucose , albeit bypassing the liver at first pass .
the time lag between plasma and isf glucose appears to differ depending on whether plasma glucose values are rising or falling ( 911 ) or the type of cgm instrument and sensor algorithm used ( 17,18 ) .
it is important to underscore that the purpose of the present article is to report the time lag of glucose to appear in the isf from the vascular compartment .
the present study has some limitations . after reviewing [ 3-h ] glucose data from the first four subjects
, we observed that the disintegrations per minute in the microdialysate were below detectable limits of the scintillation counter for several isf samples , thus providing unreliable data .
hence , for the remaining four subjects , the [ 3-h ] glucose bolus was replaced by saline , and the time gap was avoided by injecting [ 6,6-h2 ] glucose at 1200 h instead .
the preliminary finding of an inverse relationship between tracer appearance time and degree of central obesity was unexpected yet intriguing and requires further systematic examination . local metabolism of glucose tracers in the isf was not accounted for during the study .
however , it is unlikely that in the overnight fasted conditions , low physiological insulin concentrations would have resulted in meaningful tracer uptake into the subcutaneous adipose tissues .
studies examining isf glucose transport during the postprandial state will need to account for local glucose uptake .
differences in the estimated mean time to appearance for the two isotopes were likely a direct result of the isotope - specific collection schedules .
the intention of using four glucose tracers with staggered and sequential infusion and sample collection times ( of both plasma and microdialysate ) was to enable minute - by - minute estimation of tracer glucose appearance in the microdialysate at least in the period immediately after the tracer bolus doses .
however , because of an inability to measure [ 3-h ] glucose and issues around the reliability of [ 2-c ] glucose assays as mentioned earlier , we chose to analyze the data obtained from [ 1-c ] glucose and [ 6,6-h2 ] glucose for our purpose .
of note , by 9.8 min after the bolus , all subjects were observed to have had detectable isotope in the isf ; as seen in fig .
3 , the isotopes may have been detected earlier with a different sampling schedule . regardless of this difference
, the isotopes appeared faster than in prior reports ( 311 ) . in conclusion , we have demonstrated in overnight fasted healthy humans that the physiological time lag of glucose transport between the vascular and isf compartments is considerably shorter than many have hypothesized , permitting the development of cgm systems and aep devices with sufficient accuracy and timeliness for improved management of glycemic status .
future studies in type 1 diabetes are required under various dynamic conditions , including meals , exercise , and recovery from hypoglycemia , to determine when glucose transport to and from the isf could be altered .
the preliminary results presented here hold promise for optimization of current and future generation sensor algorithms , sensor - augmented pumps , and aep systems to manage insulin - dependent patients with diabetes . | the accuracy of continuous interstitial fluid ( isf ) glucose sensing is an essential component of current and emerging open- and closed - loop systems for type 1 diabetes .
an important determinant of sensor accuracy is the physiological time lag of glucose transport from the vascular to the interstitial space .
we performed the first direct measurement of this phenomenon to our knowledge in eight healthy subjects under an overnight fasted condition .
microdialysis catheters were inserted into the abdominal subcutaneous space . after intravenous bolus administrations of glucose tracers , timed samples of plasma and isf
were collected sequentially and analyzed for tracer enrichments . after accounting for catheter dead
space and assay noise , the mean time lag of tracer appearance in the interstitial space was 5.36.2 min .
we conclude that in the overnight fasted state in healthy adults , the physiological delay of glucose transport from the vascular to the interstitial space is 56 min .
physiological delay between blood glucose and isf glucose , therefore , should not be an obstacle to sensor accuracy in overnight or fasting - state closed - loop systems of insulin delivery or open - loop therapy assessment for type 1 diabetes . |
intellectual property ( ip ) is defined as property that can be protected under federal law , including copyrightable works , ideas , discoveries , and inventions.1 most research and publications on ip focus on technological development within companies and industries2,3 and on academic and government laboratories.4,5 this focus is both the result of and reinforcement for the misconception that modern technological innovation is the purview of industry and academia . in reality , many of the most influential and innovative medical and information technology ( it ) inventions have been created by independent inventors , including : wilson greatbatch , who patented the implantable cardiac pacemaker ; raymond damadian first described the concept of nuclear magnetic resonance and patented the first commercial unit ; raymond kurzweil patented and marketed the first omnifont optical character recognition system and numerous speech recognition innovations ; and linus torvalds wrote the program that became the linux kernel .
despite the many remarkable achievements of independent innovators , numerous technical , economic , political , legal , and educational challenges confront independent invention .
this article is written to serve as an educational resource and guide to the fledgling independent inventor in imaging informatics , with the hope of encouraging entrepreneurship , innovation , and creativity within the existing constraints of a field dominated by industry - initiated research and development ( r&d ) . the u.s .
patent and trademark office ( uspto ) defines an independent inventor as one whose patent ( at the time of issuance ) is unassigned or assigned to an individual .
the percentage of patents issued to independent inventors declined from 36.4% in 1987 to 26.8% in 1999.6 international patent data ( 1999 ) show great variability in the overall percentages of patents issued to independent inventors , with less industrialized countries having a higher percentage of independent invention ( 75% in hungary and 66% in brazil , for example ) , compared with more industrialized countries ( 26% in both the united kingdom and united states6 ) .
although the relative percentage of patents issued to independent inventors has gradually decreased over time , the total number of patents awarded to independent inventors increased by approximately 30% from 1990 to 2000.7 these figures suggest that independent invention is alive and well in the united states and retains a vital role in innovation throughout industry and the marketplace . a recent survey published by weick and eakin8 explored the role and economic viability of independent inventors in the united states .
eighty - four percent of inventor respondents reported developing working prototypes of their inventions within the past 5 years .
the top invention categories were dominated by hardware / tools , household , and industrial / commercial products , and the most frequently cited scientific / technology inventions were categorized as electronics ( 13% ) and medical / therapeutic ( 12% ) .
thirty - nine percent of respondent inventors reported generating sales from their inventions ( mean sales , $ 3.5 million ; median sales , $ 50,000 ) , and 22% reported profitability ( mean profit , $ 1.96 million ; median profit , $ 75,000 ) .
the three principal means of ip commercialization included development of start - up companies ( 55% of respondents ) , licensing ip to another company ( 44% of respondents ) , and outright sales of ip ( 16% of respondents ) .
inventors who elected to license their inventions to others were more likely to achieve a higher level of overall sales than those attempting to commercialize the ip themselves or who sold the ip to a third party .
this corroborates previously reported findings by khan and sokoloff,9 who reported independent inventors commercial success to be greatest through licensing agreements .
the prevalent paradigm of industry - sponsored r&d suffers from several limitations , some of which are outlined in table 1 .
the various strengths that provide industry with a distinct ( and arguably unfair ) advantage over the independent inventor paradoxically provide a disincentive toward innovation .
this can be explained in part by the life cycle of innovation embraced by many companies , particularly larger and more financially successful concerns .
table 1existing limitations of industry - sponsored r&dlimitationa follow - the - pack ( lemming ) mentalitysmall , incremental approaches to new ipinternal corporate politics and constraintsshort - term outlook targeted at immediate gratificationproduct development done in
usersreactive , not proactive , approach to market needs existing limitations of industry - sponsored r&d in the first stage ( infancy ) of this life cycle , innovation plays the dominant role in creating new ip , a process that provides the impetus and backbone for the original creation of many companies .
the fledgling company is founded by a few energetic , industrious , and optimistic inventors who , through a combination of idealism , capitalism , and naivety , decide to embark on the development of a start - up company despite long odds against success . in the second stage ( childhood ) , the company grows through successful commercialization of their innovation and ip .
as the company grows and achieves economic success , the culture begins to shift from optimism and innovation to pragmatism and risk aversity .
the political and economic realities of the marketplace begin to surface , and the founders of the company often turn over operational control to financial and management professionals .
if the company continues on a path of relative independence ( avoiding merger or acquisition ) and continues to achieve greater success in the marketplace , it may then enter stage 3 ( adulthood ) , in which it is often transformed from
in entering this stage , the company often grows by acquiring smaller ( and more innovative ) companies , thereby expanding its product line and ip pipeline . the large
company now responds to market economics , with product development largely dictated by the perceived needs of the customer base .
invention is typically performed within the company ( in house ) by individuals who are often constrained by company politics and the economics of immediate gratification .
, innovation is largely stifled and relegated to product line developments and incremental improvement .
it is ironic that the very company that was initially created by innovation and creativity becomes transformed into one that strives to stifle ( and often crush ) the creativity of the independent ( and innovative ) inventor . in this life cycle , inventors themselves are no longer frontline users but , instead , are technicians and engineers . in the medical domain , these engineers are , for the most part , technology savvy , but clinically uninformed . as a result ,
refinements and new developments are based , at best , on minimal knowledge of how the product will truly function in the clinical environment .
experts on a medical advisory board who have little practical experience outside of academia . as a result ,
even with a gloss of medical input , many products are developed within a rigid corporate culture by nonclinicians who are highly risk averse and focused on short - term horizons .
the independent inventor , on the other hand , is not bound by the same corporate constraints and , instead , can bring a fresh and practical perspective to product innovation .
this strategy of outsourcing innovation is uncommon within industry today but offers the potential to create new independent inventor industry synergies .
the creation of an open market approach to innovation provides a cost - effective and practical means for companies to remove their self - induced ip constraints and seek out inventors from external sources to enhance innovation within new and existing product lines.10,11 table 2 outlines a ten - step iterative process for invention and product development .
one example comes from my own work in private practice radiology , where one of my biggest concerns is the paucity of objective quality assurance ( qa ) metrics and standards within medical imaging and the lack of supporting technology . with the sole exception of
mammography,12 no medical imaging modality has rigorous and mandatory qa standards , despite a broad agreement on the significance of the role of medical imaging qa in clinical and economic outcomes.13 simply stated , qa in its present form is largely idiosyncratic and often nonexistent .
table 2stepwise approach to invention processapproachdefine an existing problem or questionreview the current technical solutionidentify existing limitations and inefficienciescollect data using existing technologydevise an alternative solution ( invention)develop a prototypecollect data using the prototyperefine the prototype based on data and end - user feedbackrepeat data collection ( and refinement as necessary)commercialize invention stepwise approach to invention process in attempting to objectively quantify existing qa practice , we performed several studies evaluating qa - related workflow , technology , and variability and the related effects on image quality.1417 the results have indicated that the current practice of medical imaging qa is fraught with error and inconsistencies , resulting in inefficient workflow , reduced technologist productivity , poor image quality , and suboptimal radiation dose to patients .
the data call for a complete revamping in the clinical and technical ways in which qa activities are implemented .
defining the solution becomes fairly straightforward when confronted with the paucity of data , lack of standards , wide inter- and intradepartmental variability in performance , and lack of supporting technology for qa assessment .
the ideal solution to improve current inefficiencies would be an automated system to record , measure , track , analyze , and provide qa feedback to practitioners . after identifying and defining this deficiency , i proposed and described one such solution and submitted it for review by the uspto .
although the idea may appear sound , it is only as good as the working prototype . as an independent inventor
, i did not have the technical or economic resources required to create a working prototype and , therefore , elected to seek industry partnership through a licensing agreement .
the project is far from complete , but the sequence of events outline in table 2 are those that i have come to recognize as requisite for creation and implementation of an invention , with the ultimate goal of creating independent inventor industry collaboration and a final product based on a data - driven engineering process.18 table 3 is a list of practical suggestions for the independent inventor .
first and foremost is the reality that inventorship is equivalent to running a marathon , not a sprint . even under the best of circumstances
, the patent review process takes 23 years and often longer , depending on the uspto backlog , the initial review of the patent examiner , and what
once the review process has been completed , the inventor must begin the arduous task of marketing the invention and/or developing a prototype . because of the intensive resource requirements for prototype development , many inventors elect to pursue a licensing agreement with an established company that has the technical , financial , personnel , and legal resources to commercialize the patent and defend against potential future litigation . securing a patent
the best deterrent is an ally with deep pockets and the combined economic and legal clout to punish any violators .
table 3practical advice for inventorsadviceexpect success to take 510 yearsdo not quit your day jobengage professional legal services for prior art search patent preparation nondisclosure agreements commercializationdocument everything!do not market until you receive notice of allowancebe a little paranoid ; expect dishonestyfile a provisional patent asapconsider licensing as a means to commercializeleverage existing practical knowledge and experiencethink out of the box!leverage existing resources practical advice for inventors the patent application process in the united states typically costs in the range of $ 20,000$30,000 .
the result is that many independent inventors are forced either to abandon their ip or seek external funding sources .
although third parties exist in the form of independent investor and venture capitalist consortia , the inventor sometimes forfeits substantial economic and legal rights in entering such agreements . having sound legal advice with expertise in patents and licensing is critical in ensuring that the best interests of the inventor ( and the long - term security of his or her ip ) are protected
new legislation is currently pending in congress ( hr 2795 ) that calls for major patent reforms .
enactment of this legislation could have negative effects on the independent inventor by :
changing the definition of inventor from first to invent to first to file;limiting a patent holder s rights to obtain a permanent injunction against an offending third party;creating a post - patent grant opposition proceeding ; andlimiting damages for infringement lawsuits changing the definition of inventor from first to invent to first to file ; limiting a patent holder s rights to obtain a permanent injunction against an offending third party ; creating a post - patent grant opposition proceeding ; and limiting damages for infringement lawsuits in the end , larger corporations and academic institutions have far more extensive resources and expertise to create , manage , and defend patents .
these disproportionate resources should not preclude the independent inventor from seeking patents but should provide significant incentives to pursue symbiotic partnerships with industry that can ultimately benefit both parties .
although do it yourself programs are widely advertised as ways for independent inventors to draft their own patent applications , investors should be wary of the long - term ramifications of even minor errors in the patent process .
claim wording on patents is complex and most properly the province of specialized attorneys with extensive training and experience .
the prior art search is another integral component of patent preparation that should be performed by skilled and experienced personnel .
it is also essential to have the representation of a dedicated attorney in negotiating potential partnerships and collaborations , particularly in drafting a well - constructed nondisclosure agreement ( nda ) , which serves to protect the ip of both parties .
trust and loyalty are admirable qualities , but the independent inventor must be cautious when discussing and exchanging ip .
this takes on even greater importance with the impending congressional legislation that provides ip ownership to the first to file , as opposed to the traditional first to invent .
ip until after a provisional patent has been submitted and then only with a mutually signed nda . to quote andy grove , former ceo of intel , only the paranoid survive .
in the event that patent litigation occurs and two parties are vying for patent ownership , or one party is challenging the validity of a recently issued patent , the courts will look for dated documentation to determine which party was first to invent . as a result , it is imperative that the independent inventor document everything related to the invention from concept creation , to embellishment , to all forms of communication with third parties .
most important , the intrinsic value of one s own creativity , practical knowledge , and experience should not be underestimated .
having the luxury of being independent and unconstrained by corporate shackles can be a distinct advantage to the independent inventor .
in - house patent applications must pass through serial scrutiny that often serves to squash innovation and unorthodox thinking .
the independent inventor does not have these limitations and is , instead , free to explore any and all creative concepts , regardless of the existing product pipeline .
although market viability and compatibility with a company s strategic planning remain critical points of analysis for potential inventor industry partnerships , the independent inventor should continuously strive to push the envelope and leverage his or her own unique insights and experience .
the new independent inventor should take advantage of existing resources that can provide valuable insights , contact information , and educational programs .
several of these internet - based resources are listed in table 4 and serve merely as starting points in the quest for inventor knowledge and experience .
although the barrier to entry as an inventor is high , success can be achieved by those with insight , creativity , and perseverance .
patent & trademark officehttp://www.uspto.govunited inventors associationhttp://www.uiausa.orginventor ed inc.http://www.inventored.orginvent nethttp://www.inventnet.comindex to u.s . patent classificationhttp://www.ibiblia.org / patents / index.htmllemelson foundationhttp://www.lemelson.org existing resources for the independent inventor
the u.s . patent and trademark office ( uspto ) defines an independent inventor as one whose patent ( at the time of issuance ) is unassigned or assigned to an individual .
the percentage of patents issued to independent inventors declined from 36.4% in 1987 to 26.8% in 1999.6 international patent data ( 1999 ) show great variability in the overall percentages of patents issued to independent inventors , with less industrialized countries having a higher percentage of independent invention ( 75% in hungary and 66% in brazil , for example ) , compared with more industrialized countries ( 26% in both the united kingdom and united states6 ) .
although the relative percentage of patents issued to independent inventors has gradually decreased over time , the total number of patents awarded to independent inventors increased by approximately 30% from 1990 to 2000.7 these figures suggest that independent invention is alive and well in the united states and retains a vital role in innovation throughout industry and the marketplace . a recent survey published by weick and eakin8 explored the role and economic viability of independent inventors in the united states .
eighty - four percent of inventor respondents reported developing working prototypes of their inventions within the past 5 years .
the top invention categories were dominated by hardware / tools , household , and industrial / commercial products , and the most frequently cited scientific / technology inventions were categorized as electronics ( 13% ) and medical / therapeutic ( 12% ) .
thirty - nine percent of respondent inventors reported generating sales from their inventions ( mean sales , $ 3.5 million ; median sales , $ 50,000 ) , and 22% reported profitability ( mean profit , $ 1.96 million ; median profit , $ 75,000 ) .
the three principal means of ip commercialization included development of start - up companies ( 55% of respondents ) , licensing ip to another company ( 44% of respondents ) , and outright sales of ip ( 16% of respondents ) .
inventors who elected to license their inventions to others were more likely to achieve a higher level of overall sales than those attempting to commercialize the ip themselves or who sold the ip to a third party .
this corroborates previously reported findings by khan and sokoloff,9 who reported independent inventors commercial success to be greatest through licensing agreements .
the prevalent paradigm of industry - sponsored r&d suffers from several limitations , some of which are outlined in table 1 .
the various strengths that provide industry with a distinct ( and arguably unfair ) advantage over the independent inventor paradoxically provide a disincentive toward innovation .
this can be explained in part by the life cycle of innovation embraced by many companies , particularly larger and more financially successful concerns .
table 1existing limitations of industry - sponsored r&dlimitationa follow - the - pack ( lemming ) mentalitysmall , incremental approaches to new ipinternal corporate politics and constraintsshort - term outlook targeted at immediate gratificationproduct development done in
usersreactive , not proactive , approach to market needs existing limitations of industry - sponsored r&d in the first stage ( infancy ) of this life cycle , innovation plays the dominant role in creating new ip , a process that provides the impetus and backbone for the original creation of many companies .
the fledgling company is founded by a few energetic , industrious , and optimistic inventors who , through a combination of idealism , capitalism , and naivety , decide to embark on the development of a start - up company despite long odds against success . in the second stage ( childhood ) , the company grows through successful commercialization of their innovation and ip .
as the company grows and achieves economic success , the culture begins to shift from optimism and innovation to pragmatism and risk aversity .
the political and economic realities of the marketplace begin to surface , and the founders of the company often turn over operational control to financial and management professionals .
if the company continues on a path of relative independence ( avoiding merger or acquisition ) and continues to achieve greater success in the marketplace , it may then enter stage 3 ( adulthood ) , in which it is often transformed from innovator to predator . in entering this stage
, the company often grows by acquiring smaller ( and more innovative ) companies , thereby expanding its product line and ip pipeline . the large
company now responds to market economics , with product development largely dictated by the perceived needs of the customer base .
invention is typically performed within the company ( in house ) by individuals who are often constrained by company politics and the economics of immediate gratification .
, innovation is largely stifled and relegated to product line developments and incremental improvement .
it is ironic that the very company that was initially created by innovation and creativity becomes transformed into one that strives to stifle ( and often crush ) the creativity of the independent ( and innovative ) inventor . in this life cycle ,
inventors themselves are no longer frontline users but , instead , are technicians and engineers . in the medical domain , these engineers are , for the most part , technology savvy , but clinically uninformed . as a result ,
refinements and new developments are based , at best , on minimal knowledge of how the product will truly function in the clinical environment .
experts on a medical advisory board who have little practical experience outside of academia . as a result ,
even with a gloss of medical input , many products are developed within a rigid corporate culture by nonclinicians who are highly risk averse and focused on short - term horizons .
the independent inventor , on the other hand , is not bound by the same corporate constraints and , instead , can bring a fresh and practical perspective to product innovation .
this strategy of outsourcing innovation is uncommon within industry today but offers the potential to create new independent inventor industry synergies .
the creation of an open market approach to innovation provides a cost - effective and practical means for companies to remove their self - induced ip constraints and seek out inventors from external sources to enhance innovation within new and existing product lines.10,11
table 2 outlines a ten - step iterative process for invention and product development .
one example comes from my own work in private practice radiology , where one of my biggest concerns is the paucity of objective quality assurance ( qa ) metrics and standards within medical imaging and the lack of supporting technology . with the sole exception of
mammography,12 no medical imaging modality has rigorous and mandatory qa standards , despite a broad agreement on the significance of the role of medical imaging qa in clinical and economic outcomes.13 simply stated , qa in its present form is largely idiosyncratic and often nonexistent .
table 2stepwise approach to invention processapproachdefine an existing problem or questionreview the current technical solutionidentify existing limitations and inefficienciescollect data using existing technologydevise an alternative solution ( invention)develop a prototypecollect data using the prototyperefine the prototype based on data and end - user feedbackrepeat data collection ( and refinement as necessary)commercialize invention stepwise approach to invention process in attempting to objectively quantify existing qa practice , we performed several studies evaluating qa - related workflow , technology , and variability and the related effects on image quality.1417 the results have indicated that the current practice of medical imaging qa is fraught with error and inconsistencies , resulting in inefficient workflow , reduced technologist productivity , poor image quality , and suboptimal radiation dose to patients .
the data call for a complete revamping in the clinical and technical ways in which qa activities are implemented .
defining the solution becomes fairly straightforward when confronted with the paucity of data , lack of standards , wide inter- and intradepartmental variability in performance , and lack of supporting technology for qa assessment .
the ideal solution to improve current inefficiencies would be an automated system to record , measure , track , analyze , and provide qa feedback to practitioners . after identifying and defining this deficiency
, i proposed and described one such solution and submitted it for review by the uspto .
although the idea may appear sound , it is only as good as the working prototype . as an independent inventor
, i did not have the technical or economic resources required to create a working prototype and , therefore , elected to seek industry partnership through a licensing agreement .
the project is far from complete , but the sequence of events outline in table 2 are those that i have come to recognize as requisite for creation and implementation of an invention , with the ultimate goal of creating independent inventor industry collaboration and a final product based on a data - driven engineering process.18
first and foremost is the reality that inventorship is equivalent to running a marathon , not a sprint . even under the best of circumstances
, the patent review process takes 23 years and often longer , depending on the uspto backlog , the initial review of the patent examiner , and what
once the review process has been completed , the inventor must begin the arduous task of marketing the invention and/or developing a prototype . because of the intensive resource requirements for prototype development , many inventors elect to pursue a licensing agreement with an established company that has the technical , financial , personnel , and legal resources to commercialize the patent and defend against potential future litigation . securing a patent
the best deterrent is an ally with deep pockets and the combined economic and legal clout to punish any violators .
table 3practical advice for inventorsadviceexpect success to take 510 yearsdo not quit your day jobengage professional legal services for prior art search patent preparation nondisclosure agreements commercializationdocument everything!do not market until you receive notice of allowancebe a little paranoid ; expect dishonestyfile a provisional patent asapconsider licensing as a means to commercializeleverage existing practical knowledge and experiencethink out of the box!leverage existing resources practical advice for inventors the patent application process in the united states typically costs in the range of $ 20,000$30,000 .
the result is that many independent inventors are forced either to abandon their ip or seek external funding sources .
although third parties exist in the form of independent investor and venture capitalist consortia , the inventor sometimes forfeits substantial economic and legal rights in entering such agreements . having sound legal advice with expertise in patents and licensing is critical in ensuring that the best interests of the inventor ( and the long - term security of his or her ip ) are protected
new legislation is currently pending in congress ( hr 2795 ) that calls for major patent reforms .
enactment of this legislation could have negative effects on the independent inventor by :
changing the definition of inventor from first to invent to first to file;limiting a patent holder s rights to obtain a permanent injunction against an offending third party;creating a post - patent grant opposition proceeding ; andlimiting damages for infringement lawsuits changing the definition of inventor from first to invent to first to file ; limiting a patent holder s rights to obtain a permanent injunction against an offending third party ; creating a post - patent grant opposition proceeding ; and limiting damages for infringement lawsuits in the end , larger corporations and academic institutions have far more extensive resources and expertise to create , manage , and defend patents .
these disproportionate resources should not preclude the independent inventor from seeking patents but should provide significant incentives to pursue symbiotic partnerships with industry that can ultimately benefit both parties .
although do it yourself programs are widely advertised as ways for independent inventors to draft their own patent applications , investors should be wary of the long - term ramifications of even minor errors in the patent process .
claim wording on patents is complex and most properly the province of specialized attorneys with extensive training and experience .
the prior art search is another integral component of patent preparation that should be performed by skilled and experienced personnel .
it is also essential to have the representation of a dedicated attorney in negotiating potential partnerships and collaborations , particularly in drafting a well - constructed nondisclosure agreement ( nda ) , which serves to protect the ip of both parties .
trust and loyalty are admirable qualities , but the independent inventor must be cautious when discussing and exchanging ip .
this takes on even greater importance with the impending congressional legislation that provides ip ownership to the first to file , as opposed to the traditional first to invent .
ip until after a provisional patent has been submitted and then only with a mutually signed nda . to quote andy grove , former ceo of intel , only the paranoid survive . in the event that patent litigation occurs and two parties are vying for patent ownership , or one party is challenging the validity of a recently issued patent , the courts will look for dated documentation to determine which party was first to invent .
as a result , it is imperative that the independent inventor document everything related to the invention from concept creation , to embellishment , to all forms of communication with third parties .
most important , the intrinsic value of one s own creativity , practical knowledge , and experience should not be underestimated .
having the luxury of being independent and unconstrained by corporate shackles can be a distinct advantage to the independent inventor .
in - house patent applications must pass through serial scrutiny that often serves to squash innovation and unorthodox thinking .
the independent inventor does not have these limitations and is , instead , free to explore any and all creative concepts , regardless of the existing product pipeline .
although market viability and compatibility with a company s strategic planning remain critical points of analysis for potential inventor industry partnerships , the independent inventor should continuously strive to push the envelope and leverage his or her own unique insights and experience .
the new independent inventor should take advantage of existing resources that can provide valuable insights , contact information , and educational programs .
several of these internet - based resources are listed in table 4 and serve merely as starting points in the quest for inventor knowledge and experience .
although the barrier to entry as an inventor is high , success can be achieved by those with insight , creativity , and perseverance .
despite the economic and legal impediments facing ip development in the current marketplace , many important innovations and technologic breakthroughs within medicine are the result of independent inventors .
these independent inventors play a unique and vital role towards ip development in medical imaging and information technology through their practical first - hand experience , out of the box
they are not restricted by many of the traditional constraints existing within an industry including the incremental approach to product development , internal politics , and a short - term focus on return on investment ( roi ) .
the traditional paradigm of industry - sponsored r&d may be better served through the creation of a more collaborative approach of outsourcing innovation
, thereby creating a synergy between independent inventors and industry sponsors . in the end , innovation can be better served by creating an atmosphere for open competition , creativity , and accountability . | while innovation and new product development is traditionally thought of as the exclusive domain of industry and academia , a large number of innovations in medicine and information technology have come from independent inventors , which account for almost 30% of new patents issued in the u.s . today .
a large number of economic , political , and legal challenges exist within the current marketplace that serves as relative impediments to independent invention .
this article explores the existing challenges facing the independent inventor and offers a number of recommendations and resources to facilitate independent inventors in their quest for innovation and entrepreneurship .
the concept of outsourcing innovation is discussed as an alternative to the existing model of industry sponsored research and development ( r&d ) , with the goal of combining the unique attributes and strengths of independent inventors and industry sponsors . |
patients with advanced cirrhosis can suffer from hepatorenal syndrome ( hrs ) , a unique form of kidney injury that results from renal vasoconstriction in the setting of systemic and splanchnic arterial vasodilatation , in the absence of intrinsic renal pathological changes . in a small fraction of patients , renal function
however , the prognosis of patients with cirrhosis who develop hrs remains poor because of the limited therapies we can provide for end - stage liver disease and because very few patients can get liver transplants .
it was found that mice with cirrhosis can be converted to have hrs when injected intraperitoneally with albumin . the urea transporter protein ( ut ) in the kidneys
therefore , we injected succinylated gelatin into the abdominal cavity of cirrhotic rats to produce an hrs model , then explored the changes of ut expression in this model .
the protocol was authorized by the animal experimental ethics committee of tongji hospital , tongji university .
male sd rats , weighing 20020 g ( n=100 ) were bred under standard conditions at constant humidity , room temperature , and regular 12 h/12 h light / dark cycles .
fifty male sd rats were randomly divided into 2 groups : model group rats were subcutaneously injected with a mixture of carbon tetrachloride ( 30% ) and plant oil ( 70% ) according to its weight ( initial dosage was 0.5 ml/100 g. maintenance dose was 0.3 ml/100 g twice a week ) in the model group and the control group rats were injected with plant oil ( 0.3 ml/100 g twice a week ) .
a subset of rats in the model group was sacrificed after 12 weeks and the liver histopathology was examined to ensure the successful establishment of a cirrhotic model .
twelve rats in the control groups were randomly divided into 2 subgroups : group a was the new control group and group b was the abdominal compartment syndrome ( acs ) group .
twelve cirrhotic rats were also divided into 2 groups : group c was the new cirrhotic group and group d was the hrs group .
the rats in group b and d were anesthetized subcutaneously with 0.03% na - pentobarbital ( 0.1 ml/100 g ) and fixed on experimental tables .
a pressure gauge with a t - shaped 3-way pipe , graduated l - shaped glass tube , and infusion tube was punctured into the lumbar region of midaxillary line on umbilicus level of rats to detect the abdominal pressure .
when fluid levels of the l - shaped glass tube raised to 26.7 cm of water column ( equivalent to 20 mmhg ) , abdominal pressure had been maintained at this level for 3 h by adjusting the dripping speed . except for dripping of succinylated gelatin ,
the remaining methods were the same as above for the rats in group a and group c. then , serum bun and cr were determined from blood samples obtained from rat aortas . in addition , left kidneys were cryopreserved in liquid nitrogen and right kidneys were fixed in neutral buffered formalin . the later was then sectioned in coronal plane ( 5-m slice thickness ) and prepared with h and e staining for routine light microscopy .
total rna was extracted from150 mg of renal medulla into trizol reagent ( kusatsu , japan ) according to manufacturer s instructions . for cdna synthesis ,
rt reactions were performed with total rna ( 2 ug ) according to the directions of the takara rt reagent kit ( kusatsu , japan ) .
the product was amplified in a reaction volume of 10 ul including 1 ul rt product , 5 ul sybr premix ex taq ii ( 5 ) , 0.2 ul 50rox reference dye ii ( 50 ) , and 20 pmol of each primer .
pcrs were performed for 40 cycles at 94c for 45 s , 60c for 30 s , and 72c for 30 s in a 7900ht fast rt - pcr system ( abi , palo alto , ca , usa ) .
threshold cycle values of each sample were normalized to b - actin mrna expression , and the fold change for each mrna was calculated using the 2 method .
ut - a1 ( genetex , usa ) and b - actin ( santa cruz , usa ) were used and visualized using the detection system ( odyssey li - cor 9120 , usa ) following the procedure provided by the manufacturer .
the protocol was authorized by the animal experimental ethics committee of tongji hospital , tongji university .
male sd rats , weighing 20020 g ( n=100 ) were bred under standard conditions at constant humidity , room temperature , and regular 12 h/12 h light / dark cycles .
fifty male sd rats were randomly divided into 2 groups : model group rats were subcutaneously injected with a mixture of carbon tetrachloride ( 30% ) and plant oil ( 70% ) according to its weight ( initial dosage was 0.5 ml/100 g. maintenance dose was 0.3 ml/100 g twice a week ) in the model group and the control group rats were injected with plant oil ( 0.3 ml/100 g twice a week ) .
a subset of rats in the model group was sacrificed after 12 weeks and the liver histopathology was examined to ensure the successful establishment of a cirrhotic model .
twelve rats in the control groups were randomly divided into 2 subgroups : group a was the new control group and group b was the abdominal compartment syndrome ( acs ) group .
twelve cirrhotic rats were also divided into 2 groups : group c was the new cirrhotic group and group d was the hrs group .
the rats in group b and d were anesthetized subcutaneously with 0.03% na - pentobarbital ( 0.1 ml/100 g ) and fixed on experimental tables . succinylated gelatin was dripped into the abdominal cavity of rats via an infusion tube .
a pressure gauge with a t - shaped 3-way pipe , graduated l - shaped glass tube , and infusion tube was punctured into the lumbar region of midaxillary line on umbilicus level of rats to detect the abdominal pressure .
when fluid levels of the l - shaped glass tube raised to 26.7 cm of water column ( equivalent to 20 mmhg ) , abdominal pressure had been maintained at this level for 3 h by adjusting the dripping speed . except for dripping of succinylated gelatin ,
the remaining methods were the same as above for the rats in group a and group c. then , serum bun and cr were determined from blood samples obtained from rat aortas .
in addition , left kidneys were cryopreserved in liquid nitrogen and right kidneys were fixed in neutral buffered formalin . the later was then sectioned in coronal plane ( 5-m slice thickness ) and prepared with h and e staining for routine light microscopy .
total rna was extracted from150 mg of renal medulla into trizol reagent ( kusatsu , japan ) according to manufacturer s instructions . for cdna synthesis ,
rt reactions were performed with total rna ( 2 ug ) according to the directions of the takara rt reagent kit ( kusatsu , japan ) .
the product was amplified in a reaction volume of 10 ul including 1 ul rt product , 5 ul sybr premix ex taq ii ( 5 ) , 0.2 ul 50rox reference dye ii ( 50 ) , and 20 pmol of each primer .
pcrs were performed for 40 cycles at 94c for 45 s , 60c for 30 s , and 72c for 30 s in a 7900ht fast rt - pcr system ( abi , palo alto , ca , usa ) .
threshold cycle values of each sample were normalized to b - actin mrna expression , and the fold change for each mrna was calculated using the 2 method .
ut - a1 ( genetex , usa ) and b - actin ( santa cruz , usa ) were used and visualized using the detection system ( odyssey li - cor 9120 , usa ) following the procedure provided by the manufacturer .
compared with the control group ( figure 1a ) , the surfaces of gross liver specimens of the cirrhotic group became coarser .
the normal structures of the hepatic lobules ( figure 1c ) were destroyed with hyperplasia of fibrous tissue with formation of pseudo - lobes ( figure 1d ) . during the experiment , the respiratory rate of rats increased with increased intra - abdominal pressure and abdominal distension .
bun and cr levels of group b were significantly higher than those of group a , respectively ( 10.982.14 mmol / l vs. 4.541.05 mmol / l , 369.64 umol / l vs. 25.43.29 umol / l , p<0.05 ) .
in addition , bun and cr levels of group d were also higher than those of group c ( 8.70.96 mmol
/ l vs. 4.840.93 mmol / l , 30.37.81 umol / l vs. 17.82.68 umol / l , p<0.05 ) ( figure 2 ) .
there were no significant morphological differences among the 4 groups of rat kidneys in pathological sections .
endothelial cells , mesangial cells , and renal tubules were also normal ( figure 3 )
. the mrna expression of ut - a2 and ut - a3 in group d decreased markedly compared with that of group c ( p<0.05 ) ( figure 4 ) .
moreover , there was also no significant difference in ut - a2 , ut - a3 , and ut - b between group a and group b ( p<0.05 ) ( figure 4 ) . in terms of protein expression ,
no significant difference in ut - a1was detected among the 4 groups by western blotting ( figure 5 ) .
compared with the control group ( figure 1a ) , the surfaces of gross liver specimens of the cirrhotic group became coarser .
the normal structures of the hepatic lobules ( figure 1c ) were destroyed with hyperplasia of fibrous tissue with formation of pseudo - lobes ( figure 1d ) .
during the experiment , the respiratory rate of rats increased with increased intra - abdominal pressure and abdominal distension .
bun and cr levels of group b were significantly higher than those of group a , respectively ( 10.982.14 mmol / l vs. 4.541.05
mmol / l , 369.64 umol / l vs. 25.43.29 umol / l , p<0.05 ) .
in addition , bun and cr levels of group d were also higher than those of group c ( 8.70.96 mmol / l vs. 4.840.93
mmol / l , 30.37.81 umol / l vs. 17.82.68 umol / l , p<0.05 ) ( figure 2 ) .
there were no significant morphological differences among the 4 groups of rat kidneys in pathological sections .
endothelial cells , mesangial cells , and renal tubules were also normal ( figure 3 ) .
the mrna expression of ut - a2 and ut - a3 in group d decreased markedly compared with that of group c ( p<0.05 ) ( figure 4 ) .
moreover , there was also no significant difference in ut - a2 , ut - a3 , and ut - b between group a and group b ( p<0.05 ) ( figure 4 ) . in terms of protein expression ,
no significant difference in ut - a1was detected among the 4 groups by western blotting ( figure 5 ) .
some commonly used animal models of cirrhosis are induced by ccl4 , dimethylnitrosamine , thioacetamide , and bile duct ligation [ 912 ] . the model induced by ccl4
was used in the present study . according to the changes in gross liver specimen morphology and histopathology , the rat model of cirrhosis
then , we established the rat model of acs . in the clinic , the definition of acs is an intra - abdominal pressure 20 mmhg with abdominal organ dysfunction .
it can occur in conditions such as abdominal surgery , mechanical ventilation , ileus , and acute pancreatitis [ 1316 ] .
for further study of the pathogenesis , prevention , and therapy of this disease , several animal models of acs have been reported . in these studies , gas , liquid , or solid
however , metabolic changes and inflammatory response were found in peritoneal cells exposed to high co2 concentrations .
therefore , the impact of co2 for the model was not restricted to increasing intra - abdominal pressure .
benninger et al . used a crystal solution that was easily absorbed by the peritoneum .
however , intra - abdominal pressure was not optimally controlled and the tamponade was tedious and inaccurate .
the ascites that results in intra - abdominal hypertension is a colloid suspension that contains albumin . however , the cost of injecting albumin intraperitoneally is too high .
in the present study , succinylated gelatin was used to establish a model of asc and hrs .
because of leakage from the junction of the hose and abdominal cavity , succinylated gelatin needs to be replenished .
cyanoacrylate glue was used to adhere to the junction between tubes and the skin of the rat to prevent leakage of succinylated gelatin . in our study , rats survived for 3 h when intra - abdominal pressure reached 20 mmhg .
however , we admit that 3 h may not ne enough time to cause the change of urea transporter protein by western blot .
we successfully established the acs model and confirmed that bun and cr levels in group b increased . to the best of our knowledge ,
the present study is the first to show that the model can be used in cirrhotic animal to mimic hrs .
in addition , the 20 mmhg level in the acs definition pertains to humans , not rats .
this acs model in rats can be further improved through studying changes of renal function at different intra - abdominal pressures . as a result
, the pressure of acs in rats could be obtained and the prolonged survival will be beneficial to detect the changes of urea transporter protein . moreover , the phosphorylation of urea transporter protein could be also examined , although there is no change in total protein .
renal insufficiency has been induced by arterial blood supply deficiency rather than renal organic injury . because it usually occurs at the last stage of cirrhosis ,
pereira et al . used bile duct ligation , but found it was complex and had an unpredictable success rate .
chang et al . dripped albumin into rat abdominal cavities to model acs ; however , they used the method of measuring body weight instead of measuring pressure directly , which fails to ascertain the pressure .
the rat model of hrs in this study accorded with the cirrhosis with ascites and increased level of cr without renal organic injury .
taken together , these results indicate that dripping succinylated gelatin into the abdominal cavities of cirrhotic rats is a feasible method to produce a hrs model .
a theory of passive urine concentration in the renal medulla was proposed in 1972 by koko et al . .
in the process of renal water metabolism , the gradient osmotic pressure constituted by a great quantity of bun in renal medulla facilitates reabsorption of initial urine and excretion of bun without loss of much water .
studies showed that accumulation of bun and concentration of urine was regulated by ut - a1 and ut - a3 in the inner medullary collecting duct .
in addition , ut - a2 distributed in descending thin limb of helen s loop was found to be involved in countercurrent exchange located in the ascending limb and thick descending limb , which likewise enhances the effect of gradient osmotic pressure in the renal papilla .
ut - b protein supplies the lost urea in the inner medulla by enhancing the countercurrent exchange in the vasa recta . through researching ut expression in the renal medulla in a rat model of acs and hrs
, we found that compared with the normal group ( group a ) , there was no significant difference in expression of ut - a2 , ut - a3 , and ut - b mrna in the acs group ( group b ) , and that compared with the cirrhotic group ( group c ) , the level of ut - a2 and ut - a3 mrna was significantly decreased in the hrs group ( group d ) .
in addition , there was no significant difference in ut - a1among the 4 groups .
although ascites can induce both acs and hrs , the expression of uts in the 2 formations was different .
it is feasible create a model of acs in rats by injecting succinylated gelatin into the abdominal cavity .
increasing the intra - abdominal pressure by succinylated gelatin is also a novel approach for modeling hrs in cirrhotic rats .
compared with control rats , there is an abnormal mrna expression of ut in acs rats and hrs rats . | backgroundhepatorenal syndrome ( hrs ) is a serious complication of advanced chronic liver disease .
abdominal compartment syndrome ( acs ) occurs with dysfunction of multiple organs when abdominal pressure increases . here
, we report on a novel model of acs with ascites and a model of hrs in rats to observe the urea transporter protein ( ut ) expression in the 2 models.material/methodsa liver cirrhosis model was induced by ccl4 .
after changes of liver histopathology were observed , rats were injected intraperitoneally with succinylated gelatin to establish a model of acs and hrs .
then , changes in bun , cr , and renal histopathology were detected .
moreover , the ut in acs and hrs were also quantified.resultsthe surfaces of liver in the cirrhotic group became coarse , with visible small nodules and became yellow and greasy .
the normal structure of the hepatic lobules were destroyed , and hyperplasia of fibrotic tissue and pseudo - lobe was observed .
the levels of bun and cr were significantly increased in rats suffering from acs and hrs , respectively , compared to their control groups .
in addition , the mrna levels of ut - a2 and ut - a3 decreased in rats with hrs compared to cirrhotic rats .
however , there was no significant difference between the mrna levels of ut - a2 , ut - a3 , and ut - b in rats with acs vs. normal rats.conclusionsit is feasible to model acs in rats by injecting succinylated gelatin into the abdominal cavity .
increasing the intra - abdominal pressure by succinylated gelatin is also a novel approach for modeling hrs in cirrhotic rats .
compared with control rats , there is an abnormal mrna expression of ut in acs rats and hrs rats . |
symptomatic cerebral vasospasm is one of the major problems after subarachnoid hemorrhage ( sah ) .
it causes delayed cerebral ischemia and persistent neurological deficit in 20 - 40% of patients with sah .
therefore , early diagnosis followed by therapeutic intervention is needed to improve the outcome of this disease .
almost 30 years ago , transcranial doppler ( tcd ) was introduced for noninvasive monitoring of cerebral vasospasms .
it provides information about the blood flow of basal cerebral arteries , and a cerebral vasospasm is diagnosed by the increase in blood flow velocity at the examined vessels , based on the principle of fluid dynamics that the velocity in a tube is inversely related to the area of the lumen .
because tcd examination can be performed daily at bedside , it is utilized for diagnosing cerebral vasospasm at many neurosurgical units .
in addition , a sophisticated tcd device , transcranial color flow image ( tccfi ) , has recently emerged . in the revised american heart association guidelines for the management of sah
, tcd examination is recommended to monitor for the development of cerebral vasospasm ( class iia ; level of evidence b ) .
however , the usefulness of tcd / tccfi is controversial . a recent systemic review of seven trials examining the correlation between the results of tcd and cerebral angiography suggested that the diagnostic ability of tcd is limited .
the usefulness of tcd was confirmed only for the middle cerebral artery ( mca ) and not for the other cerebral arteries . for cerebral vasospasm of the mca , the specificity and positive predictive value of tcd are both high , but the sensitivity and negative predictive value are both low .
the latter means that tcd provides negative findings even when cerebral angiography is positive , and thus we can not rule out cerebral vasospasm even if tcd provides negative findings .
a systematic review showed that the limited ability of tcd for diagnosing cerebral vasospasm is due to the high false - negative value .
although operator inexperience or technical failures were reported to be responsible for false - negatives on tcd in cerebral arteries , except for the mca , it is unclear why the tcd examination provides false - negative information even in the mca . from a rheological viewpoint
, we speculated that the false negatives on tcd examination are caused by localization of the vasospasm . according to fluid dynamics
, the flow velocity does not increase at the artery proximal to the stenotic legion , unless the flow volume increases .
our hypothesis was that flow velocity at the horizontal segment of the mca ( m1 ) does not increase unless m1 is involved in the vasospasm .
we investigated whether the cause of false negatives on tcd examination was related to the localization of the vasospasm .
in addition , we demonstrate the correlation between the localization of vasospasm and the age of patients .
we retrospectively investigated the clinical and radiological information of 702 patients with aneurysmal sah admitted to our hospital from may 2008 to april 2015 . the treatment strategy for aneurysmal sah at our hospital
tccfi examination of both mcas was performed daily during the patient 's admission at an intensive care unit using the tccfi device ( logiq p5 ; ge healthcare , tokyo , japan ) .
inclusion criteria of this study were as follows : ( 1 ) treatment consisted of microsurgical clipping or endovascular coiling , ( 2 ) delayed cerebral ischemia , ( 3 ) cerebral angiography available to examine the site of vasospasm at the mca , ( 4 ) available for daily tccfi examinations , and ( 5 ) single - photon emission computed tomography ( spect ) available to examine cerebral blood flow . to assess the localization of mca vasospasm with angiography
the mca is divided into three segments : the horizontal segment ( m1 ) , the insular segment ( m2 ) , and the cortical segment ( m3 ) .
we classified cerebral vasospasm into two types : proximal - type vasospasm involving m1 and distal - type vasospasm not involving m1 and located at the distal part of the mca ( m2 and/or m3 ) .
a large retrospective study comparing relative and absolute tcd velocity parameters for the detection of symptomatic mca vasospasm demonstrated that absolute velocity thresholds were superior to relative velocity changes . in this study , we defined the positive findings on tccfi examination as a maximum flow velocity > 200 cm / s or a mean flow velocity > 120 cm / s at m1 .
we defined group a as the patients who had positive findings on tccfi examination and group b as the patients who had negative findings on tccfi examination .
additionally , we investigated the flow velocity on tccfi examination after the onset of delayed cerebral ischemia compared to before . for
non - normally distributed continuous variables , the mann - whitney u test was performed . to determine whether there was a difference in outcome between group a and group b , we defined a good outcome as a modified rankin scale score of 1 and 2 and conducted a test .
for non - normally distributed continuous variables , the mann - whitney u test was performed . to determine whether there was a difference in outcome between group a and group b , we defined a good outcome as a modified rankin scale score of 1 and 2 and conducted a test .
fourteen patients had positive findings on tccfi examination ( group a ) , whereas the other 6 patients had negative findings on tccfi examination ( group b ; table 1 ) .
the mean age of group a was significantly younger than that of group b ( p < 0.01 ) .
the other variables of the clinical characteristics were not significantly different between group a and group b. all 14 patients of group a had angiographic vasospasm involving m1 , whereas all 6 patients of group b had angiographic vasospasm localized at the distal part of the mca ( m2 and/or m3 ; table 2 ) .
as to blood flow velocity at the initial tccfi examination , both maximum and mean velocities were significantly lower in group b ( maximum : 95.7 cm / s ; mean : 56.2 cm / s ) than in group a ( maximum : 137.7 cm / s ; mean : 89.6 cm / s ) . comparing blood flow velocity on tccfi before and after the onset of vasospasm , increases in the maximum and mean velocity were significantly smaller in group b than in group a ( maximum : 18.2 cm / s in group b vs. 94.0 cm / s in group a ; mean : 14.6 cm / s in group b vs. 75.92 cm / s in group a ; fig .
1 ) . a 34-year - old male patient presented with sah due to a ruptured basilar artery aneurysm .
he developed delayed cerebral ischemia with aphasia and right hemiparesis on day 21 after sah .
a diffusion - weighted image showed high intensity spots in the left parietal lobe ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 237 and 186 cm / s , respectively .
case 2 . a 79-year - old male patient presented with sah due to a ruptured anterior communicating artery aneurysm .
he developed delayed cerebral ischemia with aphasia and disturbance of consciousness on day 7 after sah .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 135 and 89 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
a 73-year - old female patient presented with sah due to a ruptured aneurysm at the bifurcation of a left internal carotid artery and a posterior communicating artery .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 67 and 49 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
a 34-year - old male patient presented with sah due to a ruptured basilar artery aneurysm .
he developed delayed cerebral ischemia with aphasia and right hemiparesis on day 21 after sah .
a diffusion - weighted image showed high intensity spots in the left parietal lobe ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 237 and 186 cm / s , respectively .
a 79-year - old male patient presented with sah due to a ruptured anterior communicating artery aneurysm .
he developed delayed cerebral ischemia with aphasia and disturbance of consciousness on day 7 after sah .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 135 and 89 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
a 73-year - old female patient presented with sah due to a ruptured aneurysm at the bifurcation of a left internal carotid artery and a posterior communicating artery .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 67 and 49 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
a 34-year - old male patient presented with sah due to a ruptured basilar artery aneurysm .
he developed delayed cerebral ischemia with aphasia and right hemiparesis on day 21 after sah .
a diffusion - weighted image showed high intensity spots in the left parietal lobe ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 237 and 186 cm / s , respectively .
a 79-year - old male patient presented with sah due to a ruptured anterior communicating artery aneurysm .
he developed delayed cerebral ischemia with aphasia and disturbance of consciousness on day 7 after sah .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 135 and 89 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
a 73-year - old female patient presented with sah due to a ruptured aneurysm at the bifurcation of a left internal carotid artery and a posterior communicating artery .
a diffusion - weighted image showed multiple high - intensity spots in the left hemisphere ( fig .
the tccfi examination showed that the maximum and mean velocities at the left mca were 67 and 49 cm / s , respectively .
a left internal carotid angiography showed vasospasm localized at the distal part of the left mca ( fig .
tcd / tccfi examination is reported to have limited ability to detect cerebral vasospasm after sah .
the results of the present study showed that flow velocity at m1 did not increase to the values we defined as positive findings when the vasospasm was localized at the distal part of the mca ( m2 and/or m3 ) .
therefore , tccfi provides false - negative information when a vasospasm is localized at the distal part of the mca .
the volume of blood flow [ v ( m / s ) ] is the multiplication of the surface of an artery [ s ( m ) ] and the mean velocity of blood flow over the surface [ v ( m / s ) ] : at the constant flow volume ( v ) , the velocity ( v ) is inversely proportional to the surface of an artery ( s ) .
the diagnosis for cerebral vasospasm on tcd / tccfi examination is based on this correlation , although the velocity measured by tcd / tccfi [ v ( m / s ) ] is not equal to v. however , at the constant arterial surface ( s ) , v ( or v ) does not increase , unless the flow volume ( v ) increases . in patients with delayed cerebral ischemia , the flow volume ( v ) does not increase because of the elevated resistance of peripheral arteries . in this study
, spect showed that none of the cases were hyperemic . under the condition that v did not increase ,
the velocity of m1 ( v ) did not increase when m1 was not involved in the cerebral vasospasm , and the surface of m1 ( s ) was constant .
the distal type of vasospasm at the mca in which tccfi provided false negatives was seen in 6 ( 30% ) of 20 cases in the current study .
the age of the 6 patients was significantly greater than that of the other 14 cases .
two pathophysiological reasons for this are considered . first , age - related atherosclerotic changes weaken vasoconstriction of the m1 , thereby decreasing the contractility of the basal cerebral arteries .
decreased cerebral blood flow and the absence of collateral flow in elderly patients narrows the margin between adequate cerebral blood flow and the ischemic threshold , making elderly patients susceptible to ischemic neurological deficits with even small changes in vessel caliber . to improve the diagnosability of tcd / tccfi for the distal type of vasospasm
, we propose that a slight increase in flow velocity at the onset of vasospasm is important .
in fact , the tccfi examination at the onset of vasospasm showed a slight increase in flow velocity compared with the data at the initial tccfi examination even in patients with distal - type vasospasm ( fig .
1 ) . these results suggest a slight decrease in m1 surface due to vasoconstriction which could not be detected in angiography .
given that flow velocity at the initial tccfi examination was low and the increase in velocity at the onset of vasospasm was small , neither the maximum nor mean velocity at the onset of vasospasm reached the values we defined as a positive finding ( maximum : 200 cm / s ; mean : 120 cm / s ) .
therefore , in order to reduce false negatives , a slight increase in flow velocity on tcd / tccfi examination should be recognized as positive for the diagnosis of distal - type vasospasm , especially in aged patients .
the present study did not refer to the specificity or positive predictive value of tcd / tccfi because we selected patients who had true vasospasm in order to investigate the cause of false negatives on tcd / tccfi .
however , a previous review compensates for this limitation , as it reported that the specificity and positive predictive value of tcd / tccfi were high .
it is important to understand such characteristics of tcd / tccfi examination for diagnosing cerebral vasospasm after sah .
only 20 cases were included in this study , mainly due to the availability of angiography . using magnetic resonance angiography instead of conventional angiography may allow for further investigation with a larger population to reinforce the findings of this initial study .
the present study did not refer to the specificity or positive predictive value of tcd / tccfi because we selected patients who had true vasospasm in order to investigate the cause of false negatives on tcd / tccfi .
however , a previous review compensates for this limitation , as it reported that the specificity and positive predictive value of tcd / tccfi were high .
it is important to understand such characteristics of tcd / tccfi examination for diagnosing cerebral vasospasm after sah .
only 20 cases were included in this study , mainly due to the availability of angiography . using magnetic resonance angiography instead of conventional angiography may allow for further investigation with a larger population to reinforce the findings of this initial study .
tcd / tccfi examination provided false - negative findings for the diagnosis of cerebral vasospasm localized at the distal part of the mca because flow velocity at the horizontal part of the mca did not increase to the level we defined as positive . a slight increase in flow velocity on tcd / tccfi examination
should be recognized as a positive finding for the distal type of vasospasm , especially in aged patients .
| backgroundtranscranial doppler ( tcd ) is used to monitor cerebral vasospasm after subarachnoid hemorrhage ( sah ) , but its diagnostic ability is reported to be limited . therefore , the purpose of this study was to investigate the relationship between the diagnosability of tcd and the localization of the vasospasm.methodsthis retrospective study included 20 patients who presented with symptomatic vasospasm after sah .
all 20 patients underwent daily tcd examinations and cerebral angiography after the onset of delayed cerebral ischemia .
we defined positive findings on tcd as a maximum flow velocity > 200 cm / s or as a mean flow velocity > 120 cm / s at the horizontal part of the middle cerebral artery ( mca ) .
we also examined the site of vasospasm on cerebral angiography.resultsfourteen patients had true - positive findings on tcd examination , and cerebral angiography showed diffuse vasospasm involving the horizontal segment of the mca .
however , 6 patients had false - negative findings on tcd examination , and cerebral angiography showed vasospasm localized at the distal part of the mca ( the insular and/or cortical segments ) .
the patients with proximal vasospasm were significantly younger than those with distal vasospasm .
blood flow velocity at initial tcd and the increase in velocity at the onset of vasospasm were lower and smaller , respectively , in the distal vasospasm group.conclusionsin patients with cerebral vasospasm localized at the distal part of the mca , flow velocity at the horizontal segment of the mca did not increase to the level we defined as positive .
to avoid such false negatives , a slight increase in velocity on tcd should be considered as positive in distal vasospasm cases , especially in older patients . |
prion diseases and prion infectious agents are among the most fascinating biological topics of the twentieth century and have been under the spotlight for the last 30 years , particularly due to the striking epidemic of bovine spongiform encephalopathy ( bse ) , which started in great britain in the mid - eighties and then spread to other european countries .
the transmission of the bovine prion agent to humans , possibly through consumption of prion - contaminated beef products , led to the emergence of a new human prion disease , named variant creutzfeldt - jakob disease ( vcjd ) , in young people . recently ,
several cases of secondary human - to - human transmission of vcjd through transfusion of prion - contaminated blood [ 46 ] have raised doubts within the scientific community about the safety of blood products and highlighted the crucial need of diagnostic tests for prion detection in blood . currently , the development of reliable blood tests and of therapies is the main mission of scientists working in the prion field .
historically , the infectious agent that causes prion diseases was supposed to be an atypical virus belonging to the category of slow viruses [ 7 , 8 ] .
then , in 1967 , pattison and colleagues reported that the scrapie agent was resistant to heat and formaldehyde , two treatments that inactivate most viruses , thus introducing a doubt about the true nature of this infectious agent .
in addition , in 1967 , alper and colleagues showed that the scrapie agent was also resistant to ionizing radiations and uv light irradiation that normally inactivates nucleic acids , suggesting that it was probably devoid of nucleic acids .
based on these intriguing experimental data , griffith suggested that the scrapie agent could be a protein that self - replicates through autocatalytic conformational changes .
this audacious hypothesis retained the attention of stanley prusiner who purified the scrapie agent from the brain of scrapie - infected hamsters and reported that inactivation by physicochemical agents that destroy proteins abolished the infectivity of such purified preparations . in 1982 , he proposed the new term of prion , for proteinaceous infectious only particle , to define this atypical agent .
the revolutionary idea that a protein may act as a virus was unbelievable at that time and stanley prusiner had to struggle hard to convince the scientific community .
his outstanding work on prions earned him the nobel prize of medicine in 1997 , although at that time the ground - breaking concept of proteinaceous infectious particles was not yet definitively proved .
the prion protein ( prp ) is the main component of prion agents and , remarkably , can fold into different ( normal or pathogenic ) conformations that are thermodynamically stable .
prp , the normal cellular isoform , is mostly folded into -helices and is detergent - soluble and completely digested by proteinase k. conversely , prp ( for scrapie form ) , the abnormally folded isoform , is mostly folded into -sheets , which confer insoluble property in detergents , and is partially resistant to proteinase k. indeed , prp digestion by proteinase k produces an n - terminally truncated fragment that begins around residue 90 and is commonly called prp27 - 30 .
prp isoforms are the main constituent of amyloid plaques and of brain deposits in patients affected by cjd .
for this reason , prp is considered as the main disease marker and is the reference for the histopathological analyses carried out to diagnose prion diseases .
how can prions multiply ? in the original protein - only hypothesis proposed by griffith and prusiner [ 1 , 11 ] , prp can trigger the autocatalytic conversion of normal prp into prp and imprints its misfolded form to prp , which in turn becomes pathological ( figure 1 ) .
this conversion process involves several prp intermediates that are generated through a complex oligomerization mechanism and then self - assembled into protofibrils , which in turn grow into amyloid fibrils [ 16 , 17 ] .
then , large fibrils can break naturally , producing small fragments , called seeds , that will propagate de novo the prion agent ( seeding process ) [ 1820 ] .
as both prp and prp are exposed at the cell surface and attached to the plasma membrane through a gpi anchor , they can propagate in tissues via cell - cell contacts [ 21 , 22 ] .
many recent lines of evidence indicate that the most neurotoxic species within this replication cycle are the small soluble oligomers rather than the large amyloid fibrils , which would serve as
reservoirs to trap small neurotoxic species [ 17 , 23 , 24 ] .
the advent of molecular biology allowed the generation of cell ( the neuroblastoma scn2a cell line ) and transgenic animal models [ 2527 ] to investigate the molecular basis of prion replication , pathogenicity , and propagation .
the crucial role of prp was demonstrated using mice in which the gene coding for prp ( prnp ) was genetically ablated [ 28 , 29 ] .
these mice are resistant to prion inoculation and can not propagate and replicate the infectious agent . later on , prnp knock out ( using the cre / lox system ) in the neurons of adult mice with early prion infection allowed demonstrating that the synaptic impairment , spongiosis , and behavioural deficits observed in these animals could be reversed .
conversely , transgenic mice that harbour high copy numbers of a wild - type prnp transgene develop a neurological syndrome that is similar in some aspects to prion disease , but they do not produce transmissible prp unless they are inoculated with prions . for decades ,
no animal model of sporadic prion disease was available in which prions formed spontaneously from wild - type prp and could be transmitted to other animals .
interestingly , spontaneous development of transmissible spongiform encephalopathy was observed in transgenic mice that overexpress a mouse - elk prp chimeric molecule harbouring the two point mutations s170n and n174 t that induce a rigidity of the 2-2 loop region .
the disease could be transmitted by intracerebral inoculation of brain homogenates from ill mice to tga20 mice that overexpress wild - type prp and from them to wild - type mice .
this region is rich in glutamine and asparagine residues , which are frequently encountered in amyloidogenic proteins , and may act as hot spots for protein aggregation .
recently , watts et al . generated a transgenic mouse model , named tg(bvprp ) , that overexpresses wild - type bank vole ( bv ) prp .
these mice develop spontaneous cns dysfunction between days 108 and 340 after birth that recapitulates the hallmarks of prion diseases .
moreover , the disease could be transmitted to tga20 and wild - type mice by intracerebral injection of brain homogenates from ill tg(bvprp ) animals .
this is the first animal model showing that wild - type prp can spontaneously form infectious prions in vivo and thus will be very useful for understanding the aetiology of sporadic prion diseases , such as sporadic cjd .
several transgenic mice that overexpress the most frequent mutant prp proteins , such as p101l prp [ 34 , 35 ] or prp with a 9 octarepeat insertion in the n - terminus , were also generated .
although these mice succumb to spontaneous prion disease with various incubation times , they do not show all the biochemical and pathological features of prion diseases and often fail to transmit prion infectivity to wild - type animals .
recently , several transgenic mouse models of genetic prion diseases retained our interest : the tg(pg14 ) transgenic mice that express a mutant prp with 14 octapeptide repeats and present a progressive neurological disorder with ataxia , prp deposition , and massive loss of cerebellar granule cells .
they also display the main biochemical properties of prp , such as partial resistance to proteinase k , detergent insolubility and resistance to gpi - anchor cleavage by phospholipase;the tg(mhu2me199k ) mouse model of genetic cjd , which is caused by the e200k substitution in human prp .
these animals express a chimeric mouse - human prp harbouring the corresponding mouse e199k mutation ( prpmhu2me199k ) and develop progressive neurodegenerative disease from 6 months of age .
histopathological analysis of their brain revealed the presence of astrocytic gliosis , spongiosis , and pk - resistant prp deposits by western blotting .
importantly , brain extracts from tg(mhu2me199k ) sick mice transmitted the prion disease to wild - type animals ; the knock - in ki-3f4-ffi mice that express a mutant prp ( d177n - m129 - 3f4 tagged ) associated with fatal familial insomnia ( ffi ) , a genetic human prion disease .
these mice present several neurological features ( atrophied cerebellum , enlarged ventricles , and thalamus abnormalities ) that are similar to those seen in humans with ffi .
surprisingly , these animals display a protease - sensitive prp ( sprp ) isoform , like patients with ffi , and the disease is transmissible to control ki-3f4-wt mice ( wild - type prnp ) and to transgenic mice that overexpress wild - type prp ( tga20 ) .
the presence of pk - sensitive prp in ffi mice supports recent findings showing that new pk - sensitive synthetic prions can be infectious , as well as the identification of a novel human prion disease called vpspr ( variably protease - sensitive prionopathy ) , which is characterized by the presence of prp with highly variable pk resistance . as for all neurodegenerative disorders ,
it is important to generate the most appropriate animal models of the genetic forms of the disease in order to develop pertinent therapeutic strategies .
the tg(pg14 ) transgenic mice that express a mutant prp with 14 octapeptide repeats and present a progressive neurological disorder with ataxia , prp deposition , and massive loss of cerebellar granule cells .
they also display the main biochemical properties of prp , such as partial resistance to proteinase k , detergent insolubility and resistance to gpi - anchor cleavage by phospholipase ; the tg(mhu2me199k ) mouse model of genetic cjd , which is caused by the e200k substitution in human prp .
these animals express a chimeric mouse - human prp harbouring the corresponding mouse e199k mutation ( prpmhu2me199k ) and develop progressive neurodegenerative disease from 6 months of age .
histopathological analysis of their brain revealed the presence of astrocytic gliosis , spongiosis , and pk - resistant prp deposits by western blotting .
importantly , brain extracts from tg(mhu2me199k ) sick mice transmitted the prion disease to wild - type animals ; the knock - in ki-3f4-ffi mice that express a mutant prp ( d177n - m129 - 3f4 tagged ) associated with fatal familial insomnia ( ffi ) , a genetic human prion disease .
these mice present several neurological features ( atrophied cerebellum , enlarged ventricles , and thalamus abnormalities ) that are similar to those seen in humans with ffi .
surprisingly , these animals display a protease - sensitive prp ( sprp ) isoform , like patients with ffi , and the disease is transmissible to control ki-3f4-wt mice ( wild - type prnp ) and to transgenic mice that overexpress wild - type prp ( tga20 ) .
the presence of pk - sensitive prp in ffi mice supports recent findings showing that new pk - sensitive synthetic prions can be infectious , as well as the identification of a novel human prion disease called vpspr ( variably protease - sensitive prionopathy ) , which is characterized by the presence of prp with highly variable pk resistance . as for all neurodegenerative disorders ,
it is important to generate the most appropriate animal models of the genetic forms of the disease in order to develop pertinent therapeutic strategies .
despite the compelling evidence in favour of the prion hypothesis , some sceptics argued that the definite proof could be obtained only by producing in vitro the infectious material used for intracerebral inoculation starting from pure normal prp , a technical feat that seemed impossible for many decades .
a strong advance was the finding that recombinant hamster prp(90 - 231 ) ( recprp , which corresponds to human prp27 - 30 ) purified from e. coli under reducing conditions at ph > 7 has a high -sheet content and low solubility , like prp .
conversely , recprp refolding by oxidation to form a disulphide bond produced a soluble protein with a high -helix content , similar to normal prp .
the ability of recprp to adopt either an -helix- or -sheet - rich conformation strongly suggests that the prp sequence is intrinsically plastic . some prp domains may have a relatively open conformation which makes it susceptible to conversion into prp under appropriate physicochemical conditions
however , inoculation of the -sheet - rich recprp isoform in mice did not transmit the disease . at the beginning of 2000 , baskakov et al .
[ 19 , 20 ] managed to partially solve the complex pathway of prp assembly into amyloids . to study the kinetic pathway of amyloid formation ,
they used an unglycosylated recombinant prp form that corresponds to the pk - resistant core of prp and found that it can adopt two abnormal -sheet - rich isoforms ( -oligomers and amyloid fibrils ) via separate kinetic pathways . the tendency to generate either form is driven by the experimental conditions .
acidic ph ( similar to the ph found in endocytic vesicles ) favours the transition from -monomers to -oligomers , whereas neutral ph promotes amyloid fibril formation .
these multiple misfolding pathways and the generation of distinct -sheet - rich isoforms might explain the difficulties to generate infectious prions in vitro from pure recombinant prp . then , baskakov and legname inoculated some amyloid fibrils from purified recombinant prp(89 - 231 ) in the brain of tg(prp89 - 231 ) transgenic mice that express a truncated prp variant corresponding to the pk - resistant core . after 580 days of incubation ,
analysis of brain tissue sections revealed spongiosis , astrocytic gliosis , and the presence of pk - resistant prp . at the second passage ,
brain extracts from these mice were inoculated to both tg(prp89 - 231 ) and wt fvb mice .
both types of mice showed clinical signs and the biochemical features of prion disease after 150 days ( fvb mice ) and 250 days ( tg(prp89 - 231 ) animals ) of incubation .
these findings indicate that a new prion strain can be generated from pure recombinant prp designated synthetic mammalian prions and that it can induce a transmissible neurodegenerative disease in transgenic mice .
subsequent in vivo experiments with various synthetic prion strains obtained from recombinant prp fibrils demonstrated that conformationally stable recombinant amyloids produced more stable prion strains with a longer incubation time , whereas more labile amyloids generated less stable strains with a shorter incubation time
. one major criticism to this work is that the recombinant fibrils were first injected in transgenic animals that overexpress prp and not in wild - type mice .
thus , the inoculation of recombinant fibrils might have resulted in an acceleration of preexisting conditions produced by transgenesis as it is the case for transgenic mice that overexpress normal or mutated prp [ 31 , 36 ] . however , injection of recombinant hamster prp ( recprpha ) fibrils in wild - type golden syrian hamsters provided strong evidence that fibrils can induce transmissible disease de novo , although 100% success rate was only achieved at the second passage and was correlated with the presence of prp in the brain .
the animals showed clear signs of transmissible spongiform encephalopathy ( tse ) , and the unique clinical course and neuropathological features suggested that a new prion disease was induced by recprpha fibrils .
this new prion strain was designated as sslow due to the very long disease incubation time .
these experiments are in strong favour of the protein - only hypothesis ; however , it remains to be elucidated how recombinant prp fibrils trigger the formation of transmissible prp .
the predominant hypothesis , which is based on the template - assisted mechanism of propagation , is that the preparation of recombinant prp fibrils might have included some minute amount of prp ( figure 2(a ) ) that was responsible for the disease .
this could also explain the long incubation time and the lower than 100% transmissibility at the first passage .
[ 48 , 49 ] suggests a new templating mechanism , called deformed templating ( figure 2(b ) ) .
three different inocula with conformationally distinct amyloid states ( 0.5 m fibrils , 2 m fibrils and s fibrils ) were prepared in vitro from purified recprpha .
after inoculation in mice , no signs of prion infection were found in animals injected with 2 m and s fibrils that are reminiscent of prp , whereas the less stable 0.5 m fibrils induced a pathogenic process that eventually led to transmissible prion disease . using the protein misfolding cyclic amplification ( pmca ) technique , they showed that the 0.5 m recprpha fibrils used to inoculate wild - type animals did not contain classical prp .
however , these fibrils gave rise to an atypical proteinase k - resistant prp ( prpres ) that was detected using a modified pmca procedure .
this atypical transmissible prpres has a structure that resembles that of amyloid seeds and was observed during the asymptomatic stage of the disease before the emergence of the classical prp form .
this work provides evidence that apparently noninfectiou amyloid fibrils with a structure different from that of prp can lead to transmissible prion disease and suggests a new mechanism of prion conversion through deformed templating .
in this model ( figure 2(b ) ) , recombinant prp fibrils , which have a structure that is significantly different from that of prp , can progressively acquire a new folding pattern and adapt to the template of the classical pk - resistant prp [ 48 , 49 ] . an alternative approach to demonstrate the protein - only hypothesis
was explored by wang et al . who created recombinant prions by pmca using recombinant mouse prp ( purified from e. coli ) in the presence of synthetic phospholipids and total liver rna .
the recombinant prions obtained in these conditions showed all the features of the pathogenic prp isoform , especially the protease resistance and transmissibility in wild - type cd-1 mice that succumbed to prion disease in about 150 days .
this experiment provides strong evidence in support of the protein - only hypothesis because prions with high infectivity titre could be generated in vitro from well - defined components .
it also illustrates the key role of lipids and rna as cofactors to facilitate prp conversion .
recently , deleault et al . identified phosphatidylethanolamine as the single cofactor required to facilitate the conversion of recombinant prp into infectious recombinant prp during pmca [ 51 , 52 ] .
during the last decades , many publications have shown that neurodegenerative disorders as diverse as alzheimer 's , parkinson 's , huntington 's , and creutzfeldt - jakob disease share a common pathogenic mechanism involving the aggregation and deposition of misfolded proteins .
although the type of aggregated proteins is disease specific ( table 1 ) , they all share a prion - like mechanism of cell - cell propagation , with similar pathways of protein aggregation that involve oligomeric species leading to fibril formation and amyloid deposition .
for instance , several studies have investigated the putative prion - like mechanism involved in the transmission of misfolded amyloid beta ( a ) ( table 1 ) by inoculating brain extracts from patients with alzheimer 's disease ( ad brain tissues ) in several animal models . in marmoset , a non - human primate , amyloid plaques were induced 6 - 7 years after inoculation of ad brain tissue .
these plaques were composed of aggregated a peptides similar to those found in the host , and a deposition was not restricted to the injection site , suggesting diffusion of the newly formed aggregates .
the experiment could be successfully reproduced in tg2576 transgenic mice that express the -amyloid precursor protein ( app ) with the swedish mutation corresponding to the familial form of ad .
specifically , intracerebral injection of ad brain tissue in these animals led to a peculiar brain distribution of a deposits [ 54 , 55 ] .
five months after injection , the a aggregates were localized only in the ipsilateral side , whereas after 12 months senile plaques and vascular deposits were detected in both hemispheres , suggesting spreading of the aggregates .
the use of other transgenic mouse models ( app23 and app / ps1 animals ) showed that the brain a deposit profiles vary with the host and the brain extracts used to induce amyloidosis , similar to what was observed with different prion strains [ 5658 ] .
altogether these results clearly indicate that inoculation of brain extracts containing preformed a seeds accelerates the formation of new a deposits in vivo , in transgenic mice and non - human primates .
remarkably , stohr and coworkers induced cerebral -amyloidosis by inoculating purified a aggregates derived from brain or aggregates composed of synthetic a peptides in tg(app23:gfap - luc ) mice .
monitoring of a deposition in live tg(app23:gfap - luc ) mice by using bioluminescence imaging showed that a aggregates self - propagate as prions .
similar findings were reported concerning the induction of tau aggregates in the brain of transgenic mice that express wild - type human tau after intracerebral injection of brain extracts from old tg(hutaup301s ) mice containing insoluble tau aggregates .
neurofibrillary tangles , neuropil threads , and coiled bodies could be visualized not only in neurons but also in oligodendrocytes of the injected animals .
in addition , mouse tau can coaggregate with human tau p301s , indicating cross - species seeding .
the hallmark of parkinson 's disease ( pd ) is the presence in the brain of lewy bodies and lewy neurites that contain high amounts of aggregates of misfolded -synuclein ( -syn ) . in the dual - hit hypothesis proposed by hawkes and coworkers
, pd originates in the nose and foregut after inhalation / ingestion of an unknown neurotropic pathogen and then aggregates spread throughout the nervous system with a stereotypic pattern following unmyelinated axons .
this theory is based on extensive postmortem analyses of patients with pd that identified the olfactory bulb and enteric plexus of the stomach as early sites of lewy pathology , and also on evidence of olfactory and autonomic dysfunction as early nonmotor pd symptoms .
have stereotaxically injected preformed recombinant -syn fibrils in the cortex and striatum of tg(-syna53 t ) mice that express human -syn harbouring the a53 t mutation related to familiar pd and showed that -syn aggregates can spread in the tissues with a prion - like mechanism of propagation .
similarly , a single intrastriatal inoculation of synthetic -syn fibrils in wild - type nontransgenic mice led to the cell - to - cell transmission of pathologic -syn and parkinson's - like lewy pathology in anatomically interconnected regions .
accumulation of toxic aggregates in these mice triggered a progressive loss of dopamine neurons in the substantia nigra and a reduced dopamine levels culminating in motor deficits .
remarkably , experiments of transplantation of fetal cells in pd subjects showed the presence of lewy body - like inclusions 14 years after grafting that stained positively for -syn and ubiquitin and had reduced immunostaining for dopamine transporter .
this result was confirmed in other pd subjects transplanted with fetal mesencephalic dopaminergic neurons ( 1116 years ) who developed -syn - positive lewy bodies in grafted neurons .
these results suggest a host - to - graft disease propagation mechanism with implications for cell - based therapies [ 61 , 62 ] .
these last years have been marked by the end of the controversy about the protein - only hypothesis concerning prion diseases .
in addition , a growing number of studies have shown that other amyloidogenic proteins implicated in various neurodegenerative disorders can propagate in vivo with a prion - like mechanism .
we witness the opening of a new field of research in neurodegenerative disorders [ 67 , 68 ] , and the lessons learned from prion diseases will help scientists develop new strategies for diagnostic and therapeutic approaches for other neurodegenerative disorders . | prion diseases are fatal neurodegenerative sporadic , inherited , or acquired disorders . in humans ,
creutzfeldt - jakob disease is the most studied prion disease . in animals ,
the most frequent prion diseases are scrapie in sheep and goat , bovine spongiform encephalopathy in cattle , and the emerging chronic wasting disease in wild and captive deer in north america .
the hallmark of prion diseases is the deposition in the brain of prpsc , an abnormal -sheet - rich form of the cellular prion protein ( prpc ) ( prusiner 1982 ) . according to the prion hypothesis
, prpsc can trigger the autocatalytic conversion of prpc into prpsc , presumably in the presence of cofactors ( lipids and small rnas ) that have been recently identified . in this review
, we will come back to the original works that led to the discovery of prions and to the protein - only hypothesis proposed by dr .
prusiner .
we will then describe the recent reports on mammalian synthetic prions and recombinant prions that strongly support the protein - only hypothesis .
the new concept of deformed templating regarding a new mechanism of prpsc formation and replication will be exposed .
the review will end with a chapter on the prion - like propagation of other neurodegenerative disorders , such as alzheimer 's and parkinson 's disease and tauopathies . |
oral cenesthopathy is the complaint of abnormal oral sensation where no underlying organic cause can be identified .
it is also called oral dysesthesia or oral somatic delusion and classified as delusional disorder , somatic type .
the patients with oral cenesthopathy show right > left asymmetric regional cerebral blood flow ( rcbf ) in the broad brain region
. however , the studies scrutinizing the rcbf change before and after the successful treatment are still a few so far .
we found a marked improvement of oral cenesthopathy with aripiprazole . it is suggested that right > left rcbf asymmetry in the frontal and temporal lobes and thalamus , and the dopaminergic and serotonergic dysfunctions are involved in the pathology of oral cenesthopathy .
a 72-year - old housewife was referred to our clinic from her family physician with a complaint that there are many balloons and holes on my palate all day .
two years before and 3 months after eradicating helicobacter pylori , she felt as if there were many holes on her palate and saw a gastroenterologist , but there were no abnormal findings .
in addition , she felt that there were many balloons and needles on her palate .
she saw the gastroenterologist again and was prescribed amitriptyline 10 mg / d , resulting in no improvement of her symptoms .
then she presented to our clinic by herself . because there were no delusional or hallucinatory symptoms other than in oral regions , considering the clinical history together , we diagnosed her condition as oral cenesthopathy .
on evaluation with the oral dysesthesia rating scale ( oral drs ) , the symptom severity scale ( sss ) score was 8 and functional impairment scale ( fis ) score was 7 .
single - photon emission computed tomography ( spect ) using technetium tc 99 m ethylcysteinate dimer was undertaken at 1 month after the first visit , when the symptoms had not changed .
the right > left asymmetric rcbf was seen in the frontal and temporal lobes and thalamus ( fig .
two months after the first visit , the feeling of holes on her palate still existed but did not irritate her .
fourteen months after the first visit , she reported that her symptoms had resolved ( oral drs scores : sss , 2 ; fis , 3 ) without any adverse effects .
the spect imaging at that time showed the attenuation of the asymmetric rcbf ( fig .
the right > left asymmetric rcbf is shown in the frontal and temporal lobes and thalamus before the alleviation ( a ) .
a 73-year - old man , former office worker in the accounting department of a construction company , was referred by his family physician .
his chief complaints were sticky sensation in my mouth and gritty sensation and pressure - like sensation in the lower incisor .
the patient had histories of angina pectoris , diabetes , and osteoporosis , all of which were under control at initial presentation .
he had visited 4 dental clinics and undergone dental hygiene treatment , resulting in no change .
in addition to the gritty sensation , a sticky sensation developed 6 months later . in our first examination , no organic cause was detected .
considering the history of illness , the patient s condition was diagnosed as oral cenesthopathy .
aripiprazole 1 mg / d was prescribed at first , and mirtazapine 7.5 mg / d was added to avoid sleep disturbance induced by aripiprazole 2 weeks after the first visit .
the first spect was carried out 1 month after the first visit , when he had slight improvement ( oral drs scores : sss , 6 ; fis , 2 ) .
the right > left rcbf asymmetries were seen in the inferior frontal lobe , temporal lobe , and thalamus , and slight rcbf decrease was detected in the parietal lobes bilaterally ( fig .
after the dosages of aripiprazole and mirtazapine were gradually increased , his complaints decreased . at the time of the second spect , which is 14 months after the first visit
, he reported mostly being unaware of the sticky and gritty sensation throughout the day ( oral drs scores : sss , 2 ; fis , 0 ) with the combination of aripiprazole 1.5 mg / d and mirtazapine 45 mg / d .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated in the second spect ( fig .
however , right > left asymmetric rcbf was detected in the superior frontal lobe only in the second spect ; the pathological implication is unknown .
the right > left rcbf asymmetries are shown in the inferior frontal lobe and temporal lobe and thalamus , and slight rcbf decrease was detected in the bilateral parietal lobes before the remission ( a ) .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated after the remission ( b ) .
a 72-year - old housewife was referred to our clinic from her family physician with a complaint that there are many balloons and holes on my palate all day .
two years before and 3 months after eradicating helicobacter pylori , she felt as if there were many holes on her palate and saw a gastroenterologist , but there were no abnormal findings .
in addition , she felt that there were many balloons and needles on her palate .
she saw the gastroenterologist again and was prescribed amitriptyline 10 mg / d , resulting in no improvement of her symptoms .
then she presented to our clinic by herself . because there were no delusional or hallucinatory symptoms other than in oral regions , considering the clinical history together , we diagnosed her condition as oral cenesthopathy .
on evaluation with the oral dysesthesia rating scale ( oral drs ) , the symptom severity scale ( sss ) score was 8 and functional impairment scale ( fis ) score was 7 .
single - photon emission computed tomography ( spect ) using technetium tc 99 m ethylcysteinate dimer was undertaken at 1 month after the first visit , when the symptoms had not changed .
the right > left asymmetric rcbf was seen in the frontal and temporal lobes and thalamus ( fig .
two months after the first visit , the feeling of holes on her palate still existed but did not irritate her .
fourteen months after the first visit , she reported that her symptoms had resolved ( oral drs scores : sss , 2 ; fis , 3 ) without any adverse effects .
the spect imaging at that time showed the attenuation of the asymmetric rcbf ( fig .
the right > left asymmetric rcbf is shown in the frontal and temporal lobes and thalamus before the alleviation ( a ) .
a 73-year - old man , former office worker in the accounting department of a construction company , was referred by his family physician .
his chief complaints were sticky sensation in my mouth and gritty sensation and pressure - like sensation in the lower incisor .
the patient had histories of angina pectoris , diabetes , and osteoporosis , all of which were under control at initial presentation .
he had visited 4 dental clinics and undergone dental hygiene treatment , resulting in no change .
in addition to the gritty sensation , a sticky sensation developed 6 months later . in our first examination , no organic cause was detected .
considering the history of illness , the patient s condition was diagnosed as oral cenesthopathy .
aripiprazole 1 mg / d was prescribed at first , and mirtazapine 7.5 mg / d was added to avoid sleep disturbance induced by aripiprazole 2 weeks after the first visit .
the first spect was carried out 1 month after the first visit , when he had slight improvement ( oral drs scores : sss , 6 ; fis , 2 ) .
the right > left rcbf asymmetries were seen in the inferior frontal lobe , temporal lobe , and thalamus , and slight rcbf decrease was detected in the parietal lobes bilaterally ( fig .
after the dosages of aripiprazole and mirtazapine were gradually increased , his complaints decreased . at the time of the second spect , which is 14 months after the first visit
, he reported mostly being unaware of the sticky and gritty sensation throughout the day ( oral drs scores : sss , 2 ; fis , 0 ) with the combination of aripiprazole 1.5 mg / d and mirtazapine 45 mg / d .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated in the second spect ( fig .
however , right > left asymmetric rcbf was detected in the superior frontal lobe only in the second spect ; the pathological implication is unknown .
the right > left rcbf asymmetries are shown in the inferior frontal lobe and temporal lobe and thalamus , and slight rcbf decrease was detected in the bilateral parietal lobes before the remission ( a ) .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated after the remission ( b ) .
a 72-year - old housewife was referred to our clinic from her family physician with a complaint that there are many balloons and holes on my palate all day .
two years before and 3 months after eradicating helicobacter pylori , she felt as if there were many holes on her palate and saw a gastroenterologist , but there were no abnormal findings .
in addition , she felt that there were many balloons and needles on her palate .
she saw the gastroenterologist again and was prescribed amitriptyline 10 mg / d , resulting in no improvement of her symptoms .
then she presented to our clinic by herself . because there were no delusional or hallucinatory symptoms other than in oral regions , considering the clinical history together , we diagnosed her condition as oral cenesthopathy .
on evaluation with the oral dysesthesia rating scale ( oral drs ) , the symptom severity scale ( sss ) score was 8 and functional impairment scale ( fis ) score was 7 .
single - photon emission computed tomography ( spect ) using technetium tc 99 m ethylcysteinate dimer was undertaken at 1 month after the first visit , when the symptoms had not changed .
the right > left asymmetric rcbf was seen in the frontal and temporal lobes and thalamus ( fig .
two months after the first visit , the feeling of holes on her palate still existed but did not irritate her .
fourteen months after the first visit , she reported that her symptoms had resolved ( oral drs scores : sss , 2 ; fis , 3 ) without any adverse effects .
the spect imaging at that time showed the attenuation of the asymmetric rcbf ( fig .
the right > left asymmetric rcbf is shown in the frontal and temporal lobes and thalamus before the alleviation ( a ) .
a 73-year - old man , former office worker in the accounting department of a construction company , was referred by his family physician .
his chief complaints were sticky sensation in my mouth and gritty sensation and pressure - like sensation in the lower incisor .
the patient had histories of angina pectoris , diabetes , and osteoporosis , all of which were under control at initial presentation .
he had visited 4 dental clinics and undergone dental hygiene treatment , resulting in no change .
in addition to the gritty sensation , a sticky sensation developed 6 months later . in our first examination , no organic cause was detected .
considering the history of illness , the patient s condition was diagnosed as oral cenesthopathy .
aripiprazole 1 mg / d was prescribed at first , and mirtazapine 7.5 mg / d was added to avoid sleep disturbance induced by aripiprazole 2 weeks after the first visit .
the first spect was carried out 1 month after the first visit , when he had slight improvement ( oral drs scores : sss , 6 ; fis , 2 ) .
the right > left rcbf asymmetries were seen in the inferior frontal lobe , temporal lobe , and thalamus , and slight rcbf decrease was detected in the parietal lobes bilaterally ( fig .
after the dosages of aripiprazole and mirtazapine were gradually increased , his complaints decreased . at the time of the second spect , which is 14 months after the first visit
, he reported mostly being unaware of the sticky and gritty sensation throughout the day ( oral drs scores : sss , 2 ; fis , 0 ) with the combination of aripiprazole 1.5 mg / d and mirtazapine 45 mg / d .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated in the second spect ( fig .
however , right > left asymmetric rcbf was detected in the superior frontal lobe only in the second spect ; the pathological implication is unknown . single - photon emission computed tomography imaging in patient 2 .
the right > left rcbf asymmetries are shown in the inferior frontal lobe and temporal lobe and thalamus , and slight rcbf decrease was detected in the bilateral parietal lobes before the remission ( a ) .
the asymmetric rcbf in the inferior frontal and temporal lobes and thalamus and the decreased rcbf in the bilateral parietal lobes were attenuated after the remission ( b ) .
the 2 cases are the first to be reported of oral cenesthopathy alleviated with aripiprazole concurrently with attenuation of rcbf asymmetry .
although the detail is different , the right > left rcbf asymmetries in the frontal and temporal lobes and thalamus disappeared after successful treatment in both cases .
the rcbf changes might reflect the symptom s improvement , because the prescriptions were almost the same between the first and second spect images in both cases . in the literature ,
some neuroimaging case reports on oral cenesthopathy or delusional disorder , somatic type , in the oral area have shown the attenuation of right - side - predominant rcbf asymmetry in parallel with the improvement of symptoms by paroxetine , mect , and the combination of mect and perospirone . in the present cases
. it would be useful for many types of oral cenesthopathy , because the right - side - predominant rcbf asymmetry is common between presence and absence of a history of depression , while these cases were not second symptoms of psychiatric disorders .
aripiprazole is a dopamine partial agonist that has high occupancy at d2 receptor and lower occupancy at 5-ht1a and 5-ht2 receptors .
drug occupancy levels at d2 , 5-ht1a , and 5-ht2 receptors were correlated with plasma drug concentrations .
because of this unique profile , it is suggested that dose - effect relationship for aripiprazole exists in the oral cenesthopathy treatment . in the present cases ,
low - dose aripiprazole improved the symptoms , suggesting that the complex dopaminergic and serotonergic system is involved in the pathology of oral cenesthopathy . in patient 2 ,
schle et al showed that the combination therapy with mirtazapine and aripiprazole accelerated the onset of their effects , and some case reports described that the combination therapy was safe and well tolerated and that mirtazapine reduced the aripiprazole - induced adverse effects and vice versa .
the present cases suggested that not only aripiprazole but also the combination of aripiprazole and mirtazapine could be treatment options for oral cenesthopathy . in conclusion
considering spect images and the effective drug profile , it is suggested that right > left rcbf asymmetry in the frontal and temporal lobes and thalamus and the dopaminergic and serotonergic dysfunctions are involved in the pathology of oral cenesthopathy . to further reveal the association between symptoms and brain perfusion asymmetry , a study with a larger number of cases that quantitatively evaluate symptoms by using the oral drs is warranted . | backgroundoral cenesthopathy is the complaint of abnormal oral sensation where no underlying organic cause can be identified .
it is also called oral dysesthesia or oral somatic delusion and classified as delusional disorder , somatic type .
the patients with oral cenesthopathy show right > left asymmetric regional cerebral blood flow ( rcbf ) in the broad brain region .
however , the studies scrutinizing the rcbf change before and after the successful treatment are still a few so far.casewe present 2 cases of oral cenesthopathy , who responded well to aripiprazole .
the asymmetric rcbf patterns were attenuated after successful treatment in both cases.conclusionswe found a marked improvement of oral cenesthopathy with aripiprazole . it is suggested that right > left rcbf asymmetry in the frontal and temporal lobes and thalamus , and the dopaminergic and serotonergic dysfunctions are involved in the pathology of oral cenesthopathy . |
phytochemical evaluation of the chloroform extract of roots of polygonum viscosum has yielded six compounds , stigmasterol , 7,4-dimethylquercetin , kaempferol , quercetin , myricetin and scutellarein . among the six compounds isolated and characterized by chemical and spectral ( uv , nmr and mass ) analysis in the present phytochemical evaluation , stigmasterol
was not reported earlier from p. viscosum .
the compounds , 7,4-dimethylquercetin , quercetin and scutellarein were reported from p. hydropiper .
kaempferol from p. amphibium , p. aviculare , p. convolvulus , p. hydropiper , p. lapathifolium and p. persicari a and myricetin from p. aviculare and p. lapathifolium were also reported earlier .
this appers to be the first report of the occurrence of all the six compounds from p. viscosum . | |
sjgren 's syndrome ( ss ) is a chronic inflammatory autoimmune disease characterized by progressive lymphocytic infiltration of the exocrine glands and other extra - glandular structures .
dryness of the eyes ( xerophthalmia leading to keratoconjunctivitis sicca ) and mouth ( xerostomia ) constitute the typical clinical condition of this syndrome .
although patients with ss have a lifespan not significantly different from that of the normal population , these patients carry a greater risk of developing lymphoproliferative malignancy .
in addition , other organ malignancies can also occur in patients with ss such as lung , breast , gastrointestinal , gynecological , renal , and skin cancers .
considering all these , the diagnosis of breast cancer in patients with ss can be mistaken as cancer at an advanced stage particularly in the presence of axillary multiple lymph nodes . in this study
, we report a very rare case of breast cancer associated with ss in which the cancer was overstaged and , thus , overtreated on the assumption of clinically positive axillary lymph node status .
a 45-year - old woman with a 12-year history of ss presented with a complaint of a breast mass .
a breast examination revealed a palpable mass , measuring 10 cm in diameter , located in the upper lateral quadrant of the right breast and right axillary multiple lymph nodes . on ultrasonography , the mass was a 4 cm solid lesion located in heterogeneous breast parenchyma , and conglomerates of multiple axillary lymphadenopathy suspicious of malignancy were also detected ( figure 1 ) .
the mammography was almost normal due to the dense parenchymal pattern , except for the presence of the axillary lymphadenopathy ( figure 2 ) .
a core - needle biopsy was performed on the breast lesion , and the diagnosis of ductal carcinoma in situ ( dcis ) was made preoperatively .
based on the clinical suspicion of an advanced - stage breast cancer , the patient underwent a modified radical mastectomy .
on postoperative histopathological assessment , the diagnosis of 8-cm high - grade dcis was established , however no axillary lymph node metastases were detected ( figure 3 ) .
ss is an autoimmune disease that causes chronic inflammation and primarily affects the exocrine glands .
because it is a systemic disease , ss can also exhibit a wide range of clinical manifestations . among these ,
benign or malignant lymphoproliferation due to infiltration by lymphocytes and plasma cells may be a prominent part of this syndrome .
several studies have shown a high incidence of malignancy in ss , the most common being lymphoma .
other non - lymphoid cancers including breast cancer can also occur in patients with this syndrome ; however , an increase in the incidence of these cancers has not been demonstrated .
lazarus et al . reported on a retrospective cohort study of 112 patients with ss in whom 25 developed malignancies , including three cases of breast cancer .
in a recent study reported by zhang et al . , malignancy was detected in 29 ( 2.2% ) of 1,320 patients with ss , including four patients with breast cancer .
the preoperative diagnosis of breast cancer in the presented patient with ss was established by radiological evaluation followed by breast biopsy .
lesion morphology , mammary gland density , and the lack of imaging technique skills may limit the sensitivity for detecting breast cancer . as such , mammography may not demonstrate up to 20 - 30% of malignancies in a dense breast pattern , as we encountered in the present case .
although the incidence of axillary metastases in patients with dcis is small , the evidence of axillary lymph node conglomerates on both physical and radiological examinations in this case led us to a clinical impression of a metastatic or " n2 " disease in the tnm staging definition , and that is why axillary dissection , in addition to a mastectomy , was performed .
we reviewed the literature and did not find any report regarding the management of such patients with ss presenting with breast cancer and an axillary clinicopathological discrepancy .
we recommend that lymph node status be verified either pre- or intra - operatively by lymph node biopsy using either fine - needle , core - needle , or frozen - section procedures before establishing a definitive diagnosis and appropriate surgical treatment . in conclusion
, clinicians should remain vigilant to the possibility of overstaged breast cancer due to the false clinical impression of axillary metastasis in patients with ss presenting with breast cancer .
therefore , axillary node status should be verified first to correctly establish tumor stage in this very rare clinical situation . | sjgren 's syndrome ( ss ) is an autoimmune disease that chronic inflammation and lymph node proliferation .
patients with ss carry a greater risk of developing lymphoproliferative malignancy .
in addition to other organ cancers , breast cancer may also occur in these patients .
considering these , breast cancer in patients with ss can be misdiagnosed as being in an advanced stage particularly in the presence of axillary lymphadenopathy . here , we report a rare case of a 45-year - old woman with ss who presented with a breast mass .
radiology showed a 4 cm solid lesion and conglomerates of axillary lymphadonepathy .
a breast biopsy revealed ductal carcinoma in situ .
a modified radical mastectomy was performed ; however , no axillary metastases were detected .
clinicians should remain vigilant to the possibility that a false clinical impression of axillary metastasis may occur in such patients with breast cancer .
therefore , axillary node status should be verified first . |
gestational diabetes mellitus ( gdm ) , defined as carbohydrate intolerance first recognized during pregnancy , affects up to 14% of pregnancies and appears to be increasing in frequency in concert with the rising prevalence of adult obesity ( 1 ) .
childhood obesity has also become a major public health problem as evidenced by a nearly fourfold increase over a 30-year period ending in 2000 ( 2 ) .
freinkel ( 3 ) first suggested that even the mildest forms of diabetes complicating pregnancy could have long - range effects on offspring by affecting behavioral , anthropometric , and metabolic functions .
emerging evidence suggests that the intrauterine environment of maternal diabetes can have significant influence on health in later life .
longitudinal studies of the offspring of women with diabetes during pregnancy demonstrate a link between maternal hyperglycemia and the development of obesity and altered carbohydrate metabolism during childhood and adolescence that is independent of both maternal obesity and birth weight ( 4,5 ) . in utero exposure to hyperglycemia as measured by amniotic fluid insulin levels has been found to be a strong predictor of insulin resistance during childhood ( 6 ) , and these effects of maternal diabetes on offspring appear to extend into adult life ( 7 ) .
thus , fetal programming in the setting of maternal diabetes affecting fetal islet function can lead to the development of subsequent obesity , diabetes , and insulin resistance , which may create an intergenerational cycle of diabetes ( 8) .
after decades of uncertainty , results from randomized treatment trials now confirm that treatment of mild gdm is associated with immediate benefits , including reductions in birth weight , macrosomia , and neonatal fat mass , among other outcomes ( 9,10 ) .
there is , however , insufficient evidence regarding whether treatment confers long - term metabolic benefit in offspring .
the results of an observational study and limited follow - up from one treatment trial remain inconsistent about whether treatment of gdm is a modifiable risk factor for childhood obesity ( 11,12 ) . because of concerns about potential long - term effects of maternal diabetes on the developing fetus
, we conducted a follow - up study of the offspring from a randomized treatment trial for mild gdm to determine whether treatment influences child health outcomes .
between february 2012 and september 2013 , we conducted an unplanned follow - up study of the offspring of women who participated in a eunice kennedy shriver national institute of child health and human development maternal - fetal medicine units ( mfmu ) network randomized clinical trial ( rct ) for mild gdm ( 10 ) .
mild gdm was defined as a fasting glucose < 95 mg / dl and two of three timed measurements that exceeded established thresholds ( 1 h , 180 mg / dl ; 2 h , 155 mg / dl ; 3 h , 140 mg / dl ) .
eligibility for the follow - up study included enrollment in the rct at a center still participating in the mfmu network at the time of the follow - up study ( 12 of 16 centers ; 94% of the original rct patients ) .
following mother informed consent and child assent , when appropriate , children ages 510 years of the index pregnancy were enrolled in the follow - up study . at the study visit ,
trained nursing personnel obtained height and weight measurements using a calibrated scale and stationary stadiometer .
in addition , waist circumference measurements were obtained at the position horizontal to the uppermost lateral border of the right ilium of the pelvis per the national health and nutrition examination survey anthropometry procedures manual ( 13 ) .
the study visit took place after an overnight fast , and blood samples were collected and sent to the northwest lipid metabolism and diabetes research laboratories for fasting glucose , insulin , hdl cholesterol , and triglyceride levels .
the mothers were administered a questionnaire concerning demographic information , breast - feeding history , child health , diet , and physical activity .
mothers were asked whether their child showed any signs of pubertal changes using drawings and descriptions of the five tanner stages ( 14 ) , and their responses were coded as no ( tanner = 1 ) or yes for any ( tanner > 1 ) without requiring the mothers to specify the stage .
the primary outcome of the study was defined as a bmi 95th percentile for child age and sex per 2000 centers for disease control and prevention growth charts ( 15 ) .
secondary outcomes were waist circumference 90th percentile for age , sex , and race / ethnicity ( 16 ) ; bmi 85th percentile for child age and sex ; diabetes defined as fasting glucose 126 mg / dl or impaired fasting glucose of 100125 mg / dl ( 17 ) ; elevated triglyceride levels 100 mg / dl in the children aged 59 years and 130 mg / dl in the children aged 10 years ( 18 ) ; low hdl cholesterol < 40 mg / dl ( 18 ) ; and hypertension 95th percentile for child age , sex , and height ( 19 ) .
these outcomes were also assessed as continuous outcomes , as was homa - estimated insulin resistance ( homa - ir ) calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
continuous variables were assessed to determine whether they were normally distributed and log - transformed when appropriate ; bmi percentile for child age and sex was converted to a z score .
estimation of the required sample size for the follow - up study was based on a two - sided type i error of 5% .
given the race / ethnicity distribution of the children eligible for this study and the reported prevalence of bmi 95th percentile ( 21 ) , we estimated that 20% of the treated offspring would be obese .
assuming a one - third reduction in obesity ( 30% untreated vs. 20% treated ) , a sample size of 600 was required for 80% power .
if the children of the mild gdm - treated group were one - half as likely to be obese ( e.g. , 20% in the untreated and 10% in the treated ) , a sample size of 550 would provide 90% power . because we previously reported sex differences in neonatal outcomes from the original trial ( 22 )
the and wilcoxon rank sum tests were used to assess differences between treatment groups and baseline characteristics and birth outcomes as well as to assess differences in baseline characteristics and birth outcomes between those eligible who did and did not participate in the follow - up study . when examining the primary and secondary binomial outcomes , we used multivariable log - binomial regression to estimate relative risks and 95% cis , adjusting for race / ethnicity and log maternal baseline bmi . for continuous outcomes , we used multivariable generalized least squares to estimate adjusted means and 95% cis .
tests for interaction between treatment group and age ( 56 years , 710 years ) and between treatment group and sex were determined a priori and assessed by including an interaction term in the multivariable model .
post hoc analyses also assessed the association between treatment group and child bmi by neonatal adiposity .
sas statistical software ( sas institute , cary , nc ) was used for the analyses .
all tests were two - tailed , and p < 0.05 was used to define statistical significance without adjustment for multiple comparisons .
a total of 666 of 905 eligible women ( 74% ) from the rct were successfully contacted , and 500 ( 55% ) consented to have their children enrolled in the follow - up study ; 390 children provided fasting blood samples for glucose , insulin , and lipid measurements . a comparison of maternal baseline characteristics between treated and untreated groups revealed no difference in 50-g glucose screening value , diagnostic oral glucose tolerance test results , bmi , or gestational age at entry into the trial ( table 1 ) .
treatment was associated with lower birth weight , fat mass > 90th percentile , frequency of large - for - gestational age ( lga ) , and birth weight > 4,000 g. however , these associations were observed only in male offspring ( table 2 ) .
the maternal baseline characteristics and birth outcomes were generally similar in eligible children who did and did not participate in the follow - up study , although some differences were observed ( supplementary tables 1 and 2 ) .
for example , a higher percentage of the children of non - hispanic white women participated in the follow - up study . among those who participated in the follow - up study , and
similar to the full trial cohort , the maternal glucose values during the intervention in the treated group indicated that target glycemic thresholds were achieved ( supplementary table 3 ) .
maternal baseline characteristics by mild gdm treatment group data are mean sd and n ( % ) .
ogtt , oral glucose tolerance test . based on the test for categorical variables and wilcoxon rank sum test for continuous variables .
birth outcomes by mild gdm treatment group , overall and by sex data are mean sd and n ( % ) .
based on the or fisher exact test for categorical variables and wilcoxon rank sum test for continuous variables . in the cohort of enrolled children
overall , no significant difference was found between treated and untreated groups in terms of sex ( 53.0% vs. 51.3% males , p = 0.69 ) , frequency of breast - feeding > 1 month ( 72.4% vs. 72.5% , p = 0.98 ) , tanner stage > 1 ( 20.5% vs. 26.3% , p = 0.12 ) , or age at follow - up ( 7.0 1.3 vs. 7.2 1.4 years , p = 0.40 ) .
additionally , no differences were noted among offspring of treated versus untreated women with respect to reported diet or physical activity levels ( data not shown ) .
overall , 21.8% of the children were obese , and 6.4% had impaired fasting glucose ; none had diabetes .
we found no difference in the primary outcome , as 20.8% vs. 22.9% ( p = 0.69 ) of offspring of treated compared with untreated mothers were found to have a bmi 95th percentile at follow - up ( table 3 ) .
additionally , no significant differences existed with respect to any secondary measures of obesity or metabolic dysfunction between the treatment groups ( tables 3 and 4 ) .
follow - up outcomes ( binomial ) by mild gdm treatment group , overall and by sex data are n ( % ) unless otherwise indicated .
all models adjusted for race / ethnicity and log maternal baseline bmi , except waist circumference > 90th percentile for age , sex , and race / ethnicity was adjusted only for log maternal baseline bmi .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
follow - up outcomes ( continuous ) by mild gdm treatment group , overall and by sex all models adjusted for race / ethnicity and log maternal baseline bmi ; log waist circumference also adjusted for child s sex ( overall model ) and child s age in months ; log triglycerides also adjusted for child s age in months ; and systolic and diastolic bps also adjusted for child s sex ( overall model ) , child s age in months , and child s height .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
significant interaction was observed between treatment group and sex for fasting glucose and log homa - ir ( p for interaction 0.007 for impaired fasting glucose , 0.002 for fasting glucose , and 0.02 for log homa - ir ) .
no treatment group - by - sex interaction was observed for measures of obesity ( tables 3 and 4 ) .
female offspring of treated women had a decreased frequency of impaired fasting glucose , lower fasting glucose , lower log homa - ir , but higher diastolic blood pressure than female offspring of untreated women .
however , lipid levels were similar between treatment groups ( tables 3 and 4 ) .
in male offspring , mean fasting glucose and log homa - ir were not significantly affected by treatment .
1 shows the relationship between treatment group and childhood bmi z score stratified by neonatal adiposity . in the high neonatal adiposity stratum , treatment was associated with a significantly lower childhood bmi z score in female offspring ( supplementary fig .
a total of 666 of 905 eligible women ( 74% ) from the rct were successfully contacted , and 500 ( 55% ) consented to have their children enrolled in the follow - up study ; 390 children provided fasting blood samples for glucose , insulin , and lipid measurements . a comparison of maternal baseline characteristics between treated and untreated groups revealed no difference in 50-g glucose screening value , diagnostic oral glucose tolerance test results , bmi , or gestational age at entry into the trial ( table 1 ) .
treatment was associated with lower birth weight , fat mass > 90th percentile , frequency of large - for - gestational age ( lga ) , and birth weight > 4,000 g. however , these associations were observed only in male offspring ( table 2 ) .
the maternal baseline characteristics and birth outcomes were generally similar in eligible children who did and did not participate in the follow - up study , although some differences were observed ( supplementary tables 1 and 2 ) .
for example , a higher percentage of the children of non - hispanic white women participated in the follow - up study . among those who participated in the follow - up study , and
similar to the full trial cohort , the maternal glucose values during the intervention in the treated group indicated that target glycemic thresholds were achieved ( supplementary table 3 ) .
maternal baseline characteristics by mild gdm treatment group data are mean sd and n ( % ) .
ogtt , oral glucose tolerance test . based on the test for categorical variables and wilcoxon rank sum test for continuous variables .
birth outcomes by mild gdm treatment group , overall and by sex data are mean sd and n ( % ) .
based on the or fisher exact test for categorical variables and wilcoxon rank sum test for continuous variables .
in the cohort of enrolled children overall , no significant difference was found between treated and untreated groups in terms of sex ( 53.0% vs. 51.3% males , p = 0.69 ) , frequency of breast - feeding > 1 month ( 72.4% vs. 72.5% , p = 0.98 ) , tanner stage > 1 ( 20.5% vs. 26.3% , p = 0.12 ) , or age at follow - up ( 7.0 1.3 vs. 7.2 1.4 years , p = 0.40 ) .
additionally , no differences were noted among offspring of treated versus untreated women with respect to reported diet or physical activity levels ( data not shown ) .
overall , 21.8% of the children were obese , and 6.4% had impaired fasting glucose ; none had diabetes .
we found no difference in the primary outcome , as 20.8% vs. 22.9% ( p = 0.69 ) of offspring of treated compared with untreated mothers were found to have a bmi 95th percentile at follow - up ( table 3 ) . additionally , no significant differences existed with respect to any secondary measures of obesity or metabolic dysfunction between the treatment groups ( tables 3 and 4 ) .
follow - up outcomes ( binomial ) by mild gdm treatment group , overall and by sex data are n ( % ) unless otherwise indicated .
all models adjusted for race / ethnicity and log maternal baseline bmi , except waist circumference > 90th percentile for age , sex , and race / ethnicity was adjusted only for log maternal baseline bmi .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
follow - up outcomes ( continuous ) by mild gdm treatment group , overall and by sex all models adjusted for race / ethnicity and log maternal baseline bmi ; log waist circumference also adjusted for child s sex ( overall model ) and child s age in months ; log triglycerides also adjusted for child s age in months ; and systolic and diastolic bps also adjusted for child s sex ( overall model ) , child s age in months , and child s height .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
significant interaction was observed between treatment group and sex for fasting glucose and log homa - ir ( p for interaction 0.007 for impaired fasting glucose , 0.002 for fasting glucose , and 0.02 for log homa - ir ) .
no treatment group - by - sex interaction was observed for measures of obesity ( tables 3 and 4 ) .
female offspring of treated women had a decreased frequency of impaired fasting glucose , lower fasting glucose , lower log homa - ir , but higher diastolic blood pressure than female offspring of untreated women .
however , lipid levels were similar between treatment groups ( tables 3 and 4 ) .
in male offspring , mean fasting glucose and log homa - ir were not significantly affected by treatment .
1 shows the relationship between treatment group and childhood bmi z score stratified by neonatal adiposity . in the high neonatal adiposity stratum
, treatment was associated with a significantly lower childhood bmi z score in female offspring ( supplementary fig .
in this follow - up study of the offspring of women participating in an rct for the treatment of mild gdm , we observed no difference in the overall frequency of obesity or metabolic dysfunction at ages 510 years according to whether treatment was undertaken .
we did , however , observe sex - specific differences according to treatment with respect to childhood blood glucose levels .
mild gdm treatment was associated with a decreased frequency of impaired fasting glucose , lower fasting glucose , and lower log homa - ir in female offspring at ages 510 years but not in male offspring .
this follow - up study represents the largest of its kind in offspring from a randomized treatment trial for mild gdm .
the follow - up rate of 55% in those eligible from the original rct was accomplished despite this being an unplanned study at the time we conducted the rct .
however , enrollment of 500 children fell short of our goal of 600 needed to observe at least a one - third reduction in childhood obesity with treatment with 80% power , which means that we were underpowered to observe a more modest treatment effect .
although the study also included assessment of several metabolic outcomes in addition to measures of childhood obesity , a limitation of this study was the use of bmi as the primary measure of obesity . furthermore , although we collected anthropometric data , more - precise measures of body composition , such as dexa or air densitometry , may have more accurately assessed relative obesity
. we also limited glucose measurements to the fasting state such that the full spectrum of carbohydrate intolerance in the offspring could not be assessed .
thus , a greater number of children with carbohydrate intolerance might have been identified if a glucose tolerance test had been performed .
a large prospective analysis of mother - infant pairs enrolled in the national collaborative perinatal project revealed that infants of gdm mothers were more likely to have a higher bmi z score at 7 years of age ( 23 ) .
in contrast , a retrospective cohort study of 2,093 women - and - toddler pairs demonstrated that the risk for childhood obesity was not associated with gdm but was associated with higher maternal prepregnancy bmi and lga birth weight status ( 24 ) .
these authors suggested that because their gdm population was well controlled , gdm management could be a modifiable risk factor for childhood obesity .
whether treatment of gdm is a determinant of offspring outcomes can only be assessed from follow - up studies of treatment trials .
both the mfmu network gdm and the australian carbohydrate intolerance study in pregnant women ( achois ) trials demonstrated a reduction in birth weight and macrosomia with treatment of mild gdm ( 9,10 ) .
preventive services task force to acknowledge for the first time that treatment of gdm is beneficial ( 25 ) . to date
, however , there has been a paucity of information regarding whether treatment of gdm conveys long - term benefits to offspring ( 12,26 ) .
gillman et al . ( 12 ) reported follow - up data on 199 ( or 20% ) 45-year - olds who participated in the achois trial . unlike the present study in which specific study follow - up visits occurred ,
the achois follow - up was limited to preschool height - and - weight measurements obtained through data linkage analysis .
these investigators found no difference in the bmi z score or frequency of bmi > 85th percentile in the intervention group compared with the control group ( 12 ) . a smaller and underpowered follow - up study of 89 children aged 9 years from an unblinded rct for the treatment of gdm revealed an overall greater - than - expected rate of impaired glucose tolerance with no difference in treated versus control subjects ( 26 ) .
there were fewer children with bmi > 85th percentile in the group treated for gdm ; however , this difference was not significant . notwithstanding the concern that some researchers have raised regarding the inconsistent evidence of an association of gdm and childhood obesity due to failure to consider important factors such as maternal and paternal obesity , there may be several explanations for the results of the present study ( 27 ) . of note ,
the present study included women with mild gdm ( fasting glucose < 95 mg / dl ) of whom only 7% required insulin therapy .
inclusion of women with more - pronounced hyperglycemia during pregnancy might have demonstrated a long - term treatment effect on obesity in their offspring .
alternatively , although treated women met conventional glucose targets for control , these maternal glucose levels may actually exceed those required to affect later outcomes , such as childhood obesity .
the appropriate offspring follow - up period for assessing the effects of maternal diabetes is debatable .
an analysis of the hypoglycemia and adverse pregnancy outcomes study in offspring 2 years of age found no relationship between maternal glucose levels and child obesity ( 28 ) .
we followed children ages 510 years , yet the emergence of both obesity and metabolic dysfunction in the offspring of diabetic women may not occur until adolescence or early adulthood ( 6,29 ) .
overweight infants of diabetic mothers may have normalization of their weight in the first few years of life and then develop obesity later in childhood .
crume et al . ( 29 ) reported that the effects of maternal diabetes on offspring bmi may not be apparent until age 9 or until puberty . because most of the children in the present study were prepubertal ( average age 7 years )
, we acknowledge that the development of obesity and any potential treatment benefit may not yet be apparent in this cohort .
a follow - up study of indian children born to gdm mothers also revealed that differences in adiposity compared with control subjects diminished during infancy and then increased through childhood ( 30 ) .
social and environmental factors could also be significant confounders affecting the results of a childhood follow - up study for which obesity is an outcome .
breast - feeding , for example , may be associated with a reduction in childhood obesity in offspring of diabetic women ( 29 ) .
we collected data on physical activity and nutrition , including breast - feeding practices , and did not observe significant differences between groups .
because metabolic differences exist between male and female neonates , differing sensitivities to hyperglycemia in utero may also result in long - term sex - specific programming ( 31 ) .
we previously reported that male offspring of treated women from this rct had lower birth weight and neonatal fat mass , which was not apparent in female offspring ( 22 ) . in agreement with these findings ,
lingwood et al . ( 31 ) also reported that males appear more immediately sensitive to maternal glycemia as it relates to the development of neonatal adiposity .
in contrast , female offspring may be more likely to exhibit the effects of in utero exposure to maternal diabetes later in childhood . at 5 years of age ,
female offspring of diabetic mothers exhibited increased skinfold thicknesses and higher insulin concentrations and were more likely to develop impaired glucose tolerance than control subjects ( 30 ) .
the present follow - up metabolic data further support the concept of sex - specific programming because we found higher glucose levels and a trend toward increased insulin resistance in untreated female offspring .
females have been shown to have similar cord glucose to males yet increased insulin levels at birth . together with lower birth weight and increased neonatal adiposity compared with males , in females , this might suggest increased insulin resistance ( 32 ) . in female offspring , the present results indicate that the development of such insulin resistance might be modifiable with treatment of mild gdm .
we found no evidence of such an effect in males . because neonatal adiposity has been determined to be predictive of subsequent childhood obesity , we stratified subjects according to neonatal fat mass percentile in our analysis and found a relationship with subsequent bmi . in female offspring exhibiting the highest neonatal fat mass , treatment of mild gdm was associated with a lower childhood bmi z score .
infants with the greatest degree of fat accumulation in utero in the untreated arm might represent those most susceptible to the effects of maternal hyperglycemia , which might be particularly true in the setting of mild maternal hyperglycemia found in subjects participating in the present rct .
the long - term offspring effects of maternal diabetes may be partly mediated by neonatal body composition . whereas the development of childhood obesity has been reported to be increased across the spectrum of birth weight in offspring of gdm women , boney et al .
( 33 ) reported that only lga offspring of diabetic mothers are at significant risk for the development of childhood metabolic syndrome .
in conclusion , although this study did not demonstrate an overall effect on childhood obesity with treatment of mild gdm , our observations with respect to the metabolic differences according to sex among the offspring remain intriguing .
the association between neonatal adiposity and childhood obesity in this study is also apparent , and a potential treatment effect was suggested in female offspring with the highest neonatal fat mass .
thus , the possibility that fetal programming of metabolic function in gdm can have an intergenerational effect that may in turn be modified by treatment remains open to question .
larger follow - up studies of pregnancy randomized trials are necessary to provide evidence that the vicious cycle of intergenerational diabetes and obesity can in fact be interrupted . | objectiveto evaluate whether treatment of mild gestational diabetes mellitus ( gdm ) confers sustained offspring health benefits , including a lower frequency of obesity.research design and methodsfollow - up study of children ( ages 510 ) of women enrolled in a multicenter trial of treatment versus no treatment of mild gdm .
height , weight , blood pressure , waist circumference , fasting glucose , fasting insulin , triglycerides , and hdl cholesterol were measured.resultsfive hundred of 905 eligible offspring ( 55% ) were enrolled .
maternal baseline characteristics were similar between the follow - up treated and untreated groups .
the frequencies of bmi 95th ( 20.8% and 22.9% ) and 85th ( 32.6% and 38.6% ) percentiles were not significantly different in treated versus untreated offspring ( p = 0.69 and p = 0.26 ) .
no associations were observed for bmi z score , log waist circumference , log triglycerides , hdl cholesterol , blood pressure , or log homa - estimated insulin resistance ( homa - ir ) .
the effect of treatment was different by sex for fasting glucose and log homa - ir ( p for interaction = 0.002 and 0.02 , respectively ) but not by age - group ( 56 and 710 years ) for any outcomes .
female offspring of treated women had significantly lower fasting glucose levels.conclusionsalthough treatment for mild gdm has been associated with neonatal benefits , no reduction in childhood obesity or metabolic dysfunction in the offspring of treated women was found . however , only female offspring of women treated for mild gdm had lower fasting glucose . |
herpesviruses are frequently found in humans , although their prevalence significantly varies depending on ethnicity , sex , and geographical location of individuals , among others [ 15 ] . currently , eight herpesviridae family members are known to infect humans : herpes simplex viruses ( hsv ) -1 and -2 ( hsv-1 , hhv-1 and hsv-2 , hhv-2 , resp . ) , varicella zoster virus ( vzv , hhv-3 ) , epstein barr ( ebv , hhv-4 ) , cytomegalovirus ( cmv , hhv-5 ) , human herpesvirus 6 ( hhv-6 ) , human herpesvirus 7 ( hhv-7 ) , and kaposi sarcoma - associated virus ( ksv or hhv-8 ) . all herpesviruses harbor large genomes encoding > 70 genes and share the capacity to establish lifelong persistent infections in the host ( and ncbi ) .
human infection with herpes simplex viruses ( hsvs ) traces far back , even before the intercontinental migration of our ancestors , as proposed by recent phylogenetic analyses .
symptomatic manifestations of hsvs have been described as early as 400 bc and these viruses are often considered the oldest viruses to be studied in the history of science . while hsv-1 is estimated to infect up to one - third of the world population , hsv-2 infects nearly 500 million people around the globe with more than 20 million new cases occurring every year .
importantly , hsv-1 is the foremost important cause of infectious blindness in developed countries and has gained importance in primary genital infection , surpassing in many cases hsv-2 [ 922 ] .
nevertheless , because hsv-2 recurs significantly more often than hsv-1 in the genitalia , hsv-2 remains overall the most frequent cause of genital ulcers worldwide [ 2326 ] .
it is important to bear in mind that hsv-1 and hsv-2 also produce several other pathological conditions , such as encephalitis , conjunctivitis , zosteriform skin lesions , pneumonia , and systemic infections that compromise vital organs .
an important concern regarding genital infection with hsv is its association with increased hiv infection .
indeed , genital infection with hsv has been suggested to increase up to 3 - 4 times the susceptibility of acquiring hiv [ 2729 ] , which has been proposed to be mediated , at least in part by soluble mediators at the infection site [ 30 , 31 ] .
furthermore , individuals coinfected with hsv and hiv shed significantly more these viruses than individuals with single viral infections [ 3234 ] .
important efforts have been invested in the past 20 years on the development of a vaccine against hsvs .
however , potential vaccine formulations that have reached the clinic have proven ineffective at preventing infection or reducing virus shedding [ 35 , 36 ] . discouraging results derived from the latest hsv-2 vaccine clinical trial , which used a viral subunit formulation ,
have led to new debates in the field and rethinking on the role of neutralizing antibodies in protecting against hsv-2 , as well as the need for correlates of protection [ 3739 ] .
indeed , somewhat unexpected results were obtained with a subunit vaccine consisting of hsv-2 glycoprotein d ( gd ) plus an adjuvant , which was found to be more efficacious against hsv-1 than against hsv-2-induced genital disease [ 40 , 41 ] . again
, these data are leading to new paradigm shifts in the field that hopefully will translate into novel vaccine approaches that could eventually reach the clinic .
the lack of an effective vaccine against hsvs has flourished onto the development of novel microbicides against these viruses .
hsv establishes a lifelong infection in the host by infecting neurons and persisting latently inside these cells [ 42 , 43 ] .
because sensorial nervous termini innervate the skin and mucosae , infections at these sites with hsvs can lead to neuron infection with a significantly high frequency [ 44 , 45 ] .
indeed , hsvs can readily gain access to neurons somewhat early after infecting epithelial cells , because these cells interact closely .
nevertheless , to restrict virus access to neurons and other tissues , the host has evolved an arsenal of antimicrobial determinants that aim at blocking infection , progression of infection , and microbe replication . however , as masters of immune evasion , hsvs encode molecular determinants that promote their stealth and overcome host defenses by overriding several of the antiviral elements of the host .
herpes simplex viruses are enveloped viruses with numerous proteins and glycoproteins embedded on their exterior ; whether 11 of the viral glycoproteins encoded by the viral genome are present on the virion surface remains to be thoroughly defined [ 46 , 47 ] .
nevertheless , at least five viral glycoproteins have been implicated in viral entry : glycoprotein b ( gb ) , gc , gd , gh , and gl [ 48 , 49 ] .
gb acts both as a viral attachment protein and fusion protein by binding to heparan sulfates ( hs ) on the surface of susceptible host cells and also is known to bind to paired immunoglobulin - like type 2 receptor ( pilr ) alpha [ 51 , 52 ] .
a similar function has been described for gc in virus attachment , although only for hsv-1 .
after gb - mediated attachment , gd binds to either of its receptors : nectin-1 ( pvrl1 ; poliovirus receptor - related 1 ) expressed on the surface of most host cells or alternatively hvem ( herpesvirus entry mediator , tnfrsf14 ) , mainly expressed on immune cells [ 54 , 55 ] . furthermore , 3-o - sulfate hs has also been suggested as a potential receptor for gd , although its physiological relevance requires additional research .
binding of gd to its receptors is thought to induce conformational changes leading to the functional activation of a complex formed by gh / gl .
activated gh / gl complex would in turn then promote changes in gb that activate the fusogenic properties of this protein and mediate the fusion of viral and host cell membranes [ 58 , 59 ] . as an alternative pathway
, hsvs can enter cells through endocytic vesicles [ 60 , 61 ] . in both cases , fusion of membranes promotes the entry of the capsid and accompanying viral proteins ( tegument ) into the cytoplasm .
the tegument is a complex mesh of > 20 proteins beneath the envelope that wraps the viral capsid and contains molecular determinants that mediate , among others , the inhibition of cellular translation and apoptosis [ 62 , 63 ] .
once released into the cytoplasm , the capsid associates with microtubules through two tegument proteins vp1 - 2 ( encoded by ul36 ) and ul37 and then travels to the outer nuclear membrane to bind to the host nuclear pore complex ( npc ) to release the viral dna into the nucleus [ 62 , 63 ] .
nucleoporin nup358 has been associated with this process by docking vp1 - 2 onto the nuclear pore complex and facilitating the release of viral dna into the nucleus through this macromolecular complex .
once released into the nucleus , the viral dna is transcribed by means of the host rna - polymerase ii activity [ 65 , 66 ] .
however , not all hsv genes are expressed synchronously but instead in four consecutive rounds of transcription .
first , immediate early genes ( alpha ) are transcribed , many of which encode for proteins contributing to immune evasion and work as factors controlling cell translation .
then , follows the transcription of early genes ( beta ) that are required for dna replication .
finally , early late and late genes ( gamma-1 and gamma-2 ) are transcribed , which mainly encode for structural components of virions , such as capsid , tegument , and surface proteins [ 69 , 70 ] .
these proteins can work as well as important immune evasion determinants ( see below ) . to generate new virions ,
capsid proteins migrate from the cytoplasm into the nucleus to assemble with viral dna and acquire at this location a layer of tegument proteins .
unlike other viruses , hsvs do not alter nuclear pores on exit but rather undergo envelopment in the inner nuclear membrane to form an enveloped capsid .
the capsid then travels through the perinuclear space and immediately fuses with the outer nuclear membrane thanks to glycoproteins gb and gh , exposing a tegument - recovered capsid into the cytoplasm .
once in the cytoplasm , the capsid is further coated with additional tegument proteins and is once again enveloped in the trans - golgi network . from here
, virions are exported in vesicles to the cell surface and secreted . although host tetherin ( bst-2 or cd317 ) has been shown to block the release of certain enveloped viruses from the cell surface , the hsv protein vhs ( virion host shutoff protein , ul41 ) can counteract the antiviral function of this protein by depleting it .
noteworthy , hsvs can also propagate directly onto adjacent cells through cell - cell interactions . in these circumstances ,
this type of infection is used by hsvs to infect t cells , which has been shown to occur through infected fibroblasts in vitro [ 75 , 76 ] .
this type of infection is mediated through a process called virological synapse and provides the virus a safe haven from neutralization by antibodies or complement ( see below ) [ 77 , 78 ] .
immune and nonimmune host cells express an array of surface and intracellular receptors intended to sense microbial elements and initiating local and systemic antimicrobial responses .
such receptors , termed pathogen recognition receptors ( prrs ) , recognize pathogen associated molecular patterns ( pamps ) , which consist among others of microbe - derived molecules , such as lipids , proteins and nucleic acids . an important family of prrs is toll - like receptors ( tlrs ) , which upon binding with microbe elements lead to intracellular signaling cascades that promote early antiviral cellular responses and the secretion of soluble mediators that activate infected and noninfected neighboring cells , as well as the immune system [ 8084 ] . it has been shown that hsvs induce the activation of tlr2 in primary vaginal epithelial cells and also immune cells , such as dendritic cells ( dcs ) .
interestingly , it has been suggested that in keratinocytes , neural cells , and epithelial cells tlr2-mediated effects after virus infection require the cooperation of 3-integrin , likely due to the binding of the hsv gh / gl complex to this integrin , leading to nf-b activation , interferon production , and il-10 secretion ( figure 1 ) [ 85 , 86 ] . in dcs
, the activation of tlr2 induces a cell response that leads to the downstream activation of nf-b and the transcription of immunomodulatory cytokines , such as il-6 , il-8 , il-10 , il-12 , and tnf- . another study with dcs also showed that hsv recognition by tlr2 promoted il-6 and il-12 secretion and proposed that this cytokine outcome was mediated , at least in part , by tlr9 modulation , suggesting a previously uncharacterized mechanism for sequential recognition of viruses via tlr2 through tlr9 .
consistent with this notion , tlr2 knockout mice secrete low levels of mcp-1 , a chemokine generally induced after tlr9 engagement .
importantly , tlr2 knockout mice display prolonged survival after hsv infection , as compared to wild - type and tlr4 knockout mice . despite reduced mortality ,
viral loads remained similar in tlr2-knockout and wild - type animals . on the other hand , microglia from tlr2 mice display delayed and attenuated production of reactive oxygen species ( ros ) following viral infection and
suffer lesser neuronal oxidative damage in mixed neural cell cultures , as compared to hsv - infected cells from wild - type animals .
tlr3 has also been described to play a role in hsv infection , especially for neurons and during viral brain infection .
for instance , it has been shown that tlr3 deficiencies ( tlr3 ) render astrocytes permissive to hsv infection , facilitating the establishment of cns infection in animals .
consistently , it was shown that tlr3 expressed in astrocytes provided early control of hsv infection after viral entry into the central nervous system and induced type - i ifn responses in these cells .
other studies have shown that astrocyte infection with hsv leads to tlr3 engagement and nf-b activation , upregulating the expression of tnf- and il-6 with antiviral functions attributed to these two molecules ( figure 1 ) .
on the other hand , studies performed in humans carrying mutations that negatively modulate tlr3-mediated immunity have shown that these individuals are more prone to hsv encephalitis [ 9496 ] .
consistent with these findings , a study with ex vivo differentiated neurons , astrocytes and oligodendrocytes derived from pluripotent stem cells from individuals with tlr3 deficiencies were shown to be more susceptible to hsv infection in vitro than control cells and displayed compromised interferon secretion .
interestingly , these effects depended significantly on the cell types analyzed . on the other hand , mice pretreated either intravaginally or intraperitoneally with agonists for tlr3 , such as polyi : c , suffer significantly less virus burden upon intravaginal viral challenge than nontreated animals , suggesting that activating this pathway would play favorable roles against hsv infection ( figure 1 ) . as with tlr3 , pretreating animals with tlr7 agonists , such as imiquimod , has also been shown to significantly reduce hsv burden in the genital tract after viral infection ( figure 1 ) .
because of these results , imiquimod has been tested in humans , particularly against hsv strains that are resistant to acyclovir in immunocompromised patients , with favorable results [ 100102 ] .
however , it is important to note that another study found that imiquimod produced ifn - independent anti - hsv effects in nonimmune cells , which was independent of tlr signaling and ifn production , suggesting that tlr7 is likely not the only activation pathway involved in the favorable results observed against hsv in other studies .
tlr9 has also been shown to play roles in hsv infection , although similar to tlr3 and tlr7 , because tlr9 agonists can positively influence the antiviral response against this pathogen .
indeed , mice pretreated intranasally with tlr9 agonists , such as cpg - oligodeoxynucleotides ( cpg - odns ) , show reduced secretion of inflammatory cytokines , such as ccl2 , il-6 , and ccl5 , and reduced viral loads in the brain , resulting in mild encephalitis and increased survival rates , as compared to nontreated mice ( figure 1 ) . additionally , treatment with cpg - odn containing unmethylated cpg provides protection against lethal vaginal challenge with hsv that was probably mediated by an intricate crosstalk between plasmacytoid dcs ( pdcs ) and vaginal stromal cells , as well as type - i ifns [ 104106 ] .
similar to the findings described with tlr3 and tlr7 , these results suggest that modulating tlr9 signaling could be a promising strategy for limiting hsv infection in the host , although results from another group suggest that the antiviral effects mediated by tlr9 antagonists might not necessarily be mediated uniquely by intracellular events linked to tlr9 signaling .
nevertheless , the results obtained with tlr9 agonists suggest that activating this tlr might be a useful strategy for controlling pathological responses induced by hsvs .
when combined with antivirals , such as acyclovir or anti - inflammatory molecules , this strategy could improve current therapies against these viruses [ 103 , 109 ] .
importantly , hsvs also induce the activation of non - tlr sensors in target cells .
namely , primary vaginal epithelial cells display increased activation of dna sensors , such as dai ( dna - dependent activator of interferon ) and ifi16 ( interferon - inducible 16 ) , which trigger the secretion of il-6 ( figure 1 ) . another non - tlr host sensor includes v3-integrin , mentioned above with tlr2 , which was also recently described to function as a major sensor of hsvs per se and activator of innate immunity by relocating the viruses ' nectin-1 receptor to cholesterol - rich microdomains , thus , enabling virus uptake into dynamin 2-dependent acidic endosomes .
v3-integrin interacts with hsvs gh / gl complexes and is thought to signal at least through two pathways , one mediated by tlr2 with the activation of nf-b and consequently induction of type - i interferons and another involving sarcoma- ( src- ) spleen tyrosine kinase- ( syk- ) caspase recruitment domain - containing protein 9- ( card9- ) trif ( tir - domain - containing adapter - inducing interferon- ) , which affects interferon regulatory factor 3 ( irf3 ) and irf7 ( figure 1 ) [ 85 , 86 ] .
importantly , the hsv viral protein icp0 can counteract these v3-integrin signaling pathways to impair sensing of hsvs by infected cells .
a recent study suggests that tlr signaling via myd88 and trif is expendable for controlling hsv infection and spread .
indeed , myd88 , trif , and myd88-trif double knockout mice displayed similar levels of hsv replication , when compared to wild - type mice , although this particular study was focused on hsv corneal infection .
importantly , the dna sensor ifi-16/p204 was identified here to be key for the activation of irf3 and ifn- production for viral containment .
consistently , silencing the genes that encode for ifi16/p204 inhibits the activation of irf3 and nf-b in response to hsv dna .
furthermore , a recent study showed that ifi16 depletion was associated with increased hsv yield , while its overexpression reduced the amount of virus obtained in cell cultures .
chip assays found that ifi16 binds to hsv promoters and that cells devoid of this protein display increased amounts of host proteins that promote viral gene transcription at these locations .
these findings suggest that ifi16 possesses antiviral functions and negatively modulates hsv transcription after binding to viral dna .
another intracellular , non - tlr receptor involved in the detection of hsv determinants is cyclic guanosine monophosphate - adenosine monophosphate ( cgamp ) synthase ( cgas ) , a novel cytosolic dna sensor ( figure 1 ) .
this protein has been shown to detect hsv dna leading to type - i ifn ( ifn - i ) production in fibroblasts , macrophages , and dendritic cells and mice deficient for cgas succumb to death after infection with this virus .
intracellular nucleic acid sensors rig - i and mda5 ( retinoic acid - inducible gene 1 and melanoma differentiation - associated protein 5 ) also play antiviral roles in infected cells , yet vhs can selectively inhibit the expression of these molecules and prevent downstream irf3 dimerization , as well as the translocation of this complex into the nucleus ( figure 1 ) . by doing so , vhs can block signaling mediated through non - tlr pathways .
another mechanism by which host cells can sense and initiate antiviral responses is through the activation of the inflammasome .
the inflammasome is a multiprotein complex involved in translating pathogen recognition events into the secretion of inflammatory molecules , such as il-1. relevant inflammasome sensors include nlrp3 and aim2 in the cytoplasm of cells and the nuclear sensor ifi16 , discussed above .
recent studies have shown that hsv can induce early activation of the inflammasome and then , later on , inhibit its function during active infection .
indeed , fibroblasts infected with hsv display activated ifi16 and nlrp3 and secrete il-1 early after infection , although later on ifi16 is targeted to the proteasome by icp0 , likely releasing the break that ifi16 imposes on the transcription of hsv genes [ 114 , 117 ] .
subsequently , nlrp3 and aim2 remain unaltered in cells with an inhibited inflammasome and little secretion of mature il-1 .
sensing of microbial components by immune and nonimmune cells can lead to cell apoptosis , as a host strategy to block virus replication and spread within cells .
importantly , hsvs encode viral determinants that block or delay the onset of apoptosis in infected cells , likely as a mechanism to extend the viability of its substrate for replication .
this process has been proposed to be mediated by viral glycoproteins such as gj and gd , as virus mutants lacking each one of these proteins initiated apoptotic cascades in epithelial cells ( figure 2(a ) ) .
furthermore , the viral proteins icp10pk and ul14 have also been shown to prevent apoptotic processes triggered in neurons and epithelial cells after viral infection ( figure 2(a ) ) [ 119121 ] .
finally , us3 an hsv protein kinase conserved throughout alphaherpesviruses has also been shown to play a key role in blocking apoptosis induced by viral gene products and exogenous agents in epithelial cells .
the antiapoptotic effects of us3 would be mediated through its interaction with programmed cell death protein 4 ( pdcd4 ) , which is retained in the nucleus of infected cells ( figure 2(a ) ) .
nevertheless , other hsv proteins have been proposed to induce apoptosis and necrosis in host cells .
for instance , hsv has been shown to induce necrosis in mouse fibroblast cells ( l929 cells ) mediated by the interaction between the viral ribonucleotide reductase large subunit icp6 and rip3 ( receptor - interacting kinase 3 ) through rhim domains , which activate mlkl ( mixed lineage kinase domain - like protein ) .
consistently , an hsv icp6 deletion mutant failed to cause effective necrosis of hsv - infected cells and mice lacking rip3 exhibited severely impaired control of hsv replication and pathogenesis , highlighting the importance of the latter in limiting virus pathology .
noteworthily , another study showed that early after hsv infection , natural killer cells ( nk cells ) suffer apoptosis through fas / fasl when these cells interact with hsv - infected macrophages ( figure 2(b ) ) .
similarly , hsv infection of dendritic cells induces apoptosis early after virus entry , particularly after the release of immunomodulatory cytokines [ 125 , 126 ] , and the viral protein 34.5 can interfere with dc autophagosome maturation , which is thought to play antiviral functions in these cells by degrading virus determinants ( figure 2(b ) ) [ 127 , 128 ] .
a similar role for autophagy has been proposed in the context of hsv infection in neurons as an alternative to ifn responses , which would likely result in the death of these cells or detrimental outcomes for the host .
indeed , neurons from dorsal root ganglia require autophagy to limit hsv replication in vivo and in vitro .
antiviral functions in host cells are also mediated by protein kinase r ( pkr ) , which phosphorylates the translation initiation factor eif2a as a mechanism to inhibit the translation of rna messengers upon viral infections .
importantly , this host protein has been shown to play a key role in controlling hsv replication in vitro and in vivo [ 129 , 130 ] .
for instance , viral 34.5 and us11 have been proposed to inhibit the activity of pkr to promote the translation of viral proteins ( figure 3 ) [ 131 , 132 ] .
furthermore , hsvs have evolved determinants that preferentially block the translation of host molecules over viral genes , in such a way to impair their antiviral activity .
indeed , hsvs vhs protein can mediate the degradation of host messenger rna through their ribonuclease activity ( figure 3 ) .
the spatial - temporal delivery of vhs has evolved in such a way to display optimal activity early after infection for hampering host mrna transcription and not to alter viral mrnas transcribed later on .
early sensing of viral determinants by host prrs will generally lead to the activation of interferon pathways that aim at impairing virus replication and its shedding within the host .
although cells in the genital tract infected with hsv-2 produce interferons in response to this virus , the magnitude of this response is generally hampered in the infected tissue , suggesting that these molecules likely play favorable antiviral roles .
indeed , biopsies obtained from individuals infected with hsv show extremely low levels of type - i ifns ( ifn- and ifn- ) , despite the presence of a large number of cells capable of synthesizing these mediators , which suggests alterations in the host interferon response during hsv infection . consistent with this notion , type - i ifn receptor ( ifnar ) knockout mice inoculated in the footpads with hsv manifest systemic viral infections that affect the lungs , liver , and spleens , although disease is nonlethal . interference with host interferon pathways would be mediated , at least in part by the early viral protein icp0 , which can impair irf3 function and block the transcription of genes regulated by this transcription factor .
additionally , hsv icp27 also inhibits type - i ifn signaling and interferes with nuclear accumulation of stat-1 ( figure 3 ) .
furthermore , the hsv ser / thr kinase us3 can hamper ifn- production by hyperphosphorylating irf3 and by blocking the dimerization and nuclear translocation of this factor ( figure 3 ) .
similarly , the tegument protein vp16 can also abrogate ifn- expression by inhibiting nf-b and irf3 activation by impairing the recruitment of the coactivator cbp , without interfering with irf3 dimerization , nuclear translocation , or its dna binding activity ( figure 3 ) .
yet , another mechanism by which hsv inhibits ifn- expression is through the deubiquitination of traf3 by the viral ubiquitin - specific protease ul36 , which inhibits stimuli - induced irf3 dimerization , promoter activation , and the transcription of ifn- ( figure 3 ) .
as noted , hsvs have evolved redundant and nonredundant mechanisms to specifically impair the function of host molecules that are key for the expression of antiviral molecules , namely , interferons .
the importance of ifns in controlling infection by hsvs is highlighted by the fact that the frequency of genital herpetic recurrences can be reduced in patients by applying topical ifn- , which also reduces viral dissemination .
moreover , the recently described interferon ifn- , characterized as a type - i ifn constitutively expressed by epithelial cells in the female and male reproductive tract , is proposed to be a potent antiviral host mediator that likely contributes to control of hsv infection [ 144 , 145 ] .
however , the exact mechanism by which ifn- exerts its anti - hsv effects remains to be determined .
importantly , expression of ifn- varies with the female hormonal cycle and seems to be limited to cells belonging to reproductive organs [ 145 , 146 ] .
after hsv has blocked immediate host antiviral responses , which rely on the sensing of microbe elements and early interferon responses , cell damage resulting from virus replication likely spreads virus - elicited danger signals and damage - associated molecular patterns ( damps ) onto other noninfected cells .
these neighboring cells , as well as patrolling immune cells , may sense these danger elements and initiate cytokine and chemokine responses that will modulate the milieu and other immune components [ 126 , 147 , 148 ] .
whether the soluble mediators produced in response to these danger signals or hsv itself promote the clearance of the virus or favor its persistence and spread in the host is largely unclear .
because cytokine secretion is generally dependent on the canonical activation of nf-b , hsvs have evolved several molecular mechanisms to modulate the activity of this transcription factor .
a recent report showed that the viral dna polymerase processivity factor ul42 interacts with p65/rela and p50/nf-b1 to block the translocation of nf-b to the nucleus in response to stimuli , such as tnf- .
consistently , another study found that hsv icp0 inhibits tnf--induced nf-b activation , interacting similarly with p65/rela and p50/nf-b1 .
us3 has also been shown to significantly inhibit nf-b activation and decrease the expression of inflammatory chemokines , such as il-8 .
however , other hsv proteins , such as tegument protein ul37 , have been shown to promote nf-b activation and il-8 secretion in keratinocytes .
activation of nf-b after cell infection has also been reported to facilitate viral replication [ 153 , 154 ] . taken together , hsvs have evolved strategies to both block and promote the activation of nf-b within infected cells .
whether these opposing effects depend on the cell types targeted by these viruses or different stages of the infectious cycle requires further study .
nevertheless , these findings highlight the importance of nf-b modulation by hsvs after infection . despite interference with nf-b activity ,
cells infected with hsv nonetheless secrete numerous modulatory cytokines and chemokines after infection or at the site of inflammation .
for instance , hsv has been shown to induce the secretion of ccl2 , il-8 , il-6 , and tnf- in primary endometrial genital epithelial cells . in vivo
importantly , this chemokine and cxcl10 have been shown to play important roles against hsv in cns infection in the mouse model , likely by recruiting nk and cytotoxic t cells to the infected tissue .
similarly , a recent study proposed that cxcl10 is needed for establishing protective immunity against hsv-2 genital infection after vaccination with an attenuated hsv strain .
ccl2 induced upon hsv infection has been attributed a favorable role in corneal infection in the mouse model .
indeed , ccl2 mice were unable to contain the virus and failed to recruit inflammatory monocytes to the infection site .
furthermore , ccl2 expression driven by ifi16 recognition of hsv has been described to facilitate the recruitment of inflammatory monocytes to the infection site , as silencing of p204/ifi-16 resulted in the loss of ccl2 production and significantly more hsv shedding . as indicated above , another cytokine induced after
noteworthily , a protective role has been attributed to this cytokine in microglia , likely through downstream signaling of signal transducer and activator of transcription 3 ( stat3 ) , although the precise mechanism leading to its protective role is unclear [ 160 , 161 ] .
mast cells have also been shown to secrete il-6 early after hsv infection , as well as tnf- , yet these cytokines were not induced directly by hsv in this study but depended on supernatants from hsv - infected keratinocytes and the il-33 receptor on the former cells .
importantly , mice lacking tnf- or il-6 succumbed to death , consistent with a protective role for these cytokines .
contrarily , a recent study suggested that treating mice with anti - tnf- in combination with the antiviral valacyclovir could significantly improve the prognosis of encephalitis caused by hsv .
one aspect that has brought important attention onto cytokines and chemokines produced after hsv infection is that some of the molecules secreted in the genital tract can favor host infection by other sexually transmitted pathogens , such as the human immunodeficiency virus ( hiv ) .
indeed , infection with hsv-2 increases 3 - 4 times host susceptibility of acquiring hiv and , furthermore , coinfection increases the shedding of both viruses [ 2729 , 163 ] .
the increased susceptibility to acquire hiv after hsv-2 infection has been suggested to result , within others , by an increased recruitment of target cells for hiv , such as dendritic cells and t cells to the site of infection [ 164 , 165 ] , increased expression of hiv - receptor molecules at the surface or specific cell populations [ 166 , 167 ] , and reduced expression of cell surface molecules that actually promote the capture and degradation of hiv .
furthermore , immune cells such as dendritic cells infected with hsv have been shown to produce soluble mediators that promote the reactivation of hiv from cells latently infected with the latter virus .
regretfully , the identities of the soluble molecules that account for the observed effect have not been identified so far .
besides upregulating the expression of certain cytokines and chemokines , hsvs can also reduce the expression of certain antiviral molecules , such as the secreted leucocyte protease inhibitor ( slpi ) .
indeed , hsv - infected cells secrete less slpi , which reduces the infectivity of hsv in vitro .
furthermore , a decrease in the expression of slpi would likely promote an increase in the secretion of proinflammatory cytokines , which are associated with exacerbated damage to the infected tissues .
nevertheless , virus - mediated inhibition of other chemokines could favor the host , such as cxcl2 which is secreted by monocytes in response to hsv which is known to recruit neutrophils that elicit damaging inflammatory immune responses to host cells and tissues , namely , neurons . despite the fact that hsvs have been extensively studied , it is surprising to note how little we know about the contribution of cytokines and chemokines induced upon infection by this virus to infection and pathology .
cytokines and chemokines induced by hsv infection will likely play different roles for the host , either favorable or antagonizing , depending on the tissue infected , whether it is skin , genitalia , eyes , or the central nervous system .
furthermore , differences in the nature and amounts of the cytokines and chemokines secreted upon viral infection , as well as the roles of these molecules on virus clearance and disease , will likely depend on whether infection is mediated by hsv-1 or hsv-2 .
high throughput techniques such as multiplex cytokine arrays and the availability of numerous knockout mice for these molecules should provide new insights and valuable information on the role of these soluble mediators in hsv infection in the near future .
innate immunity has evolved soluble components and specialized cells to block microbe infection , replication , and shedding .
the complement is composed of serum proteins that , once triggered by microbial determinants or antibody bound to ligands , interact with each other in a cascade of events that lead to the damaging of the surfaces of the pathogen or cells infected with the microbe .
however , hsvs have evolved molecular determinants to interfere with the function of complement protein c5 and block its downstream activating properties ; this process is mediated by glycoprotein c [ 78 , 171 ] . by doing so , the virus likely extends its lifespan in the serum and that of the cells it infects .
nk cells play important roles against several viral pathogens ; however their role in hsv infection is frequently debated .
although some studies propose key roles for these cells , others have underestimated their importance at controlling hsv infection [ 172 , 173 ] .
hsv can directly activate nk cells through tlr2 ; whether this interaction promotes viral clearance or not in vivo is still unclear .
hsv can also decrease the expression of nk - activating ligands such as mica ( mhc class i polypeptide - related sequence a ) on the surface of infected cells , thus interfering with the effector activity of these cells .
this process would be mediated by a late hsv gene product , which would mask , internalize , or retain mica intracellularly [ 175 , 176 ] .
natural killer t ( inkt ) cells are cd1d - restricted t cells that express invariant tcr chains , as well as nk surface markers , and are specialized in recognizing polar lipids presented on the surface of cd1d molecules .
although variations can be observed in the amount of inkt cells present after hsv infection , changes in the number of cells and expression of markers on their surface are somewhat discrete when compared to patients in the steady state , suggesting potential modulation of these cells by hsvs .
furthermore , infection with hsv has been described to negatively modulate the activity of nkt cells by simply directing cd1d molecules from the cell surface of infected cells into intracellular compartments , thus blocking antigen presentation [ 179 , 180 ] .
world prevalence for hsvs is a truthful testimony of the success of these viruses in establishing latent infection in the host .
successful infection with hsvs is likely the result of a wide array of viral determinants encoded by these viruses with the capacity to interfere with multiple host factors intended to control early infection by pathogenic microbes .
indeed , hsvs effectively block early cellular antiviral mechanisms by extending the survival of cells that serve as substrates , hence favoring virus production and killing cells that initiate and modulate effective antiviral immune responses , such as dcs .
additionally , these viruses promote their stealth by interfering with their sensing by infected cells and by mounting somewhat modest interferon and cytokine responses that favor their replication and shedding .
these phenomena will ultimately allow these viruses to reach cells needed for establishing latency : neurons .
noteworthily , important progress has been made in the last years in identifying early antiviral components elicited and blocked by hsvs .
these studies will hopefully lead to the identification and development of drugs that specifically interfere with viral processes .
noteworthily , findings , such as those related to the activation of particular tlrs that favor host responses against these viruses , will undoubtedly contribute to the development of novel antiviral therapies .
indeed , potentiating early antiviral functions in the host before exposure could be as effective as novel anti - hsv microbicides currently under development , while an effective vaccine against these viruses reaches the clinic . | besides overcoming physical constraints , such as extreme temperatures , reduced humidity , elevated pressure , and natural predators , human pathogens further need to overcome an arsenal of antimicrobial components evolved by the host to limit infection , replication and optimally , reinfection .
herpes simplex virus-1 ( hsv-1 ) and herpes simplex virus-2 ( hsv-2 ) infect humans at a high frequency and persist within the host for life by establishing latency in neurons . to gain access to these cells , herpes simplex viruses ( hsvs ) must replicate and block immediate host antiviral responses elicited by epithelial cells and innate immune components early after infection . during these processes ,
infected and noninfected neighboring cells , as well as tissue - resident and patrolling immune cells , will sense viral components and cell - associated danger signals and secrete soluble mediators .
while type - i interferons aim at limiting virus spread , cytokines and chemokines will modulate resident and incoming immune cells . in this paper
, we discuss recent findings relative to the early steps taking place during hsv infection and replication .
further , we discuss how hsvs evade detection by host cells and the molecular mechanisms evolved by these viruses to circumvent early antiviral mechanisms , ultimately leading to neuron infection and the establishment of latency . |
patent ductus arteriosus ( pda ) is a common form of congenital heart defect with an incidence of one in 2500 to 5000 live births .
the presence of volume overloading of the left atrium and left ventricle is an indication for closure of the defect .
the risks of endocarditis , aneurysm of pda , and pulmonary vascular disease are also indications for closure .
closure eliminates left - to - right shunting volume overload of the left - sided circulation , and the risk for pulmonary hypertension and endocarditis .
surgical closure of pda is safe and effective ; however , certain patients may experience some morbidity , including bleeding , inadvertent left pulmonary artery ( lpa ) ligation , recurrent laryngeal nerve damage , and residual shunting.[25 ] pda was the first example of congenital heart disease to be treated by transcatheter closure , which becomes an established form of treatment for the majority of patients with pda and as a safe alternative to surgery .
, since then various devices such as rashkind pda umbrella , button device , pda coils and most recently the amplatzer duct occluder ( ado ) have been introduced .
the ado device was designed to provide the most desirable characteristics for a percutaneous closure device that can be used in most if not all patients with pda .
these include user - friendly delivery system , high complete closure rate , small delivery system ( allowing its use in small infants ) , transvenous delivery route , ability to adapt to various pda sizes and types , and the ability to retrieve or reposition the device prior to release from a secure delivery system .
this study was carried out to evaluate the safety and efficacy of amplatzer device for the transcatheter closure of pda in iraqi patients .
this retrospective study was carried out in ibn al - bitar center for cardiac surgery - baghdad , from july 2006 to july 2008 , during which 149 patient who underwent cardiac catheterization in an attempt to close the pda by transcatheter approach using amplatzer duct occluder device , were evaluated .
the patients were diagnosed to have persistent patency of ductus arteriosus ( pda ) based on evaluation with a physical examination , cxr and transthoracic echo / doppler study were planned to undergo cardiac catheterization to close the pda by transcatheter occluder device .
although , the manufacturer exclusion criteria were body weight of less than 5 kg and associated cardiac anomalies , which would require cardiac surgery , exception is made for severe medical condition that necessitate early closure of pda .
general exclusion criteria include pelvic vein or inferior vena cava thrombosis , sepsis ( local and generalized ) , any type of serious infection less than one month prior to procedure , malignancy with life expectancy less than three years and demonstrated intracardiac thrombi on echocardiography .
procedure is usually done under general anesthesia , except in adult patient , where sedation with local anesthesia is given .
access in the femoral vein is obtained with placement of a 5 - 7 f sheath .
main pa pressure and aortic pressure is recorded with pall back gradient from ascending to descending aorta obtained to rule out any obstruction .
angiogram in the lateral projection is then performed with a catheter in the proximal descending aorta to calcify the pda .
the device is selected so that the smaller end is at least 2 mm larger than the narrowest portion of the pda .
an end - hole catheter is passed from the main pa through the pda into the descending aorta .
a stiff exchange guide wire is placed with the tip in the distal descending aorta .
a 5 - 7f long sheath is then passed over the wire into the descending aorta .
the appropriate - sized device is then screwed onto the delivery cable and pulled into the loader under water to prevent air entry into the device or sheath .
the device is then advanced to the tip of the sheath in the descending aorta without rotation of the cable .
the sheath and device are then pulled back into a position just distal to the ampulla .
the position of the device is confined with repeated angiograms in the descending aorta and adjusted until the retention skirt is well seated in the ampulla .
when good position is achieved , the sheath is retracted further and the tubular part of the device is opened within the pda .
another angiogram is performed in the descending aorta to confirm final device position up to this step , the device can be repositioned or retrieved if the angiogram showed significant residual flow ; sometime a repeated angiogram is performed in the descending aorta ten minutes after . if device position is satisfactory , the pin vise is then fixed onto the delivery cable , and the device is released with counter - clockwise rotation .
repeat pull back pressures are obtained from the left pa to the main pa and ascending to descending aorta to evaluate for possible pressure gradient . the patient receives intravenous antibiotics for 24 hours and usually discharged on second day after evaluation by cxr , and echo - doppler study and kept on oral antibiotic for 5 days .
observation of subacute bacterial endocarditis prophylaxis is recommended for six months or until complete closure is obtained .
follow - up the patient includes clinical evaluation , transthoracic echocardiography and cxr done after one month , six months , and one year after occlusion .
procedure is usually done under general anesthesia , except in adult patient , where sedation with local anesthesia is given .
access in the femoral vein is obtained with placement of a 5 - 7 f sheath .
main pa pressure and aortic pressure is recorded with pall back gradient from ascending to descending aorta obtained to rule out any obstruction .
angiogram in the lateral projection is then performed with a catheter in the proximal descending aorta to calcify the pda .
the device is selected so that the smaller end is at least 2 mm larger than the narrowest portion of the pda .
an end - hole catheter is passed from the main pa through the pda into the descending aorta .
a stiff exchange guide wire is placed with the tip in the distal descending aorta .
a 5 - 7f long sheath is then passed over the wire into the descending aorta .
the appropriate - sized device is then screwed onto the delivery cable and pulled into the loader under water to prevent air entry into the device or sheath .
the device is then advanced to the tip of the sheath in the descending aorta without rotation of the cable .
the sheath and device are then pulled back into a position just distal to the ampulla .
the position of the device is confined with repeated angiograms in the descending aorta and adjusted until the retention skirt is well seated in the ampulla .
when good position is achieved , the sheath is retracted further and the tubular part of the device is opened within the pda .
another angiogram is performed in the descending aorta to confirm final device position up to this step , the device can be repositioned or retrieved if the angiogram showed significant residual flow ; sometime a repeated angiogram is performed in the descending aorta ten minutes after .
if device position is satisfactory , the pin vise is then fixed onto the delivery cable , and the device is released with counter - clockwise rotation .
repeat pull back pressures are obtained from the left pa to the main pa and ascending to descending aorta to evaluate for possible pressure gradient .
the patient receives intravenous antibiotics for 24 hours and usually discharged on second day after evaluation by cxr , and echo - doppler study and kept on oral antibiotic for 5 days .
observation of subacute bacterial endocarditis prophylaxis is recommended for six months or until complete closure is obtained .
follow - up the patient includes clinical evaluation , transthoracic echocardiography and cxr done after one month , six months , and one year after occlusion .
of 149 patients included in the study , there was 98 female and 51 male , female to male ratio is 1.9:1 .
their body weights ranged from 4 kg to 75 kg ( median 15 kg ) successful pda closure from 149 patients with ado device had been achieved in 136 patients ( 91.2% ) , unsuccessful attempts was because of failure to deploy the device in 11 patients ( 1% ) and the embolization of the device which occurred in 2 patients .
table 1 shows the pda classification ( a , b , c , d , e , and f ) ; type a was the most common in 94 patients .
anatomical classification of patent ductus arteriosis ( pda ) patients in three patient it was not possible to classify the type certainly , because of the unusual orientation or the poor visualization even with repeated angiogram with views other than the standard views used in pda like ( right anterior oblique ) , and it is in those patients balloon was used to choose the proper size of the device .
pda was the isolated heart defect in 128 ( 86% ) patients . the other 21 ( 14% ) patients
the distribution of patients with associated cardiac anomalies participated in the study the vsd was the most common associated anomaly 7 patients ( 4.6% ) .
one patient had an asd which was occluded by amplatzer septal occluder in trancatheter approach before referring for pda occlusion , another 2 years old patients had coaractation of aorta with balloon aortic angioplasty done to him 1 year before referral to cardiac catheterization , no residual gradient was found between descending and ascending aorta and pda successfully occluded without residual gradient .
one patient had stenosis at the origin of left pa before device deployment and the pressure gradient was obtained between main and left pa after effective pda occlusion . in one of the patients who had interruption of inferior vena caves with azygous continuation to the superior vena
cave a difficulty was in advancing the sheath and dilator to pass the pda to the descending aorta , this problem was overcome by using a snare to capture and pull the a guide wire from arterial side into position in the descending aorta .
one 36 year old female patient who had recanalized pda after surgical ligation and with systolic and mean pa pressure of 40 mm and 10 respectively was successfully occluded by the device .
their median mean pa pressure was 25 mm hg ( range 10 - 100 mm hg ) and the mode was 15 mm hg the remaining 44 patients , a record of systolic pa pressure was obtained from echo / doppler study , which the median systolic pa pressure was 35 mm hg ( range 25 - 70 mm hg ) mode mm hg .
table 3 demonstrates that moderate size devices were used more frequently , i.e. , size 8/6 9 10/8 in 46 9 28 patients , respectively , in two patients size 18 muscular vsd amplatzer device needed to be used to close pda owing to their large pda ( wider than the largest ado device available by manufacturer ) .
the size of the devices used in the study unsuccessful attempts to close the pda were occurred in 11 patients .
two patients had severe pulmonary hypertension , because of their hemodynamic date before and after balloon closure of pda they were considered not fit for pda closure .
the pda was very large in size that even the largest available device prolapsed from the pda , those considered not fit for device closure and were referred to surgery .
device prolapsed through the ductus , the next available size ( 8/10 mm ) caused pressure gradient across aorta of 15 mm hg , which was considered significant and the device removed before its released .
significant pressure gradient ( more than 5 mm hg ) was encountered between the main and left pa after device deployment in 4 patients , for which the device was also removed [ table 4 ] .
causes of failure of deployment a few technical difficulties were encountered in several patients during the procedure .
kinking of the sheath at the right ventricular out flow tract or in pulmonary artery near the pda , which led to difficulty in advancing the device .
this was overcome either by reintroducing the dilator inside the sheath to straighten it again or by further advancing the sheath with the device inside it to pass the site of the kink , another problem faced is the difficulty to introduce the device into the sheath , size which recommended by the manufacturer for that device which needed to replace the sheath with larger one . none of these minor difficulties had led to revise the procedure .
complete angiographic closure of pda , i.e. , no residual shunt immediately or 10 minutes after device deployment was achieved in 96 ( 70% ) patients , the remaining 40 patients had minimal residual shunt through device by angiography .
all patients who underwent successful device deployment had complete closure and no residual shunt could be recorded 24 hours following the procedure by echo - doppler study .
also no shunt could be detected on echo - doppler examination in any patient at follow up .
seventy - five patients were followed for one month , 39 patients had followed up after 1 and 6 months and 20 patients had followed after 1 , 6 months , and 1 year following the procedure .
of these patient 100% had complete closure documented by doppler study , no evidence of device related obstruction , recanalization , thromboembolic episode , or clinical evidence of hemolysis .
complications : complications were encountered in 5 patients ( 3.3% ) during or following procedure .
one three years old patient in whom the device embolize into the descending aorta immediately after release , while in the other seven years old patient with large pda ( 14/12 ) device embolized to the pulmonary artery on the next day of closure . in both patients the device was successfully retrieved by snaring under fluoroscopic control .
the second five years old patient with severe pulmonary hypertension and large pda , had pressure gradient between ascending and descending aorta after pda occlusion of 10 mm hg , which was considered not significant ( any gradient of 10 mm hg or less across aorta is considered to be non - significant ) his femoral pulses was normal . on follow - up one month and six months later same gradient recorded on doppler study .
the third patients developed residual pressure gradient between the main and left pa of 5 mm hg was recorded after 8/6 sized device deployment in 1.5 years old patient on follow - up after one month , his cxr showed equal pulmonary vascular marking bilaterally and doppler study could not pick up any pressure gradient .
the fourth complication was seen in a three years old female patient who had fever ( 38.5 degree centigrade ) for three days following successful occlusion .
no focus of infection could be catched clinically ; here laboratory tests ( including cbp , esr , blood culture , and urine exam ) were normal , the temperature fall down spontaneously after 5 days .
two patients had severe pulmonary hypertension , because of their hemodynamic date before and after balloon closure of pda they were considered not fit for pda closure . as mentioned earlier . in four patients
the pda was very large in size that even the largest available device prolapsed from the pda , those considered not fit for device closure and were referred to surgery .
device prolapsed through the ductus , the next available size ( 8/10 mm ) caused pressure gradient across aorta of 15 mm hg , which was considered significant and the device removed before its released .
significant pressure gradient ( more than 5 mm hg ) was encountered between the main and left pa after device deployment in 4 patients , for which the device was also removed [ table 4 ] .
causes of failure of deployment a few technical difficulties were encountered in several patients during the procedure .
kinking of the sheath at the right ventricular out flow tract or in pulmonary artery near the pda , which led to difficulty in advancing the device .
this was overcome either by reintroducing the dilator inside the sheath to straighten it again or by further advancing the sheath with the device inside it to pass the site of the kink , another problem faced is the difficulty to introduce the device into the sheath , size which recommended by the manufacturer for that device which needed to replace the sheath with larger one .
complete angiographic closure of pda , i.e. , no residual shunt immediately or 10 minutes after device deployment was achieved in 96 ( 70% ) patients , the remaining 40 patients had minimal residual shunt through device by angiography .
all patients who underwent successful device deployment had complete closure and no residual shunt could be recorded 24 hours following the procedure by echo - doppler study .
also no shunt could be detected on echo - doppler examination in any patient at follow up . follow up the average duration of follow up is 3 - 9 month .
seventy - five patients were followed for one month , 39 patients had followed up after 1 and 6 months and 20 patients had followed after 1 , 6 months , and 1 year following the procedure .
of these patient 100% had complete closure documented by doppler study , no evidence of device related obstruction , recanalization , thromboembolic episode , or clinical evidence of hemolysis .
complications : complications were encountered in 5 patients ( 3.3% ) during or following procedure .
one three years old patient in whom the device embolize into the descending aorta immediately after release , while in the other seven years old patient with large pda ( 14/12 ) device embolized to the pulmonary artery on the next day of closure . in both patients the device was successfully retrieved by snaring under fluoroscopic control .
the second five years old patient with severe pulmonary hypertension and large pda , had pressure gradient between ascending and descending aorta after pda occlusion of 10 mm hg , which was considered not significant ( any gradient of 10 mm hg or less across aorta is considered to be non - significant ) his femoral pulses was normal . on follow - up one month and six months later same gradient recorded on doppler study .
the third patients developed residual pressure gradient between the main and left pa of 5 mm hg was recorded after 8/6 sized device deployment in 1.5 years old patient on follow - up after one month , his cxr showed equal pulmonary vascular marking bilaterally and doppler study could not pick up any pressure gradient .
the fourth complication was seen in a three years old female patient who had fever ( 38.5 degree centigrade ) for three days following successful occlusion .
no focus of infection could be catched clinically ; here laboratory tests ( including cbp , esr , blood culture , and urine exam ) were normal , the temperature fall down spontaneously after 5 days .
since portsmann et al . placed first evalonfoam plug prosthesis in 1967 , every effort had been done to develop a perfect transcatheter method for pda occlusion .
diverse devices have been designed and some undergone modification according to the experience in their use and effectiveness .
the use of these devices avoids the complications related to surgical procedure , diminishes hospitalization time by immediate recovery .
it considers that ideal device is the device that uses catheters of low caliber , that has the capacity of retrieving , that with a delivery system which is effective and easily handled , besides to have the smaller percentage of residual shunts .
the amplatzer duct occluder device was designed to provide the most desirable characteristics for percutaneous closure device .
many studies had been done worldwide to assess the safety and mid - term follow - up effectiveness of the ado device and to compare it with other devices , in closure of pda .
this study was designed to analyze the safety , efficacy , and follow - up results of percutaneous closure of pda after reviewing the result of two years work and experience in using amplatzer duct occluder device as alternative to surgical closure of pda .
the results of this work are compared with the corresponding results of various published works . regarding the age of the patients different age groups
nine patients ( 6% ) were less than one year of age and the least age was 4 months , in all except one ( five months old baby the device caused aortic obstruction and removed before release ) the pda was successfully occluded and this is in agreement with the fishers et al .
study , who considered transcatheter closure of pda with ado device in twelve patients under one year of age and showed possible to use this device successfully in the infant age group as duct closure was achieved in all but two symptomatic babies who were abandoned because of excessive procedural and fluoroscopy time ; however , they experienced some specific technical difficulties involving kinking of the long sheath at the angle of the right ventricular outflow tract of the pa . while in butera et al .
study , in which 16 symptomatic children with mean age of 18.8 10 months were included and their pdas were successfully occluded by ado device and without any complication .
so they concluded that closure of moderate to large pda in very young , symptomatic children is safe and effective technique and resolves the patient 's clinical problems . in adults
friability and/or calcification of the ductus , atherosclerosis , and aneurysm formation may provide technical challenges and the presence of other unrelated co - morbid conditions such as coronary atherosclerosis and renal disease may adversely affect the peri - operative risk . from 12 ( 8% )
adult patients included in this study , 11 ( 91.6% ) had successful device deployment and the only one patient who excluded had so large pda that the largest device did not fit inside . those who had successful device placement , neither immediate nor later complication were seen .
hong et al . in their series of 5 adults with pda , lee et al . reported a procedural success rate of 100% and there were no complications . similarly in a series of 27 adults with pda , arora et al . reported only one unsuccessful placement of ado device . in hong et al . ,
series , out of 37 adults with pda of wide variety of sizes 36 ( 97% ) patients had successful deployment of ado and in one patient the ductus could not be crossed so they concluded that the aod device is both safe and effective for the closure of pdas of all sizes in adults .
although the manufacturer does not recommend the use of ado in patients with body weight of less than 5 kg , two patient were included under that weight ( 4 , 4.5 kg ) in the treatment cohort , the procedure was achieved successfully in 6 months , 4.5 kg patient without complication .
however , the 5 months 4 kg patient , device placement caused a significant pressure gradient across aorta and it was abandoned . although the device can be used in patients with less than 5 kg body weight , care must be taken for careful measurement of pull back pressure between ascending and descending aorta and from left to main pa to detect any obstruction that may result from device placement .
other studies had included patients with weight less than 5 kg , the same agreement recorded in fischer et al . , series which include 7 patients under that weight ( from 2.6 - 4.4 kg ) . in all except 2 patients fischer et al .
, were successful in placing the ado and there was subsequent complete occlusion with good result on follow - up . however , the procedure was not successful in two small infants of 2.6 and 4 kg body weight because of technical difficulty ( kinking of the sheath at right ventricular outflow tract ) and excessive procedural and fluoroscopy time .
, reported experiences with ado in 209 patients , among whom 27% were infant weighting less or equal to 5 kg .
kinking of the delivery sheath occurred in only one infant to the extent that device delivery was impossible . in another infant ,
closure of pda by ado device can lead to favorable results , when associated cardiac anomalies with left to right shunt is present , 7 patients included had associated vsd two of them had significant pulmonary hypertension .
their pa pressure was declined significantly in all after device placement . a patient with asd closed by transcatheter amplatzer septal occluder , had undergone transcatheter closure of his pda by ado device .
therefore , pda occlusion could be helpful in either reducing surgical risk or even obviating the need for surgery in some patients , when pda is associated with certain cardiac defects . regarding the 11 patients ( 7.3% ) in which the device could not be deployed
- two patients were excluded because of severe pulmonary hypertension which made them unfit for pda closure ( i.e. , not related to the device itself ) , in 4 patients with large pda in which size 16/14 device ( which is the largest device provided by the manufacturer ) was prolapsed from the pda . manufacturing a larger sized device
although , size 18 mm muscular vsd amplatzer occluder device was placed successfully in 2 patients with large pda in which size 16/14 was not fit , but the shape of the vsd device may not fit in all types of pda , besides the vsd device is more expensive than the pda devices , which make placing vsd device in a pda not a practical solution . in the remaining 5 patients , because of their large pda , placing device size suitable for pda resulted in obstruction of aorta or left pa , and the device had to be removed by retrieving it into the sheath before release .
this advantage of ado devices to be retrieved , allows the devices to be removed if any complication was occurred from its placement .
, study from 41 attempts of pda closure by ado , 4 months old patient , because of aortic obstruction ; another one year old ( 4.8 kg ) patient in which her pda was considered too big for the device , considering her age and low weight , while in hong et al .
study , only 1 from 37 patients was excluded because the pda could nt be crossed . in fischer
study the procedure was unsuccessful in 2 out of 12 infants because of the technical problems ( kinking the sheath ) which resulted in excessive procedure time . while no unsuccessful attempts were mentioned in waight et al .
kinking of the sheath was encountered in a number of our patients but none of the technical problems were severe enough to discontinue the procedure . in the fischer et al .
series kinking of the long sheath at the right ventricular outflow tract had occurred in 9 of the 12 infant ( 75% ) , and in five of 25 older patients 20% included in the series .
they overcame this problem by snaring the long sheath from systemic arterial side , or by exchanging the long sheath by larger cook sheath , despite that two small infants were excluded because of this technical difficulty . while in bilkis et al .
study , which included 209 patients kinking the delivery sheath occurred only in one infant to the extent that device delivery was impossible .
complications had occurred in five patients ( 3.5% ) , of which device embolization was most important . in the first patient
the device which was size 10/8 embolized just after release from delivery cable to the descending aorta , while in the other patient the device embolized 24 hours after the procedure to the pa . in both ,
the embolization was probably because of large distensible pda , improper device size used or improper fixation at the pda .
this complication not recorded in later weeks probably because of buildup of experience with device use .
study , while in our study the embolized device was removed by snaring and no complication later on .
the aorta of 10 mm hg in one patient and across left pa ( 5 mm hg ) of the other patient .
the same aortic gradient recorded in the patient during 6 month follow up , but the pa gradient could not be picked up by doppler study after one month . although we considered this insignificant gradient as a complication , in hong et al .
series he recorded pressure gradient after closure was up to 11 mmhg in aorta and up to 4 mm hg at the pa , which was considered as part of procedure and not complication .
a significant aortic obstruction , requiring surgical removal of the device was reported by duke in 2 years old girl after ado device deployment , in fischer et al .
study complications related to the procedure such as blood loss needed transfusion ( one patient ) or femoral artery thrombosis ( one patient ) only occurred in under one year age group . while in hong et al .
study complications were encountered in four patients ( from 37 patients ) , one had av fistula of femoral artery , two had groin hematoma and one had allergic reaction , none were attributed to device implantation , but rather the catheterization procedure itself . in waight
, study only one patient was noted to have post procedural complication of mild coarctation of the aorta requiring stent implantation ( total complication rate was 1.2% ) .
other studies did not record any complications . in published results of the international clinical trial with ado reported 15 procedure related complications in 316 patients who underwent attempted transcatheter closure of pda .
complication included hemolysis , left pa stenosis , device protrusion into aorta , causing coaractation , device misplacement , and one death following device embolization .
no late complications were recorded on follow - up in this study or any other study related to device implantation . in bilkis
et al , series they reported one death following device embolization , while no death recorded in other series .
it meets with most of the desirable characteristics of percutaneous closure device that can be used in most if not all patients with pda .
however , care must be taken when the device used in patient less than 5 kg body weight especially those with large pda because of their small aortic size , to avoid any complication that might result .
although ado device has low early complication rate and no recorded complication on intermediate follow - up , we emphasis on care needed during cardiac catheterization for pressure recording in aorta and pulmonary artery , before and after device placement , and careful angiographic assessment of the device position , particularly the position of aortic ring , before and after detaching the device from its delivery system . | background : patent ductus arteriosus ( pda ) is a common form of congenital heart disease and forms about 5 - 10% of congenital heart diseases .
surgical closure is safe and effective ; however , certain patients may experience some morbidity . recently
, transcatheter closure of pda using the amplatzer duct occluder has been shown to be safe and efficacious.objectives:to evaluate whether transcatheter closure with this device offers an alternative to surgical closure of pda.patients and methods : between july 2006 to july 2008 , 149 patients ( 98 females and 51 males ) with pda underwent cardiac catheterization in an attempt to close their pda by transcatheter approach using amplatzer duct occluder device.results:the patient 's age ranged from 4 months to 45 years ( median 5 years ) .
successful pda closure was achieved in 136 patients ( 91.2% ) with 100% complete closure rate within 24 hours after the procedure .
thirteen patients ( 8.7% ) had unsuccessful attempts , 11 ( 7.3% ) of them had failure of deployment of the device , while embolization of the device occurred in two of the patients ( 1.3%).conclusions : amplatzer duct occluder device is safe and effective for closure of different types and sizes of pda with low rate of complication . |
laparoscopic cholecystectomy is one of the most common general surgical procedures performed in the united states today . whether performed as an open or laparoscopic procedure ,
bile duct injury ( bdi ) is a well - recognized and feared complication [ 15 ] .
bile duct injuries often occur in the setting of distorted anatomy , especially in the presence of acute cholecystitis or excessive bleeding [ 1 , 57 ] . with the introduction of laparoscopic cholecystectomy
, the incidence of bile duct injury has been reported to be roughly 0.5% [ 810 ] .
this is nearly double the reported incidence of 0.10.25% seen with open cholecystectomy [ 1113 ] . despite attempts to decrease this rate through operative maneuvers and improved teaching processes ,
few bile duct injuries are identified in the operating room . the majority of patients present with jaundice over the subsequent week following their cholecystectomy .
several groups have devised classification systems that attempt to convey mechanism and level of injury , as well as the complexity of repair that will be required .
the system proposed by bismuth and majno was based on the level of chronic biliary strictures .
unified these two systems and classified injury based on anatomic location and the complexity of repair required .
a relatively recent addition to classification systems has been consideration of concomitant arterial injuries . of the over 600 publications on bile duct injury ,
the hannover group has incorporated the presence of arterial injury , resulting in a more accurate and considerably more complex system .
the drawback to the precision of the currently proposed systems is their high degree of complexity , which makes their routine incorporation into clinical use difficult .
one area that has yet to be addressed by current classification schemes is the financial impact of bile duct injury following laparoscopic cholecystectomy .
we have devised a simple , three - tier classification scheme with the primary goal of stratifying injuries based on the financial cost of definitive management .
secondary endpoints assessed in this study include need for operative repair , risk of mortality , and biliary stenosis following definitive management .
between 1992 and 2010 , a total of 108 bile duct injuries were managed by our hepatobiliary group . with institutional review board approval
patient demographics , operative procedures , complications , mortality , and financial costs of care were examined .
grade i injuries consisted of leaks from the cystic duct stump , duct of luschka , or accessory right hepatic ducts .
grade ii injuries consisted of all other levels of biliary injury , including those to the common bile duct or intrahepatic bile ducts .
the primary endpoint of this study was to assess the ability of this classification system to stratify patients based on total financial cost of definitive management .
management of minor biliary injuries such as leaking duct of luschka consisted primarily of ercp with temporary stenting of the common bile duct . for more complex injury patterns , ercp played a primarily diagnostic role .
any fluid collections were percutaneously drained to control biliary sepsis , and patients were started on broad spectrum antibiotic therapy .
injuries at bismuth level ii or higher were initially managed by placement of ptc catheters .
patients with complex injuries were typically treated with two weeks of conservative management prior to definitive surgical therapy . the primary surgical therapy employed consisted of debridement of the damaged bile duct followed by retrocolic roux - en - y hepaticojejunostomy to the remaining biliary radicles .
small undrained biliary radicles greater than 5 mm were stented with a segment of pediatric feeding tube . for injuries extending high into segment iv
, a kasai portoenterostomy was performed . in cases of extensive unilateral biliary and/or vascular injury ,
statistical analysis was performed to compare patient demographics , complications following definitive management , mortality , late biliary stricture , length of stay , and financial cost between the three grades of injury .
financial costs included hospitalization , or and surgeon 's fees , and outpatient pharmacy charges .
continuous variables were analyzed using the wilcoxon - mann - whitney or kruskal - wallis test where appropriate .
late restricture , complications , and mortality were analyzed using fisher 's exact test and logistic regression .
the necessity for surgical versus endoscopic or percutaneous management based on grade of injury , as well as the impact of repair attempts at the referring institution on long - term biliary stricture , was analyzed using logistic regression and fisher 's exact test .
there were 108 patients referred for evaluation of bile duct injuries during the study period .
the group consisted of 79 women and 29 men , at an average age of 46.9 years .
these included attempted hepaticojejunostomy ( n = 15 ) , choledochojejunostomy ( n = 6 ) , primary repair ( n = 3 ) , and t - tube placement ( n = 4 ) . attempted surgical therapy at the primary institution was associated with a significantly higher incidence of restenosis following definitive management ( or : 7.0 , 95% ci : 2.519.6 , p < 0.001 ) .
definitive therapy at our institution consisted of biliary enteric anastomosis , portoenterostomy , ercp with stenting , hepatic resection , and percutaneous procedures ( table 2 ) .
three were from sepsis with multisystem organ failure , and the other was from postoperative pulmonary embolus .
as described above , a three - tier classification system was devised in an attempt to stratify the overall financial impact of bile duct injury .
there were 14 patients with grade i injuries , which were either repaired at the primary operation or managed with endoscopic stenting ( table 3 ) .
there were no deaths or late biliary strictures in this group , while one patient suffered a complication .
the mean length of stay following referral was 1.6 days , with an average cost of $ 12,457 .
operative repair was required in 66 patients , while the rest were managed with endoscopic or percutaneous measures .
average length of stay was 8.8 days , with a mean total cost of $ 46,481 .
application of the hannover system to patients with grade ii injuries provided no ability to discriminate based on the probability of late restenosis after definitive management ( p = 0.639 ) , total cost ( p = 0.423 ) , or length of stay ( p = 0.054 ) .
there were significant differences in the method of definitive management based on the hannover classification in this group ( p = 0.003 ) .
in particular , patients with class b or c lesions ( tangential injury or occlusion of the bile duct with a clip ) were more likely to have nonoperative management with ercp or ptc ( 37.5% versus 2.4% ; p < 0.001 ) .
in contrast , patients with lesions above the bifurcation of the hepatic duct ( c4 , d4 , or e4 ) were significantly more likely to require hepatic resection for definitive management ( 20.0% versus 1.9% ; p = 0.039 ) .
the odds of requiring hepatic resection for patients with lesions above versus below the hepatic bifurcation were 12.235 ( 95% ci : 1.278117.094 , p = 0.030 ) .
more proximal biliary injuries as defined by the bismuth classification were significantly more likely to be associated with a concomitant vascular injury ( or : 1.8 , 95% ci : 1.12.8 , p = 0.011 ) .
all but 2 patients required operative repair , although no vascular reconstructions were necessary . there were six complications in this group , including sepsis ( 2 ) , biliary leak ( 2 ) , pulmonary embolism ( 2 ) , and dehydration ( 2 ) .
two were from sepsis with multiple organ failure while the last was from pulmonary embolism in the outpatient setting .
length of stay was an average of 11.8 days , with a mean total cost of $ 69,368 .
application of the hannover system to patients with grade iii injuries provided significant ability to discriminate based on the percentage of patients who had restenosis of the bile duct following definitive management ( p = 0.024 ) .
specifically , patients with injuries to the proper hepatic artery ( hannover cp , dp , ep ) had a 100% incidence of late restenosis compared to 5.9% of patients with injuries to other vessels ( p = 0.004 ) .
the hannover system was also able to provide information as the required modality of repair for patients with grade iii injuries ( p = 0.013 ) .
specifically , 66.7% of patients with injuries to the portal vein were able to undergo nonoperative management , compared to none of the patients with arterial injuries ( p = 0.018 ) .
analysis of the primary endpoint of total cost revealed significant differences between the three groups in aggregate ( p < 0.001 ) .
between - group comparisons revealed significantly higher cost for grade ii versus grade i injuries ( p = 0.002 ) and for grade iii versus grade ii injuries ( p = 0.002 ) .
there were no significant differences between the three groups in age , gender , or time to injury recognition ( table 4 ) .
the classification system was not able to discriminate based on the incidence of restenosis ( p = 0.109 ) or complications following definitive management ( p = 0.107 ) .
length of stay was predictably longer with increasing grade of injury ( p < 0.001 ) .
as grade of injury increased , there were a significantly higher odds that surgical ( as opposed to endoscopic or percutaneous ) therapy would be required for management ( p < 0.001 ) . for grade
ii versus i injuries , odds of requiring surgical therapy were 27.7 ( 95% ci : 5.5138.9 , p < 0.001 ) .
there was no significant difference in the requirement for operative therapy between grade iii and grade ii injuries ( or : 1.8 , 95% ci : 0.49.0 , p = 0.450 ) .
there were significant differences in mortality between the three grades of injury in aggregate ( p = 0.030 ) ( table 4 ) .
bile duct injuries with laparoscopic cholecystectomy continue to occur at nearly twice the rate encountered with open cholecystectomy .
the united states has recently witnessed multiple attempts by the federal government at medical cost containment , including proposed withholding of payment for the management of iatrogenic complications . to date , multiple systems for classification of bile duct injury
have been devised to define anatomy , mechanism of injury , and expected complexity of repair ; however , none address the financial cost of management [ 1719 , 27 ] .
these systems have evolved from bismuth 's description of chronic bile duct strictures to the current complex , multi - level systems incorporating mechanism of injury , arterial injury , and expected mode of repair .
the importance of vasculobiliary injury has been highlighted by reports of increased mortality , liver ischemia , and repair failures when vascular injury is added to biliary injury [ 21 , 24 , 25 ] .
several authors have reported the incidence of vascular injury with biliary injury to be up to 20% [ 2830 ] .
the presence of vasculobiliary injury significantly increases the complexity of repair , including procedures such as hepatic resection , kasai portoenterostomy , or even liver transplantation [ 3134 ] .
our current series has identified a nearly 20% incidence of vascular injury in the setting of biliary injury following laparoscopic cholecystectomy .
this is consistent with the published literature ; however , we recognize that this incidence may be overestimated in that we only saw cases deemed severe enough for referral to a tertiary center .
although the presence of any vascular injury in our series was not significantly associated with risk of late stricture after repair , we did show an increased risk of mortality .
injuries to the main hepatic artery specifically , however , are universally associated with late restenosis after repair . as the sole factor defining a grade iii injury , vascular injury also significantly increases the cost of definitive management .
although we developed this grading system to assess the financial impact of bile duct injury , perhaps a more important attribute of our scheme is its simplicity of use in helping practicing surgeons make decisions on referral .
the currently available systems of bile duct injury classification do an excellent job of precisely defining anatomy and mechanism of injury ; however , they are too complex and cumbersome to be remembered offhand and routinely applied in routine practice .
first is , that , when attempts at surgical repair are made in the referring institution , the odds of late biliary stricture following definitive management significantly increase .
the other is that patients with grade ii or iii injuries are significantly more likely to require operative therapy to repair their biliary tree .
this is particularly true when the vascular injury is to one of the hepatic arteries rather than to the portal vein .
based on these findings , we propose the following decision tree when biliary injury is diagnosed following laparoscopic cholecystectomy ( figure 1 ) . for grade i injuries ,
endoscopic treatment is likely all that will be required , and these can be managed safely at the primary center if ercp capability is present .
patients with grade ii or iii injuries represent a significantly more complex problem and should be referred immediately to a tertiary hepatobiliary center .
attempts at surgical repair by surgeons inexperienced with complex biliary surgery should be avoided in these cases given the increased risk for later complications . for patients with grade ii injuries
not involving stricture or complete common bile duct transection ( hannover class b and c ) , nonoperative management remains a possibility .
more extensive grade ii injuries ( hannover class d and e ) almost universally require operative management . for patients with grade ii injuries above the hepatic bifurcation
, there is a significantly greater likelihood of requiring hepatic resection for definitive therapy . for patients with grade iii injuries involving the portal vein , there still remains the potential for nonoperative management , either through ercp with stenting or ptc .
all other patients with grade iii injuries should undergo operative biliary reconstruction and/or hepatic resection .
grade iii injuries to the main hepatic artery were all associated with late restenosis , a factor which should be discussed thoroughly with the patient preoperatively .
here we have presented a novel classification system for biliary injury that is the first to address the financial costs of definitive management . while this system does not provide the precise anatomic and mechanistic information afforded by current classification schemes , we believe its simplicity makes it applicable to routine clinical practice .
this is especially important as it applies to the decision making tree in referring patients with bdi to experienced hepatobiliary centers .
application of a minimal amount of additional anatomic information to this scheme ( particularly whether vascular injury is to the portal vein or main hepatic artery , whether the biliary injury is above or below the bifurcation , and whether the injury involves complete transection or stenosis of the common bile duct ) adds significant information as to the type of management strategy required .
this study is limited by its retrospective design and confinement to a tertiary referral center .
prospective validation of this system 's utility in a broader range of clinical settings will be required .
| purpose .
the study was undertaken to evaluate a novel
classification system developed to estimate financial cost of bile
duct injury ( bdi ) and to aid in decision making for referral .
study design .
a retrospective review of
patients referred for bdi was performed .
grade i injuries involve the
duct of luschka or accessory right hepatic ducts , grade ii includes
all other biliary injuries , and grade iii includes all vasculobiliary
injuries .
groups were compared using standard statistical methods .
results .
there were 14 grade i , 74 grade ii ,
and 20 grade iii injuries .
there was a significant difference in the
cost and mortality of grade i ( $ 12,457 , 0% ) , grade ii ( $ 46,481 , 1.4% ) ,
and grade iii ( $ 69,368 , 15% ,
p = 0.002
and
p = 0.030 ,
resp . )
injuries . grade ii and iii injuries
were significantly more
likely to require surgical repair ( or 27.7 ,
p < 0.001 ) .
conclusion .
we have presented a simple
classification system that is able to accurately predict cost and need
for surgical repair . |
obesity is characterized by abnormal or excessive fat accumulation that is the result of a chronic imbalance between energy intake and energy expenditure [ 1 , 2 ] .
it poses a substantial health risk , as obesity is linked to several common diseases , such as type 2 diabetes , cardiovascular disease , stroke , arthritis , and several types of cancer .
obesity can be highly heritable , and some specific genes related to obesity have been identified . however , over the past decade , the prevalence of obesity in the world has dramatically increased across all age groups , especially in developed countries , so that genetic factors alone can not explain the obesity epidemic .
it is widely agreed that obesity is a complex multifactorial disease involving genetic , environmental , and lifestyle factors and it is necessary to investigate the mode of action of each contributing factor in order to reduce the associated health risks .
metabolomics is a newly emerging bioanalytical technique similar in scope to genomics and proteomics that uses analytical techniques such as nuclear magnetic resonance ( nmr ) spectroscopy or mass spectrometry ( ms ) to characterize and quantify all small molecules in biological samples to achieve comprehensive global monitoring of metabolites and their fluctuations in response to various stimuli [ 7 , 8 ] .
therefore , metabolomic data can provide the information on what is actually happening in a biological system , serving as the crucial link between phenotype and genetics . to date
, metabolomics has demonstrated enormous potential in furthering the understanding of disease processes , toxicological mechanisms [ 7 , 10 ] , biomarker discovery , and gut microbiome - host variations [ 12 , 13 ] .
obesity is a disorder of the whole body and obviously involves metabolic changes , but the actual alterations in metabolism during obesity and any dysfunction associated with obesity at the level of individual organs or cellular organelles are not yet clearly understood . as metabolomics can readily detect subtle changes in the metabolic network , it is uniquely poised to increase our understanding of obesity and obesity - related diseases .
animal models have provided a fundamental contribution to the investigation of the onset and progression of complex multifactorial diseases such as obesity .
the greatest advantage of animal models is that they allow strict control of factors such as diet , environmental conditions , or genetic background .
thus , animal models have been widely used in metabolomics for exploring the metabolic changes and potential biochemical mechanisms of obesity development .
the general process of a metabolomics study includes appropriate design and sampling of experimental study cohorts , selection of analytical technique ( nmr spectroscopy and/or ms ) , data preprocessing and statistical analysis , identification of candidate biomarkers , and elucidation of their biological relationship . how to obtain metabolic profiles from biological fluids and how to analyse
metabolomic data will not be discussed in detail in this paper as these topics have been thoroughly reviewed elsewhere [ 7 , 1517 ] .
we will focus here on individual significant metabolites and metabolic pathways related to obesity which have been identified by metabolomics .
recently , many obesity - related metabolites have been identified by metabolomics and demonstrated to be disturbed significantly in both animal models and humans .
table 1 and figure 1 show a summary of these metabolites and their relationships in metabolic pathways , respectively .
it is catabolised via glycolysis to pyruvate , which under aerobic conditions is converted into acetyl coenzyme a ( accoa ) , the entry point into the tca cycle . under anaerobic conditions
it was found that the concentration of lactate in urine , blood , or liver tissue is elevated in obese mice induced by high - fat diet ( hfd ) , or in obese zucker rats lacking the leptin receptor , compared to their lean controls ( table 1 ) [ 1822 ] .
one study found lower lactate levels in the urine of obese zucker rats , but this decrease was only small compared to other metabolite changes and could have been caused by small cohort sizes .
the findings of generally higher lactate levels in obese zucker rats are consistent with higher blood lactate levels in obese humans measured by conventional methods .
it was presumed that the elevation of lactate in obese animals was the result of upregulated anaerobic glycolysis when compared to lean controls [ 18 , 19 ] .
the blood concentration of lactate is largely determined by the balance of the rate of lactate production ( which mainly takes place in skeletal muscle , the erythrocytes , brain , and adipose tissue ) relative to the rate of its removal by other tissues or by urinary excretion .
importantly , subcutaneous fat was demonstrated to be a significant source of lactate ; therefore , obese subjects have a greater apparent lactate release due to their larger adipose mass , and a higher plasma lactate than lean individuals .
lactate is also the major precursor for gluconeogenesis in the body , and the rise in plasma lactate in obesity may be an indicator of perturbation of hepatic glucose production and hepatic lipid synthesis .
thus , lactate is an important obesity - related metabolite identified by metabolomics . under aerobic conditions
, pyruvate enters the tca cycle via accoa to produce energy via formation of citrate , and other tca cycle metabolites .
it was reported that inhibition of citrate metabolism by fluoroacetate , a chemical inhibitor , reduced body fat in mice .
next to glucose catabolism , accoa and consequently citrate are in animals also generated by fatty acid oxidation .
the concentration of citrate in plasma is regulated by insulin , glucose levels , fatty acid utilization , cholesterol synthesis , liver clearance and renal excretion .
blood citrate was found to be increased in alloxan - induced diabetic rats , and lowered upon insulin administration in experimental animal models and children .
similarly , higher serum concentrations of citrate when compared to their controls were detected by nmr or gas chromatography - ms ( gc - ms ) based metabolomics in hfd - fed obese animals with insulin resistance .
conversely , lower urinary citrate excretion was reported to be associated with a higher level of insulin resistance in humans , and depletion of urinary citrate excretion was reported in obese animals with insulin resistance , while the opposite was seen in obese animals without insulin resistance .
depletion of urinary citrate excretion was also found in obese animals , with truncations in the intracellular domain of the growth hormone receptor ( ghr ) [ 34 , 35 ] .
urinary citrate excretion is influenced by the acid - base status of the body , with alkalosis inducing an increase in urinary citrate excretion , and acidosis having the opposite action .
obesity , especially in conjunction with insulin resistance , can increase metabolic acidosis and thus result in a reduction of urinary citrate excretion .
thus , citrate can be used as a marker related to insulin or glucose levels in metabolic studies .
blood lipids , derived from food intake or adipose tissue and liver , are mainly fatty acid derivatives and cholesterol .
high concentrations of fatty acids or cholesterol in blood have been used as an indicator of disease risk , as their alteration is related to some cardiovascular diseases , such as coronary heart disease , diabetes [ 38 , 39 ] , and hypertension . in liver and muscle , free fatty acids ( ffas )
are catabolised in the mitochondria to produce energy through -oxidation and the tca cycle , whereas excess lipids are stored in adipose tissue and elsewhere as triglycerides .
obesity , characterized by fat deposits in tissue , is generally associated with elevated levels of plasma ffas . in agreement with this ,
elevation of ffas in serum and liver of obese animals has been observed by metabolomic analysis ( table 1 ) .
furthermore , the serum ffa composition , especially the proportion of saturated fatty acids ( sfas ) , has been found to be positively associated with the development of obesity and diabetes .
in contrast , lower levels of essential fatty acids such as linoleic acid were found in circulating lipids of obese patients .
compared to conventional targeted analysis of ffas , metabolomics can provide a more unbiased relationship of ffas to other small molecules , which may help to understand obesity .
for example , based on ultraperformance liquid chromatography quadrupole time - of - flight ( uplc q - tof ) ms and gc - ms , higher levels of stearic acid , total sfas and palmitoleic acid and lower linoleic acid levels , as well as the variation of amino acids and carnitine in plasma , were detected in overweight / obese men .
carnitine is a key metabolite related to obesity , due to its involvement in fatty acid metabolism .
however , fatty acids can only produce energy via -oxidation after esterification and transport into the mitochondrion with the help of carnitine .
consequently , the amount of carnitine in cells is an important factor regulating the process of -oxidation .
indeed , it has been reported that supplementation of carnitine can diminish the risk of obesity caused by a hfd in c57bl/6j mice , and carnitine is popularly used as a weight loss product .
consistent with this picture , depletion of carnitine levels was observed in liver tissue of obese mice or blood samples of obese humans .
the decreased carnitine levels in obesity could be insufficient for -oxidation to compensate the elevation of ffas , and as a result , contribute to fat accumulation in adipose tissue .
taurine is an important metabolite in bile acid metabolism and has many important biological roles such as conjugation of cholesterol and bile acids , antioxidation , osmoregulation , and modulation of calcium signaling . in a rat model of type 2 diabetes ,
a taurine - supplemented diet tended to decrease total fat weight in the abdominal cavity and improved insulin sensitivity .
similarly , zhang et al . reported that taurine supplementation significantly decreased serum lipids and body weight in obese individuals .
based on h - nmr spectroscopy and microarray techniques , significant depletion of hepatic and urinary taurine , as well as lower expression of cysteine sulfinic acid dehydrogenase ( csad ) in ghr mutant obese mice , was observed when compared with wild - type mice in our previous work .
the findings indicated that lower urinary taurine levels in the mutant mice can reflect lower hepatic taurine biosynthesis in ghr mutant mice .
lower urinary excretion of taurine was also reported in obese zucker rats [ 21 , 53 ] ( table 1 ) .
these observations indicate that a decreased production of taurine in liver due to inhibition of taurine biosynthetic enzymes is closely related to obesity .
interestingly , we found that the hepatic taurine level in liver was increased significantly when wild - type mice were fed an hfd .
recently , rubio - aliaga et al . confirmed that not only elevation of hepatic taurine , but also depletion of the expression of two key enzymes involved in taurine biosynthesis , cysteine dioxygenase ( cdo ) and csad , was observed in hfd - induced obesity mice .
similar results of elevated taurine levels in liver extracts but decreased urinary taurine were also found in another study on hfd - fed obese mice .
in vivo , taurine in liver is supplied from blood by dietary ingestion as well as from de novo synthesis .
it is likely that the elevation of hepatic taurine and the decreased production of biosynthesized taurine in obesity induced by hfd are associated with depletion of the blood taurine concentrations .
this was confirmed in a recent metabolomic study for hfd - induced mice and obese humans in comparison with age- and sex - matched nonobese subjects .
not only found that blood taurine concentrations were decreased in hfd - induced obese mice , but also that dietary taurine supplementation could reverse the obesity induced by hfd .
they proposed a role for taurine as a metabolite able to increase fatty acid oxidation and decrease obesity . in the light of this ,
the increased provision of fatty acids in obesity may require more taurine to promote fatty acid oxidation .
thus , the obesity in the ghr mutant mice is likely to be a consequence of the low taurine levels , whereas the elevation of hepatic taurine seen in hfd - fed wild - type mice is a compensatory mechanism to overcome the increased supply of dietary triglycerides by promoting -oxidation .
these observations indicate that taurine should be a focus of further investigation with respect to the mechanism of the onset and development of obesity .
choline is an essential dietary nutrient that is important for integrity of cellular structure , methyl ( one - carbon ) metabolism , and lipid / cholesterol transport and metabolism [ 59 , 60 ] . in animals , over 95% of the total choline pool in most tissues is used for the synthesis of phosphatidylcholine ( pc ) via the kennedy pathway . in hfd - fed obese mice the hepatic and serum pc
was increased compared to normal controls . in the mitochondria of liver and kidney , choline
can be oxidized to betaine , whose methyl groups are used to synthesize methionine from homocysteine .
it was presumed that betaine plays a key role in fatty acid metabolism related to carnitine production [ 41 , 63 ] .
metabolomic analysis revealed depletion of betaine in the liver of hfd - induced obese mice and zucker rats which may result in a decreased hepatic carnitine level , and eventually lead to decreased -oxidation and increased fatty acid storage .
indeed , a lower hepatic carnitine level was detected by lc(gc)-ms in hfd - fed obese mice . in mammals ,
choline is derived not only from diet , but also from de novo synthesis . during hfd intervention ,
for example , higher hepatic choline levels and lower hepatic methionine concentrations were found in an hfd mouse model .
it was suggested that the higher hepatic choline levels were used for synthesizing essential amino acids such as methionine and that these alterations would play an important role in the development of insulin resistance and liver steatosis .
however , the amount of choline supplied by de novo biosynthesis may be not adequate to meet the demand for choline to maintain health .
indeed , feeding animals a methionine- and choline - deficient ( mcd ) diet can result in fatty liver , which is similar to human nonalcoholic steatohepatitis ( nash ) , and mcd diet is a frequently used nutritional model of nash [ 64 , 65 ] .
the mechanism of development of hepatic steatosis induced by mcd diet in mice presumably involves an increase of fatty acid uptake and decrease of very low - density lipoprotein ( vldl ) secretion , which would promote intrahepatic lipid accumulation .
the pathway from dietary pc / choline to trimethylamine ( tma ) and trimethylamine n - oxide ( tmao ) has been known since the 1950s . recently , wang et al
. crucially demonstrated that intestinal microflora are a key element in this pathway and thus in the generation of tma from dietary choline in vivo .
the importance of gut microbiota for tma production from its precursor choline was also demonstrated with germ - free mice experiments .
thus , metabolites such as tma and tmao are directly indicative of gut microbiota status . by combining h nmr spectroscopy and multivariate statistical techniques , dumas et al . found a significant association between variations in choline metabolism for example , low plasma pc and high urinary methylamines ( dimethylamine , tma , tmao)and genetic predisposition to hfd - induced nonalcoholic fatty liver disease in mice . based on this , dumas et al . proposed a diet - induced mechanism of steatosis , triggered by symbiotic microbiota , which mimic choline - deficient diets
indeed , gut microbiota have been demonstrated to be able to influence the efficiency of harvesting energy from diet and consequently influence susceptibility to obesity .
several metabolomic studies show depletion of serum or urinary tmao in hfd - induced obese mice or zucker rats ( table 1 ) , whereas , elevation of tmao was observed in ghr mutant obese mice . in addition , urinary excretion of microbiota - derived metabolites was found to vary significantly depending on the mouse strain , underlining the importance of gut microbiota in nutrient supply .
amino acids that were shown to display significant obesity - related variations are listed in table 1 .
the branched chain amino acids ( bcaas ) , leucine , isoleucine , and valine , are among the nine essential amino acids for humans .
the bcaas play important roles in protein synthesis , improve glucose metabolism and oxidation , and regulate leptin secretion from fat and food intake .
bcaa supplementation was found to beneficial for patients undergoing chemoembolization to improve postoperative nutritional status . in mouse models ,
very low blood levels of bcaas were associated with neuropathology , including the development of epileptic seizures .
however , high levels of bcaas have been reported in obese persons , and fasting concentrations of branched - chain and aromatic amino acids were correlated with obesity and serum insulin levels [ 75 , 76 ] . based on metabolic profiling of obese versus lean humans and data obtained from rats on different diets , newgard et al
. demonstrated that bcaas did contribute to obesity - related comorbidities such as insulin resistance and glucose intolerance .
furthermore , a recent study showed that the blood concentration of five branched - chain and aromatic amino acids ( isoleucine , leucine , valine , tyrosine , and phenylalanine ) could predict the risk of future diabetes . in agreement with this ,
plasma levels of valine and leucine were 23% and 14% higher , respectively , in overweight / obese male humans compared to the lean controls . in contrast , some previous studies [ 78 , 79 ] failed to demonstrate the elevation of blood bcaa levels in obese patients , but this may have been caused by a different dietary regimen in the obese subjects [ 79 , 80 ] .
similarly , depletion of serum levels of bcaas was reported in hfd - fed obese mice in other metabolomic studies [ 28 , 56 ] .
an hfd with lower protein content may decrease the supply of bcaas . on the other hand ,
bcaas are presumed to be degraded in muscle and adipose tissue rather than in the liver , and a recent study indicated that adipose tissue may make a more important contribution to the whole body bcaa metabolism .
it was reported that the activities of the mitochondrial branched chain amino acid aminotransferase and branched chain -ketoacid dehydrogenase enzyme complex , the key enzymes in the catabolic pathway of bcaas , were depressed in adipose tissue of obese ob / ob mice and zucker rats , leading to increased bcaa levels .
apart from the elevation of bcaas in plasma , blood c3 and c5 acylcarnitine levels were observed to increase significantly in obesity . in agreement with this ,
higher levels of propionyl- , butyryl- , and hexanoylcarnitines in obese male humans have been detected by metabolomics analysis .
indeed , c3 acylcarnitines are a byproduct of both isoleucine and valine catabolism , and c5 acylcarnitines are intermediates in mitochondrial isoleucine and leucine catabolism . in addition ,
elevation of blood pyruvate and alanine levels ( table 1)both metabolites related to bcaa catabolic pathways could contribute to development of glucose intolerance in obesity .
these metabolite changes may imply an overload of bcaa catabolism in obesity , caused by forcing the now expanded circulating bcaa pool to divert away from protein synthesis and into catabolic pathways .
a recent metabolomic study reported that both blood glutamine and glycine were significantly decreased in obese individuals when compared to their lean controls , which is consistent with the results of a previous study .
both glutamine and glycine are nonessential amino acids that can be synthesized in the body .
glutamine is the most abundant amino acid in plasma , and glutamate , the precursor of glutamine , can be derived from 2-oxoglutarate in the tca cycle .
early experiments with n - labeled amino acids demonstrated that about 50% of the urinary ammonia is normally derived from the amide nitrogen and 16~25% from the amino nitrogen of plasma glutamine .
it has been reported that oral administration of glycine or glutamine is associated with a significant increase in the rate of urea synthesis , and administration of glycine results in a small increase in glutamine turnover in infants .
in addition , as both glutamine and glycine are related to glucose metabolism , the depletion of glutamine or glycine in blood in obesity may lead to the dysfunction of cells .
endogenous creatinine is a break - down product of creatine in muscle , which is biosynthesized from arginine and glycine . in vivo ,
creatinine is usually produced at a fairly constant rate proportional to muscle mass , and then filtered from the blood by the kidneys .
however , previous studies showed increased urinary excretion of creatinine in obese individuals during a 4-hour or 24-hour period .
similar results were observed in hfd - fed obese mice and obese ghr mutant mice ( table 1 ) .
the reason for this may be related to skeletal and cardiac muscle hypertrophy to support and move the increased body mass , endogenous biosynthesis pathways , kidney function , or all of these . in kidney ,
the excretion of creatinine is chiefly determined by glomerular filtration and proximal tubular secretion since virtually no creatinine is reabsorbed in the nephric tubule .
therefore , creatinine levels in blood and urine may be used to calculate the creatinine clearance , which usually reflects renal function in clinic .
it was reported that glomerular filtration rate and renal plasma flow exceeded the normal value by 51 and 31% , respectively , in nondiabetic subjects with severe obesity . however , as indicated , obesity is associated with insulin resistance , hypertension , and dyslipidemia .
these metabolic abnormalities pose a higher risk for kidney diseases , which decreases creatinine clearance [ 92 , 93 ] , as does aging , thus caution is required in interpreting changes in creatinine clearance in obesity and diabetes .
metabolomics as a tool for determining biochemical profiles has in recent years been increasingly employed for investigating obesity and related diseases . with technological improvements in sensitivity and resolution , especially in multihyphenated nmr and ms ,
an increasingly large number of metabolites can be reliably detected and identified simultaneously in biofluids and tissue .
in addition , integration and correlation of data derived from different biofluids , such as urine , plasma or tissues , and even of other omics
these are expected to facilitate the development of metabolic models to understand the alterations of metabolism during obesity and related diseases such as type 2 diabetes .
based on the examples presented in this review , it is evident that metabolomics , especially when integrating multiple detecting techniques or using a multiomics approach , is a useful tool for investigating obesity .
the information generated by metabolomic analysis provides us with increased knowledge as to how the metabolic network is perturbed during obesity . however , dietary influence is a major issue that should be taken into consideration in metabolomics when relating changes in biologically significant metabolites to obesity .
it has been reported that the most recent diet can strongly affect the serum profile of mice , particularly with respect to energy metabolism and glucose utilization , despite fasting prior to serum collection .
hfd - fed animal models are widely used for studying environmental influences resulting in obesity [ 10 , 96 ] . however
, the modified nutrient composition of hfd with a high content of fat ( 59% , 21% for standard diet ) and lower protein availability may instantly change the biofluid profiles such as amino acids , even before obesity occurs , because the levels of many metabolites derive from the balance of de novo synthesis , dietary supplement , and urinary excretion .
in addition , it was found that the food intake of obese mice induced by hfd was decreased approximately 10% .
therefore , in metabolomic analysis the effect of diet needs to be taken into account to obtain the metabolite alterations related to obesity rather than to diet changes . | obesity is a serious health problem with an increased risk of several common diseases including diabetes , cardiovascular disease , and cancer .
metabolomics is an emerging analytical technique for systemic determination of metabolite profiles , which is useful for understanding the biochemical changes in obesity or related diseases both in individual organs and at the organism level .
increasingly , this technology has been applied to the study of obesity , complementing transcriptomics and/or proteomics analyses .
indeed , the alterations of metabolites in biofluids / tissues are direct indicators of variations in physiology or pathology . in this paper
, we will examine the obesity - related alterations in significant metabolites that have been identified by metabolomics as well as their metabolic pathway associations .
issues concerning the screening of biologically significant metabolites related to obesity will also be discussed . |
regulation of protein synthesis in eukaryotic cells occurs primarily at the initiation step of mrna translation , during which ribosomal subunits are recruited to the mrna through the action of eukaryotic initiation factors ( eifs ) .
the regulation of mrna translation initiation plays critical roles in the regulation of cell division , differentiation , growth , survival , and apoptosis , and dysregulation of translation initiation is associated with cancer , obesity , insulin resistance , and impaired responses to various stress situations [ 17 ] .
the two best understood mechanisms for regulation of mrna translation initiation are the regulation of formation of the ternary complex , which consists of the methionine - charged initiator trna , eif2 , and gtp , and the regulation of assembly of the eif4f complex , which involves the association of the mrna 5 cap - binding protein eif4e with eif4 g and eif4a .
phosphorylation of the alpha subunit of eif2 ( eif2 ) blocks ternary complex formation , thereby blocking formation of the 43s preinitiation complex and suppressing global translation
. mammals have four eif2 kinases that are activated by different types of cellular stress , including the unfolded protein response and amino acid deprivation , such that downstream effects of eif2 phosphorylation are shared among different stress - response pathways .
the global attenuation of translation that results from a lack of 43s preinitiation complex paradoxically increases the translation of a subset of mrnas , including that encoding activating transcription factor 4 ( atf4 ) .
upregulation of the translation of atf4 and other target proteins can then lead to increased transcription of stress - related genes ( such as atf3 , asns , cebpb , and trib3 ) , allowing the cell to synthesize the subset of proteins needed to respond to the stress that initiated the response [ 1012 ] .
formation of the eif4f complex is regulated by competition between eif4e binding proteins ( 4ebps ) and eif4 g for binding to eif4e .
the 4ebps compete with eif4 g for a shared binding site of eif4e , such that the binding of 4ebps and eif4 g to eif4e is mutually exclusive . in response to the presence of growth factors and nutrients , mechanistic target of rapamycin complex 1 ( mtorc1 ) phosphorylates 4ebp , which leads to further phosphorylation of additional residues of 4ebp .
the hyperphosphorylation of 4ebp dramatically reduces its affinity for eif4e and thereby promotes its association with eif4 g to form the translationally competent eif4f complex , which recruits the 43s preinitiation complex to the mrna .
4ebp hyperphosphorylation diminishes the capacity of eif4e to bind top - like mrnas much more than other mrnas , which explains why mtorc1 inhibition results in a marked inhibition of translation of a subset of mrnas that tend to encode proteins associated with translation ( e.g. , cytoplasmic ribosomal proteins ) and a more modest suppression of the translation of other mrnas . in mammals ,
the best characterized 4ebp is 4ebp1 , which contains six known ser / thr phosphorylation sites , two of which are phosphorylated directly by mtorc1 [ 13 , 15 , 16 ] .
4ebp1 is most abundant in tissues involved in glucose and lipid homeostasis , including adipose tissue , pancreas , muscle , and liver , whereas 4ebp2 is expressed ubiquitously .
in contrast to 4ebp1 and 4ebp2 , 4ebp3 lacks a conserved n - terminal regulatory motif ( raip ) that is critical for phosphorylation of 4ebp1/2 at the mtorc1-regulated sites [ 13 , 19 ] and may play a different cellular role than 4ebp1 and 4ebp2 .
the regulation of 4ebp1 expression in various tissues has not been studied extensively although studies with cell lines have demonstrated tgf-smad4-mediated , myc - mediated , eif2 kinase - dependent , or atf4-dependent upregulation of 4ebp1 gene transcription . in addition , 4ebp1 gene transcription was negatively regulated by induction of egr1 expression in various cells in response to activation of erk / mitogen - activated protein kinase or pi3k signaling pathways [ 24 , 25 ] . despite the complexity of the body 's responses to various stress situations , the gcn2 ( general control nonderepressible 2 , also known as eif2 kinase 4 ) atf4 pathway is well known to regulate many responses to amino acid deprivation [ 2628 ] and is a likely mediator of the induction of 4ebp1 by sulfur amino acid deprivation .
the 4ebp1 gene contains two ccaat - enhancer binding protein - activating transcription factor ( c / ebp - atf ) response elements ( care ) , and the upregulation of 4ebp1 mrna or protein abundance in response to amino acid deficiency has been reported for cells cultured in medium deficient in an essential amino acid .
upregulation of 4ebp1 has also been shown to occur in murine tissues and in min6 cells following induction of endoplasmic reticulum ( er ) stress with thapsigargin or tunicamycin .
expression of a dominant - negative form of atf4 in min6 cells suppressed 4ebp1 induction by thapsigargin , whereas expression of wild - type atf4 dramatically induced 4ebp1 expression , supporting a critical role for atf4 in induction of 4ebp1 expression . furthermore
, 4ebp1 mrna levels were not increased by thapsigargin in atf4/ murine embryonic fibroblasts ; the transcriptional inhibitor actinomycin d completely blocked induction of 4ebp1 protein by thapsigargin in min6 cells ; disruption of both atf4 binding sites in the 4ebp1 promoter abolished reporter gene expression in min6 cells .
thus , it seems likely that stress conditions , such as amino acid deprivation , may affect translational control by increased 4ebp1 abundance , which could inhibit eif4f assembly , as well as by the well - established mechanism that involves diminished formation of ternary complex , with both the decrease in ternary complex formation and the increase in 4ebp1 abundance dependent on the eif2/atf4 signaling pathway . because we previously saw a marked upregulation of eif2 phosphorylation and induction of stress responses in liver of rats fed a sulfur amino acid - deficient soy protein diet , we decided to explore the expression of hepatic 4ebp1 and its association with eif2 phosphorylation and mtor - mediated 4ebp1 hyperphosphorylation / inactivation in rats fed amino acid - based diets that differed in methionine and cystine content .
the study was conducted using male sprague - dawley rats that weighed approximately 110 g ( ~5 weeks of age ) and were purchased from harlan sprague dawley ( indianapolis , in , usa ) .
rats were housed individually in polycarbonate cages containing corncob bedding in a holding room maintained at 20c and 6070% humidity .
the room was lighted from 21:00 to 09:00 h. rats were fed diets that contained crystalline amino acids instead of protein .
the compositions of the experimental diets , which varied in methionine and cystine levels , are shown in table 1 .
sulfur amino acid levels were based on previous rat studies that demonstrated that 2.3 g methionine is adequate to meet the absolute requirement of growing rats for methionine ( i.e. , the requirement for methionine when cyst(e)ine is not limited in the diet ) [ 29 , 30 ] . for diet preparation ,
the powdered diets were mixed with an equal volume ( 1 l / kg diet ) of hot agar solution ( 3
g / l ) , and the mixture was cooled at room temperature , refrigerated , and cut into cubes for feeding .
all rats were fed a complete amino acid - based diet ( 0.23% m/0.35% c ) for 1 week for acclimation purposes prior to experimental group assignment . at the end of the adaptation week ,
rats were randomly assigned to four experimental groups , which were fed the complete amino acid - based diet ( 0.23% m/0.35% c ) , an amino acid - based diet that contained 0.11% l - methionine and 0.35% l - cystine ( 0.11% m/0.35% c ) , a diet that contained 0.23% l - methionine but no cystine ( 0.23% m ) , or a diet that contained 0.11% l - methionine but no cystine ( 0.11% m ) .
experimental diets were fed for one week , with fresh diet being given at the beginning of the dark cycle each day .
feed intake and body weights were measured daily . at the end of the dietary treatment period ( i.e. , between 13:00 and 14:00 h on day 8) ,
rats were anesthetized with co2 , and liver was rapidly removed , rinsed with ice - cold saline , and frozen in liquid nitrogen .
nonprotein - bound intracellular cyst(e)ine levels were measured by the modified acid ninhydrin method of gaitonde as described by dominy et al . after reduction of disulfides with dithiothreitol .
nonprotein - bound intracellular glutathione levels were measured by the hplc method of cereser et al .
rat liver samples were homogenized in tnes buffer with mammalian protease inhibitor cocktail ( sigma ) , phosstop phosphatase inhibitor cocktail ( roche applied sciences ) , and 50 mm naf to give a 20% ( w / v ) homogenate .
homogenates were centrifuged at 18,000 g for 20 min at 4c , and the protein concentration of the soluble fraction was determined using the bca protein assay ( thermo scientific ) .
fifty micrograms of protein per lane was resolved by sds - page and transferred onto a pvdf membrane ( millipore corp . ) .
membranes were immunoblotted using antibodies to 4ebp1 , ribosomal protein s6 ( rps6 ) , rps6-p ( ser ) , eif2 , eif2-p ( ser ) , eif4e , and actin ( all from cell signaling , danvers , ma , usa ) .
visualization of bands was accomplished either using horseradish peroxidase - coupled secondary antibodies ( 1 : 25,000 dilution in 5% ( w / v ) dry fat - free milk in 1 tbst ) and chemiluminescent substrates ( west dura , pierce ) with exposure to autoradiography film or using irdye - labeled secondary antibody ( 1 : 15,000 ) in odyssey blocking buffer plus 0.1% tween-20 and 0.01% sds ( li - cor biosciences , lincoln , ne , usa ) .
film images were digitized and analyzed using nih image 1.63 software , and odyssey images were analyzed using li - cor odyssey v3.0 software .
rna was isolated using the rneasy mini kit according to the manufacturer 's directions ( qiagen ) .
complementary dna was reverse transcribed using applied biosystems high capacity cdna kit ( applied biosystems ) and quantified using power sybr green ( applied biosystems ) in conjunction with a roche 480 lightcycler ( roche diagnostics ) .
primers for 4ebp1 mrna were forward ( 5-3 ) gatgagcctcccatgcag and reverse ( 5-3 ) ccatctcaaactgtgactcttca .
primers for eif4e mrna were forward ( 5-3 ) gcaatatggacgactgaatgtg and reverse ( 5-3 ) gtgtctgcgtgg gactgata .
results were analyzed by one - way anova , and post hoc tests were done by tukey 's procedure .
due to unequal variance , data for rps6 and 4ebp1 were transformed to square roots prior to statistical analysis .
rats fed any of the three amino acid deficient diets ( 0.11% m/0.35% c , 0.23% m , 0.11% m ) exhibited lower feed intake ( table 2 ) as well as lower body weight ( figure 1 ) compared to control rats fed the complete 0.23% m/0.35% c diet .
rats fed diets containing 0.11% m/0.35% c , 0.23% m , and 0.11% m consumed 60% , 53% , and 62% , respectively , as much diet as control rats .
notably , feed intake of these three sulfur amino acid deficient groups was similar despite the differences in dietary sulfur amino acid deficiency .
rats fed the sulfur amino acid deficient diets lost weight over the 7-day feeding period , whereas rats fed the complete amino acid diet gained an average of 6.9 0.2 g per day .
weight loss for the various sulfur amino acid deficient groups paralleled the magnitude of the sulfur amino acid deficiency ( table 2 ) . in absolute weight , liver was 67% , 57% , and 51% of control for the 0.11% m/0.35% m , 0.23% m , and 0.11% m groups , respectively ( data not shown ) . when adjusted for body weight , the liver weights were not significantly different ( p > 0.05 ) among groups although they still tended to decrease with the degree of sulfur amino acid deficiency ( 94% , 84% , and 78% of control for the 0.11% m/0.35% m , 0.23% m , and 0.11% m groups , resp . ) .
as shown in figure 2 , hepatic thiol levels were markedly lower for rats fed the amino acid deficient diets than for rats fed the control diet .
hepatic total cysteine levels decreased in a stepwise fashion with each decrease in sulfur amino acid content of the diet , with rats fed the 0.11% m/0.35% c diet having 71% , rats fed the 0.23% m diet having 52% , and rats fed the 0.11% m diet having 38% of control cysteine level .
changes in hepatic total glutathione levels tended to parallel total cysteine levels , being 69% , 25% , and 18% of control , respectively , for rats fed the 0.11% m/0.35% c , 0.23% m , and 0.11% m diets .
compared to control rats , both hepatic 4ebp1 mrna abundance and hepatic total 4ebp1 protein abundance were 2- to 4-fold higher in rats fed the two most deficient diets ( 0.23% m and 0.11% m ) ( figure 3 ) . on the other hand ,
the abundances of total 4ebp1 protein and of 4ebp1 mrna were not different from control in liver of rats fed the 0.11% m/0.35% c diet . because an increase in 4ebp1 may have little effect on translation initiation if the amount of eif4e changes in a similar direction , we also measured the abundance of eif4e .
however , neither eif4e protein abundance nor mrna abundance was affected by dietary treatment ( figure 3 ) .
the active , hypophosphorylated ( alpha and beta ) forms of 4ebp1 were higher in liver of rats fed the two most deficient diets than in liver of control rats , following a trend similar to that for total 4ebp1 abundance ( figure 4 ) . neither the abundance of the hyperphosphorylated gamma form of 4ebp1 nor the ratio of gamma 4ebp1 to total 4ebp1 differed among the four groups ( p > 0.05 ) .
although the failure to observe a difference in the proportion of total 4ebp1 in the hyperphosphorylated form in rats fed adequate and deficient diets suggests that there was no change in mtorc1 activity , it is possible that the ratio of -4ebp1 to total 4ebp1 was impacted by the doubling of total 4ebp1 levels in rats fed the diets with 0.11% m or 0.23% m without cysteine . to further assess mtorc1 activation
, we examined the phosphorylation state of the rps6 ( ratio of rps6-p to total rps6 ) as another indicator of mtorc1 activation state ( figure 5 ) .
the p70s6 kinase ( s6k ) is a direct substrate of mtorc1 , and rps6 is the target of p70s6 kinase .
the ratio of rps6-p to total rps6 was significantly lower than control ( p < 0.05 ) in liver of rats fed the 0.11% m/0.35% c and 0.23% m diets but not in liver of rats fed the 0.11% m diet , perhaps due to the concurrent decrease in total rps6 in rats fed the latter diet .
the amounts of rps6-p and total rps6 were significantly lower in liver of rats fed all three of the amino acid deficient diets .
although the ratio of rps6-p to total rps6 was not significantly lower in the 0.11% m group than in the control group , it was similar to the ratios for the 0.11% m/0.35% c and 0.23% m diet groups .
because amino acids can also signal via activation of gcn2 and because eif2 kinase activation may be required for an increase in 4ebp1 expression , we also measured eif2 phosphorylation . an increase in eif2 phosphorylation
surprisingly , rats fed the other amino acid deficient diets had hepatic eif2-p to total eif2 ratios that were similar to or less than those of control rats .
rats given the control diet gained an average of almost 7 g per day , but those given the sulfur amino acid deficient diets did not even maintain their starting body weights .
weight loss was partially due to reduced feed intake , as established by a follow - up comparison of rats fed the 0.11% m diet ad libitum with a group pair - fed the control diet for 7 days . in the follow - up study ( data not reported ) , pair - fed rats gained 1.3 0.2 g per day , whereas rats given free access to the 0.11% m diet lost 4.6 0.3 g per day ( comparable to the 4.3 0.9 g per day lost by the 0.11% m group in the main study ) .
feed intake was similar in the three sulfur amino acid deficient groups , so the contribution of reduced feed intake was presumably similar for all three groups .
lack of adequate sulfur amino acids , however , contributed to weight loss in a stepwise manner , with weight loss being greatest in those with the lowest intakes .
the inadequacy of dietary sulfur amino acids was also reflected in the reduced hepatic cysteine and glutathione levels , which also exhibited a stepwise decrease that followed the magnitude of the deficit .
the effects of dietary sulfur amino acid level on growth of young rats is consistent with earlier studies demonstrating that a diet must provide approximately 5 g methionine equivalents per kg diet , with at least half of this present as methionine , in order to support adequate sulfur amino acid status and maximal growth of sprague dawley rats during their 6th to 8th weeks [ 27 , 29 , 30 ] .
the control diet essentially met this requirement , but the other diets were low either in total sulfur amino acids or in methionine .
total hepatic 4ebp1 mrna and 4ebp1 protein abundances were both elevated in liver of rats fed the 0.23% m or 0.11% m diet but not in rats fed the 0.11% m/0.35% c diet , despite all three groups having similarly reduced feed intakes compared to the control group .
this suggests that essential amino acid deficiency , not just low feed intake , is necessary for induction of 4ebp1 expression in liver of intact rats .
rats fed a protein - free diet had nearly 60% higher ( p 0.05 ) hepatic 4ebp1 levels as well as a 200% higher ( p 0.05 ) level of 4ebp1 mrna than rats fed a control 20% soy protein diet .
rats deprived of food for 60 h , on the other hand , exhibited low levels of 4ebp1 mrna ( 45% of control , p 0.05 ) and of 4ebp1 protein ( 39% of control , p 0.05 ) ( sikalidis , mazor and stipanuk , unreported observations ) .
furthermore , additional analyses of liver of rats fed a 10% soy protein with 0.34% l - methionine ( control ) or without supplemental methionine ( deficient ) demonstrated a robust induction of hepatic 4ebp1 mrna and 4ebp1 protein levels in the sulfur amino acid - deficient group fed the unsupplemented diet ( to 3.4- and 2.4-times control levels , resp . ) ; in this study the sulfur amino acid - deficient rats consumed 83% as much feed and gained 35% as much weight as did the control rats over the 7-day treatment period .
thus , the upregulation of 4ebp1 expression in liver of rats appears to occur in response to mild as well as severe deficiencies of dietary sulfur amino acids as long as the rats are consuming at least half as much feed as control rats ( sikalidis and stipanuk , unreported data ) . in the case of starvation or lack of a source of exogenous energy , it is likely that amino acid concentrations in liver increase due to increased breakdown of muscle protein , which is consistent with our observation of higher cysteine and glutathione levels in liver of starved rats than control rats .
interestingly , we did not see changes in total 4ebp1 in gastrocnemius muscle of rats fed a protein - free diet or in those deprived of feed although both showed a dramatic decrease in 4ebp1 hyperphosphorylation .
this suggests that the regulation of 4ebp1 gene expression may occur in a tissue - specific manner .
severe deficiencies of sulfur amino acids ( i.e. , intakes 0.023 g met equivalents per day ) were always associated with elevated hepatic levels of both total and hypophosphorylated 4ebp1 , except in the case of starvation .
the degree of sulfur amino acid deficiency relative to total feed ( or energy ) deficiency seems to play a role ; however , modest deficiencies appeared to have a greater effect when total feed ( energy ) intake was more adequate ( i.e. , rats fed a 10% soy protein diet in our previous study with feed intake equivalent to 83% of control and met equivalent intake of 0.043 g / day exhibited elevated hepatic 4ebp1 , whereas rats fed the 0.11% m/0.35% c diet with feed intake equivalent to 60% of control and met equivalent intake of 0.063 met equivalents per day did not exhibit a change in hepatic 4ebp1 expression ) . the apparent interaction between sulfur amino acid intake and total feed ( energy ) intake might be explained by greater muscle proteolysis in the rats with the lower feed intakes .
it is reasonable to conclude that the increase in 4ebp1 observed in liver of rats fed sulfur amino acid deficient diets would contribute to the suppression of cap - dependent mrna translation / protein synthesis .
the abundances of eif4e mrna and eif4e protein in liver of rats fed the sulfur amino acid deficient diets were not different from those in liver of control animals , indicating that there was no compensatory increase in eif4e expression to offset the increase in 4ebp1 expression in rats fed diets severely restricted in sulfur amino acids .
assessment of changes in the abundance of the hypophosphorylated forms of 4ebp1 , the forms that are active in binding eif4e , indicated that higher levels of total 4ebp1 expression were associated with higher abundance of the alpha plus beta forms of 4ebp1 .
thus , these results suggest that diets limited in essential amino acids ( at least , sulfur amino acids ) may elevate amounts of total 4ebp1 , which could in turn reduce cap - dependent protein synthesis .
although we did not measure the association of eif4e with either 4ebp1 or eif4 g in this study , numerous studies with animals have shown that an increase in the abundance of the active forms of 4ebp1 is accompanied by increased association of eif4e with 4ebp1 and decreased association of eif4e with eif4 g to form the translationally active eif4f complex [ 3438 ] . in this study ,
the hyperphosphorylation of 4ebp1 , which is dependent upon mtorc1 , was not affected by the different diets .
neither the relative abundance of gamma 4ebp1 nor the ratio of gamma 4ebp1 to total 4ebp1 was different among the four diet groups .
this seems to indicate that mtorc1 activity was not suppressed in liver of rats fed the sulfur amino acid deficient diets , despite their lower feed ( energy ) intake and lower essential amino acid intake . using phosphorylation of rps6 as another measure of mtorc1 activity state , the ratio of phosphorylated rps6 to total rps6 was lower in rats fed the sulfur amino acid deficient diets , suggesting that mtorc1 activity was reduced in rats with lower energy and sulfur amino acid intakes .
other reports have also shown that the magnitude of increased phosphorylation of rps6 was much higher than that of 4ebp1 in response to hepatic mtorc1 activation such that it may be more difficult to observe a decrease in 4ebp1 phosphorylation , leading to less gamma 4ebp1 , than to observe a decrease in rps6 phosphorylation by rps6 kinase [ 39 , 40 ] .
nevertheless , the overall outcome was clearly a greater abundance of the hypophosphorylated forms of 4ebp1 ( i.e. , alpha + beta 4ebp1 ) in liver of rats fed diets severely limiting in sulfur amino acids .
the upregulation of 4ebp1 protein was tightly associated with upregulation of 4ebp1 mrna abundance . because cell culture studies have suggested that 4ebp1 expression may be upregulated by a gcn2-eif2-atf4 mechanism [ 23 , 26 ] and because the role of atf4 in 4ebp1 gene transcription has been clearly established in min6 cells , we assessed the phosphorylation of eif2. in contrast to the close associations observed earlier between eif2 phosphorylation and levels of atf4 , atf3 , asns , slc7a11 , cars , and cth protein abundance in liver of rats fed diets limited in sulfur amino acids
, we did not observe a consistent association of eif2 phosphorylation with increased 4ebp1 protein levels .
although both eif2 phosphorylation and total 4ebp1 expression were upregulated in liver of rats fed the 0.11% m diet compared to the 0.23% m/0.35% c diet , 4ebp1 expression but not eif2 phosphorylation was upregulated in liver of rats fed the 0.23% m diet .
these results might be explained by differences in the time courses of eif2 phosphorylation in liver of rats fed the two diets ; rats fed the 0.23% m diet may have been able to adapt more adequately such that eif2 phosphorylation was reduced by 7 days .
other investigators have reported that eif2 phosphorylation and increases in atf4 abundance tend to peak prior to peak expression of the downstream stress response proteins [ 6 , 4143 ] .
another possibility is that a pathway not involving eif2 phosphorylation can induce 4ebp1 gene expression . in this
regard , methionyl - trna synthetase , which adds methionine to both initiator and elongator trna , has been shown to be a substrate for gcn2 , at least under some conditions , and phosphorylation of methionyl - trna synthetase by gcn2 prevents binding of trna to the enzyme , reducing the aminoacylation of both initiator and elongator trna [ 44 , 45 ] .
further work will be required to elucidate whether increases in hepatic total 4ebp1 expression in response to sulfur amino acid - limited diets is independent , or partially independent , of eif2 phosphorylation status .
interestingly , gcn2 phosphorylation of either eif2 or methionyl - trna synthetase would negatively impact ternary / preinitiation complex formation . whether or not 4ebp1 expression would be increased in response to deficiencies of essential amino acids other than sulfur amino acids was not addressed in this work , but studies performed in cell culture systems suggest that this would be the case .
deficiencies of any essential amino acid are known to activate gcn2 's kinase activity although responses to particular amino acids tend to vary with cell type [ 11 , 26 , 46 , 47 ] .
. showed that removal of any single essential amino acid from the medium resulted in an increase in total 4ebp1 abundance but variable increases in eif2 phosphorylation or atf4 abundance , suggesting likely crosstalk among signaling pathways that are not all impacted similarly by lack of a particular essential amino acid .
even eif2 phosphorylation and atf4 abundance were poorly correlated , with leucine and threonine deficiency yielding the higher degrees of eif2 phosphorylation but valine and methionine yielding the highest levels of atf4 abundance .
it is possible that a methionine deficiency could have some unique effect beyond those mediated by gcn2 , perhaps via reduced availability of charged initiator trna as discussed above .
results reported here for hepatic 4ebp1 expression in rats fed sulfur amino acid deficient diets further support a physiological role for changes in 4ebp1 expression in the response of animals to a deficiency of essential amino acids . in both this study and the previous study in intact rats , higher total 4ebp1 abundance was not associated with an increase in the proportion of the 4ebp1 in the hyperphosphorylated , inactive form .
thus , changes in hepatic 4ebp1 expression led to parallel changes in the abundance of the active , hypophosphorylated forms of 4ebp1 available to bind eif4e and block cap - dependent translation initiation .
it seems likely that elevated levels of 4ebp1 are involved in regulation of hepatic protein synthesis under conditions of severe limitations of one or more essential amino acids in the face of only modest limitations of energy and other nutrients .
induction of 4ebp1 expression in liver of rats fed diets severely limited in sulfur amino acids did not appear to require sustained eif2 phosphorylation , although we can not rule out a contribution of eif2 phosphorylation to 4ebp1 induction . despite similar levels of total 4ebp1 in liver of rats fed the 0.23% m and 0.11% m diets , the abundance of 4ebp1 mrna was higher in liver of rats fed the 0.11% m diet , which also had elevated levels of phosphorylated eif2 , than in liver of rats fed the 0.23% m diet , which did not have elevated levels of phosphorylated eif2. we are currently undertaking studies in cell culture models to address how a sulfur amino acid deficiency is sensed and what signaling pathways are involved in increased expression of 4ebp1 .
regardless of the underlying amino acid sensing and signaling mechanisms , it is nevertheless clear from this study that changes in total 4ebp1 expression should be considered when examining mechanisms that attenuate protein synthesis during amino acid deficiency states . | translation initiation is known to be regulated by the binding of eukaryotic initiation factor 4e ( eif4e ) by binding proteins ( 4ebps ) , and there is evidence that amino acid deprivation and other cellular stresses upregulate 4ebp1 expression . to pursue the question of whether diets limited in an essential amino acid lead to induction of 4ebp1 expression in vivo , diets that varied in methionine and cystine content were fed to rats for 7 days , and 4ebp1 mrna and protein levels and 4ebp1 phosphorylation state were determined .
total 4ebp1 mrna and protein abundance increased in liver of rats with severely deficient intakes of sulfur amino acids ( 0.23% or 0.11% methionine without cystine ) but not in animals with a less restricted intake of sulfur amino acids ( 0.11% methionine plus 0.35% cystine ) but a similarly restricted intake of total diet ( 53 to 62% of control ) .
the amount of 4ebp1 binding activity ( + forms ) was elevated in liver of rats fed sulfur amino acid - deficient diets , whereas the hyperphosphorylation of 4ebp1 was not affected by dietary treatment .
results suggest that changes in total 4ebp1 expression should be considered when examining mechanisms that attenuate protein synthesis during amino acid deficiency states . |
hereditary hemorrhagic telangiectasia ( hht ) , also known as osler - weber - rendu disease , is a rare , genetically determined disorder of vascular dysplasia .
it can manifest at any age and is known to be present in all races , in all parts of the world . the prevalence in india is not known .
recurrent epistaxis is the most common presentation ; however , some patients present with bleeding involving major organs leading to stroke and pulmonary hemorrhage .
approximately 90% of the patients manifest by age 40 years or later . in most cases ,
there is a mutation in one of the two genes that are required for normal angiogenesis .
both telangiectasias and avms represent a direct connection between arteries and veins , without bridging capillaries .
telangiectasias occur on mucocutaneous surfaces ( i.e. , nose , gastrointestinal tract , and skin ) ; avms develop in larger organ systems ( i.e. , lungs , liver , and brain ) .
the hht may also be associated with other diseases , such as , juvenile polyposis syndrome and primary pulmonary hypertension .
this disorder is identified by features of telangiectasia , recurrent epistaxis , and a positive family history .
a 82-year - old post menopausal housewife presented to the emergency department with complaints of episodic breathlessness and easy fatigability since five years .
breathlessness was subtle in onset , initially grade 1 new york heart association ( nyha ) progressing to grade 3 nyha .
there was no history of orthopnea , paroxysmal nocturnal dyspnea ( pnd ) , wheezing , chest pain , palpitations , seasonal variations , cough or fever . since five years
, she had been visiting a number of hospitals on outpatient department ( opd ) basis and was treated symptomatically .
, she was afebrile , pale , acyanotic , and normotensive , with a respiratory rate of 28 breaths / minute and a pulse of 108 beats / minute , and did not have signs of heart failure .
a cardiovascular and respiratory system examination revealed tachycardia and crepitations in the right infrascapular area . the jugular venous pressure ( jvp ) was not elevated .
investigations showed a hemoglobin of 5.3 gm / dl , total leucocyte count of 9100/cumm , with 84% neutrophils , and a platelet count of 1.79l / cumm .
the packed cell volume ( pcv ) was 20.1 and the erythrocyte sedimentation rate ( esr ) was 30 mm at the end of one hour and the peripheral smear showed microcytic hypochromic anemia . the chest x - ray ( cxr ) showed a right paracardiac mass [ figure 1 ] .
the iron study showed low ferritin levels . in view of occult blood in stool ,
an upper gastrointestinal ( gi ) endoscopy was done , which showed multiple telangiectases in the pyriform fossa , esophagus , and gastric mucosa [ figure 2 ] .
however , in view of the right paracardiac mass on chest x - ray , a ct thorax was done , which showed a well - defined serpiginous mass in the right lower zone suggestive of av malformation .
a pulmonary angiogram was done , which confirmed the presence of large av malformation in the right lung [ figure 3 ] .
cxr showing right lower zone opacity with hilar prominence mucosal telangiectasia seen on upper gi endoscopy .
( a ) pyriform fossa ( b ) stomach ( a ) non - contrast ct chest showing a well - circumscribed serpiginous mass in the right lower lobe of the lung ( b ) contrast ct chest showing contrast enhancement of the serpiginous mass ( c ) ct pulmonary angiogram showing large av malformation arising from the right descending pulmonary artery , drained by an enlarged tributary of the pulmonary vein ( d ) ct pulmonary angiogram showing large av malformation arising from the right descending pulmonary artery , drained by an enlarged tributary of the pulmonary vein retrospective enquiry revealed episodic epistaxis in the past and a family history of bleeding tendencies in the form of recurrent epistaxis and gum bleeding ( pedigree chart - figure 4 ) .
( a ) cutaneous telangiectasia over the tips of fingers ( b ) mucosal telangiectasia over the tongue the patient was treated with blood transfusion , hemetinics , and oxygen therapy , after which the hemoglobin improved to 10.4 gm / dl .
the patient was given the option of coil embolization for pulmonary avm , but the patient refused the same and is on regular follow - up . in order to screen for cerebral av malformations , magnetic resonance ( mr ) angiogram of the brain
the syndrome is named after henri rendu , sir william osler , and frederick parks weber , who published many observations of the syndrome , but it was sutton ( 1864 ) , who first described the osler - weber - rendu disease .
type 1 and type 2 are due to defective endoglin- ( eng ) and activin - like receptor kinase ( alk1 ) genes , respectively .
the eng and alk1 genes are located on the long arms of chromosomes 9 and 12 , respectively .
hht type-3 involves mutations in the long arm of chromosome 5 ( 5q31.1 - 32 ) and type-4 maps to the short arm of chromosome 7 ( 7p14 ) .
pulmonary and cerebral avms ( cavm 's ) are more common in patients with type 1 hht , whereas , severe gi bleed and hepatic avms are common in type 2 .
series of seven patients published by puri et al . , in 1996 , the median hemoglobin was 4 gm / dl .
these telangiectatic vessels are very fragile and can rupture easily when the nasal mucosa dries up .
epistaxis being the most common symptom in hht , occurs in 90% of the patients and has a wide range of severity , even among affected family members .
the average age of onset of epistaxis is 12 years , with nearly 100% affected by age 40 years .
the diagnosis of hht should be suspected when there is a history of recurrent and unprovoked nosebleeds , skin or mucosal telangiectasias , and a family history of epistaxis .
telangiectasias can occur anywhere on the skin , but are most common on the face , chest , and hands .
mucosal telangiectasias can occur anywhere along the gi tract and are often visible on the lips and tongue ( as seen in our patient ) .
apart from epistaxis , the gi bleeding that occurs in approximately one third of the patients is another common cause of iron - deficiency anemia . about 15 to 30% of the patients with hht1
hence , the disorder should be considered in any patient diagnosed with a pulmonary avm .
right - to - left shunt between the pulmonary and systemic circulation across the avm can lead to hypoxemia .
arteriovenous malformation is also seen in the liver ( 30% ) and brain ( 10% ) .
hepatic avms can lead to portal hypertension , biliary disease , and high output cardiac failure , secondary to shunting between the hepatic artery and vein .
the criteria for diagnosis are based on the four components : ( 1 ) epistaxis : spontaneous and recurrent . ( 2 ) telangiectasias : multiple , at characteristic sites , including lips , oral cavity , fingers , and nose .
( 3 ) presence of internal lesions : gi telangiectasia , pulmonary , hepatic , cerebral , and spinal avms . ( 4 )
the diagnosis is considered definite if any three of the above - mentioned criteria are present and possibly if any two of the criteria are present .
our patient had spontaneous and recurrent epistaxis along with recurrent gum bleeding , with the background of a family history of epistaxis and gum bleeding .
it has been said that it may have the risk of missing the diagnosis in children and young adults with undiagnosed pavm / cavms , as these group of patients develop epistaxis and telangiectasia later in life .
epistaxis is treated by use of ointments , humidification of indoor air and avoidance of dry climates to decrease drying of the nasal mucosa .
estrogen has been tried ( topically or systemically ) to help support the nasal mucosa and decrease bleeding .
this is based on the belief that nasal mucosa is a hormone - modulated tissue .
laser coagulation of nasal telangiectasias , septal dermoplasty , youngs procedure , and embolization have been attempted , with temporary benefit .
the current recommendation is to treat any avm that is at least 3 mm in diameter , although some physicians treat avms as small as 1 mm .
other precautions include antibiotic prophylaxis before any invasive procedure , to prevent the risk of infection and cerebral abscess , and use of air filters on all intravenous lines .
scuba diving is not recommended for these patients , because of the risk of decompression sickness .
even though hht is the most common cause of pavm , it is worth remembering other causes for the same , which include , trauma , malignancy , hepatopulmonary syndrome , and cardiac surgery .
medical therapies under investigation include vascular endothelial growth factor ( vegf ) for the treatment of epistaxis and advanced liver disease and thalidomide for gi bleeding .
here we report a case of hht in an 82-year - old woman , who presented with a history of recurrent anemia , epistaxis , and gum bleed in the past , with a background family history of epistaxis and gum bleed in first - degree relatives . on evaluation
our patient met all the four components of the curacao criteria , confirming the diagnosis of hht .
the hht foundation international has helped fund a number of centers of excellence that provide a multidisciplinary approach to the treatment and research of this disease .
patients are encouraged to visit these centers when the need arises and to remain in contact with them about new studies and developing treatments . | arteriovenous malformation ( avm ) is a rare vascular anomaly of the lung , which manifests predominantly as dyspnea ( due to right to left shunting ) and paradoxical embolism .
hereditary hemorrhagic telangiectasia ( hht ) being a rare genetic disorder is one of the most common causes of pulmonary arteriovenous malformation ( pavm ) .
here we report an interesting case of recurrent anemia in an elderly female , who was subsequently found to have multiple cutaneous and mucosal telangiectasias and a large pulmonary avm . |
the soft palate is the posterior fibrovascular part of the palate that is attached to the posterior edge of the hard palate .
it participates in most of the oral functions like speech , swallowing , and respiration .
although continuous research on dimensional analysis of soft palate and its surrounding structures has been made , still there is a gap in the identification of soft palate morphological patterns and configuration .
soft palate plays a very crucial role in velopharyngeal closure , that is , approximation of soft palate with pharyngeal walls .
this sphincteric mechanism separates nasal and oral cavity during speech and deglutition . in this context , the study of these soft palate patterns like shape , length , and width offers a clue to evaluate any risk factors for velopharyngeal incompetence .
various authors conducted studies to assess the dimensional changes of soft palate with increasing age and changes in cleft lip and palate and in patients with sleep apnea using cephalometry [ 4 , 5 ] whereas studies regarding osmf were very limited .
oral submucous fibrosis is a chronic progressive disease affecting any part of the oral cavity and sometimes the pharynx .
it is always associated with juxtaepithelial inflammatory reaction followed by fibroelastic change of the lamina propria with epithelial atrophy .
the clinical manifestations include stomatitis , limited mouth opening , difficulty in speech and swallowing , and even hearing loss .
oral submucous fibrosis is one such pathology that could alter the dimensions of soft tissue components like oral mucosa and soft palate ; in this aspect , the present study aimed to evaluate the morphological patterns of soft palate in both normal and oral submucous fibrosis individuals . according to the literature search , to the best of our knowledge
all the procedures conducted in the present study were in compliance with the declaration of helsinki ( 2000 ) and the study protocol was approved by the institutional ethical committee of drs .
a total of 100 subjects with age range of 2070 years were included in this study .
they were divided into two groups : group 1 ( study group ) comprising 50 subjects who were clinically diagnosed with oral submucous fibrosis and group 2 ( control group ) requiring lateral cephalograms for a diagnostic purpose .
exclusion criteria were as follows : patients with history of systemic diseases , syndromes , fractures of head and neck , and cleft palate were excluded from the study . clinical diagnosis and staging of oral submucous fibrosis
characteristics of stage i , early osmf , included the following : mild blanching , no restriction in mouth opening ( normal distance between central incisor tips : males , 35 to 45 mm ; females , 30 to 42 mm ) , and no restriction in tongue protrusion .
characteristics of stage ii , moderate osmf , included the following : moderate to severe blanching , reduced mouth opening by 33% , demonstrably reduced cheek flexibility also , burning sensation also in the absence of stimuli , palpable bands felt , lymphadenopathy either unilateral or bilateral , and demonstrable anemia on hematological examination . characteristics of stage iii , severe osmf , included the following : very severe burning sensation .
the patient was unable to carry out day - to - day work , with more than 66% reduction in the mouth opening , cheek flexibility , and tongue protrusion .
ulcerative lesions may appear on the cheek , thick palpable bands and lymphadenopathy bilaterally evident .
all lateral cephalograms were taken using digital radiographic machine ( kodak 8000 digital panoramic and cephalometric machine , italy ) . a tube potential of 82 kv , a tube current of 10 ma , and an exposure time of 500 ms were used to optimize the contrast of the digital images .
the digital radiographs were processed and viewed by using kodak dental imaging software , version 6.12 .
lateral cephalometric analysis was performed to evaluate the different morphological patterns of soft palate by taking the radiographs in standardized position .
all the radiographs were observed and categorized into six types according to the soft palate morphology and were evaluated by two oral and maxillofacial radiologists .
the anteroposterior ( a - p ) length was evaluated by measuring the linear distance from the posterior nasal spine to the tip of the uvula of the resting palate .
the superoinferior ( s - i ) width was measured at the thickest section of the velum .
different patterns of soft palate were recorded , based on classification by you et al .
, as follows : type 1 ( leaf shape ) , type 2 ( rat - tail shape ) , type 3 ( butt - like shape ) , type 4 ( straight line shape ) , type 5 ( s - shape ) , and type 6 ( crook appearance of the soft palate ) .
all statistical procedures were performed using statistical package for the social sciences ( spss ) version 16 .
the significance of the differences between the means and the distribution of various patterns of soft palate were evaluated using mann - whitney u test and kruskal wallis test .
in the present study , the mean age of the subjects was 39 years . on the basis of the radiographic appearances in the lateral cephalograms , the soft palate patterns were categorized as type 1 ( leaf shape ) , which was lanceolate , indicating that the middle portion of the soft palate elevated to both the naso- and the oro - side ( figure 1 ) ; type 2 ( when the soft palate showed that the anterior portion was inflated and the free margin had an obvious coarctation , the radiographic appearance was described as having a rat - tail shape ) ( figure 2 ) ; type 3 ( butt - like soft palate showed a shorter and fatter velum appearance , and the width had almost no distinct difference from the anterior portion to the free margin ) ( figure 3 ) ; type 4 ( which indicated that the image of the soft palate presented a straight line shape ) ( figure 4 ) ; type 5 ( the distorted soft palate presented the s - shape ) ; type 6 ( which revealed a crook appearance of the soft palate , in which the posterior portion of the soft palate crooks anterosuperiorly ) ( figure 5 ) . the highest percentage of rat - tail shaped soft palate was present in control group .
similarly , a high percentage of butt - like and crooked shaped soft palates were present in the study group .
kruskal wallis test was used for comparing the mean values of a - p length and s - i width in both groups according to type - wise distribution , showing significant difference ( p < 0.05 ) in both a - p length and s - i width in type 1 pattern . in type 2 and 3 soft palate patterns ,
a difference in dimensions was significant only with a - p length and in type 6 with regard to s - i width ( p < 0.05 ) .
no significant difference was observed ( p < 0.05 ) between study and control group with respect to s - i width in types 2 , 3 , and 4 and a - p length in types 4 and 6 ( p > 0.05 ) .
the highest a - p length was observed in leaf shaped soft palate , while the highest s - i width was observed in butt - like soft palate in both groups ( table 1 ) .
mann - whitney u test was used to measure the a - p length and s - i width of soft palate showing mean value of a - p length as 32.09 in study group and 35.29 in control group .
mean value of s - i width was 10.19 and 9.23 in study and control groups , respectively , with statistically significant p value of 0.001 .
this indicates that a - p length was significantly greater in the control group , while s - i width was significantly greater in the study group .
this specifies that the soft palate becomes short and stout / bulky in osmf ( table 2 ) .
type - wise distribution of soft palate patterns according to staging of osmf in the study group showed 79.16% of cases with type 1 and 55.56% of cases with type 2 soft palate pattern in stage ii osmf .
66.66% of type 3 and the highest percentage of cases showing type 6 soft palate variant were seen in stage iii osmf .
one in each of stage i and ii osmf showed type 4 variant ( table 3 ) .
the mean length and width of soft palate patterns according to stagewise distribution of osmf revealed that the a - p length of soft palate is significantly greater in stage i than in stage ii .
the s - i width of stage iii palate is significantly greater than of stage i and stage ii ( table 4 ) .
interestingly , a negative correlation was observed in staging of osmf and a - p dimensions .
that is , as the staging increases , the a - p dimension decreases , but the s - i dimension increases along with staging ( table 5 ) .
the assessment of the soft tissue elements like soft palate and surrounding structures cephalometry is a comparatively economical method .
the dimensional analysis of the soft palate and its surrounding structures , especially the velar length and width , which has been overlooked in the past , is reasonably responsible for the different dimensions of the soft palate . to diagnose varied pathologies of soft palate like neoplastic , neurologic , and inflammatory conditions ,
morphological variants of soft palate play a very crucial role especially in conditions like cleft palate and obstructive sleep apnea .
velopharyngeal insufficiency and hypernasal speech are still the topic of debate in surgically successful but functionally compromised cases owing to varied morphologies of soft palate and surrounding structures .
henceforth , proper assessment of soft tissue morphology is mandatory to gain better results . oral submucous fibrosis is a chronic insidious disease of the oral cavity affecting mucosa and submucosa of soft palate , anterior faucial pillars , buccal mucosa , tongue , and lips [ 11 , 12 ] .
gaining meticulous knowledge regarding changes in soft palate morphology due to osmf will be helpful for proper diagnosis and successful structural and functional outcome . according to literature search
, there were only limited studies regarding this aspect ; hence , the present study was performed to evaluate morphological changes of soft palate in osmf patients and comparison was done with normal individuals . in our study group ,
52.2% had leaf shape soft palate which was the most common variant , with straight line variant being the least common type .
the s - shape soft palate was not observed in both study and control groups .
in the control group , rat - tail shaped soft palate was predominantly seen , and straight line and crook shaped patterns were the least common .
, leaf shaped soft palate was described as the most common variant and crook shape as the least common variant . in the current study , stage ii osmf was predominantly seen in 29 cases , in which type 1 pattern was seen in 19 cases ( leaf shape ) , type 2 ( rat - tail shape ) in 5 cases , type 3 ( butt - like shape ) in 4 cases , and type 4 ( straight line ) in 1 case . stage iii osmf was observed in 14 cases , in which type 1 was shown in 3 cases ( leaf shape ) , type 3 ( butt - like shape ) in 6 cases , and type 6 ( crook shape ) in 5 cases .
seven cases were seen in stage i osmf , among which type 1 ( leaf shape ) was seen in 2 cases , type 2 ( rat - tail shape ) in 4 cases , and type 4 ( straight line ) in 1 case . based on the above findings , soft palate shows morphological changes with the progression of the disease ,
these changes were attributed to the fibrosis of the mucosal covering of soft palate and uvula .
the mean length of type 1 ( leaf shape ) soft palate in the present study was 34 mm whereas for normal individuals it was 36.82 mm .
the s - i width in the study group was 10.14 mm and in normal individuals it was 9.73 mm .
there is significant reduction in length of the soft palate in the study group when compared with control group .
this type of soft palate was seen in 7 cases of stage i , 19 cases of stage ii , and 3 cases of stage iii osmf .
type 2 ( rat - tail ) soft palate was noted in 4 cases of stage i osmf and 5 cases of stage ii osmf .
the mean a - p length and s - i width in the present study were 31.80 mm and 8.34 mm whereas for normal individuals they were 35.31 mm and 8.60 mm .
reported no significant difference pertaining to both length and width of type 2 soft palate .
type 3 ( butt - like ) soft palate was seen in 4 cases of stage ii osmf and 6 cases of stage iii osmf .
the a - p length was 28.99 mm in the study group and 30.64 mm in normal individuals .
the s - i width in the study and control group was 11.66 mm and 11.42 mm , respectively .
even as there was a mild difference observed in s - i width , the difference was not statistically significant ( p > 0.05 ) .
considering the findings , a slight increase in the width and reduction in the length of soft palate were found .
similar findings were observed in the study conducted by shankar et al . , while contradictory results were obtained according to verma et al . .
type 4 ( straight line ) variety of soft palate was seen in one case in each of stage i and ii osmf .
the mean a - p length in study and control group was 28.98 mm and 35.15 mm , respectively .
the s - i widths between the study group ( 9.80 mm ) and control group ( 5.62 mm ) were compared .
even though the length and width were less in the study group when compared to control group , the results were not statistically significant which may be due to small sample size .
ppin et al . found the s - shape ( type 5 ) which had hooked appearance of the soft palate in their study , with angulation of about 30 between distal part of uvula and longitudinal axis of soft palate .
therefore , the study concluded that hooked appearance in awake patients indicates a high risk for obstructive sleep apnea syndrome .
kumar and gopal conducted a study in 100 normal individuals to evaluate the soft palate patterns and found only 2% of the cases showing s - shape ( type 5 ) pattern of soft palate .
type 6 ( crook shaped ) soft palate was seen in 5 cases of stage iii osmf .
the mean a - p length was 30.89 mm whereas for normal individuals it was 31.9 mm and the mean s - i widths were 10.95 mm and 9.14 mm in normal individuals .
stage i osmf was seen in 7 cases where a - p length was 32.96 mm and s - i width was 8.97 mm and where the length is almost comparable with normal individuals , that is , 35.29 mm . in stage
ii osmf , a - p length and s - i width were 32.70 mm and 10.00 mm and for stage iii they were 29.98 mm and 11.18 mm , respectively .
but the change is more pronounced in a - p length than in s - i width .
these changes can be attributed to the fact that the length of the soft palate and uvula corresponds to the stage of the disease , that is , gradual shortening of soft palate and uvula with the progression in the staging of osmf . in our study
, there was a gradual change in the dimensions and patterns of soft palate with advance in staging of osmf and interestingly a negative correlation was observed in staging of osmf and anteroposterior dimensions .
that is , as the staging advances , the anteroposterior dimension decreases , but the superoinferior dimension increases along with staging .
type 1 and 2 variants of soft palate were predominantly seen in initial stages of osmf , whereas type 3 and 6 variants were observed in advanced stages of osmf . | oral submucous fibrosis ( osmf ) is a chronic insidious disease affecting mucosa and submucosa of oral cavity and soft palate .
the present study aimed to evaluate the morphology of soft palate in normal individuals and osmf patients using lateral cephalometry and to compare and correlate these variants of soft palate with different stages of osmf .
100 subjects were included in the study , who were divided into two groups .
group i included 50 subjects with clinical diagnosis of osmf and group ii included 50 normal subjects ( control group ) . using digital lateral cephalometry , velar
length and width were measured and soft palatal patterns were categorized based on you et al . 's classification . leaf and rat - tail patterns of soft palate were predominant in control group , whereas butt and crook shaped variants were more in study group .
anteroposterior ( a - p ) length of soft palate was significantly greater in stage i osmf , while superoinferior ( s - i ) width was greater in stage iii osmf .
interestingly , a negative correlation was observed in staging of osmf and a - p dimensions . as the staging of osmf advances , the a - p length of soft palate decreases , but s - i width increases . |
prostate cancer is a slow growing tumor usually without any sign or symptom in the early stages of the disease ( 1 ) .
measurement of serum prostate specific antigen as a screening test and transrectal ultrasonography ( trus ) guided prostate biopsy in suspicious men help in the early detection of prostate cancer ( 2 , 3 ) . early diagnosis and treatment of the disease , when the tumor is confined to the prostate capsule , leads to complete cure of the patient with excellent prognosis .
if it remains undiagnosed , the tumor will extend to the prostate capsule with subsequent invasion to periprostatic tissue and involvement of periprostatic fat , neurovascular bundles , seminal vesicles , denonvillier s fascia and in more advanced stages to the bladder base and farther pelvic structures .
the tumors that are limited to prostate capsule have better prognosis and are usually treated by radical prostatectomy , but the tumors that are extended beyond the prostate capsule have worse prognosis and are usually treated by radiation therapy .
involvement of seminal vesicles is one of the important factors in treatment planning and patient prognosis . before widespread use of mri ,
in a great number of patients , seminal vesicle involvement remained undetected until performing surgery .
baseline psa , biopsy gleason sum and maximum tumor volume of prostate cores are used traditionally for clinical staging of prostate cancer , but it is not accurate in the prediction of t stage of the tumor . in many patients with t3 stage prostate cancer , it leads to understaging ( 4 ) .
high resolution mri with endorectal coil for local staging of prostate cancer after detection of prostate cancer in transrectal ultrasonography ( trus ) guided biopsy is recognized as the most accurate method in detecting tumor extension .
it influences treatment planning and helps to choose the most suitable plan for the patient and to estimate the prognosis ( 5 - 9 ) .
the objective of this study was to determine the value of prostate mri with endorectal coil in detecting seminal vesicle involvement in patients with prostate cancer .
from april 2011 to august 2013 , the total number of 238 patients proven to have prostate cancer by trus guided biopsy were enrolled into the study . the objectives and methods of the study
the protocol for the research project has been approved by the ethics committee of iran university of medical sciences and it conforms to the provisions of the declaration of helsinki ( as revised in edinburgh 2000 ) .
high resolution mri of prostate gland was obtained in all patients with a 1.5 tesla mri machine ( avento , siemens , erlangen , germany ) using a combination of pelvic phased array and endorectal coils .
the protocol of the study was as follows : axial , coronal and sagittal t2 weighted turbo spin echo images ( tr = 5650 ms , te = 100 ms , slice thickness =3 mm , field of view=190 190 ) , axial t1 weighted turbo spin echo images ( tr = 450 ms , te = 14 ms , slice thickness = 3 mm , field of view = 190 190 ) , volumetric interpolated breath hold examination ( vibe ) images ( tr = 4.9 ms , te = 1.8 ms , slice thickness = 3.6 mm , field of view = 240 240 ) in multiple phases before and after intravenous injection of gadolinium contrast agent ( gadovist , bayer pharma , berlin , germany ) .
all images were reviewed on one workstation by an expert uroradiologist to detect seminal vesicle involvement .
after radical prostatectomy that was performed in a maximum of 20 days after mr study , the mri results were compared with pathology results .
the prostate cancer patients who did not have radical prostatectomy or with uncertain pathology data were excluded from the study .
the statistical analysis of the collected data was performed by spss version 16 ( spss inc . ,
for comparison of the continuous variables between two groups , at first we evaluated the normality of the data .
if the data were distributed normally , we performed the t - test for comparison of the means between the two groups .
from april 2011 to august 2013 , the total number of 238 patients proven to have prostate cancer by trus guided biopsy were enrolled into the study . the objectives and methods of the study
the protocol for the research project has been approved by the ethics committee of iran university of medical sciences and it conforms to the provisions of the declaration of helsinki ( as revised in edinburgh 2000 ) .
high resolution mri of prostate gland was obtained in all patients with a 1.5 tesla mri machine ( avento , siemens , erlangen , germany ) using a combination of pelvic phased array and endorectal coils .
the protocol of the study was as follows : axial , coronal and sagittal t2 weighted turbo spin echo images ( tr = 5650 ms , te = 100 ms , slice thickness =3 mm , field of view=190 190 ) , axial t1 weighted turbo spin echo images ( tr = 450 ms , te = 14 ms , slice thickness = 3 mm , field of view = 190 190 ) , volumetric interpolated breath hold examination ( vibe ) images ( tr = 4.9 ms , te = 1.8 ms , slice thickness = 3.6 mm , field of view = 240 240 ) in multiple phases before and after intravenous injection of gadolinium contrast agent ( gadovist , bayer pharma , berlin , germany ) .
all images were reviewed on one workstation by an expert uroradiologist to detect seminal vesicle involvement .
after radical prostatectomy that was performed in a maximum of 20 days after mr study , the mri results were compared with pathology results .
the prostate cancer patients who did not have radical prostatectomy or with uncertain pathology data were excluded from the study .
the statistical analysis of the collected data was performed by spss version 16 ( spss inc . ,
for comparison of the continuous variables between two groups , at first we evaluated the normality of the data .
if the data were distributed normally , we performed the t - test for comparison of the means between the two groups .
considering the total number of patients , the mean age was 67.4 9 years , mean psa level was 16.7 18 g / mland mean gleason score was 5.7 2 .
the mean age of the patients with seminal vesicle involvement was 70 9.1 years , while this figure was 66.6 8.6 years in the other group ( p = 0.009 ) .
the mean psa level in patients with seminal vesicle involvement was 27 26.2 g / ml , while this figure was 13 13.4 g / ml in the other group ( p < 0.001 ) . the mean gleason score in patients with seminal vesicle involvement was 7.9 1.1 , while this figure was 4.9 1.1 in the other group ( p < 0.001 ) .
after radical prostatectomy , pathology confirmed the involvement of seminal vesicles by prostate cancer in 63 ( 23.5% ) patients . in 175 ( 73.5% ) of the patients ,
seminal vesicles were intact without evidence of tumoral involvement . in two ( 0.8% ) patients , seminal vesicle involvement was diagnosed by pathology but not detected by mri ( figures 1 and 2 ) .
the sensitivity , specificity , positive predictive value and negative predictive value of mri in detecting seminal vesicle involvement in patients with prostate cancer were as follows ; the sensitivity was 0.97 [ 95% confidence interval ( ci ) = 0.89 - 0.99 ] , specificity was 0.98 [ 95%ci = 0.94 - 0.99 ] , positive predictive value was 0.94 [ 95%ci = 0.85 - 0.98 ] and negative predictive value was 0.99 [ 95%ci = 0.96 - 0.99 ] .
in addition , the positive likelihood ratio and negative likelihood ratio of mri with their 95% ci were 42.9 ( 16.3 - 113.1 ) and 31.8 ( 8.1 - 124.3 ) , respectively .
detecting seminal vesicle involvement is an important part of local staging of prostate cancer and it has great impact on treatment planning and prognosis ( 10 ) .
patients with locally advanced prostate cancer are mostly treated by radiation therapy rather than radical prostatectomy .
treating patients with stage t3 prostate cancer either with external beam radiation therapy or radical prostatectomy affects the health related quality of life ( 11 ) .
seminal vesicle involvement also influences local recurrence of prostate cancer either after radical prostatectomy or radiation therapy . before widespread use of mri for local staging of prostate cancer , making decision about treatment strategy
was mainly based on the psa level of the patients and gleason score and tumor volume reported by pathologist after trus guided biopsy ( clinical staging ) ( 4 ) .
our study showed that there is significant difference in the psa level and gleason score between two groups of patients with and without seminal vesicle involvement .
the psa level and gleason score are significantly higher in patients whose seminal vesicles were involved , but this is not absolute .
we had patients with a psa level of 58 g / ml and a gleason score of 9 without involvement of seminal vesicles and a psa level of 0.8 g / ml and a gleason score of 6 in patients with seminal vesicle involvement .
it means that there is a wide range of overlap between the two groups regarding psa level and gleason score .
there are many patients suspected to have limited disease and after they undergo surgery , they show a locally advanced disease that is diagnosed after radical prostatectomy and pathologic evaluation of the resected specimen . in a study conducted by park et al .
the accuracy of endorectal mri in predicting extraprostatic extension and seminal vesicle invasion in clinically localized prostate cancer was evaluated in 54 patients .
they stated that mri is more accurate in detecting seminal vesicle involvement in higher gleason score levels and it shows better sensitivity in high - grade tumors .
evaluated the value of endorectal mri , gleason score of biopsy specimens and preoperative psa levels in local staging of prostate cancer and especially differentiating between t2 and t3 stages tumors ( 13 ) .
they stated that obliteration of recto - prostatic angle seen in endorectal mri and total pathologic gleason score have the best predictive value for diagnosis of stage t3 prostate cancer .
our study also showed the high accuracy of mri in detecting seminal vesicle involvement with high sensitivity and specificity .
evaluated the accuracy of mri in local staging of prostate cancer by only using surface coil .
lee et al . in a study on 91 patients compared the accuracy of mri in local staging of prostate cancer using only pelvic phase array coil and only endorectal coil ( 14 ) .
they reported the area under the curve ( auc value ) of 0.671 for endorectal coil and 0.657 for pelvic phase array coil .
they stated that there is no significant difference in the assessment of seminal vesicle involvement between the two methods and using surface coil is more comfortable for patients . in our study , we achieved high sensitivity and high specificity in detecting seminal vesicle involvement because of obtaining high - resolution mr images of prostate with simultaneous use of endorectal and pelvic phase array coils .
99 patients showed that dynamic contrast - enhanced mri added to t2-weighted images will improve the accuracy of prostate cancer staging especially for less - experienced radiologists ( 15 ) . in our study , we used both t2-weighted images and contrast enhanced images to detect seminal vesicle invasion . in this study , we reported a sensitivity of 97% for detection of seminal vesicle involvement . to the best of our knowledge ,
we believe that the detection of prostate cancer and its extension greatly depends on the experience of the reporting radiologist .
this experience increases significantly with team - work between the radiologist , clinical pathologist and urology surgeon .
the report from the pathologist and urologist on each patient is the best tool for a radiologist to be aware of the potential pitfalls and to avoid the situations in mr studies that may be mistaken for seminal vesicle involvement .
since all the reports of this study were performed by a single radiologist with more than 8 years of experience in the mri of the prostate with a large number of patients referred from different areas of the country , the accuracy of reports were higher than many foreign countries that do not have such high number of patients .
in addition , in this study , we used the two most important parameters ( multidirectional high resolution t2w images and dynamic contrast study ) to detect seminal vesicle involvement .
this study showed that high resolution mri using endorectal and pelvic coils is highly accurate in detecting seminal vesicle involvement and it is much more reliable than reports of psa level and gleason score for decision making about treatment strategy .
it is suggested that all patients with prostate cancer proved by trus guided biopsy undergo local staging . at the end , we conclude that mri with endorectal coil is a valuable imaging technique with suitable accuracy in detecting seminal vesicle involvement in patients with prostate cancer . | background : in prostate cancer , detection of seminal vesicle involvement is important because it influences the treatment planning and prognosis of the patients.objectives:the objective of this study was to determine the value of prostate mri with endorectal coil in the detection of seminal vesicle involvement in patients with prostate cancer.patients and methods : a total number of 238 biopsy - proven prostate cancer patients were examined by 1.5 tesla mri with a combination of pelvic and endorectal coils to detect seminal vesicle involvement .
after radical prostatectomy , the mri results were compared with pathology results.results:seminal vesicle involvement was detected in 67 ( 28.1% ) patients .
pathology confirmed the involvement of seminal vesicles by prostate cancer in 63 patients . in two patients ,
seminal vesicle involvement was diagnosed by pathology but not detected by mri .
the sensitivity was 0.97 [ 95% confidence interval = 0.89 - 0.99 ] , the specificity was 0.98 [ 95% confidence interval = 0.94 - 0.99 ] , the positive predictive value was 0.94 [ 95% confidence interval = 0.85 - 0.98 ] , and the negative predictive value was 0.99 [ 95% confidence interval = 0.96 - 0.99].conclusions : mri with endorectal coil is a valuable imaging technique with suitable accuracy in detecting seminal vesicle involvement in prostate cancer . |
congenital cleft lip and palate ( clp ) is the most common birth defect in humans
. the etiology is complicated , and it involves genetic and environmental factors [ 1 , 2 ] . maternal condition during pregnancy also appears to play an important role .
smoking [ 46 ] , over intake of vitamin a [ 7 , 8 ] , and deficiency in folic acid and bs may increase risk for oral clefts [ 912 ] .
in addition , drug - induced ( corticosteroid ) teratogenesis has also received some attention [ 1316 ] .
experiments of mouse development are used to assess the mechanism of palate defects in fetuses resulting from exposure to the risk factors .
current strategies to study orofacial defects focus on the related genotype and transcription factors [ 17 , 18 ] . however , the capability of maternal detoxification during orofacial development is important for normal palate formation . as a result ,
a fetus lacking genes associated with cleft palates still has high risk of defect if maternal detoxification is insufficient .
metabonomics , based on the nmr spectroscopic and multivariate statistics , can be useful for the description and recognition of the dynamic multivariate metabolic response of an organism to a pathological event or genetic modification .
the h - nmr spectra of the biofluids from an organism contain a significant amount of useful metabolic information .
application of automated data reduction algorithms and chemometric analysis , which is called pattern recognition analysis ( pr ) , can be competent for the description and recognition of the dynamic multivariate metabolism .
it is included two major approaches , one is termed unsupervised , which could be used to not only reduce the complex and volume data to a suitable level but also screen for the outlier and examine condition of the clusters , including principal component analysis ( pca ) , nonlinear mapping ( nlm ) and hierarchical cluster analysis ( hca ) . the other
is termed supervised that means , make a mathematical model by a training set of known class from the samples and then draw the estimated or predictive model by independent validation set .
there are many methods such as soft independent modeling of class analogy ( simca ) , partial least squares ( pls ) , linear discriminant analysis ( lda ) , k - nearest neighbor analysis ( knn ) , and bayesian methods .
these approaches have been successfully applied to study diseases and toxic processes [ 2027 ] .
principal component analysis ( pca ) as a bilinear decomposition method is one of the most easy and efficient approaches to analyze the nmr data , a pca model can trustily display a summary of all samples in the data table . combination with using a prediction model , such as simca , can be constructed to analyze the unknown samples [ 2830 ] .
development of the mammalian palate involves a number of critical steps : growth , elevation , contact , and fusion ( the medial edge epithelium disappearance ) .
dex , one of the glucocorticoids ( gc ) , can penetrate the blood - placental barrier and bind to gc receptor ( gr ) in the cytoplasm , and can depress the ability of palatal mesenchymal proliferation . since the palate is smaller ,
development of bilateral palates is interrupted , which results in the cleft [ 3134 ] .
we hypothesized that the metabonomic method could provide the framework for the studies on the consequences of maternal environmental changes during pregnancy and for illustrating the relationship between the changes of maternal environment and development of palates . to test this hypothesis , we studied the plasma samples from pregnant c57bl/6j mice , which were induced with dexamethasone ( dex ) to trigger cleft palate formation in the fetuses .
the analyses demonstrated the relationship between the change in endogenous small molecular metabolites of maternal plasma and the incidence of cleft palate ( cp ) in fetuses .
all animal experimentation was approved by the animal research committee of the west china college of stomatology ( sichuan university ) .
c57bl/6j ( c57 ) mice , about 8 weeks of age , were obtained from the laboratory animal center of sichuan university .
all mice were reared in plastic cages ( 28 cm 16 cm 12 cm ) , under a 12/12-hour light / dark cycle .
the room was maintained at a controlled ambient temperature of 2027c with 40%70% relative humidity . a commercial diet ( laboratory animal center of sichuan university , china ) and tap water were fed ad libitum .
two virgin females and one male were placed overnight in a cage and checked on following morning for the copulatory plug of female mice .
females with copulation plugs were weighed immediately and the date was designated to embryonic day 0(e0 ) .
pregnant mice ( 42 ) were randomly divided into two groups ( the experimental group and the control groupeach group 21 mice ) . from the 10th day to the 12th day of pregnancy ( from e10 to e12 ) , the mice in the experimental group were intraperitoneally injected daily with dexamethasone ( dex dexamethasone sodium phosphate injection , tianjing china ) at 6 mg / kgand while the others in the control group with isotonic sodium chloride ( 0.9% nacl ) .
the dose levels were based on the literature report . on the day of e17.5 ,
the peripheral blood was placed in a lithium heparin tube ( vacuette austria ) immediately . within 2 hours of the collection ,
the erythrocytes were separated by centrifugation ( 3000 g at 4c or 10 min ) to pick up the biofluid top of the plasma for analysis .
all the plasma samples were stored at 80c before the h - nmr analysis . at the same time , a stereomicroscope was used to determine the number of live fetuses and gross malformations .
after removal of the mandibles , embryonic palates were calculated using stereomicroscope ( 10 ) by morphologic in two groups .
histological sections of embryonic palates were cut and stained with haematoxylin and eosin ( he ) .
the numbers of cp in two groups were analyzed to detect the different incidence rates by using chi - square test and variance - based statistical algorithm ( spss 10.0 ) .
the h - nmr spectra were obtained immediately after each sample was thawed at 300 k and then kept at the same temperature in a bruker avance ii 600 spectrometer ( bruker biospin , germany ) , which was operating at 600.13 mhz with a 5-mm patxi probe .
in order to obtain a deuterium lock signal for the nmr spectrometry , 200 l aliquots of all the plasma were diluted up to 500 l with 300 l of deuterium oxide ( d2o ) .
the spectrum was obtained by using two different pulse sequences : one is selective presaturation pulse sequence ( bruker biospin , germany ) for water suppression ( located in 4.8 ppm ) and other is cpmgpr1d pulse sequence ( bruker biospin , germany ) .
the later one , which was used to attenuate the broad protein signal in the plasma , is a modification of the carr - purcell - meiboom - gill pulse sequence ( cpmg - pulse , bruker biospin germany ) to suppress the residual water signal . for each sample ,
1d h - nmr spectrum was collected with 64 k data points , 64 scans and 15 ppm spectral width .
other acquisition parameters were 5 s relaxation delay , 8 dummy scans , 400 s fixed echo time to allow the elimination of j - mod , and 400 cpmg loops for t2 filter .
the phase and the baseline of all acquired nmr spectra were manually calibrated , and the chemical shifts corrected by the reference of the lactate doublet at 1.32 with topspin 1.3 ( bruker biospin , germany ) .
all signals of the 42 samples ' were located in the range of 07 ppm in spectral region and have no visible resonance peak after 7 ppm . using mestrec ( version 4.8.1.1 , spain ) , each h - nmr spectrum was divided with 0.04 ppm width into 162 contiguous segments and integrated from the rang of 07 ppm [ 37 , 38 ] .
the region of the spectrum ( 5.04.5 ppm ) was removed to exclude the influence of the water signal .
the result was set up to a kind of 2d matrix ( n d ) ,
the matrix data were normalized to the unit area with the appropriate weighting coefficients in excel ( microsoft usa ) and then exported into the simca - p software package ( version11.0 , umetrics ab , ume , sweden ) .
after the average value being calculated from each variable and subtracted from the data , pca was applied to the mean - centered data to detect the differences among the samples .
firstly , separate pc models were built for the training sets of 10 samples from dex group with cp fetuses and 10 samples including only normal fetus of control group and were defined two distances against boundaries ( cross - validation ) by the 95% confidence interval . as a typically visualizing method ,
secondly , the procedure was repeated for all samples ( the test sets ) in turn , to predict and assess whether samples were separated into two classes .
finally , the result of the cooman 's plot illustrated the visible separation of two groups .
forty - two c57bl/6j pregnant mice were examined , and 229 fetuses were collected , including 123 fetuses from dex treatment group and 106 fetuses from the control group ( table 1 ) .
there was at least one cp fetus in each pregnant mouse in dex treatment group ( named dex group ) , while there were 3 cp fetuses in two pregnant mice of the control group ( named the control group with cp ) .
the incidence of cp in the dex treatment group was 21.95% , significantly different from the control group ( p < .005 ) .
a and c show fusion of palate shelves , while b and d show a failure of the palate shelves to fuse .
the h - nmr spectrum of the plasma from pregnant mice revealed great complexity and significant information about the biofluid ( figure 2 ) .
the regions of the significant metabolite signals usually ranged 04.5 ppm , including alkene ( 45.5 ppm ) , alkyne ( 1.83.5 ppm ) , and the aliphatic series ( 02.8 ppm ) .
articles of the locations of different chemical groups and some low - molecular - weight metabolites had already been published [ 36 , 40 ] . to detect the difference between the two groups , special software was used in the chemometric analysis .
the matrix data from the h - nmr spectra were exported into the simca - p software and processed by pca . the new principal component ( pc )
variables were created ( 6 new contributories of the pcs ) , which accounted for 84.8% of the original data and each pc was orthogonal with all the other pcs .
the result of pca could be shown ( figure 3 ) as the clustering of the individual dataset defined by the 95% hotelling 's t2 limit .
except for two control samples ( : the blue star ) , all the 21 dex samples ( : the black triangles ) and 19 control samples with fusion fetuses ( : the open squares ) , obviously , were separated well along the first principal component .
it indicated that the major difference between the two groups occurred in the first two principal components .
the detailed different biochemical changes were informed by the loadings ( table 2 ) . in order to detect the outliers , the two outliers as one group to be detected with dex group and control group respectively .
the result indicated that the two outliers with cp fetuses have some extent different from the control group , while mixed in the dex - injected group because of cp fetuses .
the result of simca was shown in the cooman 's plot ( figure 5 ) .
the condition of samples can be classified in a pair of distances against boundaries ( red lines ) for non - fusion data in dex group and fusion data in control group .
the plot contained four regions separated by 95% confidence limits in a 2d graph in which samples below the horizontal line belonged to the control group with fusion fetuses ( 95% ) , while samples in the left region of the vertical line belonged to dex group with cp fetuses ( 95% ) . the data from control group with cp fetuses ( the outliers ) neither belongs to dex group nor belongs to control group .
it demonstrated that plasma classes from pregnant mice with cp fetuses and normal control did not share the same space .
therefore , this model should be able to predict whether maternal environment has been affected by dex or not .
in the normal mouse embryo , palate shelves grow and elevate into a horizontal position by embryonic day 14 ( e14 ) . by the day of e17
it was convenient to use morphology for embryo analysis , and it was easy to display the change of maternal metabolism without the influence of dex .
furthermore , another study also proved that the spectra of plasma from dex - injected and control male mice showed no significant difference during different time frames ( 2 hours , 1 day , 2 days , 3 days , and 7 days ) .
the pcas also show that all data from different time frames were a mixture together , which accounted for 89.9% from the original data ( supplement ) .
some studies indicate [ 4345 ] that the incidence of cleft palate may be closely related to high maternal concentration of plasma homocysteine or lower activity of the glucocorticoids prereceptor metabolizing enzyme11-hydroxysteroid dehydrogenase type 2 ( 112hsd2 ) in placental trophoblastic cells .
however , the exact mechanisms by which interaction between maternal environment and dex causes teratogenic effects are poorly understood .
nmr spectroscopy - based metabonomic approach offers a unique opportunity to focus on the relationship between genotype and phenotype and is especially suited to uncover changes in drug - induced metabolites [ 46 , 47 ] . in this study
, each mother at least has one cp fetus in dex - injected group . some changes of maternal metabolites informed us about the abnormality of the embryo .
therefore , the result from two groups displayed the different metabolites between cp fetus and fusion one . from the spectra of h - nmr ( figure 2 )
, we can see clearly some differences between the samples of the two groups within the range of chemical shift from 1.8 to 3.5 ppm and the range of glucose and amino acid ch .
the pca plots showed good separation of the two groups except for two control samples ( figure 3 ) , which matched the results from morphologic analysis identifying three cleft palate fetuses from two different individual mice in the control group . in order to analyze the outlier from the control group ,
the result also show these two samples were closely blended in the dex group ( figure 4(a ) ) , while far away from the controls ' ( figure 4(b ) ) .
some biochemical changes such as decrease of arginine ( 1.72 , 1.92 ppm ) , increase of alanine ( 1.48 ppm ) , n - acetyl glycoprotein ( 2.12 ppm ) , choline ( 3.24 ppm ) , and creatine ( 3.92 ppm ) may response to the change of methyl group metabolism in maternal environment
. the key donor of methylation is s - adenosyl methionine ( sam ) which comes from methionine .
. the reason may be that we injected isotonic sodium chloride ( 0.9% nacl ) in control samples in order to keep the same stimulating circumstance as in the dex group .
after simca analysis , the result of the cooman 's plot revealed a good fit model to detect the nmr data and separate the cp group from the controls by using a test set of f - statistic .
both plots clearly showed a relationship between the fetus ' cleft palate and the plasma metabolic profile of the mother . in conclusion
, this study provides evidence that metabonomic method is sufficiently sensitive to detect small differences in the composition of maternal biofluids and may be helpful for identifying biomarkers of teratogenesis .
| mice models are an important way to understand the relation between the fetus with cleft palate and changes of maternal biofluid . this paper aims to develop a metabonomics approach to analyze dexamethasone - induced cleft palate in pregnant c57bl/6j mice and to study the relationship between the change of endogenous small molecular metabolites in maternal plasma and the incidence of cleft palate . to do so
, pregnant mice were randomly divided into two groups .
the one group was injected with dexamethasone . on e17.5th day
, the incident rates of cleft palate from embryos in two groups were calculated .
the 1h - nmr spectra from the metabolites in plasma in two groups was collected at same time .
then the data were analyzed using metabonomics methods ( pca and simca ) .
the results showed that the data from the two groups displayed distinctive characters , and the incidence of cleft palate were significantly different ( p < .005 ) .
to conclude , this study demonstrates that the metabonomics approach is a powerful and effective method in detecting the abnormal metabolites from mother in the earlier period of embryos , and supports the idea that a change from dexamethasone induced in maternal metabolites plays an important role in the incidence of cleft palate . |
infliximab , an anti - tumor necrosis factor ( tnf)- monoclonal antibody , has been reported to be effective in refractory uveoretinitis in behet 's disease . because it has been used clinically for a short time , information on its adverse effects
we report a patient who developed cystoid macular edema ( cme ) following infliximab use for uveoretinitis associated with behet 's disease .
case report : a 27-year - old man had refractory uveoretinitis and neuro - behet 's disease , and intravenous infliximab was administered .
one day after infliximab infusion , the patient complained of a decrease in the vision in his left eye .
daily optical coherence tomographic evaluations showed a progressive worsening of the cme , and fluorescein angiography showed a typical staining with a cystic pattern .
two weeks later , the height of cme appeared to reach a maximum level and thereafter gradually resolved in spite of the continuation of infliximab administration .
the visual acuity improved while the patient was treated with repeated subtenon injections of steroids in addition to continuation of infliximab and finally increased from 0.15 to 1.2 .
although the mechanism of cme is not known , clinicians should be aware that infliximab therapy might cause a development and worsening of cme .
thus , it is crucial to rule out preexisting abnormalities in the macula prior to commencing infliximab infusion .
infliximab , a monoclonal igg1 chimeric antibody against soluble and membrane - bound anti - tumor necrosis factor ( tnf)- , is widely used to treat rheumatoid arthritis and crohn 's disease .
its use has been extended to refractory uveoretinitis in behet 's disease since 2007 in japan .
the clinical findings showed that infliximab decreased the number of ocular attacks , and the findings suggested that it has a beneficial effect on chronic cystoid macular edema ( cme ) .
we report an unusual case of a 27-year - old man who developed cme after receiving infliximab for behet 's disease .
a 27-year - old man was referred to our clinic with recurrent uveitis , aphthous ulcers of the oral mucosa , and genital ulcers in september 2005 .
his best - corrected visual acuity ( bcva ) was 1.0 od and 1.2 os .
we diagnosed the patient with behet 's disease and treated him with colchicines and steroid eye drops .
however , the frequency of ocular attacks increased with an increase in the density of bilateral cataracts especially in the right eye .
the right eye developed uveoretinitis and refractory cme , and the visual acuity progressively decreased .
no macular lesion was found in the left eye , and the visual acuity remained at 1.2 . in october 2007
, the patient was admitted to our hospital with headaches , vertigo , and diplopia , and was diagnosed with neuro - behet 's disease with a brain lesion .
he was examined by a neurologist , and it was jointly decided to treat the refractory uveoretinitis and neuro - behcet 's disease with infliximab .
his bcva was 0.08 od and 1.2 os one day before the infusion of infliximab .
his right eye had moderate iritis , progressive cataracts , retinal vasculitis , macular edema , and optic disc pallor .
his left eye had slight iritis and cataract , but showed no abnormality by ophthalmoscopy and optical coherence tomography ( oct ; fig .
one day after the infusion of infliximab , he complained of blurred vision in his left eye .
, the bcva in the left eye decreased to 0.15 , and the cme detected by oct progressively worsened ( fig .
1 ) . fa 4 days after the first infusion of infliximab showed an increase in the severity of the cme ( fig .
2 ) , but the visual acuity improved to 0.6 os in spite of the exacerbation of the cme .
two weeks after the first infusion of infliximab , a second infusion of the drug was done with a daily subtenon injection of 2 mg of dexamethasone sodium phosphate in the left eye for 1 week to prevent the worsening of the cme .
one month after the first infusion of infliximab , the left bcva improved to 1.2 , and with no additional treatment , the cme was gradually reduced and completely resolved 3 months later .
the cme in the right eye did not respond to the multiple subtenon injections of triamcinolone acetonide , but it appeared to have improved 21 months after the initiation of infliximab therapy .
in addition , infliximab has been reported to have beneficial effects on cme associated with chronic uveitis in behet 's disease .
our patient complained of visual disturbances , and oct showed a development and worsening of a cme after the first administration of infliximab .
the cme worsened in the oct images , but the bcva gradually improved although the treatment regime was not altered .
we treated the patient with a daily subtenon injection of dexamethasone sodium phosphate for 1 week after the second administration of infliximab , and a worsening of the cme did not occur .
the occurrence of cme has not been reported as a side effect of infliximab . on the other hand , it has been suggested that infliximab might be immunogenic and probably retinotoxic [ 5 , 6 ] .
reported that intravitreal infliximab in patients with refractory diabetic macular edema or choroidal neovascularization secondary to age - related macular degeneration was not well tolerated .
the adverse events included persistence of cme , worsened appearance on angiography , development of inflammation ( vitritis or panuveitis ) , and decrease of electroretinographically - determined retinal function .
they mentioned that the undiminished diffuse edema and downward trend in erg values seen in their patients partly corresponded with the findings observed in experimental rabbit eyes following relative high - dose intravitreal infliximab injection .
it is assumed that the possible mechanism involved in the complication in our patient was induced immune response , which may aggravate the cme .
this is an adverse event in a single case and can not be regarded as a definite adverse effect of the drug for patients with ocular behet 's disease .
however , given the reasonable association of infliximab with cme , it might be crucial to rule out preexisting abnormalities in the macula prior to commencing infliximab infusion . | aiminfliximab , an anti - tumor necrosis factor ( tnf)- monoclonal antibody , has been reported to be effective in refractory uveoretinitis in behet 's disease . because it has been used clinically for a short time , information on its adverse effects
is limited .
we report a patient who developed cystoid macular edema ( cme ) following infliximab use for uveoretinitis associated with behet 's disease .
case report : a 27-year - old man had refractory uveoretinitis and neuro - behet 's disease , and intravenous infliximab was administered.resultsone day after infliximab infusion , the patient complained of a decrease in the vision in his left eye . the visual acuity had decreased from 1.2 to 0.5 .
daily optical coherence tomographic evaluations showed a progressive worsening of the cme , and fluorescein angiography showed a typical staining with a cystic pattern .
two weeks later , the height of cme appeared to reach a maximum level and thereafter gradually resolved in spite of the continuation of infliximab administration .
the visual acuity improved while the patient was treated with repeated subtenon injections of steroids in addition to continuation of infliximab and finally increased from 0.15 to 1.2.conclusionsalthough the mechanism of cme is not known , clinicians should be aware that infliximab therapy might cause a development and worsening of cme .
thus , it is crucial to rule out preexisting abnormalities in the macula prior to commencing infliximab infusion . |
hip fracture patient data is prospectively input into the nhfd at our level 1 trauma centre institution by trained personnel .
the clinical data for each patient were then identified and cross referenced with hospital electronic patient records to ensure accuracy .
this project was approved by leeds general infirmary institutional review board ( project 668 ) .
we collected variables including demographic ( age , gender , admission source , and walking ability ) , biochemical ( haemoglobin level , white blood cell count , platelet count , coagulation profile and urea and electrolyte levels ) and medical comorbidity data .
patient 's preoperative admission source was grouped as one of four categories : patients who were independent in their own home or sheltered accommodation ; those who were in a nursing or residential home ; those who were already in hospital and had a fall as an inpatient ; and those transferred from another hospital .
mobility was categorised into independent walkers ; walkers with a single aid ( stick or crutch ) ; walkers with two aids ( two sticks / crutches or frame ) ; and those who were wheelchair - bound .
all patient comorbidity data was identified from hospital records using international classification of disease , 10th revision ( icd-10 ) , codes and these were used to calculate the charlson comorbidity index for each patient.13 ) the american society of anesthesiologists ( asa ) grade recorded at the time of surgery was also noted .
other factors analysed included the type of fracture and the time from presentation to hospital to receiving surgical intervention .
fractures were classified as intracapsular undisplaced , intracapsular displaced , intertrochanteric , subtrochanteric or other ( if the injury could n't be distinctively classified ) .
causes of death were collected from death certificate entries as well as from coroner 's autopsy records and the primary cause of death was used for analysis .
our unit aimed to perform surgery on the day of or the day after presentation of injury in accordance with national health care guidelines.14 ) following review of imaging by multiple orthopaedic consultants and anaesthetic team at a multidisciplinary trauma meeting , operative management was decided and performed in a theatre with laminar air flow .
the majority of displaced intracapsular fractures were treated with a cemented hip hemiarthroplasty and undisplaced intracapsular fractures were fixed in situ with screw fixation .
intertrochanteric fractures were fixed with a sliding hip screw , while subtrochanteric fractures were managed with a cephalomedullary device . in accordance with national guidelines , patients that are not cognitively impaired and can mobilise independently or with a single stick were treated with a total hip arthroplasty .
after the operation , patients were mobilised fully weight bearing with physiotherapy support . to aid clinical interpretation , admission haemoglobin levels and white blood cell counts
haemoglobin levels were grouped as being less than or more than 10 g / dl this was done following evidence from a recent study which found haemoglobin < 10 g / dl to be an independent predictor of mortality.12 ) white blood cell count levels were grouped as being normal ( 4 10/l12 10/l ) or abnormal ( less than 4 10/l or more than 12 10/l ) , in keeping with the widely accepted definition of systemic inflammatory response syndrome .
this assessment involved either using a chi - squared / fisher exact test for categorical data or the independent t / mann - whitney u - test for continuous variables .
the impact of these variables were then analysed using a backward stepwise likelihood ratio cox regression analysis whilst adjusting for covariates .
covariates were included in the multivariate analysis if the univariate analysis resulted in a p - value of < 0.15 , in accordance with accepted and published statistical methods.15 ) results were displayed as hazard ratios to aid clinical interpretation .
to aid clinical interpretation , admission haemoglobin levels and white blood cell counts were categorized as dichotomous variables .
haemoglobin levels were grouped as being less than or more than 10 g / dl this was done following evidence from a recent study which found haemoglobin < 10 g / dl to be an independent predictor of mortality.12 ) white blood cell count levels were grouped as being normal ( 4 10/l12 10/l ) or abnormal ( less than 4 10/l or more than 12 10/l ) , in keeping with the widely accepted definition of systemic inflammatory response syndrome .
this assessment involved either using a chi - squared / fisher exact test for categorical data or the independent t / mann - whitney u - test for continuous variables .
the impact of these variables were then analysed using a backward stepwise likelihood ratio cox regression analysis whilst adjusting for covariates .
covariates were included in the multivariate analysis if the univariate analysis resulted in a p - value of < 0.15 , in accordance with accepted and published statistical methods.15 ) results were displayed as hazard ratios to aid clinical interpretation .
after exclusion of 132 duplicates , 44 patients that did not have an operation and 141 incomplete datasets , a total of 1,356 patients were included in the study .
the 30-day mortality rate was 8.7% ( 118/1,356 ) . of these patients , 89 died during their index admission episode following hip fracture surgery .
the clinical and demographic data for these patients are summarised in table 1 , grouped by their 30-day mortality status .
the commonest cause of death was pneumonia followed by myocardial infarction ( mi ) ( fig .
patients that died within 30 days of surgery were likely to be older , male , functionally less independent and living in a care institution rather that their own home .
the mortality group also had a significantly higher incidence of hypertension , chronic obstructive airways disease ( coad ) , previous stroke , previous mi , chronic liver disease and chest infection on admission ( table 2 ) .
analysis of admission blood parameters revealed that the mortality group was more likely to have an admission haemoglobin level of less than 10 g / dl , an abnormal white blood cell count , a raised serum potassium level ( although the mean potassium level was still within normal range ) , deranged urea and creatinine levels and a higher international normalized ratio ( table 2 ) .
following multivariate analysis , the risk factors significant for 30-day mortality included increasing age , male gender , admission source other than patient 's own home , admission haemoglobin levels less than 10 g / dl and an increasing charlson comorbidity score .
a history of previous mi , concomitant chest infection during admission and chronic liver disease were the strongest predictors of early mortality with hazard ratios of 2.191 , 3.738 , and 3.945 , respectively ( table 3 ) .
table 2 summarises the comorbidities and admission blood parameters that were significant on univariate analysis .
table 3 summarises the outcomes of the multivariate analysis analysing risk factors for 30-day mortality .
the causes of death for the 118 patients that died within 30 days of hip fracture surgery are summarised in fig
table 2 summarises the comorbidities and admission blood parameters that were significant on univariate analysis .
table 3 summarises the outcomes of the multivariate analysis analysing risk factors for 30-day mortality .
the causes of death for the 118 patients that died within 30 days of hip fracture surgery are summarised in fig
patients who died within 30 days of hip fracture surgery were likely to have admission haemoglobin levels less than 10 g / dl , be older , be male , have a history of previous myocardial infarction and/or have suffered a concomitant chest infection during their index admission .
chronic liver disease was the strongest risk factor for early death within 30 days of surgery .
the commonest causes of death were pneumonia and acute myocardial infarction followed by sepsis from other sources .
mortality risk was reduced in patients if they were admitted from their own home . in our cohort , other comorbidities such as diabetes mellitus , admission electrolyte disturbances and malignancy did not increase the risk of 30-day mortality . while increasing asa grade did not affect early death after hip fracture surgery , an increasing charlson score did .
our 30-day mortality rate of 8.7% is comparable with the figure of 7.5% across england and wales as reported by the nhfd ( this figure is case - mix adjusted for multiple variables including age , asa grade and source of admission , whereas our cohort is an unselected and unadjusted group).5 ) furthermore , our institutional findings compare favourably to those of other developed nations
. a study of over 38,000 danish patients with hip fractures showed the 30-day mortality to be between 9.2% and 10.9%.16 ) elsewhere in the world , this figure is higher , reaching up to 13.3% worldwide as reported by a recent meta - analysis.3 ) over 60% of patients that died within 30 days after surgery did so as a result of a chest infection and/or an acute mi in our study .
in fact , there were four mortalities within 24 hours of surgery resulting from overwhelming chest infection or an acute myocardial infarction .
such patients already have a higher incidence of pre - existing cardio - respiratory disease and the reduced mobility following a hip fracture is known to increase the risk of pneumonia.17 ) a chest infection is an independent risk factor for early readmission after hip fracture surgery and is a common postoperative complication.618 ) the development of a chest infection following hip fracture surgery in our cohort was one of the strongest predictors of 30-day death after hip fracture surgery with a hazard ratio of 3.738 .
these findings are in complete agreement with those of a similar study from japan showing a fivefold increase in early death in hip fracture patients who develop a postoperative pneumonia.17 ) a hip fracture in itself is an independent risk factor for acute myocardial infarction.19 ) a recent prospective study of 200 hip fracture patients undergoing surgery found that the incidence of acute myocardial infarction in the perioperative period may in fact be as high as 35.5%some of these may be completely asymptomatic.420 ) due to the high incidence of perioperative myocardial infarction in this cohort , previous authors have made recommendations to routinely measure postoperative cardiac biochemical markers to reduce cardiac - related deaths.21 ) increasing age , male gender and presentation with injury from a source other than patients ' own home were also statistically significant predictors of early mortality in our cohort .
similar findings have also been demonstrated in cohort studies of hip fracture patients looking at early mortality where increasing age , male gender , dementia and residence in an institution were identified as risk factors.322 ) mortality amongst men is generally higher than in women23 ) and perhaps multifactorial .
factors such as dementia and increasing age likely reflect the patients ' poor physiological reserve in withstanding the stress of surgery and its sequelae .
patients admitted from sources other than their own homes are likely to be care - dependent within nursing or care homes with poor mobility and health .
in contrast , patients who live in their own homes are more likely to be independent and active resulting in better postoperative outcomes.24 ) interestingly , in our cohort , the presence of diabetes mellitus , malignancy and admission electrolyte imbalances did not significantly increase the risk of 30-day mortality . in our centre ,
patients with diabetes mellitus are assessed on admission for current anti - hyperglycaemic treatment and prescribed the appropriate inpatient anti - hyperglycaemic treatment immediately .
this includes adjustable rate intravenous insulin therapy if the patient usually requires insulin or if the blood glucose readings are unusually high .
the patient 's glucose levels are monitored regularly and they are placed back on their usual treatment once they are eating and drinking normally after their operation .
acute electrolyte imbalances , if severe enough , are similarly treated in an aggressive manner on admission and the hip fracture surgery is delayed until the patient is deemed anaesthetically fit to undergo the operation .
we believe this strict inpatient diabetic and electrolyte control is responsible for the lack of association between diabetes mellitus and 30-day mortality in this cohort .
however , a higher charlson score was associated with increased mortality . this likely reflects the fact that the asa grade may be more subject to higher interobserver variability.25 ) the charlson comorbidity scoring system , however , scores specific diagnoses and is a more robust and reproducible system.26 ) our results are in accordance with a previously pooled analysis of over 500,000 hip fracture patients which also demonstrated that a high admission charlson score was a preinjury predictor of mortality.27 ) chronic liver disease was the strongest predictor of 30-day mortality in our cohort with a hazard ratio of 3.98 .
although only one patient died directly from chronic liver disease ( and , therefore , hepatorenal failure ) , the statistical analysis concluded that patients with long - term liver disease are at much higher risk of 30-day mortality from any cause .
these results are echoed by the findings of a similar australian study which showed liver disease to be an overwhelmingly strong predictor of inpatient mortality amongst hip fracture patients with a hazard ratio of 4.75.28 ) it has previously been suggested that such patients have an increased susceptibility to infection which has also been demonstrated in the elective setting following arthroplasty surgery.29 ) the mechanisms behind the increased surgical risk in patients with liver disease are poorly understood ; however , dysregulation of metabolic homeostasis and the imbalance of oxidative and antioxidative processes have been implicated as underlying mechanisms leading to morbidity and mortality.30 ) our study is strengthened by the inclusion of a large number of patients and is unique in that it provides risk factors not previously found in literature for a number of reasons .
the fact that anaemia is a risk factor for myocardial infarction and that chest infection may result in hyponatremia strengthens our reasons for including blood results as variables in our analysis .
we also examined specific comorbidities for association with early mortality as well as charlson score which is a weighted score based on specific diagnoses and has previously been used in similar patient cohorts .
other studies looking at mortality following hip fractures have previously used comorbidity counts which can be vague and have high interobserver errors .
this study is limited by its retrospective design and , therefore , does not offer the robustness of data offered by prospective data collection .
however , we are confident that due to the cross - referencing of data between the nhfd and multiple local hospital records , we obtained an accurate dataset .
the nhfd is a prospectively populated audit database with accurate data input by trained trauma coordinators at our centre .
in addition , we used multivariate analysis to investigate a large cohort of patients analysing many parameters that can influence mortality this minimises the confounding effect of covariates . a specific limitation that we faced was that we did not have complete body mass index data on all patients and , therefore , this was not included in the final analysis .
although this could impact mortality , any such effect is likely to be indirect due to the sequelae of a high body mass index such as diabetes mellitus and ischaemic heart disease .
these factors were independently analysed in this study for association with mortality . in conclusion , increasing age , male gender , admission source and admission haemoglobin of less than 10 g / dl predispose to early mortality .
a previous history of myocardial infarction , concomitant chest infection during index admission and chronic liver disease are the strongest predictors of 30-day mortality in hip fracture patients .
the charlson comorbidity score allows indexing of patient comorbidities in a more robust manner than a simple comorbidity count and is also an independent predictor of early mortality .
a multidisciplinary approach to the care of these patients should be undertaken from the point of admission with physicians supporting early medical optimisation of cardiorespiratory , metabolic and liver functions . | backgrounda fracture neck of femur is the leading cause of injury - related mortality in the elderly population .
the 30-day mortality figure is a well utilised marker of clinical outcome following a fracture neck of femur .
current studies fail to analyse all patient demographic , biochemical and comorbid parameters associated with increased 30-day mortality .
we aimed to assess medical risk factors for mortality , which are easily identifiable on admission for patients presenting with a fractured neck of femur.methodsa retrospective review of a prospectively populated database was undertaken to identify all consecutive patients with a fracture neck of femur between october 2008 and march 2011 .
all factors related to the patient , injury and surgery were identified .
the primary outcome of interest was 30-day mortality .
univariate and subsequent multivariate analyses using a backward stepwise likelihood ratio cox regression model were performed in order to establish all parameters that significantly increased the risk of death.resultsa total of 1,356 patients were included in the study .
the 30-day mortality was 8.7% .
the most common causes of death included pneumonia , sepsis and acute myocardial infarction .
multiple regression analysis revealed male gender , increasing age , admission source other than the patient 's own home , admission haemoglobin of less than 10 g / dl , a history of myocardial infarction , concomitant chest infection during admission , increasing charlson comorbidity score and liver disease to be significant predictors of mortality.conclusionsthis study has elucidated risk factors for mortality using clinical and biochemical information which are easily gathered at the point of hospitalization .
these results allow for identification of vulnerable patients who may benefit from a prioritisation of resources . |
the study was conducted on persons having somatization disorder attending the outpatient unit of lgb regional institute of mental health , tezpur , assam .
the data were collected in a period of 3 months from september 2008 to november 2008 .
a total of 60 patients were selected of both genders fulfilling the criteria of somatization disorder according to icd 10 criteria .
however , persons with mental retardation , epilepsy , any other neurological disorder , and with comorbid mental disorder were excluded .
majority of them were females ( 86.7% ) , muslims ( 93.3% ) , married ( 91.7% ) , illiterates ( 88.3% ) , homemakers ( 95% ) , hailing from a rural background ( 88% ) , belonging from a nuclear family ( 70% ) , and having a monthly family income of below rs .
showing sociodemographic characteristics of persons with somatization relevant sociodemographic and clinical details were collected using this pro forma . it is a measure of life satisfaction consisting of five items .
it is a 12-items scale , and divides perceived social support from family members , friends , and from significant others .
norms for the general population have been published with higher scores indicating more social support .
informed consent was taken from the patients and informant before eliciting relevant information . the nature and purpose of the study was explained .
all the subjects were interviewed and were then assessed with the help of a semi structured clinical and sociodemographic data sheet .
thereafter , satisfaction with life scale and multidimensional scale of perceived social support were administered . the statistical package for social sciences ( spss ) , version 14.0 , was used for the analysis of the data of this study .
it is a 12-items scale , and divides perceived social support from family members , friends , and from significant others .
norms for the general population have been published with higher scores indicating more social support .
it is a 12-items scale , and divides perceived social support from family members , friends , and from significant others .
norms for the general population have been published with higher scores indicating more social support .
informed consent was taken from the patients and informant before eliciting relevant information . the nature and purpose of the study was explained .
all the subjects were interviewed and were then assessed with the help of a semi structured clinical and sociodemographic data sheet . thereafter ,
the statistical package for social sciences ( spss ) , version 14.0 , was used for the analysis of the data of this study .
the finding of social support is given in table 2 . according to the manual of the test a higher score indicates better support .
findings suggest that in comparison to significant others perceived social support and friends social support , family perceived social support was higher .
response on life satisfaction is recorded as extremely satisfied , satisfied , slightly satisfied , neutral , slightly dissatisfied , dissatisfied , and extremely dissatisfied .
only 9% persons with somatization were dissatisfied and none of the patient was extremely dissatisfied . perceived social support was found to have a significant positive correlation with life satisfaction ( correlation value 0.639 , p<0.01 ) which suggests that higher perceived social support is associated with better life satisfaction .
overall health can be influenced by multiple factors , including a person 's psychological behavioral , and social well - being .
studies have demonstrated an association between increased levels of social support and reduced risk for physical and mental disease .
social support includes real or perceived sources provided by others that enable a person to feel cared for , valued , and part of network of communication and mutual obligation .
social support can be an important factor for those with somatization disorder who rely on family friends , or organization to assist them with daily activities , provide companionship , and care for their well - being .
a patient 's support system may come from several sources apart from the family such as friends , residential or day care providers , shelter operators , roommates , and others .
research has shown that a family with a mentally ill patient does suffer from network contraction and condensation , which in turn , increases the vulnerability of the family to stressors due to lack of social support .
these findings are consistent with the result of the previous studies.[1417 ] a physiological difference between males and females is proposed as a cause for it .
accordingly , gender differences in brain function , hormones , and reproductive processes were considered as possible factors related to the increased risk to complaint for somatic symptoms in women .
the occurrence of somatization varies across the sociocultural group and seems to be influenced by environmental stressors . in the present study
it is found that majority of the persons with somatization were illiterate , muslim , belonging to rural background , and of lower economic status .
similar findings are reported by barskey who observed that somatization is more common among those who are less educated , of lower socioeconomic status , of rural background , and among ethnic groups that discourage the direct expression of emotional distress . in the present study a positive correlation between perceived social supports and life satisfaction was found .
life satisfaction has been found to moderate the effects of stress on symptoms of psychological distress .
intimate social relationships , rather than family relationships , predict an individual 's overall life satisfaction .
social support is one of the most important factors in predicting the physical health and well - being of every one , ranging from childhood through older adults .
the absence of social support shows some disadvantage among the affected individuals . in most cases
the presence of social support significantly predicts the individual 's ability to cope with stress .
knowing that they are valued by illness is an important psychological factor in helping them to forget the negative aspect of life , and thinking more positively about their environment . somatizing patients experience or express emotional discomfort and psychosocial distress as physical symptoms .
somatization occurs in a broad spectrum of illnesses , in association with a wide variety of mental disorders , including depression , anxiety , and the somatoform disorders .
care rests upon conservative medical management and evaluation ; a physician - patient relationship based on acceptance , caring , and trust ; reinforcement of positive behaviors and elimination of destructive ones ; and the gradual use of the relationship to promote healthy relating in the patient .
these data do not support the common belief that females somatize more than males or the traditional view that somatization is a basic orientation prevailing in developing countries . instead
, somatic symptoms , emotional distress , life satisfaction , and perceived social support are strongly associated with each other and need psychosocial support and intervention to overcome their distress . | background : life satisfaction and perceived social support been shown to improve the well - being of a person and also affect the outcome of treatment in somatization disorder .
the phenomenon of somatization was explored in relation to the perceived social support and life satisfaction.aim:this study aimed at investigating perceived social support and life satisfaction in people with somatization disorder.materials and methods : the study was conducted on persons having somatization disorder attending the outpatient unit of lgb regional institute of mental health , tezpur , assam .
satisfaction with life scale and multidimensional scale of perceived social support were used to assess life satisfaction and perceived social support respectively.results:women reported more somatic symptoms than men .
family perceived social support was high in the patient in comparison to significant others perceived social support and friends perceived social support .
perceived social support showed that a significant positive correlation was found with life satisfaction.conclusion:poor social support and low life satisfaction might be a stress response with regard to increased distress severity and psychosocial stressors rather than a cultural response to express psychological problems in somatic terms . |
proprotein convertase subtilisin / kexin type 9 ( pcsk9 ) modulates low density lipoprotein cholesterol ( ldl - c ) concentrations by binding to hepatic ldl receptors , facilitating their catabolism , thereby increasing circulating ldl - c .
statin therapy increases serum pcsk9 levels , a finding that may explain the nonlinear relationship between statin dose and ldl - c reduction and the variable response that patients show to statin therapy .
the present analysis examined pcsk9 levels in subjects treated with 80 mg atorvastatin for 6 months who did not respond to statin therapy with the expected reduction in ldl - c to determine whether an exaggerated increase in circulating pcsk9 levels with statin therapy could explain blunted statin efficacy .
eighteen subjects who completed the double - blind , randomized clinical trial , the effect of statins on muscle performance ( stomp ; national heart , lung , and blood institute 5r01hl081893 , nct00609063 ) , but did not exhibit the expected reduction in ldl - c with 80 mg atorvastatin treatment for 6 months ( mean change standard deviation : 2.6 11.4% reduction in ldl - c for atorvastatin nonresponders ) were compared to 18 matched , atorvastatin - treated subjects who decreased ldl - c by 50.7 8.5% over 6 months ( atorvastatin responders ) , as well as 18 matched placebo - treated subjects ( ldl - c increased 9.9 21.5% over 6 months ) .
subjects were matched for age ( 29 13 years ) , gender ( 8 males / group ) , bmi ( 25 5 kg / m ) , and baseline ldl - c ( 104 29 mg / dl ) .
compliance to study drug was measured by pill counts of unused medication at 3 and 6 months as well as analysis of plasma atorvastatin at the posttreatment study visit .
medication compliance was higher in nonresponders than in the responder and placebo groups ( 98 9% versus 94 6% versus 94 6% , resp . ;
. furthermore , atorvastatin metabolites were nonsignificantly higher in atorvastatin nonresponders than responders ( 10 20 ng / ml versus 8 10 ng / ml ; p = 0.70 ) and placebo ( 0 0 ng / ml , p = 0.06 ) . both total pcsk9 ( which circulates in association with ldl particles by interacting with apob100 ) and free pcsk9 in archived
, frozen serum taken from fasting samples at baseline and after 6 months of treatment were measured using specific enzyme - linked immunosorbent assays ( elisa ) , proprietary to regeneron pharmaceuticals , inc .
( tarrytown , ny ) , with reference being a recombinant full length human pcsk9 . for the total pcsk9 assay ,
an acid treatment of the serum samples was included prior to analysis in order to dissociate pcsk9 complexes that might be present in the serum .
pcsk9 : alirocumab and pcsk9 : ldlr complexes are present in the serum and both active and furin cleaved pcsk9 were measured by elisa .
one - way anovas were used to compare baseline characteristics and change scores between groups , and a repeated measures analysis with group as the between - subjects factor and time as the within - subjects factor was used to compare changes in variables ( pcsk9 and ldl - c ) before and after study .
free pcsk9 ( figure 1 ) was marginally higher in atorvastatin nonresponders at baseline ( p = 0.07 ) and significantly higher in atorvastatin responders after 6 months of treatment ( p = 0.04 ) .
in addition , the change in free pcsk9 over 6 months with statin treatment was higher ( p < 0.01 ) in atorvastatin responders ( 134.2 131.5 ng / ml post- and prestudy ) than in either the nonresponders ( 39.9 87.8 ng / ml ) or placebo subjects ( 27.8 97.6 ng / ml ) .
total pcsk9 values at 6 months , as well as the change from baseline to 6 months , demonstrated a parallel trend ( higher values and a greater change observed in atorvastatin responders ) , but these differences were not significant ( p = 0.11 and 0.14 , resp . ) , a finding that is likely attributable to the lower percentages of total ( ~30% ) versus free ( ~70% ) pcsk9 that circulate in the plasma .
finally , the change in ldl - c over 6 months was inversely correlated to the change in free pcsk9 ( pearson correlation = 0.31 ; p = 0.03 ) demonstrating that the greatest reductions in ldl - c were associated with the greatest increases in pcsk9 .
our data indicate that patients whose reduction in ldl - c after 6 months of atorvastatin treatment was < 20% of baseline level and who were classified as nonresponders had marginally higher free pcsk9 at baseline and did not increase free pcsk9 with atorvastatin treatment . this could simply be noncompliance with statin drug treatment , but this would not explain baseline differences in free pcsk9 .
also , compliance was measured both by pill count , which was better over 6 months in atorvastatin nonresponders than in responders or placebo subjects , and by posttreatment plasma atorvastatin levels , which were nonsignificantly higher in nonresponders than responders . without directly observing pill ingestion
, we can not exclude the possibility that nonresponders had only taken their medication shortly before the visit ( thus not leaving sufficient time for atorvastatin to reduce cholesterol levels ) , but this seems unlikely to have occurred repeatedly throughout the nonresponder group .
statins upregulate expression and secretion of pcsk9 by activating the sterol regulatory element - binding protein-2 ( srebp-2 ) .
higher levels of pcsk9 decrease the number of hepatic ldl receptors and can produce hypercholesterolemia [ 4 , 5 ] .
previous studies have noted that sensitivity to statin therapy is increased in mice and humans with minimally expressed levels of pcsk9 [ 6 , 7 ] and that there is a correlation between the ldl - c lowering effects of statin therapy and change in pcsk9 levels [ 8 , 9 ] .
the hypothesis from collective data is that inhibition of cholesterol synthesis by statin therapy upregulates production of pcsk9 .
consequently , pcsk9 inhibition is an emerging pharmacological target for patients with familial hypercholesterolemia and/or high levels of ldl - c who do not achieve sufficient lipid lowering with statin therapy . here , for the first time
, we demonstrate that baseline serum pcsk9 levels and the response to statin therapy may differ between those who do and those who do not respond to statin treatment .
these findings support the converse of previous findings : lack of sensitivity to statin therapy in healthy adults may be predicted by higher levels of baseline pcsk9 , although an abnormally high pcsk9 response to statin therapy does not appear to be further associated with the lack of response to statins .
these preliminary results with a small sample need to be verified in additional studies , especially given that there are multiple gain of function and loss of function variants of pcsk9 which influence plasma ldl - c levels .
however , the present data indicate that pcsk9 levels may be a useful clinical biomarker with which to predict or confirm diagnosis of the approximate 410% of individuals who do not exhibit the expected reduction in ldl - c with statin therapy . | the purpose of the present report was to examine whether proprotein convertase subtilisin / kexin type 9 ( pcsk9 ) levels differ in individuals who do not exhibit expected reductions in low density lipoprotein cholesterol ( ldl - c ) with statin therapy .
eighteen nonresponder subjects treated with 80 mg atorvastatin treatment for 6 months without substantial reductions in ldl - c ( ldl - c : 2.6 11.4% ) were compared to age- and gender - matched atorvastatin responders ( ldl - c : 50.7 8.5% ) and placebo - treated subjects ( ldl - c : 9.9 21.5% ) .
free pcsk9 was marginally higher in nonresponders at baseline ( p = 0.07 ) and significantly higher in atorvastatin responders after 6 months of treatment ( p = 0.04 ) .
the change in free pcsk9 over 6 months with statin treatment was higher ( p < 0.01 ) in atorvastatin responders ( 134.2 131.5 ng / ml post- versus prestudy ) than in either the nonresponders ( 39.9 87.8 ng / ml ) or placebo subjects ( 27.8 97.6 ng / ml ) .
drug compliance was not lower in the nonresponders as assessed by pill counts and poststudy plasma atorvastatin levels .
serum pcsk9 levels , both at baseline and in response to statin therapy , may differentiate individuals who do versus those who do not respond to statin treatment . |
we selected a consecutive series of 111 colposcopically directed cervical punch biopsies from the department of pathology , korea university anam hospital . using these biopsy samples
, we performed an immunohistochemical staining for p16ink4a and ki-67 to establish a diagnosis during a period ranging from september 2009 to june 2010 .
the immunohistochemical stain for p16ink4a was performed using cintec histology kit ( mtm laboratories ag , heidelberg , germany ) and for ki-67 using mouse monoclonal antibody , clone mib-1 from dako corp .
the sections were de - paraffinized and sequentially treated for antigen epitope retrieval and endogenous peroxidase blocking . following a 30-minute incubation with primary antibodies , the section for p16ink4a was treated with visualization polymer reagent conjugated with horseradish peroxidase and goat anti - mouse fab ' antibody fragment . for the section for ki-67 ,
this was followed by the dehydration and mounting for a microscopic examination . to validate the staining procedure for each staining run
, we used a positive control slide containing tissue section from the cervical biopsy of invasive squamous cell carcinoma with known diffuse immunoreactivity for p16ink4a . for a negative control , we used the buffer solution rather than the primary antibody .
four surgical pathologists reviewed the hematoxylin and eosin ( h&e)-stained slides , and then made a diagnosis based on the histological features .
these diagnoses include benign lesions such as immature squamous metaplasia , transitional metaplasia or borderline condyloma - like lesion , cin 1 , cin 2 , and cin 3 .
then , each pathologist performed the second - round review of the h&e slide and the slide stained for p16ink4a , and the third - round review of h&e slide and those for p16ink4a and ki-67 .
this was followed by the interpretation of the slides by each pathologist based on his or her own criteria . then , the diagnosis was revised .
a majority of diagnoses were made based on concordance in the diagnosis between the pathologists ; a diagnosis was established when at least three of four pathologists agreed on the diagnosis .
if there was a lack of the majority diagnosis , a final consensus diagnosis was reached through a simultaneous meeting of all the four pathologists .
this was followed by the interpretation of the immunohistochemical findings for p16ink4a and ki-67 based on the interpretation criteria .
the expression of p16ink4a was scored as 0 ( negative ) , 1 ( focal and weak cytoplasmic staining with or without nuclear staining in superficial or intermediate layers ) , 2 ( intermediate between 1 and 3 ) , and 3 ( diffuse and strong nuclear staining in lower 2/3 or whole layers with or without cytoplasmic staining ) ( fig .
the expression of ki-67 was evaluated based on the distribution and proportion of positive cells in the squamous epithelium .
ki-67 was occasionally seen in suprabasal layers of the normal squamous epithelium ( score 0 ) , while its expression was extended to upper layers of the squamous epithelium with the progression of dysplasia from cin 1 ( score 1 ) to cin 3 ( score 3 ) ( fig .
an intra - observer variability of each pathologist was evaluated by calculating the kappa value for the pairs of ' first and second ' and ' first and third ' diagnoses .
then , these values were compared with the histologic groups : benign / cin 1 and cin 2/3 . a p - value of < 0.05 was considered statistically significant .
we selected a consecutive series of 111 colposcopically directed cervical punch biopsies from the department of pathology , korea university anam hospital . using these biopsy samples
, we performed an immunohistochemical staining for p16ink4a and ki-67 to establish a diagnosis during a period ranging from september 2009 to june 2010 .
the immunohistochemical stain for p16ink4a was performed using cintec histology kit ( mtm laboratories ag , heidelberg , germany ) and for ki-67 using mouse monoclonal antibody , clone mib-1 from dako corp .
the sections were de - paraffinized and sequentially treated for antigen epitope retrieval and endogenous peroxidase blocking . following a 30-minute incubation with primary antibodies , the section for p16ink4a was treated with visualization polymer reagent conjugated with horseradish peroxidase and goat anti - mouse fab ' antibody fragment . for the section for ki-67 ,
this was followed by the dehydration and mounting for a microscopic examination . to validate the staining procedure for each staining run
, we used a positive control slide containing tissue section from the cervical biopsy of invasive squamous cell carcinoma with known diffuse immunoreactivity for p16ink4a . for a negative control , we used the buffer solution rather than the primary antibody
four surgical pathologists reviewed the hematoxylin and eosin ( h&e)-stained slides , and then made a diagnosis based on the histological features .
these diagnoses include benign lesions such as immature squamous metaplasia , transitional metaplasia or borderline condyloma - like lesion , cin 1 , cin 2 , and cin 3 .
then , each pathologist performed the second - round review of the h&e slide and the slide stained for p16ink4a , and the third - round review of h&e slide and those for p16ink4a and ki-67 .
this was followed by the interpretation of the slides by each pathologist based on his or her own criteria . then , the diagnosis was revised .
a majority of diagnoses were made based on concordance in the diagnosis between the pathologists ; a diagnosis was established when at least three of four pathologists agreed on the diagnosis .
if there was a lack of the majority diagnosis , a final consensus diagnosis was reached through a simultaneous meeting of all the four pathologists .
this was followed by the interpretation of the immunohistochemical findings for p16ink4a and ki-67 based on the interpretation criteria .
the expression of p16ink4a was scored as 0 ( negative ) , 1 ( focal and weak cytoplasmic staining with or without nuclear staining in superficial or intermediate layers ) , 2 ( intermediate between 1 and 3 ) , and 3 ( diffuse and strong nuclear staining in lower 2/3 or whole layers with or without cytoplasmic staining ) ( fig .
the expression of ki-67 was evaluated based on the distribution and proportion of positive cells in the squamous epithelium .
ki-67 was occasionally seen in suprabasal layers of the normal squamous epithelium ( score 0 ) , while its expression was extended to upper layers of the squamous epithelium with the progression of dysplasia from cin 1 ( score 1 ) to cin 3 ( score 3 ) ( fig .
was evaluated by calculating the kappa value for the pairs of ' first and second ' and ' first and third ' diagnoses .
then , these values were compared with the histologic groups : benign / cin 1 and cin 2/3 .
following an analysis of the agreement that was reached in more than three pathologists according to the category ( benign , cin 1 and cin 2/3 ) , the overall rates of the concordance in the first ( h&e slide only ) , the second ( h&e slide and p16ink4a - stained slide ) , and the third ( h&e slide , p16ink4a- and ki-67-stained slides ) diagnoses were 77.5% , 82.0% , and 82.0% , respectively .
the rate of the concordance in the diagnosis of cin 2/3 was increased from 62.2% to 73.0% .
for the first - round diagnosis made based on the h&e slide only , none or one pathologist agreed on the same diagnosis as a consensus diagnosis in 17 cases ( 15.3% ) .
but there were at least two pathologists who agreed on both the second- and third - round diagnosis .
the second - round diagnosis was a consensus one in two cases ( 1.8% ) ( table 1 ) . following a review of the immunostained slides for p16ink4a and ki-67 , the pathologist 1 , 2 , 3 , and 4 revised the diagnosis at concordance rates of 17.1% and 4.5% ; 15.3% and 13.5% ; 4.5% and 6.3% ; and 29.7% and 10.8% , respectively , in the corresponding order . in revising the diagnosis , the pathologist 3 had the highest concordance rate ( kappa value , 0.925 and 0.900 ) and the pathologist 4 did at the lowest concordance rate ( kappa value , 0.589 and 0.850 ) .
in addition , the pathologist 1 and 2 had the concordance rates of 0.710 and 0.929 and 0.733 and 0.774 , respectively , in the corresponding order .
there were significant differences in the kappa values between the four pathologists ( p<0.05 ) . in 29 cases
there were eight cases showing an immature squamous metaplasia or a borderine condyloma - like change with a p16ink4a expression score of 2 or an increased ki-67 labeling .
of these cases , five cases and the remaining three finally had a revised diagnosis of benign cellular change and cin 1 , respectively ( fig .
there were two cases of senile atrophy with cin 2 or cin 3 lesions with a p16ink4a expression score of 3 and an increased ki-67 labeling .
the remaining 19 cases showed a broad - spectrum of squamous epithelial changes from squamous metaplasia to cin 3 on the same biopsy .
but these cases had a p16ink4a and ki-67 expression score of 2 or 3 , which led to the diagnosis cin 2 or 3 ( fig .
5 ) . following a review of the h&e - stained slides and immunostained ones for p16ink4a and ki-67 ,
there were 60 cases whose diagnosis was classified as a benign lesion . in addition , there were 44 cases showing no expression of p16ink4a , 14 cases with a p16ink4a expression score of 1 and two cases with a p16ink4a expression score of 2 .
fourteen cases were diagnosed as cin 1 lesions , which comprised four cases with a p16ink4a expression score of 1 and ten cases with a p16ink4a expression score of 2 ( fig .
all the 18 cases of cin 2 lesions showed a p16ink4a expression score of 2 , but 19 cases of cin 3 lesions showed a p16ink4a expression score of 3 ( table 2 ) .
p16ink4a is a cyclin - dependent kinase ( cdk)-4 inhibitor that blocks the cell cycle by inhibiting cdk-4 with the inactivation of prb protein .
its expression in normal adult tissue is limited to the proliferative endometrium , breast ducts , gastric antral cells , esophageal squamous epithelium , salivary glands , and some neuroendocrine cells.14 the expression of p16ink4a has been shown to disappear in some types of tumor including familial melanoma , but it is overexpressed in other types of tumor such as gastric adenocarcinoma , malignant lymphoma and lung cancer.15=19 although p16ink4a is not expressed in the normal epithelium , it is overexpressed in almost all cases of epithelial neoplasia of uterine cervix . therefore , an immunohistochemistry of p16ink4a has been used as an indicator for making a diagnosis of pre - invasive and invasive epithelial neoplasia of uterine cervix.2 - 5,7 - 13,20 in uterine cervix , e7 protein of hr - hpv inactivates rb protein , which normally inhibits transcription of p16ink4a , resulting in the accumulation of p16ink4a protein.21 it can therefore be inferred that hr - hpv - infected epithelial cells of the uterine cervix have a positive immunohistochemistry for p16ink4a .
this can therefore be used as a surrogate indicator for the presence of hr - hpv - induced squamous and glandular lesions of the uterine cervix .
a substantial number of studies have been conducted to examine the diagnostic value of p16ink4a immunostain in improving the accuracy of histological diagnosis using the tissue samples of the uterine cervix .
this showed that it is useful in many aspects ; the immunostain for p16ink4a assists in detecting very small lesions with fragmentation which can be missed or overlooked on the h&e stain.3,7,8 in addition , it is also helpful for distinguishing hpv - related lesions from benign mimickers including severe atrophy , reactive changes with inflammation or immature metaplasia.2,7,9 our results revealed these findings in cases which were misdiagnosed as cin 3 on the h&e slide but proved to be severe atrophy following the second - round review of the slide stained for p16ink4a .
we conducted the current study to examine the usefulness of p16ink4a and ki-67 immunostaining in reducing an inter - observer variation in the histopathological interpretation of cervical biopsy between the pathologists .
the pathologist 4 revised the diagnosis the most frequently based on the p16ink4a- and ki-67-immunostains but the pathologist 3 did the least frequently .
klaes et al.3 reported that the concordance rate was improved to 96% . but horn et al.8 reported that it was improved to 74% . in the current study with the additional use of p16ink4a immunostains , the concordance rate was increased from 77.5% to 82.0% .
the current three - tier cin classification system in the interpretation of the h&e slides is well known for its poor reproducibility.22 in addition , it is also difficult to make a differentiation between benign mimickers and cin 1.3,22 our results also showed that no majority diagnosis was made for some cases because there was a variability in the interpretation based on the current three - tier cin system between the pathologists .
in addition , a lack of the standard staining protocol has been pointed as potential factors of inconsistent result of p16ink4a immunostain.2,13 lack of standardized criteria for interpretation of p16ink4a immunostain was also problematic . staining intensity , number of stained cells and distribution of stained cells were arbitrarily selected by authors.2 - 5,7 - 13,20,23,24 moreover , there was also a variability in the cut - off point for grading the percentage of the stained cells depending on the authors . because p16ink4a is a nuclear protein , its immunostaining property is expected to show nuclear stain . but cytoplasmic stain with or without nuclear stain can be seen through posttranscriptional modification or overproduction of p16ink4a protein.13,20 based on our grading system , we scored the expression of p16ink4a as 0 ( negative ) , 1 ( focal and weak cytoplasmic staining with or without nuclear staining in superficial or intermediate layers ) , 2 ( intermediate between 1 and 3 ) , and 3 ( diffuse and strong nuclear staining in lower 2/3 or whole layers with or without cytoplasmic staining ) .
this showed that cases with score 3 were categorized into cin 2 and 3 but most of the non - neoplastic cervix were negative for p16ink4a .
our results showed that the first - round diagnosis was modified if the lesion showed a diffuse stain of p16ink4a in full layers .
conversely , a complete absence of p16ink4a immunostaining could rule out an associated high - grade squamous intraepithelial lesion.25,26 a small number of weakly stained cells were solely found or clustered in upper layers of the cin 1 lesions .
but some lesions showed a strong expression in lower part of the epithelium in diffuse pattern .
the latter cases were thought to be associated with a hr - hpv infection.21 this deserves more meticulous follow - up studies because there is a possibility that the above lesions might progress to a higher degree of cin.2,3 in the current study , the first diagnosis of cin 1 was revised the most frequently following the review of the p16ink4a stain .
it is presumed , however , that there are potential risks of misdiagnosis in regard to the weakly or scattered stained cells .
this is because weak positive stain can be seen in non - hpv related uterine cervix such as in normal epithelium with inflammation or metaplasia.4,10,11,24 staining property of non - epithelial cells including fibroblasts , endothelial cells and inflammatory cells has also been reported.4,6,24 our results showed that there were 14 cases with a p16ink4a expression score of 1 and two cases with a p16ink4a expression score of 2 .
following the re - assessment of the histologic sections in combination with the ki-67 labeling , however , the above cases were interpreted as an immature squamous metaplasia or a borderline condyloma - like lesion . despite a diagnostic value of p16ink4a in significantly improving the accuracy in making a diagnosis of the epithelial lesions of the uterine cervix , there are various exceptions that it should be used in combination with other markers in establishing a diagnosis in a routine clinical setting.12 ki-67 has been used in combination with p16ink4a because it can be of help for making a differentiation of a high - grade cin from benign mimickers .
this is particularly the case with atrophy and a low - grade cin whose p16ink4a immunostains are ambiguous or equivocal.2,5 but there is a variability in the interpretation of ki-67-immunostained slides depending on the authors .
the normal squamous epithelium of uterine cervix shows occasionally positive cells in suprabasal layers,27 and its expression is increased from the lower to upper layers with a progression of the dysplasia from cin 1 to cin 3 .
we evaluated the degree of expression of ki-67 in squamous epithelium , in lower 1/3 , half or more than 2/3 , corresponding to the cin 1 , cin 2 or cin 3 , respectively .
its expression was helpful in not only interpreting the atrophic squamous epithelium which was misinterpreted as cin 3 but also grading the cin lesions in combination with p16ink4a .
again , ki-67 expression is also increased in the inflammatory and reactive cases or normal epithelium in the luteal phase.5,10 in conclusion , the concomitant use of ki-67 and p16ink4a immunostains might be more effective .
in addition , criteria for interpreting both markers should be strictly applied to the evaluation of cervical lesions , which would be essential for reducing an inter - observer variability . | backgroundimmunohistochemical staining for p16ink4a and ki-67 has been used to improve the accuracy in making a diagnosis of the uterine cervix cancer on biopsy .
this study was conducted to examine the usefulness of these markers in the pathological diagnosis based on cervical biopsy.methodswe selected a consecutive series of 111 colposcopically directed cervical punch biopsies . using these biopsy samples , we performed an immunohistochemical staining for p16ink4a and ki-67 to establish a diagnosis .
the slides were circulated among four pathologists in a sequential order : the hematoxylin and eosin ( h&e ) slide , h&e slide and p16ink4a - stained slide , and h&e slide , p16ink4a- and ki-67-stained slides.resultsthe overall rates of the concordance in the first , the second , and the third diagnoses were 77.5% , 82.0% , and 82.0% , respectively .
the rate of the concordance in the diagnosis of cervical intraepithelial neoplasm ( cin ) 2/3 was increased from 62.2% to 73.0% .
but there was a variability in the rate of the revision of the diagnosis between the pathologists . with the application of criteria for interpreting the expressions of p16ink4a and ki-67
, benign and cin 1 lesions showed a p16ink4a expression score of 0 or 1 .
but cin 2 and cin 3 lesions showed a p16ink4a expression score of 2 and 3 , respectively.conclusionsthe immunostain for p16ink4a and ki-67 might be useful in reducing an inter - observer variability .
but criteria for interpreting both markers should be strictly applied . |
pseudoexfoliation syndrome ( pex ) is a common clinical condition that is characterized by the development of white and dandruff - like flakes in the anterior segments and is often associated with decreases and morphological changes in corneal endothelial cells.1,2 it is known that the presence of pex aggravates the risk of intraoperative complications during cataract surgery because of poor pupil dilation and fragile zonules.36 however , whether pex is a risk factor for reduction in corneal endothelial cell density ( ecd ) after cataract surgery is still controversial .
one study showed that a reduction in ecd was significantly greater in eyes with pex,7 whereas other studies reported contradictory findings.810 there are inherent difficulties in comparative assessments of ecd between eyes with and without pex .
first , advanced patient age11,12 and the presence of pex1,2 negatively affect ecd regardless of the performance of cataract surgery ; thus , preoperative matching between the two groups is not easy .
second is the accuracy of the ecd assessment ; variance in ecd counting is reported to be 6% , even when images of excellent quality are used.13 furthermore , ecd counting may vary by 2%5% when several examiners are involved.11 because designing a well - controlled comparative study is difficult , a factor analytical study of multiple parameters that may influence ecd should be considered . to our knowledge , such a factor analysis has rarely been reported .
kaljurand and teesalu revealed that ultrasound ( us ) power and patient age were significant factors for ecd reduction.9 polymethyl methacrylate intraocular lenses were implanted through enlarged incisions , so that the reductions in ecd were high in both groups ( 18.1% and 11.6% in the pex and control groups , respectively ) .
hence , the results can not be applied to the current small incision cataract surgery .
the purpose of this study was to investigate the factors associated with reduction in ecd when eyes with pex underwent modern small incision cataract surgery .
this retrospective study was performed in accordance with the declaration of helsinki , and the study protocol was approved by the ethics review board of miyata eye hospital . written informed consent for use of the clinical data was obtained from all patients .
the clinical records of patients who had eyes with pex and who had undergone cataract surgery from june 2010 to may 2013 were reviewed .
the inclusion criteria were an eye with pex that was diagnosed preoperatively under slit lamp microscopy and an eye that had undergone cataract surgery with phacoemulsification and aspiration and intraocular lens implantation into the capsular bag . in cases of bilateral cataract surgery ,
eyes with corneal pathologies , uveitis , history of other intraocular surgery , laser iridotomy , combined surgery with trabeculectomy or vitrectomy , conversion to extracapsular cataract extraction , intraocular surgery during postoperative observation duration , and patients who were younger than 60 years were excluded . before cataract surgery ,
ecd , anterior chamber depth ( acd ) , and dilated pupil diameter were examined .
ecd in the center of the cornea was measured using a specular microscope ( fa-3509 ; konan medical , nishinomiya , hyogo , japan ) , and experienced examiners selected the reference cells for counting the ecd with the installed software .
all cataract surgeries were performed by experienced surgeons using an infiniti vision system ( alcon laboratories , inc . , fort worth , tx , usa ) . after creating a superior scleral incision of 2.22.4 mm in width ,
the cataract was removed with phacoemulsification and aspiration , while the corneal endothelial cells were protected using the soft - shell technique.14 when pupillary dilation was insufficient , the pupil was enlarged by multiple partial sphincterotomies or the use of iris expanders . in cases of zonular dialysis , a capsular tension ring was used .
surgery time and the time ( us time ) and total power ( us total power ) of the ultrasonic that was applied were recorded .
the ecd was measured 3 months after surgery , and the reduction rate in ecd was calculated .
the aqueous flare intensity was measured using a laser flare meter ( fm-500 ; kowa , nagoya , aichi , japan ) at 1 week and 1 month postoperatively .
factors related to the reduction rate in ecd were evaluated by using multiple regression analysis .
first , the cross - correlation and principal factor analyses were conducted for excluding the parameters that would have led to multicollinearity with other parameters .
then , step - wise multiple regression analysis with respect to the reduction rate in ecd was performed with the selected parameters .
the results are expressed as the mean sd for continuous variables and as frequencies and percentages for categorical variables .
seventy - eight eyes of 78 patients ( 23 men and 55 women ) were enrolled .
preoperatively , the ecd was 2,464337 cells / mm , and 3 months postoperatively , the ecd was 2,400347 cells / mm , giving a reduction rate of ecd of 2.6%5.1% ranging from 6.4% to 18.4% . with the sample size and a significance level of 5% ,
the detection power in multiple regression analysis of the two factors was anticipated to be 75% when r was 0.10 .
the parameters used in the multiple regression analysis resulted in patient age , preoperative ecd , dilated pupil diameter , cataract grade , concomitance of diabetes mellitus or glaucoma , preoperative acd , surgery time , us time , us total power , pupillary enlargement , and aqueous flare intensity at 1 week and 1 month postoperatively .
the analysis yielded a significant multiple correlation ( r=0.12 , p=0.006 ) , and the final linear regression model included significant parameters of the cataract grade ( p=0.019 ) and preoperative acd ( p=0.023 ) ( table 2 ) .
the ecd was reduced by 1.39% with a step of the emery - little classification and by 3.45% with a 1 mm decrease in the preoperative acd .
figures 1 and 2 show the relationships between the reduction rate in ecd and cataract grade ( the emery - little classification ) as well as the preoperative acd .
in the current study , the reduction rate in ecd was 2.6%5.1% . in previous studies ,
the reduction rate in ecd due to cataract surgery in pex eyes was reported to be 9.0% at 3 months postoperation,7 11.1% at 6 months postoperation,8 and 18.1% at 1 month postoperation.9 the difference from the current study might be because of differences in the preoperative ecd , patient ages , and surgical procedure .
the current study used a small incision , the soft - shell technique , and surgical instruments equipped with sophisticated intraoperative fluidics .
the current study showed a significant association of the cataract grade . in eyes without pex , a higher density cataract needs more us time and us total power,15,16 resulting in a significant increase in the risk of ecd reduction.10,15,17,18 the previous comparison between pe and control eyes showed no significant differences in the cataract grade and the reduction in ecd.19 thus , the reduction in ecd resulting from the cataract grade was not considered to be pex related .
an in vitro investigation shows that corneal endothelial cell damage decreased with the distance to the phacoemulsification tip.20 in eyes without pex , a population - based study revealed that eyes with shallower acds had an anatomically shorter ocular axial length21 and that a short ocular axial length was a risk for ecd reduction after cataract surgery.18,22 comparison of the acd between eyes with and without pex is still unknown ; arnarsson et al23 reported no difference , while zheng et al24 found significantly shallower acd in eyes with pex . to date , concluding that preoperative acd was related with pex is difficult .
the intraoperative pupillary size is significantly smaller in eyes with pex.4,7,25 insufficient mydriasis is a risk of intraoperative complications , such as posterior capsule rupture and vitreous loss.26 the current study applied pupillary enlargement for cases of poor pupillary dilatation .
although the pupillary enlargement increased surgery time , there was no significant reduction in ecd , suggesting that pupillary enlargement to secure a sufficient working space during phacoemulsification was effective and safe in eyes with pex .
zimmermann et al27 classified eyes into two grades based on the amount of visible pex deposits on the crystalline lens , and eyes with a more severe pex grade compromised ecd , and showed that ecd decreased with higher pex grades . in the current study ,
second , the retrospective study examined the ecd only , and a morphological analysis of corneal endothelial cells was not performed .
after cataract surgery in eyes with pex , the sizes of the corneal endothelial cells were increased and the cell shape became more variable.7 morphological analyses , such as of the rate of the hexagonal cells and variation in cell size , might be more sensitive indicators .
comparative assessments of ecd inherently pose difficulties in matching preoperative demographics and accuracy of the ecd assessment , whereas the comparison of reduction in ecd and patient s demographics demonstrates no significant difference,19 which supported the analysis results in the current study .
hence , we concluded that the current analysis with no control group would be effective .
the current study indicated that a higher cataract grade and shallower preoperative anterior chamber are risk factors for ecd reduction after cataract surgery in eyes with pex .
these two factors are not unique to pex , and there has been no known difference in such parameters between eyes with and without pex .
thus , it is suggested that corneal endothelial cell damage in eyes with pex is attributable to surgical invasion itself and it is not clear at present whether the presence of pex further added to an ecd reduction . | purposethe aim of this study was to investigate the factors associated with decreases in corneal endothelial cell density ( ecd ) resulting from cataract surgery in eyes with pseudoexfoliation syndrome ( pex).methodsthe clinical records of 78 eyes of 78 patients with pex who had undergone cataract surgery were reviewed .
ecd was measured preoperatively and at 3 months postoperatively with specular microscopy .
multiple regression analysis was used to assess the factors that were significantly related to the rate of ecd loss .
explanatory variables included age , preoperative ecd , pupil diameter , cataract grade , concomitance of glaucoma or diabetes mellitus , preoperative anterior chamber depth , surgery time , total time and power of ultrasound , performance of intraoperative pupillary enlargement manipulation , and postoperative aqueous flare intensity at 1 week and 1 month.resultsecd before and after surgery was 2,464337 cells / mm2 and 2,400347 cells / mm2 , respectively , with an ecd loss rate of 2.6%5.1% ( mean sd ) .
multiple regression analysis revealed that ecd loss was significantly associated with the cataract grade ( p=0.019 ) and preoperative anterior chamber depth ( p=0.023).conclusionwith modern small incision cataract surgery , the ecd loss varied with surgical invasions due to severe cataract and shallow anterior chamber , and the presence of pex was least affected . |
the most important forms of liver disease in dialysis patients are viral hepatitis b ( hbv ) and c ( hcv ) .
the vast majority of literature on dialysis for hepatitis refers to hemodialysis ( hd ) .
individuals receiving peritoneal dialysis ( pd ) are at less risk of acquiring blood - borne infections for several reasons , including an absence of extracorporeal blood manipulation , a lack of intravascular access , as well as a lower requirement for blood transfusions . also , pd takes place in the patient 's home , where there is no exposure to other patients .
an accurate assessment of the natural history of hcv in dialysis patients is not easy to obtain .
hcv infection extends over decades rather than years whereas chronic kidney - disease ( ckd ) patients generally have higher morbidity and mortality rates than those of the general population , due to age and comorbidity conditions .
additional factors also modify the course of liver disease , including hbv / hcv coinfection , coinfection with human immunodeficiency virus , or alcohol abuse .
because of the wide use of antiviral drugs and because posttransfusional hepatitis no longer occurs , future natural - history studies on chronic hcv will become less possible .
accurate evaluation of hcv infection in the ckd population is further complicated by the observation that aminotransferase values are typically lower in dialysis than nonuremic populations . however , dialysis patients that do show detectable hcv rna have aminotransferase levels greater than those who do not , although values are typically within the normal range [ 4 , 5 ] .
therefore , if one wants to assess the impact of chronic hcv infection in ckd patients , a liver biopsy is usually performed .
however , a liver biopsy may be replaced by noninvasive tests , such as a fibrotest or a fibroscan [ 6 , 7 ] , and these tests are of particular interest when there is a possibility of kidney transplantation to treat ckd .
a recent meta - analysis on the impact of hcv on mortality in 11,589 maintenance - dialysis patients , from seven observational studies , concluded that the estimated adjusted relative risk ( arr : all cause mortality ) was 1.34 ( 1.131.59 ; p < .01 ) .
the cause of death as hepatocellular carcinoma and the incidence of liver cirrhosis , were significantly more frequent among anti - hcv - positive than anti - hcv - negative dialysis patients in all seven studies .
the unadjusted summary estimate for liver - related mortality was 5.89 ( 1.9317.99 ; p < .001 ) according to a random - effects model .
recently , kalantar - zadeh et al . evaluated a database of 13,664 chronic hd patients in the united states who had undergone hcv serology .
they observed that the mortality - hazard ratio was strongly associated with hcv infection : that is , it was 1.25 ( 1.121.39 ; p < .001 ) .
thus , when hcv - positive ckd patients undergo kidney transplantation , it is possible that the natural course of chronic hcv infection is altered by the use of chronic immunosuppression .
indeed , two studies have shown that survival was significantly improved in hcv - positive patients who had benefited from a kidney transplant compared to those who remained on a kidney waiting list [ 10 , 11 ] .
after kidney transplantation , within the first 5 years posttransplant , patient survival is similar in both hcv - positive and hcv - negative patients [ 1214 ] .
however , when 10-year survival rates are examined , hcv then appears to be a detrimental effect [ 1214 ] . a meta - analysis of observational studies identified eight clinical trials ( 6,365 unique patients ) in which the presence of anti - hcv antibodies in the serum was an independent and significant risk factor for death and graft failure after kidney transplantation .
the estimates for relative risk ( rr ) were 1.79 ( 1.572.03 ) and 1.56 ( 1.351.80 ) , respectively .
the adverse impact of hcv on survival after kidney transplantation has been linked to liver dysfunction .
furthermore , a positive anti - hcv serology in kidney - transplant patients has been implicated in the development of de novo glomerulopathy , an increased incidence of serious infections , and new - onset diabetes mellitus .
in addition , in kidney - transplant patients , the use of alpha - interferon ( ifn ) to treat hcv infection has been associated with ( i ) a poor response to antiviral therapy and ( ii ) the occurrence of a high rate of acute rejection , that is , up to 50% in some series [ 22 , 23 ] .
conversely , in kidney - transplant patients , the use of pegylated alpha - interferon ( pegifn ) , although more limited , has been rarely associated with acute allograft rejection . because of the above concerns , it seems reasonable to treat hcv infection while the patient is on dialysis , that is , before they are placed on a kidney - transplant waiting list .
at the moment , the best treatment for chronic hcv infection in patients with normal renal function relies on the combined use of pegifn and ribavirin ( rbv ) .
thus , hartwell and shepherd recently performed a meta - analysis that included ten randomized , controlled trials ( rcts ) in which treatment was based on pegifn / rbv or ifn / rbv .
pegifn / rbv therapy resulted in significantly higher sustained virological response ( svr ) rates than treatment with the combined ifn / rbv therapy .
treatment for 48 weeks with pegifn / rbv was significantly more effective than the same treatment for 24 weeks .
significantly higher svr rates were seen with combined ifn / rbv compared to either an ifn monotherapy or to no treatment . in this meta - analysis
( four ifn trials ) , the relative risk of not experiencing an svr was 0.59 ( 95% ci , 0.510.69 ) and was highly statistically significant ( p < .00001 ) .
svrs were higher for patients with genotype non-1 compared with genotype 1 for both pegifn / rbv and ifn / rbv treatments .
the aasld ( american association for the study of liver diseases ) has published guidelines for the ckd population stating that when hcv infection is identified in persons with ckd , interferon - based antiviral treatment must be considered , but the regimen will vary depending of the kidney disease the decision to treat must take into account the competing severities of the ckd and the chronic liver disease , the risks of the treatment itself , , and whether there are comorbid conditions that may affect morbidity and mortality , such as cardiovascular disease . .
the kidneys play a major role in the catabolism and filtration of both interferon and ribavirin ; thus , their clearances may be affected in subjects with ckd [ 28 , 29 ] .
the clearance of pegylated interferon is affected in those with ckd , although hemodialysis does not affect its clearance .
hence , the aasld guidelines recommend subcutaneous weekly doses of 1 g / kg of peginterferon alpha-2b and of 135 g of peginterferon alpha-2a to patients with stage 35 ckd .
because ribavirin is eliminated by the kidney , and if overdosed might result in dramatic anemia , ribavirin therapy is contraindicated when creatinine clearance is < 50 ml / min . hence , most data regarding hcv treatment in the ckd population deal with the use of either standard -interferon or -pegylated interferon .
with regards to end - stage kidney - disease ( eskd ) patients who are chronically treated by dialysis , casanovas - taltavull et al . reviewed two meta - analyses ( meta-1 and meta-2 ) published in 2008 ( table 1 ) . from these
, they analyzed the svrs , any adverse effects , and the reasons for discontinuing ifn treatment in dialysis patients .
the meta-1 study analyzed results obtained from 645 patients ; the meta-2 study used data from 459 patients ( 19 studies were duplicated ) .
overall , the svr was 40% ; svr in genotype 1 was 33% , with pegylated interferon providing few additional benefits over conventional alpha - interferon .
adverse events , such as typical flu - like syndrome occurred in 41% of patients , requiring withdrawal of antiviral treatment in 11% of them .
a high rate of anemia was also documented , although the use of recombinant erythropoietin , intravenous iron administration , or transfusions was not generally reported .
a typical flu - like syndrome occurred in 41% of patients , which required withdrawal of antiviral treatment in 11% .
severe adverse events were divided into the following groups : hormonal ( thyroid ) , bone pain , cytopenia , gastrointestinal , immunological ( prior graft rejection ) , central nervous system , cardiovascular , and infectious problems .
the reviewers of these meta - analyses pointed out any bias in the selection criteria of candidates for treatment , limitations related to the number and type of adverse effects ( as well as their clinical evaluation ) , and discrepancies in cases of discontinuation of treatment or loss to follow - up . with regards to meta-1 ,
the primary outcome was a svr ( as a measure of efficacy ) ; the secondary outcome was the drop - out rate ( as a measure of tolerability ) .
they identified 13 prospective studies , which were controlled clinical trials that included 539 unique patients , of whom 10 ( 76.9% ) patients were receiving maintenance dialysis .
pooling of these studies ' results showed a significant increase in viral response of patients treated with antiviral therapy compared to patients who did not receive any therapy ( controls ) . the pooled odds ratio ( or ) of failure to obtain a svr was 0.081 ( 95% confidence intervals ( ci ) , 0.0290.230 ) , p = .0001 .
the pooled or of drop - out rate was significantly increased in treated versus control patients , or = 0.389 ( 95% ci , 0.1550.957 ) , p = .04 .
the studies were heterogeneous with regard to viral response and drop - out rate . in the subset of clinical trials
( n = 6 ) involving only dialysis patients receiving -ifn monotherapy for chronic hcv , there was a significant difference in the risk of failure to obtain a svr ( study versus control patients ) , or = 0.054 ( 95% ci , 0.019 ; 0.150 ) , p = .0001 .
no difference in the drop - out rate between study and control patients was shown ( or = 0.920 ( 95% ci , 0.367 ; 2.311 ) , ns ) .
meta-1 showed that viral response was greater in patients with chronic kidney disease who received antiviral therapy than in controls .
no differences in the drop - out rates between study and control patients occurred in the subgroup of dialysis patients on -ifn monotherapy . with regards to meta-2
, the authors took into account those chronic dialysis patients with chronic hcv infection who were either treated with ifn or pegifn , with or without ribavirin .
they searched on medline for indexed studies since 1966 , and only selected studies with a sample size greater than 10 .
they looked for the following parameters : svr at 6 months after treatment , rate of treatment discontinuation caused by adverse events , and factors associated with these outcomes .
they analyzed 20 studies that contained 459 ifn - treated patients , three studies that contained 38 pegifn - treated patients , and two studies that contained 49 pegifn and ribavirin - treated patients .
the overall svr rate was 41% ( 95% confidence interval [ ci ] , 33 to 49 ) for ifn and 37% ( 95% ci , 9 to 77 ) for pegifn .
treatment - discontinuation rates were 26% ( 95% ci , 20 to 34 ) for ifn and 28% ( 95% ci , 12 to 53 ) for pegifn .
svr was higher , with 3 million units ( mu ) or higher of ifn at three times weekly , with lower mean amounts of hcv rna , lower rates of cirrhosis , a hcv genotype 1 , or elevated transaminase , though these findings were not statistically significant .
hence , side - effects from alpha - interferon were numerous , particularly in the eskd population .
the main side effects were fatigue / weakness and loss of appetite , which may lead to weight loss and , thus , fluid overload if dry weight is not adapted accordingly .
many patients also developed anemia , which often requires commencement or increased treatment with erythropoietin - stimulating agents ; in addition , seizures can occur if there is fluid overload and hypertension .
the limitations of these meta - analyses were publication bias , there were few randomized controlled trials , and there were limitations in generalizability of all hemodialysis patients . in conclusion ,
thus , a higher weekly dose of ifn , a lower mean level of pretreatment hcv rna , a lower rate of cirrhosis , an hcv genotype different from 1 , and/or decreased transaminase levels may all be associated with greater svr rates .
a more recent meta - analysis has been published on a group of 770 hemodialysis patients with chronic hcv infection ( table 1 ) , in which the authors evaluated factors that were associated to svr after -pegylated or standard -ifn monotherapy .
twenty - one studies on -ifn - alfa2a or -ifn - alfa2b ( 491 patients ) and 12 on pegylated - ifn - alfa2a or peg - ifn - alfa2b ( 279 patients ) were evaluated .
the pooled svrs for standard and pegylated -ifn monotherapy in random - effect models were 39.1% ( 95% ci , 32.1 to 46.1 ) and 39.3% ( 95% ci , 26.5 to 52.1 ) , respectively .
pooled dropout rates were 22.6% ( 95% ci , 10.4 to 34.8 ) and 29.7% ( 95% ci , 21.7 to 37.7 ) , respectively .
female gender , hcv - rna copies per ml , hcv genotype , alanine transaminase pattern , duration of infection , stage of liver fibrosis , and treatment duration were not associated with svr . only an age less than 40 years was significantly associated with svr ( odds ratio , 2.17 ; 95% ci , 1.03 to 4.50 ) .
there are only few limited reports that describe the combined use of ( peg)alpha - interferon and ribavirin in dialysis patients . with regard to this combined therapy , the aasld guidelines state that ribavirin can be used in combination with interferon with a markedly reduced daily dose with careful monitoring for anemia and other adverse effects . .
the largest series published so far on the combined use of peginterferon alpha-2a plus ribavirin in hemodialysis patients obtained a svr rate of 97% ( 34/35 ) in the treated patients ( peginterferon alpha-2a plus ribavirin ) versus 0% ( 0/35 ) in untreated controls .
these findings have not been confirmed in further reports where the svr rate ranges between 7% and 71% .
in the general population , with regard to the treatment of acute hcv infection , the aasld guidelines state that treatment can be delayed for 8 to 12 weeks after acute onset of hepatitis to allow spontaneous resolution ; although excellent results were achieved using standard interferon monotherapy , it is appropriate to consider the use of peginterferon until more information becomes available , no definitive recommendation can be made about the optimal duration needed for treatment of acute hepatitis c ; however , it is reasonable to treat for at least 12 weeks and 24 weeks may be considered . . in dialysis patients ,
they included 35 dialysis patients that had no spontaneous clearance of hcv at 16 weeks after acute hcv infection .
they were thus then given a course of peginterferon alpha 2a at 135 g weekly for 24 weeks .
they compared the results with those from a historical series of 36 hemodialysis patients who had acute hepatitis c , but had not received treatment .
the rate of svr in their treatment group was significantly higher than the rate of spontaneous hcv clearance in the control historical series group ( 88.6% versus 16.7% ) .
all but one patient had a rapid virologic response ( undetectable hcv rna levels at 4 weeks of therapy ) , and all patients who received more than 12 weeks of therapy had early and end - of - treatment virologic responses .
all patients who had clearance of hcv by 16 weeks had undetectable hcv rna levels during and at the end of follow - up .
liu et al . conclude that pegylated ifn alfa-2a monotherapy is safe and efficacious for hemodialysis patients with acute hepatitis c. it is suggested that patients without spontaneous clearance of hcv by week 16 should receive this therapy . .
in addition , dialysis patients who were cleared of the hcv virus after antiviral therapy , and received kidney transplantation , did not present with hcv reactivation , despite heavy immunosuppression . hence , 16 hcv seropositive / hcv rna - positive hemodialysis patients who were treated with ifn - alpha ( 9 mu / wk during 6 or 12 months ) underwent kidney transplantation 38 months ( range : 2 to 57 ) after alpha - ifn therapy . at kidney transplantation ,
immunosuppression relied on anticalcineurin agents with or without steroids and/or antimetabolites ; in addition , 12 of them received induction therapy with antithymocyte globulins ; at the last follow - up after kidney transplantation , that is , 22.5 months ( range , 2 to 88 ) , hcv viremia remained negative in all patients .
recently , we have assessed the persistence of hcv infection in 26 hcv seropositive kidney - transplant patients currently receiving immunosuppressants , and who were formerly infected with hcv , that is , they had eliminated hcv either spontaneously or after interferon- therapy while on hemodialysis .
no biochemical or virological relapse was seen during the median posttransplant follow - up of 10.5 years ( range : 216 ) in those patients who received immunosuppressive therapy that included calcineurin inhibitors ( 100% ) , and/or steroids ( 62% ) , and/or antimetabolites ( 94% ) . at the last follow - up ,
all had undetectable hcv rna according to the conventional tests that were repeated , on average , five times ( range , 115 ) .
we also looked for residual hcv rna in their plasma and peripheral blood - mononuclear cells ( pbmcs ) ( stimulated or not in culture ) with an ultrasensitive rt - pcr assay , followed by southern blotting for pbmcs : no hcv genomic rna was detected in the plasma samples or in the unstimulated and stimulated pbmcs .
thus , an absence of a relapse of hcv in formerly hcv - infected immunocompromised patients suggests complete eradication of hcv after its elimination while on dialysis .
these findings highlight the fact that hcv - positive dialysis patients who have a svr after completion of alpha-(peg)interferon therapy are really cured of hcv .
we conclude that , because it is not always safe to treat hcv infection after kidney transplantation , antiviral treatment should be implemented before transplantation , that is , while the patient is on dialysis therapy .
the evidence suggests that treatment might be based on alpha interferon ( standard or pegylated ) , this results in a high rate of sustained viral clearance . in cases where there is no virological response
, one could add very low doses of ribavirin therapy to the alpha - interferon in order to maximise the virological response .
finally , dialysis hcv seropositive patients who have a sustained virological response after antiviral therapy do not relapse after kidney transplantation despite powerful immunosuppressive therapy . | hepatitis c virus ( hcv ) infection is a blood - borne infection and its prevalence used to be elevated in hemodialysis ( hd ) patients .
its main mode of contamination relies on nosocomial transmission .
hcv infection is frequently associated in hd patients with normal liver enzymes whereas liver histology can display some degree of hcv - related lesions .
the assessment of hcv - related lesions , even in hd dialysis patients , can be done via noninvasive tests .
after kidney transplantation , hcv - related lesions can worsen ; however , in this setting antiviral treatment harbors the risk of acute rejection .
therefore , it is recommended to implement antiviral treatment while the patient is receiving dialysis therapy . in this
setting , the rate of viral clearance is usually high . in case of sustained virological response ,
no relapse occurs after kidney transplantation , despite heavy immunosuppression . |
beyond the apparent anatomical simplicity of the male reproductive system , which has a basic design consisting of a pair of gonads with its corresponding excurrent ducts and associated accessory sexual glands , there lies an overwhelmingly complex system that is responsible for gamete production and transport into the female tract for ultimate sexual reproduction .
although many aspects of the endocrine regulation of testis function are well understood and therapeutic options for hypogonadal men are available , many aspects of the multiple physiological processes involved in gamete development inside the testis are often deregulated and out of homeostasis , with the subsequent outcome of absent or disturbed spermatogenesis , which leads to infertility .
human infertility is usually defined as the inability of couples to achieve pregnancy after 12 months of unprotected intercourse and is a problem that currently affects 10 to 15% of couples .
an outstanding 50% of these cases are associated with male factors ( 1,2 ) specific etiologies of male infertility include systemic diseases ( e.g. , endocrine , infectious , and cancer ) , varicoceles , obstructive syndromes , genetic / chromosomal factors , testicular failure / hypogonadism , and cryptorchidism . of all of the causes
reported , approximately 12% of the determinants of primary dysfunction in the male reproductive organs are of unknown origin and are usually confounded by the context of multicausal origins ( figure 1 ) .
furthermore , it is clear that many cases of infertility are secondary to general systemic diseases or congenital defects , with reproductive consequences that may be treated when appropriate state - of - the - art procedures are implemented .
data in the literature show that 25 to 75% of cases ( depending on the report / study ) could theoretically be treated medically and/or surgically ( figure 1 ) . in many cases , very few sperm
are present in the testes , and they can be retrieved by biopsy and testicular sperm extraction from the tissue .
patients with access to assisted reproductive technologies ( art ) can undergo icsi ( intracytoplasmatic sperm injection ) , which is routinely used in many fertility centers worldwide , to achieve pregnancy .
however , the group of patients for whom art procedures are not an option deserves special attention .
these men present with azoospermia and varying degrees of germ cell pathology , from germinal aplasia to germ cell premeoitic / meiotic arrest .
this group of testicular pathologies has a poor prognosis and holds the status of being untreatable and incurable from a medical point of view .
we propose that men with incomplete spermatogenesis could be collectively classified as aspermatogenic , i.e. , having a severe testicular pathology with a complete absence of spermatids .
such men comprise from 25 to 50% of andrological cases ( 3,4 ) ( see figure 1 ) , and the only option currently available for these patients is adoption or artificial insemination using donor sperm .
histopathologic findings in biopsies from patients in the aspermatogenic group can be classified as : a ) sertoli cell only ( sco ) syndrome , which strictly consists of testes presenting a complete absence of germ cells ; b ) arrest at the level of meiotic germ cells ; or c ) spermatogonia only ( pre - meiotic arrest ) ( figure 2 ) .
sertoli cell only syndrome , i.e. , type i sco , refers to a situation in which testicular biopsy reveals an absence of germ cells in the seminiferous tubules ( 5 ) .
the presence of few seminiferous tubules showing active spermatogenesis has also been referred as to focal sco ( 6 ) or type ii sco ( mesh database pubmed ) .
however , in contrast to patients with complete sco , these patients benefit from art procedures , as their sperm can be retrieved by tese ( testicular sperm extraction ) .
type i sco can have a genetically determined developmental origin that results in the disturbance of migration and/or colonization of primordial germ cells ( pgcs ) into the genital ridges . because the diagnosis of type i or type ii sco depends on histopathologic analysis , which is of course prone to sampling error ( because biopsies cover only a very small portion of the testis ) ,
the situation would present less of a diagnostic challenge if a reliable , non - invasive method were available to distinguish cases of partial and complete absence of germ cells .
the first steps in this direction involved the amplification of specific germ cells , seminal vesicles and prostate mrna from cell - free seminal mrna by using rt - pcr ( 7 ) .
combinations of non - invasive diagnostic procedures with other procedures , such as hormonal profiles and histopathology , may unequivocally help to diagnose patients correctly .
as type i sco patients have no germ cells , the only possible way to generate offspring would be the use of their somatic cells to generate germline cells in vitro .
arrest represents a situation in which spermatogenesis stops at a specific stage of germ cell development .
mclachlan et al . proposed a nomenclature in which the term arrest exclusively refers to histological samples in which no progression occurs beyond that specific stage in any seminiferous tubule ( 5 ) .
arrest can represent an intermediate step on the way to more severe germ cell losses .
arrest occurs often at the spermatocytes or spermatogonial level ( 12.5% and 1.7% of 534 patients , respectively ) ( 5 ) .
arrest during spermiogenesis is rare , and hypospermatogenesis ( often misdiagnosed as arrest ) , in which a lower spermatid count is combined with the presence of all spermatogenic stages , which are reduced to some extent , accounts for up to 63% of cases ( 7 ) . in any case , because hypospermatogenesis results in the presence of spermatids , art procedures are applicable . given that germ cells are present in cases of arrest , an interesting strategy would be to differentiate these cells in vitro to obtain sperm for icsi or ivf ( in vitro fertilization ) .
interestingly , in arrest at the level of meiotic cells , these cells can be injected into oocytes to produce viable embryos and even offspring ( 8 - 10 ) .
for instance , only 15% of mouse oocytes injected with secondary spermatocytes generated offspring , whereas those injected with primary spermatocytes generated none ( 8) .
furthermore , in another set of experiments , from 0 to 9% of eggs fertilized by primary spermatocytes developed into adult fertile mice ( 9 ) .
in humans , one report showed an offspring - deriving efficiency of approximately 3% ( 10 ) .
for these reasons , the use of spermatocytes to compensate for a lack of more mature male germ cells will require further experimentation .
many patients believe that biological fatherhood has a very high value . in this respect ,
biotechnology offers , now more than ever , a basis on which to develop clinical applications for such cases , to restore fertility and consequently to obtain offspring . in this context , advances in cell biology from several animal models are waiting to be translated into human reproductive medicine , provided that some technical issues and biosafety and ethical concerns are overcome .
we propose four main groups of technologies that , alone or combined , could bring hope to men with severe cases of aspermatogenesis : i ) sperm derivation in vitro ; ii ) germ stem cell transplantation ; iii ) xenologous systems ; and iv ) haploidization .
the complex spatial and functional organization of the testis and its seminiferous epithelium make it difficult to achieve efficient spermatogenesis in artificial systems .
the observation of at least a few aspects of spermatogenesis in culture dishes has been a scientific aim for decades ( 17,18 ) .
spermatogenesis in vitro is not only a long - desired technique to gain deeper insight into the complex process of gametogenesis ; it is also desired for clinical applications to broaden the therapeutic options for men with infertility problems . given the current status of art and the requirement of only one sperm to fertilize an oocyte through icsi ,
the in vivo physiological situation , in which millions of sperm ( many more than needed ) are produced on a daily basis may be surpassed by in vitro strategies , which may be inefficient but which can generate a few fully mature sperm for art procedures .
spermatogenesis in vitro was first successfully achieved in vertebrates by using a fish model that consisted of a tissue culture system that supported full spermatogenesis in japanese eels ( 19,20 ) , which opened the possibility for similar technological advances in higher vertebrates .
systems for in vitro spermatogenesis in fish seem to be very simple from a practical point of view .
for example , one such system based on a spermatogonial cell line without sertoli cells and involving medaka fish , allowed postmeiotic advances in the presence of a culture medium containing a crude embryo extract with no specific growth factors added ( 21 ) , which introduced the idea that germ cells in lower vertebrates are more intrinsically programmed and less dependent on regulation by extrinsic signals .
currently , two main experimental approaches dominate the efforts to generate mammalian sperm in culture systems : organ culture of testes or testicular fragments that maintain the complex architecture of testicular tissue and its arrangement inside the epithelium . a recent article by sato et al .
convincingly demonstrated , in what has been described as a great scientific breakthrough , the feasibility of obtaining viable and apparently normal offspring from sperm generated through testicular tissue explants that initially contained immature germ cells ( 22 ) . in this approach ,
the cytoarchitecture of the gonad remains widely preserved in the system , many endogenous factors are produced and released by the mostly intact seminiferous epithelium , and associated somatic cells regulate the germ cells in the system similarly to the in vivo condition . in dissected tissue
, the supply of oxygen and nutrients is disturbed , and therefore the spermatogenic process is often disrupted and continues , at best , at low efficiency ( 22 ) .
the supply of oxygen and nutrients to isolated cells is achieved by modern cell culture media under appropriate culture conditions . however , the seminiferous tubule microenvironment , with its different , functionally distinct compartments ( e.g. , interstitial , basal , intraepithelial , and adluminal ) , is destroyed .
if these changes in the microenvironment during germ cell differentiation are significant , then spermatogenesis will be disrupted .
although many additional strategies of cell and tissue culture have been tested over the last 30 years , success has been limited ( 23 - 29 ) .
recent studies have used monolayers other than those generated from sertoli cells as sources of differentiating factors ( 30 - 33 ) . because the production of sperm in higher vertebrates involves an overwhelmingly intricate process of germ cell differentiation ,
further research efforts have been directed toward identifying signaling pathways associated with differentiation in the seminiferous epithelium during spermatogenesis . to incorporate this knowledge into the development of in vitro spermatogenesis systems , studies that have addressed the presence of substances such as retinol ( 34,35 ) , kit ligand ( stem cell factor ) ( 36,37 ) , insulin - like growth factor and transforming growth factor alpha ( tgf - alpha ) ( 38 ) , as well as hormones such as testosterone ( 39 ) and fsh ( 40 ) , among others ,
these studies will become particularly valuable if the paradigm of spermatogenesis in vitro , as a model of the in vivo situation , is accepted .
therefore , other factors , such as scrotal temperature , the timing of cellular events and the presence of important culture media components , e.g. , fetal calf serum , oxygen levels , pressure , substrates and the use of feeder layers , should be carefully evaluated and whenever possible translated from the in vivo situation to the artificial system .
the use of sertoli cells is controversial but , in principle , these cells are important for the maintenance of germ cells in culture and to provide differentiating factors ( 41 - 44 ) . among the advantages of cell culture systems
is that such systems ( cell cultures started from dissociated germ cell suspensions ) are much simpler than tissue cultures , in which cell function is tightly regulated and more complex , as in the in vivo situation .
cell cultures can be started with purified , selected , isolated cells , thereby allowing uncomplicated manipulation schemes because signal redundancy , which is observed in intact biological systems , is minimized .
furthermore , as the first step of the procedure , germ cells can be stimulated to proliferate in vitro , which creates the conditions suitable to obtain large numbers of spermatogonial stem cells before inducing them to differentiate during the process of gamete production .
the soft agar culture system ( sacs ) , which was originally described for the culture of hematopoietic cells in vitro , has created the conditions necessary to enable the full development of murine male germ cells in vitro ( 45 - 47 ) .
this system provides options for manipulation , e.g. , the testing of the effects of hormones , drugs , toxins or other compounds on germ cell development
. we were able to demonstrate the progression of spermatogonia into meiosis and the cells ' further maturation into morphologically normal spermatozoa .
the success of such strategies may depend on the reconstruction of small functional units of testicular cells inside the matrix , which occasionally fully resembles the microenvironment in the seminiferous tubules and thus results in small islands of complete spermatogenesis .
to recapitulate the situation in the testis , researchers must sequentially and gradually provide the right substances / conditions at the proper time , thereby emulating the in vivo processes that occur in an orderly fashion in different functional compartments ( e.g. , basal , meiotic , and adluminal ) of the seminiferous epithelium during normal in vivo spermatogenesis .
apparently , the most challenging step of differentiation to achieve in an in vitro spermatogenic system is proceeding beyond meiosis ( 41 ) .
hence , progress must be experimentally monitored by meiotic / postmeiotic - specific markers , by immunohistochemistry and/or by pcr .
the need to distinguish somatic cells renders the use of markers for this cell group useful ( table 2 ) .
these findings have greatly inspired further research involving humans in the hope of reversing cases of incomplete spermatogenesis .
this type of approach would require biopsy procedures , which usually yield small testicular samples with limited numbers of germ cells .
if the availability of testicular tissue is not an obstacle , then fertility patients with immature germ cell arrest could expect to overcome infertility by using this procedure .
moreover , cell culture systems for in vitro spermatogenesis would provide advantages not only to germ cell arrest patients but also to type ii sco syndrome cases or cases with other reproductive pathologies involving faulty spermatogonial stem cell niches .
current technology allows , at least on the theoretical level , sco syndrome patients , who have no germ cells , to achieve the goal of producing offspring that retain their own genetic material . to this end ,
pluripotent stem cells could be a reliable and plentiful source of immature germ cells to provide a baseline for a differentiation process that eventually will yield spermatozoa in vitro .
pluripotency is the property of a cell to differentiate into somatic cells of ectodermal , endodermal and mesodermal lineages , which constitute the vast majority of the cells in the body ( 94 ) .
pluripotent stem cells can be basically obtained from two sources : a ) the epiblast region in blastodermic embryos , and b ) adult somatic cells .
the latter source provides an opportunity for success in the great challenge of obtaining pluripotent stem cells from adult patients , despite the conventional wisdom in cell biology that cells in tissues tend to progress into lineage restrictions during development , gradually reaching terminal differentiation .
the idea of somatic pluripotentiation , or reprogramming , has been discussed for quite some time and found original success in mouse models ( 95 ) .
only recently , independent research groups ( 98,99 ) went a step further to achieve the major breakthrough of defining four basic pluripotency - inducing factors , i.e. , oct4 ( pouf1 ) , sox2 , c - myc , and klf4 , which are required to switch somatic cells into a pluripotent state , thus opening a window for deeper understanding of pluripotency networks , as well as the possibility of generating germ cells , among other cell types , from somatic cells induced to be pluripotent ( ips cells ) .
the availability of such personalized germ cells of somatic origin would be a prerequisite for an in vitro sperm - generating system for sco patients .
the development of in vitro spermatogenesis has benefited from various animal models , including models that use farm animals .
some culture systems were developed in domestic animal models in which germ cells progressed to advanced steps of spermatogenesis .
for instance , izadyar et al . observed elongated spermatids in a long - term culture of bovine germ cells ( 70 ) , whereas dong et al .
obtained elongated spermatids from fetal calf gonocyte cultures ( 100 ) . in these species ,
the available procedures proved to be rather inefficient because not many terminally differentiated gametes could be derived . in parallel ,
murine models involving es ( embryonic stem ) cells resulted in advances in the field . in principle ,
germ cell derivation from es cells does not seem to be practical for infertility patients , as almost no man has access to his own embryonic cells .
however , because ips cells appear to be similar to es cells ( 101 ) , and in nature , technically derivable from somatic cells , the resulting scenario becomes very promising to drive them into the production of gametes in vitro .
efforts to generate germ cells and gametes from es cells and ips cells in murine models and humans are summarized on figure 3 .
briefly , three research groups have made advances in the derivation of germ cells from mouse es cells .
one of these groups produced gamete - like cells , and using icsi as a functional assay , they managed to obtain embryos after fertilization had reached the blastocyst stage ( 102 ) .
two laboratories were able to generate sperm in vitro ( 31,103 ) , but only one of them obtained offspring by injecting the derived sperm into donor oocytes using icsi ( 31 ) .
however , in this case , the offspring production had low efficiency ( 7 out of 65 embryos ) , and the mice that were born died prematurely ( five months after birth ) , which suggests developmental aberrations .
progress in germ cell derivation from mouse ips cells was initially more limited because none of the groups involved could obtain offspring , although pgcs were obtained in one case ( 104 ) and gamete - like cells were also recently obtained ( 105 ) .
pgcs were derived from human es cells by several groups ( 30,106,107 ) . recently , aflatoonian et al .
not only generated pgcs but also derived human sperm - like cells ( haploid - like cells ) for the first time ( 108 ) . in another recent study ,
nevertheless , up to now , no human embryos have been generated using these techniques , and the scientific community continues to work together with clinicians to develop rigorous , ethical and secure tests and protocols for these innovative techniques .
the principles underlying these methods are simple enough to allow further progress from experimental to applied status .
in summary , pluripotent es cells are first given a differentiation environment in vitro to produce multiple cell lineages , and then , in a second phase , cells are selected for specific antigen expression or reporter germ cell genes . also important is the addition of differentiating factors .
the current stage of methods for the derivation of human haploid - like cells in vitro allows the generation of gametes with the correct epigenetic status ( 32,109,110 ) .
taken together , all of the findings presented are genuine biotechnological advances with potential applications in cases of men who present with aspermatogenesis , but regardless of the tremendous potential of these techniques for the derivation of germ cells to produce gametes in vitro using culture techniques , much research remains to be conducted in this area .
in cases in which the testes of infertile men contain spermatogonia , the stem cell fraction among these premeiotic germ cells could be targeted for fertility preservation .
the presence of male germline stem cells indicates high regenerative potential , as these cells can efficiently recolonize the seminiferous tubules , even when the starting population of spermatogonial stem cells is small .
when the technique was first applied by brinster and zimmermann in 1994 ( 111 ) , a crude , single - cell suspension containing spermatogonia was infused into the testis .
the stem cells migrated into testicular stem cell niches spontaneously , whereas somatic and more differentiated germ cells were flushed out .
recolonization was initiated from individual spermatogonia , which slowly but steadily divided and migrated to repopulate all of the seminiferous tubules ( 111,112 ) .
the technique of germ cell transplantation could , in principle , be applied across species .
microinjection of germ cell suspensions from rats into the seminiferous tubules of mice led to the initiation of spermatogenesis from donor spermatogonial stem cells .
spermatogonia from less closely related species have the ability to repopulate the testis but will not differentiate , which currently renders the production of primate sperm in mouse testes impossible .
subsequent studies in rodents showed that spermatogonia can be cryopreserved and expanded by in vitro culture prior to germ cell transfer .
the clinical potential of this technique was shown in non - human primates and in experimental studies using human testes .
ultrasound - guided infusion of germ cell suspensions via the intratesticular rete testis appears to offer a simple and relatively non - invasive procedure for the autologous infusion of germ cells back into the patient ( 113 ) .
our preclinical studies have demonstrated the feasibility of transplanting germ cell suspensions into the testes of non - human primates and men ( 113,114 ) .
a first clinical trial was initiated at the christie hospital in manchester , uk , in 1999 .
the fertility outcomes of the patients in this study have not been yet published ( 115,116 ) . in conclusion ,
important issues in achieving re - fertilization through germ cell transplantation include the retrieval of sufficient testicular tissue or in vitro expansion strategies for spermatogonia , prevention of ischemia in the dissected tissues and cells , cryopreservation and thawing of cell suspensions and sorting of tumor cells or enrichment of spermatogonial stem cells .
the only issue solved is the ultrasound - guided non - invasive transfer of germ cell suspensions into the rete testis .
these critical steps must be optimized by future research before this technique can offer a promising and safe option for the protection of male fertility in men with spermatogonial arrest .
testicular grafting is an extreme form of organ culture in which the tissue is transplanted into a host .
the environment is well controlled , and also the blood supply to the grafted tissue is restored .
immature testicular tissue has a high regenerative capacity and can survive and develop as an auto- or xenograft . in the absence of alternative strategies to generate sperm in vitro
, grafting provides an approach to ex - vivo generation of mature sperm . in mice , sperm generated in grafts were capable of generating healthy offspring .
we and others have recently shown that xenografting of neonatal and prepubertal testicular tissue from a variety of species permitted the generation of sperm , whereas xenografting of more developed tissue resulted in the degeneration of testicular tissue .
we have also shown that immature primate testes can be maintained on ice for 24 hours prior to xenografting and can also be cryopreserved .
however , fertility problems are usually diagnosed in adulthood , when grafting appears to be a less useful tool for generating sperm .
we therefore consider the application of grafting techniques to be more valuable for fertility preservation in children undergoing oncological treatment .
an alternative to achieve germ cell development is the use of xenologous systems , which recapitulate the organogenesis of a functional testis [ for review : gassei and schlatt , 2007 , ( 117 ) ] .
the male pathway involves regulated cell differentiation of somatic cells within the gonadal primordium , including the migration of mesonephric cells and primordial germ cells .
tissue engineering approaches that mimic male embryonic gonadogenesis could offer novel ways to study early testicular differentiation ( 29 ) and may , when eventually combined with xenografting approaches , also provide scenarios for the differentiation of male germ cells .
in previous sections , several prospective technologies were proposed to overcome the lack of gametes in men with aspermatogenesis .
these technologies are based on differentiating preexisting or pluripotential stem cell - derived germ cells in vitro ( spermatogenesis in vitro ) or on in vivo systems ( transplantation and xenografting ) to produce sperm .
haploidization is an alternative approach to manufacture gametes based on biological cloning technology . in cloning
, an entire genome is obtained from a single individual when he donates a somatic cell nucleus , which is transferred into an enucleated , developmentally young cell ( mii oocyte , zygote , embryo ) ( 118 ) .
in contrast , haploidization is a modified cloning technique in which there is a genetic haploid contribution from both parents , which is one reason why this technique has also been called semi - cloning ( 119,120 ) .
although promising , this technology has not been successful for generating live normal offspring in murine experimental models , and therefore it remains largely experimental , with no immediate prospects for clinical application .
for instance , in preliminary experiments , only 17 to 22% of mouse oocytes fertilized with somatic cells formed blastocysts , and no offspring were derived from them ( 121 ) .
this review article provides an overview of several biotechnological approaches that have the potential to offer solutions for a range of reproductive pathologies that cause sterility in a significant number of azoospermic men , while at the same time providing new tools to contribute to our current knowledge of male reproductive physiology .
although they are thus far experimental , the proposed emerging technologies could work in combination with other already well - established reproductive technologies and take advantage of the requirement for just one healthy spermatozoon to ensure successful fertilization and , hopefully , normal offspring from these individuals .
thus far , only haploid - like cells , with an apparently correct epigenetic status , have been generated by several research groups . in the near future
, we can expect the generation of sperm as the most natural , terminally differentiated cells to be used in assisted reproduction for men afflicted with aspermatogenesis .
regardless of the pervading optimism , remaining challenges include the verification of aspects such as normal cytogenetics , epigenetic stability , the tumorogenic potential of derived germ cells and even ethical aspects , which should guarantee the correct implementation of these new reproductive technologies .
additionally , the genetic basis for many conditions of aspermatogenesis will necessitate caution , as well as a consideration of the need to develop gene therapies that are specific for these reproductive problems to prevent their transmission to future generations .
at least 25% of azoospermic men are sterile because their testes either hold only immature or no germ cells at all , a condition that can be collectively termed as aspermatogenesis .
azoospermic men with germ cell arrests at early stages of spermatogenesis would benefit from sperm derivation in vitro or ex vivo .
azoospermic men with type ii sco would have the alternatives of germ cell derivation from a ) somatic cells via induced pluripotency or b ) haploidization .
the most challenging differentiation step in an in vitro spermatogenic system is completion of meiosis which has been achieved in several animal models by ex vivo approaches or 3d culture systems . in
the absence of alternative strategies , testicular grafting ( auto- or xenograft ) should be considered to ex - vivo generate mature sperm and would be more valuable for fertility preservation in children undergoing oncological treatment .
haploidization is a modified cloning technique , in which each parent genetically contributes with a haploid complement , but unfortunately this technique offers no immediate perspective for clinical application .
although extensive research has been and continues to be performed , biotechnologies described on this review article still remain largely experimental .
| aspermatogenesis is a severe impairment of spermatogenesis in which germ cells are completely lacking or present in an immature form , which results in sterility in approximately 25% of patients . because assisted reproduction techniques require mature germ cells , biotechnology is a valuable tool for rescuing fertility while maintaining biological fatherhood .
however , this process involves , for instance , the differentiation of preexisting immature germ cells or the production / derivation of sperm from somatic cells .
this review critically addresses four potential techniques : sperm derivation in vitro , germ stem cell transplantation , xenologous systems , and haploidization .
sperm derivation in vitro is already feasible in fish and mammals through organ culture or 3d systems , and it is very useful in conditions of germ cell arrest or in type ii sertoli - cell - only syndrome .
patients afflicted by type i sertoli - cell - only syndrome could also benefit from gamete derivation from induced pluripotent stem cells of somatic origin , and human haploid - like cells have already been obtained by using this novel methodology . in the absence of alternative strategies to generate sperm in vitro , in germ cells transplantation fertility is restored by placing donor cells in the recipient germ - cell - free seminiferous epithelium , which has proven effective in conditions of spermatogonial arrest .
grafting also provides an approach for ex - vivo generation of mature sperm , particularly using prepubertal testis tissue .
although less feasible , haploidization is an option for creating gametes based on biological cloning technology . in conclusion ,
the aforementioned promising techniques remain largely experimental and still require extensive research , which should address , among other concerns , ethical and biosafety issues , such as gamete epigenetic status , ploidy , and chromatin integrity . |
guillain - barr syndrome ( gbs ) is an acute autoimmune - mediated inflammatory demyelinating disease that affects the peripheral nerves involving myelin sheath and axons .
it is clinically characterized by rapidly progressing symmetrical weakness and hyporeflexia / areflexia followed mostly by recovery [ 1 , 2 ] .
the severity of weakness ranges from mild limb asthenia to absolute paralysis , occasionally with respiratory failure that may lead to death [ 1 , 2 ] .
meanwhile , the cerebrospinal fluid ( csf ) of gbs patients usually shows characteristic albumin - cytological dissociation , that is , elevated protein levels and approximately normal cell counts , from two weeks after the disease onset .
there is strong evidence proving that both humoral and cellular immune mechanisms are involved in the pathogenesis of gbs : ( i ) serum antibodies to various gangliosides in human peripheral nerves have been found in about half of gbs patients ; ( ii ) pathological findings in gbs include lymphocytic infiltration in spinal roots and peripheral nerves , followed by macrophage - mediated , multifocal stripping of myelin ; ( iii ) plasma exchange ( pe ) and intravenous immunoglobulin ( ivig ) therapies are effective in the treatment of gbs patients [ 5 , 6 ] .
interleukin ( il)-17 is mainly produced by t helper ( th ) 17 cells , a recently identified lineage of cd4 + th cells .
both il-17 and th17 cells play a critical role in host defense responses and inflammatory diseases .
besides il-17 , il-22 is another th17 effector cytokine that was originally termed as il-10-related t - cell - derived inducible factor . in experimental models of infectious diseases
, il-22 plays a crucial role in mucosal host defense in the lung and intestine by increasing epithelial cell proliferation and inducing anti - microbial peptides [ 9 , 10 ] .
il-22 has been shown to mediate either detrimental or beneficial inflammatory responses in different conditions .
studies showed that both il-17 and il-22 are functional cytokines in multiple autoimmune and inflammatory diseases .
found that multiple sclerosis ( ms ) patients have increased numbers of il-17a mrna - positive mononuclear cells in both the peripheral blood and the csf .
serum and synovial fluid levels of il-17 were in correlation with disease activity in patients with rheumatoid arthritis ( ra ) .
il-17 expression was also elevated in the serum of patients with inflammatory bowel disease ( ibd ) .
there was an increased level of il-22 in serum of psoriasis and crohn 's disease .
moreover , the expression of il-22 was also clearly associated with the severity of these diseases [ 15 , 16 ] .
beyeen et al . confirmed that il-22r 2 ( il-22a2 ) is an ms - risk gene through genetic and immunological investigation in the ms model experimental autoimmune encephalomyelitis ( eae ) and large - scale association studies of ms patients .
although il-17 and il-22 have been extensively studied in multiple inflammatory and autoimmune diseases , their correlation with gbs has not been reported yet .
we hypothesized that il-17 and il-22 are related to gbs by means of participating in the focal and systemic immune response in gbs patients .
so our study was performed to evaluate the csf and plasma levels of these two cytokines at the acute phase of gbs , and to find out the correlations between these two cytokines and functional disability scales as well as various csf parameters .
all subjects are from the department of neurology , the first hospital , jilin university , changchun , or from the department of neurology , the affiliated hospital of medical college , qingdao university , qingdao , china during september 2010 to march 2012 .
after informed consents were obtained , paired samples of plasma and csf were collected from 22 gbs patients ( 8 females and 14 males , age 1965 years ) fulfilling international diagnostic criteria for gbs or its variants and 18 healthy controls ( hc ) . at the time of sampling , none of the patients had received any immunomodulatory drugs within the past three months .
eighteen age- and sex - matched healthy donors ( 7 females and 11 males , age 2157 years ) were included as the control group .
the protocols were approved by the human ethics committee of jilin province and the human ethics committee of qingdao university , china .
csf and plasma samples were obtained during standard diagnostic lumbar puncture and peripheral vein puncture , respectively , during the first 2 weeks after the onset of gbs and stored at 80c until use .
the severity of gbs was scored by the use of gbs disability scale scores ( gdss ) , a widely accepted scoring system to evaluate the functional status of gbs patients , that is , grade 0 = normal neurological status ; grade 1 = minor symptoms , able to run ; grade 2 = limb weakness , able to walk 5 m unaided ; grade 3 = able to walk 5 m only with aid ; grade 4 = chair or bed bound ; grade 5 = requiring assisted ventilation ; grade 6 = death .
the csf and plasma il-17 and il-22 levels were detected by double antibody sandwich elisa method .
mouse anti - human il-17 and il-22 monoclonal antibodies ( mab ) as capture antibodies , biotinylated antibody reactive with human il-17 and il-22 as detecting antibodies , and recombinant human il-17 and il-22 proteins as standard controls , were used in this study ( all from r&d systems , minneapolis , usa ) .
briefly , flat bottom , high - binding capacity 96-well elisa plates ( greiner bio - one , frickenhausen , germany ) were coated with 100 l il-17 ( 4 g / ml ) mab and il-22 ( 4 g / ml ) mab in carbonate bicarbonate buffer ( ph 9.6 ) and kept at 4c overnight .
after several washes using phosphate - buffered saline ( pbs ) with 0.5% tween-20 ( pbst ) , the wells were blocked with 360 l 1% bovine serum albumin ( bsa ) ( sigma , st .
louis , mo , usa ) per well for 2 hours ( h ) at room temperature ( rt ) .
after extensive washing with pbst , 100 l plasma and csf samples diluted at 1 : 2 in pbs with 0.1% bsa , and recombinant standard proteins were added to each well for 2 h incubation at rt .
thereafter , the plates were washed with pbst , and 100 l biotinylated antibodies il-17 ( 0.20 g / ml ) and il-22 ( 0.27 g / ml ) , respectively , were added to each wells . after 2 h incubation at rt and three washes with pbst , 100 l freshly prepared streptavidin - hrp ( r&d systems ) diluted at 1 : 200 in pbs with 0.1% bsa was added to each well for 1 h at rt . after three washes with pbst , 100 l enzyme substrate that is mixed with equal volumes of stabilized hydrogen peroxide and stabilized tetramethylbenzidine ( both from r&d systems ) was added to perform color reaction . finally , after 20 min incubation in the dark , 100 l of sulfuric acid was added to stop the reaction .
optical density ( od ) was determined at 450 nm by enzyme - labeled meter ( bio - rad 680 , hercules , ca , usa ) . in order to quantify il-17 and il-22 in plasma and csf , standard il-17 and il-22 curves
were obtained simultaneously by incubating recombinant il-17 at different known concentrations ( 0 , 1.56 , 3.13 , 6.25 , 12.50 , 25 , 50 , and 100 pg / ml ) and il-22 ( 0 , 31.25 , 62.50 , 125 , 250 , 500 , 1000 , and 2000 pg / ml ) .
od values measured from the standard concentrations of il-17 and il-22 were used to plot standard curves using computer software .
data were expressed as the mean standard deviation ( sd ) . for statistical analysis
, differences of mean values were tested with the student 's t - test for two groups , using spss 17.0 ( spss , ibm , west grove , usa ) .
the pearson or spearman correlation coefficient was used to analyze correlations depending on data distribution . reported p - values are two - tailed and considered statistically significant at p < 0.05 .
the demographic features of the studied subjects , their csf data , and the individual csf and plasma concentrations of il-17 and il-22 in gbs patients and hc of this study were displayed in table 1 .
the levels of il-17 and il-22 in both csf and plasma were elevated in all gbs patients .
the elevation was most obvious for il-22 in csf ( p < 0.001 ) , followed by il-17 in csf ( p = 0.023 ) , il-17 in plasma ( p = 0.011 ) , and il-22 in plasma ( p = 0.019 ) , when compared with hc .
meanwhile , the mean levels of il-17 in csf were higher than in plasma of both gbs patients and hc , whereas the mean levels of il-22 in csf were lower than in plasma in both groups ( figure 1 ; table 1 ) .
the spearman correlation coefficient was used to analyze the correlation between cytokine levels and gdss . il-17 and il-22 levels in csf had positive correlation with gdss ( r = 0.441 , p = 0.040 ; r = 0.527 , p = 0.012 , resp . ) .
however , there was no statistical correlation between il-17 and il-22 in plasma and gdss ( r = 0.171 , p = 0.448 ; r = 0.189 , p = 0.399 , resp . ) .
although there was no statistical significance , the elevated level of il-22 in plasma had a tendency toward positive correlation with gbs severity ( figure 2 ) .
the levels of il-17 and il-22 in csf were positively correlated ( r = 0.473 , p = 0.026 ) .
so were the levels of il-22 in csf and plasma ( r = 0.444 , p = 0.039 ) .
however , no correlation was found between plasma il-17 and csf il-17 levels ( r = 0.184 , p = 0.412 ) , or between plasma il-17 and plasma il-22 levels ( r = 0.152 , p = 0.500 ) ( figure 3 ) .
however , neither the level of il-17 nor that of il-22 ( in csf and in plasma ) had any correlation with the csf data ( including the white blood cell counts , the total protein concentration , and the albumin concentration ) and qalb in gbs patients ( data not shown ) . the total protein and albumin levels in csf of gbs patients were increased compared with those of hc ( p = 0.016 and p = 0.005 , resp . ) .
qalb was defined as the ratio of csf to plasma albumin concentrations , which was elevated in gbs compared with hc ( p = 0.013 ) .
no statistical significance regarding the albumin level in plasma and white blood cells in csf was found between gbs patients and hc ( table 1 ) .
the il-17 family includes structural related cytokines , of which il-17a , il-17b , il-17c , il-17d , il-17e , and il-17f are identified .
these family members can induce the expression of proinflammatory cytokines such as tumor necrosis factor ( tnf)- and il-1 to promote neutrophil migration , so they play inflammatory roles in the development of diseases .
il-22 can be secreted by th22 cells as well as th17 cells , t cells , and nk cells .
in contrast to the anti - inflammatory properties of il-10 , however , il-22 shows proinflammatory properties .
gbs is classically regarded as t helper ( th)1 cells - mediated autoimmune inflammatory disease . whereas , some changes in experimental autoimmune neuritis ( ean ) , an animal model of human gbs could not be explained by this opinion perfectly .
zhang et al . found that ifn- knockout mice were also susceptible to ean , this indicated other factors and mechanisms are involved .
moreover , il-17a positive cells in cauda equina ( ce ) infiltrating cells , and the levels of il-17a in sera were increased in ifn- knockout mice .
il-17 was found in sciatic nerves of ean , and the accumulation of il-17 was correlated with the severity of neurological signs , which suggested a pathological contribution of il-17 to the development of ean .
the frequency of th17 cells in csf and the level of il-17 in plasma were significantly higher in active chronic inflammatory demyelinating polyradiculoneuropathy ( cidp ) .
our data showed that levels of il-17 and il-22 in csf and plasma of gbs patients were obviously elevated compared with hc .
this is the first human study reporting an elevation of il-17 and il-22 levels in gbs , although the functional roles of il-17 and il-22 in gbs require further investigation . in previous studies ,
il-6 in the presence of transforming growth factor ( tgf)-1 , and il-6 , il-23 in combination with il-1 had been proved to be the effective factors responsible for the differentiation of th17 cells and the production of il-17 ; these cytokine milieux may also facilitate the expression of il-22 [ 26 , 27 ] .
il-6 , il-1 , il-23 , and tnf- are all proinflammatory cytokines and have an important role in the pathogenesis of gbs .
therefore , it is safe to conclude in our study that the extensive network of il-17 and il-22 in coordination with these inflammatory cytokines is associated with the pathogenesis of gbs .
the elevated levels of il-17 and il-22 in plasma reflect the activation of th17 and th22 cells in the systemic auto - immune responses of gbs patients . therefore , il-17 and il-22 might be important effectors in addition to th1 cells and th1 cytokines in autoimmune - mediated responses in gbs .
the male - to - female ratio in our study was 1.75 : 1 , which was in line with some previous reports , and this confirmed that gbs might be a kind of male - vulnerable autoimmune disease .
we presume that estrogen and testosterone may influence the production of inflammatory cytokines , such as il-17 and il-22 .
in addition , in line with previous studies , qalb , the total protein and albumin level of csf were remarkably higher in gbs patients .
csf is considered to reflect events within the blood - nerve barrier ( bnb ) , and it is more approximate to target organs of gbs than the peripheral blood .
kieseier reported that immune - mediated disorders of the peripheral nervous system ( pns ) are pathologically characterized by the breakdown of the bnb , accumulation of activated t cells and macrophages in the pns , and demyelination of peripheral nerves .
human th17 cells could disrupt the tight junctions of blood - brain barrier ( bbb ) by direct effects of il-17a and il-22 on endothelial cells .
gbs is a reported autoimmune demyelination disease affecting both the central nervous system ( cns ) and pns , meanwhile , our data of the elevated il-17 and il-22 levels in csf and plasma of gbs confirmed this respect .
we presume several potential mechanisms of the origin in csf and plasma of these cytokines : ( i ) il-17 and il-22 in peripheral blood could penetrate the bbb , so the levels of them in csf are also elevated ; ( ii ) the elevation of il-17 and il-22 in csf and plasma might be related to the local inflammation of spinal roots and peripheral nerves that causes demyelination and axon degeneration ; ( iii ) reactive th17 and th22 cells in peripheral blood may cross the bbb / bnb and secret relative cytokines .
we also found that the csf levels of il-17 and il-22 , respectively , were correlated with gdss at the acute phase of gbs , and there was a positive correlation between them .
nevertheless , the levels of il-22 in csf and plasma also had a positive correlation .
this indicates that the elevation of il-17 and il-22 in csf is related to the severity of inflammation in the spinal roots .
since their elevations in csf are synchronous , il-17 and il-22 may coordinate in the pathogenesis of the disease and may be a biomarker for indicating disease severity or prognosis , which , however , should be confirmed in future studies with a larger sample size .
there are limitations in our study . due to the low incidence of gbs in the whole population
although paired samples of csf and plasma were collected , the time - points of lumbar puncture with regard to disease onset varied among gbs patients .
these limitations may influence the statistical power of the data analysis . in summary , this study showed increased csf and plasma levels of il-17 and il-22 in gbs patients compared with hc .
we also demonstrated that the levels of il-17 and il-22 in csf are correlated with gbs severity .
nevertheless , the level of il-17 was correlated with that of il-22 in csf . meanwhile , the levels of il-22 in csf and plasma also had a positive correlation .
further studies are warranted to confirm the immunological mechanisms of the elevated il-17 and il-22 levels in gbs . | guillain - barr syndrome ( gbs ) is an acute autoimmune - mediated inflammatory demyelinating disease that causes rapidly progressing paralysis and occasionally respiratory failure .
we hypothesized that interleukin ( il)-17 and il-22 are elevated in gbs and participate in the autoimmune inflammatory response of gbs .
we used sandwich enzyme - linked immunosorbent assay ( elisa ) to measure the il-17 and il-22 levels in the csf , and plasma from 22 gbs patients at the acute phase and 18 healthy controls ( hc ) .
the results show that csf and plasma levels of il-17 and il-22 are elevated in gbs patients compared with hc . il-17 and il-22 levels in csf , respectively ,
are correlated with gbs disability scale scores ( gdss ) .
meanwhile , il-17 and il-22 levels in csf , il-22 in csf , and plasma of gbs patients have positive correlation , respectively .
the increased levels of il-17 and il-22 in csf may be explained by the disruption of blood - brain barrier ( bbb ) and peripheral nervous system ( pns ) local inflammation in gbs .
meanwhile , the elevated levels of these two cytokines in plasma suggest the activation of th17 and th22 cells in the systemic immune response of gbs .
our data provide preliminary evidence that gbs is associated with high levels of il-17 and il-22 in csf and plasma .
these cytokines display pathogenic potential and may serve as useful biomarkers for gbs . |
arsenic is a significant
public health concern due to its toxicity
and carcinogenesis .
chronic arsenic exposure is related to many adverse
health effects , such as increased risk
of cancers of the skin , lung , and urinary tract .
more than 140 million people worldwide are believed
to be exposed to arsenic levels above the world health organization
maximum contaminant level of 10 ppb .
environmental routes of exposure
to arsenic include ingestion and inhalation of inorganic arsenic .
arsenite is an inorganic trivalent arsenic compound widely present
in water , soil , and food .
in contrast ,
arsenic trioxide ( ato , as2o3 ) , another trivalent
arsenic compound , is the most common inorganic arsenical in airborne
dust .
organic arsenicals
mainly consist of mono- and dimethylated arsenic metabolites , derived
from biomethylation of inorganic arsenicals in cellular environment .
a trivalent monomethylated arsenic metabolite , monomethylarsonous
acid ( mma(iii ) ) , has been shown to display greater toxicity and/or
carcinogenic potential than inorganic arsenite .
interaction
with zinc finger proteins is considered to be an important
mechanism of arsenic toxicity and carcinogenesis .
substitution of
zinc with another metal , such as arsenic , is believed to disrupt the
coordination sphere in the finger environment and consequently the
zinc finger function .
furthermore , both inorganic and
organic trivalent arsenic compounds interact with zinc finger proteins .
zinc finger proteins , poly ( adp - ribose ) polymerase 1 ( parp-1 ) , and
xeroderma pigmentosum group a ( xpa ) are both involved in dna repair
and have been validated as direct molecular targets for arsenite and
mma(iii ) .
we have investigated extensively the interaction of arsenite with
zinc finger proteins in recent years .
our findings demonstrate that
arsenite can replace zinc in the zinc finger moiety , leading to changes
of structure and loss of protein function .
in addition , we found that arsenite selectively interacts with zinc
finger motifs with c3h1 or c4 configurations by coordinating with
three cysteine residues .
this suggests that
subsets of zinc finger proteins are more sensitive molecular targets
of arsenite than others . since a methyl group already occupies one
of the three covalent bonds in mma(iii ) , it is likely that mma(iii )
will not be able to bind with three cysteine residues as arsenite
does .
therefore , we hypothesize that binding selectivity of mma(iii )
will be different from that of arsenite . in this study , we tested
the differential binding selectivity hypothesis
by investigating interactions of arsenite , ato , and mma(iii ) with
three different configurations of zinc finger peptides and proteins :
c2h2 ( aprataxin , aptx ) , c3h1 ( parp-1 ) , and c4 ( xpa ) .
a variety of
analytical approaches were utilized to determine whether the three
arsenicals display differential binding selectivity toward these zinc
finger configurations , and potential consequences of these interactions
in terms of structural or functional changes .
our results demonstrate
that the binding selectivity indeed differs among the methylated versus
nonmethylated arsenicals , which provides insightful understanding
for the molecular mechanisms underlying the differential effects of
inorganic versus organic arsenicals in arsenic toxicity and carcinogenesis .
peptides derived from the finger motifs of
aptx , xpa , and the first zinc finger motif of parp-1 ( sequences in
table 1 ) were commercially synthesized by genemed
synthesis inc .
diiodomethylarsine ( mmaiii iodide , ch3asi2 , > 98% pure ) was prepared by the synthetic chemistry facility
core ( southwest environmental health sciences center , tucson , az )
and kindly provided by dr .
cobalt chloride , zinc chloride , and
sodium arsenite were obtained from fluka chemie .
lyophilized zinc finger peptides were
suspended at 1 mm in 20 mm tris ( ph 7.8 ) containing 0.1 mm tris(2-carboxyethyl)phosphine
( tcep ) to protect the cysteine residues from oxidation prior to incubations .
solutions of arsenic compounds were prepared freshly in 20 mm tris
( ph 7.8 ) before incubation with zinc finger peptides .
zinc finger
peptides diluted to 100 m were incubated with 50 , 100 , or 200
m arsenic compounds at room temperature for 30 min , then cobalt
chloride was added to a final concentration of 200 m .
the absorption
spectra from 260 to 800 nm were collected at 25 c on a spectramax
m2 spectrophotometer ( molecular devices , llc , sunnyvale , ca ) .
absorbance
at 660 nm indicates the formation of a cobalt and zinc finger peptide
complex , and therefore ,
the cobalt spectrum a660 value represents the amount of
sites on zinc fingers that are still available for metal ions to bind
after treatments of arsenic compounds .
aliquots of 100 m zinc finger
peptides in 20 mm tris ( ph 7.8 ) were incubated with various concentrations
( 0200 m ) of arsenic compounds for 30 min at 25 c ,
then the uv vis absorption spectra of the mixtures from 260
to 500 nm were collected at 25 c on a spectramax m2 spectrophotometer
( molecular devices , llc , sunnyvale , ca ) .
s bond formation due to arsenic interaction
with cysteine residues on zinc finger peptides .
lyophilized peptides were
suspended at a concentration of 1 mm in 20 mm tris ( ph 7.8 ) containing
0.1 mm tcep to protect the cysteine residues from oxidation .
stock
solutions of arsenic compounds were freshly prepared at a concentration
of 1 m in 20 mm tris ( ph 7.8 ) .
aliquots of 100 m zinc finger
peptides were incubated with 100 m arsenic compounds for 30
min at 25 c .
the samples were then diluted 50 times in 5 mg / ml
-cyano-4- hydroxycinnamic acid ( sigma - aldrich ) in a 1:1 ( v / v )
water / acetonitrile solution , and 1 l of each sample was deposited
in duplicate on the maldi plate , allowed to dry at 37 c , and
maldi - tof - ms analyses performed on an applied biosystems 4700 proteomics
analyzer ( tof / tof ) operating in ms reflector - positive ion mode .
desorption was performed using
a neodymium / yttrium aluminum - garnet laser ( 355 nm , 3 ns pulse
width , and 200 hz repetition rate ) .
mass spectra were acquired with
laser pulses over a mass range of m / z from 1000 to 5000 da using focus mass of 3500 .
final mass spectra
were the summation of 10 subspectra , each acquired with 200 laser
pulses .
aliquots of 100 m zinc finger peptides were
incubated with different concentrations of arsenic compounds or 100
m zinc chloride for 30 min at 25 c .
after that , the emission
fluorescent spectra from 300 to 400 nm were collected at 25 c
on a spectramax m2 fluorescent spectrophotometer ( molecular devices ,
llc , sunnyvale , ca ) . the excitation wavelength was 280 nm .
the intensity
of fluorescence is related to the chemical environments of phenylalanine ,
tyrosine , and tryptophan .
the intrinsic fluorescence intensity of
zinc finger peptides undergoes a dramatic change on folding / unfolding .
this allows for the tertiary structure change of zinc finger peptides
to be monitored by fluorescence spectroscopy .
fluorescent intensity
at 350 nm was used to represent the status of the tertiary structure
of zinc finger peptides with different treatments .
the human keratinocyte cell line ( hacat ) was a kind gift from dr .
after exposure to 2 m arsenic compounds for
24 h , cells were harvested in ripa cell lysis buffer ( 25 mm tris - hcl
at ph 7.6 , 150 mm nacl , 1% np-40 , 1% sodium deoxycholate , and 0.1%
sds ) , sonicated , and centrifuged at 14,000 rpm for 15 min at 4 c
to remove cellular debris .
protein ( 500 g in 500 l )
was incubated with 5 l of rabbit polyclonal antibody ( aptx ,
abcam # 31841 ; parp-1 , cell signaling # 9542 or xpa , abcam ab85914 )
for at least 2 h at 4 c .
protein a beads ( invitrogen ) were added
in a 1:1 slurry , and samples were incubated for an additional 2 h
at 4 c .
the beads were recovered by centrifugation at 10,000
rpm for 5 min at 4 c and washed five times with 1 ml of lysis
buffer . to elute protein , the pellets were incubated with 100 l
of 100 mm citric acid ( ph 3.0 ) for 30 min , followed by centrifugation
at 14,000 rpm for 5 min at 4 c .
proteins obtained
from cells by immunoprecipitation were incubated with 10 mm h2o2 for at least 2 h at 4 c to release zinc
from proteins .
zinc content was measured by adding 10 l of
1 mm 4-(2-pyridylazo)resorcinol to 100 l of protein sample
followed by scanning the uv vis spectra at 350 to 550 nm on
a spectramax m2 spectrophotometer ( molecular devices , llc , sunnyvale ,
ca ) .
the absorbance of resorcinol shifts from 411 to 493 nm in the
presence of zinc , and the 493 nm peak is recorded and compared with
a standard curve for calculation of zinc content in protein samples .
zinc binding
within zinc finger motifs is critical for the maintenance of the tertiary
structure and activity of zinc finger proteins .
occupation of metal
binding sites by arsenic is an indicator of arsenic interaction with
zinc fingers . to determine whether an arsenic compound is capable
of occupying the metal binding sites and to investigate differences
in metal binding site occupation by mma(iii ) , arsenite or ato , we
used cobalt as a probe to detect available metal binding sites on
zinc finger motifs after incubation with arsenic compounds .
cobalt
binding with zinc finger motifs generates absorbance at 660 nm , which is used to quantitatively determine the remaining free metal
binding sites after arsenic occupation .
the zinc finger peptides derived
from the zinc finger domains of c2h2 ( aptx ) , c3h1 ( parp-1 ) , and c4
( xpa ) were incubated with arsenicals , and then the cobalt spectrum
was analyzed . in parp-1 and xpa peptides ,
arsenite incubation decreased
subsequent cobalt binding in a concentration - dependent manner but
not in aptx peptides ( figure 1a ) .
this indicates
that arsenite selectively occupies the metal binding site on c3h1
and c4 but not the c2h2 zinc fingers .
in contrast ,
incubation of peptide with mma(iii ) led to a concentration - dependent
decrease in cobalt binding to all three peptides indicating that mma(iii )
occupied the metal binding sites on all three configurations of zinc
fingers ( figure 1b ) .
these results demonstrate
that arsenite and ato selectively occupy metal binding sites on c3h1
and c4 zinc fingers , while mma(iii ) occupies metal binding sites on
each of the c2h2 , c3h1 , and c4 zinc finger peptides .
aptx , parp-1 , and xpa zinc finger peptides were preincubated with
arsenic compounds for 30 min . after that , 200 m cobalt was
added into the system .
( a ) cobalt binding signal decreased in
parp-1 and xpa zinc fingers after preincubating with increasing concentrations
of arsenite .
for the aptx zinc finger , the free metal binding site
was always available .
( b ) cobalt binding signal decreased in all three
configurations of zinc fingers in a mma(iii ) concentration - dependent
manner .
data were presented as the mean sd , * p < 0.05 vs corresponding [ as ] = 0 group , n =
3 .
when arsenicals
occupy metal binding sites on zinc fingers , they coordinate with cysteine
residues , forming an as s bond .
therefore , the as s
bond is a key structure of arsenic interacting with the thiol group
on cysteine residues of zinc fingers . in order to determine whether
arsenic interaction with thiol groups is consistent with binding site
occupation on the zinc finger motif , we analyzed as
s bond
formation between arsenic and cysteine residues on the zinc finger
peptide . in the uv vis spectrum , an as
we used
a270 in uv vis spectra as the indicator of as s
bond formation .
varying concentrations of arsenic compounds were incubated
with 100 m of different configurations of zinc finger peptides
for 30 min at room temperature , and the uv vis spectra of the
mixtures were recorded .
in arsenite treated samples , a270 values increased in a concentration - dependent manner for parp-1
and xpa zinc finger peptides , but not for aptx ( figure 2a ) , showing that arsenite selectively forms an as s
bond with c3h1 and c4 zinc fingers , as expected from our previous
report .
in contrast , in mma(iii ) treated
samples , a270 values increased for all three types of zinc
fingers in a mma(iii ) concentration - dependent manner ( figure 2b ) , indicating that mma(iii ) could form an as s
bond with each zinc finger .
ato formed as s bonds with parp-1
and xpa zinc fingers but not aptx ( figure 2c ) , showing the same binding selectivity for c3h1 and c4 configurations
as arsenite in terms of forming as
s bonds is
the molecular mechanism for zinc binding site occupation by arsenic .
among the three arsenicals ,
arsenite and ato showed the same selectivity
in forming as s bonds with c3h1 and c4 zinc fingers , but mma(iii )
could form as s bonds with all three configurations of zinc
finger peptides . as s bound formation analysis using uv
arsenic compounds ( a , arsenite ; b , mma(iii ) ; c , ato ) were incubated
with 100 m of the indicated zinc finger peptides at room temperature
for 30 min .
then uv vis spectrometry analysis was performed
as described in the experimental procedures section .
absorbance at 270 nm represents the as s bound formation
after arsenic binds to zinc fingers .
data were presented as the mean sd , * p < 0.05 vs corresponding [ as ] = 0 group , n = 3 . to further understand the differences
in binding selectivity , maldi - tof mass spectrometry was utilized to
analyze the precise molecular weights of the arsenic
zinc finger peptides with different configurations ( 100 m )
were treated with 100 m arsenic compounds .
the mass spectra
of apo - zinc finger peptide for aptx , parp-1 , and xpa are shown in
figures 3a , b , and c , respectively .
arsenite
showed no binding to the aptx zinc finger ( figure 3d ) but bound with parp-1 and xpa zinc finger peptides , both
giving + 72 m / z shift against the
apo - peptide signals ( figures 3e and f ) , indicating
that arsenite coordinates with zinc fingers with the arsenic atom
alone ( m / z = 75 ) , releasing three
hydrogen atoms ( m / z = 3 )
at the same time .
mma(iii ) induced a + 88 m / z shift to the aptx zinc finger peptide
( figure 3 g ) .
the interpretation of a + 88 m / z shift is that mma(iii ) bound to the
aptx zinc finger peptide with as - ch3 ( m / z : 75 , as+12 , c+3 , 3h = 90 ) , losing 2h ( m / z : 2 ) from cys residues on zinc
finger peptides .
mma(iii ) also bound to the parp-1 zinc finger ( figure 3h ) with a + 88 m / z shift , showing that mma(iii ) used 2 cysteine residues for binding .
for xpa , 1 molecule of mma(iii ) bound to the xpa zinc finger , giving
a + 88 m / z shift to the apo - peptide .
at the same time , we detected the signal of 2 molecules of mma(iii )
bound to the same xpa zinc finger peptide ( figure 3i ) , giving a + 88 m / z shift
for each .
since the xpa zinc finger has 4 cysteine residues , when
1 molecule of mma(iii ) bound to the zinc finger peptide , occupying
2 cysteine residues , there were still 2 free cysteine residues available
for another molecule of mma(iii ) coordination .
this result further
confirms that , unlike arsenite , mma(iii ) only occupies 2 cys during
binding with zinc fingers .
the mass spectra for ato was the same as
arsenite ; it did not bind to the aptx zinc finger ( figure 3j ) , but bound with parp-1 or xpa zinc fingers , giving
a + 72 m / z shift ( figure 3k and l ) .
therefore , the selectivity of ato binding
with zinc fingers was the same as arsenite .
furthermore , the + 72 m / z shift indicates that ato bound with
zinc fingers in the same manner as arsenite , i.e. , coordinating with
3 cys residues .
together , the mass spectrometry results show that
mma(iii ) coordinated with 2 cys but that arsenite and ato both occupy
3 cys when binding with zinc fingers . zinc finger binding behaviors analyzed
by maldi - tof mass spectrometry .
one hundred micromolar arsenic compounds were incubated with 100 m
of the indicated zinc finger peptides at room temperature for 30 min ,
then maldi - tof mass spectrometry analysis was performed as described
in experimental procedures section .
( a , b ,
and c ) apo - aptx , parp-1 , and xpa zinc fingers had m / z at 3319 , 3454 , and 4400 in mass spectra .
( d )
arsenite did not bind to the c2h2 zinc finger ( aptx ) .
( e and f ) arsenite
bound to c3h1 ( parp-1 ) and c4 ( xpa ) zinc fingers , giving a + 72 m / z shift .
( g , h , and i ) mma(iii ) could
bind to all three configurations of zinc fingers , giving + 88 m / z shift to zinc fingers . in i ,
1 or 2
molecules of mma(iii ) bound to c4 zinc finger ( xpa ) .
( j , k , and l ) ato showed the same zinc finger binding selectivity
as arsenite .
ato and arsenite gave the same + 72 m / z shift to c3h1 and c4 zinc fingers .
next , we investigated whether arsenic
binding could lead to structural changes of the zinc finger peptides .
zinc finger motifs of dna repair proteins are frequently responsible
for dna recognition and dna binding .
maintaining
a correct tertiary structure is critically important for dna binding
and dna repair capability . in order to investigate conformational
changes due to arsenic binding to the zinc fingers , intrinsic fluorescence
was used to analyze tertiary structure alteration on zinc finger peptides
after treatments with arsenic compounds , as compared to zinc incubation .
intrinsic fluorescence is primarily generated from tryptophan and
tyrosine residues ( phenylalanine also contributes a small portion ) ,
representing the chemical environment of these amino acids .
the intensity
of fluorescence usually increases while peptides fold and side chains
of trp and tyr are located in a relatively hydrophobic environment .
we treated different configurations of zinc
finger peptides ( 100 m ) for 30 min at room temperature with
varying concentrations of arsenic compounds .
after that , we collected
the fluorescent spectra of each sample under the excitation wavelength
of 280 nm and emission from 300 to 400 nm .
treatment with 100 m
zinc chloride was used as a control to show the natural folded conformation
of the zinc finger peptides .
finally , fluorescent intensity at 350
nm was used to represent the tertiary structure change of zinc fingers .
as shown in figure 4a
, the fluorescent signal
of the aptx zinc finger could be decreased in a concentration - dependent
manner only by mma(iii ) , but not arsenic or ato , while zinc treatment
generated the highest fluorescent signal ( shown as a single data point
in the top left corner of figure 1a , b , and
c ) .
this result indicates that the aptx zinc finger forms a defined
structure with zinc ions but that mma(iii ) treatment could unfold
the structure in a concentration - dependent manner .
arsenite or ato
showed no effect , which is consistent with the lack of binding based
on the selectivity data ( figures 1 , 2 , and 3 ) .
for the parp-1
zinc finger peptide , all 3 arsenic compounds decreased the fluorescent
intensity in a concentration - dependent manner ( figure 4b ) .
results on the xpa zinc finger exhibited a trend similar
( figure 4c ) to that of parp-1 ( figure 4b ) .
together , these results indicate that mma(iii )
alters the tertiary structure of all 3 conformations of zinc fingers ,
while arsenic and ato selectively disrupted the tertiary structure
of c3h1 and c4 zinc fingers .
furthermore , the findings demonstrate
that the alteration in the tertiary structure of the zinc finger is
a direct consequence of arsenic binding and that the selectivity of
structural changes induced by arsenicals is consistent with the binding
selectivity .
intensities of
fluorescence at 350 nm were used to represent the conformation / folding
status of zinc finger peptides .
the fluorescent intensities of 100
m zinc treatment on zinc finger peptides are shown ( top left
corner ) as controls .
( a ) natural conformation of aptx could be altered
by mma(iii ) in a concentration - dependent manner , while arsenic and
ato showed no effect .
( b ) all three arsenic compounds could cause
conformational change on the parp-1 zinc finger in a concentration - dependent
manner .
( c ) all three arsenic compounds could cause conformational
change on the xpa zinc finger in a concentration - dependent manner .
data were presented as the mean sd , * p <
0.05 vs corresponding [ as ] = 0 group ,
n = 3 . finally , in order to test whether the selectivity
and behavior of mma(iii ) , arsenite , and ato binding with zinc finger
proteins are applicable in cells , zinc content in dna repair proteins
from cells treated with arsenicals was analyzed .
we have reported
that zinc loss from zinc finger proteins is a direct consequence of
arsenic binding and a key event for protein function loss and arsenic
toxicity in cells .
human keratinocyte
( hacat ) cells were treated with 2 m arsenite , ato , or mma(iii )
for 24 h. aptx , parp-1 , and xpa protein were immunoprecipitated from
cell extracts using corresponding antibodies , and the zinc content
in each protein sample was determined . as shown in figure 5 , mma(iii ) caused zinc loss from all three configurations
of zinc finger proteins , while arsenite and ato selectively displaced
zinc from parp-1 and xpa proteins isolated from cells .
these results
demonstrate that arsenite and ato selectively interacted with c3h1
and c4 zinc fingers in the context of native protein but that mma(iii )
interacted with all 3 configurations of zinc finger proteins in hacat
cells .
hacat cells were treated with 2 m of different
arsenic compounds for 24 h. zinc finger proteins were immunoprecipitated
from the cell extract , then the zinc content in each specific protein
was analyzed with the colorimetric assay as described in the experimental procedures section .
zinc content in
aptx protein was sensitive only to mma(iii ) treatment , but zinc in
parp-1 and xpa was decreased by all three arsenic compounds .
that
is , mma(iii ) could remove zinc from all three configurations of zinc
finger proteins , while arsenic and ato selectively remove zinc from
c3h1 and c4 zinc finger proteins in cells .
bar plot shows the mean
sd , * p < 0.05 vs ctrl group ( no treatment ) , n = 3 .
targeted
interaction with zinc finger domains is considered an
important mechanism for arsenic toxicity and cocarcinogenesis . in
the present study , by using cobalt spectrometry , we demonstrated that
both inorganic and organic arsenicals interacted with zinc fingers
by direct occupation of metal binding sites .
vis spectra
demonstrated that all three arsenicals formed as s bonds with
cys residues on zinc fingers , illustrating the importance of cys residues
for arsenic binding .
in addition , loss of hydrogen
atoms on the complexes confirmed that arsenicals interacted with cys
residues but not his residues on zinc fingers , which is different
from the mechanism of zinc binding with zinc fingers .
this may also
be one of the reasons that arsenic binding changes conformation of
zinc fingers , which we demonstrated by intrinsic fluorescent analysis .
collectively , from the data offered by these diverse techniques , we
show that arsenite , mma(iii ) , and ato occupy metal binding sites on
zinc fingers by directly coordinating with cys residues to form as s
bonds , leading to conformational change as well as zinc loss from
the zinc fingers .
for the two trivalent inorganic arsenicals ,
arsenite and ato , their
patterns of interaction with zinc fingers are the same .
this conclusion
is drawn from the cobalt spectra showing the occupation of metal binding
sites , the uv vis spectra showing the formation of as s
bonds , and the mass spectra showing the coordination with 3 cys residues
on zinc fingers .
as shown by mass spectrometry , arsenite and ato gave
exactly the same + 72 m / z shift to
c3h1 or c4 zinc fingers , indicating that both arsenite and ato bind
to zinc fingers using the arsenic atom only and coordinate with 3
cys on zinc finger motif , with the release of three hydrogens .
this
behavior may explain the selectivity in binding with c3h1 and c4 zinc
fingers ( as illustrated in figure 6 , top row ) .
kitchin and wallace reported that arsenite bound c3h1 and c4 complexes
are over 2 orders of magnitude more stable than a c2h2 complex ( 155
versus 1.29 min ) in kinetic studies .
therefore ,
it is reasonable to suggest that trivalent arsenite or ato may form
two as s bonds with c2h2 zinc fingers while leaving the third
bond unoccupied but that the resulting product is too unstable to
accumulate to high enough a concentration to be detected by our analytical
approaches due to the presence of an unoccupied bond .
this binding
selectivity toward zinc fingers with 3 or more cys could have potential
biological significance . in terms of structural / functional consequences ,
arsenite and
ato led to selective conformational changes of c3h1 and
c4 zinc fingers and induced zinc loss selectively in parp-1 and xpa
proteins in cells .
there was no significant difference in the efficiency
of arsenite and ato in changing the structure of zinc fingers as well
as zinc release from proteins .
circular dichroism ( cd ) and nuclear
magnetic resonance ( nmr ) spectra indicate that arsenic binding to
a c3h1 or c4 zinc finger motif result in an unfolded structure .
these results , together with the findings here , provide evidence
to the alteration of zinc finger structure by arsenic binding and
further support that arsenic interaction with zinc finger proteins
will likely disrupt protein function . since c3h1 and c4 zinc finger
proteins are a minority in the whole zinc finger protein family ( less
than 20% ) , inorganic arsenicals could target some c3h1 and c4 zinc
finger proteins in cells more effectively even at low concentrations .
schematic
illustration of arsenite , ato , and mma(iii ) binding to
zinc fingers .
arsenite and ato bind to zinc fingers by coordinating
with 3 cys , which leads to selective binding with c3h1 and c4 zinc
fingers .
mma(iii ) binds to zinc fingers together with the methyl group
( -me ) , using 2 cys instead of 3 , which causes nonselective binding
with all 3 configurations of zinc fingers .
it has been reported that that mma(iii ) binds to parp-1 and
xpa
zinc finger peptides . here , we further demonstrated
that mma(iii ) could occupy metal binding sites ( figure 1a ) and form as
s bonds ( figure 2a ) on all 3 configurations of zinc fingers , nonselectively .
this
nonselective interaction is also confirmed structurally and functionally
using conformation and zinc content analysis ( figures 4 and 5 ) .
the molecular mechanism behind
the nonselectivity is that mma(iii ) covalently binds to two cys residues ,
releasing two hydrogen , as shown in mass spectrometry ( figures 3 g , h , and i ) .
in contrast to arsenite and ato binding
with three cys , mma(iii ) only binds with two cys on zinc fingers .
this
is demonstrated by the + 88 m / z shift , as well as the binding of two mma(iii ) molecules to the c4
zinc finger ( figure 3i ) . the + 88 m / z shift and loss of 2h is consistent with previous
findings by wnek et al .
in addition ,
a complex of two mma(iii ) molecules with the c4 xpa zinc finger peptide
has been detected by piatek et al . in
this work , we confirmed these findings using maldi - ms and put these
together to explain the mechanism of differential binding of mma(iii )
to zinc finger peptides at the molecular level .
although arsenic in
mma(iii ) is still trivalent , one bond is already occupied by the methyl
group , leaving the remaining two bonds for binding with cys . the + 88 m / z shift in mass spectrometry studies
with c2h2 , c3h1 , and c4 zinc fingers confirm that when mma(iii ) binds
to zinc fingers , the methyl group is still bound to arsenic . in other
words ,
the presence of the methyl group on mma(iii ) changed the binding
behavior and selectivity of this trivalent arsenical ( as illustrated
in figure 6 , bottom row ) , enabling it to bind
with two cys on zinc fingers .
importantly , unlike the situation with
inorganic arsenite , the product derived from mma(iii ) binding with
two cys is stable since there is no longer an unoccupied bond existing
on the molecule .
this result indicates that the methylation of arsenic
could dramatically change the preference and profile of arsenic interaction
with zinc finger proteins .
it is possible that the greater breadth
of zinc finger protein binding may lead to differences in toxicity
and carcinogenic potential .
some recent studies showed that mma(iii )
is more toxic than inorganic arsenic in terms of certain parameters
of carcinogenesis , such as cell transformation .
as for the possible molecular mechanism , piatek et al . demonstrated
that mma(iii ) acts more effectively than arsenite in destroying the
structure of c4 zinc fingers .
meanwhile ,
in studies of parp activity , up to 90% inhibition is readily evident
at submicromolar concentration of arsenite in human keratinocytes , but exposure to 1 m mma(iii ) caused about 30% parp activity
inhibition in urothelial cells .
these
findings might suggest that arsenite causes a greater magnitude of
parp inhibition than mma(iii ) or that the findings may simply reflect
cell type differences .
apparently , further research is needed to investigate
the relationship between binding selectivity and toxicity / carcinogenesis ,
i.e. , whether the change of selectivity enhances the effect of arsenic in vivo or simply dilutes arsenic interaction across the
large family of zinc finger proteins . in conclusion
, this work
demonstrates that arsenite and ato have
the same selective effect in binding with c3h1 and c4 zinc finger
proteins , whereas mma(iii ) interacts with all three configurations
of zinc finger proteins .
these findings
provide insightful understanding of the molecular mechanisms underlying
the differential effects of inorganic versus methylated arsenicals ,
as well as the role of in vivo arsenic methylation
in arsenic toxicity and carcinogenesis . | arsenic
is an environmental toxin that enhances the carcinogenic
effect of dna - damaging agents , such as ultraviolet radiation and benzo[a]pyrene .
interaction with zinc finger proteins has been
shown to be an important molecular mechanism for arsenic toxicity
and cocarcinogenesis .
arsenicals such as arsenite , arsenic trioxide
( ato ) , and monomethylarsonous acid ( mma(iii ) ) have been reported to
interact with cysteine residues of zinc finger domains , but little
is known about potential differences in their selectivity of interaction .
herein we analyzed the interaction of arsenite , mma(iii ) , and ato
with c2h2 , c3h1 , and c4 configurations of zinc fingers using uv vis ,
cobalt , fluorescence , and mass spectrometry .
we observed that arsenite
and ato both selectively bound to c3h1 and c4 zinc fingers , while
mma(iii ) interacted with all three configurations of zinc finger peptides .
structurally and functionally , arsenite and ato caused conformational
changes and zinc loss on c3h1 and c4 zinc finger peptide and protein ,
respectively , whereas mma(iii ) changed conformation and displaced
zinc on all three types of zinc fingers .
the differential selectivity
was also demonstrated in zinc finger proteins isolated from cells
treated with these arsenicals .
our results show that trivalent inorganic
arsenic compounds , arsenite and ato , have the same selectivity and
behavior when interacting with zinc finger proteins , while methylation
removes the selectivity .
these findings provide insights on the molecular
mechanisms underlying the differential effects of inorganic versus
methylated arsenicals , as well as the role of in vivo arsenic methylation in arsenic toxicity and carcinogenesis . |
although papilledema is commonly reported with hypoparathyroidism primary or secondary , but not reported commonly with php .
a 10-year - old male child presented to our outpatient service with the complaints of blurring of vision , diplopia , and associated headache .
patient also had clinical signs and biochemical parameters of hypocalcemia , along with normal parathyroid hormone ( pth ) levels .
in cases of chronic papilledema , the assessment of the calcium serum level is a safe and simple method to exclude hypoparathyroidism or php .
pseudohypoparathyroidism ( php ) is an inherited metabolic disorder characterized by end organ resistance to the action of parathyroid hormone ( pth ) .
pth maintains serum calcium levels by promoting bone resorption , enhanced distal tubular reabsorption of calcium , and increased synthesis of 1,25-dihydroxyvitamin d , thereby causing enhanced intestinal calcium absorption .
chronic hypocalcemia is responsible for increase in intracranial tension , thus causing papilledema , hence visual disturbances .
a 10-year - old male child presented to our outpatient service with the complaints of blurring of vision , double vision , and dimness of vision .
patient also had history of cramping pain of extremities with spasms more in lower limb and calf muscles . on clinical examination patient
bilateral cataract was present and fundus was showing presence of papilledema [ figure 1 ] .
fundus photograph of the patient before and after treatment biochemical analysis is shown in table 1 . in presence of clinical features and biochemical analysis showing hypocalcemia ,
urinary calcium was 3.57 mg / dl and urinary creatinine was 3.77 mg / dl , thus indicating renal tubular calcium loss .
serum biochemistry of the patient in presence of hypocalcemia , renal tubular calcium loss and normal pth and aho phenotype , patient was labeled as a case of php .
features of raised intracranial tension were resolved once patient was started on treatment with oral calcium , phosphate binders along with active vitamin d3 .
php is called pseudo hypoparathyroidism because the blood chemistry values ( low to normal serum calcium and high serum phosphorous ) resemble the more common disorder hypoparathyroidism in which pth is absent or low , but pth is actually normal or elevated because the kidney can not fully respond to pth .
a multifactorial etiology for bilateral disc edema can be postulated , such as impaired axoplasmic conduction due to reduced calcium and stasis , impaired central nervous system ( cns ) vascular autoregulation causing venous stasis , and raised intracranial pressure due to pseudotumor cerebri .
the papilledema in hypocalcemia does not behave like that due to intracranial space occupying lesion or cerebral venous thrombosis .
the disc edema readily responds to calcium therapy and disappears with calcium levels higher than 8 mg / dl .
our patient also improved with normal fundoscopic findings [ figure 1 ] and clinical and biochemical [ table 1 ] improvement .
in cases of chronic papilledema , the assessment of the calcium serum level is a safe and simple method to exclude hypoparathyroidism or php . | introduction : visual disturbance as a presenting feature of pseudohypoparathyroidism ( php ) is uncommon .
although papilledema is commonly reported with hypoparathyroidism primary or secondary , but not reported commonly with php.description of the case : a 10-year - old male child presented to our outpatient service with the complaints of blurring of vision , diplopia , and associated headache .
there was no history of seizure episode .
patient had rounded face with a short , stocky built .
shortening of the fourth metacarpal and fifth metatarsal was present
. pitted nails and bilateral cataract .
patient also had clinical signs and biochemical parameters of hypocalcemia , along with normal parathyroid hormone ( pth ) levels .
consistent with pseudohypopathyroidism.conclusion:in cases of chronic papilledema , the assessment of the calcium serum level is a safe and simple method to exclude hypoparathyroidism or php . |
based on the fact that computers are commonly used in hospital patient wards and operation theatres , it would be not surprising if they could be contaminated with nosocomial pathogens .
cultures taken from the surface of computers keyboards yielded microorganisms such as coagulase - negative staphylococcus ( cns ) ( from 100% of all keyboards ) , diphtheroids ( 80% ) , micrococcus spp .
( 64% ) , methicillin - resistant staphylococcus aureus ( mrsa ; 4% ) , methicillin - sensitive staphylococcus aureus ( mssa ; 4% ) , vancomycin - sensitive enterococcus spp .
these studies found all of the tested disinfection solutions were to be effective and compatible for use in disinfecting keyboards .
it could be further demonstrated that contamination of the keyboards used by numerous persons was far higher than that seen in keyboards used by only one person . as a consequence to this unavoidable
situation , anderson et al . also recommended routine cleaning and disinfection of the work station , especially in situations where keyboard usage involves numerous persons . on an intensive care unit
it was discovered that the keyboard keys and mouse input devices of the ward station computers were contaminated up to 5.9% and 6.3% , respectively .
interestingly , the telephone handles as well as intercoms were not contaminated due to the fact that they were regularly disinfected .
analogously , keyboard keys used by anesthesiologists in the operating room were also shown to be contaminated ( most often with cns and bacillus spp . , but also with mrsa ) .
consequent to these findings , a recommendation was made for routine hand disinfection along with daily wipe - disinfection of the computer contact surface .
the general consensus from all of the studies examining computer keyboard and mouse devices is unanimous : the decisive preventative measure for the elimination of these infection sources is improved hand hygiene and routine disinfection / cleaning of the pc contact / touch surfaces , , , , , , , , .
based upon the fact that most laptops are fitted with a cooling ventilation blower , it was decided to investigate whether the external air inlets into the vent and eventually blown back into the room actually culminates into contamination , thereby spreading potential pathogens into the surrounding area .
in order to avoid a mixture of the emission from the laptop together with the surrounding contaminated environmental air , it had to be ascertained that the air exhausted from the laptop would be captured into a microbial air sampler , whereby a secure separation between contaminated room - air and laptop emission could be maintained .
the laptops chosen for the study were examined within a laminar air flow safety workbench ( microflow , nunc gmbh , wiesbaden - biebrich ) . for the purpose of this study a box which could be disinfected as well as completely sealed was constructed and placed into the security workbench ( figure 1 ( fig .
the suction vent of the microbial air sampler ( air deal 3 p , biomerieux deutschland gmbh , nrtigen ) was precisely positioned onto the opening punched out from the bottom of the box .
the top cover of the box could be open in order to place the laptop within ( figure 2 ( fig .
further course of the experiment involved the following steps : disinfection of all internal and external surfaces of the box using an alcohol - based surface disinfectant ( terralin liquid ; schlke and mayr gmbh , norderstedt ) possessing microbiocidal and virocidal efficacy ( declared max .
effect time against non - sheathed viruses 2 min ) for a minimal duration of 5 minsimultaneous disinfection of the internal surfaces of the workbench with the same liquid solution also for 5 min with the safety workbench switched - ondisinfection of the surface of the microbial air sampler with the same liquid solution for 5 minsurgical , alcohol - based hand disinfection and disinfection of the lower arms according to the declared time of effect for duration of 1.5 min ( ahd 2000 , lysoform , dr .
hans rosemann gmbh , berlin ) , sterile op gloves were subsequently put onplacement of the disinfected box into safety workbench , thereafter the box was not movedswitching - off of the safety workbench for the duration of time it took to carefully place the laptops into the box without causing any air - movement or disturbancesswitching - on of the safety workbench for a period of 20 secdisinfection of the gloved handsplacement of the blood agar culture plate into the microbial air sampler , unscrewing the collection head which for the first measurement of the day was initially sterile . for each new subsequent measurement
the collection head was disinfected for a duration period of 5 min with a bottled disinfection solution.careful attachment of the microbial air sampler to the opening at the bottom of the box with special attention not to allow any space between the connection ( figure 3 ( fig . 3))switching - on the microbial air sampler for a time period of 5 min in order to determine the blank values ; that is the number of airborne bacteria released into the laminar air flow from the external body of the non - activated laptop removal of the agar plate from the microbial air sampler , disinfection of the collection head and placement of a new agar plateswitching - on the laptop and program start ; as soon as the ventilation fan is activated the microbial air sampler is immediately switched - on once again for a period of 5 min in order to register the air released by the ventilation blowerremoval of the laptop out of the box .
disinfection of all internal and external surfaces of the box using an alcohol - based surface disinfectant ( terralin liquid ; schlke and mayr gmbh , norderstedt ) possessing microbiocidal and virocidal efficacy ( declared max .
effect time against non - sheathed viruses 2 min ) for a minimal duration of 5 min simultaneous disinfection of the internal surfaces of the workbench with the same liquid solution also for 5 min with the safety workbench switched - on disinfection of the surface of the microbial air sampler with the same liquid solution for 5 min surgical , alcohol - based hand disinfection and disinfection of the lower arms according to the declared time of effect for duration of 1.5 min ( ahd 2000 , lysoform , dr .
hans rosemann gmbh , berlin ) , sterile op gloves were subsequently put on placement of the disinfected box into safety workbench , thereafter the box was not moved switching - off of the safety workbench for the duration of time it took to carefully place the laptops into the box without causing any air - movement or disturbances switching - on of the safety workbench for a period of 20 sec disinfection of the gloved hands placement of the blood agar culture plate into the microbial air sampler , unscrewing the collection head which for the first measurement of the day was initially sterile . for each new subsequent measurement
the collection head was disinfected for a duration period of 5 min with a bottled disinfection solution .
careful attachment of the microbial air sampler to the opening at the bottom of the box with special attention not to allow any space between the connection ( figure 3 ( fig .
3 ) ) switching - on the microbial air sampler for a time period of 5 min in order to determine the blank values ; that is the number of airborne bacteria released into the laminar air flow from the external body of the non - activated laptop removal of the agar plate from the microbial air sampler , disinfection of the collection head and placement of a new agar plate switching - on the laptop and program start ; as soon as the ventilation fan is activated the microbial air sampler is immediately switched - on once again for a period of 5 min in order to register the air released by the ventilation blower removal of the laptop out of the box . in parallel , a smear was taken using cotton swabs at the site of the laptop exhaust vent where the cooled air is blown out .
mller gmbh , eppelheim ) , subsequently placed into a casein - sojapepton - solution and vortexed .
after 24 hr incubation of the csl , 50 l fractionated were spread onto columbia blood agar .
the cultivated colonies derived from the collected air as well as those from the smear were biochemically differentiated in the same manner as those from enrichment cultures .
the devices originated from a total of 7 different manufacturers and were drafted for use from various hospital stations without prior notice or disinfection ( table 1 ( tab .
temperature pictures were performed at the blower exhaust vent and within the interior of the laptop using a thermo camera variocam high resolution ( infra tec gmbh dresden ) .
for this the housing of the laptops were opened . in order to achieve a defined cpu - burden and the associated warmth development the software stress my pc
the pre - values derived from the air circulated around the casing of the laptop stood at 40.117.9 colony forming units per m ( cfu / m ) ( table 2 ( tab .
this was also found to be the case with molds whereby the factor was increased by only 1.2 ( 5.79.46 vs. 7.114.90 ) . with the exception of the aerobic sporulation
, there was no differentiation observed between the blank values and the running blowers in terms of species distribution . in the case of the apathogenic sporulators ,
the figures were doubled from 4.86.1 cfu / m to 11.113.2 cfu / m
whereby , however , this difference was not considered significant ( wilcoxon signed rank - test , p=0.211 ) .
the spectrum of the freely released microorganisms encompassed mostly members of the localized flora of the skin ( coagulase - negative staphylococcus and micrococcus luteus ) , lacking pathogenic potential and therefore only capable of contaminating the body surface . from 2 laptops
were 4 cfu of methicillin sensitive staphylococcus aureus released but each time only for the blank values ( laptops 2 & 12 ) . 1 laptop released 2 cfu of -hemolyzing streptococcus but in this case only after the blower was switched - on .
a correlation between origin of the laptop , the manufacturer , the amount of freely - released germs as well as germ spectrum could not be developed .
swab culture samples taken from the blower exit vents which were directly smeared demonstrated negative growth in 16 of the cases .
the remaining 4 showed only members of the localized flora of the skin and/or aerobic spores . even following applied enrichment , 6 of the smears remained negative and the germ spectrum did not alter ( table 3 ( tab .
the results were found to be so uniform that it was decided not to match the results to the specific laptop manufacturers . at the site of the blower exit vent of a laptop model travelmate 3000 following 10 min of running the software at maximum , measured temperature 56.4c ( figure 4 ( fig .
4 ) ) . suctioned cool air flowing over the internal surface of the laptop achieved a measured temperature of 73.2c ( figure 5 ( fig .
the results of this study allow the assumption that the activated blowers within the investigated laptops did not result in an additional release of nosocomial pathogens into the surrounding environment .
the exit vent of the blower was also not contaminated with nosocomial germs . due to the high temperatures in the inner parts of the laptop ( up to 73c )
, a biofilm could not be created within the blower space or surrounding surfaces from which the risk of disease activators could be emitted . even at the site of the blower vent
the fact that spores were released with or without the activated blower leads to the assumption that they originated from the external surface of the laptop and perhaps from the air shaft of the blower . that spores and molds possess a high persistence against dry heat than vegetative bacteria ; it is possible that they could survive a short term within the airspace of the blower .
this is , however , unlikely for nosocomial vegetative bacteria due to an intolerance of general temperatures 60c .
before the point is reached where the processor has become heated - up and the blower is activated , the surrounding room air is sucked into the device .
the air becomes immediately warm and dry , whereby bacteria have no possibility of clinging to the inner surface of the blower , reproducing and eventually building a biofilm .
the explanation for this is that most disease activators are mesophilic ; meaning that they proliferate preferably at temperatures between 1545c and for the construction of biofilm require water in order to develop a completely hydrated eps - matrix .
interpretation of the findings is thereby supported in that direct smears obtained from the airflow ventilated inner surface of the laptop were without exception negative .
once the remaining warm air within the airspace of the blower is cooled after the laptop has been switched - off , it is possible through volume traction that contaminated external air finds its way into the blower compartment .
that room air within ward stations is minimally burdened in a microbial sense ( e.g. 200400 cfu / m in a patient room and hall of an icu ward , it can be calculated that after a room air backflow of approximately 2 cm , the number of germs which had entered clearly stood at 1 cfu . even though the cooling blower was turned - off the conditions for biofilm development were not present . | inadequately performed hand hygiene and non - disinfected surfaces are two reasons why the keys and mouse - buttons of laptops could be sources of microbial contamination resulting consequently in indirect transmission of potential pathogens and nosocomial infections . until now
the question has not been addressed whether the ventilation - blowers in laptops are actually responsible for the spreading of nosocomial pathogens .
therefore , an investigational experimental model was developed which was capable of differentiating between the microorganisms originating from the external surfaces of the laptop , and from those being blown out via the ventilation - blower duct .
culture samples were taken at the site of the external exhaust vent and temperature controls were collected through the use of a thermo - camera at the site of the blower exhaust vent as well as from surfaces which were directly exposed to the cooling ventilation air projected by the laptop .
control of 20 laptops yielded no evidence of microbial emission originating from the internal compartment following switching - on of the ventilation blower .
cultures obtained at the site of the blower exhaust vent also showed no evidence of nosocomial potential .
high internal temperatures on the inner surfaces of the laptops ( up to 73c ) as well as those documented at the site of the blower exhaust vent ( up to 56c ) might be responsible for these findings . |
miniature punch grafting is one of the easiest and cheapest office procedure for vitiligo with excellent repigmentation and minimal complications . in spite of the rapid ongoing advancement in its treatment ,
vitiligo remains one of the most common difficult to handle pigmentary disorders for a dermatologist , with a high degree of psychosocial impact on the patients .
a large proportion of vitiligo patients do not respond to the conventional medical modalities probably because of the total absence of melanocytic reservoir in their lesional skin .
in such cases , replacement of the achromic skin with newer source of melanocytes by surgical means , holds a good promise . among the various surgical modalities ,
miniature punch grafting is still regarded as the easiest and cheapest office procedure . with proper procurement and placement of grafts and good postoperative care ,
we report a case of stable vitiligo where target - like pigmentation occurred after miniature punch grafting , which is a rare and unique observation .
a 14-year - old girl presented to us with asymptomatic depigmented macules in a segmental distribution over upper back of 5 years duration .
the lesions had not shown any progression for the past 3 years and there was no evidence of koebner 's phenomenon .
patient did not suffer from any other autoimmune disorders and her routine investigations and thyroid function tests were normal .
she was previously treated with topical steroids , tacrolimus , and topical psoralen and sunlight ( puvasol ) without much improvement . as her lesions were stable and unresponsive , we performed miniature punch grafting after taking informed consent from the patient .
punch grafts of 2.5 mm were taken from the gluteal skin while 2 mm punches were used to make the recipient chambers .
a total of 27 grafts were put on the vitiliginous area . after achieving hemostasis ,
dressing was changed after 8 days , all grafts had taken up well and she was started on topical puvasol after 3 weeks .
patient came for second follow up only after 4 months when perigraft pigment spread was seen around majority excepting few grafts .
most of these sites showed a target - like pigmentation [ figure 1a and b ] . at the center
there was the pigmented graft in place , surrounding this was a circular hypopigmented zone ( perigraft halo ) and then the zone of pigmented annulus indicating the spread of pigment from the donor graft .
the successful repigmentation of achromic skin through punch grafting in vitiligo patients has been demonstrated by many authors .
various reported complications include cobble stoning , sinking pits , polka dot appearance , variegated appearance , color mismatch , static graft ( no pigment spread ) , depigmentation of graft , perigraft halo , graft dislodgement / rejection , hypertrophic scar , and keloid formation .
most authors have described perigraft halo as the peripheral rim of hypo / depigmentation , which persists after skin grafting in a vitiliginous patch .
first , improper placement of donor grafts , that is , far from the margin of the patch so that the repigmentation does not extend till the margin .
second reason could be grafting in cases of unstable / active vitiligo . as postulated by badri et al .
in active vitiligo , the autoimmune process consisting of activated t cells is maximum at the margin of the lesion .
these activated cd3 + , cd4 + , and cd8 + t cells express the cutaneous lymphocyte - associated antigen ( heca-452 + ) typical of infiltrating t cells .
this occurs due to the contracture of the graft when it is harvested because of the contraction of the elastin fibers .
in contrast to the above mentioned perigraft halo , the halo , which we found in our patient , was around the individual grafts .
a possible reason for this could be circular scarring that occurred between the graft and the normal skin .
savant mentions use of donor grafts 0.5 mm larger than the recipient bed to compensate for any graft contraction and prevent perigraft circular scarring
. however , malakar and rajagopal et al . reported the use of same size punches with good results . in our patient , in spite of using 0.5 mm larger graft from the donor site , a thin rim of hypopigmentation appeared around many of the grafts , which was then surrounded by a zone of pigment spread .
target - like pigmentation consisting of three zones , that is , central pigmentation surrounded by a rim of hypopigmentation and a peripheral zone of hyperpigmentation .
the central zone ( a ) represented the graft in situ , whereas the rim of hypopigmentation ( b ) represented the junction of donor and the recipient skin .
we can consider the remaining area as the fourth zone also , which actually represents the presurgical vitiligenous skin ( d ) .
thus we can assume that the melanocytes travelled from the graft to the periphery through the rim of hypopigmented zone .
this rim of hypopigmentation can be considered as a thin scar between the graft and the vitiliginous skin .
the above pattern of pigmentation was observed despite the use of 0.5 mm larger graft from the donor site thus debating the use of larger donor grafts for vitiligo punch grafting .
a- central pigmented zone , b- rim of hypopigmentation , c- peripheral pigmented zone , d- background vitiligenous skin we observed an unusual pattern of repigmentation following minipunch grafting , which resembled target - like lesions with a perigraft halo surrounding individual grafts despite the use of larger donor grafts . | surgical treatment for vitiligo has been ever evolving .
each surgical modality has its own benefits and limitations .
miniature punch grafting is the most extensively performed surgery , which gives good results in stable vitiligo .
herein we report an unusual type of repigmentation observed after minipunch grafting in a patient of stable vitiligo , which resembled target - like lesions with a perigraft halo surrounding individual grafts .
such pigment spread occurred despite the use of 0.5 mm larger graft from the donor site . |
the methodology compares utilization of imaging in the icd and nonimplant cohorts to illustrate the gap in volume of imaging linked to restrictions in its use in patients with icds .
the study also compares utilization in subsets of the cohorts , including stroke , back pain , and joint pain .
four calendar years of mri utilization in the nonimplant cohort was utilized to forecast the potential utilization for mri over a 10year time horizon .
this study used data from the truven health marketscan commercial claims and medicare supplemental research databases , which contain health insurance portability and accountability act ( hipaa)compliant , individuallevel , deidentified , healthcare claims information from employers , health plans , hospitals , medicare , and medicaid programs .
research using marketscan data has been widely published in peerreviewed journals , including the field of imaging.21 , 22 a protocol describing the study objectives , criteria for patient selection , data elements of interest , and statistical methods was submitted to the new england institutional review board ( neirb ) and deemed exempt from review ( neirb # 13343 ) .
patientlevel data were extracted from the truven health marketscan research databases for the years 20092012 .
two cohorts were defined : 1 ) patients having a record of an icd implant : " icd implant cohort " ; 2 ) patients without a record of a cardiac device or other implantable device that is contraindicated for mri : " nonimplant cohort . " the following inclusion / exclusion criteria were then applied to each cohort :
icd implant cohort : patients with continuous health plan enrollment in the calendar year 2012 who had a record of an icd implant for that entire calendar year were identified ( appendix implant code combinations , implant codes ) .
( note : patients had to have a record of an implant prior to the start of the calendar year 2012 and could not have a record of an explant [ appendix explant codes ] anytime during that year).nonimplant cohort : patients with continuous health plan enrollment in 20092012 without a record of any cardiac or contraindicated mri implant or related monitoring codes ( appendix implant code combinations interrogation and evaluation codes ) during the entire 4year time period were identified .
icd implant cohort : patients with continuous health plan enrollment in the calendar year 2012 who had a record of an icd implant for that entire calendar year were identified ( appendix implant code combinations , implant codes ) .
( note : patients had to have a record of an implant prior to the start of the calendar year 2012 and could not have a record of an explant [ appendix explant codes ] anytime during that year ) .
nonimplant cohort : patients with continuous health plan enrollment in 20092012 without a record of any cardiac or contraindicated mri implant or related monitoring codes ( appendix implant code combinations interrogation and evaluation codes ) during the entire 4year time period were identified .
the main outcome measure analyzed was yearly ( 2012 ) diagnostic imaging utilization which was organized into the following six categories : 1 ) computed tomography ( ct ) and computed tomography angiography ( cta);2 mri and magnetic resonance angiogram ( mra ) ; 3 ) ultrasound , echo , doppler , and duplex ; 4 ) xray and fluoroscopy ; 5 ) nuclear ; and 6 ) other .
diagnostic imaging utilization was then measured two different ways : i ) by the number of procedures overall and across each category , and ii ) by the number of actual patients having a procedure within each category .
the main independent variable for this analysis was whether a patient was in the icd cohort or the nonimplant cohort .
explanatory variables included patient demographics ( age , gender , and type of plan ) and patient comorbidities ( diabetes , hypertension , chronic pulmonary obstruction disease [ copd ] , etc . ) .
see appendix comorbid condition codes and anticoagulation specification for a complete listing of all comorbidities and their corresponding diagnostic codes .
this included patients with a diagnosis code on record for the year 2012 for the following diseases : acute stroke , back pain , and joint pain .
for the calendar year 2012 , patients with icd9 diagnosis codes for stroke or transient ischemic attack ( tia ) had their diagnostic imaging utilization summarized within 3 days of the stroke / tia event .
patients with icd9 diagnosis codes for back pain or joint pain had their diagnostic imagining utilization summarized within 3 days before and 30 days after their first diagnosis on record .
tabulation of summary statistics , graphical presentations , and data analyses were performed using sas v. 9.2 .
once all variables were created , patients in the icd implant cohort were matched 1:1 using a combination of direct ( age , gender , type of plan ) and propensity score matching ( comorbid conditions ) to patients in the nonimplant cohort .
a full list of comorbid conditions used for the propensity score are listed in appendix comorbid condition codes and anticoagulation specification .
propensity score matching , or conditional probability of assignment to a particular treatment given a set of observed characteristics , has been shown to balance the number of confounders among matched cohorts .
the propensity score was calculated from a logistic regression model as the probability that a patient was assigned to a particular treatment given the patient 's comorbid conditions . from this
model , individual propensity scores were calculated for each patient as a measure of the likelihood that the patient would have been in the icd cohort versus the nonimplant cohort .
an sas macro from the mayo clinic ( gmatch ) was used to create a greedy match based on the propensity score.23 , 24 this method utilizes random selection of treatment subjects and chooses the nearest matching nonimplant subject .
once matched , the pairs will not be broken , even for a more optimal match .
pi = e(0+1x1i++pxpi)1+e(0+1x1i++pxpi)where pi is the likelihood of icd implant for the i patient ( i = 1, ,n ) and x1i xip are covariate characteristics for the i patient . diagnostic imaging utilization was compared across the matched cohorts , in total , by imaging category ( mri , ct scan , xray , etc . ) , and for mri by body area for the calendar year 2012 .
the same comparison was carried out for the following three subpopulations of interest : acute stroke / tia , back pain , and joint pain .
predicting the probability of mri utilization : 10year time horizon in an effort to further understand mri utilization , the nonimplant matched cohort was used to measure the percent of patients with icds who needed an mri over the 4year period.(2009 2012 ) this survival data were then fitted with exponential functions to forecast a range of best fit scenarios , as measured by the coefficient of determination , out to 10 years .
this study used data from the truven health marketscan commercial claims and medicare supplemental research databases , which contain health insurance portability and accountability act ( hipaa)compliant , individuallevel , deidentified , healthcare claims information from employers , health plans , hospitals , medicare , and medicaid programs .
research using marketscan data has been widely published in peerreviewed journals , including the field of imaging.21 , 22 a protocol describing the study objectives , criteria for patient selection , data elements of interest , and statistical methods was submitted to the new england institutional review board ( neirb ) and deemed exempt from review ( neirb # 13343 ) .
patientlevel data were extracted from the truven health marketscan research databases for the years 20092012 .
two cohorts were defined : 1 ) patients having a record of an icd implant : " icd implant cohort " ; 2 ) patients without a record of a cardiac device or other implantable device that is contraindicated for mri : " nonimplant cohort . " the following inclusion / exclusion criteria were then applied to each cohort :
icd implant cohort : patients with continuous health plan enrollment in the calendar year 2012 who had a record of an icd implant for that entire calendar year were identified ( appendix implant code combinations , implant codes ) .
( note : patients had to have a record of an implant prior to the start of the calendar year 2012 and could not have a record of an explant [ appendix explant codes ] anytime during that year).nonimplant cohort : patients with continuous health plan enrollment in 20092012 without a record of any cardiac or contraindicated mri implant or related monitoring codes ( appendix implant code combinations interrogation and evaluation codes ) during the entire 4year time period were identified .
icd implant cohort : patients with continuous health plan enrollment in the calendar year 2012 who had a record of an icd implant for that entire calendar year were identified ( appendix implant code combinations , implant codes ) .
( note : patients had to have a record of an implant prior to the start of the calendar year 2012 and could not have a record of an explant [ appendix explant codes ] anytime during that year ) .
nonimplant cohort : patients with continuous health plan enrollment in 20092012 without a record of any cardiac or contraindicated mri implant or related monitoring codes ( appendix implant code combinations interrogation and evaluation codes ) during the entire 4year time period were identified .
the main outcome measure analyzed was yearly ( 2012 ) diagnostic imaging utilization which was organized into the following six categories : 1 ) computed tomography ( ct ) and computed tomography angiography ( cta);2 mri and magnetic resonance angiogram ( mra ) ; 3 ) ultrasound , echo , doppler , and duplex ; 4 ) xray and fluoroscopy ; 5 ) nuclear ; and 6 ) other .
diagnostic imaging utilization was then measured two different ways : i ) by the number of procedures overall and across each category , and ii ) by the number of actual patients having a procedure within each category .
the main independent variable for this analysis was whether a patient was in the icd cohort or the nonimplant cohort .
explanatory variables included patient demographics ( age , gender , and type of plan ) and patient comorbidities ( diabetes , hypertension , chronic pulmonary obstruction disease [ copd ] , etc . ) .
see appendix comorbid condition codes and anticoagulation specification for a complete listing of all comorbidities and their corresponding diagnostic codes .
this included patients with a diagnosis code on record for the year 2012 for the following diseases : acute stroke , back pain , and joint pain .
for the calendar year 2012 , patients with icd9 diagnosis codes for stroke or transient ischemic attack ( tia ) had their diagnostic imaging utilization summarized within 3 days of the stroke / tia event .
patients with icd9 diagnosis codes for back pain or joint pain had their diagnostic imagining utilization summarized within 3 days before and 30 days after their first diagnosis on record .
tabulation of summary statistics , graphical presentations , and data analyses were performed using sas v. 9.2 .
once all variables were created , patients in the icd implant cohort were matched 1:1 using a combination of direct ( age , gender , type of plan ) and propensity score matching ( comorbid conditions ) to patients in the nonimplant cohort .
a full list of comorbid conditions used for the propensity score are listed in appendix comorbid condition codes and anticoagulation specification .
propensity score matching , or conditional probability of assignment to a particular treatment given a set of observed characteristics , has been shown to balance the number of confounders among matched cohorts .
the propensity score was calculated from a logistic regression model as the probability that a patient was assigned to a particular treatment given the patient 's comorbid conditions . from this model ,
individual propensity scores were calculated for each patient as a measure of the likelihood that the patient would have been in the icd cohort versus the nonimplant cohort .
an sas macro from the mayo clinic ( gmatch ) was used to create a greedy match based on the propensity score.23 , 24 this method utilizes random selection of treatment subjects and chooses the nearest matching nonimplant subject .
once matched , the pairs will not be broken , even for a more optimal match .
pi = e(0+1x1i++pxpi)1+e(0+1x1i++pxpi)where pi is the likelihood of icd implant for the i patient ( i = 1, ,n ) and x1i xip are covariate characteristics for the i patient .
diagnostic imaging utilization was compared across the matched cohorts , in total , by imaging category ( mri , ct scan , xray , etc . ) , and for mri by body area for the calendar year 2012 .
the same comparison was carried out for the following three subpopulations of interest : acute stroke / tia , back pain , and joint pain . predicting the probability of mri utilization : 10year time horizon in an effort to further understand mri utilization , the nonimplant matched cohort was used to measure the percent of patients with icds who needed an mri over the 4year period.(2009 2012 ) this survival data
were then fitted with exponential functions to forecast a range of best fit scenarios , as measured by the coefficient of determination , out to 10 years .
a total of 97,150,333 patients from the truven health marketscan research databases were identified as meeting the initial inclusion criteria .
for the 1 ) icd implant cohort , a total of 12,615 patients had continuous health plan enrollment in the calendar year 2012 and a record of an icd implant for that entire calendar year .
for the 2 ) nonimplant cohort , a total of 13,112,933 patients had continuous health plan enrollment in 20092012 without a record of any cardiac or contraindicated mri implant or related monitoring codes during the entire 4year time period .
after 1:1 matching , the final sample was a total of 18,770 with 9,385 patients in each cohort .
patient demographics and comorbid conditions in the matched cohorts are shown in tables 1 and 2 . since
direct matching was used for age , gender , and type of plan , distributions were virtually equal across cohorts . over 70% in each cohort were 60 years of age or older and 78% male .
medicare and commercial insurance were distributed fairly equally , with 53% being medicare and 47% commercial .
the highest concentration of patients by region occurred in the north central ( 30% ) and south ( 34% ) .
all standardized differences for demographics and comorbid conditions were < 0.01 , except for region .
patient demographics after matching cdhp : consumer driven health plans ; epo : exclusive provider organization ; hdhp : high deductible health plan ; hmo : health maintenance organization ; icd : implantable cardioverter defibrillator ; pos : point of service ; ppo : preferred provider organization .
comorbid conditions after matching gerd : gastroesophageal reflux disease ; mi : myocardial infarction ; nec : not elsewhere classified ; tia : transient ischemic attack . after matching ,
icd patients had significantly less imaging per patient compared to the nonimplant cohort ( 4.3 6.10 sd vs. 5.6 7.87 sd , p < 0.0001 ) .
icd patients had significantly less mri ( 0.23 0.70 sd vs. 0.00 0.08 sd , p < 0.0001 ) than the nonimplant cohort .
when evaluating the breakdown of procedures by imaging modality , there was a lower utilization of all imaging among icd patients , with the most marked differences in mri / mra ( 2,121 nonimplant vs. 37 icd ) , xray and fluoroscopy ( 25,956 nonimplant vs. 19,577 icd ) , and ultrasound ( 16,543 nonimplant vs. 13,692 icd ) ( fig .
2b ) . among those patients of each 9385 cohort , who had an mri , the most frequently occurring mri was of the brain ( 29% nonimplant vs. 30% icd )
. table 3 shows the number and percent of mris for each cohort by body area .
a : total number of procedures for each cohort by radiology category .
icd : implantable cardioverter defibrillator ; ct : computed tomography ; cta : computed tomography angiography ; mri : magnetic resonance imaging ; mra : magnetic resonance angiogram . mri / mra scans by body area includes two instances of the same subcategory of mri on the same day , causing that mri to only be counted once previously .
table 4 depicts the overall differences in imaging utilization between icd and nonimplant patients across the three subpopulations : stroke / tia , back pain , and joint pain . among patients with records of stroke / tia ( icd 5% , nonimplant 4% ) and accompanying diagnostic imaging , 44% of nonimplant patients underwent mri vs. 1% of icd patients ( p < 0.0001 ) ( fig .
3a ) and nonimplant patients had more imaging tests overall ( 4.1 2.47 sd vs. 3.2 2.16 sd , p < 0.0001 ) . among patients with records of back pain and accompanying diagnostic imaging ,
3b ) , and nonimplant patients had more imaging tests overall ( 2.5 2.80 sd vs. 2.0 2.04 sd , p = 0.0003 ) . by comparison ,
patients with records of back pain and icds underwent a statistically significantly larger volume of ct and cta ( 32% ) as compared to the nonimplant cohort ( 21% ) ( p = 0.0011 ) . among patients with records of joint pain and accompanying diagnostic imaging , 17% of nonimplant patients underwent mri vs. 0.1% of icd patients
3c ) , and nonimplant patients had more imaging tests overall ( 2.5 2.77 sd vs. 2.1 1.89 sd , p < 0.0001 ) .
similar to the back pain subgroup , patients with joint pain records and icds underwent ct and cta more often ( 19% ) than patients with joint pain in the nonimplant cohort ( 16% ) .
ct : computed tomography ; cta : computed tomography angiography ; mri : magnetic resonance imaging ; mra : magnetic resonance angiogram
.
a : percentage of patients with stroke / tia event by radiology type .
icd : implantable cardioverter defibrillator ; ct : computed tomography ; cta : computed tomography angiography ; mri : magnetic resonance imaging ; mra : magnetic resonance angiogram .
the proportion of nonimplant patients who received an mri or mra at 1 , 2 , 3 , and 4 years and projected to 10 years are shown in fig .
4 . these icdindicated patients had a projected mri or mra utilization of between 53% and 64% within 10 years .
the black line represents the proportion of icdindicated patients who received an mri or mra at 1 , 2 , 3 , and 4 years .
the lines extending after year 4 show two projections , which are high and low estimates of utilization .
mri : magnetic resonance imaging ; mra : magnetic resonance angiogram ; icd : implantable cardioverter defibrillator .
these findings of minimal utilization of mris among icd patients suggest continued reluctance to perform mris in those patients and an unmet need for mris , yet this practice conflicts with the current trend toward greater use of complex imaging .
the volume of patients with icds is growing , and for much of the last decade medicare part b spending on complex scanning methods , including mri , rose an average 17% per year .
this indicates a spending pattern that is nearly twice that of spending on ultrasound , radiography , and other standard imaging procedures.2 mri volume flattened somewhat middecade,25 following implementation of the deficit reduction act in 2007,26 but the overall trajectory is upward.1 according to a recent report from the medicare payment advisory committee , the number of brain mris per 1000 medicare beneficiaries rose to 75 in 2012 , up from 44 in 2000 .
likewise , the number of " other " mris jumped to 129 per 1000 in 2012 , versus 58 in 2000 .
further evidence of the growing role of mris comes from appropriateness criteria from the american college of radiology , which are evidencedbased guidelines designed to help imaging decisionmaking .
the appropriateness criteria consistently rank mri as an appropriate diagnostic tool for a wide range of musculoskeletal , neurologic , cardiac , and other conditions.5 in the case of low back pain , for example , mri is highly rated as a preferred modality , ranking an " 8 " out of a possible " 9 " for patients with a suspicion of cancer , infection , or immunosuppression , or in patients with lowvelocity trauma , osteoporosis , focal and/or progressive deficit , prolonged symptom duration , or greater than 70 years of age . by comparison , for this same indication
, use of a ct scan is rated " 6 , " which suggests this approach " may be appropriate . " similarly , for pain in the hip joint , an mri without contrast is rated a " 9 " for patients who are radiograph negative , equivocal , or nondiagnostic , and have suspected osseous or surrounding softtissue abnormality , excluding osteoid osteoma . a ct scan for this indication is rated " 2 , " which translates as " usually not appropriate . "
given the evidencedbased importance of mri as a valued diagnostic tool , its minimal use in icd patients is a concern .
our study revealed this same pattern of sharply different mri / mra utilization among the three matched subpopulations of interest : acute stroke / tia , back pain , and joint pain . at the time of this analysis , mrconditional icds were not available in the u.s . , but our finding of an unmet need for imaging in patients with icds is similar to results from a european study where conditional icds have been available for a few years .
a study of 51 european heart rhythm association centers by marinskis et al27 focused on mris in patients with icds , and 65.8% reported never performing mri on nonmrconditional icd recipients .
our results indicate that despite the growing literature regarding the safety of mri in the setting of implanted legacy icds,19 widespread adaptation of safety protocols has not occurred .
in the course of evaluating a protocol for safely imaging icd patients , a prospective study conducted 555 mris in 438 patients .
they found devices of three patients reverted to backup programming mode and decreases in right ventricular ( rv ) sensing , as well as atrial , right and left ventricular lead impedances .
interrogations at 6 months showed decreased rv sensing , decreased rv lead impedance , increased rv capture threshold , and decreased battery voltage .
it is important to note that none of the reported changes required device revision or reprogramming.19 the magnasafe registry reported on 500 patients with an icd who have had a nonthoracic mri .
they report that no deaths , generator or lead failures , loss of capture , or ventricular arrhythmias occurred and found that one or more clinically relevant device parameter changes occurred in 29% of icd patients .
the generator of one icd was later replaced due to inappropriate activation of tachytherapy during the mri.28 the hesitation to adopt such safety protocols is partially attributable to the current lack of an fdaapproved mrconditional icd and medicare coverage restrictions regarding mri scans in patients with icds .
fda and cms will review and revise their mri coverage policy ; however , substantial safety data will understandably be needed .
an important outcome of our study is that more than half , 53%64% , of icdindicated patients are projected to require mri within a decade , a result that is consistent with previous research.4 kalin and stanton4 reported that the combination of greater mri use and more patients with icds coupled with expanded medicare coverage leads to a projected range from 50% to 75% of icd patients needing an mri over the lifetime of the device .
this study adds to the literature , as it had sizeable cohorts to highlight the nominal use of mris in patients with icds , reflecting ongoing safety concerns.13 moreover , this research indicates the need for mrconditionally safe icds and appropriate protocols that will increase the likelihood that mris can be performed safely in individuals implanted with these devices . currently , there is a growing body of research on careful use of mris in patients implanted with icds.11 , 19 , 29 van der graaf et al29 describe the status of mri and implantable electronic devices , including icds , and report on four ongoing clinical trials studying mrconditional pacing devices .
the european society of cardiology ( esc ) on cardiac pacing and cardiac resynchronization therapy ( crt ) recently published guidelines that suggest that mri can be safely performed in patients with icds if strict safety conditions are met.30 these guidelines represent a major shift in the previously accepted standard that patients with a pacemaker or icd should not undergo mri.29
there are several important limitations to consider .
first , although data sources were large and contemporary , variables were based on medical claims designed for billing purposes , and unidentified confounders may be present , which could affect the precision of the prediction model .
second , we are unable to ascertain indication for imaging , which could help generate precise estimates of likelihood of need or mri based on comorbidities , or clarify conditions or indications in which nonmri alternatives could be suitable .
third , findings may not be generalizable to other countries or nonfee for service healthcare systems , which may have lower rates of imaging utilization .
finally , patient outcomes related to receiving mri versus not could not be determined from this claims analysis . in conclusion ,
mri utilization is lower in icd patients compared to nonimplant patients , and disparities are seen in access to mri among the three subgroups of interest .
one in 25 icd patients would have qualified for imaging for a recorded stroke / tia , yet less than 1% received mri for this indication .
we project that 53%64% of icd patients are likely to need an mri over a 10year time horizon , highlighting the importance of mrconditional icds for this patient population . | purposeto examine imaging utilization in a matched cohort of patients with and without implantable cardioverter defibrillators ( icd ) and to project magnetic resonance imaging ( mri ) utilization over a 10year period.materials and methodsthe truven health marketscan commercial claims and medicare supplemental health insurance claims data were used to identify patients with continuous health plan enrollment in 20092012 .
patients with icds were identified using icd9 and cpt codes , and matched to patients with the same demographic and comorbidity profile , but no record of device implantation .
diagnostic imaging utilization was compared across the matched cohorts , in total , by imaging categories , and in subpopulations of stroke , back pain , and joint pain .
mri use in the nonimplant group over the 4year period was extrapolated out to 10 years for icdindicated patients.resultsa cohort of 18,770 matched patients were identified ; average age 65.5 13.38 and 21.9% female .
icd patients had significantly less mri imaging ( 0.23 0.70 sd vs. 0.00 0.08 sd , p < 0.0001 ) than nonimplant patients . among patients with records of stroke / transient ischemic attack ( tia )
( icd 5% , nonimplant 4% ) and accompanying diagnostic imaging , 44% of nonimplant patients underwent mri vs. 1% of icd patients ( p < 0.0001 ) .
forecast models estimated that 53% to 64% of icdeligible patients may require an mri within 10 years.conclusionmri utilization is lower in icd patients compared to nonimplant patients , yet the burden of incident stroke / tia , back , and joint pain suggests an unmet need for mrconditional devices . j. magn .
reson .
imaging 2016;43:115127 . |
blood samples were collected during postmortem examination of 313 red deer and 211 roe deer shot during the 2010 and 2011 hunting seasons .
the 524 samples were randomly collected during october december from 35 hunting estates in 4 of the 5 provinces in southern belgium ( figure 1 ) . the animals sex ; age ; body condition ; and macroscopic aspects of hooves , mucosae , and internal organs were recorded .
igg against the recombinant nucleoprotein of the emerging sbv was detected by using an elisa kit ( i d screen schmallenberg virus indirect , version 1 ; id.vet innovative diagnostics , montpellier , france ) .
results are expressed as percentages of the reference signal yielded by the positive control serum ; serologic status is defined as negative ( < 60% ) , doubtful ( 60%70% ) , or positive ( > 70% ) . neutralizing antibodies against sbv
were sought as described ( 3 ) in subsets of roe deer serum ( igg - negative and igg - positive according to elisa ) , and a linear relationship between percentages and reciprocal neutralizing titers was found .
in addition , necropsies were performed on 22 fetuses and 5 newborn red deer fawns ; brain samples were tested for sbv genomic rna and cellular -actin transcripts by reverse transcription quantitative pcr ( 3 ) .
contingency tables were analyzed by using analysis to detect associations between seroconversion and species , sex , age , sampling location , and sampling date .
location of 4 provinces in southeast belgium ( shaded ) where 524 wild cervids ( 313 red deer and 211 roe deer ) were killed during hunting seasons 2010 and 2011 and sampled .
seroprevelance for schmallenberg virus is shown for each of the 225 deer killed in 2011 .
all 299 serum samples collected during the fall of 2010 were negative for igg against sbv .
however , among the 225 samples from deer killed in 2011 , seroprevalence was 43.1% ( 95% ci 36.6%49.6% ) .
no significant association was found between species and seroconversion : 40.5% ( 95% ci 31.6%49.5% ) among red deer and 45.9% ( 95% ci 36.5%55.2% ) among roe deer ; p = 0.42 . acquired immunity against sbv was thus already high , suggesting that sbv had quickly spread since its emergence 250 km northeast during late summer 2011 .
a significant association between month of sampling and seroconversion was detected for both deer species ( p = 0.0016 and 0.0083 for red and roe deer , respectively ) .
seroprevalence increased during weeks 4050 of 2011 : for red deer , 20.0% ( 95% ci 8.3%31.7% ) in october , 52.6% ( 95% ci 36.8%68.5% ) in november , and 54.6% ( 95% ci 37.6%71.5% ) in december and for roe deer , 34.0% ( 95% ci 20.5%47.6% ) in october , 49.1% ( 95% ci 35.6%62.5% ) in november , and 88.9% ( 95% ci 68.4%100% ) in december , thus suggesting that the virus had circulated in the areas sampled until at least mid - november ( figure 2 ) .
frequency distribution of the results yielded by indirect elisa for detecting igg targeting recombinant nucleoprotein of emerging schmallenberg virus in serum samples collected from 116 red deer and 109 roe deer in southeast belgium during the fall of 2011 .
results are expressed as percentages of the reference signal yielded by the positive control serum .
serologic status is defined as negative ( < 60% ) , doubtful ( 60%70% ) , or positive ( > 70% ) .
this late circulation of virus might be surprising because biting midges of the genus culicoides , which reportedly transmit sbv ( 4 ) , are not usually active during cold months .
however , during fall 2011 , temperatures in the region were substantially higher than normal ( 5 ) and thus compatible with persistent wild - ruminant exposure to biting midges until mid - december .
no association was found between seroconversion and sex of the deer ( p = 0.71 and 0.85 for red and roe deer , respectively ) , age ( p = 0.99 and 0.24 ) , and location of sampling ( p = 0.47 and 0.23 ) .
these results suggest a similar level of exposure to infected vectors and a similar degree of susceptibility to infection among all animals in the study area ( 13,058 km ) . in most animals that had been found dead ,
gross lesions were consistent with trauma ( e.g. , fractures , hematomas , hemoperitoneum / thorax , ruptured spleen ) suggestive of impact against a vehicle .
no fetus or newborn showed morphologic alterations of the neck , trunk , or limbs suggestive of arthrogryposis .
no macroscopic abnormalities were seen in the cerebral cortex , cerebellum , and spinal cord .
all -actin positive samples of these 27 fetuses and newborns remained negative for sbv rna .
sbv infects wild cervid populations , and infected insect vectors were homogeneously distributed over southern belgium in the fall of 2011 .
emergence probably took place in 2011 . however , because seroprevalence was already 20% in red deer and 34% in roe deer during october and because our results show that the proportion of the infected population increased exponentially during october december , we suggest that the virus began circulating months earlier than the currently believed august / september ( 3 ) .
we recently showed that among the fetuses of pregnant cows that were infected after the establishment of the first placentome , 28% were infected and that an arthrogryposis / hydranencephaly syndrome follows if transplacental virus transmission occurs before fetuses are immunocompetent ( 6 ) .
for this study , no feedback from forest rangers , no macroscopic observations , and no pcr results suggested transplacental contamination .
however , aborted fetuses and stillborn and distorted nonviable newborn fawns are almost impossible to collect in the wild ( quickly eaten by scavengers ) , and the absence of sbv - specific genetic material or morphologic alterations at necropsy are not evidence of noninfection . therefore , no objective facts confirm or refute transplacental transfer .
because the virus can infect the fetus only after the first placentome has developed and because roe deer embryos remain in diapause until january ( 7 ) , it is unlikely that sbv has contaminated many roe deer fetuses . because 90% of roe deer were already sbv positive in mid - december and because circulating antibodies prevent transplacental passage of the closest phylogenetic relatives of the virus ( 8)
, we suggest that roe deer fetuses were probably not infected . on the contrary , red deer mate in september , and the first functional placentome
is established by the end of october ( 9 ) ; thus , 80% of pregnant red deer were exposed to the emerging virus when placental transfer was possible . furthermore
, 35% of pregnant red deer were infected in november and december , i.e. , after establishment of the first placentome and before the fetus was immunocompetent . by extrapolating the rate of transplacental infection among cattle ( 6 )
, we determined that 28% of these pregnancies resulted in contamination of the fetus , i.e. , 10% , of expected pregnancies . because unrestricted replication of simbu - like viruses occurs in the central nervous system of immunologically incompetent ruminant fetuses ( 1 ) , which can lead to a typical arthrogryposis / hydranencephaly syndrome
, a 10% loss among fawns can be expected in 2012 . in the same geographic area , 5 years apart ,
2 arboviruses have emerged : bluetongue virus serotype 8 ( btv-8 ) during the summer of 2006 and sbv during the summer of 2011 . for each virus , culicoides spp .
midges function as vectors and infect sheep , goats , cattle , and red deer . although most ( > 50% ) red deer seroconverted against btv-8 , only a few ( < 3% ) roe deer sampled in the same places and at the same time were btv-8-positive ( 10 ) , which sharply contrasts with the sbv seroconversion rates reported here .
this finding invalidates the assumption that less exposure of roe deer to infected midge bites explains the almost complete absence of seroconversion against btv-8 in this species . | schmallenberg virus was detected in cattle and sheep in northwestern europe in 2011 . to determine whether wild ruminants are also susceptible , we measured antibody seroprevalence in cervids ( roe deer and red deer ) in belgium in 2010 and 2011 .
findings indicated rapid spread among these deer since virus emergence 250 km away . |
the so - called biometals ( e.g. , iron , copper , or zinc ) are known to play a fundamental role in numerous essential metabolic processes , thus being considered as essential for life .
metal ion homeostasis is maintained through highly regulated mechanisms of uptake , storage , and secretion .
a specific set of transporters functions in each cellular compartment to provide a strict balance of transport activities across their membranes .
normally , under healthy conditions , these metal ions are bound to ligands ( e.g. , transferrin , ceruloplasmin ) , and they are not found as free species . however , the release of free ionic or exchangeable zinc and copper has been reported in the synaptic cleft .
in addition , zinc is also being increasingly involved in several cellular reactions like calcium , and it has been proposed as a new class of second messenger . a loss or an abnormal metal homeostasis might cause cellular death or severe dysfunction , and it has been recognized as a triggering factor for different neurodegenerative disorders such as alzheimer 's ( ad ) , parkinson 's ( pd ) , and huntington 's ( hd ) diseases as well as amyotrophic lateral sclerosis ( als ) [ 26 ] . although the etiology of these diseases is still largely unknown , oxidative damage mediated by metals has been thought to be a significant contributor since metals such as iron , aluminum , zinc , and copper have been observed to be dysregulated and/or increased in ad brains and prone to generate a pro - oxidative environment [ 711 ] .
taking into account the great amount of information regarding the role of transition metals in cell biology , this paper will be mainly focused on the role of iron in neurodegeneration .
loss of iron may cause neurological disease , and , in opposition , its accumulation or abnormal interaction with cellular components such as proteins , lipids , or nucleic acids may also contribute to neurodegenerative disorders .
the intracellular pool of free iron , the labile iron pool ( lip ) , has been well established to modulate the expression of various proteins , including the amyloid precursor protein ( app ) [ 12 , 13 ] . in the brain , the movement of metals across the blood - brain barrier
is highly regulated , and there is no passive flux of metals from the circulation to the brain [ 1 , 14 ] .
while iron , copper , and zinc are being increasingly implicated in interactions with the major protein components of neurodegenerative diseases , this is not merely due to increased ( e.g. , toxicological ) exposure to metals but rather because of a breakdown in the homeostatic mechanisms that compartmentalize and regulate metals .
the ability of iron to accept and donate electrons can lead to the formation of reactive nitrogen and oxygen species ( the latter named ros in this paper ) which may trigger the oxidative attack of tissue components , therefore contributing to disease and perhaps aging itself [ 15 , 16 ] .
several studies in animals and humans have reported a rise in brain iron as a function of ageing [ 17 , 18 ] .
the vulnerability of the brain to abnormal iron regulation has been demonstrated by the relationship between the failure of ferroxidases , ceruloplasmin [ 19 , 20 ] , ferritin [ 18 , 21 , 22 ] , and frataxin [ 23 , 24 ] , iron accumulation ( ia ) , and the onset of neurodegenerative diseases .
the accumulation of transition metals in the nervous system is a common observation in different neurodegenerative diseases that support a role of metals in these disorders [ 25 , 26 ] .
particularly , iron homeostasis has shown to be altered [ 26 , 27 ] .
excessive iron deposition has been reported to occur in the central nervous system ( cns ) in a number of neurodegenerative pathologies such as ad , pd , als , and neuroferritinopathies , among others [ 4 , 2833 ] .
als is a neurodegenerative disorder characterized by progressive paralysis of skeletal muscles and degeneration of motor neurons in the spinal cord , brainstem , and cortex .
high levels of iron in the cns of both familial and sporadic forms of als have been reported [ 32 , 34 , 35 ] . however , neither the mechanisms underlying iron accumulation nor its complete role in the pathogenesis of the disease are clear .
neuroferritinopathies , like neurodegeneration with brain iron accumulation ( nbia ) , are defined as extrapyramidal disorders characterized by radiographic evidence of focal iron accumulation in the brain .
these diseases are progressive movement disorders caused by nucleotide insertions in exon 4 of the ferritin light chain gene .
these patients show low levels of serum ferritin and abundant spherical inclusions in the brain , skin , kidney , liver , and muscle that are positive for iron , ferritin , and ubiquitin staining . moreover ,
abnormal accumulation of iron is also considered to be involved in the pathogenesis of myelin diseases such as multiple sclerosis ( ms ) .
histochemical studies have shown that abnormal iron deposits are observed in reactive microglia , axons , neurons , and oligodendrocytes in patients with ms [ 39 , 40 ] .
indeed , ferritin levels are increased in the cns of mice with experimental autoimmune encephalomyelitis , an animal model of ms , and in the cerebrospinal fluid of ms patients [ 42 , 43 ] . since the synthesis of ferritin can reduce toxic ferrous iron ( fe ) , the elevated level of ferritin in autoimmune encephalomyelitis mice and ms patients
although iron has been demonstrated to have a potential role in many diseases of the cns , this paper will focus mainly on the information regarding the role of iron in ad .
it is well known that transition metals provoke oxidative stress by generating ros through the fenton reaction , thus causing brain lipid peroxidation and protein oxidation [ 45 , 46 ] .
interestingly , not only has iron been involved in lipid and protein oxidation but also in dna damage .
it has been shown that iron is able to oxidize dna bases , and it has been suggested that the accumulation of this transition metal observed in some neurodegenerative disorders could act by both increasing oxidative genome damage and also preventing its repair .
iron itself has been related to neurotoxicity , and its accumulation , mainly in the hippocampus and cortex , has been observed to occur before ad lesions are detectable .
moreover , it has been also demonstrated to accumulate both in ad senile plaques and in amyloid deposits in app2576 transgenic mouse model of ad .
oxidative stress is considered to be the earliest change in the pathogenesis of ad , and high levels of oxidative stress have been demonstrated to occur in the clinical precursor of ad , known as mild cognitive impairment ( mci ) [ 51 , 52 ] .
coincidently , increased iron levels were found both in the cortex and cerebellum from the preclinical ad / mci cases .
moreover , iron concentrations have been found to be increased in the bilateral hippocampus , parietal cortex , frontal white matter , putamen , caudate nucleus , thalamus , red nucleus , substantia nigra , and dentate nucleus subregions of patients with diagnosed ad and in normal elderly patients [ 53 , 54 ] .
it is important to note that these brain iron concentrations , particularly those in the parietal cortex at the early stages of ad , have been found to positively correlate with the severity of patients ' cognitive impairment .
although extensive evidence links the dysregulation of iron homeostasis and ad , relatively little is known about the resulting forms of iron that accumulate in the brain .
numerous techniques have been developed in order to characterize , locate , and quantify iron species and iron - containing compounds in ad .
for example , the use of iron fluorescence together with synchrotron x - ray absorption spectroscopy showed in situ iron accumulations containing high concentrations of ferritin and magnetite in ad brain tissue sections .
alterations in iron metabolism with age have been described , and they may involve iron uptake and release , storage , and intracellular metabolism [ 5659 ] . although some issues remain unclear , it is well known that the dyshomeostasis of brain iron metabolism is one of the initial events that trigger neuronal death in some neurodegenerative disorders [ 6063 ] .
existing evidence shows that these mechanisms may well be altered by the ageing process with increased ( ia ) in the brain as the final outcome [ 6466 ] .
age - induced ia has shown to be a consequence of the accumulation of different iron - containing molecules in different brain regions known to be particularly affected in disorders such as ad and pd [ 18 , 56 ] .
cellular studies have shown that iron is specifically accumulated in microglia and astrocytes in the cerebral cortex , cerebellum , substantia nigra , and hippocampus , and it is believed that this metal ion would be involved in the neuroinflammation observed in ad and pd .
however , one hypothesis holds that it is the blood brain barrier dysfunction that is responsible for the exudation of serum components , with iron among them .
another hypothesis with strong experimental support proposes that ia is a consequence of the dysregulation of proteins that govern metal homeostasis . among candidates
, it has been demonstrated that the iron regulatory proteins ( ireg ) participate in neuronal ia .
in addition , ireg2 knockout ( ireb2(/ ) ) mice develop ia in white matter tracts and nuclei in different brain areas and display neurodegeneration signs in purkinje cells .
mutations in the divalent metal transporter 1 ( dmt1 ) have been shown to impair iron transport and to protect rodents against neurotoxins like 6-hydroxydopamine , supporting a critical role for dmt1 in iron - mediated neurodegeneration .
mitochondrial ia , loss of iron - sulfur cluster - containing enzymes , and increased oxidative damage are known to occur in yeast and mouse frataxin - depleted mutants as well as in tissues and cell lines from friedrich 's ataxia ( frda ) patients , suggesting that frataxin may be involved in the export of iron from the mitochondria , the synthesis of iron - sulfur clusters , and/or the protection from oxidative damage .
the use of deferiprone ( dfp , a chelator in clinical use for treating iron overload ) in frda cells has been found to reduce the mitochondrial lip increased by frataxin deficiency .
a new recently reported mitochondrial ferritin ( mtft ) specifically expresses in high energy - consuming cells , including neurons .
the overexpression of mtft has been observed to lead to a cytosolic iron deficiency and to significantly prevent the alteration of iron redistribution and , consequently , neuronal toxicity induced by 6-hydrodopamine .
although the existing data clearly show a relationship between iron metabolism , aging , and neurodegeneration , more and deeper studies are needed to completely understand the role of this transition metal in the onset and progression of neurodegenerative diseases and neurological age - related disorders .
interestingly , ia , as well as oxidative stress in ad brains , has been linked to altered a deposition .
it is well known that a accumulates in senile plaques in ad , and it has also been demonstrated to participate in a positive feedback loop , where oxidative stress leads to increased a generation , and , conversely , the mechanism of a polymerization generates oxidative stress which in turn enhances a production . additionally , a has been characterized as a metalloprotein able to bind transition metals ( e.g. , zinc , iron , copper ) via 3 histidine ( positions 6 , 13 , and 14 ) and 1 tyrosine ( position 10 ) residues located in the hydrophilic n - terminal part of the peptide [ 74 , 75 ] , and in so doing a would prevent these potentially redox - active ions from causing oxidative stress . notably , the redox potential of iron is significantly attenuated by a , supporting a neuroprotective chelating role for a in ad pathogenesis [ 76 , 77 ] .
this particular feature of a could , at least in part , explain the enrichment of these transition metals in ad plaques .
it has been shown that not only ros production induces a aggregation but also its ability to bind metal ions as well .
augmented iron concentrations and oxidative stress have been found to correlate with changes in the concentration of both soluble and deposited a .
interestingly , the metal - dependent generation of ros by a may be a good target for therapeutics .
for example , chelation therapy with desferrioxamine and clioquinol ( which are iron and copper / zinc chelators , resp . ) has shown to induce clinical improvement in patients with ad [ 79 , 80 ] . moreover , coincubation of a from postmortem ad brains with metal chelators has shown to dissolve a deposits .
in addition , both animal and human studies with clioquinol have been found to reverse a deposition , improve cognition , general behavior and health , and lower plasma a levels [ 79 , 82 , 83 ] . taken together , all
these data clearly demonstrate that a deeper understanding of the metal - related mechanisms operating in neurodegenerative disorders such as ad is needed , since it may provide insights into new therapeutic approaches .
neurons have developed several mechanisms in response to oxidative injury ; one of them is the activation of signaling pathways that promote death or survival .
the extent and duration of the oxidative insult as well as the cell type injured are crucial factors in determining which pathways are activated , their prevalence , and , in consequence , the final cellular fate [ 84 , 85 ] . in this aspect , metal - induced oxidative stress has been implicated as the triggering factor of several protective and proapoptotic signaling pathways in neurons [ 7 , 86 ] .
their vulnerability to iron - induced oxidative stress has been largely demonstrated by the presence of membrane lipid peroxidation , impairment of membrane ion - motive atpases , glucose and glutamate transport , and mitochondrial function . in this
regard , several key components of signaling pathways like extracellular signal - regulated kinase ( erk ) , phosphoinositide 3-kinase ( pi3k ) , akt , and glycogen synthase kinase 3 ( gsk3 ) are activated in situ in isolated synaptic endings exposed to iron - induced oxidative injury [ 88 , 89 ] . moreover ,
several key biochemical events that are known to occur in intact neurons undergoing apoptosis ( i.e. , exposure of phosphatidylserine on the plasma membrane surface , activation of caspase-3 , mitochondrial calcium uptake , and ros accumulation ) also occur in isolated synaptosomes exposed to iron - induced oxidative stress . synapse loss ,
a key event in neurodegenerative disorders , might also involve in situ apoptotic cascades that might occur before , or independently of , neuronal death .
this assumption is supported by the appearance of degenerative morphological changes in synapses preceding amyloid deposition and neuronal degeneration .
however , mechanisms whereby apoptotic events triggered by iron - induced oxidative stress in synapses propagate to the cell body remain unknown .
some cellular signaling pathways are clearly linked to enhanced survival , while others are associated with cell death .
hence , it has been suggested that the balance between the magnitude of erk and jun kinase ( jnk ) activation is key to determining survival . while this idea is still generally accepted
, more recent evidence suggests that erk can exert apoptotic influences , and jnk can exert antiapoptotic influences during the cellular response to oxidative stress .
the presence of iron and a provokes a marked decrease in protein kinase c isoforms , reduced akt serine / threonine kinase activity , bcl-2-associated death promoter ( bad ) phosphorylation , and enhanced p38 mitogen - activated protein kinase ( mapk ) and caspase-9 and caspase-3 activation [ 9294 ] . in isolated synaptic endings , the coincubation with iron and a triggers the activation of akt and erk signaling in an oxidation - dependent manner
. the phosphorylation and subsequent inhibition of gsk3 mediated by amp - activated protein kinase ( ampk ) contributes to protecting mitochondria against iron - catalyzed oxidative stress . in ad , abnormal activation of gsk3 pathway might play an important role in neurodegeneration , and compounds such as lithium that modulate gsk3 activity have been shown to reduce a production and tau phosphorylation in app transgenic mice .
deferoxamine , a known iron chelator , has been shown to block all the proapoptotic signaling events triggered by a-fe . moreover ,
a alone has been shown not to activate proapoptotic signaling , thus demonstrating that apoptotic cell death can be only triggered by the presence of iron in vitro [ 9294 ] .
iron has been found to be required for long - term potentiation in hippocampal ca1 neurons , and it is known to participate in the stimulation of calcium release through ros produced via the fenton reaction triggering the stimulation of the erk signaling pathway .
these results support a coordinated action between iron and calcium in synaptic plasticity and raise the possibility that elevated iron levels may contribute to neuronal degeneration through excessive intracellular calcium increase caused by iron - induced oxidative stress . as previously mentioned , iron ( alone or in combination with a ) is able to activate different signaling cascades .
the activation of these signaling pathways is , in most cases , a necessary upstream event for the activation of several transcription factors ( tfs ) .
these tfs regulate the expression of specific genes that participate in cellular events such as survival or death .
nuclear factor kappa b ( nf-b ) plays crucial roles in cellular resistance to oxidants and survival .
although the knowledge of nf-b gene targets in neurons is limited , it has been demonstrated that this tf can promote their survival and regulate synaptic plasticity .
nf-b plays a central role in the induction of neuroprotective antiapoptotic gene products , such as mnsod and bcl-2 that are known to contribute to ischemic tolerance .
activation of nf-b has also been associated with increased resistance of neurons to apoptosis induced by iron exposure .
levels of p65 immunoreactivity have been reported to be increased in neurons and astrocytes associated with a plaques in the brains of ad patients , suggesting an increased nf-b activation .
exposure of cultured neurons to a or a secreted form of amyloid precursor protein ( sapp ) has shown to induce nf-b activation , thus suggesting a role for proteolytic products of app in nf-b activation in ad .
levels of nf-b activity have been reported to be increased in cholinergic neurons in the basal forebrain of ad patients .
others have established a correlation between increased nf-b activity and cox-2 gene transcription in brain regions affected in ad patients .
in addition , the inhibition of nf-b transcriptional activity results in increased vulnerability of neurons to death induced by a . hypoxia - inducible factor ( hif )
the expression of genes relevant to iron metabolism such as ceruloplasmin , transferrin receptor , transferrin , and heme - oxygenase 1 has been shown to be regulated by hif [ 108111 ] .
iron chelation therapy that reduces the size of lip has been reported to induce the activity of this tf . moreover ,
a new multifunctional nontoxic , brain permeable iron chelator , m30 , has shown to activate the hif-1alpha signaling pathway in rat primary culture of cortical cells .
m30 has also been found to increase the expression levels of the transcripts of brain - derived neurotrophic factor ( bdnf ) and growth - associated protein-43 ( gap-43 ) . in connection with ad ,
m30 has been reported to enhance the levels of phospho - akt ( ser473 ) and phospho - gsk3 ( ser9 ) and to attenuate tau phosphorylation .
ap-1 is known to participate in critical cellular processes such as proliferation , differentiation , and survival .
strong evidence supports the involvement of ap-1 in oxidative stress signaling in neurons . in rat
upstream of ap-1 , c - jun - n - terminal kinase ( jnk ) , and p38 ( two stress - related mapk ) has also shown to be activated by increases in the intracellular levels of oxidants [ 114116 ] .
c - jun , a component of ap-1 , has been recently attributed a dual role : it is believed to mediate neurodegeneration and cell death as well as participate in plasticity and repair mechanisms .
moreover , upregulation of iron regulatory proteins and dmt-1 isoforms after neuronal injury induced by kainate has been found to be modulated by ap-1 in rat hippocampus .
activation of jnk signaling in neurons has shown to increase stress resistance and to extend life span by the activation of the forkhead transcription factor ( foxo ) family in drosophila .
recent studies have suggested that mst1 mediates oxidative stress - induced neuronal cell death by phosphorylating the transcription factor foxo3 at serine 207 , a site that is conserved in other foxo family members [ 119 , 120 ] .
all these data support the hypothesis that foxo signaling extends life span via amelioration of oxidative damage and mitochondrial dysfunction in neurons . however , to date
, there is no link between foxo signaling and iron - induced oxidative stress in neurons .
understanding signal transduction networks that participate in iron - induced neurotoxicity constitutes one essential objective for the discovery of new drugs and treatments aimed at the improvement and delay of ad symptoms .
in this paper , we summarize the latest knowledge about the role of iron in neurodegeneration processes .
iron , a redox - active transition metal , has been proposed as an important contributing factor to the neuropathology of alzheimer 's disease . even though increasing evidence points towards iron participation in oxidative stress events and protein aggregation , we are still far from totally comprehending the role of this transition metal in the onset and progression of neurodegenerative disorders ( figure 1 ) .
the advancement in this field will be fundamental for the establishment of new therapies intended for neuronal protection during iron mismanagement conditions . | the accumulation of transition metals ( e.g. , copper , zinc , and iron ) and the dysregulation of their metabolism are a hallmark in the pathogenesis of several neurodegenerative diseases . this paper will be focused on the mechanism of neurotoxicity mediated by iron .
this metal progressively accumulates in the brain both during normal aging and neurodegenerative processes .
high iron concentrations in the brain have been consistently observed in alzheimer 's ( ad ) and parkinson 's ( pd ) diseases . in this connection
, metalloneurobiology has become extremely important in establishing the role of iron in the onset and progression of neurodegenerative diseases .
neurons have developed several protective mechanisms against oxidative stress , among them , the activation of cellular signaling pathways .
the final response will depend on the identity , intensity , and persistence of the oxidative insult .
the characterization of the mechanisms mediating the effects of iron - induced increase in neuronal dysfunction and death is central to understanding the pathology of a number of neurodegenerative disorders . |
the era of interventional cardiology began with the performance of the first successful balloon angioplasty by andreas gruentzig in 1977 .
the data from the european society of cardiology reveal that the total numbers of coronary angiographies increased from 684,000 in 1992 to 2,238,000 in 2004 ( from 1,250 to 3,930 per one million inhabitants ) .
percutaneous coronary interventions ( pcis ) and coronary stenting procedures increased from 184,000 to 885,000 ( from 335 to 1,550 ) and from 3,000 to 770,000 ( from 5 to 1,350 per one million inhabitants ) , respectively .
these procedures were adopted most aggressively in germany , with 712,000 angiographies ( 8,600 per one million inhabitants ) , 249,000 angioplasties ( 3,000 per one million inhabitants ) and 200,000 stenting procedures ( 2,400 per one million inhabitants ) in 2004 .
data from the new york pci registry reveal that the rate of mortality following pci procedure has declined from 0.90% in 1997 to 0.58% in 2003 , which represents a reduction of 36% ( p < 0.001 ) .
although minor infections have been reported , there are no published cases of splenic abscesses that have ruptured into the abdomen .
splenic abscesses continue to be a rare clinical entity . the diagnosis of fulminant intraabdominal infection which has ruptured into the abdomen is often overlooked because of its rarity and its misleading clinical presentations . although rare , this case report should be an eye - opener towards ensuring meticulous antiseptic precautions prior to pcis .
a 40-year - old asian male was referred from the cardiology unit of another hospital to our emergency department with pain in the left upper abdomen and generalized malaise that had persisted for 3 days .
he denied any fever , chest pain , altered bowel habits , nausea or vomiting .
he had undergone coronary angioplasty for an inferior wall myocardial infarction in another institution 5 days before presentation and was taking cardiac medications .
he had been taking 5 mg of glibenclamide twice daily for 3 years , which poorly controlled his type 2 diabetes mellitus .
he had a history of smoking 20 cigarettes per day for the last 7 years and had consumed bootleg liquor daily for more than 7 years . upon examination , the patient was conscious and alert with a pulse of 88 bpm , a blood pressure of 100/70 mm hg , a respiratory rate of 18/min and a temperature of 37c .
initial laboratory tests included the following : hemoglobin 13.2 g / dl , total white blood cell count 8,900/mm ( differential count : neutrophils 82% , lymphocytes 16% , eosinophils 2% ) , erythrocyte sedimentation rate 32 mm / h , platelet count 185 10/mm , blood urea nitrogen 32 mg / dl , serum creatinine 0.9 mg / dl , random blood sugar 406 mg / dl , sodium 136 mmol / l , potassium 4.8 mmol / l , serum bilirubin 1.3 mg / dl , direct bilirubin 0.6 mg / dl , serum glutamic oxaloacetic transaminase / glutamic - pyruvic transaminase ratio 84/28 iu , alkaline phosphatase 240 iu ( 0140 ) , total protein 6.4 g/100 ml , serum albumin 3.1 g/100 ml , serum amylase 30 u / l and serum lipase 10 u / l . the following serologies were reported as negative : widal test , hepatitis b surface antigen , hepatitis c , weil 's antibody , brucella agglutination titer , human immunodeficiency virus 1 and 11 , antinuclear antibodies , and anti - double - stranded dna antibody and venereal disease research laboratory test was non - reactive .
the patient 's serum alpha lipoprotein was 10 ng / dl ( 07.2 ) and his serum carcinoembryonic antigen concentration was 2.44 ng / dl ( 03.4 ) .
chest x - ray postero - anterior view and plain x - ray of the abdomen in the erect position were normal .
the patient was prescribed broad - spectrum antibiotics , and his cardiac medications were continued except for aspirin which was withheld temporarily .
his blood sugar was controlled with 16 u of regular insulin 3 times daily . on day 4 of admission ,
acetaminophen ( 650 mg by mouth ) provided temporary relief from fever which lasted for up to 6 h. the abdominal pain was increasing in intensity .
thus , the laboratory tests were repeated and reported the following : hemoglobin 13 g / dl , total white cell count 20,500/mm ( differential count : neutrophils 90% , lymphocytes 10% ) , erythrocyte sedimentation rate 96 mm / h and platelet count 140 10/mm .
renal function tests were normal . blood culture and urine cultures were determined to be negative . because of a negative abdominal ultrasound , we proceeded to abdominal computed tomography ( ct ) scan , which revealed a ruptured splenic abscess ( fig .
an emergency laparotomy was performed , and approximately 500 ml of purulent fluid was drained .
culturing and sensitivity of this fluid revealed a multidrug - resistant strain of klebsiella pneumoniae that was sensitive to meropenem .
therefore , 1 g of meropenem was administered 3 times daily , and the patient 's spleen was salvaged .
the total numbers of coronary angiographies , pcis and coronary stenting procedures increased significantly from 1992 to 2004 .
data from the new york pci registry reveal that the rate of mortality following pci has declined from 0.90% in 1997 ( 13 ) to 0.58% in 2003 ( 14 ) , which represents a reduction of 36% ( p < 0.001 ) .
stathopoulos et al . reported that the overall pci complication rate was lower during the final 4 years of their study ( 20032006 ) than in the first 4 years ( 19992002 ) . to explore the reasons for readmission after pci , yost et al .
analyzed data submitted prospectively to the american college of cardiology 's national cardiovascular data registry on elective , urgent and emergent pcis performed from january 1 , 2007 to april 12 , 2010 . of the 4,523 patients who underwent pcis during the study period , 222 ( 4.9% ) required readmission within 30 days for the following causes : reasons unrelated to index admission or pci ( 41.4% ) , cardiac reasons unrelated to pci ( 39.2% ) , pci - related complications ( 13.5% ) and non - cardiac reasons related to the index admission ( 5.9% ) . infectious complications occurring after percutaneous transluminal coronary angioplasty ( ptca ) are extremely rare . in a study of 147 patients undergoing blood culture testing immediately after pci , 26 ( 17.7% ) had a detectable bacteremia 12 h after the procedure .
another 12% of patients had positive blood cultures during the next 12 h with femoral sheaths still in situ .
there were no associated clinical sequelae ; this finding emphasizes the need for maximum sterility during pci procedures to avoid infective complications and stent infection . whereas cardiac catheterization carries a negligible risk of bacteremia , pci bacteremia occurs frequently ( in approximately 30% of cases ) ; however , clinical sequelae occur rarely in such cases .
pci has a greater bacteremic potential , probably because of the length of the procedure and the repeated insertion of interventional devices into the vascular system .
reports of infectious complications , such as myocardial abscesses directly related to percutaneous transluminal angioplasty , are extremely rare .
there have only been a few reported cases of groin infection following femoral artery repuncture for a coronary angioplasty . a case of bacterial pericarditis developed 1 week after coronary angioplasty and stent implantation , two cases of septic arthritis of the knee secondary to probable femoral endarteritis , and another with infected hematoma of the groin .
standard aseptic techniques may be inadequate if early repuncture is performed or if an indwelling line is utilized .
prophylactic antibiotics should be considered in these cases , although their usefulness has not been formally demonstrated so far .
the following risk factors may predispose a patient to infectious sequelae following ptca : early reuse of the initial puncture site , prolonged retention of the femoral sheath , bleeding or hematoma at the femoral sheath insertion site and vascular complications such as pseudoaneurysms .
the clinician should be aware of these risks because a patient may develop these potentially serious complications after ptca .
this is the first case report of a splenic abscess that perforated and produced a subdiaphragmatic collection .
the proposed mechanism of the splenic abscess in this patient is a splenic infarction caused by dislodged cholesterol emboli during ptca , followed by a secondary infection that became septic .
the absence of fever and the normal laboratory findings at presentation also support this hypothesis .
the incidence of splenic abscesses is currently 0.140.7% [ 13 , 14 ] , with a reported mortality of 047% .
the diagnosis is often overlooked because of its rarity and misleading clinical presentation , as well as the presence of predisposing conditions that obscure its presentation . even in the most recently published series diagnosis
, splenic abscesses have been diagnosed more frequently because of the increasing number of immunocompromised patients and the widespread use of diagnostic imaging modalities , such as ct and ultrasonography .
although staphylococcus aureus and streptococcus pyogenes are most frequently reported as the causes of splenic abscesses , several studies have investigated the significant role of enterobacteriaceae [ 11 , 12 ] . in a study by chang et al .
in taiwan , k. pneumoniae was the most common cause of splenic abscesses [ 11 , 13 ] .
there are increasing numbers of case reports of fungal and mycobacterial abscesses in the spleen , especially in immunosuppressed patients .
the following five etiological variants can predispose a patient to developing a splenic abscess : trauma , metastatic infection , rheumatologic disorders , contiguous infection and immunosuppression .
abdominal ct is currently the standard for diagnosing a splenic abscess with a sensitivity of 100% .
the characteristic ct findings for splenic abscesses are low - density lesions that fail to enhance with iv contrast .
some recent case series have reported good success rates with ct - guided percutaneous drainage , but the success depends on the radiological findings .
this technique can be effective and is superior to splenectomy in selected cases because it preserves the spleen , which has an important role in the immune system .
percutaneous , radiologically guided drainage may be suitable in some cases , but splenectomy with appropriate antibiotics is the definitive treatment .
some recent case series have reported positive outcomes with the non - operative management of splenic abscesses .
however , splenectomy is the most reliable way to remove the abscess and may be necessary in more severe cases .
due to advances in interventional cardiology techniques , the number of people undergoing these procedures has increased overwhelmingly . however , the number of drug - resistant organisms is also increasing .
we strongly advocate antibiotic prophylaxis in patients who are at a high risk of infection or who are immunocompromised .
the case described here involved an infection of the spleen , which is a rare site for abscess formation , and further substantiates the importance of antibiotic prophylaxis .
| the incidence of splenic abscesses is currently 0.140.7% with a reported mortality of 047% .
the diagnosis of splenic abscess which has ruptured into the abdomen is often overlooked because of its rarity and its misleading clinical presentations .
percutaneous coronary interventions ( pcis ) and coronary stenting procedures increased from 184,000 to 885,000 ( from 335 to 1,550 ) and from 3,000 to 770,000 ( from 5 to 1,350 per one million inhabitants ) , respectively .
a 40-year - old asian male presented to our emergency department with upper abdominal pain 5 days after a percutaneous transluminal coronary angioplasty .
clinical examination raised the possibilities of acute pancreatitis and intraabdominal sepsis .
an initial ultrasound of the abdomen and blood tests were negative .
a computed tomography scan of the abdomen revealed a splenic abscess that had ruptured into the abdomen .
pus culture revealed a multidrug - resistant strain of klebsiella pneumoniae that was sensitive to meropenem .
the patient recovered quickly after open surgical drainage and antibiotic therapy .
as this is the second case of splenic abscess and the first case report of a ruptured splenic abscess following a pci , it will be rational to administer a short course of antibiotic prophylaxis for high - risk immunocompromised patients who are undergoing percutaneous transluminal coronary intervention . |
it has been reported that there are more than 285 million subscribers to cell - phone services in the us in 2009 , which is more than a twofold increase from 110 million in 2000 .
this dramatic rise of cell - phone usage has also led to concerns over their possible adverse effects on human health .
while cell phones may exert both thermal and nonthermal influences on the user , the latter has been under particular scrutiny .
cell phones transmit pulsed , radiofrequency radiation from their antennas and from circuit elements inside [ 2 , 3 ] .
because cell phones are held against the head , many studies have examined the risk that these phones pose on the brain , including cognitive function [ 4 , 5 ] and sleep .
concerns over microwave radiation effects have mainly spurred research into the relation between cell - phone usage and brain tumours , including acoustic neuroma , glioma , and meningioma .
while some results have shown significant associations with several types of brain tumours [ 7 , 8 ] , most have shown a null association [ 911 ] . however , it is not clear if cell - phone usage is related to cardiovascular diseases ( cvd ) .
some occupational studies have shown that chronic exposure to low - intensity electromagnetic field ( emf ) is associated with increased risk of cardiac arrhythmias , acute myocardial infarction , cardiovascular mortality , and alteration of diurnal variation of blood pressure [ 13 , 14 ] , but others have not found such an association [ 1518 ] .
hypertension is a common vascular condition that is a strong and independent risk factor for cvd .
a german study in 1998 found that cell - phone usage was associated with an increase in resting blood pressure .
the independent expert group on mobile phones hypothesized that radiation from the cell phone may possibly affect the cardiovascular centers of the brainstem or the carotid body receptors involved in the control of blood pressure . in contrast , studies from former soviet union reported that exposure to radiofrequency radiation might reduce blood pressure and heart rate alterations and low - dose emf therapy might be beneficial in treating hypertension and angina pectoris .
given the dramatic increase in cell - phone usage in the past decade , it would be of interest to further investigate the effect of using cell phones on hypertension . in this context
, we examined the association between mobile - phone usage and occurrence of hypertension in a large , representative sample of us adults .
the data for this study is derived from the 2008 national health interview survey ( nhis ) .
the details of the study design , questionnaire , and methods are available online . in brief , nhis is a multistage probability sample of the civilian , noninstitutionalized population of us adults .
blacks , hispanics , and asians were oversampled to provide stable estimates of these groups .
information on household telephone status was obtained for 12,597 households that include one civilian adult or child .
the current study is based on the sample adult core component of the nhis survey , administered by in - person interview to randomly selected civilian adults , aged 18 years . of the 21,781 adults
interviewed , after excluding participants who were pregnant ( n = 221 ) , those with missing information on cell - phone status ( n = 90 ) , and on certain other variables included in the multivariable analysis ( n = 335 ) , 21,135 were available for the current analysis .
the main outcome of interest in the current study was physician - diagnosed hypertension ascertained by an affirmative response to the question , have you ever been told by a doctor or other health professional that you had hypertension , also called high blood pressure ?
cell - phone use was assessed from the following question asked to the survey respondent from each family : do you or anyone in your family have a working cell phone ?
participants who had no working cell phone in the family were classified as cell - phone nonusers . of those living in a household with both landline and cell phone , those who received very few or no calls on cell phones and mostly on landlines ,
were classified as predominantly landline users ; those who received some on cell phone and some on landline phones were classified as dual users of cell phone and landline ; those who received all or almost all calls on cell phones were classified as predominantly cell - phone users .
information on demographic factors , socioeconomic characteristics , lifestyle characteristics , and health status were obtained through a standardized questionnaire .
we examined the association between cell - phone use and hypertension in two logistic regression models : ( 1 ) the age- ( years ) sex - adjusted model and ( 2 ) the multivariable - adjusted model , additionally adjusting for race / ethnicity , cigarette smoking , alcohol intake , body mass index ( bmi ) , physical activity , education , and landline use .
we then examined the association between cell - phone use and hypertension in subgroups of age , gender , race / ethnicity and bmi categories .
linear trends were tested using categories of cell phone use as an ordinal variable in the corresponding logistic regression model .
interactions between cell - phone use and other covariates including age , gender , race / ethnicity , bmi were examined by introducing cross - product interaction terms between cell - phone use and the covariate examined , one at a time , in the corresponding multivariable model .
likelihood ratio tests were used to assess the statistical significance of an interaction between cell phone use and a covariate .
all analyses were weighted to account for the complex survey design and survey nonresponse using sudaan ( version 8.0 ; research triangle institute , research triangle park , nc ) and sas ( version 9.2 ; sas institute , cary , nc ) software .
table 1 shows the characteristics of the study participants by cell - phone usage status .
compared to subjects who were cell - phone nonusers , predominantly cell - phone users were younger , more likely to be current drinkers , or to be educated at a level higher than high school , less likely to be current smokers or physically active .
further , predominantly landline users were older , more likely to be females or non - hispanic whites .
the group with the highest prevalence was the predominantly landline users followed by cell - phone nonusers , dual users , and predominantly cell - phone users respectively .
increasing categories of cell - phone usage was found to be inversely associated with hypertension in both the age- , sex - adjusted model ( p trend < .0001 ) , and the multivariable - adjusted model ( p trend = .005 ) .
tables 3 , 4 , 5 , and 6 show the association between cell - phone use and hypertension in subgroups of age , gender , race / ethnicity , and bmi categories .
similar to the main findings in table 2 , an inverse association was observed between cell - phone use and hypertension within subgroups of age , gender , race / ethnicity , and bmi .
although there was no statistically significant interaction by age ( p interaction = .99 ) , gender ( p interaction = .98 ) , race / ethnicity ( p interaction = .24 ) , and bmi ( p interaction = .07 ) , the association was stronger in women , those aged < 60 years , whites , and those with bmi < 25 kg / m .
in a contemporary sample of us adults , we found that cell - phone usage was inversely associated with self - reported hypertension independent of age , sex , race / ethnicity , smoking , alcohol consumption , bmi , education , physical activity , and landline use .
this inverse association between cell - phone usage and hypertension was found to be stronger in women , those aged < 60 years , whites , and those with bmi < 25 kg / m .
this is the first study to examine the association between cell - phone use and hypertension in a population - based sample of us adults . in the current study , we used self - reported hypertension to define the presence of hypertension , since nhis did not have measured blood pressure .
we believe that this is an important study limitation , since recent estimates from the us national health and nutritional examination surveys suggest that nearly 22% of truly hypertensive subjects are unaware of their condition . this lack of blood pressure measurement may have resulted in outcome misclassification .
since hypertension status was assessed independently of a person 's cell - phone use , we believe that this misclassification is more likely to be nondifferential and likely to underestimate a true association .
however , we can not entirely rule out the possibility that our findings are overestimate ; that is , there is actually no protective association between cell - phone use and hypertension if there were no bias .
few experimental studies have examined the association between cell - phone usage and blood pressure [ 21 , 25 ] .
noted a significant increase in systolic and diastolic bp in a small group of ten healthy volunteers exposed to emf from a global system for satellite communications ( gsm ) cell phone compared with placebo exposure .
reported significantly higher levels of systolic and diastolic blood pressure in a group of 100 broadcasting and tv station operators exposed to emf .
previous studies examining the relation between occupational emf exposure and cardiovascular diseases have shown mixed results . while majority of the studies have shown a null association
[ 11 , 1518 ] , some have shown a positive association [ 12 , 26 ] , and one has shown a protective association .
savitz et al . reported a positive association between occupational emf exposure and cardiovascular mortality in a large cohort of 138,903 male electric utility workers from five us companies .
sastre et al . found that exposure to intermittent 60-hz magnetic fields reversibly reduces the normal variability of the heart rate in laboratory studies of volunteers .
solenova et al . reported lower levels of all - cause and cardiovascular mortality in tv workers exposed to emf . in the current study ,
it is possible that the effects of cell - phone usage could reduce bp due to an increase in parasympathetic activity and reduction in sympathetic activity originating in the brainstem .
another possibility is that cell phones increase and sustain the social networks of the users , reducing stress and establishing greater connectedness of the users with their communities .
this has been previously reported to be protectively associated with cardiovascular disease mortality [ 29 , 30 ] , and following this , we hypothesize that it may reduce the risk of hypertension as well .
finally , it is possible that our findings are due to chance . there is a need for longitudinal studies to examine the effect of cell - phone usage on longitudinal changes in blood pressure and hypertension development to refute or validate our findings .
future studies should also examine if there are differential effects for different mobile technologies such as gsm and code division multiple access ( cdma ) phones .
the strengths of our study include a large sample size and availability of information on potential confounders .
first , as discussed above , our assessment of cell - phone usage and hypertension though self - reported questionnaire data may have resulted in misclassification bias .
second , a measure of blood pressure as a continuous variable would have greatly increased the impact of this study .
we recommend that future studies examining the association between cell - phone use and hypertension should include measured blood pressure in addition to self - reported hypertension diagnosis to confirm if our findings are true .
third , we do not have information on emf exposure from other sources ( including cordless phones , radio , television , and microwave oven ) that could potentially confound the association between cell phone and hypertension .
fifth , while the large sample size allows for correction of potential confounders , it is possible that cell - phone use is different in categories of age , gender , race / ethnicity , and physical activity all of which are known to influence the prevalence of hypertension
. finally , the cross - sectional nature of the study limits any temporal relationship to be ascertained . in conclusion
, we found that cell - phone usage was inversely associated with self - reported hypertension in a nationally representative sample of us adults .
future research should investigate this relationship in prospective studies to provide more insight into the association .
the guarantor , a. shankar , accepts full responsibility for the work and/or the conduct of the study , had access to the data , and controlled the decision to publish . | background .
cell - phone usage has increased dramatically over the last decade , along with a rising public concern over the health effects of using this device .
the association between cell - phone usage and hypertension has not been examined before .
methods .
we analysed data from 21,135 adults aged 18 years who participated in the 2008 national health interview survey .
based on reported cell - phone use , participants were categorized as cell - phone nonusers , predominantly landline users , dual users of cell phone and landline , and predominantly cell - phone users .
the main outcome of interest was self - reported physician - diagnosed hypertension ( n = 6,793 ) .
results .
43.5% of the participants were cell - phone nonusers , while 13.8% were predominantly cell - phone users .
we found that cell - phone use was inversely associated with hypertension , independent of age , sex , race / ethnicity , smoking , alcohol consumption , education , body mass index ( bmi ) , and physical activity .
compared to cell - phone nonusers , the multivariable odds ratio ( 95% confidence interval ) of hypertension was 0.86 ( 0.750.98 , p trend = .005 ) among predominantly cell - phone users .
this inverse association between cell - phone use and hypertension was stronger in women , those aged < 60 years , whites , and those with bmi < 25 kg / m2 .
conclusion .
we found that cell - phone usage was protectively associated with self - reported hypertension in a nationally representative sample of us adults . |
osteogenesis imperfecta ( oi ) or brittle bone disease considered as a genetically heterogeneous connective tissue disorder which is characterized by bone fragility and thus repeated bone fractures .
consequently skeletal deformities may arise as a result of reduced bone mass and frequent bone fractures .
the incidence of oi varies between 6 and 20 in 100,000 newborns and its prevalence is 4 - 10 in 100,000 individuals . according to sillence , oi is classified based on clinical , genetically , and radiographic features in four groups [ table 1 ] .
type ii is the lethal form of oi , even during the prenatal and perinatal period .
patients with type iv of oi are those who show moderate to severe phenotypes and do not fit into any of the first three categories . some of them demonstrate heterogeneous features , which are not even according to sillence classification .
hence , patients affected by these types do not demonstrate di and blue sclera ; oi types v - viii are called syndromes resembling oi . a reduction in collagen type i synthesis results in type i of oi , while quantitative or qualitative alterations in type i collagen leads to types ii , iii , and iv . therefore all tissues rich in type i collagen may be affected in these patients as a result of impaired collagen synthesis . some clinical signs and symptoms
may arise including di , blue sclera , hearing loss , growth deficiency , and joint laxity .
dentinogenesis imperfecta ( di ) has been reported in more than 50% of patients suffering from oi .
di is a hereditary disorder of dentin formation , which exhibits mostly an autosomal dominant ( ad ) trait .
although di type i is the oral manifestation of deficient collagen formation and is mainly associated with oi , di types ii and iii are related to a mutation in the dentin sialophophosphoprotein ( dspp ) gene .
primary and permanent dentitions are both involved in di type i , though primary teeth are more severely affected .
the most common clinical manifestations in teeth with di are teeth discoloration ( gray / opalescent , yellow / brown ) and enamel fracture .
radiographically , the crowns are bulbous as a result of significant cervical constriction , roots are short , and the dentin is defective although normal enamel in thickness and density exists .
normal mantle dentin , irregular circum pulpal dentin with abnormal dentinal tubules , and some atubular areas are evident in the histological study .
midface hypoplasia , cl iii malocclusion , unilateral or bilateral crossbite , ectopic eruption of the first or second permanent molars and missing of second premolar are more prevalent in these patients . however , their dental development is age appropriate . according to brustein
the mortality rate during infancy period was 70 - 80% and showed a reduction during puberty .
however , women after menopause and men after the fifth decade of their life exhibit exacerbated symptoms .
iv administration of pamidronate for these patients inhibits osteoclast activity by osteoclast apoptosis and preventing osteoclast formation .
this will lead to increased bone thickness and bone strength and finally decreased fracture incidence . because of the numerous and severe skeletal and dental abnormalities occurring with oi , dental treatment is challenging for both patient and dentist . being informed about the possible complexities encountering during the dental treatment for these children will help the dentist to manage their oral or dental problems .
therefore , the aim of this study was to describe the characteristics of oi , its oral and dental manifestations from a clinical , radiographic , and pathologic point of view by presenting a case .
a 5-year - old iranian boy was referred to the pediatric department of dental school , shahid beheshti university of medical sciences in 2010 . according to the medical records
taking skeletal radiography at that time revealed that also a femoral fracture occurred at birth .
the patient 's family history showed that his parents ( mother , 27 and father 35 years old ) were not related . based on his medical and radiographic results ,
the diagnosis of oi was made , and intravenous pamidronate for every 4 months followed by daily use of calcium syrup was prescribed . following numerous bone fractures due to poor muscle coordination at the toddler age and the bone fragility in these patients ( two and eight times in the left and right femur , respectively ) intramedulary rods were inserted within the right and left femurs at the age of 2.5 and 3.5 years accordingly .
figure 1 shows the left femur with the rod inside and the bowing in the right femur at the age 5 , as intramedulary was removed due to the successful recovery . bone deformity and the inserted rod in right and left femoral bone ,
clinical examinations demonstrated limited mobility , short stature , bowing of the long bones , shortness of the neck , protuberance of the sternum , and relative macrocephaly . due to these clinical signs and symptoms and the absence of hearing loss , according to oi classification [ table 1 ] ,
the patient was diagnosed with type iv of oi . in the frontal view , the patient 's face seemed symmetrical and hypoplasia of the maxilla and thus the cl iii profile was evident [ figure 2 ] .
features of osteogenesis imperfecta types i - iv sagittal view of patient 's face intraoral view .
( d ) enamel disintegration on the right upper canine ( a lateral view ) intraoral examinations showed yellow / brown discoloration in all primary teeth , with severe attrition on the lingual and vertical cracks on the labial side of the upper and lower anterior teeth .
moreover , enamel disintegration was evident on the buccal surface of the canines [ figure 3b d ] . owing to the uncooperative behavior of the patient all the required dental treatments were performed under general anesthesia .
the following treatment procedure was carried out prior to his attendance in our clinic : ( a ) extraction of 64 , 74 , and 84 .
( b ) pulp therapy of 54 , 55 , 63 , 65 , 75 , and 85 restored with stainless steel crowns or composite resins .
( c ) composite resin restoration for 53 , 63 , and 73 [ figure 4 ] .
strict recommendations have been made by the operating team , for immediate space maintenance in the extraction areas .
however , the patient was referred 4 months after the extensive dental treatment to the pediatric department of shahid beheshti university of medical sciences ( tehran , iran ) . at the first visit a arch space available
was evaluated and two band and loops were placed in the lower jaw to preserve the space of two extracted first primary molars .
the upper jaw received a bonded facemask to stimulate the maxillary growth [ figure 5 ] .
radiographically , no pulp obliteration was observed and the bulbous appearance of the posterior teeth was masked by the full coverage of the crowns .
note the hypotrophic dentin and hypoplastic enamel on the first permanent molars the patient received a face mask to stimulate the maxillary growth by the age of 6 , the mandibular central incisors and first permanent molars appeared in the mouth . despite the lingual eruption of incisors
however , enamel hypoplasia was evident in first permanent molars [ figure 3c ] , which was restored with composite resins immediately after eruption .
the loose primary central incisors were removed and placed in a formalin 10% solution ( merck , germany ) for 24 hours . then the teeth were prepared for histological examination under a steromicroscope ( x400 ) ( nikon , usa ) : following the decalcifying procedure by formic acid 10% for 6 weeks , the samples were sectioned , stained by hematoxilin eosin and observed by a light microscope .
stereomicroscope evaluations exhibited a few disorganized tubular structures with an increased caliber , which was more prominent in circumpulpal dentin compared to the mantle dentin .
the dentino - enamel junction ( dej ) mostly demonstrated an irregular scalloped appearance , although in some locations a straight smooth dej was also obvious .
in certain regions in the middle third of the sectioned teeth the dentin was lost .
active odontoblasts in pulpal tissue were attributable to the normal physiologic exfoliative stage [ figure 6a d ] . microscopic view of the sectioned tooth , ( a ) periodic irregular dentinogenesis , ( b ) dentin detachment , ( c ) dentinogenesis with a globular pattern , ( d ) interglobular pattern
oi is a rare hereditary entity , diagnosed by disordered collagen formation and bone fragility .
the disease is usually inherited as an ad trait , although recently mutations are also reported in some cases .
our patient showed no family history of oi , so it may be assumed that it may be an ad trait with an incomplete penetrance or a new genetic mutation .
however , because of the distinctive signs and symptoms , the early diagnosis of oi was made and further genetic assessments were unnecessary .
deformity and bowing in the long bones particularly in femur was obvious . according to sillence ,
although types iv and i of oi are similar in some ways , this patient did not experience prolonged bleeding , bone pain or heart problems , the less extraskeletal abnormalities , and more severe osseous involvements are investigative for type iv of oi . all patients suffering from oi display short statures as observed in this case .
relative macrocephaly due to the short size of the body and mid - face hypoplasia with a normal mandibular length resulting in posterior cross bite was similar to that described by oconnell and marini .
they described that the existing malocclusion in these patients is attributed to the disfigured dentoalveolar complex and the abnormal location , size , and weight of the head .
schwartz and tsipouras reported a prevalence of 75% for cl iii malocclusion and 65% for posterior crossbite in oi patients .
dentiogenesis imperfecta ( di ) has been noted in 80% of oi types iii and iv . according to di classifications
this patient was assigned to di type i , as the other two types of di merely demonstrate dental signs and do not accompany with any type of oi .
intraoral examination of this boy revealed yellow / brown discoloration of the primary teeth and a normal appearance in permanent anterior teeth .
this is consistent with the fact that primary dentition is usually more affected by di than permanent dentition .
moreover , yellow / brown discoloration of affected primary teeth is more prevalent than gray discoloration , stated by majorana et al .
however , as extensive attrition and enamel fractures occurred more frequently in yellow / brown primary teeth than the gray discolored teeth , it is concluded that gray discoloration has a better prognosis .
the patient showed vertical cracks and enamel detachments on the buccal or lingual side of the primary teeth .
children with di experience vertical enamel fractures leading to exposure of the soft underneath dentin and consequently premature severe attrition . preserving the normal vertical dimension of these patients in primary and mixed dentition is only possible if the posterior teeth are completely covered by stainless steel crowns . as a result
, all the existing posterior primary molars in this case were restored with stainless steel crowns .
lindau et al . reported an anomaly in the structure of the enamel of patients suffering from di .
they found a more irregular pattern of enamel in affected primary teeth compared to permanent dentition .
however , they stated that the extent of the dental involvement in primary dentition seems not to be a major predictor for the severity of di in permanent teeth and there is no association between the enamel morphology and a certain type of oi .
norgen and malgren explained that permanent teeth of children with oi may display normal clinical and radiographic appearance but a histological defective dentin exists .
as all posterior primary teeth had received full coverage treatment , the bulbous shape of the crown was not discernible .
first permanent molars exhibited hypotrophic enamel and broad , large root canals . according to schwartz and
tsipouras the rate of pulpal obliteration appears to be different in various types of oi .
for instance , teeth in oi type iii seem to show an accelerated pulp obliteration compared to other types .
pulpal obliteration may merely occur subsequent to root completion ( 2 - 4 years after tooth eruption ) ; therefore it is possible that the root canal of the first permanent teeth in this case will become obliterated in the future .
other dental anomalies such as ectopic eruption and missing ( 10% ) are more common in oi . we found no missing or ectopic eruption in this case . however , at the time of evaluation the patient was too young to detect any ectopic eruption .
structural evaluations by means of a stereomicroscope revealed a periodic irregular dentinogenesis with abundant globular and interglobular calcifications throughout the dentin . a decline in the number , an increase in the diameter of dentinal tubules , and obvious dentin disorganization were observed .
this was in line with the findings of teixeira et al . however , shafer reported a lower number of dentinal tubules with larger calibers .
rios et al . stated that while an absence of the tubules was present in all samples , the tubules diameters varied among different subjects with di ( either reduction or increase ) .
the dej appeared to have an irregular scalloping and in some areas a straight smooth pattern in the examined dental sections .
the disarrangement in the dej may be considered as a secondary effect of defective predentin in adequate induction of preameloblasts .
low wear resistance of affected teeth is related to the absence of dej scalloping described by schwartz et al .
however , the abnormal dentinal structure has been suggested to be the main reason for enamel breakage .
similarly , levin noticed severe attrition in di - affected teeth with a normal scalloping of dej .
they concluded that the enamel detachments principally occurred because of the defective molecular collagen or some impaired matrix molecules .
we observed numerous enamel disintegrations in anterior primary teeth , although a scalloping pattern of dej existed microscopically in several regions of these teeth .
it is essential for clinicians to be familiar with different medical and oral aspects of oi .
children with oi should be examined as soon as teeth are erupted to prevent loss of tooth structure and seen frequently to restore any new enamel fracture and maintain their oral health . | this paper presents a case with dentinogenesis imperfecta ( di ) associated with osteogenesis imperfecta .
systemic and dental manifestations of oi and its medical and dental treatments are discussed in this paper . a 5-year - old child with the diagnosis of oi
was referred to the dental school of shaid beheshti university of medical sciences . on clinical examination
yellow / brown discoloration of primary teeth with the attrition of the exposed dentin and class iii malocclusion was observed .
enamel of first permanent molars was hypoplastic .
radiographic examinations confirmed the diagnosis of di .
a histological study was performed on one of the exfoliating teeth , which showed abnormal dentin .
primary teeth with di were more severely affected compared to permanent teeth ; enamel disintegration occurred in teeth with di , demonstrating the need for restricts recalls for these patients . |
eri-1(mg366 ) ; nrde-2(gg091 ) , ( yy158 ) nrde-3(gg066),(yy174 ) ggis1[nrde-3p3xflaggfpnrde-3 ] , ( yy178 ) eri-1(mg366 ) ; ggis1 , ( yy186 ) nrde-2 ( gg091 ) , ( yy197 ) nrde-2(gg091 ) ; axis36[pes-10gfp ] , ( yy229 ) nrde-2(gg091 ) ; ggis1 , ( yy258 ) nrde-2(gg091 ) ; nrde-3(gg066 ) , ( yy298 ) nrde-3(gg066 ) ; ggis24[nrde-3p3xflaggfpnrde-3*nls ] , ( yy323 ) eri-1(mg366 ) ; nrde-2(gg091 ) ; unc-119(ed3 ) ; ggis28[nrde-3p3xflaggfpnrde-2 ] , ( yy346 ) , nrde-2(gg091 ) ; ggis28 , ( yy353 ) nrde-2(gg091 ) ; ggis1 ; ggis36[nrde-3p3xhagfpnrde-2 ] , ( yy363 ) nrde-3(gg066 ) ; nrde-2(gg091 ) ; ggis28 , ( gr1373 ) eri-1(mg366 ) , ( wm27 ) rde-1(ne219 ) , ( dr1099 ) ama-1(m118m526 ) , ( mt309 ) lin-15ab(n309 ) , ( jh103 ) axis36 .
worm culture conditions , plasmid construction , feeding rnai assay , lir-1 rnai assay , rna in situ hybridization , fluorescence imaging , cdna preparation , nrde-2/3 co - precipitation , rna immunoprecipitation ( rip ) , rna isolation , quantitative real time pcr , chromatin immunoprecipitation ( chip ) , and nuclear run - on ( nro ) assays are described in detail in methods .
| eukaryotic cells express a wide variety of endogenous small regulatory rnas that regulate heterochromatin formation , developmental timing , defense against parasitic nucleic acids , and genome rearrangement .
many small regulatory rnas are thought to function in nuclei 1 - 2 .
for instance , in plants and fungi sirnas associate with nascent transcripts and direct chromatin and/or dna modifications 1 - 2 .
to further understand the biological roles of small regulatory rnas , we conducted a genetic screen to identify factors required for rna interference ( rnai ) in c. elegans nuclei 3 .
here we show that nrde-2 encodes an evolutionarily conserved protein that is required for small interfering ( si)rna - mediated silencing in nuclei .
nrde-2 associates with the argonaute protein nrde-3 within nuclei and is recruited by nrde-3/sirna complexes to nascent transcripts that have been targeted by rnai .
we find that nuclear - localized sirnas direct a nrde-2-dependent silencing of pre - mrnas 3 to sites of rnai , a nrde-2-dependent accumulation of rna polymerase ( rnap ) ii at genomic loci targeted by rnai , and nrde-2-dependent decreases in rnap ii occupancy and rnap ii transcriptional activity 3 to sites of rnai .
these results define nrde-2 as a component of the nuclear rnai machinery and demonstrate that metazoan sirnas can silence nuclear - localized rnas co - transcriptionally .
in addition , these results establish a novel mode of rnap ii regulation ; sirna - directed recruitment of nrde factors that inhibit rnap ii during the elongation phase of transcription . |
extramedullary relapse ( emr ) is a recurrence of leukemia in sites other than the bone marrow , and it exhibits a relatively rare presentation of relapse of acute leukemia ( 1 ) .
however , the exact incidence of emr remains unclear because the reported incidence has varied in previous studies . about 3% - 5% of patients
are estimated to have an emr in acute myeloid leukemia ( aml ) at some point in their lives ( 2 - 4 ) . in acute lymphoid leukemia ( all ) , approximately 20% will experience relapse .
the cumulative risk of relapse is 11% in a 10- year period , including emr and bone marrow relapse ( bmr ) ( 5 - 7 ) .
emr remains an important cause of treatment failure among patients with acute leukemia ( 3 ) .
the prognosis of emr is poor with a median survival of only a few months ( 3 , 4 ) .
the clinical characteristics and radiologic findings of emr are limited because of its low incidence ( 1 , 8) .
however , emr cases have been increasingly reported in the last few years ( 9 ) .
we aimed to describe the demographic and clinical features , radiologic findings , and clinical outcomes for children diagnosed with emr in acute leukemia .
our institutional review board approved this retrospective study and waived the requirement for an informed consent .
we used our computerized hospital information system to identify all children under 16 years old who were diagnosed with emr with acute leukemia presenting from january 1 , 2009 to december 31 , 2011 at our hospital .
the diagnosis of emr was established by tissue biopsy in six cases , examination of the csf in seven cases , and clinical course and radiologic findings in residual cases .
all patients who presented with emr underwent a bm biopsy and aspiration for the evaluation of a possible coincident bmr within four ( 1 - 7 ) days after emr diagnosis .
patients past medical records were also reviewed for age , gender , white blood cell count ( wbc ) , french - american - british ( fab ) morphology , cytogenetics , and the presence of extramedullary disease ( emd ) at initial diagnosis of acute leukemia .
time to and site of emr , radiologic findings , and clinical course were also reviewed .
the number of emr among acute leukemia patients was 22 ( ( m : f = 14:8 ; mean age , 7.30 ( 2.1 - 15.7 ) years and initial diagnosis of acute leukemia , 1.7 - 15 years ) ) . among the patients , 14 had all and 8 patients had aml .
median wbc initially diagnosed as acute leukemia was 80.0 10/l ( range 3 - 475.5 10/l ) . among the 22 patients ,
14 had fab l1 all , 5 had fab m2 aml , and each of the 3 remaining had fab m0 , m4 , and m7 , respectively .
leukemic cells of four patients had a normal karyotype , five had t(8 : 21 ) , two had t(9 : 22 ) , and one each had t(1 : 18 ) , t(17 : 19 ) , t(5 : 10 ) , t(2 : 12 ) , and t(1 : 17 ) , respectively
. only one of the patients had emd at the first diagnosis ( site of emd : bilateral ocular / temporalis muscles , paranasal sinuses , skull base , nasal cavity , and both mastoid spaces ) .
emr occurred with a median of 30.2 ( 4.4 - 117.5 ) months from the initial diagnosis of acute leukemia and 22.7 ( 2 - 116.5 ) months from complete remission ( cr ) .
the disease - related features of the 22 patients with emr are summarized in table 1 .
bilateral ocular / temporalis muscles , paranasal sinuses , skull base , nasal cavity , and both mastoid spaces table 2 summarizes the site distribution of the emr .
the site of emr included the following : csf ( n = 7 ) , brain ( n = 2 ) , brachial and sacral plexus ( n = 2 ) , bone ( n = 6 ) , kidney ( n = 4 ) , muscle ( n = 2 ) , liver ( n = 2 ) , lung ( n = 1 ) , pleura ( n = 1 ) , pancreas ( n = 1 ) , intestine ( n = 1 ) , peritoneum and omentum ( n = 1 ) , parotid gland ( n = 1 ) , lymph node ( n = 2 ) , breast ( n = 1 ) , ovary and uterus ( n = 1 ) , skin ( n = 1 ) , and testis ( n = 2 ) . the central nervous system ( cns ) , bone , and kidney were the most common sites of emr . among the 22 patients , a single site of emr was found in 13 patients and multiple sites in 9 patients . for the 5 patients with bone involvement , sites included the mastoid and temporal bone , sacrum , ulna , radius , and humerus .
the sites of emr were predominantly the csf and kidney in all ( 29.2% and 16.7% , respectively ) and the cns except for csf and bone in aml ( 28.6% and 42.8% , respectively ) .
clinical symptoms included soft tissue or scrotal swelling ( n = 5 ) , pain ( n = 6 ) , fever ( n = 4 ) , headache with vomiting (
n = 2 ) , and no symptoms ( n = 5 ) . among the seven patients with csf relapse , five patients had no significant symptoms with the detection of csf relapse during a routine follow - up .
all patients had symptoms , such as swelling , pain , and fever . only one case of emr with massive pancreatic involvement showed abnormality in blood chemistry that had led to it being mistaken for pancreatitis . among the 11 patients with symptoms of swelling and pain that involved the area , 4 patients ( 36.4% ) had additional relapsed sites without presenting symptoms . at the time of emr , examination of the bm aspirate did not show any evidence of leukemic recurrence in 10 ( 45.5% ) patients .
seven ( 31.8% ) patients had bmr at the time of emr and five ( 22.7% ) patients had it 1 - 7.2 months ( median , 3.4 months ) later ( table 3 ) .
the emr of cns was hypointense or isointense on the t1-weighted magnetic resonance ( mr ) images and isointense or hyperintense on the t2-weighted mr images .
the structures were enhanced homogenously after the injection of contrast media ( figures 1 and 2 ) .
a , axial t2 and b , axial t1 showing a round mass in the periphery of the right cerebellum with surrounding edema ( arrows ) .
c , axial t1 and d , coronal t1 with gadolinium reveal a homogenous enhancement of lesion ( arrows ) .
bone and muscle lesions showed isointense and mildly hyperintense to normal muscle on t1- and t2- weighted mr images ( figure 3 ) . among the five cases of bone emr involvement
one case depicted mr images only . in the head and neck regions , emr was presented with a bulging mass formation .
hepatic or renal involvement appeared as a well - defined solid mass , which could be indistinguishable from an abscess or lymphoma ( figure 4 ) .
most emr revealed discrete hypodense solid masses on the ct with a typically homogeneous enhancement ( figure 4 ) .
a , axial t2 and b , axial t1 showing a large bulging mass on the left mastoid ( arrow ) and similar lesions involving the skull base and orbits ( arrowheads ) .
c , axial t1 and d , coronal t1 with gadolinium reveal a relatively homogenous enhancement with a central non - enhancing area ( arrow , arrowheads ) .
enhanced ct showing a hypodense mass of mesentery root and the pancreas head ( arrows ) ( a ) , and hypodense oval lesions on the right kidney ( arrowheads ) ( b ) .
longitudinal scan through the scrotum showing an ill - defined hypoechoic mass posteriorly ( arrows ) ( a ) and doppler sonography showing hypervascular flow signals ( b ) .
seven emr patients with concurrent bmr showed a relatively grave clinical course , and three of the seven expired . among the 22 patients with emr , 5 patients expired with a median of 15.1 ( 2.2 - 39 ) weeks .
the cr from the emr occurred with a median of 10.3 ( 2 - 20 ) weeks .
the cr from the bmr occurred with a median of 10.3 ( 2 - 20 ) weeks .
the number of emr among acute leukemia patients was 22 ( ( m : f = 14:8 ; mean age , 7.30 ( 2.1 - 15.7 ) years and initial diagnosis of acute leukemia , 1.7 - 15 years ) ) . among the patients , 14 had all and 8 patients had aml .
median wbc initially diagnosed as acute leukemia was 80.0 10/l ( range 3 - 475.5 10/l ) . among the 22 patients ,
14 had fab l1 all , 5 had fab m2 aml , and each of the 3 remaining had fab m0 , m4 , and m7 , respectively .
leukemic cells of four patients had a normal karyotype , five had t(8 : 21 ) , two had t(9 : 22 ) , and one each had t(1 : 18 ) , t(17 : 19 ) , t(5 : 10 ) , t(2 : 12 ) , and t(1 : 17 ) , respectively
. only one of the patients had emd at the first diagnosis ( site of emd : bilateral ocular / temporalis muscles , paranasal sinuses , skull base , nasal cavity , and both mastoid spaces ) .
emr occurred with a median of 30.2 ( 4.4 - 117.5 ) months from the initial diagnosis of acute leukemia and 22.7 ( 2 - 116.5 ) months from complete remission ( cr ) .
the disease - related features of the 22 patients with emr are summarized in table 1 .
. bilateral ocular / temporalis muscles , paranasal sinuses , skull base , nasal cavity , and both mastoid spaces
the site of emr included the following : csf ( n = 7 ) , brain ( n = 2 ) , brachial and sacral plexus ( n = 2 ) , bone ( n = 6 ) , kidney ( n = 4 ) , muscle ( n = 2 ) , liver ( n = 2 ) , lung ( n = 1 ) , pleura ( n = 1 ) , pancreas ( n = 1 ) , intestine ( n = 1 ) , peritoneum and omentum ( n = 1 ) , parotid gland ( n = 1 ) , lymph node ( n = 2 ) , breast ( n = 1 ) , ovary and uterus ( n = 1 ) , skin ( n = 1 ) , and testis ( n = 2 ) . the central nervous system ( cns ) , bone , and kidney were the most common sites of emr . among the 22 patients , a single site of emr was found in 13 patients and multiple sites in 9 patients . for the 5 patients with bone involvement , sites included the mastoid and temporal bone , sacrum , ulna , radius , and humerus
. the sites of emr were predominantly the csf and kidney in all ( 29.2% and 16.7% , respectively ) and the cns except for csf and bone in aml ( 28.6% and 42.8% , respectively ) .
clinical symptoms included soft tissue or scrotal swelling ( n = 5 ) , pain ( n = 6 ) , fever ( n = 4 ) , headache with vomiting ( n = 2 ) , and no symptoms ( n = 5 ) . among the seven patients with csf relapse , five patients had no significant symptoms with the detection of csf relapse during a routine follow - up .
all patients had symptoms , such as swelling , pain , and fever . only one case of emr with massive pancreatic involvement showed abnormality in blood chemistry that had led to it being mistaken for pancreatitis . among the 11 patients with symptoms of swelling and pain that involved the area , 4 patients ( 36.4% ) had additional relapsed sites without presenting symptoms . at the time of emr , examination of the bm aspirate did not show any evidence of leukemic recurrence in 10 ( 45.5% ) patients .
seven ( 31.8% ) patients had bmr at the time of emr and five ( 22.7% ) patients had it 1 - 7.2 months ( median , 3.4 months ) later ( table 3 ) .
the emr of cns was hypointense or isointense on the t1-weighted magnetic resonance ( mr ) images and isointense or hyperintense on the t2-weighted mr images .
the structures were enhanced homogenously after the injection of contrast media ( figures 1 and 2 ) .
a , axial t2 and b , axial t1 showing a round mass in the periphery of the right cerebellum with surrounding edema ( arrows ) .
c , axial t1 and d , coronal t1 with gadolinium reveal a homogenous enhancement of lesion ( arrows ) .
bone and muscle lesions showed isointense and mildly hyperintense to normal muscle on t1- and t2- weighted mr images ( figure 3 ) . among the five cases of bone emr involvement ,
one case depicted mr images only . in the head and neck regions , emr was presented with a bulging mass formation .
hepatic or renal involvement appeared as a well - defined solid mass , which could be indistinguishable from an abscess or lymphoma ( figure 4 ) .
most emr revealed discrete hypodense solid masses on the ct with a typically homogeneous enhancement ( figure 4 ) .
a , axial t2 and b , axial t1 showing a large bulging mass on the left mastoid ( arrow ) and similar lesions involving the skull base and orbits ( arrowheads ) .
c , axial t1 and d , coronal t1 with gadolinium reveal a relatively homogenous enhancement with a central non - enhancing area ( arrow , arrowheads ) . enhanced ct showing a hypodense mass of mesentery root and the pancreas head ( arrows ) ( a ) , and hypodense oval lesions on the right kidney ( arrowheads ) ( b ) .
longitudinal scan through the scrotum showing an ill - defined hypoechoic mass posteriorly ( arrows ) ( a ) and doppler sonography showing hypervascular flow signals ( b ) .
seven emr patients with concurrent bmr showed a relatively grave clinical course , and three of the seven expired . among the 22 patients with emr , 5 patients expired with a median of 15.1 ( 2.2 - 39 ) weeks .
the cr from the emr occurred with a median of 10.3 ( 2 - 20 ) weeks .
the cr from the bmr occurred with a median of 10.3 ( 2 - 20 ) weeks .
although the prognostic significance and management of emr in acute leukemia is controversial because of its low incidence , emr reports have demonstrated several meaningful results ( 3 - 5 , 9 - 12 ) .
factors predisposing emr to aml include an abnormal karyotype ( e.g. , t(8 ; 21 ) , inv(16 ) and t(11q23 ) ) fab type m4 , five morphologies , and strong male predominance ( 3 , 11 ) .
additional emr risk factors for all include male sex , age < 1 year or 10 years at diagnosis , wbc count of > 50,000/ l , t - cell lineage , and cytogenic abnormalities such as t(9 ; 22 ) ( 4 , 5 , 12 ) . in our study , patients with emr had a significantly higher incidence of t(8 ; 21 ) cytogenetics .
however , unlike previous studies , we found no significant correlation between initial emd at first diagnosis and emr . in our series ,
however , the possibility of initial emd can not be completely excluded because the entire body screening is not usually performed at the initial work - up for acute leukemia except for symptomatic lesions .
the most common sites of emr are the cns and skin in aml and cns and testis in all ( 4 , 9 , 10 ) . the most frequent site of emr in our patients was the cns , but different results were found in the predominant sites of emr patients with aml and all .
the sites of emr were predominantly cns except for csf and bone in aml ( 29.2% and 16.7% , respectively ) and csf and kidney in all ( 28.6% and 42.8% , respectively ) .
emr may herald bmr ( within 1 to 12 months ) , and thus a prompt emr diagnosis is necessary ( 5 , 13 ) .
our series revealed a similar finding and the mean interval until bmr was 3.4 ( 1 - 7.2 ) months .
the prognosis was better known among patients with isolated emr than among patients with concurrent bmr or later ( 14 , 15 ) . in our series , emr patients had concurrent bmr in 31.8% and exhibited a relatively grave clinical course .
in addition , the radiologic features of emr are usually similar to those of lymphoma , infection , and secondary neoplasm ( 1 , 16 , 17 ) .
however , emr should be considered whenever a mass is newly detected in a patient with a history of acute leukemia .
first , this work was a retrospective study and was based on a small number of patients .
second , we did not have pathologic confirmation of emr in every case . in conclusion
, emr appears to have a predilection for aml in cns except for csf and bone and all in csf and kidney .
patients with emr had a significantly high incidence of t(8 : 21 ) cytogenetics and fab m2 and l1 morphologies .
knowledge of the potential sites of emr and their risk factors may be helpful in the early diagnosis of relapse and planning for therapy .
additional studies with greater samples may be needed to define the risk factors and prognostic indicators .
in conclusion , emr appears to have a predilection for aml in cns except for csf and bone and all in csf and kidney .
patients with emr had a significantly high incidence of t(8 : 21 ) cytogenetics and fab m2 and l1 morphologies .
knowledge of the potential sites of emr and their risk factors may be helpful in the early diagnosis of relapse and planning for therapy .
additional studies with greater samples may be needed to define the risk factors and prognostic indicators . | backgroundextramedullary relapse ( emr ) is a recurrence of leukemia in sites other than the bone marrow , and it exhibits a relatively rare presentation of relapse of acute leukemia .
however , emr is an important cause of treatment failure among patients with acute leukemia .
therefore , early detection of these relapses may improve the prognosis.objectivesto describe the disease - related demographic and clinical features and radiologic findings for children diagnosed with emr in acute leukemia.patients and methodsthe study was based on 22 children ( m : f = 14 : 8 ; mean age 7.30 ( 2.1 - 15.7 ) years ) with 8 acute myeloid leukemia ( aml ) and 14 acute lymphoid leukemia ( all ) who had experienced an emr .
age , gender , clinical symptoms , initial extramedullary disease ( emd ) , french - american - british ( fab ) morphology , cytogenetics , time to and site of emr , concurrent bone marrow relapse ( bmr ) , radiologic findings , and outcomes were evaluated.resultsno definite relationship was found between initial emd and emr .
a predilection for aml to relapse in the central nervous system ( cns ) , except for the csf and bone , and for all to relapse in the csf and kidney seemed to occur .
patients with emr had a significantly higher incidence of t(8 : 21 ) cytogenetics and fab m2 and l1 morphologies .
emr accompanied with concurrent bmr occurred in 31.8% of the patients , who exhibited a relatively grave clinical course .
radiologic findings were nonspecific and had a great variety of structure involved , including bulging enhancing mass in the ct scan , hypoechoic mass in the us , and enhanced mass - like lesion in the mri.conclusionsknowledge of the potential sites of emr , their risk factors , and their clinical and radiologic features may be helpful in the early diagnosis of relapse and planning for therapy . |
there is a remarkable regional variation in the incidence , sex and age distributions , aetiology , and site distribution of maxillofacial fractures depending upon the geographic conditions , cultural characteristics , and socioeconomic trends [ 16 ] .
the province of pescara is a province in the abruzzo region of italy ; it has an area of 1.187 km and a total population of 314.391 inhabitants .
since the department of maxillofacial surgery in the hospital of pescara was opened in january 2010 acting as facial trauma centre , no study has been carried out so far to find out the epidemiological data of maxillofacial fractures in our province .
we therefore assessed the etiology and pattern of maxillofacial fractures in patients treated at our centre with the aim to give valuable information for both health care providers and government officials that can be used for the development of public health programs for education and prevention .
we have carried out a retrospective analysis of all patients with maxillofacial fractures surgically treated at the department of maxillofacial surgery of spirito santo hospital , pescara , italy , from january 2010 to december 2012 .
data collected and analyzed included sex , age , cause of injury , site of fracture , monthly distribution , and alcohol misuse .
the aetiological factors were classified into road traffic accidents ( rta ) , interpersonal violence , falls , work- related accidents , and others ( iatrogenic , gunshot , pathological , etc . ) . in patients with multiple facial bone fractures ,
patients with dentoalveolar fractures and patients with nasal bone fractures were excluded from the study because in our hospital they are treated by dentist and otorhinolaryngologist , respectively .
a total of 306 patients sustaining 401 maxillofacial fractures were treated at our centre between january 2010 and december 2012 .
there were 173 males ( 56.5% ) and 133 females ( 43.5% ) , giving a male to female ratio of 1.3 : 1 .
distribution of patients according to gender and causes of injuries is shown in figure 1 .
most of the patients ( 125 ; 36.9% ) were in the age group of 1844 years , while the smallest number of patients ( 32 ; 10.4% ) was over the age of 80 .
distribution of patients according to age group and causes of fractures is shown in figure 2 .
the most common causes of injuries were road traffic accidents ( 81 patients ; 26.4% ) ; out of these 81 patients , 35 ( 43.2% ) were involved in bicycle accidents , 24 ( 29.6% ) in motorcycle accidents , and 22 ( 27.2% ) in car accidents .
the second leading cause was interpersonal violence ( 71 patients ; 23.2% ) , followed by injuries associated with falls accounting for 59 ( 19.2% ) of all injuries ; out of these 59 patients , 56 ( 94.9% ) injuries were associated with falls on the ground and 3 ( 5.1% ) with falls from height .
sport - related injuries were documented in 48 ( 15.7% ) patients : 23 playing soccer , 6 rugby , 6 capoeira , 12 bicycle racing , 1 volleyball , and 1 basketball .
work - related injuries caused maxillofacial fracture in 24 ( 7.8% ) patients . in 23 ( 7.5% )
patients other causes were recorded : 11 pathological fractures , 8 iatrogenic fractures , 2 collision with a heavy object , 1 hit by horse kick , and 1 gunshot .
out of the total of 306 patients , 91 ( 29.7% ) presented two or more sites of fractures , average 1.3 fractures per patient ; panfacial fractures were treated in 11 ( 3.6% ) patients .
fractures of the mandible ( 123 ; 31% ) and zygoma ( 92 ; 23% ) were the most common ; site distribution of fractures is shown in figure 3 . among the 306 patients , 121 ( 39.5% )
the monthly distribution peaked in the summer ( july and august , 30.4% ) and in october ( 13.1% ) ; in figure 4 is shown the yearly and monthly distribution of maxillofacial fractures .
the epidemiological features of maxillofacial fractures are consistently influenced depending on environmental , cultural , and socioeconomic factors , with great variations among populations of different countries and even within the same country [ 17 ] .
like previous studies , our finding shows that maxillofacial fractures are more common in males , but the male to female ratio in our study ( 1.3 : 1 ) was lower than those reported in the international literature [ 38 ] . in this study ,
the peak incidence was in the age group of 1844 years , in agreement with the results of many other authors [ 3 , 4 , 9 ] and reflecting the fact that people in the third decade of life are more active regarding work , sports , violent activities , and high speed transportation .
as throughout the world [ 3 , 912 ] even in our province the primary causes of maxillofacial fractures are road traffic accidents , interpersonal violence , and falls .
according to this study , road traffic accidents remain the leading cause of injuries in both males and females , although the numbers of females injured by road traffic accidents and by interpersonal violence are practically equal ( 35 versus 34 ) ( figure 1 ) . in contrast to other previous reports [ 2 , 9 , 11 , 12 ] , violence - related fractures proved to be higher in females ( 25.6% ) than in males ( 21.4% ) . in this study ,
interpersonal violence is the main cause of maxillofacial fractures in patients between 18 and 44 years while falls were the most common cause in children ( < 18 years ) and the elderly ( > 65 years ) ( figure 2 ) . among road traffic accidents ,
two wheelers were responsible for the majority of maxillofacial fractures ( 59 patients ; 72.8% of rtas ) ; these results were similar to previous studies reported in the literature [ 2 , 3 , 10 , 11 ] and can be explained by the fact that bicycles and motorcycles are very popular as means of transport in our province because of its geographical and climatic features . among sports - related fractures we reported 6 patients injured by playing capoeira .
all of these patients were treated in a period time of 5 months , between september 2011 and january 2012 ; this is due to the fact that during that period there was a large spread in italy of capoeira and many people have started to practice this sport .
this data confirms the variability over time of the etiology of maxillofacial trauma and the close correlation with the sociocultural trends . in the present series ,
these reports are consistent with studies in several other countries [ 24 , 9 , 10 ] but in contrast with one recent study from italy that indicates the zygoma as the most fractured anatomical site , followed by isolated fractures of the orbital floor .
our study shows a close association between maxillofacial injuries and alcohol consumption ( 39.5% of patients ) ; these findings are similar with previous studies from several countries [ 3 , 10 , 14 , 15 ] .
alcohol significantly impairs judgment and coordination , facilitates aggression and interpersonal violence , and is a major cause of road traffic accidents .
the first one was in july - august and was related to the tourist season during which there is an exponential increase of population in our territory .
the second peak was in october and can be explained by the olive - harvesting season . in our province , there is a long tradition of olive oil production that is often a family activity . for this
many people , even the elderly and those with little experience , are involved in the olive harvest , resulting in significant number of maxillofacial traumas related to it .
this study confirms the close correlation between the incidence and etiology of facial fractures and the geographical , cultural , and socioeconomic features of a population .
the data obtained provide important information for the design of future plans for injury prevention and for education of citizens . | the aim of the present study was to assess the etiology and pattern of maxillofacial fractures in the province of pescara , abruzzo , central italy .
was performed a retrospective review of patients treated at the department of maxillofacial surgery of spirito santo hospital from january 2010 to december 2012 . data collected and analyzed included sex , age , cause of injury , site of fracture , monthly distribution , and alcohol misuse .
a total of 306 patients sustaining 401 maxillofacial fractures were treated .
there were 173 males ( 56.5% ) and 133 females ( 43.5% ) .
most of the patients ( 36.9% ) were in the age group of 1844 years .
the most common causes of injuries were road traffic accidents ( 26.4% ) ; the second leading cause was interpersonal violence ( 23.2% ) , followed by injuries associated with falls ( 19.2% ) .
fractures of the mandible ( 31% ) and zygoma ( 23% ) were the most common maxillofacial fractures in our study .
the monthly distribution peaked in the summer ( july and august , 30.4% ) and in october ( 13.1% ) . in conclusion , this study confirms the close correlation between the incidence and etiology of facial fractures and the geographical , cultural , and socioeconomic features of a population .
the data obtained provide important information for the design of future plans for injury prevention and for education of citizens . |
the gut microbiota fulfills an important role , helping to protect its host from disease.12 the gut microbiota inhibits the proliferation and colonization of pathogens by occupying potential intestinal niches and competing for nutrients.13 additionally , the gut microbiota contributes to the differentiation and maturation of resident intestinal immune cells , including th17 cells , regulatory t cells , innate lymphoid cells , and iga - producing b cells.4 the gut microbiota also acts as a metabolic organ that interacts with host cells and provides the functional support required for the maintenance of homeostasis .
for example , short chain fatty acids ( scfas ) , which are the end products of anaerobic bacterial fermentation of dietary fiber in the intestine , have been shown to enhance the epithelial cell barrier and anti - inflammatory immune cell function . among these scfas ,
butyrate is important for the maintenance of various aspects of colonic homeostasis , such as intestinal motility , visceral blood flow , and suppression of pathogen expansion.56 furthermore , the gut microbiota plays an essential role in the metabolism of bile acids .
it has been established that the primary bile acids , cholic and chenodeoxycholic acid , are converted to more than 20 different secondary bile acid metabolites including deoxycholic acid ( dca ) and lithocholic acid ( lca ) , by the gut microbiota.7 the accumulation of secondary bile acids , especially dca , causes mucosal and dna damage , leads to increased reactive oxygen species , and promotes tumor growth .
in contrast , some secondary bile acids inhibit the growth of pathogens , suggesting that bile acid metabolism and its regulation by the gut microbiota can have both beneficial and harmful effects in the intestine.7 under normal physiological conditions , the microbiota receives nutritional niches from the host . in turn , the microbiota provides symbiotic support for the host in the form of intestinal homeostasis maintenance .
however , some resident bacteria can acquire virulence , shift from symbionts to pathobionts , and contribute to the development and progression of various gastrointestinal ( gi ) diseases .
a growing number of studies suggest that disturbance of the intestinal microbiota and its metabolic functions are strongly correlated with the initiation and progression of gi diseases , including functional dyspepsia , severe diarrhea , ibd , colorectal cancer ( crc ) , celiac disease , and ibs.89 it is now understood that disturbance of intestinal microbial communities , called dysbiosis , can be triggered by both extrinsic ( e.g. , diet , appendectomy , and antibiotic use ) and intrinsic factors ( e.g. , genetics , stress , and aging ) . here
ibd , comprising uc and cd , is chronic , relapsing inflammation of the gi tract .
the development of ibd is governed by complex interactions between environmental risk factors , gut microbiota , and host genetics.10 recently , the role of the gut microbiota in ibd pathogenesis has attracted considerable attention.1112 it has been well documented that the diversity and richness of the gut microbiota are significantly reduced in patients with ibd , a condition referred to as dysbiosis.1113 moreover , the accumulation of certain pathobionts has been reported in both patients with ibd and animal models of ibd .
this pathobiont accumulation may trigger , or at least contribute to , disease pathogenesis.112 for example , there is increasing evidence that defects in the inflammasome or nod like receptor family pyrin domain containing protein ( nlrp ) signaling can lead to intestinal dysbiosis accompanied by an accumulation of potential pathobionts.14
nlrp6 mice , which have impaired il-18 production , are characterized by an abnormal expansion of the phyla prevotellaceae and tm7 .
prevotellaceae have the ability to enzymatically disrupt mucosal barrier function.15 members of the phylum prevotellaceae also tend to be more abundant in intestinal biopsy samples isolated from patients with ibd.16 administration of dextran sodium sulfate ( dss ) , commonly used to trigger ibd - like experimental colitis in mice , induces significantly more severe inflammation in nlrp6 mice than in wild - type mice.17 nlrp6 deficiency leads to upregulation of ccl5 ; thereby promoting intestinal inflammation due to the recruitment of innate and adaptive immune cells.17 notably , the colitogenic phenotypes observed in nlrp6 mice are transmissible to wild - type mice upon co - housing with nlrp6 mice.17 this suggests that the nlrp6 deficiency in the host is not a requirement for the induction of colitogenic phenotypes ; rather , dysbiosis driven by the nlrp6 deficiency is the key factor responsible for triggering ibd - prone phenotypes in nlrp6 mice.17 likewise , mice deficient in nod2 , another gene known to be associated with cd susceptibility , also display alterations in their microbiota composition and increased susceptibility to dss - induced colitis.18 the colitogenic phenotype of nod2 mice , like that of nlrp6 mice , can be acquired by wild - type mice through co - housing.18 however , unlike nlrp6 mice , the bacterial strains that accumulate in nod2 mice and drive this phenotype are unknown .
mice deficient in il-10 or il-2 have also been used as a model of ibd - like spontaneous colitis .
it is noteworthy that these animals either have no symptoms or develop only very mild colitis when housed under germ - free conditions , suggesting that the gut microbiota is a key driver of inflammation in these two models.1920 interestingly , some bacterial strains are capable of causing intestinal inflammation in these mice.2122 for instance , monocolonization of germ - free il10 or il2 mice with a human commensal bacterium such as escherichia coli or enterococcus faecalis , results in intestinal inflammation , whereas monocolonization with another commensal bacterium bacteroides vulgatus , does not .
this type of intestinal inflammation is accompanied by increased production of two pro - inflammatory cytokines , il-12 and ifn- dual colonization of germ - free 129s6/svev il10 mice by e. coli and e. faecalis induces more severe colitis than monocolonization does.23 in contrast , neither monocolonization nor dual colonization by these bacterial strains can induce the development of colitis in germ - free wild - type mice.21 interestingly , colonization of germ - free hla - b27 transgenic rats by b. vulgatus , but not e. coli , causes severe intestinal inflammation.24 these findings indicate that complicated interactions between commensal bacteria and the host 's genetic background determine the fate of genetically susceptible individuals , i.e. , colitis or no colitis .
in addition to genetics , other factors such as the environment can also trigger the development of ibd through dysbiosis .
for example , dietary fats induce dysbiosis , thereby leading to intestinal inflammation.25 devkota et al . demonstrated that taurocholic acid derived from dietary fats ( milk - derived ) , but not from polyunsaturated fatty acids , promoted the expansion of a particular member of deltaproteobacteria , a sulfate - reducing commensal bacterium bilophila wadsworthia while reducing the abundance of firmicutes .
b. wadsworthia induced colitis in genetically susceptible ibd - prone il10 mice,26 but not in wild - type mice , and the resulting colitis was mediated by more pronounced antigenspecific th1 immune responses.27
b. wadsworthia produces hydrogen sulfate ( h2s ) , a genotoxic chemical agent that is capable of causing inflammation . in this context
, excessive protein ingestion raises the level of waste products in the colon , such as sulfates , nitrates , ammonium , and ethanolamine .
these metabolites stimulate the overgrowth of sulfate - reducing bacteria such as desulfovibrio spp . and
desulfuromonas spp.28 notably , these bacteria are much more prevalent in patients with ibd than in healthy subjects.29 given that the expansion of sulfate - reducing bacteria can also be induced by high dietary fats , it can be concluded that diet directly impacts mucosal immunity and ibd pathogenesis .
likewise , diets rich in fats and beef can induce the accumulation of potential pathobionts .
the abundance of erysipelotrichaceae and bacteroides fragilis was significantly increased in subjects on diets rich in fat or beef.3031 although the pathogenic roles of these bacteria remain largely unknown , they were identified as potential pathobionts by iga coating.32 in a recent study , palm et al . demonstrated that the binding of iga to intestinal bacteria can discriminate colitogenic bacteria from harmless non - colitogenic bacteria within the gut microbiota.32 iga - binding intestinal bacteria induced more severe colitis when used to colonize germ - free mice after dss administration.32 notably , iga - binding bacteria were present in both mice and humans ( patients with ibd ) .
thus , although iga identifies potential ibd - related pathobionts , dietary factors may regulate the abundance of these pathobionts in the intestine .
these findings support the notion that the typical western diet may promote alternations in the composition of the microbiota , resulting in an accumulation of colitogenic pathobionts , and perturbed colitogenic microbiota facilitates the development and/or progression of ibd .
smoking is a well - known environmental factor that exacerbates ibd symptoms.3334 a meta - analysis showed that anaerostipes , which convert lactate to butyrate , were lower in patients with ibd who smoked than in those that did not.35 thus , smoking may lead to decreased butyrate production by the microbiota .
given that butyrate contributes to intestinal homeostasis by enhancing epithelial barrier function and facilitating regulatory t cell development,56 impaired butyrate production due to smoking may increase the susceptibility of the host to ibd .
antibiotic treatment is one of the most potent factors that can lead to a disturbance in healthy intestinal microbiota .
studies have shown that administration of antibiotics in the first year of life is associated with the development of pediatric ibd.3637 patients with ibd who were treated with ciprofloxacin and metronidazole had a reduced abundance of dorea , butyricicoccus , and coriobacteriaceae.3637 organic compounds produced by these bacteria , such as formate and butyrate , are important for the regulation of gut homeostasis .
additionally , gut dysbiosis driven by antibiotic use often results in the overgrowth of pathogens . for instance
, the abundance of clostridium difficile is effectively suppressed in a healthy intestine by other commensal microorganisms . however , once the healthy microbial community is disrupted by antibiotics , c. difficile can bloom in the gut and cause c. difficile - induced colitis.3839
c. difficile infection causes significant morbidity and mortality in hospitalized patients40 and is a serious complication for patients with ibd .
although the precise mechanism is unclear , ibd is a risk factor for c. difficile infection.4142 moreover , c. difficile infection also exacerbates ibd.4243 a key mechanism by which gut dysbiosis increases susceptibility to c. difficile infection is perturbation of the luminal metabolic profile .
it has been well documented that antibiotics significantly decrease the abundance of bacteria responsible for bile acid metabolism.44 given that these bacteria can convert primary bile acids into secondary bile acids , the ratio of primary to secondary bile acids is significantly increased after antibiotic treatment.45 primary bile acids are known to promote the growth of c. difficile , whereas secondary bile acids inhibit c. difficile growth.4546 buffie et al .
recently identified clostridium scindens as a key bacterium that suppresses the growth of c. difficile.47
c. scindens has high levels of bile acid 7alpha - dehydroxylating activity , which converts primary bile acids to secondary bile acids .
interestingly , the abundance of c. scindens is significantly reduced in c. difficile - susceptible mice and humans.47 additionally , adoptive transfer of c. scindens into c. difficile - susceptible ( antibiotic - treated ) mice inhibited the germination of c. difficile spores via dca production.47 as it has been reported that the balance of primary and secondary bile acids in the intestine is perturbed in patients with ibd,4849 this dysbiosis - induced imbalance of microbial metabolites may be associated with the increased susceptibility to c. difficile of patients with ibd .
further studies focusing on the luminal metabolites produced by dysbiotic microbiota are needed to unravel the precise mechanisms involved in the increased susceptibility of patients with ibd to c. difficile colonization .
in addition to pathogen overgrowth , dysbiosis in ibd can also result in the loss of beneficial commensal bacteria , increasing the risk of intestinal inflammation .
for instance , a lower abundance of faecalibacterium prausnitzii is associated with a higher risk of postoperative recurrence of inflammation in patients with ibd , particularly cd patients.5051
f. prausnitzii is one of the most abundant anaerobic bacteria in the human gut .
it has an important function , providing energy to colonocytes and maintaining overall intestinal health .
these effects are mediated by the induction of a tolerogenic cytokine profile , which includes lower il-12 and ifn- production and elevated levels of il-10.51 notably , in a mouse model of intestinal inflammation , oral administration of f. prausnitzii showed anti - inflammatory effects and ameliorated colitis.51 these results indicate that f. prausnitzii can counterbalance dysbiosis and may be a promising candidate probiotic for the treatment of cd . what is still unclear is the cause of the reduced abundance of f. prausnitzii in patients with ibd .
further studies are needed to determine whether this approach can be translated into novel and effective ibd treatment options . taken together , these findings suggest that the incidence and prevalence of ibd are closely related to various parameters that can shift the status of individual members of the gut microbiota from symbiotic to pathobiotic ( table 1 and fig .
the incidence of crc is higher in the western world,52 and this increased incidence is largely due to the dietary differences between developed and developing countries .
recent meta - analyses indicate that diets rich in fiber are associated with a lower risk of crc,53 whereas consumption of saturated fat - rich foods such as red and processed meat , is strongly associated with an increased risk of crc.5455 an epidemiological study showed that the incidence of crc in african americans who generally consume high - fat , low - fiber diets was higher than that of rural indigenous africans who generally consume low - fat , high - fiber diets.56 in addition , there were significant differences in the microbiota composition and the metabolic profiles of these two groups ; fecal samples from african americans had lower numbers of total bacteria and the major butyrate - producing groups and higher numbers of hydrogen sulfide - producing bacteria than fecal samples from indigenous africans .
additionally , the fecal concentrations of secondary bile acids such as lca and dca , were higher in african americans , whereas the concentrations of scfas such as acetate , butyrate , and propionate , were higher in indigenous africans.56 in fact , previous reports on dietary fat consumption and crc risk have shown that secondary bile acids are increased and scfas are decreased in patients with crc.5758 similarly , consumption of diets rich in beef also affects the composition of the intestinal microbiota .
the abundance of b. fragilis was significantly higher in individuals consuming a diet rich in beef than in those consuming a vegetarian diet.31 the enterotoxigenic form of b. fragilis , enterotoxigenic b. fragilis ( etbf ) , is associated with acute diarrheal disease , ibd ( as discussed above ) , and crc due to production of the b. fragilis toxin.59
b. fragilis toxin alters the structure and function of colonic epithelial cells , and cleaves the tumor suppressor protein e - cadherin , which is critical for the formation and maintenance of adherent junctions in areas of epithelial cell - cell contact .
the toxin increases the permeability of the epithelial barrier and enhances wnt/-catenin signaling , resulting in an increased colonic carcinoma cell population.60 importantly , colonization by etbf , but not non - toxigenic b. fragilis , promotes colonic colitis and carcinogenesis in crc model min mice.61 this finding indicates that in min mice , etbf specifically activates stat3 , a key regulator of crc development , by increasing il-17 production by th17 cells in the colonic tissue .
blocking il-17 or il-23r can significantly reduce tumor formation in vivo.61 etbf tends to be more abundant in patients with crc than in healthy individuals.62 genotoxins also have a considerable effect on the composition of microbial communities and can promote tumorigenesis .
the adherent - invasive e. coli strain nc101 induces dna double - strand breaks by utilizing several of the enzymes involved in the production of colibactin , which are encoded on the polyketide synthase ( pks ) genotoxic island.63 although monocolonization of azoxymethanetreated germ - free il10 mice by e. coli nc101 promoted tumor formation and intestinal inflammation , monocolonization of these mice by a pks - deleted mutant showed significantly reduced tumor multiplicity and invasion.64 however , colonization of azoxymethane - treated wild - type germ - free mice by e. coli nc101 does not result in tumor development , suggesting that bacteria - driven inflammation is required for carcinogenesis mediated by this bacterium.64 it is noteworthy that pks e. coli tend to be more abundant in patients with ibd or crc than in patents without ibd and crc.64 high consumption of alcohol also increases the risk of crc.65 a higher incidence of crc was observed in heavy drinkers than in non - drinkers , and the microbial composition in the gut of these two groups was different.66 mutlu et al
in particular , the abundance of bacteroidetes is lower and the abundance of proteobacteria is higher in people with alcoholism than in healthy controls.67 interestingly , the abundance of gram - positive erysipelotrichaceae , which are considered to be pro - inflammatory ( as described above ) , was higher in chronic alcohol - fed mice than in control mice.68 this observation also holds true in crc patients.69 expression of reg3 , an antimicrobial peptide that targets gram - positive bacteria , was downregulated in alcohol - fed mice .
this result suggests that alcohol consumption leads to an overgrowth of erysipelotrichaceae due to lower reg3 expression .
collectively , these findings support the notion that excess alcohol consumption leads to the development of crc through dysbiosis , although the underlying mechanism remains unclear .
the aging process also plays a key role in crc pathogenesis , and aging has been shown to affect the composition of the human microbiota .
studies of the relationship between age and microbiota composition have demonstrated that both the total number of bacteria and bacterial diversity decrease with age .
in fact , a lower abundance of firmicutes and a higher abundance of bacteroidetes were observed in older populations.7071 there is also evidence that older age is associated with decreased butyrate production and reduced numbers of f. prausnitzii and roseburia intestinalis,72 antiinflammatory bacteria with protective roles against crc.73 thus , the aging process may affect gut homeostasis , thereby increasing the risk of crc development .
bacteria of the genus fusobacterium are oral commensal organisms that maintain epithelial barrier function by producing butyrate.74 however , these bacteria have pathogenic potential in the gut . for example , an invasive strain of fusobacterium nucleatum has been shown to promote the onset of colonic tumorigenesis by mediating e - cadherin/-catenin signaling via an adhesion protein called fada.75
f. nucleatum has also been shown to be highly prevalent in the intestinal tissue and stool of patients with crc.76 these findings suggest that although f. nucleatum is a beneficial commensal bacterium , its abnormal accumulation may increase the risk of crc .
all of these findings suggest that changes in the structure , distribution , and metabolism of the colonic microbiota , which can be triggered by diverse factors , may contribute to the development and progression of crc
. a better understanding of the mechanisms that influence homeostasis of the gut microbiota will pave the way for novel and effective approaches to prevent and treat crc ( table 1 and fig .
celiac disease , a chronic immune - mediated inflammatory disease of the small intestine , is an autoimmune disorder triggered by the consumption of dietary gluten.77 studies suggest that alterations in the gut microbiota composition may contribute to the development and/or progression of celiac disease.78 changes in the intestinal metabolic profile , including alterations in scfa production , have also been reported in patients with celiac disease.79 it has been reported that klebsiella oxytoca , staphylococcus epidermidis , and staphylococcus pasteuri are more abundant in duodenal biopsy specimens from patients with active celiac disease than in specimens from healthy individuals . in contrast , streptococcus anginosus and streptococcus mutans are less abundant in patients with celiac disease than in healthy individuals , regardless of inflammation status.80 notably , some of the changes in the gut microbiota of patients with celiac disease can not be restored after long - term treatment with a gluten - free diet,81 indicating that dysbiosis might be related to a celiac disease - associated genotype .
. showed that a mutation in the fucosyltransferase 2 ( fut2 ) gene , which controls the expression of abh blood group antigens in mucus and other body secretions,82 is associated with the pathogenesis of celiac disease,83 although the mechanism that underlies this phenomenon has not yet been fully elucidated .
additionally , fut2 can influence the structure of mucosa - associated bacteria,84 and fut2 mutations have been shown to lead to reduced bacterial diversity and richness , including a lower abundance of bifidobacterium spp .
fut2-null mice display greater susceptibility to c. albicans colonization than wild - type mice,87 and c. albicans infection can trigger the onset of celiac disease.88 therefore , perturbations of the microbiota due to fut2 mutation result in lower resistance to colonization by pathobionts , thus contributing to the pathogenesis of celiac disease .
antibiotic exposure is also a recognized risk factor for the development of celiac disease.89 perinatal antibiotic treatment ( vancomycin ) of gluten - sensitive nod / dq8 mice worsened gluten - induced pathology90 and led to an overall decrease in fecal microbial diversity . although the abundance of proteobacteria , including escherichia and helicobacter spp .
was significantly decreased.90 this finding provides additional evidence for the role of the gut microbial community in the development of celiac disease and confirms the relationship between antibiotic use and an increased risk of celiac disease .
previous epidemiological analyses showed that breastfeeding of infants exerts protective effects against the development of celiac disease .
this effect is believed to be mediated by the establishment of specific gut microbiota.9192 meta - analysis demonstrated that the risk of later celiac disease was significantly reduced in infants who were breastfed when gluten - containing foods were introduced compared to infants who were not breastfed during this period.9293 breastfeeding is known to promote gut colonization by bifidobacterium spp .
are less abundant in the breast milk of mothers with celiac disease , suggesting that infants raised by mothers with celiac disease may have decreased numbers of bifidobacterium spp.94 this result suggests that breastfeeding may protect infants against the development of celiac disease and that this protective effect is modulated by the microbiota .
it is unclear whether alterations of the microbiota and its components are a cause or a consequence of the development of celiac disease .
the fact that both newly diagnosed celiac disease patients as well as those that have been treated with a gluten - free diet have imbalanced microbiotas indicates that the gut microbiota may play a primary role in the pathogenesis of celiac disease .
further research using animal models is needed to elucidate the mechanism by which the microbiota shapes host immune response against gluten ( table 1 and fig .
irritable bowel syndrome ( ibs ) is a functional bowel disorder that commonly causes abdominal pain , diarrhea , cramping , gas , and constipation.95 a growing number of studies have demonstrated that gut dysbiosis is involved in ibs pathogenesis ; specifically gut motility dysfunction , intestinal permeability , and visceral pain responses.9697 patients with ibs have greater numbers of ruminococcaceae and clostridium cluster xiva , and lesser numbers of bacteroides than healthy individuals do.98 it is unclear whether intestinal dysbiosis is the cause of ibs or merely a consequence .
for instance , colonization of germ - free rats with dysbiotic fecal microbiota ( e.g. , increased bifidobacteria and decreased enterobacteriaceae and sulfate - reducing bacteria ) isolated from ibs patients was sufficient to cause increased abdominal contractions , a typical symptom of patients with ibs .
this observation confirms that the gut dysbiosis present in patients with ibs contributes to disease pathogenesis.99 patients with ibs also display defects in luminal metabolic function , which is likely caused by dysbiosis .
the degree of breath methane production is markedly enhanced in patients with ibs and is correlated with the incidence of constipation .
100 methane has a negative effect on various aspects of gi motility , including gut transit and contraction .
consistent with the observation of increased methane production , methanobrevibacter smithii , a predominant methanogen in the human gut,101 was shown to be more abundant in stool samples from patients with constipation - predominant ibs.100 thus , methanogenic bacteria appear to play a role in the pathogenesis of ibs ; however , the factors that promote the bloom of methanogenic bacteria in patients with ibs are not yet known .
these findings indicate that microbial imbalance leads to gut dysfunction and contributes to ibs symptoms .
moreover , several meta - analyses have shown that the pathogenesis of ibs is influenced by multiple factors , all of which can result in gut dysbiosis.96 for example , intestinal infections with pathogenic bacteria such as salmonella , campylobacter , and shigella , are known to increase the risk of developing ibs.102 although enteric infections may directly influence gi motility , infection - induced dysbiosis may also contribute to post - infectious ibs symptoms.103104 moreover , epidemiologic studies have shown that the incidence of ibs symptoms is significantly increased in patients who , as children , were treated with antibiotics , particularly macrolides and tetracycline.105106 in summary , the effects of physical and psychological stressors and dietary factors such as fat consumption , on ibs have been extensively studied.96 however , the precise mechanisms by which these factors influence the gut microbial profile and lead to the development and/or progression of ibs are still unknown .
thus , more research is required to advance our current understanding of the relationship between the intestinal microbiota and gut dysfunction in ibs ( table 1 and fig .
ibd , comprising uc and cd , is chronic , relapsing inflammation of the gi tract .
the development of ibd is governed by complex interactions between environmental risk factors , gut microbiota , and host genetics.10 recently , the role of the gut microbiota in ibd pathogenesis has attracted considerable attention.1112 it has been well documented that the diversity and richness of the gut microbiota are significantly reduced in patients with ibd , a condition referred to as dysbiosis.1113 moreover , the accumulation of certain pathobionts has been reported in both patients with ibd and animal models of ibd .
this pathobiont accumulation may trigger , or at least contribute to , disease pathogenesis.112 for example , there is increasing evidence that defects in the inflammasome or nod like receptor family pyrin domain containing protein ( nlrp ) signaling can lead to intestinal dysbiosis accompanied by an accumulation of potential pathobionts.14
nlrp6 mice , which have impaired il-18 production , are characterized by an abnormal expansion of the phyla prevotellaceae and tm7 .
prevotellaceae have the ability to enzymatically disrupt mucosal barrier function.15 members of the phylum prevotellaceae also tend to be more abundant in intestinal biopsy samples isolated from patients with ibd.16 administration of dextran sodium sulfate ( dss ) , commonly used to trigger ibd - like experimental colitis in mice , induces significantly more severe inflammation in nlrp6 mice than in wild - type mice.17 nlrp6 deficiency leads to upregulation of ccl5 ; thereby promoting intestinal inflammation due to the recruitment of innate and adaptive immune cells.17 notably , the colitogenic phenotypes observed in nlrp6 mice are transmissible to wild - type mice upon co - housing with nlrp6 mice.17 this suggests that the nlrp6 deficiency in the host is not a requirement for the induction of colitogenic phenotypes ; rather , dysbiosis driven by the nlrp6 deficiency is the key factor responsible for triggering ibd - prone phenotypes in nlrp6 mice.17 likewise , mice deficient in nod2 , another gene known to be associated with cd susceptibility , also display alterations in their microbiota composition and increased susceptibility to dss - induced colitis.18 the colitogenic phenotype of nod2 mice , like that of nlrp6 mice , can be acquired by wild - type mice through co - housing.18 however , unlike nlrp6 mice , the bacterial strains that accumulate in nod2 mice and drive this phenotype are unknown .
mice deficient in il-10 or il-2 have also been used as a model of ibd - like spontaneous colitis .
it is noteworthy that these animals either have no symptoms or develop only very mild colitis when housed under germ - free conditions , suggesting that the gut microbiota is a key driver of inflammation in these two models.1920 interestingly , some bacterial strains are capable of causing intestinal inflammation in these mice.2122 for instance , monocolonization of germ - free il10 or il2 mice with a human commensal bacterium such as escherichia coli or enterococcus faecalis , results in intestinal inflammation , whereas monocolonization with another commensal bacterium bacteroides vulgatus , does not .
this type of intestinal inflammation is accompanied by increased production of two pro - inflammatory cytokines , il-12 and ifn- dual colonization of germ - free 129s6/svev il10 mice by e. coli and e. faecalis induces more severe colitis than monocolonization does.23 in contrast , neither monocolonization nor dual colonization by these bacterial strains can induce the development of colitis in germ - free wild - type mice.21 interestingly , colonization of germ - free hla - b27 transgenic rats by b. vulgatus , but not e. coli , causes severe intestinal inflammation.24 these findings indicate that complicated interactions between commensal bacteria and the host 's genetic background determine the fate of genetically susceptible individuals , i.e. , colitis or no colitis .
in addition to genetics , other factors such as the environment can also trigger the development of ibd through dysbiosis .
for example , dietary fats induce dysbiosis , thereby leading to intestinal inflammation.25 devkota et al . demonstrated that taurocholic acid derived from dietary fats ( milk - derived ) , but not from polyunsaturated fatty acids , promoted the expansion of a particular member of deltaproteobacteria , a sulfate - reducing commensal bacterium bilophila wadsworthia while reducing the abundance of firmicutes .
b. wadsworthia induced colitis in genetically susceptible ibd - prone il10 mice,26 but not in wild - type mice , and the resulting colitis was mediated by more pronounced antigenspecific th1 immune responses.27
b. wadsworthia produces hydrogen sulfate ( h2s ) , a genotoxic chemical agent that is capable of causing inflammation . in this context
, excessive protein ingestion raises the level of waste products in the colon , such as sulfates , nitrates , ammonium , and ethanolamine .
these metabolites stimulate the overgrowth of sulfate - reducing bacteria such as desulfovibrio spp . and
desulfuromonas spp.28 notably , these bacteria are much more prevalent in patients with ibd than in healthy subjects.29 given that the expansion of sulfate - reducing bacteria can also be induced by high dietary fats , it can be concluded that diet directly impacts mucosal immunity and ibd pathogenesis .
likewise , diets rich in fats and beef can induce the accumulation of potential pathobionts .
the abundance of erysipelotrichaceae and bacteroides fragilis was significantly increased in subjects on diets rich in fat or beef.3031 although the pathogenic roles of these bacteria remain largely unknown , they were identified as potential pathobionts by iga coating.32 in a recent study , palm et al . demonstrated that the binding of iga to intestinal bacteria can discriminate colitogenic bacteria from harmless non - colitogenic bacteria within the gut microbiota.32 iga - binding intestinal bacteria induced more severe colitis when used to colonize germ - free mice after dss administration.32 notably , iga - binding bacteria were present in both mice and humans ( patients with ibd ) .
thus , although iga identifies potential ibd - related pathobionts , dietary factors may regulate the abundance of these pathobionts in the intestine .
these findings support the notion that the typical western diet may promote alternations in the composition of the microbiota , resulting in an accumulation of colitogenic pathobionts , and perturbed colitogenic microbiota facilitates the development and/or progression of ibd .
smoking is a well - known environmental factor that exacerbates ibd symptoms.3334 a meta - analysis showed that anaerostipes , which convert lactate to butyrate , were lower in patients with ibd who smoked than in those that did not.35 thus , smoking may lead to decreased butyrate production by the microbiota .
given that butyrate contributes to intestinal homeostasis by enhancing epithelial barrier function and facilitating regulatory t cell development,56 impaired butyrate production due to smoking may increase the susceptibility of the host to ibd .
antibiotic treatment is one of the most potent factors that can lead to a disturbance in healthy intestinal microbiota .
studies have shown that administration of antibiotics in the first year of life is associated with the development of pediatric ibd.3637 patients with ibd who were treated with ciprofloxacin and metronidazole had a reduced abundance of dorea , butyricicoccus , and coriobacteriaceae.3637 organic compounds produced by these bacteria , such as formate and butyrate , are important for the regulation of gut homeostasis .
additionally , gut dysbiosis driven by antibiotic use often results in the overgrowth of pathogens . for instance
, the abundance of clostridium difficile is effectively suppressed in a healthy intestine by other commensal microorganisms . however , once the healthy microbial community is disrupted by antibiotics , c. difficile can bloom in the gut and cause c. difficile - induced colitis.3839
c. difficile infection causes significant morbidity and mortality in hospitalized patients40 and is a serious complication for patients with ibd .
although the precise mechanism is unclear , ibd is a risk factor for c. difficile infection.4142 moreover , c. difficile infection also exacerbates ibd.4243 a key mechanism by which gut dysbiosis increases susceptibility to c. difficile infection is perturbation of the luminal metabolic profile .
it has been well documented that antibiotics significantly decrease the abundance of bacteria responsible for bile acid metabolism.44 given that these bacteria can convert primary bile acids into secondary bile acids , the ratio of primary to secondary bile acids is significantly increased after antibiotic treatment.45 primary bile acids are known to promote the growth of c. difficile , whereas secondary bile acids inhibit c. difficile growth.4546 buffie et al .
recently identified clostridium scindens as a key bacterium that suppresses the growth of c. difficile.47
c. scindens has high levels of bile acid 7alpha - dehydroxylating activity , which converts primary bile acids to secondary bile acids .
interestingly , the abundance of c. scindens is significantly reduced in c. difficile - susceptible mice and humans.47 additionally , adoptive transfer of c. scindens into c. difficile - susceptible ( antibiotic - treated ) mice inhibited the germination of c. difficile spores via dca production.47 as it has been reported that the balance of primary and secondary bile acids in the intestine is perturbed in patients with ibd,4849 this dysbiosis - induced imbalance of microbial metabolites may be associated with the increased susceptibility to c. difficile of patients with ibd .
further studies focusing on the luminal metabolites produced by dysbiotic microbiota are needed to unravel the precise mechanisms involved in the increased susceptibility of patients with ibd to c. difficile colonization .
in addition to pathogen overgrowth , dysbiosis in ibd can also result in the loss of beneficial commensal bacteria , increasing the risk of intestinal inflammation .
for instance , a lower abundance of faecalibacterium prausnitzii is associated with a higher risk of postoperative recurrence of inflammation in patients with ibd , particularly cd patients.5051
f. prausnitzii is one of the most abundant anaerobic bacteria in the human gut .
it has an important function , providing energy to colonocytes and maintaining overall intestinal health .
these effects are mediated by the induction of a tolerogenic cytokine profile , which includes lower il-12 and ifn- production and elevated levels of il-10.51 notably , in a mouse model of intestinal inflammation , oral administration of f. prausnitzii showed anti - inflammatory effects and ameliorated colitis.51 these results indicate that f. prausnitzii can counterbalance dysbiosis and may be a promising candidate probiotic for the treatment of cd . what is still unclear is the cause of the reduced abundance of f. prausnitzii in patients with ibd .
further studies are needed to determine whether this approach can be translated into novel and effective ibd treatment options . taken together , these findings suggest that the incidence and prevalence of ibd are closely related to various parameters that can shift the status of individual members of the gut microbiota from symbiotic to pathobiotic ( table 1 and fig .
the incidence of crc is higher in the western world,52 and this increased incidence is largely due to the dietary differences between developed and developing countries .
recent meta - analyses indicate that diets rich in fiber are associated with a lower risk of crc,53 whereas consumption of saturated fat - rich foods such as red and processed meat , is strongly associated with an increased risk of crc.5455 an epidemiological study showed that the incidence of crc in african americans who generally consume high - fat , low - fiber diets was higher than that of rural indigenous africans who generally consume low - fat , high - fiber diets.56 in addition , there were significant differences in the microbiota composition and the metabolic profiles of these two groups ; fecal samples from african americans had lower numbers of total bacteria and the major butyrate - producing groups and higher numbers of hydrogen sulfide - producing bacteria than fecal samples from indigenous africans .
additionally , the fecal concentrations of secondary bile acids such as lca and dca , were higher in african americans , whereas the concentrations of scfas such as acetate , butyrate , and propionate , were higher in indigenous africans.56 in fact , previous reports on dietary fat consumption and crc risk have shown that secondary bile acids are increased and scfas are decreased in patients with crc.5758 similarly , consumption of diets rich in beef also affects the composition of the intestinal microbiota .
the abundance of b. fragilis was significantly higher in individuals consuming a diet rich in beef than in those consuming a vegetarian diet.31 the enterotoxigenic form of b. fragilis , enterotoxigenic b. fragilis ( etbf ) , is associated with acute diarrheal disease , ibd ( as discussed above ) , and crc due to production of the b. fragilis toxin.59
b. fragilis toxin alters the structure and function of colonic epithelial cells , and cleaves the tumor suppressor protein e - cadherin , which is critical for the formation and maintenance of adherent junctions in areas of epithelial cell - cell contact .
the toxin increases the permeability of the epithelial barrier and enhances wnt/-catenin signaling , resulting in an increased colonic carcinoma cell population.60 importantly , colonization by etbf , but not non - toxigenic b. fragilis , promotes colonic colitis and carcinogenesis in crc model min mice.61 this finding indicates that in min mice , etbf specifically activates stat3 , a key regulator of crc development , by increasing il-17 production by th17 cells in the colonic tissue . blocking il-17 or il-23r can significantly reduce tumor formation in vivo.61 etbf tends to be more abundant in patients with crc than in healthy individuals.62 genotoxins also have a considerable effect on the composition of microbial communities and can promote tumorigenesis .
the adherent - invasive e. coli strain nc101 induces dna double - strand breaks by utilizing several of the enzymes involved in the production of colibactin , which are encoded on the polyketide synthase ( pks ) genotoxic island.63 although monocolonization of azoxymethanetreated germ - free il10 mice by e. coli nc101 promoted tumor formation and intestinal inflammation , monocolonization of these mice by a pks - deleted mutant showed significantly reduced tumor multiplicity and invasion.64 however , colonization of azoxymethane - treated wild - type germ - free mice by e. coli nc101 does not result in tumor development , suggesting that bacteria - driven inflammation is required for carcinogenesis mediated by this bacterium.64 it is noteworthy that pks e. coli tend to be more abundant in patients with ibd or crc than in patents without ibd and crc.64 high consumption of alcohol also increases the risk of crc.65 a higher incidence of crc was observed in heavy drinkers than in non - drinkers , and the microbial composition in the gut of these two groups was different.66 mutlu et al . showed that intestinal dysbiosis is observed in persons with alcoholism . in particular , the abundance of bacteroidetes is lower and the abundance of proteobacteria is higher in people with alcoholism than in healthy controls.67 interestingly , the abundance of gram - positive erysipelotrichaceae , which are considered to be pro - inflammatory ( as described above ) , was higher in chronic alcohol - fed mice than in control mice.68 this observation also holds true in crc patients.69 expression of reg3 , an antimicrobial peptide that targets gram - positive bacteria , was downregulated in alcohol - fed mice .
this result suggests that alcohol consumption leads to an overgrowth of erysipelotrichaceae due to lower reg3 expression .
collectively , these findings support the notion that excess alcohol consumption leads to the development of crc through dysbiosis , although the underlying mechanism remains unclear .
the aging process also plays a key role in crc pathogenesis , and aging has been shown to affect the composition of the human microbiota .
studies of the relationship between age and microbiota composition have demonstrated that both the total number of bacteria and bacterial diversity decrease with age .
in fact , a lower abundance of firmicutes and a higher abundance of bacteroidetes were observed in older populations.7071 there is also evidence that older age is associated with decreased butyrate production and reduced numbers of f. prausnitzii and roseburia intestinalis,72 antiinflammatory bacteria with protective roles against crc.73 thus , the aging process may affect gut homeostasis , thereby increasing the risk of crc development .
bacteria of the genus fusobacterium are oral commensal organisms that maintain epithelial barrier function by producing butyrate.74 however , these bacteria have pathogenic potential in the gut . for example , an invasive strain of fusobacterium nucleatum has been shown to promote the onset of colonic tumorigenesis by mediating e - cadherin/-catenin signaling via an adhesion protein called fada.75
f. nucleatum has also been shown to be highly prevalent in the intestinal tissue and stool of patients with crc.76 these findings suggest that although f. nucleatum is a beneficial commensal bacterium , its abnormal accumulation may increase the risk of crc . all of these findings suggest that changes in the structure , distribution , and metabolism of the colonic microbiota , which can be triggered by diverse factors , may contribute to the development and progression of crc
. a better understanding of the mechanisms that influence homeostasis of the gut microbiota will pave the way for novel and effective approaches to prevent and treat crc ( table 1 and fig .
celiac disease , a chronic immune - mediated inflammatory disease of the small intestine , is an autoimmune disorder triggered by the consumption of dietary gluten.77 studies suggest that alterations in the gut microbiota composition may contribute to the development and/or progression of celiac disease.78 changes in the intestinal metabolic profile , including alterations in scfa production , have also been reported in patients with celiac disease.79 it has been reported that klebsiella oxytoca , staphylococcus epidermidis , and staphylococcus pasteuri are more abundant in duodenal biopsy specimens from patients with active celiac disease than in specimens from healthy individuals . in contrast ,
streptococcus anginosus and streptococcus mutans are less abundant in patients with celiac disease than in healthy individuals , regardless of inflammation status.80 notably , some of the changes in the gut microbiota of patients with celiac disease can not be restored after long - term treatment with a gluten - free diet,81 indicating that dysbiosis might be related to a celiac disease - associated genotype .
. showed that a mutation in the fucosyltransferase 2 ( fut2 ) gene , which controls the expression of abh blood group antigens in mucus and other body secretions,82 is associated with the pathogenesis of celiac disease,83 although the mechanism that underlies this phenomenon has not yet been fully elucidated .
additionally , fut2 can influence the structure of mucosa - associated bacteria,84 and fut2 mutations have been shown to lead to reduced bacterial diversity and richness , including a lower abundance of bifidobacterium spp .
fut2-null mice display greater susceptibility to c. albicans colonization than wild - type mice,87 and c. albicans infection can trigger the onset of celiac disease.88 therefore , perturbations of the microbiota due to fut2 mutation result in lower resistance to colonization by pathobionts , thus contributing to the pathogenesis of celiac disease .
antibiotic exposure is also a recognized risk factor for the development of celiac disease.89 perinatal antibiotic treatment ( vancomycin ) of gluten - sensitive nod / dq8 mice worsened gluten - induced pathology90 and led to an overall decrease in fecal microbial diversity .
was significantly decreased.90 this finding provides additional evidence for the role of the gut microbial community in the development of celiac disease and confirms the relationship between antibiotic use and an increased risk of celiac disease .
previous epidemiological analyses showed that breastfeeding of infants exerts protective effects against the development of celiac disease .
this effect is believed to be mediated by the establishment of specific gut microbiota.9192 meta - analysis demonstrated that the risk of later celiac disease was significantly reduced in infants who were breastfed when gluten - containing foods were introduced compared to infants who were not breastfed during this period.9293 breastfeeding is known to promote gut colonization by bifidobacterium spp .
are less abundant in the breast milk of mothers with celiac disease , suggesting that infants raised by mothers with celiac disease may have decreased numbers of bifidobacterium spp.94 this result suggests that breastfeeding may protect infants against the development of celiac disease and that this protective effect is modulated by the microbiota .
it is unclear whether alterations of the microbiota and its components are a cause or a consequence of the development of celiac disease .
the fact that both newly diagnosed celiac disease patients as well as those that have been treated with a gluten - free diet have imbalanced microbiotas indicates that the gut microbiota may play a primary role in the pathogenesis of celiac disease .
further research using animal models is needed to elucidate the mechanism by which the microbiota shapes host immune response against gluten ( table 1 and fig .
irritable bowel syndrome ( ibs ) is a functional bowel disorder that commonly causes abdominal pain , diarrhea , cramping , gas , and constipation.95 a growing number of studies have demonstrated that gut dysbiosis is involved in ibs pathogenesis ; specifically gut motility dysfunction , intestinal permeability , and visceral pain responses.9697 patients with ibs have greater numbers of ruminococcaceae and clostridium cluster xiva , and lesser numbers of bacteroides than healthy individuals do.98 it is unclear whether intestinal dysbiosis is the cause of ibs or merely a consequence .
for instance , colonization of germ - free rats with dysbiotic fecal microbiota ( e.g. , increased bifidobacteria and decreased enterobacteriaceae and sulfate - reducing bacteria ) isolated from ibs patients was sufficient to cause increased abdominal contractions , a typical symptom of patients with ibs .
this observation confirms that the gut dysbiosis present in patients with ibs contributes to disease pathogenesis.99 patients with ibs also display defects in luminal metabolic function , which is likely caused by dysbiosis .
the degree of breath methane production is markedly enhanced in patients with ibs and is correlated with the incidence of constipation .
100 methane has a negative effect on various aspects of gi motility , including gut transit and contraction .
consistent with the observation of increased methane production , methanobrevibacter smithii , a predominant methanogen in the human gut,101 was shown to be more abundant in stool samples from patients with constipation - predominant ibs.100 thus , methanogenic bacteria appear to play a role in the pathogenesis of ibs ; however , the factors that promote the bloom of methanogenic bacteria in patients with ibs are not yet known .
these findings indicate that microbial imbalance leads to gut dysfunction and contributes to ibs symptoms .
moreover , several meta - analyses have shown that the pathogenesis of ibs is influenced by multiple factors , all of which can result in gut dysbiosis.96 for example , intestinal infections with pathogenic bacteria such as salmonella , campylobacter , and shigella , are known to increase the risk of developing ibs.102 although enteric infections may directly influence gi motility , infection - induced dysbiosis may also contribute to post - infectious ibs symptoms.103104 moreover , epidemiologic studies have shown that the incidence of ibs symptoms is significantly increased in patients who , as children , were treated with antibiotics , particularly macrolides and tetracycline.105106 in summary , the effects of physical and psychological stressors and dietary factors such as fat consumption , on ibs have been extensively studied.96 however , the precise mechanisms by which these factors influence the gut microbial profile and lead to the development and/or progression of ibs are still unknown .
thus , more research is required to advance our current understanding of the relationship between the intestinal microbiota and gut dysfunction in ibs ( table 1 and fig .
mounting evidence suggests that the initiation and development of gi diseases are governed by multiple factors . as described above
, current studies indicate that the phenotype associated with commensal bacteria can shift from symbiotic to pathogenic in response to several risk factors . these phenotypic alterations impact
the host immune system and the other microorganisms , thereby leading to the development and/or progression of various gi diseases.107 based on this evidence , therapeutic approaches that aim to correct perturbations of the intestinal bacterial structure and its metabolic function will likely be most effective for the treatment of gi diseases .
for example , it has been reported that a diet low in fermentable oligosaccharides , disaccharides , monosaccharides , and polyols ( fodmaps ) reduces gi symptoms in ibs patients by altering the microbial composition and colonic luminal environment , including the ph and scfa level.108109 additionally , healthy fecal microbiota transfer ( fmt ) appears to be effective for the treatment of ibd.110 in a clinical study , all tested patients with ibd showed resolution of c. difficile symptoms post - fmt.111 in addition , fmt increased bacterial diversity and richness to levels similar to those of healthy donors.112 similarly , consumption of beneficial microorganisms , called probiotics , has shown great promise as a potential therapeutic approach for the treatment and prevention of crc.113 although more clinical trials are clearly needed , the potential role of probiotics in crc has been evaluated .
administration of lactobacillus johnsonii modulated immune responses and decreased the risk of pathogen colonization in crc patients.114 other studies have demonstrated that the administration of lactobacillus casei prevented the growth of colorectal tumors in crc patients for at least 4 years after treatment.115 these trials were limited by the small number of patients included and the short experimental period . therefore , in the future , larger studies are required to explore the full therapeutic potential of gut microbiota modulation in the treatment of gi diseases . | the gastrointestinal ( gi ) tract is colonized by a dense community of commensal microorganisms referred to as the gut microbiota . the gut microbiota and the host
have co - evolved , and they engage in a myriad of immunogenic and metabolic interactions .
the gut microbiota contributes to the maintenance of host health .
however , when healthy microbial structure is perturbed , a condition termed dysbiosis , the altered gut microbiota can trigger the development of various gi diseases including inflammatory bowel disease , colon cancer , celiac disease , and irritable bowel syndrome .
there is a growing body of evidence suggesting that multiple intrinsic and extrinsic factors , such as genetic variations , diet , stress , and medication , can dramatically affect the balance of the gut microbiota .
therefore , these factors regulate the development and progression of gi diseases by inducing dysbiosis .
herein , we will review the recent advances in the field , focusing on the mechanisms through which intrinsic and extrinsic factors induce dysbiosis and the role a dysbiotic microbiota plays in the pathogenesis of gi diseases . |
early childhood caries ( ecc ) has been defined as the occurrence of one or more carious lesions occurring in a child younger than 71 months of age .
caries is a multifactorial disease , and among the many factors associated with ecc , the role of stress has recently received a lot of attention [ 25 ] .
the relationship between caries and stress is not one of simple cause and effect and must be viewed in the context of socioeconomic factors .
recently a unifying conceptual model has suggested that in addition to environmental and child factors maternal factors , such as stress in the mother , could contribute significantly to the development of early childhood caries .
while some authors have suggested a positive correlation between the stress of parents and caries in children [ 7 , 8 ] , others using the same methods have found no association between stress and caries .
the development of caries in children of mothers with high stress has been attributed to the poor parenting and feeding habits that are a result of stress [ 4 , 6 , 9 ] .
it is known that stress in the parents , especially the mother , could be transmitted to their children .
however little attempt has been made to either quantify this stress using a biomarker or evaluate the correlation between the stress level of the parent and that of the child with relation to early childhood caries .
salivary cortisol levels provide an accurate , reliable , and noninvasive measure of stress in both adults and children .
cortisol is a hormone secreted by the hypothalamus pituitary adrenal axis ( hpaa ) and has been used as an accurate biomarker in stress research for over half a century . in dentistry
salivary cortisol has been used to measure the role of stress in a variety of settings from the anxiety of dental treatment [ 13 , 14 ] to periodontal disease and dental caries [ 15 , 16 ] .
children with ecc have constantly shown higher levels of salivary cortisol than their caries free counterparts suggesting that stress could influence the development of caries in children [ 2 , 5 ] . the aim of this study was to study the relationship between maternal stress , childhood stress , and early childhood caries , among working mothers from middle income families and their first born children using salivary cortisol as a biomarker .
ethical clearance for the study was obtained from the research center of the riyadh colleges of dentistry and pharmacy ( usrp-2011 - 010 , december 23rd , 2011 ) .
pamphlets in arabic about the objectives of the study and the need for volunteers were circulated among working mothers in riyadh city .
a total of 106 mothers contacted the authors and were then screened to evaluate if they met the inclusion criteria .
the procedure was explained to all selected mothers and they signed an informed consent form for themselves and on behalf of their child before participating in the study .
mothers were selected if they met the following inclusion criteria ; they were from a middle income family ( monthly household income between 14,000 and 20,000 sar [ us$ 37155305 ] ) ; they had a college education and were working .
the children were the first born children in the family were aged between 48 and 71 months of age and had one younger sibling .
the children were attending preschool and were placed in day - care centers during the working hours of the mother .
mothers who had children with a history of systemic illness or long - term medication were excluded from the study .
mothers who were themselves on antipsychotic medication or had a history of psychiatric illness were excluded from the study .
a total of 64 mothers and their first born children met the inclusion criteria .
saliva was collected using the passive drool method into sterile collection tubes ( greiner bio - one gmbh , austria ) .
these tubes were then stored in a vaccine box ( apex international , uttar pradesh , india ) at 5c before being transported to the lab for analysis . given the diurnal and intraweek variation in the levels of salivary cortisol , the samples were collected two hours after waking up on wednesday mornings . to standardize the time of collection parents who agreed to participate in the study consented to wake up their children at 0700 hrs .
a call was placed to the parents and children between 0700 and 0730 hrs on day of collection of saliva by one of the investigators to verify the time of waking up .
salivary cortisol was estimated using the electrochemiluminescence ( ecl ) immunoassay using an elecsys e immunoassay analyzer and the cobas salivary kit .
the dft of the children was recorded by one of the authors while another recorded the dmft of the mothers .
examination was done in a dental chair with a mouth mirror and ball ended probe using who criteria for the diagnosis of a carious lesion .
bitewing radiographs of both the children and the mothers were taken to assess the presence of proximal caries .
the power of the sample was calculated using the g - power 3.1.3 power analysis software ( universtt kiel , germany ) .
the minimum required sample for the intraclass correlation with an alpha of 0.05 and a one tailed model with an r of 0.3 was 110 ( 55 pairs ) .
the achieved power of this sample of 64 pairs with alpha of 0.05 and a two tailed model for the paired t test was 0.976 with a critical t of 1.99 .
the salivary cortisol data was subject to an analysis of skewness and the shapiro - wilk test for significance of skew .
the cortisol data had a skewness of 1.83 and the shapiro - wilk statistic ( 0.893 , p < 0.001 ) suggested a dataset with significant skew to the left . given the skew of cortisol values , nonparametric tests were used .
the mann - whitney u test was used to measure the significance of difference in the cortisol level of children with and without ecc , as well as in the cortisol levels of mothers of children with ecc and mothers of children without ecc . a paired samples correlation , the intraclass correlation coefficient ( icc ) was used to measure the association between the salivary cortisol levels of the children and that of their mothers .
spearman 's correlation was used to explore the relationship between the salivary cortisol level and the severity of the caries .
a logistic regression model was posited to explore the results of the correlation and examine the association between maternal cortisol levels , children 's cortisol levels , and the presence of ecc .
the sample comprised 64 mothers aged between 24 and 31 years ( mean age 27.2 2.6 years ) .
the children ( 34 boys and 30 girls ) were aged between 49 months and 70 months ( mean age 54.1 8.2 months ) , 24 of whom were caries free , while 40 had ecc .
the caries distribution of the children in the ecc group and the dmf of the mothers is tabulated in table 1 .
the salivary cortisol levels of the mothers ranged between .093 g / dl and .995 g / dl ( mean .358 .24 g / dl ) .
the salivary cortisol levels of the children ranged from .012 g / dl to .54 g / dl ( mean .165 .012
the mean salivary cortisol levels of children with ecc were significantly higher than caries free children .
the mean salivary cortisol levels of mothers of children with ecc were also significantly higher than those of mothers of caries free children .
( table 2 ) no significant gender differences were found in the salivary cortisol levels of the children . when the cortisol levels of the children were paired with those of their mothers , the intraclass correlation coefficient showed a highly significant correlation between the two .
( table 3 ) the pearson 's correlation showed significant correlation between salivary cortisol level of the child and the dft ( r = 0.549 , p < 0.0001 ) and between the salivary cortisol level of the mother and the dmft of the mother ( r = 0.349 , p = 0.004 ) .
however there was no correlation between the salivary cortisol level of the mother and the dft of the child ( r = 0.042 , p = 0.840 ) .
as these correlations suggest an association between stress and the incidence of ecc rather than the severity of ecc , a binary logistic regression model was framed using the presence or absence of ecc as the dependent variable and the maternal and child salivary cortisol levels as covariates .
the regression model showed a likelihood ratio of 11.22 and a nagelkerke r of .814 suggesting excellent goodness of fit .
the model suggested that significant associations existed between caries and the overall model , as well as caries and the salivary cortisol level of the child .
maternal cortisol levels , though positively associated with caries , did not show significant association in the model ( table 4 ) .
the association between stress , in both children and mothers , and ecc has been receiving considerable attention in recent literature [ 2 , 6 ] with authors seeking to expand on existing socio - dental models [ 1922 ] .
although the role of salivary cortisol , and thereby childhood stress , has been explored previously [ 2 , 3 , 5 ] , there is little data on maternal stress and ecc .
the goal of this study was to use salivary cortisol a biomarker to assess the impact of maternal stress on ecc in a selected socioeconomic group .
the role of social factors in dental caries in general and ecc in particular has been discussed in detail [ 2 , 6 , 19 ] . in order to detect the impact of stress on ecc we decided to choose a narrow social and economic construct for this study , reducing the effect of confounding factors .
poor education of the mother , low socioeconomic status [ 2 , 20 ] , being a single parent , and history of anxiety disorders [ 9 , 10 , 23 ] have all been shown to be risk factors for the development of caries and were thus made part of the exclusion criteria .
children of working mothers who were left at day - care centers were chosen for this study as it has been shown that the regulation of diet in the time the child is in the center actually helps to reduce the risk of caries . the analysis of salivary cortisol is technique sensitive and highly sensitive to diurnal variation [ 11 , 12 ] .
in addition there is also evidence to show that the cortisol levels are their highest early in the morning and on the last day of the working week .
it was for these reasons that the collection of cortisol was scheduled one hour after waking up on wednesday ( last day of the working week in saudi arabia ) .
the decision to use the passive drool method for collection of saliva was based on the work of putnam et al . who showed this to be a simple and effective technique for the recovery of cortisol in children .
the finding of significantly higher cortisol levels in children with ecc is in keeping with those previous studies [ 2 , 5 ] that indicate a higher cortisol levels in children with caries .
the finding of significantly higher cortisol levels in the mothers of children with ecc is , however , a previously unreported finding .
the role of maternal stress on the development of ecc has been previously reported and discussed [ 4 , 6 , 7 , 9 , 23 ] .
the finding of higher cortisol levels in mothers of children with ecc lends support to the argument that maternal stress is an integral part of the pathogenesis of caries in children [ 4 , 6 , 7 ] .
has often been discussed in the context of mothers with stress disorders [ 20 , 22 ] , single mothers , or familial stress [ 9 , 23 ] .
however the exclusion of these risk groups from our study sample indicates that the role of stress may be more ubiquitous than previously anticipated .
the strong correlation between the cortisol levels of the mother and those of the child is in keeping with recent anxiety research that maternal transmission of anxiety to their children may be a continuous process that has long - term implications .
most psychosocial models of ecc assign an indirect role to maternal stress suggesting that the poor oral habits and lack of time for the child 's oral health result in the development of caries [ 4 , 9 , 20 , 22 , 23 ] .
the aim of the regression model used in this study was to identify the impact that cortisol levels of the child and the mother had on dental caries .
the goodness of fit of the logistic regression model lends support to the assumption that maternal stress and the stress of the child are strongly linked to the presence of ecc in children .
the significant association of dft with salivary cortisol in the child , coupled with a lack of significant association with maternal cortisol in the regression model , seems to support the theories that stress in the child could have a direct influence on the occurrence of ecc [ 2 , 5 ] while also lending credence to the theory that maternal stress plays an indirect role in the development of caries [ 4 , 6 , 7 , 23 ] .
the results of this study however must be viewed within the limitations of the study itself .
the use of a narrow social and economic construct in this study , while useful in demonstrating the role of maternal stress , means that the study would need to be expanded to view the impact across different socioeconomic strata .
furthermore the high prevalence of ecc in saudi arabia [ 26 , 27 ] may actually mask the overall impact of maternal stress .
studies from countries with low caries rates could help explore in greater detail the impact of maternal stress .
within the limitations of the narrow sociodemographic cohort of this study , we can conclude that a definite relationship exists between salivary cortisol levels of the mother , salivary cortisol levels of the child , and the development of ecc .
a larger study that uses multiple sociodemographic groups and data from countries with varying prevalence of ecc could shed more light on the exact nature of the role of maternal stress . | objective . to compare salivary cortisol levels of children with ecc and their mothers with those of caries free children from a similar sociodemographic cohort . design .
sixty - four college - educated , working mothers from middle income families with no history of anxiety disorders and their first born children aged between 48 and 71 months were included in the study .
salivary cortisol levels were analyzed using electrochemiluminescence ( ecl ) immunoassay . statistical analyses .
significance of difference between the cortisol levels of children with ecc and control children and of their mothers was analyzed using the student 's t- test .
the intraclass correlation coefficient was used to measure the significance of correlation of cortisol levels between the mother and the child with logistic regression to explore possible associations .
results .
mothers of children with ecc had significantly higher levels of salivary cortisol ( p < 0.05 ) than mothers of caries free children .
the salivary cortisol levels of children with ecc were significantly higher than caries free children ( p < 0.0001 ) .
a significant correlation existed between the salivary cortisol level of the mother and that of the child ( p < 0.0001 ) . conclusion .
while salivary cortisol levels of the child seem to have a direct impact on the incidence of ecc , maternal stress seems to have an indirect effect . |
male sprague - dawley rats were made diabetic with a single intraperitoneal injection of 75 mg / kg stz ( sigma , st .
these diabetic rats were healthy and did not need insulin supplementation to maintain body weight .
insulin implants ( two linplant implants ; linshin canada , toronto , on , canada ) were placed subcutaneously into a subgroup of stz - diabetic rats after 18 weeks of diabetes and remained in place for a further 4 weeks to test the impact of suboptimal insulin levels on mitochondrial function .
animals were killed and tissue collected after 12 , 16 , or 22 weeks of diabetes .
animal procedures followed guidelines laid down by the university of manitoba animal care committee using the canadian council of animal care guidelines . nonfasting blood glucose concentration was measured using the accu - chek compact plus glucometer ( roche , laval , qc , canada ) and blood a1c levels by the a1cnow+ system ( bayer healthcare , sunnyvale , ca ) .
nerve sugar and polyol content was measured by gas chromatography of trimethylsilyl derivatives ( 17 ) and lipid peroxidation by spectrophotometric assay of total malondialdehyde ( mda ) and 4-hydroxyalkanal ( hae ) content ( lpo-586 kit , oxis , ca ) ( 20 ) .
cohorts 1 , 2 , and 3 ( table 1 ) were used to prepare lumbar drg tissue homogenates for mitochondrial respirometry , and another group ( cohort 4 ) was used as a source of mitochondrial preparations from lumbar drg .
lumbar drg were rinsed in ice - cold solution containing sucrose / tris / edta ( ste ) buffer ( 250 mmol / l sucrose , 10 mmol / l tris - hcl , 1 mmol / l edta , ph 7.4 ) and then homogenized with a polytron homogenizer ( kinematica , lucerne , switzerland ) using 3 7.5 s grinding pulses at 30-s intervals . in cohort 4 , mitochondria were isolated from lumbar drg using a differential centrifugation method ( 21 ) .
the degree of integrity of the mitochondrial preparation was tested by adding exogenous cytochrome c ( 10 mol / l ) in the presence of pyruvate , malate , and adp . under these conditions ,
the respiration rate in lumbar drg was increased by 17 8% in control and 22 9% in 22 weeks stz - diabetic rats ( means sd , n = 4 )
. this demonstrates a low level of fragmentation of the mitochondria and the similarity of the preparation between the two groups .
rat body weight , blood glucose levels , and glycated hemoglobin at end point starting body weight ranged between 275 and 325 g. cohorts were maintained for 1222 weeks .
rats from cohort 3 and 4 were used for the preparation of lumbar drg tissue homogenate samples and isolated mitochondria samples from lumbar drg , respectively .
values are means sd . * p < 0.05 vs. other groups ; * * p < 0.001 vs. diabetic ; * * * p < 0.05 vs. diabetic ( all by one - way anova with tukey 's post hoc test ) ; and * * * * p < 0.0001 vs. diabetic ( student 's t test ) .
note that % a1c values in cohort 3 were derived using the dca 2000 + kit ( n = 45 ) and for cohort 4 were generated using the a1c now kit ( n = 811 ) .
mitochondrial preparations were homogenized in ste buffer and 510 g protein resolved on a 10% sds - page gel and electroblotted onto nitrocellulose membrane .
blots were then blocked in 5% nonfat milk containing 0.05% tween-20 , rinsed in pbs ( ph 7.4 ) , and incubated with the following antibodies : monoclonal anti
cytochrome c oxidase subunit 4 ( cox iv , 1:1,000 ; mitosciences , eugene , or ) , monoclonal anti - nadh dehydrogenase ( ubiquinone ) iron - sulfur protein 3 ( ndufs3 , 1:1,000 ; mitosciences ) , and monoclonal anti - atp synthase subunit ( 1:2,000 dilution ; mitosciences ) .
extracellular signal regulated kinase ( erk , 1:2,000 ; covance ) was probed as a loading control ( previous studies show this protein to not change level of expression in drg in diabetes ) .
the blots were rinsed , incubated in western blotting luminol reagent ( santa cruz biotechnology ) , and imaged using a bio - rad fluor - s image analyzer ( bio - rad , hercules , ca ) .
oxygen consumption was determined at 37c using the oroboros oxygraph-2k ( oroboros instruments , innsbruck , austria ) ( 22 ) .
tissue homogenates or isolated mitochondria from lumbar drg were resuspended in kcl medium ( 80 mmol / l kcl , 10 mmol / l tris - hcl , 3 mmol / l mgcl2 , 1 mmol / l edta , 5 mmol / l potassium phosphate , ph 7.4 ) . various substrates and inhibitors for mitochondrial respiratory chain complexes were used as described in fig .
all measurements of enzymatic activities in lumbar drg mitochondrial preparations were performed spectrophotometrically using a temperature - controlled ultrospec 2100 ultraviolet - visible spectrophotometer ( biopharmacia biotech , uppsala , sweden ) .
complex i activity was measured as rotenone - sensitive nadh : cytochrome c reductase activity .
purified mitochondria were thawed and subjected to three freeze - thaw cycles to disrupt mitochondrial membranes and permit access of substrates . freshly prepared assay buffer ( 50 mmol / l k - phosphate , ph 7.4
, 1 mmol / l potassium cyanide ( kcn ) , 100 mol / l nadh ) and 10 g protein of mitochondrial preparation were added to the cuvette and preincubated for 3 min at 25c .
after addition of 100 mol / l oxidized cytochrome c , the reaction was followed for 2 min at 550 nm and then for 2 more minutes after addition of 25 mol / l rotenone to allow calculation of the rotenone - sensitive complex i activity .
complex iv activity was measured at 25c by monitoring the absorbance decrease of reduced cytochrome c at 550 nm ( 23 ) .
the reaction was started by addition of 40 mo / l reduced cytochrome c into 50 mmol / l phosphate buffer containing 5 g mitochondrial protein solubilized with 0.02% laurylmaltoside .
activity of the krebs cycle enzyme , citrate synthase , was determined at 25c in medium containing 150 mmol
/ l tris - hcl ( ph 8.2 ) , 0.02% laurylmaltoside , 0.1 mmol / l dithionitrobenzoic acid , and 5 g mitochondrial protein ( 24 ) .
the reaction was initiated by addition of 100 mol / l acetyl coa and changes in absorbance at 412 nm were measured for 1 min .
this value was subtracted from the rate obtained after addition of 0.05 mmol / l oxaloacetic acid .
adult lumbar drg sensory neuron cultures from age - matched control and 22-week stz - diabetic rats were prepared as described previously ( 17 ) .
neurons were suspended in modified bottenstein and sato 's n2 medium ( 0.1 mg / ml transferrin , 20 nmol / l progesterone , 100 mol / l putrescine , 30 nmol / l sodium selenite , and 1 mg / ml bsa , 0.01 mmol / l cytosine arabinoside ; all from sigma ) in ham 's f12 . to mimic in vivo conditions , the following additions were made to the basal defined medium : control 10 nmol
ros levels were imaged on a carl zeiss lsm510 inverted confocal microscope using two dyes : dihydrorhodamine 123 ( dhr123 ) or 5-(and-6)-chlromethyl-27-dichlorohydrofluorescein diacetate acetyl ester ( cm - h2dcfda ) .
/ l dhr 123 ( sigma , in 100% stock solution ) or 1.2 mol / l cm - h2dcfda ( invitrogen , carlsbad , ca ) for 30 or 15 min , respectively , at 37c .
ros generation in lumbar drg mitochondria from control and 22-week stz - diabetic rats was evaluated by the detection of h2o2 .
hydrogen peroxide production was determined fluorometrically by measuring oxidation of amplex red ( invitrogen ) ( 22 ) .
fluorescence of the amplex red oxidation product was measured at 25c using spectramax gemini spectrofluorometer ( molecular devices , sunnyvale , ca ) .
the assay was performed with 100 g mitochondrial protein per milliliter in kcl - based medium supplemented with 10 mmol / l pyruvate and 5 mmol / l malate in the presence or absence of antimycin a ( 10 g / ml ) .
amplex red was used at 50 mol / l , with horseradish peroxidase at 0.5 units / ml . function of small sensory neurons was inferred by measuring hind paw thermal response latency using a modified hargreaves apparatus ( university anesthesia research and development , san diego , ca ) with a heating rate of 1c / s from a baseline of 30c and with a cutoff at 20 s ( 25 ) .
the structural integrity of small sensory neurons was assessed by measuring intraepidermal nerve fiber ( ienf ) profiles in hind paw plantar skin that was immersion fixed in 4% paraformaldehyde and processed to paraffin blocks .
sections ( 6 m ) were stained with the pan - neuronal marker pgp9.5 ( 1:1,000 ; biogenesis , u.k . ) and viewed under a light microscope to allow counting of ienf and subepidermal nerve profiles per unit length of the dermal : epidermal border ( 26 ) .
structural integrity of large myelinated fibers was assessed by measuring mean axonal caliber in distal tibial nerves that were immersion fixed in 2.5% glutaraldehyde , postfixed in osmium tetroxide , and processed to araldite blocks before cutting 1.0-m sections .
tissue sections were stained with p - phenylenediamine and viewed under a light microscope connected to a computer running image analysis software to allow calculation of axonal diameter ( 17 ) .
where appropriate , data were subjected to one - way anova with post hoc comparison using tukey 's test or two - way anova with bonferroni 's post hoc tests ( graphpad prism 4 ; graphpad software , san diego , ca ) . in all other cases ,
male sprague - dawley rats were made diabetic with a single intraperitoneal injection of 75 mg / kg stz ( sigma , st .
these diabetic rats were healthy and did not need insulin supplementation to maintain body weight .
insulin implants ( two linplant implants ; linshin canada , toronto , on , canada ) were placed subcutaneously into a subgroup of stz - diabetic rats after 18 weeks of diabetes and remained in place for a further 4 weeks to test the impact of suboptimal insulin levels on mitochondrial function .
animals were killed and tissue collected after 12 , 16 , or 22 weeks of diabetes .
animal procedures followed guidelines laid down by the university of manitoba animal care committee using the canadian council of animal care guidelines . nonfasting blood glucose concentration was measured using the accu - chek compact plus glucometer ( roche , laval , qc , canada ) and blood a1c levels by the a1cnow+ system ( bayer healthcare , sunnyvale , ca ) .
nerve sugar and polyol content was measured by gas chromatography of trimethylsilyl derivatives ( 17 ) and lipid peroxidation by spectrophotometric assay of total malondialdehyde ( mda ) and 4-hydroxyalkanal ( hae ) content ( lpo-586 kit , oxis , ca ) ( 20 ) .
cohorts 1 , 2 , and 3 ( table 1 ) were used to prepare lumbar drg tissue homogenates for mitochondrial respirometry , and another group ( cohort 4 ) was used as a source of mitochondrial preparations from lumbar drg .
lumbar drg were rinsed in ice - cold solution containing sucrose / tris / edta ( ste ) buffer ( 250 mmol / l sucrose , 10 mmol / l tris - hcl , 1 mmol / l edta , ph 7.4 ) and then homogenized with a polytron homogenizer ( kinematica , lucerne , switzerland ) using 3 7.5 s grinding pulses at 30-s intervals . in cohort 4 , mitochondria were isolated from lumbar drg using a differential centrifugation method ( 21 ) .
the degree of integrity of the mitochondrial preparation was tested by adding exogenous cytochrome c ( 10 mol / l ) in the presence of pyruvate , malate , and adp . under these conditions ,
the respiration rate in lumbar drg was increased by 17 8% in control and 22 9% in 22 weeks stz - diabetic rats ( means sd , n = 4 )
. this demonstrates a low level of fragmentation of the mitochondria and the similarity of the preparation between the two groups .
rat body weight , blood glucose levels , and glycated hemoglobin at end point starting body weight ranged between 275 and 325 g. cohorts were maintained for 1222 weeks .
rats from cohort 3 and 4 were used for the preparation of lumbar drg tissue homogenate samples and isolated mitochondria samples from lumbar drg , respectively .
* p < 0.05 vs. other groups ; * * p < 0.001 vs. diabetic ; * * * p < 0.05 vs. diabetic ( all by one - way anova with tukey 's post hoc test ) ; and * * * * p < 0.0001 vs. diabetic ( student 's t test ) . note that % a1c values in cohort 3 were derived using the dca 2000 + kit ( n = 45 ) and for cohort 4 were generated using the a1c now kit ( n = 811 ) .
mitochondrial preparations were homogenized in ste buffer and 510 g protein resolved on a 10% sds - page gel and electroblotted onto nitrocellulose membrane .
blots were then blocked in 5% nonfat milk containing 0.05% tween-20 , rinsed in pbs ( ph 7.4 ) , and incubated with the following antibodies : monoclonal anti
cytochrome c oxidase subunit 4 ( cox iv , 1:1,000 ; mitosciences , eugene , or ) , monoclonal anti - nadh dehydrogenase ( ubiquinone ) iron - sulfur protein 3 ( ndufs3 , 1:1,000 ; mitosciences ) , and monoclonal anti - atp synthase subunit ( 1:2,000 dilution ; mitosciences ) .
extracellular signal regulated kinase ( erk , 1:2,000 ; covance ) was probed as a loading control ( previous studies show this protein to not change level of expression in drg in diabetes ) .
the blots were rinsed , incubated in western blotting luminol reagent ( santa cruz biotechnology ) , and imaged using a bio - rad fluor - s image analyzer ( bio - rad , hercules , ca ) .
oxygen consumption was determined at 37c using the oroboros oxygraph-2k ( oroboros instruments , innsbruck , austria ) ( 22 ) .
tissue homogenates or isolated mitochondria from lumbar drg were resuspended in kcl medium ( 80 mmol / l kcl , 10 mmol / l tris - hcl , 3 mmol / l mgcl2 , 1 mmol / l edta , 5 mmol / l potassium phosphate , ph 7.4 ) .
various substrates and inhibitors for mitochondrial respiratory chain complexes were used as described in fig .
all measurements of enzymatic activities in lumbar drg mitochondrial preparations were performed spectrophotometrically using a temperature - controlled ultrospec 2100 ultraviolet - visible spectrophotometer ( biopharmacia biotech , uppsala , sweden ) .
complex i activity was measured as rotenone - sensitive nadh : cytochrome c reductase activity .
purified mitochondria were thawed and subjected to three freeze - thaw cycles to disrupt mitochondrial membranes and permit access of substrates . freshly prepared assay buffer ( 50 mmol / l k - phosphate , ph 7.4
, 1 mmol / l potassium cyanide ( kcn ) , 100 mol / l nadh ) and 10 g protein of mitochondrial preparation were added to the cuvette and preincubated for 3 min at 25c .
after addition of 100 mol / l oxidized cytochrome c , the reaction was followed for 2 min at 550 nm and then for 2 more minutes after addition of 25 mol / l rotenone to allow calculation of the rotenone - sensitive complex i activity .
complex iv activity was measured at 25c by monitoring the absorbance decrease of reduced cytochrome c at 550 nm ( 23 ) .
the reaction was started by addition of 40 mo / l reduced cytochrome c into 50 mmol / l phosphate buffer containing 5 g mitochondrial protein solubilized with 0.02% laurylmaltoside .
activity of the krebs cycle enzyme , citrate synthase , was determined at 25c in medium containing 150 mmol / l tris - hcl ( ph 8.2 ) , 0.02% laurylmaltoside , 0.1 mmol / l dithionitrobenzoic acid , and 5 g mitochondrial protein ( 24 ) .
the reaction was initiated by addition of 100 mol / l acetyl coa and changes in absorbance at 412 nm were measured for 1 min .
this value was subtracted from the rate obtained after addition of 0.05 mmol / l oxaloacetic acid .
adult lumbar drg sensory neuron cultures from age - matched control and 22-week stz - diabetic rats were prepared as described previously ( 17 ) .
neurons were suspended in modified bottenstein and sato 's n2 medium ( 0.1 mg / ml transferrin , 20 nmol / l progesterone , 100 mol / l putrescine , 30 nmol / l sodium selenite , and 1 mg / ml bsa , 0.01 mmol / l cytosine arabinoside ; all from sigma ) in ham 's f12 . to mimic in vivo conditions ,
the following additions were made to the basal defined medium : control 10 nmol / l insulin and diabetic 25 mmol / l glucose .
ros levels were imaged on a carl zeiss lsm510 inverted confocal microscope using two dyes : dihydrorhodamine 123 ( dhr123 ) or 5-(and-6)-chlromethyl-27-dichlorohydrofluorescein diacetate acetyl ester ( cm - h2dcfda ) .
/ l dhr 123 ( sigma , in 100% stock solution ) or 1.2 mol / l cm - h2dcfda ( invitrogen , carlsbad , ca ) for 30 or 15 min , respectively , at 37c . for dhr 123 and cm - h2dcfda , excitation / emission was 488/>505 nm .
ros generation in lumbar drg mitochondria from control and 22-week stz - diabetic rats was evaluated by the detection of h2o2 .
hydrogen peroxide production was determined fluorometrically by measuring oxidation of amplex red ( invitrogen ) ( 22 ) .
fluorescence of the amplex red oxidation product was measured at 25c using spectramax gemini spectrofluorometer ( molecular devices , sunnyvale , ca ) .
the assay was performed with 100 g mitochondrial protein per milliliter in kcl - based medium supplemented with 10 mmol / l pyruvate and 5 mmol / l malate in the presence or absence of antimycin a ( 10 g / ml ) .
amplex red was used at 50 mol / l , with horseradish peroxidase at 0.5 units / ml .
function of small sensory neurons was inferred by measuring hind paw thermal response latency using a modified hargreaves apparatus ( university anesthesia research and development , san diego , ca ) with a heating rate of 1c / s from a baseline of 30c and with a cutoff at 20 s ( 25 ) .
the structural integrity of small sensory neurons was assessed by measuring intraepidermal nerve fiber ( ienf ) profiles in hind paw plantar skin that was immersion fixed in 4% paraformaldehyde and processed to paraffin blocks .
sections ( 6 m ) were stained with the pan - neuronal marker pgp9.5 ( 1:1,000 ; biogenesis , u.k . ) and viewed under a light microscope to allow counting of ienf and subepidermal nerve profiles per unit length of the dermal : epidermal border ( 26 ) .
structural integrity of large myelinated fibers was assessed by measuring mean axonal caliber in distal tibial nerves that were immersion fixed in 2.5% glutaraldehyde , postfixed in osmium tetroxide , and processed to araldite blocks before cutting 1.0-m sections .
tissue sections were stained with p - phenylenediamine and viewed under a light microscope connected to a computer running image analysis software to allow calculation of axonal diameter ( 17 ) .
where appropriate , data were subjected to one - way anova with post hoc comparison using tukey 's test or two - way anova with bonferroni 's post hoc tests ( graphpad prism 4 ; graphpad software , san diego , ca ) . in all other cases ,
stz - diabetic rats did not suffer weight loss during the study but showed reduced weight gain after 1222 weeks of stz - induced diabetes compared with age - matched controls ( table 1 ) .
persistence of diabetes was also indicated by elevated nonfasting blood glucose and glycated hemoglobin levels ( table 1 ) .
stz - diabetic rats of cohorts 3 and 4 that received insulin supplementation for the final 4 weeks of a 22-week period of diabetes showed a partial recovery of body weight accompanied by a partial decrease in blood glucose , but retained elevated glycated hemoglobin levels .
insulin treatment also partially lowered nerve glucose content and corrected the deficit in myo - inositol ( table 2 ) .
diabetes - induced increases in nerve fructose content and lipid peroxidation were not altered by insulin therapy .
nerve protein content was not altered by diabetes , whereas insulin treatment significantly increased this parameter above in both controls and untreated diabetic rats .
sugar , protein , and lipid peroxidation levels in sciatic nerve sciatic nerves were taken from cohort 4 .
values are means sd ( n = 69 ) . * p < 0.05 vs. control ; * * p < 0.05 vs. diabetic + insulin .
there was no overt evidence of degeneration in the distal tibial nerve of rats after 22 weeks of diabetes ( supplemental fig .
1a and , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1299/dc1 ) , and morphometric analysis indicated a mild trend toward decreased mean axonal diameter associated with a shift in the size - frequency distribution toward smaller fibers ( supplemental fig .
paw thermal response latency was normal in rats after 22 weeks of diabetes , as were both ienf and subepidermal nerve profile counts ( supplemental fig .
insulin supplementation for the last 4 weeks of diabetes significantly increased paw ienf profile number compared with controls ( supplemental fig .
mitochondrial respiratory chain activity of drg was determined using a clarke type electrode in the presence of specific substrates and inhibitors of the mitochondrial respiratory chain .
figure 1 demonstrates typical measurements of oxygen consumption in freshly isolated mitochondria of lumbar drg from age - matched control , diabetic , and insulin - treated diabetic rats . basal respiration in lumbar drg mitochondria
is stated as respiration at state 4 with energetic substrates , pyruvate and malate ( p + m ) . coupled respiration at state 3 was induced by addition of adp .
after this measurement , the atp - synthase specific inhibitor , oligomycin ( ol ) , was added to prevent reverse pumping of protons by the atpase , and then the uncoupled rate was determined by adding the uncoupling agent , carbonylcyanide p - trifluoromethoxyphenylhydrazone ( fccp ) .
uncoupled respiration was inhibited at complex iii by antimycin a. ascorbate ( asc ) and n , n , n,n-tetramethyl - p - phenylenediamine ( tmpd ) were then added to determine the capacity of cytochrome c oxidase ( complex iv ) .
tmpd is an artificial redox mediator that assists transfer of electrons from ascorbate to cytochrome c. complex iv respiration was calculated as the portion sensitive to kcn , a specific inhibitor of cytochrome c oxidase .
representative measurements of oxygen consumption in isolated lumbar drg mitochondria from control , diabetic , and insulin - treated diabetic rats .
freshly isolated lumbar drg mitochondria were assessed in control ( a ) , diabetic ( b ) , and insulin - treated ( c ) diabetic rats using oroboros oxygraph 2k as described in research design and methods .
thick lines indicate the level of oxygen in the chamber of electrode and expressed in nanomoles per milliliter .
thin lines indicate oxygen flux per mass ( picomoles o2 per second per milligram protein ) in the presence of specific substrates and inhibitors of the mitochondrial respiratory chain .
mmol / l ) ; m , malate ( 5 mmol / l ) ; adp , adenosine diphosphate ( 2 mmol / l ) ; ol , oligomycin ( 1.0
mol / l ) ; aa , antimycin a ( 1 g / ml ) ; asc , ascorbate ( 5 mmol / l ) ; tmpd , n , n , n,n-tetramethyl - p - phenylenediamine dihydrochloride ( 0.5 mmol / l ) ; kcn , potassium cyanide ( 0.25 mmol / l ) . basal respiration with pyruvate and malate ( p + m ) , rates of coupled respiration at state 3 , and the respiration rate with ascorbate and tmpd ( asc + tmpd ; complex iv ) of lumbar drg tissue homogenates from control and stz - diabetic rats were not changed after 12 weeks of diabetes ( fig .
, there was a statistically nonsignificant decrease in coupled respiration and the respiration rate with asc + tmpd in stz - diabetic rats .
with progression of untreated diabetes to 22 weeks in both lumbar drg tissue homogenates ( fig .
3b ) , coupled respiration with p + m was decreased by 3144% in diabetic rats compared with control lumbar drg tissue .
respiration rates with asc + tmpd were decreased by 2939% in diabetic lumbar drg tissues and mitochondrial preparations and protected by insulin ( figs . 2c and 3d ) .
uncoupled respiration in mitochondria isolated from lumbar drg was also decreased in stz - diabetic rats compared with control and significantly improved by insulin supplementation ( fig .
these deficits were specific for lumbar drg , since similar measurements in cortex revealed no effect after 22 weeks of diabetes ( supplemental table 1 ) .
effect of 1222 weeks of stz - induced diabetes on the activity of the mitochondrial respiratory chain in freshly prepared lumbar drg tissue homogenate .
measurements of oxygen consumption were performed with energetic substrates , pyruvate and malate , as described in fig .
1 . basal respiration ( a ) , pyruvate + malate + adp ( coupled oxidative phosphorylation ) ( b ) , and the respiration rate with asc + tmpd ( complex iv ) ( c ) were assessed in age - matched controls ( ctrl ) , stz - diabetic rats ( db ) , and stz - diabetic rats with insulin implant ( db + ins ) at 12 ( n = 5 ) , 16 ( n = 711 ) , and 22 ( n = 56 ) weeks of diabetes .
values are means sd ; n = as indicated . * p < 0.05 vs. db + ins ; * * p < 0.001 vs. db ( one - way anova with tukey 's post hoc comparison ) .
mitochondrial respiratory chain activity is impaired in freshly isolated mitochondria from lumbar drg of 22 weeks of stz - diabetic rats .
after measurement of coupled respiration , the atp synthase specific inhibitor , oligomycin , was added to prevent reverse pumping of protons by the atpase , and then the uncoupled rate of mitochondrial respiration was generated by adding the uncoupling agent fccp . basal respiration ( a ) , pyruvate + malate + adp ( coupled oxidative phosphorylation ) ( b ) , fccp ( uncoupled respiration ) ( c ) , and the respiration rate with asc + tmpd ( complex iv ) ( d ) were measured in age - matched controls ( ctrl ) , stz - diabetic rats ( db ) , and stz - diabetic rats with insulin implant ( db + ins ) after 22 weeks of diabetes .
values are means sd , n = 6 . * p < 0.05 vs. other groups ; * * p < 0.05 vs. db + ins ( one - way anova with tukey 's post hoc comparison ) .
treatment of the mitochondrial preparation with the uncoupler fccp induced a four- to sixfold elevation in the rate of oxygen consumption over the basal rate confirming that the mitochondrial preparations were intact and of high quality in all groups .
enzymatic activities of mitochondrial complexes and the krebs cycle enzyme , citrate synthase , were assessed in mitochondria isolated from lumbar drg of age - matched control and 22-week stz - diabetic rats .
the activity of mitochondrial complex i was assessed as rotenone - sensitive nadh - cytochrome c reductase when cytochrome c is the acceptor of electrons . the enzymatic activities of rotenone - sensitive nadh - cytochrome c reductase ( complex i ) and cytochrome c oxidase ( complex iv ) as well as the krebs cycle enzyme , citrate synthase ,
enzymatic activities of mitochondrial respiratory chain and citrate synthase activity are decreased in isolated mitochondria from lumbar drg of stz - diabetic rats .
enzymatic activity of complex i was assessed as rotenone - sensitive portion of nadh - cytochrome c reductase ( nccr ) ( n = 5 ) ( a ) , cytochrome c oxidase ( n = 67 ) ( b ) , and citrate synthase ( n = 5 ) ( c ) and was measured as described in research design and methods .
values are means sd , n = as indicated . * p < 0.05 vs. control ( ctrl ) ( unpaired student 's t test ) .
if decreased mitochondrial activity in diabetic animals was associated with alterations in ros generation , adult sensory neurons from lumbar drg were cultured from age - matched control and stz - diabetic rats and assessed within 2 h of plating for levels of ros using the fluorescent dyes dhr 123 and cm - h2dcfda .
figure 5a c show that sensory neurons from all treatment groups exhibited similar levels of dhr 123 fluorescence emission from perikarya . in a separate group of stz - diabetic rats , ros levels in acutely isolated neurons were detected using cm - h2dcfda and confirmed the lack of any effect of diabetes on ros generation ( fig .
f ) . ros generation ( h2o2 as detected by amplex red ) by mitochondria isolated from lumbar drg of age - matched control or 22-week stz - diabetic rats was detected fluorometrically using the amplex red kit .
ros generation in lumbar drg mitochondria in the presence of the substrates , pyruvate and malate , was not elevated in stz - diabetic rats compared with control ( fig .
however , when mitochondria samples were treated with antimycin a ( a specific inhibitor of complex iii ) , control rats significantly increased ros production compared with age - matched stz - diabetic rats ( fig .
5h ) . finally , quantitative western blotting showed diminished expression of some components of the mitochondrial electron transport chain ( fig .
ndufs3 ( component of complex i ) and cox iv ( component of complex iv ) were significantly decreased by 50 and 20% , respectively , whereas levels of atp synthase -subunit and erk remained unaltered .
ros were not elevated in acutely isolated drg sensory neurons or mitochondria from stz - diabetic rats .
a f : ros levels were assessed using real - time fluorescence imaging of dhr 123 or cm - h2dcfda .
a and b : dhr 123 loaded neurons from acutely isolated lumbar drg neurons of control or stz - diabetic rats .
values are means sem ( n = 5080 neurons , observed in five independently assessed control ( ctrl ) and diabetic ( db ) rats ) .
d and e : cm - h2dcfda based ros imaging of sensory neurons from control and stz - diabetic rats .
values are means sem ( n = 200230 neurons , observed in two independently assessed control and diabetic rats ) .
g : ros generation is not elevated in isolated mitochondria from lumbar drg of diabetic rats compared with control .
mitochondrial ros generation was measured at state 4 with substrates pyruvate and malate ( p + m ) in the absence or presence of antimycin a ( aa ) .
h2o2 was measured fluorometrically in 0.1 mg / ml mitochondrial suspension with amplex red kits ( 50 mol / l amplex red and 0.5 units / ml horseradish peroxidase )
significance level was determined by two - way anova with bonferroni 's post hoc tests . * * p < 0.01 for control ( p + m ) vs. control ( p + m + aa ) .
( a high - quality color representation of this figure is available in the online issue . ) expression of components of the electron transport chain are reduced in drg from stz - diabetic rats . shown
are representative blots ( a d ) and charts in which ndufs3 ( e ) , cox iv ( f ) , and atp synthase subunit signal ( g ) have been presented relative to total erk level .
values are the means sem , n = 6 . * * p < 0.005 vs. control ( ctr ) , * p < 0.05 vs. db + ins ( one - way anova with tukey 's post hoc test ) .
in this study , we show , we believe for the first time , that mitochondrial respiratory function , activity , and expression of components of the respiratory chain and the krebs cycle enzyme , citrate synthase , are decreased in drg sensory neurons from rats with type 1 diabetes . this novel observation provides direct functional evidence of diabetes - induced alterations in mitochondrial performance at multiple sites along the mitochondrial respiratory chain .
previous studies have used only indirect assessments of mitochondrial inner - membrane polarization to analyze mitochondrial dysfunction in drg sensory neurons in diabetes ( 1719 ) .
these observations imply that the diabetes - induced impairment of mitochondrial function is not associated with generation of oxidative stress .
mitochondrial dysfunction has been proposed to mediate development of diabetes complications in endothelial cells , skeletal muscle , cardiomyocytes , and neurons ( 1214,27 ) .
studies of isolated endothelial cells demonstrate that a short period of exposure to high glucose concentrations induces hyperpolarization of the mitochondrial inner membrane , which is a consequence of glycolysis - driven enhancement of electron donation from the tricarboxylic acid pathway ( 5 ) .
it was therefore proposed that the high electrochemical potential difference across the mitochondrial membrane , driven by excessive proton gradient , prolonged the life of superoxide - producing electron transfer intermediates such as ubi - semiquinone ( 5 ) .
however , recent studies have revealed that respiration and enzymatic activities are decreased in mitochondria from hearts of stz - diabetic rats ( 12,13 ) , whereas several studies have reported decreased activity of the mitochondrial respiratory chain and the krebs cycle enzyme , citrate synthase , in skeletal muscle of patients with type 2 diabetes ( 1416 ) .
our data are consistent with these findings and indicate that decreased rates of respiration and activities of mitochondrial complexes and citrate synthase occur in nervous tissues exposed to prolonged diabetes in vivo . diminished mitochondrial respiratory function caused by diabetes has been investigated by proteomic and gene array techniques ( 28,29 ) . reduced expression of oxidative phosphorylation genes have been found in type 2 diabetes ( 30 ) , and decreased expression of the transcriptional regulator nrf-1 and the transcriptional coactivator peroxisome proliferator activated receptor- coactivator 1 ( pgc-1 ) were observed in pre - diabetic and diabetic muscle ( 31 ) .
6 are consistent with these findings and support the suggestion that reduced activity of the mitochondrial respiratory chain could result from a proteome alteration leading to reduced expression / activity of a range of mitochondrial components .
studies in lens ( 32 ) , retina ( 33 ) , and cardiac tissue ( 34 ) in experimental animal models of type 1 diabetes show that parts of glycolytic pathway function are depressed . in diabetic rats ,
activity of 6-phosphofructokinase is reduced in nerve ( 35 ) , and activity of hexokinase , the first rate - limiting step in glycolysis , is reduced in drg ( 36 ) . diminished activity of glycolytic pathway enzymes
may combine to reduce delivery of pyruvate and other glucose metabolism - dependent products to the tricarboxylic acid pathway ( 3234,37 ) , and it has been shown that pool sizes of products of glycolysis , such as pyruvate , are either unchanged or reduced in diabetes ( 33,38 ) .
it therefore appears that rates of electron donation to the electron transport chain are suboptimal in adult diabetic rats and may predispose to lower rates of mitochondrial respiratory chain activity and oxidative phosphorylation . finally , a diabetes - induced rise in resting intracellular calcium to 200 nmol / l ( 39 ) can trigger elevated mitochondrial ca buffering by entry of ca through the ca uniporter and other routes , which can cause partial or complete inner mitochondrial membrane depolarization ( 27 ) . there is evidence of aberrant mitochondrial buffering of calcium in neurons from diabetic rats .
plasma membrane depolarization - induced ca transients are prolonged in diabetic neurons and blockade of mitochondrial uptake of ca using the mitochondrial uncoupler , cccp , prevented these abnormalities ( 40 ) .
this implies , indirectly , that abnormal mitochondrial buffering of ca plays a role in shaping ca transients in diabetic neurons . in our present study ,
impaired mitochondrial respiratory chain activity was not accompanied by increased ros production in neuronal perikarya from stz - diabetic rats , whereas generation of ros in mitochondria from stz - diabetic rats treated with pyruvate and malate in the presence of antimycin a was significantly decreased compared with control . in contrast , studies using cultures of embryonic sensory neurons showed that a high concentration of glucose directly triggers oxidative stress and apoptosis ( 8) , suggesting differences in ros production or management between embryonic and adult neurons in culture .
we have recently found that ros levels and adducts of 4-hydroxy-2-nonenal are elevated in the presence of high glucose in axons of adult sensory neurons isolated from 3- to 5-month stz - diabetic rats , with the perikarya being unaffected ( 41 ) .
oxidative damage to lipids in the sciatic nerve was increased in the present study , supporting previous work ( 9,42,43 ) .
these results suggest that mitochondrial function may differ between axons and perikarya or that oxidative stress in axons and other cells of the nerve trunk may derive from alternative sources .
our studies were performed in rats that showed relatively mild stz - induced diabetes , as indicated by maintenance of starting body weight over a long period of time .
marked hyperglycemia and increased a1c indicate that these rats were clearly diabetic and established biochemical consequences of hyperglycemia such as nerve polyol pathway flux ( indicated by nerve fructose accumulation ) and lipid peroxidation were present .
this model contrasts with the acute and extreme stz - induced insulin - deficient diabetes frequently studied in rats and mice that may not adequately model long - term diabetes in well - managed patients .
the absence of significantly reduced axonal caliber in myelinated fibers , altered thermal nociception , or loss of ienf after 22 weeks of diabetes confirms that stz lacked direct neurotoxic effects and emphasizes the relatively mild nature of the diabetes in our rats , since all of these disorders have been widely reported in previous stz - diabetic rodent studies . we do not suspect a lack of discrimination in our assays , as we have previously reported reduced axonal caliber ( 44 ) , thermal hypoalgesia ( 25 ) , and ienf loss ( 26 ) in stz - diabetic rodents .
given that the rats in our present study showed marked hyperglycemia , polyol pathway flux , and lipid peroxidation , the data may suggest that additional risk factors may be required in concert with these established biochemical disorders to generate the indices of neuropathy described above .
mitochondrial dysfunction appeared only after 16 weeks of diabetes and therefore represents a metabolic disorder of neurons that can emerge before onset of functional and structural manifestations of diabetic neuropathy .
interestingly , abnormalities in calcium homeostasis also appear after 812 weeks of diabetes and could possibly preempt mitochondrial dysfunction ( 39 ) .
the pathogenesis of this mitochondrial disorder may involve insulin deficiency per se , since our insulin treatment regime for the last month of diabetes had minimal effects on indices of systemic diabetes such as body weight , plasma , nerve sugar levels , lipid peroxidation , and a1c , but had marked effects on mitochondrial dysfunction .
these findings agree with prior reports that insulin has direct effects on mitochondrial function ( 17,45 ) .
insulin treatment also increased nerve total protein and ienf values above those of age - matched control rats , which may reflect the capacity of insulin to induce sensory neuron axonal sprouting ( 46,47 ) .
the contribution of impaired insulin signaling to complications of both type 1 and type 2 diabetes , either independent of , or in concert with , hyperglycemia is clearly an area of emerging interest that deserves further study ( 11,4648 ) . in conclusion ,
our data show that mitochondrial respiratory chain function and activity / expression of mitochondrial complexes as well as the krebs cycle enzyme , citrate synthase , are decreased in mitochondria isolated from drg of stz - diabetic rats and can be normalized by insulin at levels that do not markedly alter the consequences of hyperglycemia .
the appearance of mitochondrial dysfunction at a time before onset of overt functional or structural neuropathy indicates the possibility of a pathogenic role for insulin deficiency in diabetic neuropathy that is independent of hyperglycemia .
| objectiveimpairments in mitochondrial physiology may play a role in diabetic sensory neuropathy .
we tested the hypothesis that mitochondrial dysfunction in sensory neurons is due to abnormal mitochondrial respiratory function.research design and methodsrates of oxygen consumption were measured in mitochondria from dorsal root ganglia ( drg ) of 12- to- 22-week streptozotocin ( stz)-induced diabetic rats , diabetic rats treated with insulin , and age - matched controls . activities and expression of components of mitochondrial complexes and reactive oxygen species ( ros ) were analyzed.resultsrates of coupled respiration with pyruvate + malate ( p + m ) and with ascorbate + tmpd ( asc + tmpd ) in drg were unchanged after 12 weeks of diabetes . by 22 weeks of diabetes , respiration with p + m was significantly decreased by 3144% and with asc + tmpd by 2939% compared with control .
attenuated mitochondrial respiratory activity of stz - diabetic rats was significantly improved by insulin that did not correct other indices of diabetes .
activities of mitochondrial complexes i and iv and the krebs cycle enzyme , citrate synthase , were decreased in mitochondria from drg of 22-week stz - diabetic rats compared with control .
ros levels in perikarya of drg neurons were not altered by diabetes , but ros generation from mitochondria treated with antimycin a was diminished compared with control
. reduced mitochondrial respiratory function was associated with downregulation of expression of mitochondrial proteins.conclusionsmitochondrial dysfunction in sensory neurons from type 1 diabetic rats is associated with impaired rates of respiratory activity and occurs without a significant rise in perikaryal ros . |
behcet s disease ( bd ) is known to be a systemic disease of unknown process affecting multi - organs with a variety of clinical manifestations , which are a result of systemic vasculitis caused by the deposition of immune complex onto the eye , skin , joint and central nervous system .
but the pulmonary involvements , which include pulmonary artery aneurysm ( paa ) , pulmonary infiltrates and pulmonary infarction , in bd are uncommon .
there were a few cases of female bd patients with paa reported , but there was no report in korea . in this article , we report a rare case of bd , combined with paa , confirmed by pulmonary angiogram in a korean female patient .
a 21-year - old korean woman had suffered from dyspnea and cough for the past 3 months .
she was healthy until 2 years ago , when she first noticed both knee joints to swell and subside spontaneously .
two months ago , chest p - a showed heterogenous , hazy , streaky densities on both lower lung fields and a well - marginated homogenous squared shape of mass - like density on the right middle lung ( fig .
she was treated with isoniazid , rifampin and pyrazinamide under the diagnosis of pulmonary tuberculosis , which was not confirmed by microbiologic study , at a private clinic .
after 2 months of anti - tuberculous drugs , the chest x - ray revealed much improved infiltrations on both lower lung fields and right middle lung , but with newly developed lobulated , round homogenous density , with 44 cm in diameter , at the left hilar region ( fig .
2 ) . she was transferred to our hospital for the evaluation of the left hilar lung mass .
she denied fever , sweats , hemoptysis , headache , otalgia and otorrhea , and bladder or bowel dysfunction .
the temperature was 36.8 c , the pulse was 68 and the respiration was 18 .
the blood pressure was 130/80 mmhg . on physical examination , she appeared pale and chronically ill .
she had multiple ulcerations on lower lip and oral cavity near right premolar teeth , but not on genital area .
the skin examination revealed erythematous , tender nodules on wrist and both pretibial areas , which were pathologically proven as erythema nodosum .
the hematocrit was 27 percent ; the white - cell count was 9,000/mm , with 68 percent neutrophils , 29 percent lymphocytes , 2 percent monocytes and 1 percent eosinophils .
the urea nitrogen was 18 mg% , the glucose 80 mg% , the serum alanine aminotransferase 20 iu , the alkaline phosphatase 56 u. the vdrl was negative .
the arterial blood gas analysis showed ph ; 7.40 , paco2 ; 41 mmhg , pao2 ; 96 mmhg .
the perfusion scan showed lobar perfusion defect of left lower lobe and focal segmental perfusion defect of right lower lobe .
the computerized tomogram of thorax revealed 55cm - sized , round , mass with surrounding low density , suggesting paa with thrombosis in left lung ( fig .
3 ) . ascending venogram of lower leg showed diffuse obstruction of right femoral vein .
the digital subtraction pulmonary angiogram revealed huge dilatation of left main pulmonary artery , proximal to the obstructed pulmonary artery ( fig .
the patient was treated with steroids for 14 days without improvement of hemoptysis . during the next 6 weeks , although she was given steroids persistently , the left hilar lesions grew to large mass with diameter of 5 cm .
macroscopic examination of the excised lobe showed saccular dilation of pulmonary artery surrounded by the underventilated pulmonary parenchyma . on section ,
the aneurysmal dilatation was 5 cm in diameter and lined with laminated old blood clots .
the arterial wall was markedly destructed with minimal fibrous thickening , medial destruction , marked infiltration of inflammatory cells , predominantly neutrophils .
she was treated with maintenance prednisolone during 1 year after lobectomy , but she noted sudden massive hemoptysis and eventually died .
the underlying causes of paa without arteriovenous communication are infection ( mycotic ) , structural cardiac abnormalities , structural vascular abnormalities including marfan s syndrome and bd , pulmonary hypertension and trauma . in this case , bd is the cause of paa because of the presence of recurrent oral and genital ulceration and skin lesion ( erythema nodosum ) which fulfill the diagnostic criteria of bd . of 137 and 316
patients with bd , 38 ( 21% ) and 69 ( 28% ) patients had vascular involvement , respectively .
therefore , there were a few cases of female patients with bd combined with paa confirmed by pulmonary angiogram .
so , it is valuable to report this rare case of female bd with paa confirmed by angiogram .
the pulmonary manifestations , including recurrent episodes of dyspnea , cough , chest pain and hemoptysis , occur in 5% to 10% of patients with bd .
the major symptom is hemoptysis , which is the result of pulmonary embolism evoked by deep thrombophlebitis or pulmonary thrombophlebitis or communication between paa and its related bronchus . in this case
, the first manifestation of blood - tinged sputum may be related with pulmonary embolism secondary to deep vein thrombosis which were proven by lung scan and ri venogram .
the massive hemoptysis resulting in death may be rupture of the main aneurysm to related bronchus . although the ct findings of thorax have not been well documented , aneurysm with or without thrombus , irregular configuration of peripheral vessels , peripheral opacities in the lower zones and enlarged peripheral arteries were reported . in this case , ct scan with contrast media showed well - opacified round arterial lumen with eccentric soft tissue mass which suggested thrombus within aneurysm .
we think that the thrombus within aneury sm may be related with stasis of blood flow due to obstructed distal arterial lumen by vasculitis .
this deterioration was the result of a puncture of the inflamed arterial wall , severe ill state and pulmonary catheterization itself .
so , it is doubtful to perform pulmonary angiogram for demonstration of aneurysm and vascular change .
fortunately , we did not find any deterioration of pulmonary symptoms after angiogram in this case .
in future , high resolution computerized tomogram and dynamic ct may replace angiogram in confirmative or routine diagnostic modality of aneurysm without any complication .
the steroid , with or without immunosuppressive agents , is the first line therapy in bd with lung involvements .
but the long - term effect of steroid is not defined , in spite of the short - term effect of steroid being reported to be very good .
furthermore , patients with paa died due to massive hemoptysis by rupture of aneurysm during treatment with massive steroids .
if the aneurysm dilates , the dilating force increases and in turn , results in the rupture of aneurysm .
. eventually , we performed lobectomy due to the fear of rupture of the aneurysm . | behcet s disease ( bd ) is a systemic disorder of unknown process resulting from systemic vasculitis .
the pulmonary involvements in bd are uncommon . furthermore , in the female
, involvement of the pulmonary artery is quite rare .
there were a few cases of female patients with bd with pulmonary artery aneurysm confirmed by pulmonary artery angiogram . in this article
, we report a case of bd , combined with pulmonary artery aneurysm , confirmed by pulmonary angiogram and treated by surgery in a korean female patient . |
incontinentia pigmenti ( ip ) or bloch - sulzberger syndrome is a rare x - linked dominant disorder that is predominant among females .
it is a systemic disease that involves tissues of ecto- and mesodermal origin , including the skin , teeth , eyes and the central nervous system , among other organs [ 14 ] .
it is secondary to mutations in the ikk - gamma gene , which is also known as nf - kappa - b essential modulator and is located on xq28 .
nf - kappa - b essential modulator allows cells to respond to external signals such as growth factors and encodes a protein that controls the function of several chemokines , cytokines , and adhesion molecules , and is necessary for protection against tumor necrosis factor induced apoptosis [ 1,7 , 8 ] .
incontinentia pigmenti is characterized by erythematous eruptions with linear vesiculations , which are present at birth or appear soon after , and are mainly localized on the skin of the back , torso or the extremities .
cutaneous eruptions along the lines of blaschko are the hallmark of ip and develop in four different stages :
1 stage : inflammatory , erythematous , vesicu - lobullous lesions , usually configured in a linear pattern ( birth to one or two weeks);2 stage : papules and verrucous lesions with hyperkeratosis ( two to six weeks);3 stage : hyperpigmentation of the skin ( three to six months);4 stage : hypopigmentation and atrophy of the skin ( two to three decades ) . 1 stage : inflammatory , erythematous , vesicu - lobullous lesions , usually configured in a linear pattern ( birth to one or two weeks ) ; 2 stage : papules and verrucous lesions with hyperkeratosis ( two to six weeks ) ; 3 stage : hyperpigmentation of the skin ( three to six months ) ; 4 stage : hypopigmentation and atrophy of the skin ( two to three decades ) .
pigmentation gently fades and is usually absent by adulthood . despite eosinophilia and leukocytosis on peripheral blood count , infants affected are generally not systemically compromised .
prognosis of ip is generally good and depends on extra - cutaneous involvement , which may also affect patients quality of life .
according to the criteria presented by landy and donnai , skin lesions ( erythema , hyper - pigmented streaks and whorls , as well as pale , hairless , atrophic linear streaks or patches ) were categorized as major diagnostic criteria for ip ; whereas , dental , retinal , hair , and nail abnormalities are considered minor criteria for ip . according to the findings of some large case series of ip patients [ 2,8,1417 ] ,
the incidence of dental anomalies in patients with ip varies from 30.86% to 92% .
similarly , the number of dental and/or oral anomalies per patient ranges from 1.48 to 2.48 .
dental anomalies are the most common manifestations of ip patients and are observed in up to 80% of the patients and usually affect both dentitions .
hypodontia is the most common anomaly ( up to 43% of patients ) , followed by pegged or conically crowned teeth ( 30% of patients ) .in this report , we present a patient with ip who had multiple missing teeth in both the mandible and the maxilla , and provide a proper treatment plan for the patient s condition .
a two year - old caucasian girl was referred to the hamadan university of medical sciences , faculty of dentistry , for multidisciplinary evaluation and treatment of her dental condition .
her mother did not report any family history of ip and there was no consanguineous marriage .
she also reported the presence of a rash on upper limbs at birth that further developed into inflammatory vesicular alterations all over the body and cleared gradually , leaving linear pigmentations on the trunk and upper and lower limbs .
physical and intellectual development were normal except for the skin findings that are outlined below .
her skin was notable for linear pigmented macular lesions on the trunk , upper and lower limbs , and ears .
examination of the patient s oral cavity showed normal soft tissue with oligodontia and only four teeth were present ( 52 , 72 , 81 , 82 ) .
panoramic radiographs also showed oligodontia with eruption of left primary mandibular second molar ( 75 ) , tooth germs of primary maxillary second molars ( 55 , 65 ) , left maxillary and mandibular permanent first molars ( 26 , 36 ) , mandibular permanent canines and right permanent lateral incisor ( 33 , 43 , 42 ) ( fig .
panoramic radiograph showing hypodontia and unerupted teeth at age two treatment plan at that time consisted of topical fluoride therapy with fluoride varnish every three months .
the patient s family were given detailed instructions for oral hygiene . by the time the patient was seven years old she exhibited
faded linear pigmented macular lesions on the trunk as well as the upper and lower limbs ( fig .
dental examination was significant for conical and peg - shaped anterior teeth as well as delayed eruption of primary ( 52 , 55 , 65 , 72 , 75 , 81 , 82 ) and permanent teeth ( 26 , 36 ) ( fig .
3 ) . hyperpigmentation on the trunk , upper and lower limbs and ears clinical view of the maxillary and mandibular arches at age seven panoramic radiographs revealed no dental or facial abnormalities except for multiple missing teeth .
4 ) including number 12 , which was malformed , and 25 , 33 , 37 , 42 and 43 .
the patient was initially treated with pulpectomy and composite filling of tooth 52 , followed by fissure sealant therapy of teeth 55 , 65 , 75 , 26 and 36 and composite veneering of teeth 52 and 82 .
pretreatment panoramic radiograph ; note the multiple missing teeth in both arches in order to restore her masticatory function and improve her esthetics , removable partial dentures were fabricated for her according to the following instructions :
impression making for the study casts was performed with alginate material by using selected stock tray for children.special trays were made with acrylic resin.final impression making was performed with alginate ( alginoplast , heraeus kulzer , wehrheim , germany ) , using the trays and border molding with compound material.wax rims were made on the master casts.occlusal record was obtained with proper vertical dimension and freeway space was established.a semi - adjustable articulator was used ( a7plus , bio - art , sao carlos , brazil).wax dentures were adjusted in the mouth.the temporary dentures were made of heat - cured acrylic resin . at seven years and 10 months of age ,
impression making for the study casts was performed with alginate material by using selected stock tray for children .
final impression making was performed with alginate ( alginoplast , heraeus kulzer , wehrheim , germany ) , using the trays and border molding with compound material .
a semi - adjustable articulator was used ( a7plus , bio - art , sao carlos , brazil ) .
the temporary dentures were made of heat - cured acrylic resin . at seven years and 10 months of age ,
intraoral photograph before and after insertion of the interim removable partial dentures frontal smile view of the patient after inserting the interim removable partial dentures the patient and her mother were instructed that the dentures should be worn at all times except for while brushing and during sleep .
after a week , she complained of pain near the lingual flange of the lower denture .
the denture was subsequently adjusted by checking the extension of the borders with light body silicone material ( speedex , coltene , alstatten , switzerland ) .
incontinentia pigmenti is an x - linked dominant disorder ; therefore , the majority of the cases are seen in women . in antenatal males , a mutant copy of the gene
it may rarely occur in men with klinefelter syndrome ( xxy syndrome ) or as a result of somatic mosaicism or hypomorphic mutation in the nf - kappa - b essential modulator gene .
incontinentia pigmenti is diagnosed in older children and adults by a series of skin manifestations , as well as possible dental , neurologic and eye abnormalities .
the clinical findings in this patient were consistent with those reported by others [ 11,12 , 22 ] .
her dental findings consisted of oligodontia , conical and peg - shaped anterior teeth and delayed eruption of primary and permanent teeth . based on our findings and that of the other case series , it could be concluded that this triad is the characteristic dentition pattern of the patients with ip .
there was no evidence of enamel defects , tooth malformation , missing teeth or ectodermic abnormalities in the other family members .
our patient only exhibited findings consistent with stage 1 ( inflammatory or vesicular ) and stage 3 ( hyperpigmentation ) of ip .
since the patient only suffered from xerophthalmia and dry skin , most of her complications were related to the stomatognathic system [ 1,3 , 24 ] .
some authors have reported subtle alterations of enamel and dentin structure that may evolve into caries , in addition to the typical dental findings of patients with ip .
holmstrm et al , reported decreased saliva secretion in 10 out of 25 ip patients , which caused dental caries , as saliva is protective against caries .
wang et al , reported that different genes , or genes with differential effect sizes are involved in decay of primary and permanent dentitions .
there were no other abnormal findings such as gothic plate that were reported by mini et al , and himelhoch et al . in spite of studies reporting hypocalcification and prevalent caries in patients with ip ,
our patient did not exhibit any enamel defects and dental caries were only detected in the primary maxillary lateral incisor .
dental and oral anomalies may affect the patients quality of life and cause feeding problems ( hypodontia , cleft lip and cleft palate ) but they are rarely life threatening .
hypodontia can be treated by fixed or removable prostheses or , in some cases , by tooth auto - transplantation . to provide acceptable appearance for anterior teeth , composite was chosen for veneering and restoring carious teeth .
fissure sealant therapy is also recommended for non - carious , unrestored molars and premolars .
we prepared interim removable partial dentures to treat her masticatory problems and improve her occlusal function and esthetic appearance .
when the patient s growth spurt is completed , the removable prosthesis may be replaced by a permanent restoration such as osseointegrated implants .
implant - supported removable dentures also provide good stability and retention [ 3133 ] , but the placement of dental implants in young children is accompanied by several complications .
yamashiro et al , used orthodontic treatment to reposition the teeth in a 21 year - old female who had multiple missing and malformed teeth because prosthetic reconstruction without excessive tooth preparation was deemed difficult .
ocular defects including strabismus , cataract , conjunctival pigmentosa uveitis , optic atrophy , retinal vascular abnormalities , blue sclera , and microphthalmia are found in about 40% of the patients with pi .
retinal lesions may affect the peripheral retina and appear to be the result of ischemia with subsequent compensatory vaso - proliferation . while central nervous
system disorders such as seizures , mental retardation , spasticity , cerebral atrophy , hemiparesis , and encephalopathy occur in about 25% of the cases , our patient did not have any central nervous system abnormalities .
since ip affects different organ systems to varying degrees , as seen in the present case , a multidisciplinary approach is recommended to treat and rehabilitate such patients .
patients suffering from ip should be constantly monitored by the ophthalmologists , oral surgeons and neurologists .
as the patients grow up , periodic dental follow - ups should be scheduled to evaluate caries formation and the need for prosthetic reconstruction .
patients with ip , like all other patients with hypodontia , require care from pediatric dentists , prosthodontists and orthodontists to achieve best results . | incontinentia pigmenti is a rare inherited disorder involving abnormalities of the skin , hair , eyes , musculoskeletal system , central nervous system , and the teeth .
dental abnormalities are the most common manifestations of this disorder .
the purpose of this case report was to present the clinical and radiological findings of a seven - year - old girl as well as the results of her five - year follow up .
the patient showed faded linear pigmented macular lesions on the trunk and on upper and lower limbs .
dental examination was notable for conical and peg - shaped anterior teeth as well as delayed eruption of primary and permanent teeth .
in addition to conservative treatments , prosthetic treatments such as interim removable partial dentures were indicated for the patient . |
obesity is a significant cause of morbidity and
mortality in the us and worldwide .
obesity in adults and children increases the risk of type 2 diabetes mellitus , cardiovascular disease , and
nonalcoholic fatty liver disease , as well as psychosocial and social
disturbances .
significantly , obese
children have an increased likelihood of becoming obese adults compared with
children who are not obese
. and the
incidence of childhood obesity is rising :
during 2003 - 2004 , 17.1% of children ( < 20 years ) had body mass indexes
( bmis ) 95% for age and sex .
increases in weight in the pediatric population are on the rise ; by the
year 2010 , almost 50% of north american children and 38% of european children
are expected to be overweight .
this
forecast represents a long - term trend :
surveys since 1963 have documented increasing numbers of overweight and
obese children , and the rate of increase is accelerating [ 8 , 9 ] .
not surprisingly , bmi has also continued to
increase with a shifting of the normal population bell - shaped curve to the
right . at the other end of the
spectrum , children with chronic diseases are significantly affected by weight
loss , or cachexia , that includes
key features of
cachexia include anorexia or decreased appetite despite weight below the
physiologic set point , an accelerated loss of lean body tissues , and lack of a
protective decrease in basal metabolic rate as weight continues to be
lost .
cachexia has been found to be
associated with such chronic illnesses as congenital heart disease , crohn
disease , renal failure [ 14 , 15 ] , and cancer [ 16 , 17 ] . while the underlying cause of cachexia in
chronic disease is complex , most authors agree that increased production of
proinflammatory cytokines leads to many of the pathological features observed
in this condition .
these cytokines
interact directly and indirectly with centers in the brain that control
appetite and basal metabolic rate and also have important direct effects on
peripheral tissues .
although great progress has been made in understanding
the hormonal players that regulate appetite in adults , and therefore contribute
to obesity and its opposite cachexia ,
these insights have not yet been applied to the pediatric
population .
this article will review the
key hormonal players involved in hunger and satiety and how these hormones
directly affect the brain .
we will also
review how humans and animals with mutations in these hormones or their
receptors develop substantial pathology .
such mutations may increase the risk of developing obesity or
disease - associated cachexia .
finally , we
will discuss how hormone replacement or supplementation can offer a therapeutic
option for obesity or cachexia .
much
work has been done in adults and animal models .
here , we will attempt to address how these insights might affect
pediatric practice and highlight the importance in children .
part of the hypothalamus , the arcuate nucleus ( or , in humans , the
infundibular nucleus ) , allows entry through the blood - brain barrier of
peripheral peptides and proteins that directly interact with its neurons .
these include neurons that coexpress peptides
that stimulate food intake and weight gain , specifically , neuropeptide y ( npy )
and agouti - related peptide ( agrp ) , as well as those expressing
pro - opiomelanocortin ( pomc ) and cocaine- and amphetamine - regulated transcript
( cart ) which inhibit feeding and promote weight loss ( see table 1 ) .
these neurons and peptides control
the sensations of hunger and satiety and ultimately weight gain and weight
loss .
npy is part of the
pancreatic polypeptide ( pp-)fold peptide family ( npy , polypeptide yy ( pyy ) , pp ) .
the medial arcuate nucleus contains the npy
neurons which project to the paraventricular nucleus , hypothalamic nucleus ,
lateral hypothalamic area , and other hypothalamic sites .
npy synthesis and release are regulated by
leptin and insulin ( both inhibitory ) , and glucocorticoids and ghrelin ( both
stimulatory ) , among many other factors .
the most noticeable physiological response to central administration of
npy is the stimulation of feeding .
npy initiates appetite drive through the npy g - protein coupled receptors
( primarily y1 and y5 ) .
npy also
represses the anorexigenic effect of melanocortin signaling in the
arcuate . in the hypothalamus
, npy is one
of the most abundant peptides and one of the most potent orexigenic
factors .
agrp is produced by
neurons located within the medial arcuate nucleus that coexpress npy .
the
agouti protein is a paracrine - signaling molecule produced normally in the skin
that inhibits the effect of -melanocyte stimulating hormone ( -msh ) on the
melanocortin-1 ( mc-1 ) receptor .
overexpression of agouti signaling protein in mice leads to yellow coat color
by blocking -msh at the mc-1 receptor .
these mice are also obese , insulin resistant , hyperglycemic , and have increased
body length .
this is because agrp ,
an endogenous antagonist ( and inverse agonist ) of melanocortin-3 and
melanocortin-4 receptors , is implicated in control of energy balance .
blockage of these receptors leads to
stimulation of feeding . circulating peptides also play important roles in appetitive
behaviors .
of these , ghrelin , or growth
hormone ( gh)-releasing peptide , is the only known circulating orexigen , or
appetite stimulant .
it is mainly
produced by the endocrine cells of the gastric mucosa of the fundus , but is
also found in much smaller amounts in other tissues , including the small
intestine , pituitary gland , hypothalamus , pancreas , lung , immune cells ,
placenta , ovary , testis , and kidney .
ghrelin levels rise prior to meals , then fall quickly after ingestion of
nutrients .
thus it is postulated
that one primary role of ghrelin is to act as a meal initiator .
the ghrelin receptor , gh secretagogue receptor type 1a ( ghs - r1a ) , is a
g - protein coupled receptor that is widely expressed . within the cns
, it is found in areas involved
in the regulation of appetite and energy balance , including the hypothalamic
nuclei , dorsal vagal complex , and mesolimbic dopaminergic system .
ghrelin has multiple effects , including
stimulation of gh , acth , cortisol , aldosterone , catecholamine , and prolactin
secretion .
exogenous ghrelin administration
has also been found to affect glucose homeostasis , gut motility , pancreatic
exocrine secretion , cardiovascular function , immunity , and inflammation .
intracerebroventricular administration of
ghrelin in rats leads to increased food intake , excess weight gain , and
adiposity .
similarly ,
administration of ghrelin to obese and lean human subjects leads to increased
food intake .
ghrelin leads to this
increase of food intake and body weight in part by stimulating the production
of npy and agrp in the arcuate nucleus .
ghrelin may also alter energy balance by stimulating adipogenesis ,
inhibiting apoptosis , transitioning from fatty acid oxidation to glycolysis for
energy expenditure , and inhibiting sympathetic nervous system activity [ 2831 ] .
ghrelin levels in humans are inversely
correlated with adiposity , being low in obese subjects , higher in lean
subjects , and markedly elevated in subjects with cachexia due to cancer and
chronic cardiac failure , as well as those in starvation states such as anorexia
nervosa [ 3237 ] .
an exception to this is
prader - willi syndrome , where , despite obesity , affected individuals have high
levels of fasting and postprandial ghrelin .
ghrelin treatment in rats has been shown to
improve weight gain and lean body mass retention in cancer cachexia and chronic
kidney disease [ 39 , 40 ] , offering a potential therapy for cachexia in
humans .
alternatively , future studies
may examine ghrelin antagonists as a therapeutic option for obesity .
the hypothalamus is also the master regulator of satiety , via production
of pomc and cart .
the pomc gene is
expressed by multiple tissues , including the skin and immune system , as well as
the pituitary gland and the arcuate nucleus of the hypothalamus .
pomc undergoes tissue - specific
post - translational cleavage , with the product depending on the endoproteases
expressed in that tissue . for example ,
in the anterior pituitary gland , pomc is primarily converted to acth by
prohormone convertase 1 . in mammals
other than primates , prohormone convertase 2 in the intermediate pituitary
cleaves acth to yield -melanocyte stimulating hormone ( -msh ) that is involved
in the control of coat / skin color . with
respect to the hypothalamus in humans , leptin ( a peptide produced by adipose
tissue )
the neurotransmitter in turn
binds to the melanocortin-4 receptor ( mc4r ) , a key receptor involved in
appetite control and energy homeostasis , in the paraventricular nucleus and in
numerous other sites throughout the brain .
thus , mice overexpressing
agrp or mc4r knockout mice are hyperphagic and obese
and are insensitive to -msh .
mc4r mutations have been found in up to 5.8% of adults with severe
childhood - onset obesity .
pomc
deficiency also leads to obesity ( due to lack of binding at mc4r ) ,
hypocortisolism ( due to lack of binding of acth to the mc2r in the adrenal
gland ) , and alteration of pigment ( due to lack of binding at mc1r in the
skin ) .
this syndrome is defined by
severe early onset obesity , adrenal insufficiency , and red hair .
accordingly , in rodent models of cancer and
renal failure , mc4r receptor antagonists attenuate symptoms of cachexia by
maintaining appetite , lean body mass , and basal energy expenditure .
thus , mc4r antagonists may be a useful clinical
treatment of cachexia , while agonists are being developed to treat
obesity .
another important satiety regulator in the hypothalamus is cocaine- and
amphetamine - regulated transcript ( cart ) , which is coexpressed with pomc in arcuate neurons in animal models and somewhat paradoxically with agrp and npy in humans .
cart neurons target areas
throughout the hypothalamus and are associated with reinforcement and reward ,
sensory processing , and stress and endocrine regulation [ 47 , 49 ] .
animals deprived of food have decreased the expression
of cart mrna . along those same
lines , blocking cart with an antiserum increases feeding in normal rats .
intracerebroventricular administration of
cart in rats inhibits normal and starvation - induced feeding , as well as
blocking the npy feeding response [ 47 , 50 ] .
at this point , we are not aware of any clinical trials utilizing cart
agonists or antagonists for weight regulation perhaps due to the significant
nonappetite effects associated with cart .
in contrast to ghrelin , the single peripheral peptide known to stimulate
hunger , there are many peripheral peptides that are associated with
satiety .
various organs secrete these
hormones , including the gastrointestinal tract , pancreas , and adipose
tissue .
the list of satiety hormones is
far too extensive to discuss in this review .
we will , therefore , focus on the key players starting with
cholecystokinin ( cck ) , the first discovered satiety hormone .
cholecystokinin ( cck ) was initially discovered in 1928 and was one of the
first peptides to be found in the gut .
in addition to inhibiting food intake , cck stimulates pancreatic secretion ,
gall bladder contraction , intestinal motility , and inhibition of gastric
mobility .
administration of cck to rats
inhibits food intake by reducing meal size and duration , which is enhanced
by gastric distention .
the
half - life of cck is only 1 - 2 minutes , therefore it is not effective at reducing
meal size if administered more than 15 minutes before a meal .
cck is synthesized throughout the gastrointestinal tract , but mainly in
the duodenum and jejunum .
multiple
bioactive forms are derived from the same gene product by posttranslational or
extracellular processing .
cck is rapidly
released locally and into the circulation in response to nutrients in the gut ,
especially fat and protein , with a gradual increase in levels over 1030 minutes
after meal initiation , remaining elevated for up to 5 hours .
cck - sensitive brain sites include the lateral hypothalamus , medial pons ,
and lateral medulla .
these areas are
involved in reward behavior , memory and anxiety , as well as satiety [ 55 , 56 ] .
there are two types of g - protein coupled cck
receptors : cck - a and cck - b .
cck - a is found on the afferent
vagal neurons that have a direct effect on food intake .
rats deficient in cck - a ( otsuka long evans
tokushima fatty ( oletf ) rats ) are hyperphagic , obese , and develop diabetes
mellitus type 2 . another satiety peptide , peptide yy ( pyy ) , is part of the pancreatic
polypeptide ( pp- ) fold peptide family ( npy , pyy , pp ) , all of which have 36
amino acids , contain several tyrosine residues , and require c - terminal
amidation for biologic activity . the
pp - fold family exerts their effects via the y family of g - protein coupled
receptors ( y1 , y2 , y4 , y5 ) that are expressed in the hypothalamus .
pyy is produced by the intestinal l cells of
the ileum , colon , and rectum .
following
food intake , pyy is released into the circulation and peaks 1 - 2 hours
postprandially .
pyy concentrations
are proportional to meal energy content and are therefore higher after fat
intake compared to carbohydrates and proteins .
circulating pyy exists in two forms : pyy1 - 36 and pyy3 - 36 . pyy3 - 36 is the peripherally active
anorectic signal and is created by cleavage of the n - terminal tyr - pro residues
by dipeptidyl peptidase iv ( dpp - iv ) .
pyy3 - 36 binds to y2 receptors leading to inhibition of npy
neurons and stimulation of pomc neurons .
administration of pyy delays gastric emptying , inhibits secretions from
the pancreas and stomach , inhibits gallbladder contraction , and increases the
absorption of fluid and electrolytes from the ileum . in rodents , the administration of pyy
decreases food intake and reduces weight gain , as well as , improvesglycemic control in rodent models of diabetes
.
pyy - deficient mice are resistant
to satiety and develop marked obesity , which is reversed by exogenous pyy
administration . in contrast
this is thought to be via action
on y1 and y5 receptors in the paraventricular nucleus , the neurons targeted by
the orexigenic arcuate nucleus npy neurons . in obese and lean humans , administration of pyy3 - 36 decreases
food intake with a significant decrease in the cumulative 24 hour caloric
intake .
obese subjects , however ,
have a lower endogenous pyy response at each meal compared to normal weight
volunteers
obese patients treated by jejunoileal bypass
surgery or vertical - banded gastroplasty have elevated pyy levels ,
which may contribute to their appetite loss .
pancreatic polypeptide ( pp ) , another member of the pp - fold peptide
family , is produced largely in the endocrine pancreas , and also in the exocrine
pancreas , colon , and rectum .
pp is also
released in response to a meal , in proportion to caloric load , and inhibits
appetite .
pp release is stimulated
by ghrelin , as well as motilin ( a peptide secreted by the small intestine that
enhances gastrointestinal motility ) and secretin ( a peptide secreted by the
duodenum that stimulates gastric acid secretion ) , whereas somatostatin ( a
hormone that decreases the rate of gastric emptying , and reduces smooth muscle
contraction and blood flow within the intestine ) and its analogs significantly
reduce pp secretion .
peripheral administration of pp in normal
mice reduces food intake , gastric emptying , and gastric expression of ghrelin ,
while it increases vagal tone .
similar to pyy , injection of pp into the third ventricle stimulates
daytime food intake .
interestingly ,
patients with prader - willi syndrome have suppressed basal and postprandial pp
levels .
incretins are hormones released from the gastrointestinal tract into the
circulation in response to nutrient ingestion .
preproglucagon is expressed in the cells of
the endocrine pancreas , l cells of the intestine ( distal ileum and colon ) , and
neurons located in the caudal brainstem and hypothalamus .
it is cleaved into multiple different
products , including glucagon and two of the incretins , oxyntomodulin and
glucagon - like peptide-1 ( glp-1 ) .
oxyntomodulin and glp-1 are released from l cells in the distal ileum
and colon in response to ingestion of nutrients .
oxyntomodulin binds the glp-1 receptor that
is expressed in the nucleus of the solitary tract in the brainstem and in the
arcuate nucleus .
oxyntomodulin inhibits
gastric acid secretion , decreases gastric emptying , and decreases pancreatic
enzyme secretion which is likely related to decreased gastric output .
administration of oxyntomodulin in humans has
been found to suppress ghrelin levels , decrease body weight and appetite ,
decrease leptin , and increase adiponectin levels presumably secondary to loss
of adipose tissue .
glp-1 leads to delay in gastric emptying , stimulation of
glucose - dependent insulin secretion , inhibition of glucagon secretion , and
stimulation of somatostatin secretion .
glp-1 binds to its receptor , a g - protein coupled receptor that belongs
to the class b family , including receptors for glucagon and gip .
the glp-1 receptor is expressed in a wide
range of tissues , including the pancreatic islet cells , lung , heart , kidney ,
stomach , intestine , pituitary , skin , vagus nerve , and several regions of the
cns including the hypothalamus and brainstem .
peripheral and central glp-1 administration activates neurons in the
arcuate and paraventricular nuclei , nucleus of the solitary tract , and area
postrema leading to decreased appetite .
glp-1 is released rapidly into the
circulation after oral nutrient ingestion , and its secretion occurs in a
biphasic pattern starting with an early ( within 1015 minutes ) phase that is
followed by a longer ( 3060 minutes ) phase .
the half - life of glp-1 is less than 2 minutes
owing to rapid inactivation by the enzyme dpp - iv , which also cleaves pyy .
this is the basis for the development of
exenatide ( byetta ) , a subcutaneously administered dpp - iv - resistant glp-1
receptor agonist .
glucose - dependent insulinotropic polypeptide ( gip ) is another incretin
that is secreted by the stomach and k cells in the duodenum and jejunum in
response to nutrient ingestion .
the half - life
of gip is 7 minutes in healthy individuals and 5 minutes in patients with type
2 diabetes .
the gip receptor
gene is expressed in the pancreas , stomach , small intestine , adipose tissue ,
adrenal cortex , pituitary , heart , testis , endothelial cells , bone , trachea ,
spleen , thymus , lung , kidney , thyroid , and several regions in the cns .
gip leads to glucose - dependent insulin
secretion , induction of cell proliferation , promotion of energy storage via
direct actions on adipose tissue , and enhancement of bone formation via
stimulation of osteoblast proliferation and inhibition of apoptosis . in the cns
, gip is expressed in the
hippocampus and gip receptor expression is detected in the cerebral cortex ,
hippocampus , and olfactory bulb .
gip
action in the cns may play a role in neural progenitor cell proliferation and
behavior modification .
insulin levels increase rapidly after a meal
and vary directly with changes in adiposity .
insulin penetrates the blood - brain barrier via a saturatable ,
receptor - mediated process at levels proportional to the circulating insulin
.
insulin receptors are widely
distributed in the brain with highest concentrations found in the olfactory
bulbs and arcuate nucleus . once insulin
enters the brain , it acts as an anorexigenic signal .
mice with a neuron - specific disruption of the
insulin receptor gene have increased food intake , obesity with increased body
fat , and plasma leptin levels , and impaired spermatogenesis and ovarian
follicle maturation .
there are
several insulin receptor substrates ( irs ) that are activated by phosphorylation
by the insulin receptor on their tyrosine residues . irs-1 and
irs-2 knockout mice have been
found to have increased food intake , increased fat stores , and infertility .
it
is produced by the white and brown adipose tissue , stomach , placenta , mammary
gland , ovarian follicles , and certain fetal organs such as heart , bone or
cartilage , and perhaps the brain .
the ob
gene is expressed in all adipose tissue , but to a greater degree in the
subcutaneous adipose tissue than the omental fat .
instead , the circadian pattern is
characterized by high levels between midnight and early morning hours and a
nadir around noon to midafternoon .
leptin is secreted in a pulsatile fashion with 32 peaks per 24-hour
period and a pulse duration of 32.8 minutes .
this implies that neural and neurohormonal
components in the brain may regulate leptin secretion from adipocytes .
leptin receptors belong to the cytokine receptor superfamily , which uses
the janus activating kinase ( jak- ) signal transducer and activator of
transcription ( stat ) pathway of signal transduction .
ob - rb is the long form
of the receptor and has a long intracellular domain , which is necessary for the
action of leptin on appetite .
ob - rb is
expressed in multiple different sites within the hypothalamus including the
arcuate nucleus , paraventricular nucleus , dorsomedial hypothalamic
nucleus , and lateral hypothalamic area .
short forms of the ob receptor may play a role in the transport of leptin
across the blood - brain barrier .
after binding the receptor
, leptin stimulates a specific signaling
cascade that results in inhibition of orexigenic peptides ( npy and agrp ) [ 93 , 94 ] , while stimulating anorectic peptides ( including pomc and cart ) [ 93 , 95 ] . ultimately , this leads to decreased appetite
and increased energy expenditure .
db / db
mice have a mutation in the intracellular portion of ob - rb and therefore are
unable to respond to the leptin signal and as a result develop profound obesity
.
additionally , it has been found
that up to 3% of individuals with severe early onset obesity have pathogenic
mutations in the leptin - receptor gene .
ob - deficient mice have an absence of circulating leptin and develop
severe obesity due to both increased food intake and decreased energy
expenditure , both of which can be normalized by the administration of
leptin .
the absence of leptin in
humans leads to severe obesity , hypogonadism , and impaired t cell mediated immunity ,
which are remediable with administration of recombinant leptin .
about 5% of obese populations are
relatively leptin deficient and it is possible that these individuals could
benefit from leptin therapy .
adiponectin receptors are
expressed in the brain , particularly in the paraventricular nucleus , amygdala ,
area postrema , and diffusely in the periventricular areas . for reasons that are unclear ,
adiponectin 's
concentration in the blood stream is extremely high , approximately 1000 times higher than that of other
polypeptide hormones .
generally , adiponectin self associates to
form homotrimers that then dimerize to yield hexamers . increased adiponectin levels in rodents
appear to decrease body fat mass by stimulation of fatty acid oxidation in
muscle .
adiponectin also decreases
food intake and obesity in obese rats , and improves insulin sensitivity
by decreasing hepatic glucose output .
in humans ,
high molecular weight adiponectin ( which is thought to be the
active form ) is reduced in patients with type 2 diabetes , and increasing the
proportion of high molecular weight adiponectin by weight loss and treatment
with thiazolinediones leads to improved insulin sensitivity .
although the obesity epidemic has worsened significantly in children presumably owing to alterations in dietary
intake and energy expenditure , there have been clearly demonstrable genetic
mutations in hormones and their receptors that may be implicated in childhood
obesity .
it would therefore be important
to identify children with early onset obesity that is resistant to dietary modification
and physical activity to evaluate them for possible genetic mutations .
this could lead to more appropriate therapies
targeted at the underlying disease process .
it has also become clear that certain acquired pathological states
associated with childhood obesity may respond well to specific - targeted therapy
based on the underlying pathology . for
example
, the intense hyperphagia and weight gain frequently observed after
damage of the basal
hypothalamus ( e.g. , commonly observed after resection of a craniopharyngioma ) may be due to the loss of the inhibitory tone provided by pomc neurons . in this case , treatment with a melanocortin
agonist may be particularly beneficial .
in contrast , patients with prader - willi syndrome may be more likely to
benefit from therapies that restore normal physiological levels of peripheral
appetite regulating hormones , such as ghrelin antagonists .
similarly , one might also consider hormonal agonists or antagonists as
treatments of cachexia .
several
preclinical and clinical trials indicate that ghs-1 r agonists ( including
ghrelin itself ) are effective agents for this particular metabolic
derangement .
other models suggest that
melanocortin-4 receptor antagonists will also provide effective therapy for
cachexia and involuntary weight loss .
collectively , our understanding of the complex nature of weight
regulation has opened the door to a more thoughtful approach to therapeutic
intervention in disorders of weight regulation .
the redundancy of these systems highlights the likelihood that no one
single agent will be effective in every situation , making individualized
combinations of therapy a more rational solution to weight regulation therapy . | obesity is a significant cause of morbidity and mortality
worldwide .
there has been a significant worsening of the obesity
epidemic mainly due to alterations in dietary intake and energy
expenditure .
alternatively , cachexia , or pathologic weight loss ,
is a significant problem for individuals with chronic disease .
despite their obvious differences ,
both processes involve hormones
that regulate appetite .
these hormones act on specific
centers in the brain that affect the sensations of hunger and
satiety .
mutations in these hormones or their receptors can cause
substantial pathology leading to obesity or anorexia .
identification of individuals with specific genetic mutations may
ultimately lead to more appropriate therapies targeted at the
underlying disease process .
thus far , these hormones have mainly
been studied in adults and animal models .
this article is aimed at
reviewing the hormones involved in hunger and satiety , with a
focus on pediatrics . |
rotator cuff diseases are some of the most common musculoskeletal diseases among adults ,
occurring frequently in both the young and the old1 .
there are various causes and symptoms of rotator cuff diseases , and
it is important to implement treatments appropriate for each case . as one ages and the
rotator cuff weakens or tears , it becomes harder to prevent rotator cuff diseases from
occurring2 .
however , various studies
have proposed methods to prevent these symptoms through rotator cuff muscle training
exercises3,4,5,6 .
the patterns of maximum torque and muscle activity for a given joint angle and velocity are
different for each person .
existing resistance training machines assume the general hill
type muscle model to produce a cam shape that keeps muscle activation consistent during the
exercise process and appropriate for these patterns .
however , there is a limit to
maintaining the muscle activity using a cam shape7 .
west et al . and carignan et al . proposed a training machine that
enables exercise that satisfies the individual user s patterns of joint torque and muscle
activation using a haptic device8 , 9
when a haptic device is used , the
individual user s patterns can be measured and registered using a force sensor , and the
exercise load can be adjusted to maintain the muscle activity at a steady level throughout
the exercise process . in fields such as rehabilitation ,
in which exercise customized to the
individual user is especially effective , various uses of exercise machines using haptic
devices have been attempted10 . because it is hard to effectively train the target muscles in a proper posture using
dumbbells unless the user is experienced in performing resistance training with them ,
training using machines is advantageous for beginners .
shoulder joint rotator cuff training
exercise is necessary for athletes who actively use their rotator cuffs , such as
professional golfers , but it is also necessary for the middle - aged and older populations who
suffer from diseases such as frozen shoulder or who want to prevent such diseases .
it is
difficult for this population to maintain a correct posture during rotator cuff exercises
using dumbbells or cables without some help of an assistant .
however , except for expensive
isokinetic machines , resistance training machines for rotator cuff exercise that are not
easily accessible at general fitness centers .
even the rotator cuff training exercises
suggested by past studies include many routines that use dumbbells or a resistance band or
cable3 .
the present study proposed an
individualized resistance training method to enable exercise while maintaining a workload
that is set according to an individual s joint angle - torque using a haptic - based resistance
training machine .
this study was used to develop a haptic - based resistance training machine that enables
exercise using a 2-d arbitrary path and then used the machine for rotator cuff muscle
training .
haptic - based resistance training machine and the controlling and measurement
software shows the haptic - based resistance training machine and controlling software11 .
haptic - based resistance training machines
enable exercise and measurement of 2-d force using two electric motors and a force sensor ,
and can apply resistance in an arbitrary 2-d direction .
this makes it possible to measure
and record an individual user s exercise trajectory and force profile , and to apply a
dynamic exercise load according to a predefined exercise trajectory ( pdet ) and location
appropriate for each user by position - based impedance control11 . by using this haptic - based resistance training machine ,
haptic - based resistance training machine and the controlling and measurement
software the experiment was conducted on ten subjects to verify the effects of exercise using the
haptic - based resistance training machine for rotator cuff muscle training .
the recruited
subjects were korean males in their twenties who had no history of shoulder injury and who
had no professional experience in weight training in the year before the experiment
( 24.91.7 ages , 174.44.6 cm , 67.38.5 kg ) . before the start of the experiment ,
the subjects
were given a full explanation of the purpose and experimental procedure , and signed
institutional review board consent forms to comply with the ethical standards of the
declaration of helsinki ( 1975 , revised 1983 ) .
they were not allowed any exercise that could
affect the rotator cuff during the training period ( e.g. , tennis , baseball , golf ) .
the machine group consisted of five subjects who
performed rotator cuff training exercises using the haptic - based resistance training machine
developed in this study , and the control group consisted of five subjects who performed
standard rotator cuff training exercises using dumbbells . before starting training , each subject s 1 repetition maximums ( 1 rms ) of internal rotation
and external rotation
1 rm was measured using dumbbells . in
the case of the control group , 20 rm , which was calculated based on 1 rm ,
was set as the
load for the training12 , 13 . in the case of the machine group ,
an individual s
exercise trajectory and force - velocity - angle curve were determined in an isokinetic manner
using the haptic device , and was then applied to the haptic - based training machine to set
the load pattern for training .
the training load pattern for each subject was set to 20 rm
by scaling down the angle - force profile .
training was conducted over an eight - week period , and each exercise session lasted about
one hour and was performed twice per week .
the machine group anchored their upper arm to the
support of the haptic device while sitting in a chair , as shown in fig .
external / internal rotation exercise using a haptic - based resistance training machine
( upper ) and force profiles of external / internal rotation measured by a haptic - based
resistance training machine ( lower ) , and executed internal and external rotation motions . a pair of internal rotation and
external rotation motions was counted as one repetition , and five sets of twenty repetitions
were executed .
the control group executed internal and external rotation motions using
dumbbells while lying on their sides , as shown in fig .
external ( left)/ internal ( right ) rotation exercise using dumbbells ( upper ) and
force profiles with respect to shoulder rotation angle ( lower ) .
five sets of twenty repetitions each of internal and external rotations were
executed .
external / internal rotation exercise using a haptic - based resistance training machine
( upper ) and force profiles of external / internal rotation measured by a haptic - based
resistance training machine ( lower ) external ( left)/ internal ( right ) rotation exercise using dumbbells ( upper ) and
force profiles with respect to shoulder rotation angle ( lower ) to evaluate the exercise performance of the shoulder joint rotator cuff before and after
training , the average powers of the shoulder internal and external rotation motions were
measured with a biodex system 3 isokinetic dynamometer ( biodex medical systems , shirley , new
york , usa ) on a scapular plane14,15,16,17,18 .
the one - way anova test
the average powers of shoulder internal and external rotation were increased after eight
weeks training for both groups .
summary of the progress in average power of external
rotationexternal rotationaverage power ( watts)prepostprogress % sub116.419.418.29sub214.317.824.48sub316.71913.77sub415.222.850.00sub515.418.822.08sub6 * 18.420.29.78sub7 * 12.214.317.21sub8 * 13.715.110.22sub9 * 12.312.84.07sub10 * 19.319.82.59progress of average power of machine group %
( sd)25.72 ( 14.16)progress of average power of control group %
( sd)8.77 ( 5.80 ) * control grouptable 2 . summary of progress in average power of internal rotation
of internal rotationinternal rotationaverage power ( watts)prepostprogress % sub131.235.212.82sub225.926.52.32sub328.932.913.84sub429.840.535.91sub53435.13.24sub6 * 38.240.25.24sub7 * 27.628.73.99sub8 * 25.930.316.99sub9 * 22.825.110.09sub10 * 34.435.42.91progress of average power of machine group %
( sd)13.62 ( 13.53)progress of average power of control group %
( sd)7.84 ( 5.80 ) * control group show the results of training . in the machine group ,
the mean average power of
external rotation increased 25.7% and mean average power of internal rotation increased
13.6% . in the control group ,
the mean average power of external rotation increased 8.77% ,
while that of internal rotation increased 7.84% in the case of external rotation , there were
significant differences in mean average power progress between the two groups ( p<0.05 ) ,
while that of internal rotation did not show any significant difference .
comparison of the average power before and after training indicates that shoulder external
rotation training using the haptic - based resistance training machine has a larger impact
than conventional training using dumbbells in the case of internal rotation , however ,
haptic - based training and dumbbell - based training show similar progresses on average power .
the differences in average power progress of external rotation between the groups are due to
the difference in the joint angle - torque profiles when engaged in exercise using dumbbells
as opposed to exercise using haptic - based resistance training .
each subject s joint
angle - torque profile was measured as shown in fig .
2 , and the resistance of the haptic device was determined based on this
measurement . in contrast , in the case of the control group ,
the exercise load was determined
by the weight of the dumbbell and the influence of gravity for each joint angle as shown in
fig .
, there
was no substantial difference in the impact of the training sessions because the joint
angle - force profiles for the machine group and control group showed similar tendencies .
however , in the case of external rotation , the profiles exhibited opposite tendencies , as
shown in fig . 3 , and this was consistent with the
finding that the machine group showed a greater improvement in exercise performance by
maintaining consistent muscle activation throughout the exercise .
many previous studies
mentioned the effectiveness of a training load considering the joint angle - torque
relationship in elbow or knee joint exercises7 , 11 , 19 .
the number of subjects was limited , because we
had only one haptic device and only one subject could use the device at a time . to clarify
the effects of haptic resistance training ,
this study focuses on the effect of resistance training in the
beginners ; however , the results can not be applied to older people who need to train rotator
cuff muscles , because the subjects who participated in this study were young , with the mean
age being only 24.9 .
this study proposes a rotator cuff muscle training exercise using a haptic - based resistance
training machine . in the case of existing rotator
cuff training exercises using dumbbells ,
cables , or rubber bands , it is difficult for beginners or older subjects to effectively
train the target muscles because it is difficult to assume the appropriate postures without
assistance . in the case of the haptic - based resistance training ,
every subject could
effectively train in a stable posture without assistance , as the machine guides the exercise
trajectory and direction of the force .
furthermore , the impact of exercise can be expected
to be the same as , or greater than , that of the standard rotator cuff training exercise
because the muscle activation levels are kept relatively consistent during the exercise
process . | [ purpose ] the aim of this study was to present an individualized resistance training
method to enable exercise while maintaining an exercise load that is set according to an
individual s joint angle - torque using a haptic - based resistance training machine .
[ methods ] five participants ( machine group ) performed individualized shoulder internal and
external rotation training with a haptic resistance training machine , while another five
participants performed general dumbbell - based shoulder internal and external rotation
training for eight weeks .
internal and external rotation powers of subjects were measured
using an isokinetic machine before and after training . [ results ]
the average powers of
both shoulder internal and external rotation has been improved after training ( 25.72% ,
13.62% ) .
the improvement in power of external rotation in the machine group was
significantly higher than that in the control group .
[ conclusion ] this study proposes a
haptic - based individualized rotator cuff muscle training method .
the training protocol
maintaining the joint angle - torque profile showed better improvement of shoulder
internal / external rotation than dumbbell training . |
extracted human teeth ( eht ) are routinely used by students for performing preclinical exercises , for preparing ground sections , and for research . since they harbor bloodborne pathogens and are a potential source of infection , they must be sterilized before use .
the efficiency of several sterilization methods is comparatively evaluated in a number of randomized controlled trials .
the objective of this study was to systematically organize all the studies evaluating the efficiency of different sterilization methods of human teeth and to determine efficient methods by summarizing the findings from individual studies .
this systematic review was conducted following the preferred reporting items for systematic reviews and meta - analyses guidelines to ensure optimum quality . an extensive literature search concerning the sterilization of eht
was conducted in electronic databases of pubmed , lilacs , scopus , google scholar , and hand searching reference lists from relevant journals .
the keywords used were human teeth , sterilization , disinfection , randomized controlled trials , and infection control .
after removal of irrelevant articles and duplicates , the abstracts of the selected 43 articles were screened .
studies evaluating the effect of different sterilization methods on the physical and chemical composition of tooth structure were all eliminated . for the remaining twenty articles ,
full text was retrieved and they were screened based on the following predetermined study eligibility criteria .
studies that were ( 1 ) done from 1990 to 2015 , ( 2 ) in english , ( 3 ) randomized controlled trials , ( 4 ) done in eht , ( 5)in vitro studies , ( 6 ) comparing the efficacy of at least one method of sterilization of eht with that of a control group .
studies that were ( 1)in vivo studies , letters , comments , editorials , questionnaire surveys , case reports , proceedings , personal communications , and any type of literature reviews , ( 2 ) done in nonhuman teeth , ( 3 ) with no control group , ( 4 ) with outcome measures not defined clearly .
list of studies with references and their reasons for exclusion as numbered in the study exclusion criteria is given in table 1 .
a flowchart diagram of the study selection process list of studies and their reasons for exclusion as numbered in the exclusion criteria
studies that were ( 1 ) done from 1990 to 2015 , ( 2 ) in english , ( 3 ) randomized controlled trials , ( 4 ) done in eht , ( 5)in vitro studies , ( 6 ) comparing the efficacy of at least one method of sterilization of eht with that of a control group .
studies that were ( 1)in vivo studies , letters , comments , editorials , questionnaire surveys , case reports , proceedings , personal communications , and any type of literature reviews , ( 2 ) done in nonhuman teeth , ( 3 ) with no control group , ( 4 ) with outcome measures not defined clearly .
list of studies with references and their reasons for exclusion as numbered in the study exclusion criteria is given in table 1 .
a flowchart diagram of the study selection process list of studies and their reasons for exclusion as numbered in the exclusion criteria
table 2 summarizes the method of data collection , synthesis , and extraction from the eight selected primary studies . in this systematic review ,
percentile efficiency of each sterilization method is calculated from the total number of samples tested and the total number of samples which had no microbial growth after being subjected to the particular sterilization method .
the method of data synthesis and data extraction from the selected primary studies autoclaving method and usage of 10% formalin showed 100% efficient sterilization .
the other methods of sterilization ( 5.25% sodium hypochlorite , 3% hydrogen peroxide , 2% glutaraldehyde , 0.1% thymol , and boiling to 100c ) all showed inefficient sterilization , percentile efficiency of which are also presented in table 2 .
extracted teeth are prone to colonization by potentially pathogenic bacteria and need to be sterilized properly before use in teaching laboratory and research .
scientific literature has documented various randomized controlled trials comparing various methods of sterilization of eht .
although several narrative literature reviews were done in the past , there are no systematic reviews done in this field .
the objective of this systematic review was to identify all randomized controlled trials evaluating the efficiency of different sterilization methods of eht , to determine the total number of trials done to date , to assess the quality of those trials , to determine whether a particular sterilization method works better than the others based on the findings from the primary individual studies , and to identify gaps in knowledge where new trials are still needed .
the present systematic review concluded that autoclaving and 10% formalin are very efficient and reliable methods of sterilization of eht ; 5.25% sodium hypochlorite , 3% hydrogen peroxide , 2% glutaraldehyde , 0.1% thymol , and boiling to 100c are all inefficient and unreliable methods of sterilization of eht .
while the data obtained from this review are valuable , its application to practice may be limited because these methods of sterilization reviewed have their own set of advantages and disadvantages .
autoclaving and 10% formalin do not alter the feel and cutting characteristics ; therefore , they do not compromise the learning experience when used for preclinical exercises
. autoclaving causes disruption of collagen and denature the organic component in dentin , which can alter the hybrid layer after resin penetration .
therefore , autoclaving makes the teeth not suitable for use in in vitro studies testing the microhardness , bond strength , and microleakage .
the tooth containing dental amalgam restorations should not be autoclaved because the vaporized mercury can be inhaled subjecting the patients and dental personnel to health risk .
formalin causes stabilization of the collagen preventing their collapse , which allows increased mechanical interlocking of the restorative material to the dentin .
therefore , although being an efficient sterilization method , its use is discontinued as it poses a major health hazard . limitations of this systematic review are ( 1 ) preferable inclusion of articles in english , ( 2 ) restricted time frame from 1990 to 2015 , ( 3 ) other methods of sterilization including gamma radiations , chemiclave , dry heat , microwave , benzalkonium chloride , 0.5% chloramine , 2% sodium azide , iodophor , phenol , alcohol , and antibiotics could not be included because of lack of sufficient number of studies carried out using these methods for effective comparison , ( 4 ) perceived weakness of such disinfection efficiency evaluation studies may be due to inherent variations in the microbial composition , microbial load , and biofilm matrix composition between individual tooth used in different studies , ( 5 ) it is not coupled with a meta - analysis because there is a mix of comparisons of different sterilization methods with diverse outcomes in the primary studies , ( 6 ) although the concentration of disinfectant solutions used were all standardized while summarizing this systematic review , the time limit of each sterilization method used in the primary studies could not be standardized . excluding gamma radiations , all the other sterilization methods tested so far resulted in changes in properties of tooth structure . therefore , there exists a need to find out a feasible and efficient sterilization method suitable for use in teeth to be used for in vitro studies .
further , this review brings into light the need for new ideas and methods for sterilization of root canal space of extracted teeth to be used in preclinical endodontics .
this systematic review concluded that autoclaving and 10% formalin were 100% efficient and reliable methods of sterilization of eht ; autoclaving method may be the definitive method for sterilizing teeth used for preclinical conservative exercises .
usage of 10% formalin , although effective , is discouraged due to associated health risks .
5.25% sodium hypochlorite , 3% hydrogen peroxide , 2% glutaraldehyde , 0.1% thymol , and boiling to 100c are all inefficient and unreliable methods of sterilization of eht .
this systematic review also brings into light the need for sterilization methods and protocol needed for sterilization of extracted teeth to be used for preclinical endodontics and in in vitro studies .
| aim of this study : the aim was to evaluate the efficiency of different sterilization methods on extracted human teeth ( eht ) by a systematic review of in vitro randomized controlled trials.methodology:an extensive electronic database literature search concerning the sterilization of eht was conducted .
the search terms used were human teeth , sterilization , disinfection , randomized controlled trials , and infection control .
randomized controlled trials which aim at comparing the efficiency of different methods of sterilization of eht were all included in this systematic review.results:out of 1618 articles obtained , eight articles were selected for this systematic review .
the sterilization methods reviewed were autoclaving , 10% formalin , 5.25% sodium hypochlorite , 3% hydrogen peroxide , 2% glutaraldehyde , 0.1% thymol , and boiling to 100c .
data were extracted from the selected individual studies and their findings were summarized.conclusion:autoclaving and 10% formalin can be considered as 100% efficient and reliable methods . while the use of 5.25% sodium hypochlorite , 3% hydrogen peroxide , 2% glutaraldehyde , 0.1% thymol , and boiling to 100c was inefficient and unreliable methods of sterilization of eht . |
shoulder arthroscopy is a commonly used technique for dealing with pathologies of the shoulder joint , like rotator cuff tears , recurrent dislocations and other subacromial lesions .
arthroscopy of the joint can be performed under general or regional anaesthetic techniques , and the joint space is visualized with the help of irrigating fluid infused at desired pressures .
we report a case of a rare but life - threatening complication occurring because of fluid extravasation following shoulder arthroscopy .
an 18-year - old boy with a height of 150 cm and weight of 50 kg with history of recurrent shoulder dislocation was scheduled for elective shoulder arthroscopy and accepted for anaesthesia under asa grade i. the anaesthetic technique employed was general anaesthesia with endotracheal intubation and controlled ventilation . in the operation theatre , after placing standard monitors [ electrocardiogram ( ecg ) , pulse oximeter , capnometer , non - invasive blood pressure ) and securing intra - venous access , the patient was pre - medicated with injection diclofenac 75 mg intramuscular ( i.m . ) and injection fentanyl 100 gm intravenous ( i.v . ) .
general anaesthesia was induced with propofol 100 mg i.v . and injection rocuronium 25 mg i.v .
followed by direct laryngoscopy ( cormack lehane view : grade one ) and intubation of trachea with a cuffed orotracheal tube of 8 mm internal diameter .
the patient was put on intermittent positive - pressure ventilation ( ippv ) using the ohmeda ventilator with tidal volume equal to 500 ml , respiratory rate of 10/min and inspiriratory : expiratory ratio=1:2 , and then turned to the right lateral position for performing arthroscopy on the left shoulder joint .
general anaesthesia was maintained with oxygen ( 33% ) , nitrous oxide ( 66% ) and isoflurane ( titrated to mean arterial pressure of 6065 mmhg ) .
intra - operative monitoring was within normal limit [ heart rate of 6585/min , end tidal carbon dioxide ( etco2 ) was 3034 mmhg , oxygen saturation was ( spo2 ) was 98100% ] .
the surgical procedure lasted for 3 h , during which the patient received approximately 1500 ml of balanced ringer lactate solution .
the shoulder joint was irrigated using approximately 36 l of normal saline with epinephrine in a concentration of one in three million employing a stryker infusion pump at a pressure of 100150 cm water .
fifteen to 20 min before the end of surgery , rocuronium infusion and isoflurane were switched off .
neuromuscular blockade was reversed using injection neostigmine 2.5 mg i.v . and injection glycopyrrolate 0.4 mg i.v .
n2o was switched off and , after ensuring adequate reversal ( head lift for more than 5 s , tongue protrusion present ) , the trachea was extubated .
post extubation , the patient started having obstructed breathing that progressed to complete airway obstruction as evidenced by obstructed abdominal movements , no movements of reservoir bag when switched from controlled system to manual , lack of waveform on capnograph and decreasing spo2 ( up to 70% ) .
also , a quick blow into the capnograph sampling tube by the anesthesiologist 's assistant obtained a graph ensuring that the line was clear and not blocked by moisture .
considering the threat of airway obstruction , the trachea was immediately intubated after direct laryngoscopy ( view was now cormack lehane grade 2b ) with orotracheal tube of 7 mm internal diameter and ippv with 100% oxygen was given till spo2 increased to 95% .
on further examination , auscultation of the chest revealed bilateral crepts , and neck circumference was measured as 52 cm .
based on the above findings , a diagnosis of post - obstructive non - cardiogenic pulmonary oedema was made .
was shifted to the intensive care unit ( icu ) for elective ventilation and further management . in the icu , the patient was put on a puritan benett 7200 ventilator with pressure control ventilation with positive end expiratory pressure ( peep ) of 10 cm h2o .
routine blood investigations ( haemogram , kidney function test , serum electrolytes , blood sugar and liver function test ) and ecg were within normal limits .
chest x - ray revealed marked left chest wall oedema and resolving pulmonary oedema with a normal cardiothoracic ratio [ figure 1 ] . after 24 h of ippv
, the neck circumference had reduced to 38 cm ( from 52 cm ) and chest x - ray had also became normal .
he was shifted to the ward and finally discharged from the hospital 2 days later .
the glenohumeral joint is almost completely encapsulated . proper visualization of the glenohumeral joint requires expansion of the joint space by irrigating fluid from a capacity of 34 ml to 60 ml .
the subacromial area on the other hand is an unencapsulated area and communicates well via various anatomical planes to the soft tissues of the neck and chest .
this space requires higher pressures for proper visualization and poses risk of fluid escape into the neck and chest , leading to airway swelling and further to respiratory compromise .
amount of fluid extravasation will depend on the amount and pressure of the irrigating fluid used and duration of surgery
. lateral position ( usual surgical position ) and obesity also predispose to fluid accumulation .
this fluid extravasation is not just a mere inconvenience as large amounts of fluid escaping into the neck and chest can accumulate and cause external compression on the laryngeal and tracheal tissues as well as swelling of these structures , leading to airway obstruction ( partial or complete ) that can be life - threatening.[14 ] thus , measures that decrease fluid extravasation play a very important role in shoulder arthroscopy .
pumps used to deliver the irrigating fluid can be gravity - dependent pumps or mechanical pumps .
gravity - dependent pumps consist of bags of normal saline of 23 l capacity hung at different heights , which will determine the pressure delivered .
mechanical pumps are more accurate , allowing better control of pressure , but can be associated with pressure surges . minimizing bleeding into the joint cavity
a clear field will help minimize the duration of surgery and hence decrease the total amount of irrigating fluid used .
this is achieved by use of epinephrine in irrigating solutions ( 1 in 3,000,000 ) , cauterization of large vessels and tamponade effect of the irrigating fluid .
induced hypotension plays a vital role as it not only decreases bleeding ( thereby limiting the surgical duration ) but consequentially also decreases the amount and pressure of fluid required for tamponade effect .
shoulder arthroscopy can be performed under general anaesthesia or regional anaesthesia ( interscalene block ) .
the main advantage of general anaesthesia is that the airway is secured and induced hypotension can be used to decrease the irrigating fluid requirements .
merits of regional anaesthesia are that it avoids multipharmacy , provides for post - operative analgesia , promotes early ambulation and , if direct communication is maintained with the patient ( by use of measured amount of sedatives ) , then the patient can aid in early recognition of airway obstruction by complaining of ominous signs like difficulty in swallowing or a throat sensation . however , if regional anaesthesia is used as the sole anaesthetic technique , then , in the first place , the airway is not secured and , also , if intra - operative airway obstruction develops , then bringing the patient to the supine position can cause delay in ultimately securing the airway . also , neck swelling once present may limit neck mobility as well as visualization of the glottis , making laryngoscopy and intubation difficult to impossible .
glottic swelling itself can significantly decrease the size of its aperture and hence impede the passage of an adequate - sized endotracheal tube .
attempting endotracheal intubation after development of airway obstruction in such a scenario can thus be tedious and time consuming .
however , external swelling on the neck can prevent proper identification of the necessary landmarks , and may not be possible in all cases .
still , an external superficial incision on the anterior side of the neck can relieve external compression on the trachea , thereby improving ventilation and also facilitating re - intubation .
fibreoptic evaluation of the airway for laryngopharyngeal oedema and glottic visualization followed by intubation of the trachea with an appropriate - sized endotracheal tube ( glottic aperture may be reduced ) may have to be resorted to .
arthroscopic shoulder surgery has several advantages over open procedures like reduced post - operative pain , reduced hospital stay and early ambulation .
it is considered to be a fairly safe procedure with limited complications:[69 ] traction neuropraxia of brachial plexus ( most commonly musculocutaneous nerves ) , cervical neuropraxia ( if beach chair position is used ) , haemorrhage , infection , complex regional pain syndrome type - ii , rhabdomyolysis , compartment syndrome , instrumentation - induced cartilage injury , fluid extravasation , airway obstruction and respiratory compromise .
anaesthesia - related complications include mainly those due to interscalene block and use of hypotensive anaesthesia . in our case ,
post - obstructive negative - pressure pulmonary oedema is a transudative oedema arising from the large negative intrathoracic pressure generated on inspiration against an obstructed airway .
large negative intrathoracic pressure increases venous return to the right atrium and increases pulmonary artery pressure .
hypoxia due to airway obstruction along with increased myocardial wall stress and systemic vascular resistance due to the large negative intrathoracic pressure lead to a depression of cardiac output .
this decrease in cardiac output proceeds as increased end diastolic left ventricular pressure followed by increased left atrial pressure and , finally , increased pulmonary venous and pulmonary microvascular pressure . thus , increased hydrostatic pressure in the pulmonary circulation disturbs the balance of starling 's forces between pulmonary vasculature and pulmonary interstial tissue , causing shift of fluid into the pulmonary interstitium manifesting as negative - pressure pulmonary oedema .
fluid extravasation leading to airway obstruction is a rare but potentially life - threatening complication of shoulder arthroscopy .
we recommend the use of balanced anaesthesia using general anaesthesia with endotracheal intubation and controlled ventilation supplemented with interscalene block as the anaesthetic technique of choice .
monitoring of neck circumference and airway pressures can forewarn about the amount of fluid extravasation .
because intra - operative measurement of neck circumference is not possible as the neck is covered under drapes and also in obese patients as increase in neck circumference may not be apparent , the difference between the pre - and the post - operative values can be calculated ( up to 5 cm increase in the neck circumference can be considered insignificant ) .
if post - operative airway obstruction is anticipated , then tube exchanger or aintree catheter can be used while extubation .
aintree catheter can aid ventilation as well as fibreoptic assessment of the airway for laryngopharyngeal oedema and glottis aperture .
if airway obstruction does occur , then these devices will also aid in quick restoration of the airway .
an experienced surgical team to limit operative time along with proper patient positioning , use of lower pump pressures and induced hypotension will help in decreasing the irrigating fluid requirements and hence the risk of airway obstruction from fluid extravasation .
use of minimal number of portals with adequate lengths and water - tight seals by the surgeon and creation of least number of rents in the native capsule to preserve its integrity can also be useful .
by reporting this case , we highlight the indispensable role of an anaesthesiologist in prevention , anticipation and management of airway obstruction resulting from fluid extravasation during shoulder arthroscopy .
use of general anaesthesia with endotracheal intubation not only helps by securing the airway pre - emptively but also provides the option of employing induced hypotension to minimize irrigating fluid requirements . pre - and post - operative measurement of neck circumference can help anticipate dangerous levels of fluid extravasation .
if a sign of airway obstruction is present , the trachea should not be extubated immediately post - operatively and elective ventilation should be continued till the airway oedema has subsided . | an 18-year - old asa - i patient who underwent elective left shoulder arthroscopy developed severe airway obstruction post - extubation due to fluid extravasation from the shoulder joint into the neck and airway tissue .
re - intubation for relief of obstruction resulted in negative - pressure pulmonary oedema .
the patient was electively ventilated in the intensive care unit and recovered uneventfully .
a high index of suspicion along with monitoring of neck circumference can prevent this kind of complication . |
the establishment of the primary dna sequence of a species is a key point in modern research .
it permits to obtain subsequently further insights on the functionality of the genes present in a genome . the first plant genome sequenced was that of the eudicot model plant arabidopsis thaliana , which was released in 2000 .
from this date , and mainly after the appearance of next generation sequencing technology in 2005 , the number of sequenced plant species has exponentially increased . in recent years , several reviews had targeted the state of art of the plant sequencing projects [ 1 - 4 ] . among the sequenced species ,
several algae genomes , a moss , a lycophyte , three conifer and examples from the majority of the monocot and eudicot lineages have been sequenced [ 4 , 5 ] .
interestingly , the vast majority of economical important crops have been sequenced and drafts of their genomes have been produced .
once the genomic sequence has been parsed , assembled and annotated ; the corresponding data has been traditionally compiled in a database available for the scientific community .
the importance of the creation of an open - access database comes from the rationale of the biological exploitation of the novel genomic resources generated by the researches .
basic considerations on dealing with crop plant databases utilization in the genomic era has been recently reviewed . in this mini - review ,
the first step in the valorization of a genomic project is to know the availability of related projects completed or in progress .
these searches can be done by two methods . by searching in the internet motor searches using key words or by exploring the specific databases related to genomic projects .
although the information in these databases is not always up to date , second method is more adequate to obtain the best results .
there are four main genomic projects databases that can be used when information on plant genomes is required , gold ( genomes online database ) , ncbi genomes , cogepedia and plabi ( table 1 ) .
is a world wide web resource for comprehensive access to information regarding genome and metagenome sequencing projects , and their associated metadata .
gold is now hosted by the jgi doe institute and the current release is the version 5 .
the database currently hosts information for more than 20,000 studies , 60,000 biosamples , 60,000 sequencing projects and 50,000 analysis projects .
one of the specific features of gold is that it includes nuclear and organelle genome projects , but also transcriptomic , methylation , exome and re - sequencing projects .
around one hundred and more than 3,400 finished or ongoing projects involve species from the phyla chlorophyta and streptophyta , respectively .
gold is manually curated , their stored metadata are quality - controlled , and fully supports and follows the genomic standards consortium ( gsc ) minimum information standards .
ncbi genomes is a resource of the ncbi ( national center for biotechnology information ) which organizes information on genomes including sequences , maps , chromosomes , assemblies , and annotations .
the ncbi genome database collects genomic sequencing projects for a given species and provides links to corresponding records in bioproject , assembly , nucleotide and protein databases . besides
, a list of the current status of all genomes annotated at ncbi is provided .
currently , more than 2,200 eukaryotic genomes have been deposited , and from that , more than 200 corresponds to plant species .
the database provides a versioned assembly accession number that tracks changes to assemblies as they are updated by submitting groups over time .
the assembly database reports metadata such as assembly names , simple statistical reports of the assembly as well as the assembly update history .
links in the assembly resource allow users to easily download sequence and annotations for current versions of genome assemblies from the ncbi genomes ftp site .
2.3.cogepedia is the official wiki page of coge , a platform for performing comparative genomics research which provides a network of interconnected tools to manage , analyze , and visualize next generation sequenced data .
their interest to plant genomics is the existence of a link in this page with much updated information on sequenced plant genomes .
individual information on each species with links to the genome publication or the genome project main page is provided .
2.4.plabi is a plant genomic database with a very updated tool to know which plant species have been sequenced .
links to the research articles where each plant genome has been published are also included .
is a world wide web resource for comprehensive access to information regarding genome and metagenome sequencing projects , and their associated metadata .
gold is now hosted by the jgi doe institute and the current release is the version 5 .
the database currently hosts information for more than 20,000 studies , 60,000 biosamples , 60,000 sequencing projects and 50,000 analysis projects .
one of the specific features of gold is that it includes nuclear and organelle genome projects , but also transcriptomic , methylation , exome and re - sequencing projects .
around one hundred and more than 3,400 finished or ongoing projects involve species from the phyla chlorophyta and streptophyta , respectively .
gold is manually curated , their stored metadata are quality - controlled , and fully supports and follows the genomic standards consortium ( gsc ) minimum information standards .
ncbi genomes is a resource of the ncbi ( national center for biotechnology information ) which organizes information on genomes including sequences , maps , chromosomes , assemblies , and annotations .
the ncbi genome database collects genomic sequencing projects for a given species and provides links to corresponding records in bioproject , assembly , nucleotide and protein databases . besides
, a list of the current status of all genomes annotated at ncbi is provided .
currently , more than 2,200 eukaryotic genomes have been deposited , and from that , more than 200 corresponds to plant species .
the database provides a versioned assembly accession number that tracks changes to assemblies as they are updated by submitting groups over time .
the assembly database reports metadata such as assembly names , simple statistical reports of the assembly as well as the assembly update history .
links in the assembly resource allow users to easily download sequence and annotations for current versions of genome assemblies from the ncbi genomes ftp site .
2.3.cogepedia is the official wiki page of coge , a platform for performing comparative genomics research which provides a network of interconnected tools to manage , analyze , and visualize next generation sequenced data .
their interest to plant genomics is the existence of a link in this page with much updated information on sequenced plant genomes .
individual information on each species with links to the genome publication or the genome project main page is provided .
2.4.plabi is a plant genomic database with a very updated tool to know which plant species have been sequenced .
links to the research articles where each plant genome has been published are also included .
formerly , species specific databases were developed . the arabidopsis initiative resource , tair ( http://www.arabidopsis.org/ ) was the first database created to harbor the genomic sequence of a plant and to surround it with different tools to explore this sequence .
these tools have been increasing with the subsequent releases of the genomic sequence and cover different aspects related not only with the arabidopsis genome , but with some other features such as germplasm , teaching , laboratory protocols or gene expression experiments . with the increasing of genome projects regarding various related species , databases from specific clades
this database comprises the reference genomes of tomato , potato , pepper and solanum pennelli ; the draft genomes of solanum pimpinellifolium , nicotiana benthamiana and nicotiana tabaccum ; and the genomes of two inbred lines of solanum lycopersicum . as for individual databases , a set of tools have been implemented to analyze the genomic sequences .
the individual / clade databases hosting the approximately 140 plant species sequenced to date can be easily found by writing the word genome and the species / clade in any internet search engine . at the same time , secondary databases have arisen to deal with features regarding comparative plant genomics research .
these databases harbor different plant genomes and differ in both , the plant species they host , and the tools and resources they have .
the aim of these projects is to explore how genomics is evolving from largely descriptive to highly predictive driven by quantitative measurements , with algorithms and computation as the domain - adapted language .
several tools are common to all databases . for example , sequence similarity searches are the most reliable strategy to identify homologous proteins or genes by detecting statistically significant similarity .
all databases include in their repertoire of bioinformatics tools a search engine to explore the annotated genome sequences , typically using the blast algorithm
. likewise , genome browsers , such are the commonly used gbrowse or jbrowse , are key tools offered by all databases to provide a graphical interface for users to browse , search , retrieve and analyze genomic sequence and annotation data . because of their importance in modern research , several of the comparative genomic databases
ensembl plants is an integrative resource presenting genome - scale information for 39 sequenced plant species , including 12 eudicots , 21 monocots , one moss , one pseudofern , two green algae , one red algae and the genome of amborella trichopoda , which belongs to a sister clade of the other angiosperm species .
data provided includes genome sequence , gene models , functional annotation , and polymorphic loci .
gene families , based in an all - versus - all blastp alignment , are provided .
gene trees showing the evolutionary history of each gene family are available under the plant compara section .
access to the data is provided through a genome browser with tracks displaying genome sequence and assembly information , additional gene model and variation datasets , and precomputed sequence alignments including ests , rnaseq experiments , repeat features , oligo - probe , and marker sets .
ensembl plants is updated 45 times a year and is developed in collaboration with the gramene database and the transplant project ( http://www.transplantdb.eu ) that aims to facilitate the exchange and integration of plant genome data from distributed resources as well as the development of common standards and protocols .
gramene is a curated online resource for comparative functional genomics in crops and model plant species , currently hosting 45 sequenced reference genomes in its build number 48 . since 2009 gramene has partnered with the plants division of ensembl genomes ( http://www.plants.ensemb.orgl/ ) to jointly produce the genome browser described above , which takes advantage of the ensembl infrastructure and provides an interface for exploration of genome features , functional ontologies , variation data and comparative phylogenomics .
gramene includes a wide array of potentially useful tools such as genetic and physical maps with genes , ests and qtls locations , genetic diversity data sets , structure - function analysis of proteins , plant pathways databases ( biocyc and plant reactome platforms ) , and descriptions of phenotypic traits and mutations .
plant gdb is a web resource devoted to develop robust genome annotation methods , tools , and standard training sets for plant genomes . from 2012
plant gdb also provides annotated transcript assemblies for more than 250 plant species , with transcripts mapped to their cognate genomic context where available , integrated with a variety of sequence analysis tools and web services .
plant gdb hosts a plant genomics research outreach portal that facilitates access to a large number of resources for research and training . from july 2015
the plant gdb 's funding has ended and the website is no longer being updated .
3.4 .
plants db is a database that has been developed by the plant genomics group of the pgsb ( plant genome and systems biology , formerly mips ) .
plants db aims to provide a data and information resource for individual plant species , especially complex triticeae genomes , and currently hosts 13 monocot and dicot species .
the database framework integrates genome data from both model and crop plants and facilitates knowledge transfer between them using state - of - the - art comparative genomics tools such as crowsnest , created to visualize and investigate syntenic relationships between monocot genomes , and the genome zipper concept for an ordered gene annotation in cereals .
phytozome is the plant comparative genomics portal of the department of energy 's joint genome institute ( doe jgi ) . in the current release v10.3
, phytozome provides access to sixty - one sequenced and annotated green plant genomes , forty - seven of which have been clustered into gene families at 12 evolutionarily significant nodes .
it harbors the individual species genomic sequences compiled in the doe jgi , and links to the individual pages of the other genomes it hosts .
families of related genes representing the modern descendants of ancestral genes are available . they have been constructed from an all - versus - all blastp alignment used to compute the evolutionary distance between each two proteins , the identification of orthologs via reciprocal best hit or synteny analysis , and the accretion of paralogs using outgroup scores .
these families allow easy access to clade - specific orthology / paralogy relationships as well as insights into clade - specific novelties and expansions
. each gene has been annotated with available pfam , kog , kegg , panther and go assignments , and its evolutionary history at the level of sequence , gene structure , gene family and genome organization is provided . besides , phytozome provides access to the plant genomes it hosts using the jbrowse genome browsers available for all genomes .
plaza is a platform designed to make comparative genomics in plants and developed in the university of ghent .
the current version plaza 3.0 hosts 37 plant species covering a broad taxonomic range and includes 25 eudicot , 8 monocot , one moss and two algae species , as well as the genome of amborella trichopoda .
plaza provides detailed structural and functional annotation of the genes , which has been expanded in the new version and now comprises data from gene ontology , mapman , uniprotkb / swiss - prot , plntfdb and planttfdb . from the more than one million genes annotated in the genomes it harbors , gene families and subfamilies have been delineated .
first , by computing the protein sequence similarity through an all - against - all blast , and then by applying graph - based clustering methods implemented in tribemcl and orthomcl . other relevant data available in this database consist of phylogenetic trees to identify biologically relevant duplication and speciation events , and detailed information about genome organization to unveil small and large genome duplication events .
furthermore , this database provides tools to transfer functional annotation from well - characterized plant genomes to other plant species .
greenphyldb is a comparative genomics database jointly developed by biodiversity international and the international cooperation center for agricultural research for development ( cirad ) .
the current version greenphyldb 4.0 hosts 37 species of the plantae kingdom including one red alga , two green algae , one moss , one lycophyte , one conifer , the ancestral angiosperm amborella , ten monocots and 20 eudicot species .
this software uses different pairwise similarity matrices obtained by running protein - protein blast using increasing stringent thresholds .
then , these matrices are used by a markov cluster algorithm to group proteins in families at different levels of clustering ( 1 to 4 ) .
results of the automatic clustering are manually annotated using cross reference databases and analyzed by a phylogenetic - based approach to predict homologous relationships .
currently , greenphyldb contains 8,347 clusters with more than 5 sequences at level 1 , from which 2,939 are annotated and 4,788 have available phylogenetic trees . for each gene cluster , this database offers an easy access to the gene composition by species , and provides protein domains , orthologous gene predictions and relevant external links .
plantordb is a genome - wide database created to classify genes in families and to find orthologous genes clusters . the recently launched first version of plantordb hosts 41 species including six green algae , one moss , one lycophyte , six monocots and 27 eudicot species .
gene families are available , which have been generated from an all - against - all blast search approach .
the web interfaces provided by plantordb display information on the evolutionary features of an individual gene and its homolog gene family , which can be deduced from multiple sequence alignments and phylogenetics trees . tools to provide an accurate classification of a query sequence within a phylogenetic tree and a multiple sequence alignment are also available .
salad is a comparative genomics database constructed from plant - genome - based proteome data sets .
the version 3.0 , appeared in 2009 , hosts 10 species including a yeast species .
the most important singularity of this database is the construction of dendrograms for protein families using the information derived from conserved motifs discovered using the meme software .
protein clusters are determined from blastp searches and , then , meme motifs are used to select the proteins displayed in the dendrograms . a viewer to see microarray data sets of paralogous genes in the dendrograms is also provided .
planttribes is a gene family resource for comparative genomics in plants that launched its current 2.0 version in 2007 .
it harbors the proteome of ten plant species , from green algae to angiosperms , from which putative gene families were created by a blastp approach and the use of the mcl algorithm for clustering .
the database is currently active and permits identify groups of related genes and their expression patterns , using the microarray information existing at the date the current version was released .
plantgenie.org is a collection of web resources for searching , visualizing and analyzing genomics and transcriptomics data recently developed for different plant species .
currently , it includes dedicated web portals for enabling in - depth exploration of poplar , norway spruce , and arabidopsis genomes .
standard features , including genome browsers , gene list annotation , blast tools and gene information pages are provided .
the aim of this database is to continue and develop the resource by inclusion of additional species , maintaining a focus on woody species .
pogs2 is a relational database designed to facilitate cross - species inferences about gene functions and gene models in plants . in its current 2.0 version , the database integrates data from rice , maize , arabidopsis thaliana , and poplar by placing the complete predicted proteomes into putative orthologous groups
each pog entry includes putative orthologs annotated with gene descriptions imported from species - specific databases , graphical representations of conserved protein domains and phylogenetic trees showing closely - related proteins .
extant genomes of 16 eudicot and 10 monocot plants can be analyzed , as well as 23 ancestral reconstructed genomes . in the current 16.03 version ,
all the data on extant species come from the annotations of selected genomes available in ensembl plants and phytozome .
a distinctive feature of this database is that the displayed genomic context of a gene is showed in parallel to the genomic context of all its orthologous and paralogous copies evolutionarily ordered in a phylogenetic tree .
piece is a comparative genomics database focused in the comparison of exon - intron plant gene structures and their evolutionary and functional relationships . in the first and current version , annotated genes were extracted from 25 species , from green algae to angiosperms , and classified based on pfam motifs .
phylogenetics trees are available for each gene family , which integrate exon - intron and protein motif information .
both the sequences and gene structure information for each identified gene are also available .
plantseed is a database created to support subsystems - based annotation and metabolic model reconstruction for plant genomes .
annotations of protein families from ensembl plants for five eudicot and five monocot species have been used to construct subsystems , which are the integration of metabolic pathways or other biological processes with genome annotations .
the manual curation of the subsystems permits a rapid reconstruction and modelling of primary metabolism for all plant genomes in the database .
pgdbj is the plant genome database japan , a portal website that aims to integrate plant genome - related information from databases .
the main tool developed in this web is the ortholog db , which comprises clusters of homologous sequences .
clusters were obtained from reciprocal blast searches using the proteome of 20 plant species from the main clades of the viridiplantae kingdom .
pgdbj also provides dna marker and qtl information of important agronomic traits for many plant species .
the new high - throughput genomic methods implies the generation of massive data . computation capability is a major challenge for the handling of these data .
the accessibility to computational tools easy to manage for a scientist without programming or informatics expertise is a solution to address this problem . in recent years , several web - based platforms
have been created to store next - generation sequencing data and to host different applications to work with these data to extract biological relevant information .
galaxy is an open web - based platform for genomic research with many tools to work with computation - reliant results .
recently , an open - source project specific for plants , the iplant , has been launched .
the iplant collaborative ( https://de.iplantcollaborative.org/ ) is a united states national science foundation ( nsf ) funded project created as an innovative , comprehensive , and foundational cyberinfrastructure in support of plant biology research .
iplant includes the use of high - performance computing , use of large shared data storage , and the establishment of collaborations and virtual organizations around shared analysis tools and analyzed data .
iplant hosts bioinformatics tools for most of the modern research challenges , such as data importers , sequence alignments and phylogenetic tree building , phylogenetic and evolutionary analyses , qtl mapping and genome - wide association studies , ultrahigh - throughput sequence processing , functional analyses , clustering and network analyses , variant detection and annotation , rnaseq analyses and chip - seq studies .
in particular , to manage and serve published plant genome data , iplant has developed a workspace named dna subway .
dna subway has been conceived to be a space for gene annotation and genome analysis that currently hosts tools to predict and annotate genes , prospect entire plant genomes for related genes and sequences , determine sequence relationships and analyze rna - seq reads to measure differential expression . to prospect genomes
, it harbors the target program that permits a search for homologous sequences in 18 plant genomes , covering different clades from algae to angiosperms , and builds multiple sequence alignments and phylogenetic trees with the obtained sequences .
bioinformatic programs and algorithms have arisen as key tools for modern research . in plants ,
the number and relevance of these tools have been increased in recent years , mainly those related to genomics aspects .
new science implies the existence of databases where the genomes are hosted and exhaustive analysis can be performed .
although these databases should be continuously updated , the assembly and annotation of many of the draft genomic sequences have not been improved from its first release .
this is an actual challenge , since it is easy now to produce a new draft sequence but more complicated to improve its quality .
for example , the pre - release of the version number 11 for the arabidopsis genome has appeared in araport ( https://www.araport.org/ ) in october 2015 with genomic sequences assembled in its five chromosomes .
on the contrary , the first release of the genome of the lycophyte selaginella moellendorffii appeared in 2007 assembled into 768 scaffolds and has not been subsequently updated . as a next step in plant genomics
, new databases have been developed to deal with the issue of comparing the increasing number of sequenced genomes .
most comparative genomic databases are periodically updated and have become powerful tools to extract shared information coming from evolutionarily related plant species .
however , the extremely high new information obtained in modern laboratories using computational approaches makes necessary the existence of new high - performance computational developments that uses the computational power of the internet and the storage of resources in the cloud . as a new challenge , actual projects in arabidopsis and rice
are directed to the comparison of thousands of genomes obtaining from different genotypes of the same species .
innovative solutions for storage and visualization , such as the rice snp - seek database ( http://oryzasnp.org/iric-portal/ ) , have to be developed to use efficiently the massive new information obtained .
as an example of the continuous evolution of genomic databases , the iplant collaborative resource has evolved into the cyverse cyberinfrastructure , which provides tools not only for plant research ( http://www.cyverse.org/ ) .
| in recent years , the genomic sequence of numerous plant species including the main crop species has been determined .
computational tools have been developed to deal with the issue of which plant has been sequenced and where is the sequence hosted . in this mini - review ,
the databases for genome projects , the databases created to host species / clade projects and the databases developed to perform plant comparative genomics are revised .
because of their importance in modern research , an in - depth analysis of the plant comparative genomics databases has been performed .
this comparative analysis is focused in the common and specific computational tools developed to achieve the particular objectives of each database . besides , emerging high - performance bioinformatics tools specific for plant research are commented .
what kind of computational approaches should be implemented in next years to efficiently analyze plant genomes is discussed . |
chronic rhinosinusitis ( crs ) is one of the most common chronic medical complaints in the united states , affecting nearly 16% of the general population , and seems to be increasing in incidence and prevalence , accounting for 13 million physician visits annually and responsible for an estimated total cost of $ us6 billion / year.1,2 the etiology of crs is thought to be multifactorial and can include bacterial infection , fungal colonization , environmental or aspirin sensitivities , immune or genetic disorders , poor mucociliary clearance , anatomic obstruction , and idiopathic inflammation.2,3 chronic inflammatory disease of the paranasal sinuses was thought to arise from prolonged obstruction of the ostiomeatal complex , leading to stasis of secretions , mucociliary dysfunction , and failure to clear bacteria from the sinuses.24 although there has been a shift to anti - inflammatory therapies in crs , bacteria and fungi are still likely to be powerful mediators of inflammation.4 in the blocked sinus , bacteria that are normally removed from the sinuses by drainage of secretions may proliferate .
the current model of crs pathophysiology focuses on the interaction of the inflammatory mucosal disease with microbial flora and the failure of innate immunity.25 in the medical management of crs , a combination of nasal saline irrigations , decongestants , nasal and systemic steroids , and courses of antibiotics are currently prescribed.25 current systemic agents , such as oral or intravenous antimicrobials or corticosteroids , have significant side effects and are not successful in many patients .
this problem has led investigators to examine local delivery of topical therapies.6 in cases where conservative management has failed , endoscopic sinus surgery ( ess ) is considered.3,4 topical forms of medical therapy represent an attractive alternative for drug delivery to the nasal cavity and paranasal sinuses .
topical drug delivery has the advantage of directly acting on the site of inflammation , producing a higher concentration at the target site while avoiding systemic side effects.6 moreover , a successful topical nasal treatment will increase the response rates of conservative management and will decrease the need for surgery.3,6 the general aim of topical therapy may also lie between potentially contending procedures such as mechanical irrigation and pharmaceutical intervention.5,6 the mechanical removal of pollutants , inflammatory products , mucus , antigen , and bacteria / biofilms is often addressed by nasal irrigation .
these procedures rely on high - volume , positive - pressure solutions to provide shearing forces
. however , the same approach may not be appropriate for drug delivery since complete sinus delivery , prolonged mucosal contact time with local absorption , and minimal depletion are often the desired properties.6 corticosteroids and antibiotics have been successfully delivered through intranasal means .
various methods of topical drug delivery have been used , such as nasal drops , nasal sprays , nebulized droplets , and larger - volume irrigation.2,6 despite general acceptance and clinical use of topical nasal therapy , only a few studies have concentrated upon the intranasal drug distribution . although considerable research was carried out into improving nasal formulations in order to enhance absorption , little attention has so far been directed to upgrading delivery devices . the aim of the present review is to present the current knowledge on the novel drug delivery devices in use in the management of crs patients , and to present the data on topical drug penetration into the sinuses .
additionally , methods used to enhance fluid sinus deposition are presented and the published clinical studies on the results of nebulized antibiotics in the treatment of crs patients are discussed . nasal irrigation with isotonic or hypertonic
saline is an inexpensive treatment and is a widely used drug delivery method in crs patients .
it is suggested that nasal irrigation removes inflammatory cells and excess secretions from the mucosal surface , decreases edema , enhances mucociliary clearance , and could be a potential route for topical drug delivery into the paranasal sinuses , including during the post - ess period.6,7 however , it was demonstrated that access of the drug to the paranasal sinuses during nasal irrigation may only be possible post sinus surgery.8 therefore , in addition to saline , other drugs , such as steroids and antibiotics , may be applied during nasal irrigation in the post - ess period .
another current topical treatment option is the use of nasal pump sprays , mainly because of their ease of use .
these generate droplets between 50 and 100 m in diameter , and amounts between 70 and 150 l are administered per puff .
different drug formulations are available for use with nasal pump sprays , such as saline , decongestants , mucolytics , or steroids
. however , a common feature of nasal sprays is the large fraction deposited in the anterior region of the nose with no significant aerosol access to the paranasal sinuses.9,10 the recently introduced breath - actuated bidirectional delivery device ( optimist ; optinose as , oslo , norway ) surmounted several limitations of the current methods of nasal spray delivery.11 the optimist device has a conical , sealing nosepiece and a mouthpiece , includes a traditional spray pump and a breath - actuation mechanism , and generates droplets of 43 m diameter .
the device is inserted into one nostril and the patient blows into the mouthpiece . blowing closes the soft palate and transfers the oral pressure to the nostril .
the nosepiece automatically balances the pressure in the nasal and oral cavities . in these instances , air is able to exit through the other nostril ( bidirectional flow )
. exhalation automatically triggers particle release at the moment where the positive dynamic pressure expands the nasal cavities .
since drug delivery occurs during exhalation , small particles can not enter the lungs.11 djupesland et al11 compared nasal deposition patterns between a conventional nasal spray and the optimist device .
the deposition models generated by the two devices were compared in nine healthy subjects subsequent to technetium 99 m ( tc ) administration.11 the study demonstrated significantly larger initial and cumulative deposition in the upper posterior sector of the nasal cavities housing the middle meatus and sinus ostia and significantly lower deposition in the anterior segment .
standard medical nebulizers can be used for aerosol generation and delivery into the nasal cavity.9 for efficient deposition into the sinuses , the aerosol should enter into the posterior nasal cavity .
two main nebulizer systems have been developed , differing in the diameter of the droplets produced and the flow patterns conveyed to these particles.12 passive - diffusion nebulizers produce particles of a smaller size delivered in a constant direction ; nevertheless , they have a slower velocity .
vortex - propelled nebulizers produce larger nebulized particles and centrifuge these droplets to the outer edge of the vortex represented by the walls of the nasal cavity and the paranasal sinuses .
a passive - diffusion nebulizer system is the sinuneb device ( pari respiratory equipment , inc , midlothian , va ) .
the sinuneb device generates aerosolized particles of 3 m in diameter and delivers particles to the nasal cavity by passive diffusion through a hollow tube with two perforations at one end , spaced apart to match the nares .
the vianase device ( kurve technology inc , lynnwood , wa ) is a vortex - propelled nebulizer system . the vianase device generates an active vortex of nebulized particles , contained within an occlusive nosepiece .
the vianase device generates particles of between 9 and 11 m in size . a recent development in the field of nebulizers
is the pulsating aerosol delivery device.9,10,13,14 a pulsating aerosol is an aerosol stream superimposed by a pulsation ( sound wave ) .
the german company pari developed a commercial pulsating aerosol delivery device , the pari sinus pulsating aerosol system ( pari gmbh , starnberg , germany ) in 2003 .
the pari sinus device contains the pari lc star jet nebulizer with a 3-m mass median aerodynamic diameter and output flow rate of 6 l / minute . a pulsation of 44 hz
further developments incorporating a new vibrating membrane technology were recently reported , as commercialized in the eflow electronic nebulizer ( pari ) . using this technology in the pari device , the particle size distribution could be sharpened and the flow rate could be reduced to 3 l / minute .
a pressure wave of 25 hz frequency with amplitude of 20 mbar was superimposed on the aerosol stream.13,14 for delivery , the nebulizer is attached to one nostril and a flow resistor is plugged into the contralateral nostril . during delivery
the patients are instructed to close their soft palate , which directs the aerosol from the delivery nostril to the second output nostril . using this
recommended protocol an aerosol pathway to the nasal airways is generated and drug penetration to the lung can be prevented .
the output resistor and closure of the soft palate ensure optimal pressure transduction to the sinuses.9,10,13,14
nasal irrigation with isotonic or hypertonic saline is an inexpensive treatment and is a widely used drug delivery method in crs patients .
it is suggested that nasal irrigation removes inflammatory cells and excess secretions from the mucosal surface , decreases edema , enhances mucociliary clearance , and could be a potential route for topical drug delivery into the paranasal sinuses , including during the post - ess period.6,7 however , it was demonstrated that access of the drug to the paranasal sinuses during nasal irrigation may only be possible post sinus surgery.8 therefore , in addition to saline , other drugs , such as steroids and antibiotics , may be applied during nasal irrigation in the post - ess period .
another current topical treatment option is the use of nasal pump sprays , mainly because of their ease of use .
these generate droplets between 50 and 100 m in diameter , and amounts between 70 and 150 l are administered per puff .
different drug formulations are available for use with nasal pump sprays , such as saline , decongestants , mucolytics , or steroids
. however , a common feature of nasal sprays is the large fraction deposited in the anterior region of the nose with no significant aerosol access to the paranasal sinuses.9,10 the recently introduced breath - actuated bidirectional delivery device ( optimist ; optinose as , oslo , norway ) surmounted several limitations of the current methods of nasal spray delivery.11 the optimist device has a conical , sealing nosepiece and a mouthpiece , includes a traditional spray pump and a breath - actuation mechanism , and generates droplets of 43 m diameter .
the device is inserted into one nostril and the patient blows into the mouthpiece . blowing closes the soft palate and transfers the oral pressure to the nostril .
the nosepiece automatically balances the pressure in the nasal and oral cavities . in these instances , air is able to exit through the other nostril ( bidirectional flow )
. exhalation automatically triggers particle release at the moment where the positive dynamic pressure expands the nasal cavities .
since drug delivery occurs during exhalation , small particles can not enter the lungs.11 djupesland et al11 compared nasal deposition patterns between a conventional nasal spray and the optimist device .
the deposition models generated by the two devices were compared in nine healthy subjects subsequent to technetium 99 m ( tc ) administration.11 the study demonstrated significantly larger initial and cumulative deposition in the upper posterior sector of the nasal cavities housing the middle meatus and sinus ostia and significantly lower deposition in the anterior segment .
standard medical nebulizers can be used for aerosol generation and delivery into the nasal cavity.9 for efficient deposition into the sinuses , the aerosol should enter into the posterior nasal cavity .
two main nebulizer systems have been developed , differing in the diameter of the droplets produced and the flow patterns conveyed to these particles.12 passive - diffusion nebulizers produce particles of a smaller size delivered in a constant direction ; nevertheless , they have a slower velocity .
vortex - propelled nebulizers produce larger nebulized particles and centrifuge these droplets to the outer edge of the vortex represented by the walls of the nasal cavity and the paranasal sinuses .
a passive - diffusion nebulizer system is the sinuneb device ( pari respiratory equipment , inc , midlothian , va ) .
the sinuneb device generates aerosolized particles of 3 m in diameter and delivers particles to the nasal cavity by passive diffusion through a hollow tube with two perforations at one end , spaced apart to match the nares .
the vianase device ( kurve technology inc , lynnwood , wa ) is a vortex - propelled nebulizer system . the vianase device generates an active vortex of nebulized particles , contained within an occlusive nosepiece .
the vianase device generates particles of between 9 and 11 m in size . a recent development in the field of nebulizers
is the pulsating aerosol delivery device.9,10,13,14 a pulsating aerosol is an aerosol stream superimposed by a pulsation ( sound wave ) .
the german company pari developed a commercial pulsating aerosol delivery device , the pari sinus pulsating aerosol system ( pari gmbh , starnberg , germany ) in 2003 .
the pari sinus device contains the pari lc star jet nebulizer with a 3-m mass median aerodynamic diameter and output flow rate of 6 l / minute . a pulsation of 44 hz
further developments incorporating a new vibrating membrane technology were recently reported , as commercialized in the eflow electronic nebulizer ( pari ) . using this technology in the pari device , the particle size distribution could be sharpened and the flow rate could be reduced to 3 l / minute .
a pressure wave of 25 hz frequency with amplitude of 20 mbar was superimposed on the aerosol stream.13,14 for delivery , the nebulizer is attached to one nostril and a flow resistor is plugged into the contralateral nostril . during delivery
the patients are instructed to close their soft palate , which directs the aerosol from the delivery nostril to the second output nostril . using this recommended protocol an aerosol pathway to the nasal airways is generated and drug penetration to the lung can be prevented .
the output resistor and closure of the soft palate ensure optimal pressure transduction to the sinuses.9,10,13,14
the paranasal sinuses are air - filled cavities within the bones of the skull , ranging in volume between 5 and 30 ml .
the sinus is connected to the nasal cavity through the ostium , a narrow channel of about 13 mm in diameter and 1015 mm in length .
since the sinuses are poorly ventilated , hollow cavities , current in vivo and in vitro experimentation has found inconsistent drug penetration into the sinuses .
the fundamental principles that determine the efficiency of deposition of aerosolized particles in the paranasal sinuses were described by hyo et al.15 using a plastic cast model , hyo et al found that optimum particle size for deposition in the maxillary sinus varied with size of the ostia , and they documented no difference in deposition efficiency when comparing a plastic mold model and healthy volunteers.15 mathematical modeling of aerosolized particle deposition suggests that three main factors are associated with particle penetration within the sinus : size of the ostium , pressure / rate of flow of the aerosol , and particle size .
the authors concluded that ciliary action and respiration play a minor role in particle deposition , validating the use of a static cadaver model that has been used in subsequent studies of aerosolized delivery to the paranasal sinuses.15 hyo et al15 theorized that the ideal particle size for aerosol delivery to the maxillary sinus would be 310 m . however , an average of 3% of particles from 3 to 10 m in diameter penetrates into the maxillary sinus . on the other hand , saijo et al16 investigated the particle deposition of steady - state aerosol flow in the paranasal sinuses in a post - ess cast model .
they found that an insertion angle of 45 significantly increased the particle deposition compared with a 30 insertion .
they also showed that higher flow rates , smaller particle size , and larger ostial diameter allow for better penetration into the maxillary sinus .
particles of 5.63 m in diameter were deposited in the maxillary sinus in greater frequency than particles with a diameter of 16.37 m.16 negley et
al17 studied the sinus deposition of technetium tc administration by means of the rinoflow nasal aerosol delivery device ( respironics , inc , cedar grove , nj ) on five healthy subjects .
the rinoflow is a nebulizing device that delivers droplet particles in the 2030 m range in a controlled flow .
subjects were asked to voluntarily perform the politzer maneuver ( occluding the alternate nostril and swallowing ) during nebulization .
three of the five subjects revealed incomplete and inconsistent deposition in the frontal and maxillary sinuses .
the sample size was too small to attain significance , but one should take into account that in subjects without any blockages of the ostiomeatal unit an insignificant amount of irrigation solution could be delivered into the paranasal sinuses.17 olson et al18 also studied the distribution of nasal irrigation isotonic solutions in eight healthy , unoperated volunteers by comparing three - dimensional computed tomography imaging of three irrigation techniques : positive - pressure irrigation , negative - pressure irrigation , and passive - diffusion nebulization .
positive - pressure irrigation was generated by a squeeze bottle such as the sinus rinse ( neilmed , inc , santa rosa , ca ) , negative pressure was created through sniffing and nebulization was generated by the rinoflow device .
the rinoflow nebulizer was found ineffective , consistent with the previous study : ethmoid penetration was achieved in only two cases .
interestingly , nasal irrigation was effective in the cases of spray bottle use and inhalation methods.18 contrast solution reached ethmoid and maxillary sinuses that were more uniform irrigated in positive - pressure administration .
the ethmoid sinuses were penetrated in seven subjects during negative - pressure irrigation and in six subjects during positive - pressure irrigation .
maxillary sinus irrigation was highest in the positive - pressure group versus the negative - pressure group ( seven versus five ) with bilateral involvement in five of eight subjects .
however , the study demonstrated universally poor sphenoid and frontal sinus penetration . according to these results
, the ability of an irrigation technique to deliver a solution to the paranasal sinuses should be related to sufficient pressure and high volume.18 wormald et al19 compared the effectiveness of three methods of nasal irrigation : irrigation with a nasal spray bottle , nasal nebulizer , and nasal douching bottle with the subject in the kneeling position .
one limitation of nasal douching is that it may be difficult for older patients or patients with arthritis to adopt the position required . nasal cavity , maxillary sinus , and the frontal recess ( not frontal sinus ) were the accessible areas , but no technique was found to reliably penetrate the sphenoid or frontal sinus.19 snidvongs et al20 conducted a clinical study to investigate how well nasal irrigation could reach the paranasal sinuses in crs patients .
nasal douching was carried out using an irrigation syringe in one side , and 10 ml of spray in the other .
a computed tomography scan was undertaken for each patient to determine the volume and distribution of staining .
only two patients had any staining , with a small amount present in a total of three maxillary sinuses .
both of them delivered only a small amount of the solution , if any , into the sinuses .
blockages of the ostiomeatal complex may be a primary cause for the poor sinus solution penetration.20 hwang et al7 investigated ten healthy subjects and five post - ess subjects looking at sinus penetration of the sinuneb device , the vianase device , and the nasal spray bottle .
the vortex nebulizer had the greatest potential for sinus penetration with rates of 30% penetration for the frontal sinus , 10% for the maxillary sinus , and 30% for the sphenoid sinus .
in contrast , the sinuneb device and the spray bottle both showed 0% penetration for all sinuses .
the sinus penetration for the postoperative group was collectively poor.7 valentine et al12 compared the sinus penetration of the pari pulsed nebulizer to nasal irrigation with a squeeze bottle in a highly dissected cadaver model .
solutions were stained with methylene blue while staining intensity and colored area within the sinuses were assessed by three independent , blinded observers .
the authors documented a significant increase in intensity of stain , percentage of stain , and circumference stained with the plastic nasal irrigation squeeze bottle versus the pari device .
analysis of individual sinuses showed noteworthy increases in the indices of nasal douching relative to nebulization . in their study ,
the pari device was noted to achieve ethmoid staining on a regular basis , whereas the other sinuses were inconsistently reached : frontal sinus , 43% ; maxillary sinus , 46% , and sphenoid , 54%.12 in a recent study , mller et al9,10 investigated sinus ventilation in healthy human volunteers using dynamic kr - gas imaging in combination with pulsating airflows .
kr - gas was continuously ventilated through the nasal airways with and without pulsation and sinus gas access was monitored using gamma camera imaging . without pulsation , only the central nasal cavity appeared on the image . with pulsation ,
less than 5% of the total kr - gas activity within the nasal cavity penetrated into the sinuses .
in addition , pulsating airflow caused a sustained release of kr - gas activity from the nasal cavity and the sinuses after switching off kr - gas delivery .
the authors suggest that this postponement can cause an increased residence time of an aerosolized drug in the sinuses , further enhancing aerosol deposition.9,10 during the same study , the deposition efficiency of tc - diethylene triamine pentaacetic acid aerosol delivered by pulsating airflow was assessed in each volunteer and compared to its deposition effectiveness using nasal pump sprays .
a solution composed of tc - diethylene triamine pentaacetic acid was delivered to each nostril for 20 seconds .
the authors compared their results on distribution and clearance with those obtained after nasal pump spray delivery of a similar tc - diethylene triamine pentaacetic acid solution .
nasal distribution was assessed by generating an image composed from lateral gamma camera images superimposed on a coronal magnetic resonance tomography scan of the volunteer .
nasal pump sprays gave anterior nasal airway deposition , and significant mucociliary clearance had already happened by the time the image was recorded.10 the pulsating aerosol delivery gave more posterior aerosol deposition , with access to the ostiomeatal complex .
with pulsating aerosol delivery , the authors report that total deposition in the nasal cavity ( including sinuses ) of the five subjects was 71% 17% of the nebulized dose , and 6.5% 2.3% of the total nose activity ( including sinuses ) penetrated to the sinuses . in the same study
it was demonstrated that by using the nasal pump spray , there was 100% deposition of the administered activity , and less than 1% of this dose penetrated into the sinuses.9 aerosol delivered by nasal pump sprays has a high rate of clearance out of the nose : 50% was cleared after 14.2 3.4 minutes , and after 6 hours , less than 5% of activity was retained in the nose .
in contrast , the pulsating aerosol delivery has retarded clearance kinetics : 50% of the dose was cleared after 1.2 0.5 hours , and more than 20% of the administered dose was retained in the nose after 6 hours.9,10 the studies conducted by mller et al9,10,13,14 have shown that drug delivery using pulsating aerosols was associated with slower clearance of the radiotracer from the nose compared with nasal pump spray delivery , suggesting penetration into the nose to sites with retarded mucociliary clearance .
the authors conclude that clearance kinetics in the range of hours using pulsating aerosol delivery , compared with 1020 minutes using nasal pump sprays , may provide longer residence times of a drug administered to the nose as a pulsating aerosol , and it may prevent rapid removal by mucociliary clearance and by circulation.9,10,13,14 therefore , pulsating aerosols may consent to formulations with sustained - release profiles and possibly once - daily application , even with shorter half - time values.9,14
besides the delivery methods discussed previously , there are other methods used in clinical practice to enhance drug delivery to the sinuses : ess and the position of the patient during nasal irrigation.6 recent evidence supports the belief that ess improves the delivery of topical medications to the sinus mucosa : harvey et al8 studied the efficiency of nasal irrigation in ten cadavers and demonstrated that ess significantly enhanced sinus delivery of medication , regardless of delivery device .
ess is essential to effectively allow topical distribution to the sinus mucosa.6,8,21 the frontal and sphenoid sinus are essentially inaccessible before surgery and according to grobler et al22 an ostium size of greater than 4 mm is required to even begin drug penetration into the maxillary sinus . for those with mucosal edema and chronic inflammation , distribution is probably worse . for these reasons , harvey and
schlosser6 stated that in medically managing crs , the use of expensive and time - wasting topical therapies , such as increasing topical steroid options , are probably not supported prior to ess .
there are conflicting reports on the most effective position for drug delivery to the nasal cavity and paranasal sinuses .
the majority of these studies involve assessment of dye distribution in the region of the middle turbinate with simple sprays and drops in nonoperated patients.23,24 many commercial products recommend a head - down , over sink , with nose to ground position for irrigation .
( left lateral and supine positions ) were superior to the mecca and head back positions in delivery of drops to the middle meatus.25 however , these results were found inconclusive by other investigators.2630 the relevance of positioning with positive - pressure irrigation is supposed to be less significant.2732 however , even with positive - pressure , high - volume irrigation , the head - down or lateral position may lead to better frontal distribution.33
it is common practice to prescribe prolonged courses of antibiotics during the medical management of crs patients .
although widely accepted , this strategy is empirical and based in part upon culture reports available.24 in many bacteriological culture studies , staphylococcus aureus has been found to be a predominant species.3,4 despite the consistency of culture results positive for s. aureus , there is no consensus on whether or not its presence is of pathogenic importance .
the secretion of various enzymes and toxins feeds the inflammatory reaction and preserves the recalcitrance of the disease .
moreover s. aureus has been discussed in the literature because of its superantigen potentials and their apparent link to biofilm.35 disadvantages of prolonged antibiotic administration include bacterial resistance , allergic reactions , nephrotoxicity , ototoxicity , and gastrointestinal and hepatic disturbances .
it has been suggested that topical application of antibiotics directly to the target site prevents these adverse effects of prolonged systemic administration , and avoids selection of resistant gut microflora . on the other hand ,
topical antibiotics have the theoretical advantage of acting directly on the site of infection and producing a higher concentration of antibiotic at the target site .
such increased concentrations of topical antibiotics have also been shown to be effective in killing bacteria in biofilm form.3 there is experimental evidence on the effectiveness of topical therapy in the management of crs .
recently , antunes et al34 reported on the dose - dependent effects of topical tobramycin in an animal model of pseudomonas aeruginosa sinusitis .
they noted that as opposed to normal saline irrigations , topical tobramycin led to a significant improvement in the degree of infection in this animal model.34 it is interesting that so few clinical studies have been conducted to explore the therapeutic option of nebulized antimicrobials in the treatment of crs . in a prospective study ,
kamijyo et al35 reported on 28 patients treated with fosfomycin nebulization three times a week for a period of 4 weeks .
improvement in terms of objective symptoms and endoscopic findings was rated as at least fair in about 60% of patients , except for the amount of secretion .
postnasal drip improved in 88% of the patients.35 vaughan and carvalho36 evaluated the effect of the nebulization of several antimicrobials over a period of 3 months in 42 patients with crs .
the authors compared the efficiency of six different culture - dependent nebulized antibiotics versus standard oral or intravenous antibiotic therapy .
they reported significant improvements for posterior nasal discharge , facial pain , and emotional consequences .
there was also an increase of the disease - free interval period : an average of 17 weeks for nebulized therapy versus 6 weeks for standard therapy.36 in a retrospective evaluation , scheinberg and otsuji37 reported on the effect of nebulized antibiotics for the treatment of acute exacerbations of crs in 41 patients .
eighty - three percent of the patients improved on nasal obstruction , facial pain , rhinorrhea , and malaise after administration of nebulized antibiotics .
the researchers concluded that nebulized antibiotics should be considered for all patients with crs who have undergone ess and who have failed to respond to oral antibiotics or who do not tolerate them.37 kobayashi and baba38 used an ultrasound - type inhaler and studied therapy with aminoglycoside , fosfomycin , and cefmenoxime three times per week .
their findings suggested that in patients without previous sinus surgery , the main effect of the nebulized medications was in the nose , with only an indirect effect on the maxillary sinuses : no experimental evidence was found of antibiotic penetration into the maxillary sinus.38 in a randomized , double - blind trial desrosiers and salas - prato39 reported that both tobramycin - saline solution and aerosolized saline solution led to equal improvements in quality of life , symptoms , and endoscopic aspects of the nasal mucosa .
the addition of tobramycin appears of minimal benefit.39 videler et al40 conducted a randomized , placebo - controlled , double - blind , cross - over pilot study on 14 patients with recalcitrant crs .
nasal irrigation with bacitracin / colimycin or placebo using the rhinoflow nebulizer twice daily was administered in combination with oral levofloxacin .
the study demonstrated that in patients with therapy - resistant crs , many symptoms have a tendency to decrease compared with the pretreatment period after using the nebulizer in combination with levofloxacin .
none of the analyses comparing the bacitracin / colimycin group with placebo , however , identified significant differences .
therefore this study has not confirmed any additional effect of the locally administered antibiotics.40 emerging evidence from a recent review suggests that topical antibiotics may be useful as a treatment modality in crs and its exacerbations.41 current corroborating evidence , at a relatively low level of evidence , points to the efficacy of nasal irrigation or nebulization rather than delivery by nasal spray . for the antibacterial studies , the highest level of evidence currently exists for studies that have used postsurgical patients and culture - directed therapy . both stable and acute
exacerbations of crs appear to benefit from topical antibiotics.41 in the same review , it is suggested that topical antibiotics should not be first - line management but may be attempted in patients refractory to the traditional topical steroids and oral antibiotics.41 larger and better - designed , randomized , double - blind , placebo - controlled trials are required to more fully evaluate this modality of treatment . in particular , the control group for these future studies should be an equivalent sinus placebo rather than alternative methods of therapy .
additional studies could also directly compare different delivery methods , surgical and nonsurgical patients , and culture - directed versus empiric treatment . | chronic rhinosinusitis , one of the most common chronic medical complaints in the united states , seems to be increasing in incidence and prevalence , and has a significant impact on quality of life .
topical forms of medical therapy represent an attractive alternative for drug delivery to the nasal cavity and paranasal sinuses .
topical drug delivery has the advantage of directly acting on the site of inflammation , producing a higher concentration at the target site while avoiding systemic side effects .
although considerable research has been undertaken into improving nasal formulations in order to enhance absorption , little attention has so far been directed to upgrading the delivery devices .
the aim of this review is to present current knowledge on the novel drug - delivery devices in use in the management of chronic rhinosinusitis patients , and to present the current available knowledge on topical drug penetration into the sinuses using various delivery devices .
additionally , methods used to enhance fluid sinus deposition are presented and the published clinical studies on the results of nebulized antibiotics in the treatment of chronic rhinosinusitis patients are discussed . |
organizational culture is defined as the ways in which people know and understand the values and beliefs of a specific group of people or an institution .
these values and beliefs are established over time , are considered valid , and are taught to new members who enter into the culture [ 1 , 2 ] . organizational beliefs and values are guiding principles that influence the development of individuals ' attitudes towards the organization and how individuals within that culture make decisions or invest their time .
academic nursing programs are situated within challenging and complex organizational cultures characterized by a combination of the traditional research , teaching , and service requirements of academia coupled with professional practice requirements .
added to the complex culture of academic nursing is the integration of new technology in conjunction with a demand for diverse teaching strategies .
simulation , specifically using mid- to high - fidelity equipment , which closely mimics real life experience without the real life risks , is considered new technology .
although simulation has been used in nursing education programs since the early nineteen hundreds [ 7 , 8 ] , advances in the technological capabilities and the types of simulator equipment available today reinforce the notion of simulation being viewed by nursing faculty as a new teaching strategy .
additionally , there have been inconsistent levels of adoption and incorporation of simulation among individual nurse educators and across nursing programs .
individual factors such as faculty members ' attitudes and perceptions of simulation have been studied [ 1012 ] , but there is a gap in the literature related to how organizational culture shapes and contributes to attitudes , perceptions , and behaviors that impact the adoption and incorporation of simulation into nursing curricula .
akhtar - danesh and colleagues conducted a q - methodology study in canada of nursing faculty members ' perceptions related to the adoption and integration of simulation .
benefits included aligning with students ' positive perceptions about the use of simulation as a valuable teaching strategy , but challenges were identified about the usefulness and practicality of simulation in undergraduate education .
other researchers have reported that having the time to learn about and use simulation as well as having the resources to coordinate simulation - based education are the most significant barriers related to adoption and incorporation [ 1214 ] . in the nursing education literature ,
identification of the individual perceptions , values , and concerns that influence the uptake of simulation have been well documented . while there has been some preliminary work to identify organizational influences on this issue such as the lack of faculty time and resources to implement this new technology [ 1214 ] ,
what has been consistently lacking is an examination of the organizational culture that leads to the development of attitudes , values , beliefs , and perceptions among nursing faculty as they respond to change or adopt an innovation . there is more to integrating simulation into nursing curricula than faculty buy - in . the choices people make and the activities they invest in are not always guided by personal choice but by the culture of the organization .
therefore , it is important to examine how organizational factors impact the adoption and incorporation of simulation as a teaching strategy as it is becoming more prevalent in nursing education and as institutions look for ways to facilitate this change .
schein 's theory of organizational culture was used to sensitize the researcher about concepts of organizational culture .
this theory provided both a clear definition of organizational culture and distinguishable levels of culture that should be considered .
although grounded theory research is not typically conducted using an existing theoretical framework , schein 's model was used to ensure exploration of core constructs associated with organizational culture .
schein defines organizational culture as the ways of knowing within a specific group that have been established over time and have been shown to be effective in managing problems .
they are considered valid , taught formally and informally to new members , and include both explicit and tacit knowledge .
schein suggests there are three major tenets to consider when analyzing organizational culture : artifacts , espoused beliefs or values , and basic assumptions , each representing different levels of culture .
artifacts are predominantly the observed characteristics of organizational culture such as building design and structure and dress norms ; these represent the most superficial level of organizational culture .
schein suggests that the best way to understand organizational culture is to examine it at deeper levels .
beliefs and values are considered legitimate and significant guiding principles of an institution [ 1 , 2 ] .
they are the goals , aspirations , and ideologies that signify what is most important to an organization or for what the organization is ultimately striving .
beliefs and values are often represented in public statements such as mission and vision statements . at the deepest level of schein 's model
are the basic assumptions which are thought to guide actions , contribute to attitudes and behaviours , and impact thoughts and feelings .
nursing programs in ontario , canada , provided ideal circumstances in which to consider this issue . in 2004 , the ontario ministry of health and long - term care demonstrated a commitment to nursing education through a $ 20 million investment for the purchase of simulation equipment for undergraduate nursing programs .
monies were distributed to all 34 programs , ranging from $ 196,300 to $ 706,400 , with the average institution receiving $ 500,000 .
simulation equipment was the only allowable expense and nursing programs were expected to secure funds to ensure the continued operation and use of the equipment .
charged with this expectation , nursing programs had to undergo a process of adopting and incorporating simulation into the curricula .
so many nursing programs dealing with this initiative at the same time provided a good opportunity to examine the organizational elements that impacted this change .
as the focus of the funding was mid- to high - fidelity simulation equipment , virtual simulations and standardized patients were excluded from this study .
charmaz 's approach served to answer the research question : how do the organizational cultures of ontario undergraduate programs of nursing shape the adoption and incorporation of simulation as a teaching and learning strategy within the curricula ?
, colleges in ontario have worked in partnership with universities to offer collaborative nursing programs where students can obtain a baccalaureate degree .
collaborative programs are offered as articulated or integrated models . in articulated collaborations , the first two years of the nursing program are offered at the college and the second two years are offered at the university . in integrated collaborations , the delivery of the program happens at all of the sites , and the faculty members from both the college and university are involved throughout each year of the program .
nursing programs were selected based on the following criteria : ( a ) listed on the college of nurses of ontario web site as an accredited program , ( b ) offered a four - year baccalaureate degree in english either on its own or in collaboration with another educational institution located within ontario .
nursing programs that met the inclusion criteria were separated into geographical regions and then selected by stratified randomization to increase variability and reduce bias .
theoretical sampling as a form of purposeful sampling was used to ensure the core constructs and the deepest levels of organizational culture were examined .
the examination of artifacts was excluded from this study since there was an absence of equal opportunities to examine the artifacts at all of the sites .
knowledge about the beliefs and values was obtained by studying guiding documents such as the mission , vision , or philosophy statements at the level of the institution , the faculty , and the nursing program .
sampling to investigate basic assumptions , the deepest level of organizational culture , occurred at the level of the nursing program through in - depth semistructured interviews with participants .
participants from multiple roles within the program included nursing administrators , nursing faculty members , and key simulation leaders , thereby facilitating maximum variation sampling .
snowball sampling was used to identify additional participants and documents [ 21 , 22 ] .
theoretical sampling was used as data collection progressed and categories and themes started to emerge .
this continued until data were sufficient to provide detailed descriptions of the experience from the participants ' perspective .
that is , sampling continued until theoretical sufficiency was obtained [ 19 , 23 ] .
this included up to two in - depth semistructured interviews with nursing administrators , nursing faculty members , and simulation leaders .
first interviews lasted approximately 6075 minutes and explored organizational factors involved in the processes of adoption and incorporation of simulation .
second interviews , lasting 3060 minutes , were conducted to further develop the categories emerging from the data . to gain a rich description of the organizational culture ,
these documents were compiled and sent to participants in advance of the interview . during the interviews ,
participants were asked if and how the documents shaped the adoption and incorporation of simulation into the curricula .
participants were also asked if any other documents contributed to this process and to share those documents when possible .
nvivo 9 qualitative software was used to store , organize , and manage all data .
interviews were transcribed verbatim ; then , data were analyzed line - by - line and incident - by - incident resulting in multiple codes , many of which were unique terms used by the participants ( in vivo codes ) .
the initial codes moved to focused codes that served to develop analytical categories for further examination and exploration .
once the tentative categories were further explored and developed , they were raised to conceptual categories which are more abstract and led to the nascent structure of the theory .
documents were analyzed for key concepts and compared to interviews to see if the concepts were captured implicitly , explicitly , or at all . during data analysis a seven - phase process of adoption and incorporation emerged which resulted in the differentiation of high- , mid- , and low - uptake sites .
the constant comparative method was used to explore how organizational culture impacted or shaped the process . to facilitate this , creating memos and theoretical sampling
were used to capture thoughts , define codes , illuminate properties , make connections , and explore emerging themes . during this process
this allowed for further exploration and expansion of emerging categories until theoretical saturation was reached .
participation was voluntary and participants could withdraw from the study at any time or choose not to answer questions . identifying information
representatives of thirteen nursing programs across the province of ontario , including seven universities and six colleges , participated in this study . of these sites
seven were identified as high - uptake , five as mid - uptake , and one as low - uptake .
55.5% of participants worked in the high - uptake sites , 40.7% at mid - uptake sites , and 3.7% at the low - uptake site .
their roles included simulation leaders ( n = 6 ) , nursing administrators ( n = 5 ) , nursing faculty ( n = 12 ) , and those serving in a combined role ( n = 4 ) .
all had a baccalaureate degree with the majority having a master 's degree ( 85.1% ) ; 14.8% had a phd . the majority ( 75% ) were between the ages of 41 and 60 years .
refer to table 2 for a summary of the type of documents and the level of the institution they represent . to explain how educational organizational cultures influence the adoption and incorporation of simulation , a theoretical model identified as the organizational elements that shape simulation in nursing ( oessn ) model , figure 1 , was developed .
a brief description of the full model will be followed by an in - depth explanation of each of the key organizational components .
the model displays concentric circles that represent the different levels of the organization that impact the adoption and incorporation of simulation into nursing curricula .
the next circle represents the faculty of health ( or otherwise named ) and the innermost circle represents the nursing program .
each of these three levels has within it values and beliefs , which are termed guiding philosophies , and contributes to the organizational culture of the nursing program . within the level of the nursing program , five key elements of the organizational culture emerged .
they represent what schein asserts are basic assumptions in that they influenced perceptions and attitudes and impacted behaviours and actions related to the adoption and incorporation of simulation .
they are ( a ) nursing leaders , ( b ) information exchange , ( c ) physical locale , ( d ) shared motivators , and ( e ) scaffolding to manage change .
the central organizational element among the five was the nursing leaders who were typically nursing administration and the key simulation person ( simulation leader ) . within the model
, there is an arrow from the nursing administrator to simulation leader indicating the distribution of power required in the creation of a new role to manage the simulation initiative .
the five key organizational elements impacted the seven - phase process of adoption and incorporation , represented in the model by the large downward arrow .
the phases include ( a ) securing resources , ( b ) nursing leaders working in tandem , ( c ) getting it out of the box , ( d ) learning about simulation and its potential for teaching , ( e ) finding a fit , ( f ) trialing the equipment , and ( g ) integrating into the curriculum .
the seven - phase process leads directly to the levels of uptake which occurred across a continuum .
high - uptake was defined as nursing programs that moved through all of the seven phases of the process and successfully integrated simulation into all levels of the curricula in which nursing content is taught .
institutions that met some , but not all , phases of the process were classified as mid - uptake and institutions that were not able to progress through any of the phases were classified as low - uptake .
institutions that were classified as high - uptake experienced more outcomes than the other sites and the outcomes had the potential to cross all levels of the organization .
the remainder of this paper will provide in - depth explanations of the organizational elements that shape the adoption and incorporation of simulation into nursing curricula and will , at times , be discussed in relation to the level of uptake .
they were selected amongst all of the data to illustrate or provide an example of the broader context being described . before discussing each of the organizational components in detail , it is useful to discuss the relationship between the level of uptake and the guiding philosophies .
the guiding philosophies , in the form of mission , vision , value , or philosophy statements , impacted on nursing programs ' capacity to adopt and incorporate change .
these beliefs and values influence actions and decision making when managing change . the explicit knowledge and use of the organizational guiding philosophies varied considerably across the uptake continuum .
many of the high - uptake sites consciously used the mission and vision statements of the institution , faculty , and nursing program as a method to make decisions and situate simulation within the curricula . when asked about adopting and incorporating simulation , one simulation leader indicated this by stating : [ simulation ] relates to the mission , it 's innovative being involved in things that are innovative is part of our mission ( 006 ) . specifically , the terms innovative , research focused , experiential learning , and quality of students ' experiences , as well as the institutional teaching and research components facilitated decision making with regard to simulation .
nursing leaders used the guiding philosophies as a strategy for change but also as a tactic to acquire necessary resources .
this is represented by the two - way arrow in the oessn model between the leaders and the concentric circles representing the guiding philosophies .
one nursing simulation leader reinforced this when stating:so anything that we do has to somehow relate if we 're asking for resources , financial or human , it has to relate to the mission , vision , or values in order to be accepted .
so any proposal that i bring forward , i ensure that it relates to those statements and i include rationale as to how this meets our mission , vision , or values ( 002 ) .
if we 're asking for resources , financial or human , it has to relate to the mission , vision , or values in order to be accepted .
so any proposal that i bring forward , i ensure that it relates to those statements and i include rationale as to how this meets our mission , vision , or values ( 002 ) . in the mid - uptake sites the impact of guiding assumptions was much more implicit .
participants used language such as cutting edge , engaging students in learning , and evaluating simulation during the interviews that mirrored or resembled the key concepts of the institutional , faculty , or nursing program guiding documents . when questioned directly about the influence these documents had on the adoption and incorporation of simulation
, participants needed to refer back to the guiding documents in order to make connections .
one simulation leader emphasized this stating : i 'm sitting here looking at the two mission statements
on the other end of the spectrum is the low - uptake site . when questioned about how the guiding philosophies shape the adoption and incorporation of simulation a nursing a faculty member responded saying there is nothing in our statements specific to simulation ( 027 ) .
the findings show that it is was not necessarily the specific language of the underlying beliefs and values but the way in which leaders and nursing faculty members chose to use them that shaped the adoption and incorporation of simulation . with an initiative as extensive as this one ,
many nursing administrators had this insight realizing they would not be able to do it all themselves , so simulation leaders were appointed or volunteered .
this was the beginning of the shared leadership that has shaped the adoption and incorporation of simulation in nursing curricula .
this was noted by one simulation leader as follows : our former chair was instrumental in giving me .
the green light to go ahead and take the lead on this ( 001 ) .
this shared leadership became the driving organizational force that was required to implement simulation as a teaching and learning strategy in nursing curricula .
they were the key organizational element and served as the axis on which the other essential organizational elements interacted .
the leaders did not act as individual leaders working on separate tasks but shared strategic leadership working in tandem toward a common goal .
one nursing administrator highlighted this sayingin any successful venture one person ca n't do it all it was a joint effort
the ideas for the strategic plan were mine but without [ the simulation leader ] it would n't have gone anywhere and still would be an idea ( 012 ) . in any successful venture one person ca n't do it all it was a joint effort everybody brings their own unique knowledge and skill to the table .
the ideas for the strategic plan were mine but without [ the simulation leader ] it would n't have gone anywhere and still would be an idea ( 012 ) .
the nursing leader 's role is multifaceted and required the leader to engage multiple strategies to facilitate the simulation initiative .
negotiating involves working with nursing faculty members within the nursing program as well as with groups or individuals at the level of the faculty and the institution to exchange ideas and secure necessary resources .
navigating includes mapping out a certain course or plan for simulation within the nursing curriculum . networking consists of generating a support system within the institution or among community members who have similar interests in simulation or can assist with the navigating process .
much of what drove the leaders to support the simulation initiative were the overarching guiding philosophies .
these statements articulate what is significant or important to the institution , faculty , and nursing program and , in turn , imply value .
for example , institutions that promoted innovation within their mission or vision statements had nursing leaders that used that value statement as a rationale to secure resources and promote the implementation of simulation into the curriculum because it ultimately aligned with and supported the mission of the institution .
another driving factor among nursing leaders was the expectation of use and the shared motivators that are discussed in relation to the four remaining organizational elements .
information about simulation , its potential for enhancing the teaching and educational experience , and information about the additional resource requirements needed to support it had to be shared between nursing leaders , nursing faculty members , collaborative partners , and among different levels within the institution .
the exchange of information about simulation was required at the onset of adoption and incorporation to get it started , but ongoing communication was also required to maintain simulation as part of the nursing curriculum .
information was communicated in a variety of ways and was significantly influenced by the nursing leaders who used formal and informal as well as written and spoken communication .
one formal strategy used by several high - uptake sites was student evaluations of simulations .
these evaluations included student feedback about the satisfaction with , or perceptions of , simulation as a teaching / learning strategy .
the summaries of these evaluations were presented at formal meetings as a way to facilitate the formal exchange of information among individuals or groups that were using simulation and those who were considering using it or uncertain about using it .
the nursing leaders who facilitated this type of formal communication placed value on simulation and provided ongoing opportunities for simulation to be considered as a teaching / learning opportunity .
one nursing administrator explained this sayingwe've built in evaluation all along then twice a year we invite the sim coordinator to do a presentation to faculty about the events and activities that have occurred and i think what that does is keeping the thinking process alive and helping faculty members anticipate what they might consider in their own courses ( 025 ) . we 've built in evaluation all along then twice a year we invite the sim coordinator to do a presentation to faculty about the events and activities that have occurred and i think what that does is keeping the thinking process alive and helping faculty members anticipate what they might consider in their own courses ( 025 ) .
all sites used some formal information exchange strategies such as introducing simulation at faculty or curricula meetings or learning about simulation at conferences .
however , the majority of low and mid - uptake sites used fewer formal exchanges of information and used them less frequently than the high - uptake sites .
this was articulated by one faculty member stating we do n't have a formal process ; it 's more informal discussions ( 023 ) .
this informal exchange of information was also more prevalent and diverse in the high - uptake sites and occurred in a variety of ways .
predominantly , it was centered on one - on - one or small group discussions .
also included were email updates about simulation , discussions about research findings , or displays of the findings .
one simulation leader maintained this saying our manager would just send something out via email and it was by word - of - mouth ( 021 ) .
informal information exchanges strategies often served to promote interest and generate ideas about simulation .
multiple and diverse ways of communication facilitated movement through the seven - phase process of adoption and incorporation .
exchange of information was needed for all of the phases but was crucial in the phases of learning about simulation and its potential for teaching , finding and fit , and securing additional resources .
the transfer of information about simulation between all levels of the organization was needed to secure a place for it in the curriculum .
information exchange is not only influenced by the communication strategies of the leaders , but also shaped by the physical environment .
one faculty member recognized this stating our offices were across the hall from each other so we were always bouncing ideas off of each other ( 024 ) . having people work in close proximity allowed for spontaneous conversations and sharing of ideas related to simulation .
this concept of physical environment leads to the subsequent organizational element , physical locale that shaped the adoption and incorporation of simulation into nursing curricula .
a significant amount of space is required to store , maintain , and utilize simulation equipment .
when the initial request for funding was advertised , institutions were required to show the appropriate allocation of space or a renovation plan .
this resulted in many nursing administrators having to fight for space and many simulation leaders having to deal with the space provided .
space was rented that was located away from the nursing program on another campus , in a different part of the city , or on another campus .
many participants claimed that the physical environment of the lab shaped the adoption and incorporation of simulation into nursing curricula .
often the remote physical location of the lab was isolating for many simulation leaders and created disconnects between people making it difficult to share or generate ideas .
one simulation leader stated the labs are completely separate from the nursing program and that also is a little bit tricky because sometimes people do n't want to come over here ( 007 ) .
the isolated location of many simulation labs leads to feelings of frustration and the perception that simulation as a teaching strategy was undervalued or unsupported by the institution .
this impeded the ability of some institutions to move successfully through all of the phases in the process . despite the isolation and disconnection that occurred in many new spaces , institutions which renovated spaces also had their own unique challenges .
renovated spaces were often described as inadequate or inefficient because of lack of knowledge about simulation equipment during the planning of the renovations .
one simulation leader summed this up stating the way our simulation area has been set up is not the best layout .
it 's not even connected to the space that we 're in it was n't a well thought out design ( 027 ) .
renovations completed during the early stages of this initiative before stakeholders had a full understanding of the complexity of the equipment often resulted in frustration among simulation leaders and other users and ineffective use of the equipment .
the physical locale proved to be a significant organizational element that shaped the adoption and incorporation of simulation in shared nursing curricula being offered among collaborative partners . within the context of this study ,
nursing programs are offered in collaboration with college and university partners ; typically collaborations comprised two or three institutions .
there is a physical distance between the institutions as most collaborative partners are not housed in the same location .
despite sharing curricula , the physical locale of the lab in separate physical environments provided a greater organizational influence than the collaborative partnership .
one faculty summed this up saying although we are a collaborative program , we are not really collaborative with regard to sim .
i have no idea what is being done there and they have no idea what we do here ( 011 ) . the expectations and philosophies of the physical institution where the lab is housed took precedent over the collaborations , meaning that the institution where the simulation lab was located had greater influence in shaping the adoption and incorporation of simulation than collaborative partnerships delivering the same curricula .
two participants provided insight to this ; one simulation leader stated the barrier is the collaboration the two philosophies are so different they do utilize simulation in some respect ; they certainly run their simulation much differently than we ( 022 ) ; while a nursing administrator added collaborative programs are extremely difficult to work with because there are substantial differences just between colleges and universities in terms of how they think but i mean programs take on the personalities of their people as well ( 015 ) .
collective or shared social responses or common experiences shared by many proved to be motivating factors of the organizational culture that shaped the adoption and incorporation of simulation .
the initial reaction experienced by most institutions was one wanting to take advantage of a rare opportunity .
the reaction of some programs was to apply for the funding and then , later , figure out how to use the money .
one simulation leader explained we 're going to take it [ the provincial simulation funding ] and we 'll learn what to do with it after ( 010 ) . wanting to take advantage of a onetime funding opportunity was a significant motivator experienced by all institutions .
people were unsure of what to do with the equipment , of what the equipment was capable , and of how simulation might impact their workload and teaching responsibilities .
this resulted in avoidance in many organizations , some not even opening the boxes until two to three years had passed .
what helped some institutions move past the uncertainty was primarily the creation of the simulation leader role .
once this person was employed , expectations of this role developed and included learning about the potential of the equipment , how to set it up , and how to use it .
while the uncertainty dissipated over time in the high - uptake sites , the low - uptake site continues to be immobilized and indecisive about simulation .
this was highlighted by one faculty member there who stated we got the equipment out of the boxes and put it in a closet ; we do not use it very often and there really is no one to show us how to use it ( 027 ) .
concern , as a shared motivating factor , was related to not wanting to be left behind and to sustainability .
many mid - uptake sites and some high - uptake sites that moved slower through the process of adoption and incorporation experienced uneasiness about not being as competitive as other institutions that were utilizing simulation to a greater level or with more consistency .
they expressed concern over recruitment of students and felt that the slow or minimal uptake of simulation could be a deterrent for some students .
several participants also shared the belief that simulation was an expectation in all health related education programs and if they were not able to implement simulation as a teaching strategy , they would be left behind . the angst about being left behind is driven by the concept of time as a measurement of success . while there was neither an expected timeline nor clearly articulated time sensitive goals required in the initial proposal , many institutions measured their success in terms of time .
the high - uptake sites , because of the leadership and past experiences managing this type of change , navigated the adoption more rapidly than other sites and placed a value of success on this as noted by one nursing administrator expressing pride in the short time frame her nursing program took from conception to integration stating it was less than one year ( 012 ) .
time was also emphasized by a nursing faculty member at a mid - uptake sight who stated i have shamed a few people into doing it because everybody else was doing it[simulation ] , so we better get going with it [ simulation ] ( 017 ) . on the far end of the uptake spectrum
is the low - uptake site where the simulation leader expressed frustration and embarrassment stating despite being eight years into this initiative to have it only in one course it is just kind of weird we are so far behind in simulation ( 027 ) .
the other concern common among all mid and high - uptake sites was the issue of sustainability . since the funding was a one - time nonsustainable resource , there was insecurity as to how to implement and sustain it once in place .
there were also concerns about the equipment breaking or implementing it to a level within the curriculum where the demand would outweigh the availability , thus resulting in the need to purchase additional equipment but not having the funds . while the concern about being
left behind has lessened for some institutions , it remains a concern for many , especially for the sites which have collaborative partners who outrival them with simulation .
since nursing is a practice - based profession , much learning comes from interaction with and practice of psychomotor skills on patients .
the adoption and incorporation of simulation does not negate nor replace the learning from and with patients but it provides an opportunity to practice and refine skills prior to them taking place with patients .
this enables students to practice in a safe and secure setting without concern for patient safety .
one faculty member summed this up stating[students ] need to demonstrate before they can do it [ on patients ] , [ simulation ] allows them to experiment , make mistakes , and figure it out for themselves .
clinical teachers are out there to protect the patient so [ during simulation ] their mindset is n't this is n't a patient that needs protecting but a group of students who can learn from making mistakes ( 008 ) . [ students ] need to demonstrate before they can do it [ on patients ] , [ simulation ] allows them to experiment , make mistakes , and figure it out for themselves .
clinical teachers are out there to protect the patient so [ during simulation ] their mindset is n't this is n't a patient that needs protecting but a group of students who can learn from making mistakes ( 008 ) .
positive student responses to simulation provided the most significant motivating factor for moving forward with the implementation of simulation .
participants consistently reported on students ' feelings of security working with simulated patients , relief that they could practice without harm , and that all students could benefit from the learning instead of the one lucky enough to have an experience during clinical training .
participants said it reduced anxiety and competition between students because they were all provided with the same experience .
one simulation leader clarified this statinginstead of having only one or two students have the learning experience in the clinical setting we can set up experiences with simulation we can make sure all of our students have experiences they may not always get ( 001 ) . instead of having only one or two students have the learning experience in the clinical setting we can set up experiences with simulation we can make sure all of our students have experiences they may not always get ( 001 ) . the students ' responses were a profound motivating factor for participants of this study consistently among all of the mid- and high - uptake sites .
two statements by participants summed this up , one by a faculty member who stated
i think what motivates us to do [ simulation ] is the student 's reaction ( 010 ) , and the other by a simulation leader who stated the feedback we get is so positive from the students and the instructors we feel like we can see the learning happening ( 020 ) .
student responses appeared to energize the participants and spur them onto further use simulation as a teaching / learning strategy .
the final motivating factor of the organizational culture stemmed from the overarching institutional expectations such as workload and the value of independence .
workload expectations are a significant driving force when adopting a new innovation , particularly one as extensive as simulation .
there is a considerable amount of learning , trialing , and time required to become proficient in running the equipment , developing learning experiences , and implementing them .
some institutions have no way to accommodate this into workload assignments which results in people taking this on in their own time , aligning the work required with their own personal goals or research interests , or not participating at all .
one simulation leader highlighted this sayingit 's hard to know [ if ] it 's an expectation of the organization .
it seems like if you 're tenure track you would never do this kind of work load
70% teaching and they would have 40% teaching and 40% research their teaching work load allocation is really different because their research is way up ( 024 ) .
it 's hard to know [ if ] it 's an expectation of the organization .
it seems like if you 're tenure track you would never do this kind of work load
70% teaching and they would have 40% teaching and 40% research their teaching work load allocation is really different because their research is way up ( 024 ) . due to the different workload agreements , some of the college sites were able to adjust workloads to include simulation placing them at the higher end of the uptake continuum .
independent organizational culture that holds the time - honoured practice of academic freedom above other values provides unique challenges for nursing programs wanting to adopt or integrate simulation .
one nursing administrator confirmed this point stating the university culture is such that we all have to be individuals to get ahead , to get tenure and promotion , and do research which becomes a very competitive , isolating experience ( 005 ) .
a faculty member shared her view of this stating if the expectation came from on high that thou shall implement [ simulation ] , i ca n't see that happening because we could always preach academic freedom ; i do n't see how they could ever tell us we had to ( 003 ) .
this level of independence that is the standard in many academic nursing programs creates unique challenges when trying to adopt and incorporate an innovation that requires a significant amount of extra time and a high degree of teamwork .
the shared dynamic is a key organizational element that drives people to act and make decisions .
this element of organizational culture included support and structure as a framework to facilitate movement through the process of adoption and incorporation .
it involved reaching outside the nursing program and linking with in - house partners to share resources .
this proved to be beneficial in many high - uptake sites , especially when requesting resources that benefit more than one program within the same institution .
it also included the sharing of personnel resources and expertise which in turn provided an institutional cost saving strategy . securing the framework to support simulation outside of the nursing program served to move simulation forward and to contribute to incorporation as it became a faculty wide initiative rather than just a nursing program initiative .
as this option was not available to all institutions some chose to secure support by linking with community partners to share resources and expertise .
essentially this provided the similar support as noted with the institutions that linked with their in - house partners ; it made the simulation initiative larger than just the nursing program .
the benefit of connecting and linking with others for support in turn raises the profile of the initiative , as summarized by one nursing faculty member who stated a new building was built for the faculty there was space in that new building allocated for clinical education , and simulation for all the health sciences and we also rent it out to groups like the hospital educators ( 014 ) .
sharing resources was a way to manage change , and using the same lab , equipment , or personnel proved to be beneficial .
creating links beyond the nursing program strengthened the scaffolding and contributed to the level of uptake .
institutions which chose not to link with community partners or did not have in - house partners to link with were at a disadvantage since the simulation initiative was supported primarily by just the nursing departments , and this led to a lower level of uptake . scaffolding to manage change intersects with all of the other organizational elements and is essential to accommodate initial and ongoing changes .
it includes being creative with limited resources , providing recognition for extra work , and orienting new members . while links external to the nursing program provided extra support and facilitated movement through the process of adoption and incorporation , there were two strategies within the nursing programs that provided support and created a structure to promote simulation as a teaching strategy .
consistently , participants stated that the work which was required to make simulation part of the curriculum was unparalleled to anything they had previously experienced .
one nursing faculty member stated we 're actually supposed to do three hours a week for sim , which if you multiply by a 15 week semester , is 45 hours a semester , i do 45 hours in 3 days ( 010 ) .
institutions that compensated or recognized the extra work involved were higher on the uptake continuum than those that did not .
recognition was acknowledged in the form of education and travel that was paid for by the institution .
one nursing administrator discussed recognition stating [ simulation leaders ] get a lot of rewards because these are the folks we are sending to conferences all over the world ( 015 ) .
recognition also came in the form of role designation , giving the simulation leaders a new and specific title .
what this did was to differentiate the simulation leaders and give them a new status within their institution .
recognition provided incentive for those involved in simulation , thus strengthening the support system to facilitate the incorporation of simulation .
while recognition is an astute place to start with the development of a new role , one aspect which could have strengthened the scaffolding and provided additional support would be the addition of a job description and annual appraisal documents that were reflective of the role and the work therein .
most participants stated their annual evaluation had nothing to do with their work relating to simulation .
few appraisal templates were shared with the researcher as participants voiced there was little to no connection between the work they do and their annual evaluation process .
there 's nothing that comes out of the appraisal process that forces me to teach in a particular way ( 006 ) .
one simulation leader from a mid - level uptake site interpreted this disconnection as a devaluation of her work and her teaching methods , stating there is a lack of associated respect or merit placed on any of [ simulation ] activities ( 009 ) . while recognition is one strategy to strengthen support and provide a framework for success , adding specific job descriptions and having people evaluated for the work they do are strategies that could be used to add an additional level of structure and support to a newly developing role in nursing .
the last scaffolding strategy that was consistent among the majority of the high - uptake sites was the orientation of new members .
orientation of current and new nursing faculty members and staff is a strategy to maintain change and assign value to the innovation .
one nursing administrator stated we focused on everybody getting a baseline understanding of simulation
so new faculty and staff goes to the [ simulation leader ] for training ( 012 ) .
other examples of orienting new members included training modules for new faculty and the availability of individual training .
orientation was a consideration in both of the rapid high and a couple of slower high - uptake sites , but most of the other sites had not given this much consideration as stated by one faculty member we do n't really have a process for [ orientation ] ( 023 ) . using strategies such as being creative with resources , providing recognition for extra work , and orienting new members proved to be effective scaffolding strategies that contributed to the adoption and incorporation of simulation .
the organizational culture of nursing programs and the academic institutions in which they are situated contribute significantly toward the adoption and incorporation of simulation into the curriculum .
this study revealed that five key organizational elements contribute to the adoption and incorporation of simulation into nursing curricula .
the oessn model shows these organizational elements as bordered by the institutional , faculty , or nursing program guiding philosophies .
the connection between the beliefs and values and the leaders in the oessn was portrayed as a two - way path .
this dual direction concept adds to schein 's theory by suggesting that movement between and among these concepts exists and can facilitate the uptake of an innovation into an academic program .
schein purports that beliefs and values impact actions and decisions , but this study reveals that movement from the beliefs and values is not unidirectional ; flowing downward , the guiding philosophies influence the decision making of leaders ; flowing upward , the leaders used the values and beliefs as rationale to support their requests for additional resources .
organizational philosophies are an important aspect that should be used to guide the adoption and incorporation of simulation . despite funding constraints in academia
, a recommendation resulting from this study is that when requesting funding support , nursing programs strategically use the guiding philosophies as tools to negotiate the needed resources when adopting or incorporating an innovation .
an important consideration from the findings of this research is the shared emotional reaction to time as a driving force . the initial emotion of not wanting to be left behind and the ongoing emotion related to perceptions of success both denote time by the form of measurement .
graham suggests that time is a concept of culture that influences people 's perceptions .
he further suggests that the completion of tasks is directly related to time , and a task that is not completed or takes additional unanticipated time is often referred to as being behind
graham further suggests that time spent completing tasks positions people or institutions for future progress .
this is consistent with what was found in this study when participants expressed feelings of satisfaction with how far they had progressed with the adoption and incorporation of simulation over a short period of time .
surprising because few institutions were able to articulate goals related to simulation therefore making it difficult to measure accurately their success or validate their progress or lack thereof .
the concept of time as a measurement of success is simultaneously predictable within the context of this study .
researchers have suggested that north america typically has a monochronic perception of time , where the focus is future oriented and concerned with completing tasks within set time frames .
there is also the philosophy that time can be wasted and that time provides meaning and affects judgment [ 29 , 30 ] .
the result of measuring progression and or success by time when there is no clear vision or goals related to the adoption and intergradations of simulation causes unnecessary emotional reactions which can become a barrier .
one recommendation is to take lessons from polychronic time oriented cultures that focus on participation and achievement of milestones rather than fixed or unreal time frames .
many aspects of adopting and incorporating an innovation are multifaceted and require many levels of cooperation within the organizations that takes time .
recommendations from this study would be to set clear measurable goals related to the adoption and incorporation of simulation and the purpose that it will serve in the program . the quality and achievement of goals
this research provides insight into the emotional and cultural concepts of time when adopting and incorporating simulation and could generate future research in this area .
using schein 's theory sensitized the researchers to the concept of space as an organizational element . while space as a concept has the potential to be interpreted in a variety of ways , the findings of this research suggest that the physical locale is an essential driving force within the context of adopting and incorporating simulation into nursing curricula . while space is a commodity at many postsecondary institutions , this study found it was more than just the availability of space
the physical location of the lab elicited emotional responses such as isolation or questions of value .
nursing program members perceived simulation to be undervalued or not valued if the allocated space was not ideally located nor within close proximity to the nursing department .
recommendations would be to encourage leaders to negotiate desired space close to the department if possible .
if not , then leaders should communicate that space in academic settings is a scarce resource , a commodity , and that value exists even when the space is less than ideal .
schein states that the orientation of new members can perpetuate the values and beliefs of an organization .
this was noted in a few of the high - uptake sites in this study but , overall , was limited in the other sites .
he further states that the culture of the organization is taught to new members so that they can learn how to think , feel , and act in relation to the work environment .
not including simulation as part of the orientation of new members may lead to its devaluation , or new hires might view it as optional .
this provides an opportunity to show the value of simulation as a teaching strategy and perpetuates it as part of the culture .
the findings from this study indicate that there are many motivating factors involved at the level of the nursing program including the positive responses of students toward simulation as a teaching strategy .
while there is not a substantial body of evidence supporting the effectiveness of simulation to positively influence the acquisition of new or sustained clinical skills [ 32 , 33 ] , organizations are highly motivated and focused on implementing simulation for the outcome of improved student satisfaction and student engagement with the learning environment .
the connections and the fluidity between and among the key organizational elements were an important finding from this study .
the five organizational elements link together and are interdependent . having this understanding of the interconnectedness of the organizational factors
provides an opportunity for leaders to facilitate change . for example , the institutional expectations link directly to scaffolding .
it is an expectation in most institutions that some form of annual appraisal is done .
participants in this study shared that they felt their work related to simulation was not reflected in this process .
this disconnection provides an ideal opportunity for leaders to communicate , share information , and align work contributions so they fit within the parameters of the appraisal process .
other than the inherent link between leadership and communication [ 15 , 34 ] , the concept of interconnectedness adds to the literature on organizational culture .
the dimensions of organizational culture are often presented in isolation of each other [ 15 , 34 , 35 ] .
having an awareness of this would provide an advantage to nursing programs wanting to incorporate simulation because they could look at these aspects from a holistic viewpoint , knowing that one element of organizational culture impacts the other .
being cognizant of this when creating strategies to enhance this synergy could facilitate the adoption and incorporation of simulation as well as other innovations into nursing curricula .
the inclusion of multiple sites added to the transferability of the findings . an audit trail consisting of memos , reflexive journaling , and field notes was maintained throughout the study to maintain confirmability [ 37 , 38 ] .
this study did not include an exploration of nursing program , faculty , or institutional finances , flow of funding within organizations or among collaborative programs , nor union agreements .
inclusion of these aspects may have elicited additional findings related to the organizational elements that shape the adoption and incorporation of simulation into nursing curricula .
the organizational cultures of nursing programs in ontario that shape the adoption and incorporation of simulation into curricula has been represented by the oessn model that depicts the five key organizational elements : leaders , information exchange , physical locale , shared motivators , and scaffolding as a strategy to manage change .
this paper was conceptualized from interviews with nursing administrators , nursing faculty members , and simulation leaders as well as a review of key documents from 13 different nursing programs .
this research has contributed to the literature on simulation and enhanced the literature on organizational culture .
the oessn model provides a framework that nursing programs could use to initiate or further facilitate the adoption and incorporation of simulation into curricula . | purpose . to create a substantive mid - range theory explaining how the organizational cultures of undergraduate nursing programs shape the adoption and incorporation of mid - to high - level technical fidelity simulators as a teaching strategy within curricula
. method .
a constructivist grounded theory was used to guide this study which was conducted in ontario , canada , during 2011 - 12 .
semistructured interviews ( n = 43 ) with participants that included nursing administrators , nursing faculty , and simulation leaders across multiple programs ( n = 13 ) informed this study . additionally , key documents ( n = 67 ) were reviewed .
purposeful and theoretical sampling was used and data were collected and analyzed simultaneously .
data were compared among and between sites .
findings .
the organizational elements that shape simulation in nursing ( oessn ) model depicts five key organizational factors at the nursing program level that shaped the adoption and incorporation of simulation : ( 1 ) leaders working in tandem , ( 2 ) information exchange , ( 3 ) physical locale , ( 4 ) shared motivators , and ( 5 ) scaffolding to manage change .
conclusions .
the oessn model provides an explanation of the organizational factors that contributed to the adoption and incorporation of simulation into nursing curricula .
nursing programs that use the oessn model may experience a more rapid or broad uptake of simulation when organizational factors that impact adoption and incorporation are considered and planned for . |
congenital anomalies of the coronary arteries , though uncommon , are an important cause of chest pain and in some cases can produce hemodynamically significant abnormalities , and even sudden cardiac death .
malignant anomalous right coronary , with an incidence of 0.03 - 0.17% of patients undergoing angiography , is a rare form of such congenital anomalies .
the development of electrocardiography ( ecg ) gated multidetector row computed tomography ( mdct ) allows accurate and noninvasive detection of coronary artery anomalies .
knowledge of normal ct appearances of various anomalies and an understanding of their clinical significance is essential for correct diagnosis .
a 38 year old male presented with complaints of chest pain , aggravated by physical stress , of more than four months duration .
ct coronary angiography was performed using a 64 slice ct scanner ( brilliance-64 , philips , the netherland ) .
the following parameters were used : 120 kvp , 800 mas , rotation time : 0.4 s , pitch : 0.2 mm and collimation : 64 0.625 mm . using a dual head pressure injector ( mallinckrodt ) ,
80 ml of nonionic iodinated contrast ( iopamiro 370 , bayer , germany ) was administered at the rate of 5 ml / sec , followed by 20 ml of saline . the total scan time was 8.6 seconds .
ct coronary angiography showed the right coronary artery originating from the left coronary sinus , coursing between the aortic root and pulmonary artery with a narrowed proximal segment .
the rest of the coronary arteries , including the left main lca , the left anterior descending and the left circumflex were normal in course .
maximum intensity projection of top of heart showing both right coronary artey ( rca ) and left coronary artey ( lca ) originating from left coronary sinus .
rca has a slit - like ostium and courses between pulmonary artery ( pa ) and aorta ( a ) volume rendered image of same showing anomalous , interarterial course of right coronary artey ( rca ) , between pulmonary artery ( pa ) and aorta ( a )
anomalies of coronary arteries may be found incidentally in 0.3 - 1% of healthy individuals .
the coronary artery anomalies can be classified into anomalies of origin , course or termination or as hemodynamically significant or insignificant .
hemodynamically significant anomalies are characterized by abnormalities of myocardial perfusion , leading to increased risk of myocardial ischemia or sudden death .
these include an anomalous origin of either the lca or rca from the pulmonary artery , an anomalous course between the pulmonary artery and aorta ( inter - arterial ) of either the rca arising from the left sinus of valsalva or the lca arising from the right sinus of valsalva , and , occasionally myocardial bridging or congenital coronary artery fistula .
the rca arising from the left sinus of valsalva as a separate vessel or as a branch of a single coronary artery has an incidence of 0.03 - 0.17% of patients undergoing angiography .
the anomalous origin may have inter - arterial , retro - aortic , prepulmonic or septal ( subpulmonic ) course , the most common being inter - arterial .
the incidence of sudden death with this anomaly is estimated at 25 - 40% and is associated with exercise in half of the reported cases .
various theories have been proposed for this association , including slit like ostium , acute angulation at the origin and compression of the vessel between the aorta and pulmonary artery .
the choice of treatment for this congenital anomaly is still controversial ; however , because of significant hemodynamic consequences and propensity to cause sudden death , most of the literature advocates definite surgical revascularization in all cases , and the different options available include coronary artery bypass grafting , reimplantation of the coronary ostia and unroofing of the coronary artery , the last being considered the best solution if anatomically feasible . in japan , the treatment for this condition is conservative with the patient being treated medically with beta blockers .
ct coronary angiography was made possible with the introduction of mdct and development of ecg gated scanning . for several decades , the imaging of coronary arteries was done with conventional angiography .
however , it has been reported that anomalies of coronary arteries detected on conventional angiography were only 35% of those detected on 16 slice mdct .
although coronary artery anomalies are far less common than acquired coronary artery disease , their propensity to cause premature cardiac morbidity and mortality especially in young adults make them significant . in a study by eikart et al . , cardiac abnormality was responsible for 51% of sudden deaths in young adults , with coronary artery abnormality being the most common cardiac abnormality ( 61% ) . in conclusion , we describe a 38 year old man with an anomalous right coronary artery , arising from the left sinus of valsalva and coursing between the aortic root and pulmonary artery .
this case report emphasizes the role of non - invasive ecg gated mdct coronary angiography in accurate detection of coronary artery anomalies . | we report a case of an anomalous origin of a right coronary artery from the left coronary sinus with an inter - arterial course , between the aorta and the main pulmonary artery .
this variant has been called malignant because of its association with sudden death , especially in young asymptomatic athletes .
although these variants are rare , knowledge of cross sectional anatomy of the coronary arteries and their variants is critical , especially because some variants are associated with sudden death . |
during june august , 2008 , with the permission of the governor of wakayama prefecture , japan , we caught 8 insectivorous vespertilionid bats , miniopterus fuliginosus , and used their spleens and kidneys to establish primary cell cultures . during passage of the primary spleen adherent cells , cytopathic effect ( cell death ) was noted at third passage .
the collected supernatant was injected into fresh primary kidney cells and caused apparent cytopathic effect at first passage . before using the rdv method ,
we had attempted to detect herpesvirus by nested pcr with the consensus primer sets dfa , ilk , kg1 , tgv , and iyg , which were designed according to the consensus - degenerate hybrid oligonucleotide primers program ( 7 ) .
we then attempted to detect herpesvirus by using rdv version 3.1 , our modification from version 3.0 ( 5 ) .
the adapters and primers for construction of the second cdna library in rdv version 3.1 were newly designed and replaced those used in rdv version 3.0 ( technical appendix 1 ) .
rdv version 3.1 can determine an unknown viral cdna fragment with 64 primer pairs , which we used for constructing the second cdna library . with rdv version 3.1 , we obtained 4 unknown cdna fragments , which had no matches in a blastn ( www.ncbi.nlm.nih.gov/blast/blast.cgi ) search . in a blastx search ,
1 cdna fragment ( deduced sequence of 29 aa ) was homologous to the glycoprotein b ( gb ) amino acid sequence of the tupaiid herpesvirus 1 ( tuhv-1 ) ( 79% identity ) , which belongs to subfamily betaherpesvirinae .
we designed new consensus - degenerate hybrid oligonucleotide primers ( http://blocks.fhcrc.org/codehop.html ) selective for the betaherpesvirus gb and dna polymerase ( dpol ) genes , and we determined the complete gb sequence and the partial dpol sequence of the isolated virus ( 5,029 bp , dna data bank of japan accession no .
blast search indicated that the complete gb sequence was novel and most similar to that of tuhv-1 ( 59% aa sequence identity ) ( appendix figure ) .
we constructed a phylogenetic tree by using the neighbor - joining method with the gb amino acid sequence and the available sequences of known herpesviruses ( figure ) .
the phylogenetic tree based on betaherpesvirus gb genes showed that batbhv-2 is most closely related to tuhv-1 and caviid herpesvirus 2 ( guinea pig cytomegalovirus ) .
tuhv-2 and caviid herpesvirus 2 are species unassigned to any genus in the subfamily betaherpesvirinae .
phylogenetic tree based on the deduced amino acid sequences of complete glycoprotein b. the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test ( 1,000 replicates ) is shown next to the branches .
the tree is drawn to scale , with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree .
the evolutionary distances were computed by using the poisson correction method and are in units of the number of amino acid substitutions per site .
phylogenetic analyses were conducted in mega4 ( 8) . the herpesviruses used for comparison and their accession numbers are as follows : epstein - barr virus 1 ( ebv , nc_007605 ) , caviid herpesvirus ( cavhv-2 , fj355434 ) ; mouse cytomegalovirus ( muhv-1 , nc_004065 ) , human cytomegalovirus ( hcmv , x17403 ) , human herpesvirus 6 ( hhv-6 , af157706 ) , human herpesvirus 7 ( hhv-7 , af037218 ) , human herpesvirus 8 ( hhv-8 , af148805 ) , rat cytomegalovirus ( muhv-2 , nc_002512 ) , cercopithecine herpesvirus 8 ( cehv-8 , ay186194 ) , saimiriine herpesvirus 2 ( sahv-2 , nc_001350 ) , and tupaiid herpesvirus 1 ( tuhv-1 , af281817 ) .
scale bar indicates evolutionary distance . in may 2009 , we collected , again with permission , another 50 bats belonging to 1 species , m. fuliginosus , from the same location for an epizootologic study ( technical appendix 2 ) .
spleens and blood were collected from all bats , and other organs ( liver , kidney , lung , brain , intestine , trachea , and urinary bladder ) were collected from 10 bats .
nested pcr was performed by using specific primers selective for the dpol gene of batbhv-2 , and pcr products were subjected to direct sequencing .
other organs and serum collected from 2 of the bats were also tested by nested pcr , and viral dna was detected in the liver , kidneys , and lungs of both bats .
although pcrs with consensus primers effectively detect known and unknown viruses , they failed to detect batbhv-2 , possibly because of minor mismatches between the sequences of batbhv-2 and the primer sets ( tgv , iyg , and kg1 ) .
the variety of virus sequences and gene mutations often prevents successful amplification of virus genes .
rdv , however , can detect viral cdna fragments independent of virus species and thus is useful as a first - choice tool for identifying emerging known and unknown viruses in animals and humans .
blast search showed that the complete gb sequence of the isolated virus was novel and most similar to that of tuhv-1 .
recently , bats have been described as hosts for herpesviruses in several countries in europe , america , africa , and asia ( 4,9,10 ) .
reported that the partial dpol sequence ( 175 bp ) of a betaherpesvirus , bat betaherpesvirus 1 ( batbhv-1 ) , was obtained from several insectivorous bat species ( 10 ) .
although the length of the batbhv-1 sequence was short , similarity between batbhv-1 and batbhv-2 was relatively high ( 58% ) .
our epizootologic study found relatively high ( 8% ) prevalence of batbhv-2 in insectivorous bats . although the virus genome was detected in a few parenchymal organs by nested pcr , no amplification was possible for serum , intestine , or urinary bladder samples , which may exclude apparent virus shedding by the bats .
in addition , all 50 bats collected appeared clinically healthy . to understand the life cycle of this virus
phylogenetic tree based on the deduced amino acid sequences of complete glycoprotein b. the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test ( 1,000 replicates ) is shown next to the branches .
the tree is drawn to scale , with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree .
the evolutionary distances were computed by using the poisson correction method and are in units of the number of amino acid substitutions per site .
phylogenetic analyses were conducted in mega4 ( 8) . the herpesviruses used for comparison and their accession numbers are as follows : epstein - barr virus 1 ( ebv , nc_007605 ) , caviid herpesvirus ( cavhv-2 , fj355434 ) ; mouse cytomegalovirus ( muhv-1 , nc_004065 ) , human cytomegalovirus ( hcmv , x17403 ) , human herpesvirus 6 ( hhv-6 , af157706 ) , human herpesvirus 7 ( hhv-7 , af037218 ) , human herpesvirus 8 ( hhv-8 , af148805 ) , rat cytomegalovirus ( muhv-2 , nc_002512 ) , cercopithecine herpesvirus 8 ( cehv-8 , ay186194 ) , saimiriine herpesvirus 2 ( sahv-2 , nc_001350 ) , and tupaiid herpesvirus 1 ( tuhv-1 , af281817 ) . | because bats are associated with emerging zoonoses , identification and characterization of novel viruses from bats is needed . using a modified rapid determination system for viral rna / dna sequences , we identified a novel bat betaherpesvirus 2 not detected by herpesvirus consensus pcr .
this modified system is useful for detecting unknown viruses . |
prostate cancer is estimated to rank first in number of cancer cases and second in number of deaths due to cancer among men in the western world .
gastrin - releasing peptides ( grps ) , including bombesin - like peptides ( blps ) , are involved in the regulation of a large number of biological processes in the gut and central nervous system ( cns ) .
they mediate their action on cells by binding to members of a superfamily of g protein - coupled receptors .
there are four known subtypes of bn - related peptide receptors , namely , gastrin - releasing peptide receptor ( grpr , bb2 , brs-2 ) , neuromedin b receptor ( nmbr , bb1 , brs-1 ) , orphan receptor ( brs-3 ) , and amphibian receptor ( bb4-r ) . except the bb4-r ,
all the receptors were widely distributed , especially in the gastrointestinal ( gi ) tract and central nervous system ( cns ) .
the receptors have a large range of effects in both normal physiology and pathophysiological conditions .
grprs are normally expressed in nonneuroendocrine tissues of the pancreas , breast , and neuroendocrine cells of the brain , gi tract , lung , and prostate , but are not normally expressed by epithelial cells in the colon , lung , or prostate [ 6 , 7 ] .
molecular imaging enables the visualization of the cellular function and the followup of the molecular process in living organisms without perturbing them .
the radionuclide molecular imaging technique is the most sensitive and can provide target - specific information .
thus , the development of a personalized theranostic ( image and treat ) agent would allow greater accuracy in selection of patients who may respond to treatment , and assessing the outcome of therapeutic response .
gastrin - releasing peptide receptors ( grprs ) are overexpressed in several primary human tumors and metastases .
markwalder and reubi reported that grprs are expressed in invasive prostate carcinomas and in prostatic intraepithelial neoplasms at high density , whereas normal prostate tissue and hyperplastic prostate tissue were predominantly grpr negative .
these findings suggest that grpr may be used as a molecular basis for diagnosing and staging prostate cancer , further for imaging - guided personalized medicine using radiolabeled bombesin analogues .
previous studies have evaluated the in - radiolabeled bn analogues which bind rapidly into grp receptor - positive tumor cells , including pc-3 , ca20948 , and ar42j using gamma camera imaging after administration [ 1114 ] .
amba ( do3a - ch2co - g-(4-aminobenzoyl)-qwavghlm - nh2 ) ( figure 1 ) , a bbn - related peptide agonist , has a do3a structure that can chelate tripositive lanthanide isotopes , such as ga , y , in , and lu .
indium 111 emits -photons of two energies ( 172 and 245 kev ) as well as auger and internal conversion electrons .
in - amba was initially used for diagnostic purposes but remains the potential for radiotherapy .
auger electron , with a maximum energy of < 30 kev , is a high linear energy transfer ( let ) radiation with subcellular pathlength ( 2500 nm ) in tissues . for imaging the presence or absence of grpr ,
the in - amba could be used for patient selection for further radiotherapy ( lu - amba ) , chemotherapy ( blp antagonists ) , or therapeutic response monitoring as imaging - guided personalized medicine .
although in - amba has been evaluated as an imaging agent [ 1720 ] , the pharmacokinetics and dosimetry of the agent have not been reported yet . in this study , in - amba
was designed as an image - guided diagnostic agent for human grpr - positive tumors , which only retain the last eight amino acids ( q - w - a - v - g - h - l - m - nh2 ) from native bn .
the pharmacokinetics , biodistribution , dosimetry , and micro - spect / ct imaging of in - amba were evaluated in human androgen - independent pc-3 prostate tumor - bearing scid mice .
protected n - fmoc - amino acid derivatives were purchased from calbiochem - novabiochem ( laufelfingen , switzerland ) , fmoc - amide resin and coupling reagent were purchased from applied biosystems inc .
( foster city , ca , usa ) , and dota - tetra ( tbu ) ester was purchased from macrocyclics ( dallas , tx , usa ) .
amba was synthesized by solid phase peptide synthesis ( spps ) using an applied biosystems model 433a full automated peptide synthesizer ( applied biosystems , foster city , ca , usa ) employing the fmoc ( 9-fluorenylmethoxy - carbonyl ) strategy .
carboxyl groups on fmoc - protected amino acids were activated by ( 2-(h - benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate ( hbtu ) , forming a peptide bond with the n - terminal amino group on the growing peptide , anchored via the c - terminus to the resin , provided for stepwise amino acid addition .
rink amide resin ( 0.25 mmole ) and fmoc - protected amino acids ( 1.0 mmol ) , with appropriate side - chain protections , and dota - tetra ( tbu ester ) were used for spps of the bbn conjugates .
side chain protecting groups in the synthesis were trt for gln and his , and boc for trp .
the protected peptide - resin was cleaved and deprotected with mixture of 50% trifluoroacetic acid ( tfa ) : 45% chloroform , 3.75% anisole , and 1.25% 1 , 2-ethanedithiol ( edt ) for 4 h at room temperature ( rt ) .
the crude peptide sample was purified by reverse phase high - performance liquid chromatography ( hplc ) using a column of xterra prep , msc18 , 5 m , 18 50 mm ( waters corp .
, ma , usa ) with an acetonitrile / water gradient consisting of solvent a ( 0.1% tfa in h2o ) and solvent b ( 0.1% tfa in acetonitrile ) , with a 14.8% yield ; flow : 6 ml / min ; gradient : 20%40% b for 20 min .
the molecular weight was determined with a maldi - tof mass spectrometer ( bruker daltonics inc , germany ) .
briefly , amba was labeled with in ( incl3 , institute of nuclear energy research ( iner ) , taoyuan ( taiwan ) , 16430 mbq / ml in 0.05 n hcl , ph 1.51.9 ) by reaction of 6.66 10 mole ( 1 g ) peptide in 95 l 0.1 m nh4oac ( ph 5.5 ) with 64.75 mbq incl3 in 5 l 0.04 n hcl for 10 min at 95c .
the radiolabeling efficiency was analyzed using instant thin - layer chromatography ( itlc sg , pall corporation , new york .
usa ) with 0.1 m na - citrate ( ph 5.0 ) as solvent ( indium citrate and incl3 : rf = 0.9~1.0 , peptide - bound in : rf = 0~0.1 ) .
radio high - performance liquid chromatography ( radio - hplc ) analysis was performed using a waters 2690 chromatography system with a 2996 photodiode array detector ( pda ) , a bioscan radiodetector ( washington , dc , usa ) , and an fc 203b fraction collector by gilson ( middleton , wi , usa )
. in - amba was purified by an agilent ( santa clara , ca , usa ) zorbax bonus - rp hplc column ( 4.6 250 mm , 5 m ) eluted with a gradient mixture from 10% b to 40% b in 40 min .
flow rate was 1 ml / min at rt , and the retention time for in - amba was 22.5 min .
after purification by hplc , 100% ethanol was used instead of acetonitrile by solvent exchange with waters sep - pak light c18 cartridge ( milford , ma , usa ) .
normal saline was added after evaporation , and ph value was at the range 7~7.5 .
cold competition binding assay was studied using human bombesin 2 receptor expressed in hek-293 cells as the source of grp receptors ( perkinelmer , boston , ma , usa ) .
assays were performed using fc96 plates and the multiscreen system ( millipore , bedford , ma ) .
binding of i - tyr - bombesin ( perkinelmer , boston , ma , usa ) to human bombesin 2 receptor ( 0.16 g per well ) was determined in the presence of increasing concentrations ( 0.001
nmole / l ) of unlabeled amba in a buffer solution ( 20 mmol / l hepes , ph 7.4 , 3 mmol / l mgcl2 , 1 mmol / l edta , and 0.3% bsa ) with a total volume of 250 l per well .
after incubation for 60 min at rt , membranes were filtered and washed with ice - cold tris - hcl buffer ( 50 mmol / l ) .
the filters containing membrane - bound radioactivity were counted using a cobra ii gamma - counter ( packard , meriden , ct ) . the inhibitory concentration of 50% ( ic50 ) was calculated using a four - parameter curve - fitting routine using the kell software for windows version 6 ( biosoft , ferguson , mo , usa ) .
human androgen - independent prostate cancer pc-3 cells ( bioresource collection and research center , taiwan ) were cultured in ham 's f-12k medium supplemented with 10% heat - inactivated fetal bovine serum ( all from gibco , grand island , ny , usa ) containing 5% co2 at 37c . for animal inoculation ,
five - week - old male icr scid ( severely compromised immunodeficient ) outbred mice were obtained from the national animal center of taiwan ( taipei , taiwan , roc ) and maintained on a standard diet ( lab diet ; pmi feeds , st .
louis , mo , usa ) at rt , with free access to tap water in the animal house of iner ) .
thirty - three scid mice were subcutaneously injected with 2 10 pc-3 cells in the right hind flank .
the animal experiments were approved by the institutional animal care and use committee ( iacuc ) of the iner . at 4 weeks after pc-3 cell inoculation , the weight of the developed tumors ranged from 0.05 to 0.2 g. twenty - five pc-3 xenograft scid mice ( n = 5 for each group ) were injected with 0.37 mbq ( 0.1 g ) of the in - amba in 100-l normal saline via the tail vein .
the mice were sacrificed by co2 asphyxiation with tissues and organs excised at 1 , 4 , 8 , 24 , and 48 h postinjection ( p.i . ) .
subsequently , the tissues and organs were weighed , radioactivity was counted in a packard cobra ii gamma - counter by perkin - elmer ( waltham , ma , usa ) , and the percentage of injected dose per gram ( % id / g ) for each organ or tissue was calculated .
six pc-3 xenograft scid mice were injected with 0.37 mbq ( 0.1 g ) of the in - amba in 100-l normal saline via the tail vein . at 0.25 , 1 , 4 , 16 , 24 , 48 , 72 , 96 , and 168 h p.i .
, 20 l of blood was collected from the heart puncture , then the blood was weighed , radioactivity was counted in the cobra ii gamma - counter , and the percentage of injected dose per gram ( % id / g ) was calculated .
the data were fitted to a two - compartment model and the pharmacokinetic parameters were derived by the winnonlin 5.0 software ( pharsight corporation , mountain view , ca , usa ) .
two male scid mice bearing human pc-3 tumors of approximately 0.1 g were i.v . injected with 12.2 mbq/4 g in - amba after purification by radio - hplc .
the spect and ct images were acquired by a micro - spect / ct scanner system ( xspect ; gamma medica - ideas inc . ,
spect imaging was performed using medium - energy , parallel - hole collimators at 1 , 4 , 8 , 24 , and 48 h. the source and detector were mounted on a circular gantry allowing them to rotate 360 degrees around the subject ( mouse ) positioned on a stationary bed .
the energy windows were set at 173 kev 10% and 247 kev 10% .
spect imaging was followed by ct imaging ( x - ray source : 50 kv , 0.4 ma ; 256 projections ) with the animal in exactly the same position .
a three - dimensional ( 3d ) feldkamp cone beam algorithm was used for ct image reconstruction , and a two - dimensional ( 2d ) filtered back projection algorithm was used for spect image reconstruction .
all image processing softwares , including spect / ct coregistration , were provided by gamma medica - ideas inc ( northridge , ca , usa ) .
after coregistration , both the fused spect and ct images had 256 256 256 voxels with an isotropic 0.3-mm voxel size .
the relative organ mass scaling method was employed to extrapolate the animal data to humans [ 24 , 25 ] .
the mean absorbed dose in various tissues was calculated from the radionuclide concentration in tissues / organs of interest , assuming a homogeneous distribution of the radionuclide within any source region .
the calculated mean value of percentage of injected activity per g ( % ia / g ) for the organs in mice was extrapolated to uptake in organs of a 70-kg adult using the following formula :
( 1)[(%iagorgan)animal(kgtb weight)animal](gorgankgtb weight)human = ( % iaorgan)human .
the extrapolated values ( % ia ) in the human organs at 1 , 4 , 8 , 24 , and 48 h were fitted with exponential biokinetic models and integrated to obtain the number of disintegrations in the source organs .
the integrals ( mbq - s ) for 15 organs , including heart contents ( blood ) , brain , muscle , bone , heart , lung , spleen , pancreas , kidneys , liver , and remainder of body were evaluated and used for dosimetry evaluation .
the code also displays contributions of different source organs to the total dose of target organs . for the estimation of the tumor absorbed dose
, it was assumed that once the radiopharmaceutical is inside the tumor , there is no biological elimination .
the radiolabeling efficiency of in - amba was 95.43 1.37% ( n = 11 ) .
the in vitro competitive binding assays were determined in the human bombesin 2 receptor using i - tyr - bombesin as the grp - r specific radiotracer , and unlabeled amba and native bn as competitors .
the ic50 of the amba and native bn in human bombesin 2 receptor ( figure 2 ) is 0.82 0.41
nmol / l and 0.13 0.10 nmol / l , respectively , in a single , direct , nanomolar range , demonstrating high specificity and affinity for the grp receptor .
nmol / l and 0.10 0.08 nmol / l , respectively .
in - amba accumulated significantly in tumor , adrenal , pancreas , small intestine , and large intestine ( table 1 )
high levels of radioactivity were found in the kidneys before 24 h , indicating that the radioactivity was excreted rapidly in the urine within 24 h. the levels of radioactivity reached the highest with 3.87 0.65 % id / g at 8 h and then declined rapidly . the highest tumor / muscle ratio ( tu / mu ) of in - amba was 11.79 at 8 h after injection and decreased progressively to 4.82 and 5.16 at 24 and 48 h after administration , respectively .
other grpr - positive organs ( small intestine and large intestine ) also showed the specific binding of in - amba ( table 1 ) .
the tumor / muscle ratios were decreased conspicuously at 4 and 24 h postadministration .
the radioactivity declined to under detection limit after 24 h. the pharmacokinetic parameters derived by a two - compartment model indicated that the distribution half - life ( t1/2 ) and distribution half - life ( t1/2 ) of in - amba were 1.53 0.69 h and 30.73 8.56 h , respectively ( table 2 ) .
micro - spect / ct imaging of in - amba indicated significant uptake in the tumors at 8 and 24 h after intravenous injection ( figure 3 ) .
the longitudinal micro - spect / ct imaging showed high accumulation of in - amba in pancreas and gastrointestinal tract at 4 , 8 , 24 , and 48 h after intravenous injection .
the radiation - absorbed dose projections for the administration of in - amba to humans , determined from the residence times in mice , are shown in table 3 .
the highest absorbed doses appear in the lower large intestine ( 0.12 msv / mbq ) , upper large intestine ( 0.13 msv / mbq ) , kidneys ( 0.12 msv / mbq ) , osteogenic cells ( 0.22 msv / mbq ) , and pancreas ( 0.25 msv / mbq ) .
the red marrow absorbed dose is estimated to be 0.09 msv / mbq . for a 2-g tumor , the unit density sphere model was used and the estimated absorbed dose was 8.09 mgymbq .
growth factor receptors are involved in all steps of tumor progression , enhancing angiogenesis , local invasion , and distant metastases .
the overexpression of growth factor receptors on the cell surface of malignant cells might be associated with a more aggressive behavior and a poor prognosis . for these reasons
, tumor - related growth factor receptors can be taken as potential targets for therapeutic intervention . over the last two decades , grp and other blps
grpr antagonists have been developed as anticancer candidate compounds , exhibiting impressive antitumoral activity both in vitro and in vivo in various murine and human tumors [ 28 , 29 ] .
clinical trials with grpr antagonists in cancer patients are in its initial phase as anticipated by animal toxicology studies and preliminary evaluation in humans . presently , efforts at the identification of the most suitable candidates for clinical trials and at improving drug formulation for human use are considered priorities .
it may also be anticipated that grprs may be exploited as potential carriers for cytotoxins , immunotoxins , or radioactive compounds .
thus , the visualization of these receptors through molecular image - guided diagnostic agents may become an interesting tool for tumor detection and staging in personalized medicine .
the present study showed the highest accumulation of in - amba in pancreas in mice ( table 1 ) .
however , interspecies differences in structure and pharmacology of human and animal grp receptors have been reported . because the pancreas is the primary normal tissue in these animals that expresses a high density of bloodstream - accessible grprs ,
the accumulation of in in the pancreas is a direct reflection of the efficacy of radiolabeled bn analogs for in vivo targeting of cell - surface - expressed grprs .
retention of in - amba in the pancreas may be due to the characteristic of a radioagonist with effective internalization and cell retention .
waser et al . reported that in contrast to the strongly labeled grpr - positive mouse pancreas with lu - amba , the human pancreas did not bind lu - amba unless chronic pancreatitis was diagnosed .
the majority of research efforts into the design of bombesin - based radiopharmaceuticals have been carried out using grpr agonists .
the main reason for using agonists is that they undergo receptor - mediated endocytosis enabling residualization of the attached radiometal within the targeted cell .
micro - spect / ct imaging is a noninvasive imaging modality that can longitudinally monitor the behavior of grpr expression in the same animal across different time - points before and during therapy . in the present study , tumor targeting and localization of in - amba
was clearly imaged with micro - spect / ct after 1 to 48 h of administration , suggesting that micro - spect / ct imaging with in - amba is a good tool for studying the tumor targeting , distribution , and real - time therapeutic response in vivo .
the effective dose projected for the administration of in - amba to humans ( 0.11 msv / mbq ) ( table 3 ) is comparable to that for in - pentetreotide ( 0.12 msv / mbq ) , the only in - labeled peptide receptor - targeted radiotherapeutic agent to be used clinically [ 35 , 36 ] .
the intestines , osteogenic cells , kidneys , and pancreas appear to receive absorbed doses around 0.2 msv / mbq of in - amba . at a maximum planned administration of 111
mbq for diagnostic imaging , the total radiation - absorbed dose to these organs kidneys would be about 12 msv .
the use of animal data to estimate human doses is a necessary first step , but such studies give only an estimate of radiation doses to be expected in human subjects .
more accurate human dosimetry must be established with imaging studies involving human volunteers or patients .
the dosimetry data presented here will be valuable in the dose planning of these studies , and for application of in - amba to investigational new drug ( ind ) research .
clinically , primary prostate cancer and the metastases may be heterogeneous , demonstrating a spectrum of phenotypes from androgen - sensitive to androgen - insensitive .
lu - amba , a conjugated bombesin compound for imaging and systemic radiotherapy , is now in phase i clinical trials .
lu - amba has been evaluated in early stages of prostate cancer represented by the androgen - dependent , prostate - specific antigen - secreting hormone - sensitive prostate cancer cell line lncap , derived from a lymph node metastasis , and also in pc-3 cell line , derived from bone metastasis , is androgen - independent and is thought to represent late - stage hormone - refractory prostate cancer ( hrpc ) .
lu - amba will be clinically efficacious as a single - agent radiotherapeutic for heterogeneous metastatic prostate cancer and be a valuable adjunct to traditional chemotherapy .
thus , the visualization of grpr receptors through in - amba as an image - guided agent may contribute to the use of radiotherapeutic , lu - amba , and other traditional chemotherapy in personalized medicine .
targeted therapeutic and imaging agents are becoming more prevalent and are used to treat increasingly smaller population of patients .
biomarkers have great potential to reduce the numbers of patients needed to test novel targeted agents by predicting or identifying nonresponse early on and thus enriching the clinical trial population with patients more likely to respond .
grprs are expressed on prostate tumor cells , making it a potential biomarker for cancer .
the imaging of in - amba indicated the stage of prostate cancer for determining the therapeutic approach to prostate cancer and for monitoring the therapeutic efficacy .
the expression of grpr will vary from patient to patient due to the stages and individual difference .
if such patients could be prescreened with in - amba to identify those with higher tumor expression of grpr , then it would be possible to select cases for receiving blps - specific treatment , while cases with low tumor expression of grpr can consider other treatment options .
consequently , the proposed approaches enable optimized and individualized treatment protocols and can enhance the development of image - guide personalized medicine . by visualizing how well drug targeting systems deliver pharmacologically active agents to the pathological site
, in - amba furthermore facilitates personalized medicine and patient individualization , as well as the efficacy of combination regimens .
regarding personalized medicine , it can be reasoned that only in patients showing high levels of target site uptake with high expression of grpr should treatment be continued ; otherwise , alternative therapeutic approaches should be considered .
in - amba showed a characteristic of agonist , a good bioactivity in vitro and uptake in human grpr - expressing tumors in vivo .
the molecular image - guided diagnostic agent can be used for various different purposes , ranging from simple and straightforward biodistribution studies to extensive and elaborate experimental setups aiming to enable personalized medicine and to improve the efficacy of combined modality anticancer therapy . | molecular imaging with promise of personalized medicine can provide patient - specific information noninvasively , thus enabling treatment to be tailored to the specific biological attributes of both the disease and the patient .
this study was to investigate the characterization of do3a - ch2co - g-4-aminobenzoyl - q - w - a - v - g - h - l - m - nh2 ( amba ) in vitro , microspect / ct imaging , and biological activities of 111in - amba in pc-3 prostate tumor - bearing scid mice .
the uptake of 111in - amba reached highest with 3.87 0.65% id / g at 8 h. microspect / ct imaging studies suggested that the uptake of 111in - amba was clearly visualized between 8 and 48 h postinjection . the distribution half - life ( t1/2 ) and
the elimination half - life ( t1/2 ) of 111in - amba in mice were 1.53 h and 30.7 h , respectively .
the cmax and auc of 111in - amba were 7.57% id / g and 66.39 h% id / g , respectively .
the effective dose appeared to be 0.11 msv / mbq1 .
we demonstrated a good uptake of 111in - amba in the grpr - overexpressed pc-3 tumor - bearing scid mice .
111in - amba is a safe , potential molecular image - guided diagnostic agent for human grpr - positive tumors , ranging from simple and straightforward biodistribution studies to improve the efficacy of combined modality anticancer therapy . |
bariatric surgery has proven to be a treatment of choice for morbid obesity [ 1 , 2 ] . it is recommended for patients with body mass index ( bmi ) above 40 kg / m or higher than 35 kg / m when associated with comorbidities which include the different components of metabolic syndrome and type 2 diabetes [ 3 , 4 ] .
weight loss obtained after bariatric surgery is associated with a highly significant reduction in cardiovascular risk factors [ 57 ] .
more recently , improvement or remission of diabetes has been observed following bariatric surgery in obese patients with type 2 diabetes and mortality rate linked to diabetes was consequently significantly reduced [ 1 , 2 , 812 ] .
weight loss induced by bariatric surgery is a major factor of diabetes improvement [ 11 , 13 ] .
however , in several studies , the resolution of diabetes has often been observed before a significant weight loss has been obtained [ 1417 ] .
the early postsurgical improvement of diabetes suggested a major physiopathological role for changes in gut hormone secretion . as a matter of fact , a decrease in plasma levels of ghrelin , an orexigenic peptide , has been described following gastric bypass for morbid obesity [ 1922 ] .
the involvement of other intestinal peptides like glp-1 ( hindgut hypothesis ) [ 2326 ] and neuropeptide yy [ 22 , 2730 ] or a decreased secretion of anti - incretin hormones ( foregut hypothesis ) [ 31 , 32 ] has been proposed to explain the rapid remission of diabetes after bariatric surgery .
otherwise , roux - en - y bypass ( rygb ) that excludes the duodenum from the nutriments ' route and profoundly modifies the gut microbial metabolic cross - talk has been shown to improve insulin resistance more rapidly than sleeve gastrectomy .
most studies have compared two by two procedures . using this approach , rygb and sleeve gastrectomy ( sg )
seem to be more efficient for treating diabetes than gastric banding ( gb ) . however , these studies failed to provide clear conclusions owing to the great heterogeneity of the results .
for instance , depending on the mode of surgery used ( restrictive , malabsorptive , or combined ) and study design , the diabetes remission rate varied from 45 to 97% of patients [ 5 , 9 , 12 , 3439 ] . in our center , four surgical procedures have been used for the last 15 years to treat obesity , gb , sg , calibrated gastrectomy type mason ( cgma ) , and rygb . the aim of the present retrospective study was to evaluate the efficacy of these four procedures to induce diabetes remission and lower cardiovascular risk factors . moreover , the influence of surgery on weight evolution in the diabetic population was compared with that observed in a nondiabetic population matched for sex , age , bmi , and surgical procedure .
we have conducted a retrospective case - control comparative study aimed at evaluating the impact of bariatric surgery on type 2 diabetes . among 970 patients who underwent bariatric surgery in our center since 2001 ,
all patients had undergone a medical supervised therapy for weight loss , for at least 12 months before bariatric surgery .
preoperatively , they were evaluated for medical or surgical history , and treatment used was recorded .
a clinical examination was performed and risk factors and comorbidities , including arterial hypertension and sleep apnoea syndrome , were collected .
the serum levels of biological markers ( fasting glycemia , glycosylated hemoglobin , total cholesterol , hdl- and ldl - cholesterol , and triglycerides ) were measured .
then , one of the four following surgical procedures was used : gb ( 20 patients ) , cgma ( 14 patients ) , sg ( 24 patients ) , and rygb ( 23 patients ) .
after surgery , the weight change could be followed for 24 months and biological parameters for 12 months .
the weight changes in patients with diabetes were also compared to those observed in obese patients without diabetes and matched for age , sex , bmi , and type of surgery .
the evolution of diabetes has been chosen as the primary end point of the study .
remission of diabetes ( score 1 ) was defined as hba1c level lower than 6.5% and interruption of antidiabetic treatment .
improvement ( score 2 ) was defined as either a decrease in hba1c level or a reduction in the antidiabetic treatment .
score 3 corresponded to a stabilisation of diabetes and score 4 to a degradation of the glycaemic pattern .
as the latter is a qualitative parameter , statistical analysis of the data used a test .
similar scores and statistical procedures were used to evaluate the changes in the following comorbidities : arterial hypertension , sleep apnoea syndrome , and serum lipid pattern .
the serum hba1c levels , measured , respectively , before and 6 to 12 months after surgery , were compared with the wilcoxon test .
the nonparametric test of kruskal wallis was used to evaluate this biological parameter as a function of the type of surgery employed .
the weight changes were initially analysed using anova for two factors : time and type of surgery .
depending on the results of this first analysis , a second statistical evaluation using an anova for one factor ( type of surgery ) was performed .
complementary tests of comparison two by two ( newman and keuls ) were done for the different time points where anova ( one factor ) was statistically significant .
statistical analyses were performed with statview software ( 5th version , sas institute , north carolina ) .
the mean diabetes duration was 8 8 years . according to who criteria , 67 patients ( 82.7% ) harboured a profile of metabolic syndrome .
the number of patients with cardiovascular risk factors was similar whatever the type of surgery performed .
38% of the patients suffered from micro- and/or macrovascular complications of diabetes and 24 ( 29.6% ) complained of signs of depression .
10 patients were treated by diet alone , 44 patients ( 54% ) by oral antidiabetic drugs ( oad ) , 7% by insulin , and 25% by oad plus insulin .
bariatric surgery induced a significant ( p < 0.001 ) weight loss in both groups of obese patients ( figure 1 ) .
one year after surgery , weight was reduced by 30.7 2.1 and 37.2 2.6 kg in patients with and without diabetes , respectively ( figure 1 ) . basal weight before surgery was significantly different according to the surgical procedure ( p = 0.002 ) ( figure 2 ) so further anova analysis has been performed on the weight difference .
a significant weight loss ( p < 0.01 ) was obtained after each surgical procedure , reaching 26.0 2.0% ( 6.7 4.6 kg , gb ) , 28.0 1.6% ( 27.8 5.4 kg , cgma ) , 41.0 3.3% ( 32.2 5.0 kg , sg ) , and 43.0 2.9% ( 28.2 4.5 kg , rygb ) of the initial weight on month six after surgery .
repeated measure anova analysis ( time surgical procedure ) revealed significant differences between the weight loss and the surgery procedure in the diabetic group ( p = 0.007 ) .
the weight loss in the gb group compared to the three other procedures was statistically lower at 3 , 6 , and 12 months after the surgery .
the weight loss was not statistically different between diabetic and nondiabetic matched patients , regardless of the surgical procedures performed ( figure 3 ) . in the whole group of obese patients with diabetes , a statistically significant decrease in serum hba1c level from 8.4 0.2% to 6.8 0.16% ( p <
0.001 ) was observed one year following surgery . as a function of type of surgery , serum hba1c level dropped from 9.01 0.44 to 7.33 0.33% ( gb ) , 8.61 0.47 to 7.21 0.32% ( cgma ) , 7.94 0.38 to 6.81 0.33 ( sg ) , and 8.31 0.43 to 6.34 0.27 ( rygb , p < 0.001 ) ( figure 4 ) . in terms of decrease in hba1c levels
considering the overall surgical approach , diabetes significantly ( p = 0.015 ) improved after surgery .
a remission was observed in , respectively , 20% of patients after gb , 29% after cgma , 62.5% after sg , and 52% after rygb .
diabetes remission was clearly better after sg than following gb ( p = 0.0026 ) .
conversely , the superiority of rygb on gb was only at the limit of statistical significance ( p = 0.051 ) ( figure 4 ) .
arterial hypertension resolved in 12% of the patients and was improved in additional 7% of them after bariatric surgery .
however , no statistically significant difference in either arterial blood pressure or antihypertensive drug need was observed between the four surgical procedures .
the intensity of sleep apnoea syndrome and the need of continuous positive airway pressure were not modified , on a statistical basis , after each mode of surgery despite the weight loss .
in contrast , in the group of diabetic patients considered as a whole , sleep apnoea syndrome disappeared or was improved after bariatric surgery in , respectively , 20% and 90% of cases .
the serum levels of hdl - cholesterol did not significantly change during the postsurgery follow - up .
in contrast , serum triglycerides fell in 76% of the patients but the comparison between the four different modes of surgery did not reveal any significant difference among them .
serum ldl - cholesterol level was significantly ( p = 0.0034 ) reduced after surgery .
the decrease in ldl - cholesterol was significantly ( p = 0.01 ) higher after cgma than following gb and significantly higher ( p = 0.03 ) after rygb than following cgma .
bariatric surgery has been proven to be an effective approach for the treatment of morbid obesity in adults with bmi > 40 kg / m [ 2 , 5 , 17 ] .
an increasing body of evidence also emphasizes the bariatric surgery benefit for the treatment of the type 2 diabetes in obese patients .
moreover , the new therapeutic algorithms of type 2 diabetes suggest an earlier surgical intervention for increasing the likelihood of remission of diabetes [ 4 , 40 ] . however , the question of the choice of surgical procedure to be used in this purpose remains yet largely debated and many variations in selection of the surgical technique are observed among obesity care centres . because randomized studies are scarce and very difficult to realize , until now most statements are issued from observational studies and meta - analyses . in this context , the choice for the surgical procedure remains open according to idf recommendations .
our study is the first one comparing four surgical procedures of bariatric surgery on the remission rate of diabetes , weight loss , and reduction of comorbidities in obese patients with type 2 diabetes with similar effectiveness in the diverse groups of patients .
although weight loss was similar following each type of bariatric surgery , significant differences were observed in the remission rate of type 2 diabetes depending on the surgical method used .
sg or rybg gave no different results but were followed by better remission rates than after gb .
the lack of standardization for the criteria of remission of diabetes between studies introduces a limit to the strength of the comparison with those previously published on this topic .
however , our results agree with those of abbatini et al . and campos et al . who showed a superiority of rygb on gb on the remission rate of type 2 diabetes and with the conclusions of the meta - analysis by buchwald et al .
it has been proposed that differences in the secretion of gut hormones ( ghrelin , glp-1 , peptide yy ) occurring after sg or rygb may play a pivotal role in diabetes regression by acting on appetite [ 41 , 42 ] , improving insulin sensitivity , and restoring the first phase of insulin secretion [ 23 , 27 , 28 ] , all effects which , concomitantly to weight loss , participate to the improvement of diabetes . in our study , the best rates of remission of diabetes were observed after performing either sg ( 62.5% ) or rygb ( 52% ) . they seem to be quite lower than those previously reported but the results are variable from one study to the other .
described a resolution of diabetes in 83% of the 240 patients operated by laparoscopic rygb and followed for a five - year period .
however , a recent randomised trial reported 42% remission after rygb and 37% after sg 12 months after the surgery , with no difference between the 2 surgical groups in diabetic obese patients .
this discrepancy of the efficacy could be explained by the lack of standardisation for remission criteria as well as phenotypic differences among patients .
indeed , our patients were quite older and one - third exhibited diabetic complications , suggesting a more pronounced diabetic state .
no significant difference in weight changes was observed in the group of nondiabetic obese patients by comparison with diabetic patients regardless of the type of surgery performed . by comparison with nondiabetic patients ,
a lower decrease in weight has been previously observed in obese diabetic patients treated with rygb in relation to the modalities of the treatment for diabetes . in this study , patients requiring a more powerful treatment of diabetes lost less weight .
conversely , in the present study , the proportion of patients who had the diverse modalities of treatment , that is , diet alone , oral hypoglycemic drugs , and/or insulin , was similarly distributed between the four surgical procedures ; a direct incidence of the therapy for diabetes on the pattern of weight loss appears unlikely .
as frequently observed in retrospective studies , the preoperative characteristics of the patients were significantly different between the groups .
this can be explained by the fact that the mode of surgery had been chosen according to the patient 's profile .
in fact , while gb or rygb were performed in patients with lower bmi ( 4045 kg / m ) and in those suffering from nibbling , sg was preferentially proposed in patients with bmi > 50 kg / m or with significant comorbidities .
we observed a postsurgical improvement in arterial hypertension and sleep apnoea syndrome in the group of diabetic patients considered as a whole .
the higher number of comorbidities found in our severely obese patients , whose diabetes was imperfectly controlled as evidenced by high basal hba1c levels , the long - lasting preoperative duration of diabetes which was frequently complicated ( 38% of cases ) , could explain the less pronounced improvement than that reported in other studies .
considering each of the four surgical procedures , none appears to be significantly more effective than others to improve arterial hypertension or sleep apnoea syndrome .
bariatric surgery was followed by a significant drop in serum triglycerides in agreement with previously published studies [ 6 , 15 , 46 ] .
however , in contrast to reports of higher effectiveness of rygb to reduce serum triglyceride levels [ 15 , 46 , 47 ] , we found no difference between the four types of surgery used .
in contrast , rygb appears as potent as sg to decrease ldl - cholesterol level , both being more effective than cgma . like in the majority of retrospective investigations , the main limitation of our study
however , randomised trials are particularly difficult to realize in this field and even not conceivable for four different surgical procedures .
another classical limitation in this type of study is the high percentage of patients lost to follow - up .
however , it is important to notice that 30% of these patients declared that they had stopped the specialized follow - up because of diabetes regression .
this observation illustrates the difficulties to follow these patients and emphasizes the need for clinical investigators to develop collaboration with general practitioners . to conclude
, the results of our study suggest that among the four surgical procedures available for the management of obese patients with type 2 diabetes , sg and rygb might be more efficient than cgma and gb to improve dt2 one year after the intervention .
sg seems to be in our study at least as efficient as rygb to treat diabetes and other comorbidities .
this observation , which needs to be confirmed in larger populations , is interesting because sg offers several other advantages .
especially , sg , which is a technically simpler method of surgery than rygb , induces less vitamin deficiency and can be subsequently converted into rygb if its effects are considered unsatisfactory . | aim .
the aim of the present retrospective study was to evaluate the efficacy of four bariatric surgical procedures to induce diabetes remission and lower cardiovascular risk factors in diabetic obese patients .
moreover , the influence of surgery on weight evolution in the diabetic population was compared with that observed in a nondiabetic matched population
. methods . among 970 patients who were operated on in our center since 2001 ,
81 patients were identified as type 2 diabetes .
laparoscopic adjustable gastric banding ( gb ) , intervention type mason ( ma ) , gastric bypass ( rygb ) , and sleeve gastrectomy ( sg ) were performed , respectively , in 25% , 17% , 28% , and 30% of this diabetic population .
results . the resolution rate of diabetes one year after surgery was significantly higher after sg than gb ( 62.5% versus 20% , p < 0.01 ) , but not significantly different between sg and rygb . in terms of ldl - cholesterol reduction , rygb was equivalent to sg and superior to cgma or gb . considering the other cardiovascular risk factors , there was no significant difference according to surgical procedures .
the weight loss was not statistically different between diabetic and nondiabetic matched patients regardless of the surgical procedures used .
conclusion .
our data confirm that the efficacy of surgery to treat diabetes is variable among the diverse procedures and sg might be an interesting option in this context . |
gorlin - goltz syndrome ( ggs ) also known as nevoid basal cell carcinoma syndrome ( nbccs ) is an autosomal dominant inherited disorder .
the incidence of this disorder is estimated to be 1 in 50,000 - 1,50,000 in the general population , varying by region .
it appears in all ethnic groups , but most often in whites ; males and females are equally affected .
the pathogenesis of ggs is attributed to abnormalities linked to the long arm of chromosome 9 ( q22.3-q31 ) .
it has been reported that loss of human patched gene ( ptch1 gene ) , which is a tumor suppressor gene , could be the molecular origin of the syndrome .
human patched gene ( ptch1 gene ) is significant for embryonic structuring and cellular cycle and thus its mutation comprises a key event for the development of this syndrome .
ggs is characterized mainly by the presence of multiple basal cell carcinomas ( bcc ) , odontogenic keratocysts ( okcs ) of the jaw , palmar pits and ectopic calcifications of the falx cerebri .
the presence of two major and one minor criteria or one major and three minor criteria are necessary to establish a diagnosis .
a 13-year - old boy visited our hospital with a chief complaint of swelling on lower anterior region of the jaw since 10 days .
swelling was approximately 2 cm 1 cm in size , soft to firm in consistency and tender on palpation .
intraoral examination revealed his deciduous teeth were still present and few permanent teeth were missing [ figure 1 ] .
intraoral photograph showing missing permanent teeth and deciduous teeth were still present the orthopantomogram was advised , which revealed three cystic lesions in the mandible and two involving the maxillary sinus on either side with the displaced permanent teeth [ figure 2 ] . owing to the presence of multiple cysts like lesions in the jaw , ggs was suspected and further investigations were carried out .
orthopantogram showing three cystic lesions in the mandible and two involving the maxillary sinus on either side with the displaced permanent teeth the radiograph of the skull showed bilamellar calcification of the falx cerebri [ figure 3 ] .
physical examination revealed macrocephaly with a head circumference of 92 cm ( normal for a 13-year - old boy is 54 - 57 cm ) , frontal bossing , depressed nasal bridge , hypertelorism and mandibular prognathism [ figure 4 ] .
palmar pits were brown coloured and measuring 1 - 3 mm in diameter [ figure 5 ] .
no other anomalies of the skeletal , cardiovascular , or central nervous system were present .
prior to the surgical procedure , an arch bar was placed on the lower jaw to prevent fracture of the mandible as well as to splint the unsupported permanent teeth .
after the cystic lesions enucleated , large areas of bone loss were seen and the displaced permanent teeth were visible on the floor of the cystic cavity [ figure 6 ] .
axial computed tomography brain image showing bilamellar calcification of the falx cerebri side profile photograph showing mandibular prognathism ( class iii jaw relationship ) very thinned out labial cortical plate and displaced right permanent canine were seen carnoy 's solution was then applied using cotton rolls for a period of 5 min .
the excess solution was then irrigated using saline and the cavity was packed with bismuth iodine paraffin paste .
the pack was removed after 7 days and regular irrigation of the cavity was done .
the histopathological examination of the enucleated tissue showed parakeratinized uniform squamous epithelial lining , five to eight cells thick with fairly flat base .
the epithelium demonstrated a well - developed basal layer of palisaded columnar cells with polarized hyperchromatic nuclei .
multiple satellite and daughter cysts were seen in the connective tissue wall [ figure 7 ] .
histopathological photomicrograph showing uniform parakeratinized epithelial lining with satellite cyst in the connective tissue wall ( h and e , 10 ) the parents of the patient were examined and underwent radiological evaluation ; neither of them had any features of the ggs .
nbccs was first described by jarish and white in 1894 and was later establish as a unique syndrome by gorlin - goltz in 1960 .
first established major and minor criteria for diagnosis of this rare entity , later modified by kimonis et al . according to them diagnosis of ggs
can be established when two major or one major and two minor features are present .
the major criteria are :
multiple bcc or one occurring under the age of 20 yearshistologically proven okcs of the jawspalmar or plantar pits ( three or more)bilamellar calcification of the falx cerebribifid , fused or markedly splayed ribsfirst - degree relative with nbccs .
multiple bcc or one occurring under the age of 20 years histologically proven okcs of the jaws palmar or plantar pits ( three or more ) bilamellar calcification of the falx cerebri bifid , fused or markedly splayed ribs first - degree relative with nbccs .
the minor criteria are :
macrocephaly ( adjusted for height)congenital malformation : cleft lip or palate , frontal bossing , coarse face , moderate or severe hypertelorismother skeletal abnormalities : sprengel deformity , marked pectus deformity , marked syndactily of the digitsradiological abnormalities : bridging of the sella turcica , vertebral anomalies such as hemivertebrae , fusion or elongation of the vertebral bodies , modeling defects of the hands and feet or flame shaped hands or feetovarian fibromamedulloblastoma .
macrocephaly ( adjusted for height ) congenital malformation : cleft lip or palate , frontal bossing , coarse face , moderate or severe hypertelorism other skeletal abnormalities : sprengel deformity , marked pectus deformity , marked syndactily of the digits radiological abnormalities : bridging of the sella turcica , vertebral anomalies such as hemivertebrae , fusion or elongation of the vertebral bodies , modeling defects of the hands and feet or flame shaped hands or feet our patient had three major features , namely palmar pits , multiple okcs in the jaw and lamellar calcification of the falx cerebri and minor features such as macrocephaly , fontal bossing and hypertelorism , thus suggesting it to be a case of the ggs . in general , okcs are more common in the adult life , the peak incidence being the third decade of life . however , in the ggs , okc occurs at a much younger age .
lo muzio et al . , observation showed that okcs were often the first sign of ggs in 78% of the cases and they could be detected in patients younger than 10 years of age .
okcs , which are relatively common in ggs , are diagnosed with dental panoramic radiography .
keratocysts may show a uni - or multilocular pattern and the cystic spaces may have a smooth or scalloped border .
syndrome keratocysts were found to have a markedly increased number of satellite cysts , solid islands of epithelial proliferation , odontogenic rests within the capsule , and mitotic figures in the epithelial lining of the main cavity . in our patient , the lining of the okcs revealed the presence of parakeratinized uniform squamous epithelial lining with multiple satellite and daughter cysts in the connective tissue wall , thus indicating the association with ggs .
removal of cystic lesions , similar to the one seen in our case , weakens the remaining bony integrity and places it at risk of pathologic fracture .
this can be managed with intermaxillary fixation or placement of reconstruction plate . in our case
, an arch bar was attached to the lower teeth to splint them as well as to support the remaining bone structure to prevent any fracture of the jaw .
early recognition of the disease , a detailed family history and a thorough evaluation of signs and symptoms are the cornerstones for appropriate management . because of the different systems affected and diversity in the clinical picture ,
once diagnosis is established , a multidisciplinary approach team of various specialists is required for a successful treatment .
the ggs is a well - known syndrome with a variety of findings in and outside the head and neck region .
early diagnosis of this syndrome is important to reduce the associated complications , which are life - threatening and also to provide genetic counselling to the parents . | gorlin - goltz syndrome is an uncommon autosomal dominant inherited disorder characterized by numerous basal cell carcinomas , odontogenic keratocysts ( okcs ) and musculoskeletal malformations .
a rare case of this syndrome observed in a 13-year - old male patient is presented in which multiple okcs were causing disfigurement of the lower jaw as well as displacement and malocclusion of the teeth .
early diagnosis and treatment of this syndrome is important to reduce the severity of complications including cutaneous and cerebral malignancy and oromaxillofacial deformation and destruction due to jaw cysts . |
photoaged skin is largely a result of chronic exposure to ultraviolet ( uv ) radiation.1 photoaging , which causes premature aging in the appearance and function of the skin , is similar to chronological aging in that it is cumulative over time .
the amount of photodamage depends on the duration and intensity of exposure to the sun along with inherent pigmentation of the skin.2,3 photodamaged skin is characterized by various undesirable esthetic manifestations including dyspigmentation , wrinkling , roughness , laxity , dullness , lentigines , atrophy , and purpura on areas of the body chronically exposed to the sun .
clinical dyschromia is often a prominent feature in sun - exposed skin , especially the face.46 while benign in nature , dyschromias can have an adverse effect on social functioning , lower work productivity and self - esteem , and produce a negative impact on a patient s quality of life.7,8 women frequently seek effective treatment for their irregular pigmentation as well as other clinical manifestations of photodamaged skin .
dermatological procedures , including chemical peels,9,10 along with lasers and pulsed light,11,12 are often utilized alone or in combination with various topical treatments for hyperpigmentation.1216 broad - spectrum sunscreens ( blockers of both uva and uvb ) are considered the cornerstone of effective management of hyperpigmentary disorders .
evidence now strongly suggests that augmenting sunscreens with active ingredients that provide antioxidant and anti - inflammatory benefits can help increase the photo - protective qualities of sunscreens.17 in addition to uva and uvb radiation , sunlight contains a large amount of infrared ( ir ) radiation . protection against ir is equally important as it penetrates deeper into the skin and can produce significant damage in the dermis.18 one of the early and visible manifestations of both uv and ir exposure to skin is hyperpigmentation .
in addition to providing an effective protection against sunlight , inclusion of actives in sunscreen that can decrease melanin synthesis and distribution can provide significant benefit in improving overall appearance of skin after prolonged sun exposure . a major limitation with topical treatments for hyperpigmentation
is that the beneficial effects generally are not seen for several weeks or even months after initiation of treatment .
patients typically do not want to wait so long for visual improvement in their condition , particularly if the uneven pigmentation is on their face .
a colored medical makeup was developed to provide immediate cosmetic correction including photo - protection and long - term pigmentation reduction benefits .
this clinical trial is designed to assess the effects of a multifunctional facial primer ( cosmetic correction , uv / ir protection , and pigmentation treatment ) when used by patients with both mild - to - moderate hyperpigmentation and fine lines associated with photodamage .
iv , who were regular users of foundation and in good general health , were recruited for the study .
inclusion criteria were the presence of mild - to - moderate facial hyper - pigmentation and fine lines associated with photodamage .
subjects were required to have a baseline score of 36 on both the hyperpigmentation scale ( 09 ) and the fine lines scale ( 09 ) .
primary exclusion criteria included use of topical skin - lightening and antiaging products within 4 weeks prior to the study as well as facial dermatologic procedures within 12 months prior to the study .
subjects were provided a facial regimen of four products ( even up - clinical pigment protector , pigment perfecting facial primer , sunforgettable setting mist , pressed mineral foundation and sunforgettable spf 30 ; colorescience , inc . ,
all the products were applied in the morning with sunforgettable spf 30 reapplied as needed throughout the day .
subjects were advised to avoid extended periods of sun exposure and all use of tanning beds during the study and to use protective clothing ( including sunglasses ) and avoid sun exposure from 10 am to 2 pm .
subjects were allowed to continue the use of their regular cosmetics ( except foundation ) for the duration of the study but were not allowed to use any antiaging or skin - lightening products .
daily diary recordings of test material applications and comments by the subjects were made during the course of the study .
diaries were reviewed , and test materials were visually inspected at each post - baseline visit .
the product contains zinc oxide and titanium dioxide to provide broad - spectrum spf 50 sun protection .
improvement in skin pigmentation is provided by a combination of three actives that prevent stimulation of melanocytes by anti - inflammatory mechanisms ( tocopheryl phosphate ) , suppress tyrosinase activity and transfer of melanin to keratinocytes ( acetylated rheum rhaponticum root extract ) , and increase skin turnover to remove existing melanin with retinoid - like activity ( bidens pilosa extract ) .
the conduct of the study followed all applicable guidelines for the protection of human subjects as outlined in 21 cfr50.25 , in accordance with the accepted standards for good clinical practice , international conference of harmonisation ( ich ) , and the standard practices of thomas j stephens & associates . prior to treatment , subjects provided informed consent .
the study was conducted in dallas , tx , usa , from january to april 2014 .
subjects were treated over a 12-week period and arrived at the clinic for each visit having removed all makeup at least 30 minutes prior to the appointment .
clinical efficacy and tolerability evaluations were made by an expert grader at baseline , week 4 , week 8 , and week 12 on bare skin ( without primer application ) .
additionally , following the application of facial primer by a certified makeup artist , clinical assessments were performed by the same expert grader after the baseline application of the facial primer and after the week 12 application .
hyperpigmentation ( 0= faint spots or not visible , 9= discrete dark spots ) fine lines ( 0= none , 9= numerous ) overall appearance ( 0= excellent , 9= poor ) pore size ( 0= small or not noticeable pores , 9= pores large and prominent ) radiance ( 0= radiant , luminous appearance , 9= dull / matte or sallow appearance ) skin smoothness ( 0= smooth , even - looking texture , 9= rough , uneven - looking texture ) skin tone ( 0= even , healthy skin color , 9= uneven , dis - colored appearance ) the expert grader also performed global assessments of each subject s face using a modified griffith s ten - point scale19 according to the following numerical definitions :
0= none ( best possible)13= mild46= moderate79= severe ( worst possible ) 0= none ( best possible ) 79= severe ( worst possible ) at each assessment , the subjects were evaluated by an expert grader for objective evidence of erythema , edema , and dryness and peeling using a four - point scale ( 0= none , 3= severe ) . subjects also assessed themselves for subjective irritation parameters including itching , stinging , tingling , and burning on a four - point scale ( 0= none , 3= severe ) . at each assessment
, digital photographs were taken using the visia cr2 ( canfield imaging systems , fairfield , nj , usa ) with a canon mark ii 5d digital slr camera ( canon , inc . ,
subjects had three sets of full - face images taken ( right side , left side , and center view ) using all lighting modes .
at each evaluation visit , subjects completed a self - assessment questionnaire regarding their experience with the test material , efficacy , esthetics , and other attributes using a 09 scale ( 0= best condition and 9= worst condition ) .
the per - protocol ( pp ) population was the primary population for all statistical analyses testing .
the pp population included all subjects who were deemed eligible for participation and completed the study according to protocol . the average percentage change from baseline was calculated at each post - baseline evaluation visit .
wilcoxon signed - rank test was used for clinical grading of the efficacy parameters , tolerability evaluations , and skin condition - related self - assessment questionnaires .
hyperpigmentation ( 0= faint spots or not visible , 9= discrete dark spots ) fine lines ( 0= none , 9= numerous ) overall appearance ( 0= excellent , 9= poor ) pore size ( 0= small or not noticeable pores , 9= pores large and prominent ) radiance ( 0= radiant , luminous appearance , 9= dull / matte or sallow appearance ) skin smoothness ( 0= smooth , even - looking texture , 9= rough , uneven - looking texture ) skin tone ( 0= even , healthy skin color , 9= uneven , dis - colored appearance ) the expert grader also performed global assessments of each subject s face using a modified griffith s ten - point scale19 according to the following numerical definitions :
0= none ( best possible)13= mild46= moderate79= severe ( worst possible ) 0= none ( best possible ) 79= severe ( worst possible )
at each assessment , the subjects were evaluated by an expert grader for objective evidence of erythema , edema , and dryness and peeling using a four - point scale ( 0= none , 3= severe ) .
subjects also assessed themselves for subjective irritation parameters including itching , stinging , tingling , and burning on a four - point scale ( 0= none , 3= severe ) .
at each assessment , digital photographs were taken using the visia cr2 ( canfield imaging systems , fairfield , nj , usa ) with a canon mark ii 5d digital slr camera ( canon , inc . , tokyo , japan ) .
subjects had three sets of full - face images taken ( right side , left side , and center view ) using all lighting modes .
at each evaluation visit , subjects completed a self - assessment questionnaire regarding their experience with the test material , efficacy , esthetics , and other attributes using a 09 scale ( 0= best condition and 9= worst condition ) .
the per - protocol ( pp ) population was the primary population for all statistical analyses testing .
the pp population included all subjects who were deemed eligible for participation and completed the study according to protocol .
the average percentage change from baseline was calculated at each post - baseline evaluation visit .
wilcoxon signed - rank test was used for clinical grading of the efficacy parameters , tolerability evaluations , and skin condition - related self - assessment questionnaires .
three subjects discontinued the study ( one was lost to follow - up , one was noncompliant , and one for a product - unrelated adverse event ) .
the subjects were predominantly caucasian with both mild - to - moderate hyperpigmentation and fine lines associated with photodamage .
application of the facial primer produced a statistically significant 38.4% improvement in clinical grading scores for hyperpigmentation after first application when compared to bare skin condition at baseline .
this immediate improvement is a result of covering up the imperfections and dark spots on the skin with micronized pigments .
after 12 weeks of product use , a 43.9% improvement was seen compared to baseline ( figure 1 ) .
this additional improvement in clinical grading scores for hyperpigmentation at 12 weeks over the first application is the apparent result of the cumulative effect of key ingredients on the overall skin condition .
similarly , statistically significant improvements were seen in other parameters of photoaging including skin tone , radiance , fine lines , skin smoothness , pore size , and overall appearance of the skin immediately following the first application which further improved after 12 weeks of product use ( figure 2 ) .
a statistical progressive improvement in hyperpigmentation scores upon assessment of bare skin ( no primer applied ) was seen at week 4 , week 8 , and week 12 indicating an improvement in skin quality with regular use of the products ( figure 3 ) .
the facial primer was well tolerated by the subjects with no statistically significant increases in scores for tolerability / safety parameters at any study visit compared to baseline scores .
the facial primer was well received by the subjects as indicated in the self - assessment questionnaires .
96.4% of subjects stated that the appearance of age spots / dark spots / sunspots / discolorations improved at 12 weeks , whereas 89.3% considered that the appearance of fine lines / wrinkles improved over this same time period with use of the facial primer .
each figure shows baseline photos ( before use of the primer ) and 12-week photos ( without primer application and following primer application ) .
color cosmetics may be useful for the cosmetic correction of pigment abnormalities and can provide emotional benefits to patients with such esthetic skin conditions , particularly for those conditions that are readily visible.20,21 studies have shown that use of corrective makeup in cosmetically disfiguring der - matoses improves both appearance and quality of life.22 the appropriate use of corrective makeup may also complement the treatment of such disorders by improving adherence to therapy.22 use of a concealer or foundation to mask hyperpigmented areas , however , may fail to uniformly cover imperfections , and spots can take on a dull gray coloration.23 while there are many different approaches to the treatment of disorders of hyperpigmentation , topical therapies are typically employed .
unfortunately , benefits from use of depigmenting agents are uncertain and often delayed for several weeks or longer .
the traditional advantage of a cosmetic correction is that it offers the patient rapid and dramatic coverage , while the underlying condition is being treated with therapeutic modalities .
a cosmetic primer is a cream or lotion applied before another cosmetic to improve coverage and lengthen the amount of time the cosmetic lasts on the face .
typically , a primer is used as a base cosmetic correction to even out the surface of the face prior to application of a foundation .
the facial primer utilized in this study is unique in that it combines three functions , namely a cosmetic correction makeup to conceal facial imperfections , a broad - spectrum spf 50 sunscreen , and multifunctional treatment for hyperpigmentation .
the treatment component is based on ingredients having several activities : prevention of uv- and ir - mediated skin damage , prevention of melanocyte stimulation , tyrosinase inhibition ( decreases production of melanin ) , decreased transfer of melanin to keratinocytes , keratolytic ( increases cell exfoliation enhancing cell turnover and removal of epidermal melanin ) , and anti - inflammatory ( reduces pro - inflammatory mediators ) .
the facial primer studied here belongs to a new class of medical makeup that provides coverage to hide pigmentary skin imperfections while protecting skin and correcting underlying conditions.24 it is well known that sun exposure plays a major aggravating role in reinforcing existing dyschromias and causing new areas of pigmentation . as such ,
minimizing sun exposure and the regular use of broad - spectrum sunscreens are fundamentals in the management of hyperpigmentation .
however , it is often difficult for physicians to convince their patients of the necessity to use sunscreen chronically , and in sufficient amounts , to prevent recurrence of dyschromias .
the facial primer incorporates broad - spectrum spf 50 sunscreen with ir protection as an integral component of the product .
the subjects in this study had both mild - to - moderate hyperpigmentation along with fine lines of the face .
not only was the facial primer effective in improving the appearance of hyperpigmentation after first application due to its cosmetic correction effects , but its continued use for the 12-week study period also improved dyschromias when assessed on bare skin .
daily application of the facial primer progressively decreased pigmentation from baseline by 4% at 4 weeks to 15% at 12 weeks .
this long - term effect on pigmentation can be attributed to the strong antioxidants that prevent activation of melanocytes by uv , ir , and oxidative stress , thereby reducing pigmentation over time .
additional actives also target various steps in the melanogenesis pathway by inhibiting tyrosinase , reducing melanin transfer to keratinocytes , and increasing epidermal turnover to remove existing melanin .
many preventive properties of this product may help reduce the occurrence of post - inflammatory hyperpigmentation .
all of the other clinical efficacy assessments of the facial skin ( overall appearance , pore size , radiance , smoothness , fine lines , and skin tone ) showed a statistical improvement at their first use and at week 12 compared to baseline .
these effects are likely a result of strong antioxidant properties of actives that help strengthen skin and improve its quality over time .
tolerability assessments by both the investigator and subject confirmed that the facial primer was well tolerated .
this study demonstrates the efficacy and tolerability of a multifunctional facial primer for the treatment of mild - to - moderate facial hyperpigmentation and fine lines associated with photodamage . | backgroundphotoaged skin results from various environmental factors , most importantly chronic sun exposure .
dyschromia and fine lines / wrinkles are common clinical manifestations of photodamaged skin.purposethis single - center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer ( camouflage , broad - spectrum spf 50 , and a treatment for hyperpigmentation ) when used by females with mild - to - moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks.patients and methodssubjects were provided test material ( even up - clinical pigment perfector ) and supporting products to use on their face and neck .
products were used according to specific application instructions .
clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline , baseline ( post - application primer ) , week 4 , week 8 , week 12 , and week 12 ( post - application primer ) .
standardized digital photographs were taken , and self - assessment questionnaires were conducted.resultstwenty-eight female subjects completed the 12-week trial .
the facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application .
the treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial .
these long - term benefits can be attributed to an improvement in the underlying skin condition .
the facial primer was well tolerated .
subject questionnaires showed that the product was highly rated at all visits.conclusionthe facial primer was shown to be effective and well tolerated for immediate and long - term improvement in the appearance of mild - to - moderate hyperpigmentation and fine lines associated with photodamage when used over a 12-week period . |
adolescent idiopathic scoliosis is defined as a curvature of the spine with a cobb angle of more than 10 degrees with concomitant rotational displacement .
curvatures larger than 50 at skeletal maturity are at high risk of continued progression throughout the lifespan . while bracing and surgical intervention have been the mainstays of conventional scoliosis management for progressive curvatures , exercise - based methods have become more known , with various exercise - based methods being published mainly from europe .
the main objectives of exercise treatment for idiopathic scoliosis to date have primarily been 3 outcomes : i ) decreased pain ; ii ) improved pulmonary function ; and iii ) preventing curve progression . although it has been suggested that scoliosis exercises are unable to provide curve correction in adolescent cases , there are studies documenting the ability of scoliosis - specific exercises to alter the course of adolescent idiopathic scoliosis . in a review of manual therapy by romano and negrini , they found 3 studies that fit their criteria , all of which were low quality .
therefore , it is unknown how to best translate their conclusions into clinical practice . since the review by romano and negrini , subsequent randomized controlled trials , case reports and series have been published . a randomized controlled trial ( rct ) by monticone et al . assessed a treatment program consisting of active self - correction and task - oriented exercises . using radiographic cobb angle and the health related quality of life ( hrql ) questionnaire
another rct by kuru et al . showed cobb angle changes in patients receiving clinic - based schroth scoliosis therapy under physical therapist supervision .
a third rct by schreiber et al . showed that patients participating in a scoliosis - specific exercise program in addition to standard of care management achieved statistically significant improvements in back muscle endurance , as well as self - rated pain and self - image scores on the scoliosis research society ( srs-22r ) questionnaire .
these studies followed adolescent patients to skeletal maturity or beyond but in only 3 total patients .
this study presents a larger data sample of patients with adolescent idiopathic scoliosis who were treated , discharged to home care , and followed up with through skeletal maturity .
the results of this study are reported according to criteria previously described in the braist study , as well as guidelines created by the society on spinal orthopedic and rehabilitation treatment ( sosort ) and the scoliosis research society ( srs ) non - operative management committee .
we conducted a power analysis using power and precision 4 software . using a 95% confidence interval , as well as improvement of 6 as the target outcome
, our analysis showed that we needed a sample size of at least 50 patients to make our outcome both clinically and statistically significant .
we consecutively sampled patient charts from two separate chiropractic clinics if they met the following inclusion criteria : i ) patient had a history of adolescent idiopathic scoliosis > 10 ; ii ) initiated treatment at the chiropractic office between risser 0 - 2 ; iii ) were given home exercises to continue on their own ; and iv ) had at least one follow - up visit at end of growth , defined as a risser 3/4 , or at skeletal maturity , defined as risser 5 . adhering to these inclusion criteria ,
patients whose charts were selected gave their written informed consent for their information to the used .
we applied for and received institutional review board ( irb ) exemption for this study through integreview irb .
the treatment approach provided to the sample population takes advantage of central reflexive neuromotor control . in order to recruit these automatic postural control reflexes ,
external postural weighting was employed in various configurations , depending upon each patient s curve pattern .
these external postural weights purposely alter the centers of mass of the head , torso , and pelvis in specific vectors to cause automatic neuromuscular responses to counterbalance the external weight in predictable dimensions .
examples of this postural weighting process have been previously reported in scoliosis treatment all patients in this study were prescribed their own sets of this weighting system for both in - office treatment as well as home use .
patients performed proprioceptive balancing on a 24-inch vestibular disc while using a cantilever exercise apparatus that increases the leverage of these externally placed postural weights without needing to add extra weight . by lengthening the distance of the weight from the patient s torso ,
as patients progressed through care , many increased the difficulty of the exercise by performing this activity while balancing on the vestibular disc on top of a whole body vibration platform set at 30hz .
the goal of this therapy is to repetitively recruit reflexive postural muscle control while the patients perform a conscious activity ( i.e. , balancing on the vestibular disc ) , thus making the postural adaptations to the externally applied weight automatic , reflexive responses instead of voluntary muscle recruitment patterns such as those used in other types of scoliosis - specific exercise protocols .
motorized repetitive traction , supine positional traction , and chiropractic manipulation were administered to patients as well .
supine positional traction and related exercises were performed to promote a normal sagittal contour , providing a biomechanical baseline from which to perform specific core spinal stabilization excercises ( figure 1 ) .
chiropractic manipulation was performed on patients when active range - of - motion restrictions were observed .
patients received an average of 1 - 3 manipulations over the 1 - 2 weeks of therapy .
these therapies were organized and performed for each patient as his or her curve pattern dictated .
they were performed for approximately 25 hours per each week of therapy . upon discharge patients
were given an individualized exercise prescription for home care to continue on an ongoing basis .
typical home exercise recommendations included two daily exercise sessions lasting 25 - 35 minutes each .
once they reached skeletal maturity a final evaluation was performed , and they were then dismissed from active management .
to be consistent with sosort / srs and braist criteria , we calculated the following outcomes : the percentage of patients who progressed beyond 50 , the percentage of patients who corrected 6 or more , the percentage who progressed 6 or more , and the percentage of patients whose curves stabilized at 5 from the baseline measurement . under these criteria ,
successful treatment was observed in 90% of the entire cohort ( defined as the total percent of patients who achieved curve correction or curve stabilization ) ; 51.7% correction and 38.3% stabilization . in those patients who achieved curve correction ,
the average correction was 12.75. the remaining 10% of patients had curve progression of 6 or more .
patient data was broken down by baseline risser stage , with the purpose of evaluating how baseline risser stage affected the outcomes at end of growth .
for the highest risk curves at end of growth , risser 0 - 1 , 45% of them corrected , 38% were maintained , and 17% progressed . of those curves that progressed ,
3 of them progressed to surgical threshold , representing 5% of the risser 0 - 1 groups .
the average baseline cobb angle for this group was 3414 , the average end - of - growth cobb angle was 3117 .
their average starting age was 11 years , 5 months , with an average total treatment time of 2 years , 11 months . in those risser 0 - 1 curves that obtained correction ,
the average correction was 11. baseline curves at risser 2 averaged 3110 , and 2615 at end - of - growth . among baseline risser 2 curves
, 53% achieved an average correction of 13 , while 35% were maintained at 5 , and 12% progressed beyond 5. of those that progressed , 1 curve progressed beyond surgical threshold ( 50 ) , while the other had already reached surgical threshold at baseline .
all patients who were premenarchial at treatment initiation ( a total of 29 ) were either risser 0 or 1 . among these patients ,
41% of them achieved a curve correction ( 13 of 29 ) , 38% of them ( 11 of 29 ) maintained their curvatures , and 21% of them progressed more than 6 ( 6 of 29 ) .
the sosort guidelines also recommend grouping patients based upon their baseline cobb angle , as well as their ending cobb angle .
when examining curves first treated between 10 - 19 , 71% of these patients ( 5 of 7 ) achieved a correction of 6 or more , while the remaining 2 ( 29% ) progressed by more than 5. neither of these cases increased to surgical threshold ( > 50 ) . for patients initiating the described rehabilitation treatment between 20 - 29 , 19 of 33 patients ( 58% ) achieved a correction by the end of growth , while 12 of the 33 ( 36% ) maintained their curvatures to within 5. the remaining 2 of the 33 patients saw their curves progress 6 or more ; but not beyond surgical threshold . in the 30 - 39 starting range
, 37% of patients had corrections in their curves ( 7 of 19 ) , 31.5% of patients had their curves progress more than 6 ( 6 of 19 ) , and 31.5% of patients ( 6 of 19 ) remained 5 at end of growth .
a total of 15 patients began treatment with curves between 40 - 49. of these , 8 patients had curve correction , 6 patients had curve stabilization of 5 , and 1 patient had her curve increase over 6. this patient was subsequently referred for surgical consultation .
finally , 10 patients initially presented with curves above surgical threshold ( > 50 ) .
a total of 4 of these patients had curve corrections , 5 of them maintained their curves , and 1 had a curve progression .
the data were also classified according to each curve pattern : thoracic , lumbar , thoracolumbar , and double major .
for the 16 patients with thoracic curves , 11 were corrected , while 5 were maintained .
none of these patients progressed . in lumbar curves , 1 patient achieved correction , while the remaining 2 patients stabilized their curves . for patients with a double major curve pattern ,
8 out of 24 patients achieved correction , 11 patients were maintained , and 5 patients progressed .
when totaling the number of cases who started below 50 and progressed to beyond 50 , 2 patients saw their curves progress to that point .
the remaining patients with curves beyond 50 at end of treatment had already reached 50 by the time treatment was initiated . of these ,
half of them achieved a curve reduction to below 50 by the end of follow - up .
a total of 5 of these patients were referred for surgical intervention due to lack correction .
there were 3 patients in this cohort that did not follow up through risser 3/4 .
of these , 1 had curve progression , 1 patient achieved correction , and 1 was maintained .
as part of a worst - case analysis scenario , if it is assumed that all 3 patients had failed in their treatment by the time they reached skeletal maturity , our total failure rate would be 13% .
this would include these 3 patients , plus 5 other patients who had at least one curve progress 6 or more at final follow - up .
these 5 patients who progressed that had follow - ups at skeletal maturity were recommended for surgical intervention .
this study is the largest study to evaluate the impact of chiropractic rehabilitation treatment on adolescent idiopathic scoliosis when managed from onset through skeletal maturity . however , there are some important points that need to be discussed . first , the extent of chiropractic manipulation used in these cases was de - emphasized in both clinics . although the decision whether to provide manipulation on a given day was a clinical decision made at the time by the rendering provider , only 40% of all patients received manipulation at any point throughout their one- or two - week therapy .
we feel this is an important distinction to make , as many patients and providers equate chiropractic care with spinal manipulation , and this is not always the case as this study demonstrates . while selection bias is always a concern in retrospective study designs , our goal was to evaluate everyone who had completed this process and fit the criteria
. however , an important additional parameter in future studies will be to provide a quantification on home care compliance , since this may well affect the outcome of exercise - based protocols such as that illustrated in this study .
the sosort and srs criteria indicate that adolescent , skeletally immature , high - risk patients should be braced if their curves exceed 25. in the present study , patients selected for inclusion had either declined the bracing treatment option by another provider , or were given the option for concurrent therapy with the exercises described herein , but decided to forego bracing as a component of treatment .
hence , patients proceeded with rehabilitation , only after informing them of the standard of care and their decision to decline that aspect of treatment .
future studies should look at the combination of the chiropractic rehabilitation described in this study with part- or full - time rigid bracing .
although no control group was used in this study , the criteria laid out by the braist study and the sosort / srs committees clearly define what outcomes are considered important . therefore , using these known and accepted parameters allowed us to determine if these results were clinically meaningful and statistically significant .
it will also allow various types of exercise - based therapies to compare methodologies so that newer exercise theories and treatment approaches can evolve .
this retrospective chart review demonstrated that 90% of patients who participated in a chiropractic rehabilitation treatment for adolescent idiopathic scoliosis , and were followed through at least the end of growth , achieved a curve correction or stabilization .
for those patients achieving correction , their average correction was 12.75. all but 2 patients who were followed all the way through skeletal maturity whose curves started below 50 were able to keep their curves below 50. worst - case analysis showed a failure rate of 13% . | the aim of this study was to evaluate the radiographic outcomes obtained in a sample of patients treated with a chiropractic scoliosis - specific exercise program for patients with adolescent idiopathic scoliosis .
patients were treated and subsequently followed through skeletal maturity , and their results were reported in accordance with the sosort consensus guidelines .
a total of 60 patient charts were consecutively selected when they met inclusion criteria .
cobb angle measurements and risser staging were collected on all images .
using sosort criteria , 51.7% of patients achieved curve correction and 38.3% achieved stabilization . in the curve correction group ,
average total correction was 12.75. a small number of sampled patients curves progressed , with a 13% failure rate based upon patients who dropped out before skeletal maturity combined with those who had progressed at skeletal maturity .
future studies are needed to corroborate these observations . |
cytochrome p450 ( cyp )
constitutes a large family of heme - containing
enzymes that are present in a wide variety of organisms and are involved
in the metabolism of both xenobiotics ( e.g. , drugs ) and endogenous
compounds such as steroidal hormones .
they function
by oxidizing a broad spectrum of both water - soluble and lipophilic
molecules .
one of the key aspects of their function is the mechanism
and pathway by which various molecular species gain access to the
active site of the enzyme , a process that is particularly important
for membrane - associated cyps .
the crystal structures of a large number
of cyps , in both apo and substrate - bound forms , have been solved ;
however , they provide limited information on these pathways . in particular , substrate access through the membrane ,
which is suggested to be the main mechanism for lipophilic and amphiphilic
substrates to gain access to the active site of cyps , is largely unknown , as a complete description of the involved pathways
relies on the characterization of the enzyme structure , and more importantly
its dynamics , in its membrane - associated form .
human cyps are
anchored in the cellular membrane by an n - terminal
transmembrane helix .
however , a large body
of evidence strongly suggests that the globular , enzymatic part of
the protein directly interacts with the surface of the membrane .
naturally , such direct interactions are key to the orientation and
partitioning of the enzyme on the surface of the membrane , which are
the main determinants of substrate s efficient access to the
enzyme from the membrane . in humans ,
it is present in the liver and in the small intestine , and it is responsible for the metabolism of more than 50%
of clinically used drugs that are metabolized in the body , indicating a high ligand promiscuity when compared to other human
cyp enzymes . due to its broad involvement in drug metabolism , cyp3a4
plays a key role in determining the bioavailability and , thereby ,
the effective plasma concentration of a wide range of pharmacological
compounds in the body .
similarly , cyp3a4 is a key element in side
effects of drugs in which the metabolites are the main source of toxicity ,
as well as in drug drug interactions due to its promiscuous
substrate specificity and malleable active site . to date , over 1000 compounds , including inhibitors and inducers
of cyp3a4 , have been identified that interact with and affect the
activity of cyp3a4 .
accumulating
evidence has strongly indicated that the interaction
of cyps with the cellular membrane contributes to the recruitment
of liposoluble substrates to the active site of the enzyme .
therefore , in order to understand its effects in the body , it is
crucial to understand the interaction of cyp3a4 with the membrane
at an atomic resolution . to date , several x - ray structures of cyp3a4
with a truncated n - terminal transmembrane helix have been solved ,
both in the ligand - free form and bound to a variety of ligands .
these structures have not only established that cyp3a4 presents
an overall fold similar to other cyps ( figure 1 ) but also revealed functionally relevant aspects , such as the ability
of cyp3a4 to bind to a broad range of molecules of different sizes and a malleable active site that might even allow binding of two
ligands simultaneously , a feature that
had been suggested on the basis of the atypical kinetic behavior exhibited
by the enzyme .
structure of cyp3a4 : two views , rotated by 90 , showing
the
side ( left ) and bottom ( right ) views of the globular domain .
a schematic
of the location of the tm helix with respect to the globular domain
is included in the side view .
the structure presents a fold similar
to other p450 enzymes , consisting of an n - terminal -sheet domain
and a helical c - terminal domain , containing the cofactor heme ( red
stick representation ) and the active site .
the nomenclature used for
the secondary structure elements was adopted from ref ( 54 ) .
the side chains forming
a - anchor are shown in orange stick representation in both views and
boxed in the side view .
also depicted in the figure is a schematic
representation of the hmmm membrane , highlighting the location of
the organic phase and the short - tailed lipids .
structural dynamics of human cyps have been studied with
molecular
dynamics ( md ) simulations .
several previous md studies of cyp3a4 aimed
at studying the interaction of the enzyme with some of its ligands ,
focusing on the gating mechanisms involved in the access / egress of
the ligands from the active site and on the
underlying mechanism of positive homotropic cooperativity observed
upon binding of two ligands .
other simulation
studies investigated the dynamics of water molecules in different
human cyps , including cyp3a4 . despite
providing insightful information about the dynamics of cyp3a4
, these
studies were performed mostly without taking into account the interaction
of the enzyme with a membrane , which could affect both structural
and dynamical properties of cyp3a4 . in a recent simulation study of
membrane - bound cyp3a4 by denisov et al .
, it was shown that interaction with the membrane affects the opening / closing
of the access tunnels observed in the crystal structures . moreover ,
md studies with human cyp2c9 in the presence of the membrane have
shown that interaction of the enzyme with the membrane favors the
opening of additional access tunnels not identified in the crystal
structures .
an experimentally observable
yet unexplored aspect of cyp3a4 is
the orientation of the enzyme in its membrane - bound form .
the angle
between the heme plane and the membrane plane , termed the heme tilt
angle , has been estimated experimentally to be between 38 and
78 for several other cyps isoforms but not for cyp3a4 . for cyp2c9 , md studies have suggested that the
enzyme might even adopt two different orientations upon membrane binding ,
corresponding to two different conformations of the f - g loop of this
isoform .
the orientation that the enzyme
takes after binding to the membrane might have implications not only
in efficient substrate recruitment but also in the rate of electron
transfer from the cyp reductase necessary for the oxidation reaction . in order to study the binding and interaction of cyp3a4 with
the
membrane ,
we have performed md simulations employing a novel membrane
representation , termed highly mobile membrane mimetic ( hmmm ) , which
was recently developed in our lab .
this
membrane model employs a biphasic solvent system together with short - tailed lipids located at the organic / water
interface .
due to the reduced entanglement of the shortened lipid
tails and the fluid nature of the hydrophobic core , the hmmm membrane
allows for an increase of 12 orders of magnitude in the lateral
diffusion of the lipids , thereby accelerating the association of proteins
with the bilayer without the need for external biases or forces , while
preserving the atomistic details of the interactions between the protein
and lipid headgroups . in multiple independent
simulations , spontaneous binding and insertion of the globular domain
of cyp3a4
was captured , resulting in a convergent model for the membrane - bound
form of cyp3a4 , whose insertion depth and orientation on the membrane
are preserved after transformation of the hmmm model to a full lipid
bilayer .
complementary to the simulations , a series of planar waveguide
linear dichroism measurements were performed to characterize the heme
tilt angle of cyp3a4 bound to a nanodisc , a membrane system that is
water - soluble and preserves the structure and activity of membrane
proteins .
the measurements were performed
by first determining the dichroic ratio of a monolayer of nanodisc - incorporated
cyp3a4 protein , and then calculating the orientation of the cyp3a4
within the lipid bilayer .
together , the structural models resulting
from the simulations and experimental measurements allow for a detailed
description of the enzyme in its membrane - bound form .
furthermore ,
the simulations also reveal some of the membrane - induced conformational
changes in cyp3a4 that might affect the accessibility of the active
site to substrates approaching from the membrane .
details of the simulations and
experiments are presented in the
following two sections . a more detailed description of derivation
of the dichroic ratio is included in supporting
information .
the hmmm membrane patch
was constructed by placing two leaflets of short - tailed lipids at
the interface of water and 1,1-dichloroethane ( dcle ) , as described
in detail elsewhere . the phosphatidylcholine
( pc ) headgroup was selected for this study because of its relevance
to membrane composition of eukaryotic cells .
the lipids used in the
membrane patch were constructed starting from palmitoyloleoylphosphatidylcholine
( popc ) molecule as a template and shortening its lipid tails to only
five carbons .
the hmmm membrane was then
assembled by use of packmol software by
constructing a dcle box , with dimensions of 100 100
10 and containing 5840 molecules of the organic
solvent , and placing 300 short - tailed pc lipids on its large faces ,
with 150 lipids in each leaflet .
the resulting structure was then
solvated with water by use of the solvate plugin of vmd , yielding a system of 66 000 atoms .
the solvated membrane mimetic system was energy - minimized for 10 000
steps and simulated for 2 ns , by use of an npnat ensemble with constant area , and with a target normal pressure
and temperature of 1.0 atm and 310 k , respectively .
a constant area
of 11 236 ( 106 106 ) was employed , yielding an area of 75 / lipid ( al ) , which is 8% higher
than the experimental al for popc .
this was done to account for the area of the
membrane that would be occupied by the protein upon its insertion .
on the basis of our experience with several other peripheral proteins ,
a mild increase ( 58% ) in the area can significantly accelerate
the process .
the resulting membrane was employed in all subsequent
simulations of membrane binding and dynamics of cyp3a4 .
the ligand - free
crystal structure of cyp3a4 was obtained
from the rcsb protein data bank ( pdb
entry 1tqn ) .
the missing residues lys-282 , glu-283 , thr-284 , and glu-285 were added
by use of the program modeller 9v10 .
for the first part of
this study the n - terminal transmembrane ( tm ) helix ( 27 residues ) ,
which is also missing from the crystal structures , was not modeled ,
as the main aim was to independently characterize membrane binding
and insertion of the globular domain of the enzyme . in the second
part of the study , two models including the tm helix were constructed
by adding the tm helix to one of the membrane - bound cyp3a4 structures
obtained from the simulations in the first part of the study .
one
model included all n - terminal 27 residues of cyp3a4 ( full - length cyp3a4 ) ,
while the other model included a truncated tm helix , which does not
include the first 12 residues and has a s18f point mutation .
these
systems are referred to as wt - tm and truncated - tm simulation systems ,
respectively .
the truncated - tm model was designed and simulated to
match the sequence of cyp3a4 employed during the experimental measurements
reported in this study .
the additional tm residues were added to the
membrane - bound cyp3a4 by use of modeller 9v10 . in the first set of simulations , hereby referred
to as membrane binding
simulations , the globular domain
of cyp3a4 ( i.e. , without the tm helix ) was placed in five different
initial orientations and between 7 and 13 above the surface
of the membrane .
the initial orientations were obtained by first aligning
the three principal axes of the protein to the xyz axes , respectively , and then rotating the principal axis aligned
to z in different planes , thus resulting in five
different initial heme tilt angles .
an additional layer of water was
then added to the resulting structure by use of the solvate plugin ,
and a concentration of 100 mm na and cl ions was generated in the systems by use of the autoionize plugin
of vmd .
the resulting initial systems
then consisted of a box with dimensions 100 100 130
and containing 140 000 atoms . in
addition and as a control , cyp3a4 was also simulated in an aqueous
solution , that is , in the absence of a membrane . for the solution
simulation , cyp3a4 was solvated with water by use of the solvate plugin
of vmd with a minimum padding of 10 in all directions , resulting
in a box with dimensions of 89 95 107 including 62 000 atoms .
all systems were energy - minimized
for 10 000 steps and relaxed further for 100 ps with the c
atoms of the protein restrained ( k = 5 kcalmol ) , except for the
residues that were modeled and added to the crystal structure .
then
systems mem-1 through mem-5 and the solvated cyp3a4 were simulated
each for 50 ns , while systems wt - tm and truncated - tm were simulated
each for 40 ns . for the hmmm simulations , a harmonic constraint on
the z - position , with a force constant k = 0.05 kcalmol
, was applied to the carbonyl atoms of the pc lipids , in order to
restrain the position of the short - tailed lipids to mimic the atomic
distributions of a full lipid bilayer more closely and to prevent
their occasional diffusion into the aqueous solution , which is expected
for short - tailed lipids ( surfactants ) .
in addition to the hmmm
simulation systems , and in order to further
examine the stability and dynamics of the resulting membrane - bound
cyp3a4 from these simulations , a simulation employing a full popc
lipid bilayer was also performed .
a membrane - bound model of the globular
domain of cyp3a4 was adopted from one of the last frames of one of
the hmmm simulations described above .
the lipid bilayer was then grown
( transformed ) into a full lipid bilayer by removing the dcle molecules
and adding the missing carbons of the lipid tails while preserving
the positions of the lipid atoms already present in the hmmm model
( headgroups and initial few carbons of the lipid tails ) . in order
to further optimize the process , the positions of the newly added
atoms in the lipid tails were based on the coordinates of randomly
selected lipid molecules from a separately equilibrated popc membrane .
during these steps , the original contacts established between the
lipids and cyp3a4 during the hmmm membrane - binding simulations were
preserved .
this system , which is referred to as the popc system , was
then minimized and equilibrated for 100 ps while constraining the
heavy atoms of the protein , the short - tailed lipids ( already present
before adding the new atoms ) to allow for the newly added atoms to
relax . following this step ,
all the simulations
were performed with namd2 utilizing the
charmm27 force field with cmap corrections
for the protein and charmm36 for lipids .
all
simulations , except system popc , were performed as an npnat ensemble at 1.0 atm and 310 k and with a time
step of 2 fs .
a
constant area of 11 236 ( 106 106
) was employed for npnat .
hoover
langevin piston method , and constant temperature
was maintained by langevin dynamics with a damping coefficient
of 0.5 ps applied to all atoms .
nonbonded interactions
were cut off after 12 with a smoothing function applied after
10 . the particle
mesh ewald ( pme ) method was used for long - range electrostatic calculations with
a grid density greater than 1 .
access tunnels to the
active site were characterized by use of molaxis , which identifies tunnels and cavities in macromolecules
via computational geometry techniques .
snapshots of the protein were
obtained every 100 ps from the last 40 ns of the trajectories , which
in all the membrane binding simulations corresponded to the period
after cyp3a4 has completed its binding and insertion into the membrane .
the access tunnels to the active site were calculated for each snapshot .
in order to cluster the tunnels calculated for each different snapshots ,
an average structure over the last 40 ns of the trajectory of the
bound cyp3a4 for each simulated system was obtained and the access
tunnels of these average structures were used as references for their
respective system .
then , for each system , the spatial overlap between
each reference tunnel and each tunnel from the trajectory snapshots
was calculated .
tunnels from different snapshots were assumed to be
the same when they had a spatial overlap of at least 70% with the
same reference tunnel .
the bottleneck radius and the bottleneck residues
for each identified access tunnel were obtained from the molaxis calculations .
all tunnels with a bottleneck radius 1.2
cyp3a4 was expressed with a
histidine affinity tag from the nf-14 construct in the pcwori+ vector ,
purified , and incorporated into popc nanodisc lipid bilayers as previously
described .
the nanodiscs were stored
in a buffer ( 50 mm tris - hcl , ph 7.4 ,
and 0.3 m nacl ) before use . a commercially available 405 nm
the laser spot was reduced by
use of an iris , and any stray polarization was excluded by use of
a glan - taylor polarizer ( melles griot ) .
the laser assembly was mounted
on a rotational stage to precisely modulate the polarization of light .
the laser was shone on the glass slide assembly , which used two bk7
prisms ( edmund optics ) to couple the light in and out of the internal
reflection element ( ire ) .
the ire substrates used were superclean
2 microarray substrates ( arrayit corp . ) with dimensions of 25
76 0.940 mm .
the out - coupled light went through a band - pass
filter and onto a light diffuser before being detected by a phototube
( oriel instruments ) .
the output of the phototube was amplified by
a low - noise current amplifier ( stanford research systems ) before being
measured by a digital multimeter ( hewlett - packard ) .
the background
signal was measured by placing several drops of the buffer on a glass
substrate slide and measuring the signal . in order to facilitate adsorption
onto the glass slide
subsequently ,
cyp3a4 nanodiscs were added to the buffer on the substrate so that
total concentration of cyp3a4 was 100 nm and total concentration
of mgcl2 was 10 mm .
adsorbed nanodiscs formed a thin monolayer
film at the interface between the glass slide and the bulk solution .
after 30 min ( required for adsorption ) , the slide was flushed with
3 volumes of buffer to wash away nonadsorbed analytes .
the final signal
was compared to the background signal to calculate the thin film absorbance .
light inside an ire is totally reflected internally and has no
transmitted element . from the electric field amplitudes of the evanescent
wave along the laboratory axes
, it is possible to calculate the absorbance
of a chromophore that is adsorbed to the surface of the ire .
since a heme ring can be modeled as a circular
oscillator and the transition moments
are degenerate , the absorbance can be broken down into the three components
along the laboratory axes and simplified to the following three equations:123where
is the absorption transition
moment ; ex , ey , and ez are the components of the electric field ; and ,
the orientation angle , is the angle between the transition moment
and the laboratory z - axis .
the subscripts te and
tm refer to transverse electric polarized and transverse magnetic
polarized light , respectively .
te polarized light is oriented in the y direction , and only absorbers with a transition moment
component in the y direction will absorb it , whereas
tm polarized light is oriented in the x and z directions , thus only absorbers with transition moment
components lying in the x or z direction
will be able to absorb this light .
the ratio of the absorbance of
te to tm polarized light , the dichroic ratio , can be used to determine
the orientation of the absorber .
the
following equation relates the dichroic ratio to the orientation angle ,
using eqs 1 , 2 , and 3:4where
is the dichroic ratio and
is the angle between the transition moment vector and the laboratory z - axis . since cyp3a4 is a heme protein , it is possible to
use the heme as the absorber and monitor the orientation of the protein
in the lipid bilayer .
the heme moiety has a strong absorption at the
soret band , with cyp3a4 having a molar absorptivity on the order of
106 mcm .
in order to study the binding of cyp3a4
to the membrane , five different
orientations of the globular domain of the enzyme ( not including the
tm helix ) initially placed above the pc lipid bilayer were simulated ,
each for 50 ns ( mem-1 to mem-5 ) .
spontaneous binding of cyp3a4 with
the hmmm membrane was consistently observed in all the simulations .
membrane binding did not require the use of external forces or biasing
potentials , thus resulting in an unbiased positioning of the enzyme
at the lipid water interface within the first 10 ns of simulation .
for the five different starting positions tested , cyp3a4 first encounters
the membrane through its hydrophobic helices f and g ( figure 1 ) and
with a hydrophobic
anchor composed of residues leu-44 , pro-45 , phe-46 , and leu-47 .
this
hydrophobic anchor , which is located between helices a and
a and that we term a - anchor hereafter , is one of the features that
distinguishes cyp3a4 from other cyp isoforms .
a - anchor has been hypothesized
to mediate the interaction with the membrane , together with the hydrophobic helices f and g , on the basis of its location in the globular domain of the enzyme .
after the first encounter with the membrane , the enzyme is rapidly
inserted into the membrane and remains bound to it for the remainder
of the simulation , as exemplified in figure 2 for simulation mem-1 . in less than 10 ns , a - anchor establishes contacts
with the lipid headgroups , as characterized by monitoring the position
of the anchor with respect to po4 and choline groups ( figure 2 ) . in systems mem-2 and mem-5 , a - anchor remains
buried below the po4 level for the remainder of the simulation ,
while in systems mem-1 , mem-3 , and mem-4 , the anchor fluctuates within
the region between the po4 and the choline groups .
interestingly ,
and functionally highly relevant ,
a - anchor inserts deeper into the membrane than helices f and
g. helices f and g are stabilized at a level
close to the lipid headgroups after 10 ns ( figure 2 ) but do not completely insert into the membrane , with helix
g establishing a closer contact to the membrane than helix
f. for the five independent membrane binding simulations ,
the depth of insertion of a - anchor and of helices f and g
converges to the same range of values , with the residues located in
these three elements forming the majority of the hydrophobic contacts
between cyp3a4 and the membrane after insertion ( figure s1 , supporting information ) .
( top ) snapshots
taken at different time points from the simulation system mem-1 .
( bottom
right ) close - up view of the membrane - bound form of cyp3a4 , highlighting
residues inserting directly into and interacting with the membrane .
the hydrophobic side chains of a - anchor , formed by residues leu-44 ,
pro-45 , phe-46 , and leu-47 , and of helix g are shown in stick
representation in orange and magenta , respectively .
( bottom left )
time evolution of average height of the center of mass of a - anchor
and helices f and g in different simulations .
the average positions
of the phosphorus ( po4 ) group and the nitrogen ( choline )
atoms of the lipid headgroups are shown as gray and brown dotted lines ,
respectively .
experimentally ,
it is difficult to measure characteristic parameters of membrane - bound
proteins , such as depth of insertion or orientation . in the case of
cyps , although measuring the insertion depth remains a difficult task ,
it is possible to measure their orientation by taking advantage of
the optical properties of the heme moiety buried in the active site .
the orientation of some cyp isoforms associated with proteoliposomes
or microsomes has been measured experimentally ;
however , such experiments have not been reported for cyp3a4 .
a series
of linear dichroism measurements were performed in this study to calculate
the orientation of cyp3a4 in popc nanodiscs .
the nanodisc approach
has been employed to study the metabolic mechanisms of cyp3a4 in a
phospholipid bilayer .
the orientation
of the nanodisc - bound cyp3a4 was calculated by measuring the angle
between the heme moiety and the z - axis from the dichroic
ratio measured from the sample ( see materials and
methods ) .
the
heme tilt angle of cyp3a4
in the nanodisc exhibits values between 52.0 and 67.3 ,
with an average of 59.7. these measurements suggest that the
cyp3a4 bound to the popc nanodiscs adopts a specific orientation ,
rather than a nonspecific adsorption to the membrane surface . from the simulations , the positioning of the globular
domain of
cyp3a4 after binding to the membrane was studied more thoroughly by
defining a set of angles that characterize the orientation of its
membrane - bound form .
the orientation of cyp3a4 after association with
the membrane was characterized by measuring the heme tilt angle with
respect to the membrane normal ( z - axis ) .
the time
evolution of the heme tilt angle for the five simulated membrane systems
( mem-1 to mem-5 ) is presented in figure 3 .
the tilt angle converges to a value around 70 in about 10 ns ,
corresponding to the time of binding of cyp3a4 to the membrane . for
the remainder of the simulations
, the tilt angle fluctuates between
70 and 80. in table 2 , the initial
and average values of the tilt angle for each simulated system are
shown , with the average obtained over the last 40 ns of the simulation ,
that is , the portion corresponding to the membrane - bound form of the
enzyme .
the average heme tilt angle is calculated to be between 68.7
and 75.9 for individual simulations , with an overall average
of 72.2 over the five simulations .
the calculated average angles
strongly support the convergence of the simulations ; despite using
very different initial orientations in solution , the final tilt angles
in all the simulations are very similar and deviate by only a few
degrees .
this suggests that , as observed in the experiments , cyp3a4
adopts a specific orientation upon binding to the membrane , with the
heme moiety oriented at approximately 70 with respect to the
membrane normal .
orientation of cyp3a4 upon binding to the membrane : time
series
of the heme tilt angle for the five membrane simulations ( mem-1 to
mem-5 ) .
the heme plane was defined by fitting the position of the
four porphyrin nitrogen atoms to a plane .
the angle is defined
as the angle between the membrane normal ( z - axis )
and the heme plane .
averages were
calculated from
the last 40 ns of each simulation corresponding to the membrane - bound
form of cyp3a4 .
standard deviations are given in parentheses . in order to examine the structure
and dynamics of the membrane - bound
model for cyp3a4 that was developed with the hmmm membrane model
,
we put the model to a test simulation performed in a full membrane .
while we might not expect to capture the complete insertion process
using such a full representation for the membrane within our limited
simulation time scales ( the main reason for using the hmmm model ) ,
we have adopted the membrane - bound configuration from an hmmm simulation
and performed additional equilibrium simulations ( 40 ns ) after transforming
the lipids to full popc lipid molecules ( see materials
and methods ) .
as depicted in figure 4 , the membrane - bound configuration is highly preserved ; both the
depth of membrane insertion and the orientation show similar average
values and range of fluctuation to those obtained from membrane binding
simulations .
( top ) time evolution of the heme tilt angle and ( bottom ) average height
of the center of mass of a - anchor and helices f and g
are shown for cyp3a4 bound to a full popc membrane .
average positions
of the phosphorus ( po4 ) group and the nitrogen ( choline )
atoms of the lipid headgroups are shown as gray and brown dotted lines ,
respectively . in order to characterize
the orientation of cyp3a4 on the membrane ,
in addition to the heme tilt angle described above , two additional
orthogonal vectors were defined , similar to the approach employed
in other studies of cyps in membranes .
the time evolution and average values of the angles between these
two vectors and the membrane normal ( table s1 and figure s2 , supporting information ) further confirm the specific
orientation of cyp3a4 upon binding to the membrane , which in turn
determines the accessibility of the active site .
since the experiments
presented in this work were carried out with
a sequence of cyp3a4 that includes a truncated tm helix , two additional
simulations including a tm helix were performed , with the models prepared
as described under materials and methods .
the average heme tilt angle of these membrane simulations ( figure 5 ) , 72.6 for wt - tm and 73.4 for truncated - tm ,
suggests that the orientation angle of cyp3a4 is not significantly
affected by the presence of the tm anchor .
whether or not the helix
is there , the tilt angle would not drastically change .
the observation
that the heme tilt angle is largely independent of the presence of
the tm helix suggests that the globular domain , not the tm anchor ,
is the main determinant of the orientation of the membrane - bound enzyme .
( top ) initial configuration of the two simulated systems including
a transmembrane helix .
( bottom ) time evolution of the heme tilt angle
for the simulations including the transmembrane helix .
the average
heme tilt angle for the wt - tm system is 72.6 5.1
and for truncated - tm is 73.4 4.2. despite
the large number of crystallographic structures available for cyp3a4 ,
no structural information for its membrane - bound state at an atomic
level is available .
this is particularly critical since the structure
of cyp3a4 might be affected by the membrane , and the potential membrane - induced
conformational changes could have a direct impact on the access of
substrates , especially large molecules , to the active site , an aspect
that is unclear from the crystal structures .
binding of cyp3a4 to
the membrane does not induce any global conformational changes in
the enzyme within the simulated time , as measured by the backbone
root - mean - square deviation ( rmsd ) with respect to the x - ray structure ,
which shows values < 2.5 ( figure s3 , supporting information ) .
the rmsd of the membrane - bound cyp3a4
does not deviate significantly from that of the aqueous simulation
of cyp3a4 either , suggesting that the overall fold of the enzyme is
likely preserved upon binding to the membrane , in agreement with the
reported behavior of the cyp2c9 isoform when bound to a conventional
membrane in a previous md study .
however , significant
local conformational changes at the membrane interface accompany the
process of membrane binding of the enzyme . these conformational changes ,
which are mostly localized to the membrane protein interface ,
likely arise due to close interaction of specific residues and/or
regions of cyp3a4 with lipid molecules in the membrane , in particular
helices f and g and a - anchor ( figure s1 , supporting information ) . such specific lipid protein
interactions might disrupt interactions with residues located in other
regions of the enzyme , for example , interactions with residues of
the bc loop , which is in close proximity to helix g , or interactions
between the 1 sheet and helix f. while the globally
low rmsd appears to suggest that cyp3a4 remains in a nearly closed
conformation in its membrane - bound form , side - chain fluctuations due
to interaction with the lipids directly affect the opening and closing
of access tunnels leading to the active site of the enzyme . for other
human cyp isoforms , it has been suggested that access of lipophilic
substrates to the active site is primarily through the membrane , while
egress of products occurs through solvent - accessible tunnels . in our simulations ,
the interaction
of cyp3a4 with the membrane induces local changes that promote the
opening of access tunnels leading to the active site of the enzyme
( figure 6 ) .
these tunnels correspond to the
2a , 2b , 2e , 3 , and solvent ( s ) tunnels , named after their lining secondary
structures according to the nomenclature established in ref ( 2 ) .
the tunnels were observed
to start to open to different degrees during the membrane binding
simulations .
interestingly , tunnels 2a and 3 are delimited by regions
of cyp3a4 that are in close contact with the membrane ( table s2 , supporting information ) ; for example , tunnel
2a is located between 1 sheet and the f
f loop ,
close to a - anchor , and tunnel 3 is located within the f - g loop , surrounded
by helices f and g. membrane - induced rearrangement of the
access tunnels .
two views ,
rotated by 120 , are presented , showing the side ( left ) and bottom
( right ) of the protein and the location of the access tunnels leading
to the active site .
( middle ) percentage of frames from the membrane
binding ( mem-1 to mem-5 ) and solution trajectories in which the access
tunnels to the active site were opening .
( bottom ) time evolution of
the smallest ( bottleneck ) radius along each access tunnel during the
simulations .
a tunnel is considered to be opening when its bottleneck
radius is 1.2 .
the identified access tunnels open to varying degrees in
each simulation
( figure 6 ) .
the data were collected from the
last 40 ns of each simulation ( i.e. , for membrane - bound cyp3a4 ) .
tunnels
2b and 2e are predominantly more open than other tunnels during the
simulations .
furthermore , the solution simulation of cyp3a4 reveals
that these tunnels are open to a lesser extent in the absence of the
membrane .
the interaction of cyp3a4 with the membrane not only promotes
the opening of those tunnels already identified from the crystal structures but also induces the opening of additional tunnels .
it should be
noted that these opening events are not observed in the solution simulation
of the enzyme .
we also note that although these openings are significant ,
we do not believe that we have been able to capture the complete process
and the ultimate open
configuration of the tunnels ,
since they are still too small for accommodating such large substrates
as those metabolized by cyp3a4 .
although the hmmm model allows for
increased lateral diffusion of the lipids in our simulations , the
internal degrees of freedom of the protein governing the opening of
the access tunnels still follow the unaccelerated and therefore slow
protein dynamics .
therefore , it is highly likely that we have not
been able to capture the full opening of the access tunnels and the
formation of their fully open states .
the opening of the tunnels
facing the membrane is of particular
importance in the recruitment of lipophilic substrates directly from
the membrane into the active site . in our simulations ,
access tunnels 2a , 3 , and s are
observed to open to varying degrees and are found to be facing the
lipid layer in the membrane - bound form of cyp3a4 .
the lipophilic substrate
transport hypothesis is particularly relevant for tunnel 3 , since
it is formed only after membrane binding of the enzyme , with opening
observed in at least 20% of the snapshots in systems mem-2 and mem-3 .
in the membrane binding simulations , tunnels 2b and 2e open after
binding to the membrane , and they remain open for most of the simulation
time ( figure 6 ) , whereas in the aqueous simulation
these tunnels start to open only sporadically .
access tunnel 3 opens
after binding to the membrane in systems mem-2 and mem-3 , where the
opening occurs approximately at t = 25 and 40 ns ,
respectively ( figure 6 ) .
the opening of tunnel 3 is related to the motion of the side chain
of phe-219 located in helix f , favoring the opening of this
tunnel when pointing toward the membrane .
the entrance of this tunnel
is defined by residues phe-213 and phe-220 , which together with phe-108 ,
phe-219 , phe-241 , and phe-304 form a phe cluster in the absence of
the membrane ( figure 7 ) , a distinctive region
of cyp3a4 that has been suggested to serve as a substrate recognition
mechanism and that has been observed to serve as a
peripheral binding site for progesterone , through residues phe-219
and phe-220 .
access tunnel s is observed
to open to various degrees after membrane binding , except for system
mem-5 ( figure 6 ) .
the opening of this tunnel
seems to be coupled to the motion of arg-212 , a residue that has been
recently reported to assist the binding of ligands to the active site .
it has been suggested that tunnel s might function as a ligand egress
path in other cyps as well as in cyp3a4 in water .
available crystal structures indicate that in
order to accommodate large compounds in the active site of cyp3a4 ,
such as ritonavir , two ketoconazole molecules ,
or erythromycin , rearrangement of the
f - g region , in particular between helices f and f , is necessary ,
suggesting that this is a very flexible region ( figure s4 , supporting information ) .
although we do not observe
a dramatic backbone motion in this region in our simulations ( figure
s5 , supporting information ) , the side - chain
motion of the residues located in this region , including the phe cluster ,
is promoted in the presence of the membrane .
membrane - induced rearrangement
of the phe cluster of cyp3a4 : side
view of the phe cluster of cyp3a4 in the crystal structure ( left )
and in the membrane - bound form ( system mem-2 ) ( right ) .
the side chains of phe-108 , phe-213 , and phe-220 , involved in tunnel
gating , are shown in red stick representation .
the side chain of phe-219
is shown in gray stick representation . during the process of membrane
binding ,
the side chain of phe-219 is observed to change its orientation
toward the membrane , and the phe cluster starts to break .
the radius of the observed access tunnels is small
for the average
size of the substrates of the enzyme , indicating that further changes
are needed in order for the substrates to be able to gain access to
the active site .
the interaction with the membrane might represent
only the first step in formation of substrate access pathways to the
active site .
although the binding of small ligands to the active site
does not require major conformational changes over the enzyme , it has been observed that the binding of larger compounds accompanies
a significant effect in the conformation of the f - g region of cyp3a4 , including helices f and
g that are in direct contact with the membrane in membrane - bound
cyp3a4 .
these conformational changes induced by the ligand , together
with the interaction between the enzyme and the lipids observed in
our simulations , suggest that the size of the tunnels leading to the
active site could further increase to allow a lipophilic substrate
into the active site .
cyp3a4 , a membrane - associated
isoform of the cytochrome p450 family ,
is the most common metabolizing enzyme in the human body for biotransformation
of a large number of pharmaceutical compounds and toxic xenobiotics
and a major site for biosynthesis of various endogenous compounds .
given the fact that a large fraction of compounds metabolized by the
enzyme primarily partition in the membrane , characterizing the membrane - bound
form of the enzyme is key to our understanding of its mechanism and
spectrum , yet this has proven an extremely challenging task given
the difficulties associated with high - resolution structural determination
of the membrane - associated state of peripheral membrane proteins .
in the present study , employing a concerted experimental and simulation
approach , we have developed a structural model for the membrane - bound
state of cyp3a4 .
spontaneous membrane binding and insertion of the
globular domain of cyp3a4 , independent of the transmembrane helix
of the protein , have been successfully captured in multiple independent ,
unbiased simulations by taking advantage of a novel membrane representation
( hmmm ) with enhanced lipid diffusion that allows for more efficient
description and sampling of membrane - associated phenomena without
compromising atomic details .
the simulations resulted in a convergent
model for the membrane - bound
state of cyp3a4 , characterized by the depth of insertion and orientation
of the globular domain on the surface of the membrane .
these results
indicate that cyp3a4 does not interact with the membrane merely through
nonspecific contacts and adsorption to the surface but rather through
specific lipid
protein interactions that closely control the
pose of the protein on the surface of the membrane .
the protein is
anchored into the membrane primarily through a hydrophobic anchor
located between helices a and a , which inserts deeply into
the membrane , and helix g , which partitions mainly within
the headgroup region . in parallel to the simulations , experimental
linear dichroism measurements of cyp3a4 bound to popc nanodiscs have
been used to determine the orientation of the globular domain of cyp3a4
with regard to the membrane . these measurements also demonstrate a
specific orientation of the globular domain of the enzyme in its membrane - bound
form , as opposed to nonspecific adhesion to the lipid bilayer .
remarkably ,
the heme tilt angles obtained from the simulations and the experiments
are in close agreement , which further verifies the validity of the
structural model resulting from the simulations .
moreover , the resulting
model was further tested by use of simulations performed in a full
membrane environment , during which the insertion depth and orientation
of the protein on the membrane were largely preserved .
we show
that membrane binding of cyp3a4 has significant structural
and dynamical impacts on its globular domain at the membrane interface .
the presence of the membrane induces local side - chain fluctuations
that initiates the opening of access tunnels to the active site that
are not observed in the crystal structures or in solution simulations ,
suggesting that binding to the membrane might play a role in efficient
recruitment of lipophilic ligands from the membrane to the active
site .
in particular , rearrangement of a phe cluster induced by the
membrane is found to be among the structural changes that are directly
coupled to modulation of the access tunnels leading to the active
site .
these attributes are of direct relevance to the mechanism and
pathway for recruitment and binding of amphiphilic substrates , including
both endogenous and drug molecules , directly from the membrane into
the active site of the enzyme . | cytochrome p450 3a4 ( cyp3a4 ) is the
most abundant membrane - associated
isoform of the p450 family in humans and is responsible for biotransformation
of more than 50% of drugs metabolized in the body . despite the large
number of crystallographic structures available for cyp3a4 , no structural
information for its membrane - bound state at an atomic level is available .
in order to characterize binding , depth of insertion , membrane orientation ,
and lipid interactions of cyp3a4 ,
we have employed a combined experimental
and simulation approach in this study .
taking advantage of a novel
membrane representation , highly mobile membrane mimetic ( hmmm ) , with
enhanced lipid mobility and dynamics , we have been able to capture
spontaneous binding and insertion of the globular domain of the enzyme
into the membrane in multiple independent , unbiased simulations . despite
different initial orientations and positions of the protein in solution
,
all the simulations converged into the same membrane - bound configuration
with regard to both the depth of membrane insertion and the orientation
of the enzyme on the surface of the membrane . in tandem , linear dichroism
measurements performed on cyp3a4 bound to nanodisc membranes were
used to characterize the orientation of the enzyme in its membrane - bound
form experimentally .
the heme tilt angles measured experimentally
are in close agreement with those calculated for the membrane - bound
structures resulted from the simulations , thereby verifying the validity
of the developed model .
membrane binding of the globular domain in
cyp3a4 , which appears to be independent of the presence of the transmembrane
helix of the full - length enzyme , significantly reshapes the protein
at the membrane interface , causing conformational changes relevant
to access tunnels leading to the active site of the enzyme . |
in countries with free access to antiretroviral therapy ( art ) , infection with hiv has become a chronic manageable condition , and nonaids comorbidities have become an increasing concern . in particular , patients infected with hiv1 are at increased risk of cardiovascular disease ( cvd ) 1 , 2 , 3 , such as myocardial infarction ( mi ) , with an estimated 50% increased risk beyond that explained by recognized cardiovascular risk factors 4 .
hivaccelerated chronic inflammation and immune perturbation , despite art , might be directly associated with vascular dysfunction and the accelerated development of cvd 1 , 5 . however , also art itself has been suggested as a potential factor leading to increased risk of mi through disturbances in the lipid metabolism and/or a direct effect on the cardiovascular system 6 .
biomarkers related to inflammation and associated with risk of cvd may help identify those hiv1infected patients with the highest risk of disease and allow early and preventive intervention . among the more promising biomarkers are interleukin 6 ( il6 ) , ddimer , creactive protein ( crp ) 7 , 8 , soluble tumor necrosis factor receptor ( stnfr ) i and ii 9 , and , as we have recently shown in a sub group of the present cohort , plasminogen activator inhibitor1 ( pai1 ) 10 . soluble urokinase plasminogen activator receptor ( supar ) is a stable plasma biomarker associated with inflammation and immune activation .
supar can bind urokinase plasminogen activator ( upa ) and has been suggested to act as a upascavenger 11 , 12 thereby inhibiting the catalytic process mediated by upa with possible implications of fibrinolysis inhibition .
supar is a strong prognostic marker of disease severity and mortality in different patient populations 13 , 14 , including hiv1infected patients 15 , 16 . in the general population ,
increased plasma supar levels have been associated with an increased risk of cvd , including mi 14 , 17 , 18 , but it remains unknown whether supar is a useful marker for cvd in hiv1infected patients . in this study , we aimed to investigate the potential role of supar as a prognostic marker of firsttime mi in patients with hiv .
in a nested casecontrol study previously described 19 , 55 hiv1infected patients with verified firsttime mi were compared with 182 hiv1infected controls with no cvd event .
briefly , data were extracted from the danish national patient register on patients given a diagnosis of ischaemic heart disease and hiv [ international classification of diseases10th revision ( icd10 ) i2025 and b2024 ] from january 1998 to december 2008 . among these
, patients registered in the danish hiv cohort study ( dhcs ) were identified , and only patients with verified firsttime mi according to international criteria were included in the study . stored plasma samples from routine visits were analysed .
written informed consent for the storage and scientific analysis of blood samples was obtained from all participants and the study approved by the scientific ethical committee of the capital region of denmark ( kf hc2008108 ) .
the date of the case 's mi served as index date for the selection of controls from the dhcs .
up to four controls were obtained per case . individuals with diabetes and/or cvd , other than hypertension ,
controls were matched with their respective case for age at the time of mi 3 years , gender , duration of art and smoking .
the study setup included four plasma samples for each patient at four timepoints : 1 , last available sample before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi ; and 4 , the last sample available before the case 's mi .
plasma samples were stored at 80c until the analysis of supar levels , using the commercially available ce / ivd approved suparnostic elisa ( virogates a / s , birkerd , denmark ) according to the manufacturer 's instruction .
the suparnostic elisa has been validated to measure supar concentrations of 0.622 ng / ml .
total cholesterol , highdensity lipoprotein ( hdl ) and triglycerides ( tg ) were analysed on a vitros 5.1 chemistry system ( ortho clinical diagnostics , new york , ny , usa ) .
very lowdensity lipoprotein ( vldl ) was calculated by the formula tg ( mmol / l ) 0.45 , and ldl was calculated by the formula : total cholesterol ( mmol / l ) [ hdl ( mmol / l ) + vldl ( mmol / l ) ] .
conditional logistic regression was used to estimate odds ratios ( or ) for the association of supar and mi and for the comparison of intergroup differences .
adjustment for covariables was performed with multiple conditional regression analysis , and associations between all predictors and outcome were analysed for the full model .
ldl and vldl were not included in multiple conditional logistic regressions because they were calculated from the other lipids .
the spss 20 software ( ibm , armonk , ny , usa ) was used for all statistical analysis .
in a nested casecontrol study previously described 19 , 55 hiv1infected patients with verified firsttime mi were compared with 182 hiv1infected controls with no cvd event .
briefly , data were extracted from the danish national patient register on patients given a diagnosis of ischaemic heart disease and hiv [ international classification of diseases10th revision ( icd10 ) i2025 and b2024 ] from january 1998 to december 2008 . among these
, patients registered in the danish hiv cohort study ( dhcs ) were identified , and only patients with verified firsttime mi according to international criteria were included in the study . stored plasma samples from routine visits were analysed .
written informed consent for the storage and scientific analysis of blood samples was obtained from all participants and the study approved by the scientific ethical committee of the capital region of denmark ( kf hc2008108 ) .
the date of the case 's mi served as index date for the selection of controls from the dhcs .
up to four controls were obtained per case . individuals with diabetes and/or cvd , other than hypertension ,
controls were matched with their respective case for age at the time of mi 3 years , gender , duration of art and smoking .
the study setup included four plasma samples for each patient at four timepoints : 1 , last available sample before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi ; and 4 , the last sample available before the case 's mi .
plasma samples were stored at 80c until the analysis of supar levels , using the commercially available ce / ivd approved suparnostic elisa ( virogates a / s , birkerd , denmark ) according to the manufacturer 's instruction .
the suparnostic elisa has been validated to measure supar concentrations of 0.622 ng / ml .
total cholesterol , highdensity lipoprotein ( hdl ) and triglycerides ( tg ) were analysed on a vitros 5.1 chemistry system ( ortho clinical diagnostics , new york , ny , usa ) .
very lowdensity lipoprotein ( vldl ) was calculated by the formula tg ( mmol / l ) 0.45 , and ldl was calculated by the formula : total cholesterol ( mmol / l ) [ hdl ( mmol / l ) + vldl ( mmol / l ) ] .
conditional logistic regression was used to estimate odds ratios ( or ) for the association of supar and mi and for the comparison of intergroup differences .
adjustment for covariables was performed with multiple conditional regression analysis , and associations between all predictors and outcome were analysed for the full model .
ldl and vldl were not included in multiple conditional logistic regressions because they were calculated from the other lipids .
the spss 20 software ( ibm , armonk , ny , usa ) was used for all statistical analysis .
more than 80% of all patients had suppressed viral load ( hiv1 rna < 400 copies / ml ) and cd4 cell count above 400 cells/l in plasma sample 4 and did not differ in art regimen at any timepoint .
the cases , however , had a tendency towards higher values of totalcholesterol , ldl and tg , and lower hdl in all samples ( table 2 ) . demographic characteristics of the hiv1infected patients with firsttime myocardial infarction and the hiv1infected controls art , antiretroviral therapy ; iqr , interquartile range ; mi , myocardial infarction . within the study period . characteristics of the study groups at the four sample timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date
pvalues are calculated with conditional logistic regression .
art , antiretroviral therapy ; hdl , highdensity lipoprotein ; iqr , interquartile range ; ldl , lowdensity lipoprotein ; nnrti , nonnucleoside reversetranscriptase inhibitors ; nrti , nucleoside reversetranscriptase inhibitors ; pi , protease inhibitors .
cases had significantly higher supar levels compared to controls at all timepoints [ timepoint 1 : 5.2 ng / ml ( 3.67.7 ) vs. 4.2 ng / ml ( 3.06.1 ) ; timepoint 2 : 4.5 ng / ml ( 3.45.3 ) vs. 3.6 ng / ml ( 2.94.7 ) ; timepoint 3 : 4.3 ng / ml ( 3.55.2 ) vs. 3.4 ng / ml ( 2.74.3 ) ; timepoint 4 : 4.4 ng / ml ( 3.65.6 ) vs. 3.5 ng / ml ( 2.84.6 ) ; ranges in parentheses indicate iqr , p < 0.05 ) .
scatter plot of plasma supar levels ( ng / ml ) for controls ( circles ) and cases ( squares ) at four different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date .
art , antiretroviral therapy ; mi , myocardial infarction ; supar , soluble urokinase plasminogen activator receptor . in an unadjusted conditional regression analysis ,
an increase in supar of 1 ng / ml was associated with an increased risk of mi by 12% ( 95% ci : 125 ) at timepoint 1 , 26% ( 95% ci : 355 ) at timepoint 2 , 29% ( 95% ci : 656 ) at timepoint 3 , and 23% ( 95% ci : 545 ) at timepoint 4 ( p < 0.05 for all timepoints ; table 3 ) . in a multiple conditional regression analysis , supar was adjusted for total cholesterol , hdl , tg , and hiv1 rna .
the univariate and multiple analyses between all predictors and outcome are shown in table 3 .
univariate and multiple conditional logistic regression analysis for myocardial infarction at four samples taken at different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date numbers shown are odds ratios ( 95% confidence intervals ) .
hdl , highdensity lipoprotein ; supar , soluble urokinase plasminogen activator receptor . compared with patients in the lowest ( 1st ) supar quartile ,
the risk of mi was significantly higher in the 3rd and 4th supar quartiles at all timepoints ( fig .
especially 1 year before mi ( timepoint 3 ) , there was a pronounced increase in risk of mi for patients in the 3rd and 4th supar quartiles with odds ratios of 7.41 ( 95% ci : 2.1126.05 , p < 0.01 ) and 10.38 ( 95% ci : 2.8238.27 , p < 0.001 ) , respectively ( fig .
even before initiation of art ( timepoint 1 ) , there was an increased risk with odds ratios of 3.17 ( 95% ci : 1.059.59 , p < 0.05 ) and 4.33 ( 95% ci : 1.4413.03 , p < 0.01 ) for the 3rd and 4th supar quartiles , respectively ( fig
the risk of myocardial infarction ( odds ratios , 95% ci ) for patients with plasma supar levels in the upper three quartiles compared to the lowest quartile at four different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date . ( a ) unadjusted and ( b ) adjusted for hiv1 viral load , total cholesterol , hdl and triglycerides . art , antiretroviral therapy ; ci , confidence interval ; hdl , highdensity lipoprotein ; mi , myocardial infarction ; supar , soluble urokinase plasminogen activator receptor
adjusting for hiv1 rna , total cholesterol , hdl , and triglycerides , supar remained an independent predictor of mi . at timepoint 3 ,
risk of mi remained strongly associated with high supar with odds ratios of 7.18 ( 95% ci : 1.9726.24 , p < 0.01 ) and 9.09 ( 95% ci : 2.3734.87 , p < 0.01 ) for patients in the 3rd and 4th supar quartiles , respectively , compared to patients in the lowest supar quartile ( fig .
furthermore , the 4th supar quartile at timepoint 1 ( before art ) and timepoint 2 ( 3 months after art ) were also associated with an increased risk of mi [ or ( 95% ci ) : 7.94 ( 1.3546.79 ) , p < 0.05 , and or ( 95% ci ) : 4.76 ( 1.4116.10 ) , p = 0.01 ] ( fig .
total cholesterol was significantly associated with mi at timepoint 1 [ or ( 95% ci ) : 1.72 ( 1.072.76 ) , p < 0.05 ] , timepoint 2 [ or ( 95% ci ) : 1.65 ( 1.152.38 ) , p < 0.01 ] , and timepoint 4 [ or ( 95% ci ) : 1.45 ( 1.121.89 ) , p < 0.01 ] . at timepoint 3 the association was borderline significant [ or ( 95% ci ) : 1.28 ( 0.951.71 ) , p = 0.11 ] .
supar was significantly correlated with hiv1 rna except at timepoint 2 ( timepoint 1 : r = 0.16 , p = 0.04 ; timepoint 2 : r = 0.06 , p = 0.38 ; timepoint 3 : r = 0.20 , p = 0.003 ; timepoint 4 : r = 0.16 , p = 0.02 ) .
an inverse , significant correlation was found between supar and cd4 cell count except at timepoint 2 , where the correlation was borderline significant ( timepoint 1 : r = 0.28 , p < 0.0001 ; timepoint
2 : r = 0.14 , p = 0.052 ; timepoint 3 , r = 0.21 , p = 0.002 ; timepoint 4 , r = 0.20 , p = 0.003 ) . we have previously published data on pai1 and the risk of mi at timepoints 3 and 4 in a subgroup of this sample 10 and we therefore performed a correlation analysis of supar and pai1 at timepoints 3 and 4 , but no correlation was found ( data not shown ) .
more than 80% of all patients had suppressed viral load ( hiv1 rna < 400 copies / ml ) and cd4 cell count above 400 cells/l in plasma sample 4 and did not differ in art regimen at any timepoint .
the cases , however , had a tendency towards higher values of totalcholesterol , ldl and tg , and lower hdl in all samples ( table 2 ) . demographic characteristics of the hiv1infected patients with firsttime myocardial infarction and the hiv1infected controls art , antiretroviral therapy ; iqr , interquartile range ; mi , myocardial infarction . within the study period . characteristics of the study groups at the four sample timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date
pvalues are calculated with conditional logistic regression .
art , antiretroviral therapy ; hdl , highdensity lipoprotein ; iqr , interquartile range ; ldl , lowdensity lipoprotein ; nnrti , nonnucleoside reversetranscriptase inhibitors ; nrti , nucleoside reversetranscriptase inhibitors ; pi , protease inhibitors .
cases had significantly higher supar levels compared to controls at all timepoints [ timepoint 1 : 5.2 ng / ml ( 3.67.7 ) vs. 4.2 ng / ml ( 3.06.1 ) ; timepoint 2 : 4.5 ng / ml ( 3.45.3 ) vs. 3.6 ng / ml ( 2.94.7 ) ; timepoint 3 : 4.3 ng / ml ( 3.55.2 ) vs. 3.4 ng / ml ( 2.74.3 ) ; timepoint 4 : 4.4 ng / ml ( 3.65.6 ) vs. 3.5 ng / ml ( 2.84.6 ) ; ranges in parentheses indicate iqr , p < 0.05 ) . scatter plot of plasma supar levels ( ng / ml ) for controls ( circles ) and cases ( squares ) at four different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date .
art , antiretroviral therapy ; mi , myocardial infarction ; supar , soluble urokinase plasminogen activator receptor . in an unadjusted conditional regression analysis ,
an increase in supar of 1 ng / ml was associated with an increased risk of mi by 12% ( 95% ci : 125 ) at timepoint 1 , 26% ( 95% ci : 355 ) at timepoint 2 , 29% ( 95% ci : 656 ) at timepoint 3 , and 23% ( 95% ci : 545 ) at timepoint 4 ( p < 0.05 for all timepoints ; table 3 ) . in a multiple conditional regression analysis ,
the univariate and multiple analyses between all predictors and outcome are shown in table 3 .
univariate and multiple conditional logistic regression analysis for myocardial infarction at four samples taken at different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date numbers shown are odds ratios ( 95% confidence intervals ) .
compared with patients in the lowest ( 1st ) supar quartile , the risk of mi was significantly higher in the 3rd and 4th supar quartiles at all timepoints ( fig .
especially 1 year before mi ( timepoint 3 ) , there was a pronounced increase in risk of mi for patients in the 3rd and 4th supar quartiles with odds ratios of 7.41 ( 95% ci : 2.1126.05 , p < 0.01 ) and 10.38 ( 95% ci : 2.8238.27 , p < 0.001 ) , respectively ( fig .
2a ) . but even before initiation of art ( timepoint 1 ) , there was an increased risk with odds ratios of 3.17 ( 95% ci : 1.059.59 , p < 0.05 ) and 4.33 ( 95% ci : 1.4413.03 , p < 0.01 ) for the 3rd and 4th supar quartiles , respectively ( fig . 2a ) . the risk of myocardial infarction ( odds ratios , 95% ci ) for patients with plasma supar levels in the upper three quartiles compared to the lowest quartile at four different timepoints : 1 , the last sample available before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi / index date ; and 4 , the last sample available before the case 's mi / index date .
( a ) unadjusted and ( b ) adjusted for hiv1 viral load , total cholesterol , hdl and triglycerides .
art , antiretroviral therapy ; ci , confidence interval ; hdl , highdensity lipoprotein ; mi , myocardial infarction ; supar , soluble urokinase plasminogen activator receptor .
in a multiple conditional logistic regression analysis of supar quartiles adjusting for hiv1 rna , total cholesterol , hdl , and triglycerides , supar remained an independent predictor of mi . at timepoint 3 ,
risk of mi remained strongly associated with high supar with odds ratios of 7.18 ( 95% ci : 1.9726.24 , p < 0.01 ) and 9.09 ( 95% ci : 2.3734.87 , p < 0.01 ) for patients in the 3rd and 4th supar quartiles , respectively , compared to patients in the lowest supar quartile ( fig .
furthermore , the 4th supar quartile at timepoint 1 ( before art ) and timepoint 2 ( 3 months after art ) were also associated with an increased risk of mi [ or ( 95% ci ) : 7.94 ( 1.3546.79 ) , p < 0.05 , and or ( 95% ci ) : 4.76 ( 1.4116.10 ) , p = 0.01 ] ( fig .
total cholesterol was significantly associated with mi at timepoint 1 [ or ( 95% ci ) : 1.72 ( 1.072.76 ) , p < 0.05 ] , timepoint 2 [ or ( 95% ci ) : 1.65 ( 1.152.38 ) , p < 0.01 ] , and timepoint 4 [ or ( 95% ci ) : 1.45 ( 1.121.89 ) , p < 0.01 ] . at timepoint 3
the association was borderline significant [ or ( 95% ci ) : 1.28 ( 0.951.71 ) , p = 0.11 ] .
supar was significantly correlated with hiv1 rna except at timepoint 2 ( timepoint 1 : r = 0.16 , p = 0.04 ; timepoint 2 : r = 0.06 , p = 0.38 ; timepoint 3 : r = 0.20 , p = 0.003 ; timepoint 4 : r = 0.16 , p = 0.02 ) . an inverse , significant correlation was found between supar and cd4 cell count except at timepoint 2 , where the correlation was borderline significant ( timepoint 1 : r = 0.28 , p < 0.0001 ; timepoint
3 , r = 0.21 , p = 0.002 ; timepoint 4 , r = 0.20 , p = 0.003 ) .
we have previously published data on pai1 and the risk of mi at timepoints 3 and 4 in a subgroup of this sample 10 and we therefore performed a correlation analysis of supar and pai1 at timepoints 3 and 4 , but no correlation was found ( data not shown ) . no interaction was found between casecontrol status and the correlated parameters .
in this casecontrol study , we show for the first time that supar is a strong independent predictor of mi among hiv1infected patients .
elevated supar levels were strongly and significantly associated with subsequent development of firsttime mi , even years before the event .
inflammatory biomarkers such as crp , ddimer and il6 have all been suggested to predict cardiovascular events in hiv1infected patients , even with full viral suppression obtained by art 7 , 8 , 9 .
however , it remains debated whether the art itself is involved in the development of mi among hiv1infected patients 1 , 6 .
our findings seem to suggest that art did not play a direct role in the development of mi , given that supar levels among cases were already increased before initiation of art .
this indicates that the cases had an inherent risk of cvd unrelated to their hiv treatment or , in other words , that supar predicts mi through pathways independent of art use .
supar has previously been shown to predict mortality in treatmentnave hiv1infected patients 16 . in hivpatients initiating art ,
mortality was concentrated in the highest supar quartile , while patients with a low supar level had a low risk of mortality despite low cd4 cell count and low body weight 15 .
thus , supar appears to add significant information to other measures of poor prognosis in hivinfected patients .
we found that supar levels were lower in both cases and controls at the sampling points after initiation of art therapy , which correlates well with previous findings 20 , 21 .
supar has been suggested to be a marker of metabolic disturbances , such as lipodystrophy , dyslipidemia and insulin resistance , in hivinfected patients 22 , 23 , which are all potential cofactors in the pathogenesis of mi among hivinfected patients , but in this study supar predicted mi independently of lipid values .
together , these findings suggest that beside the risk associated with the traditional risk factors , such as total cholesterol and ldl , supar may reflect a different pathogenesis of a more inflammatory nature .
pai1 has previously been associated with mi in a subgroup of this cohort 10 , and as supar can act as a upascavenger our findings in this study cohort could point to a theory of hypercoagulability in the development of mi in hiv1infected patients , even with full viral suppression .
however , we found no correlation between pai1 and supar in a subpopulation of this cohort .
the contribution of a hypercoagulable state to morbidity and mortality in hiv has been observed in other studies , showing that ddimer is associated with cvd and mortality in hiv1infected patients 7 , 9 , 24 .
the present results introduce supar as a potential novel inflammatory marker of cardiovascular events in hivinfected patients with a > 10fold increase in risk of mi for patients with the highest supar levels . the use of supar as an indicator / surrogate marker for the chronic inflammation associated with increased cardiovascular risk and other nonaidsrelated morbidities may markedly improve the risk stratification of routinely followed hivpatients and may aid in the identification of those patients mostly at risk of cvd events beyond the information provided by traditional risk factors ; a property of supar , which is also observed in the general population 17 , 18
intriguingly , supar predicted the cardiovascular events even before the initiation of art and may therefore be of guidance in both the choice of art and direct focus towards early signs of comorbidities in this population at risk .
the casecontrol design is associated with the risk of selection bias and residual confounding , and furthermore , the number of cases in the study was low .
therefore , we can not exclude the possibility that cases had higher intensity of smoking , which has been found to correlate with supar levels 25 .
furthermore , it is important to underline that there is a higher percentage of previous smokers among the controls , causing a slight skewness of the data .
another limitation to this study is the lack of measurements of other competent inflammatory markers , such as il6 and tnf receptors , which has recently been shown to be associated with nonaidsdefining events 9 .
however , supar has previously been shown to be positively correlated with stnfrii and il6 in hiv1infected individuals 21 , 22 , suggesting that these inflammatory markers reflect similar aspects of hivassociated inflammation .
as pai1 was only analysed in a subgroup of the cohort , it is not possible to adjust for pai1 in the full model .
all of the necessary parameters for the creation of an individual cardiovascular risk score , such as the framingham risk score , were not registered , and we are therefore unable to test if the addition of supar to an existing risk score could increase the auc .
in conclusion , this nested casecontrol study of 55 cases and 182 controls showed that elevated plasma supar levels were independently associated with an increased risk of developing firsttime mi in an hiv1infected population .
thus , supar may be a new risk marker in the monitoring and management of comorbidities among hiv1infected patients even years before the event . | objectivespatients infected with hiv are at increased risk of myocardial infarction ( mi ) . increased plasma levels of the inflammatory biomarker soluble urokinase plasminogen activator receptor ( supar ) have been associated with increased risk of cardiovascular diseases ( cvd ) , including mi in the general population .
we tested supar as a predictive biomarker of mi in hiv1infected individuals.methodssupar levels were investigated in a nested casecontrol study of 55 hiv1infected cases with verified firsttime mi and 182 hiv1infected controls with no known cvd .
controls were matched for age , gender , duration of antiretroviral therapy ( art ) , smoking and no known cvd .
supar was measured in the four plasma samples available for each patient at different timepoints ; 1 , before initiation of art ; 2 , 3 months after initiation of art ; 3 , 1 year before the case 's mi ; and 4 , the last sample available before the case 's mi.resultsin unadjusted conditional regression analysis , higher levels of supar were associated with a significant increase in risk of mi at all timepoints .
patients in the third and fourth supar quartiles had a three to 10fold higher risk of mi compared to patients in the lowest supar quartile at all timepoints .
supar remained a strong significant predictor of mi , when adjusting for hiv1 rna , total cholesterol , triglycerides and highdensity lipoprotein.conclusionelevated supar levels were associated with increased risk of mi in hivinfected patients , suggesting that supar could be a useful biomarker for prediction of firsttime mi in this patient group , even years before the event . |
adult t - cell leukemia ( atl ) is an aggressive lymphoid proliferation associated with the human t - lymphotropic virus type i ( htlv - i ) [ 1 , 2 ]
. htlv - i causes transformation and clonal expansion of t cells , resulting in atl in approximately 14% of the estimated 1020 million infected hosts , with a mean latency period of > 50 years .
the diversity in clinical features and prognosis of patients with atl has led to its subclassification into the following 4 subtypes : smoldering , chronic , acute leukemic forms , and atl lymphoma .
rare cases with intraocular invasion of acute - type atl have been reported [ 4 , 5 , 6 ] .
we reported previously that flow cytometric analysis of vitreous samples is useful for the diagnosis of ocular sarcoidosis .
here , we report a patient with intraocular invasion of smoldering - type atl after cataract surgery , which was confirmed by flow cytometric analysis , cytology , and pcr analysis of vitreous samples .
this study was performed in accordance with the tenets of the declaration of helsinki , and the procedures were approved by the institutional review board of the kyoto prefectural university of medicine hospital and tohoku university graduate school of medicine .
a 75-year - old man without any systemic disease underwent uneventful cataract surgery of the right eye .
the best - corrected visual acuity was 1.0 on the next day , with normal postoperative findings .
on postoperative day 6 , the patient presented with blurred vision in the right eye without any specific clinical findings such as ocular pain .
his best - corrected visual acuity had decreased to 0.5 , and funduscopic examination revealed diffuse vitreous opacity ( fig .
1 ) . based on the clinical course and the ocular manifestations , postoperative bacterial endophthalmitis was suspected , and a pars plana vitrectomy was performed .
a vitreous specimen was obtained at the start of a conventional 25-gauge pars plana vitrectomy .
dry vitrectomy without perfusion of a balanced salt solution ( alcon laboratories , inc . ,
usa ) was conducted at a rate of 500 cuts per min so as not to damage cells infiltrating into the vitreous . after collecting 2 ml of a pure vitreous sample
, an additional vitrectomy was performed under balanced salt solution perfusion in order to collect 10 ml of the diluted vitreous sample .
genomic dna for herpes virus and other ocular pathogens was assayed in vitreous fluids using 2 independent pcr assays ( a qualitative multiplex pcr assay and a quantitative real - time pcr assay ) as described previously .
a high level of cd4 and cd8 double - positive t cells was detected in the vitreous fluid but not in the peripheral blood ( fig .
2a , b ) , which is rarely seen in other cases of uveitis . based on the result of flow cytometry , atl or
cytological examination of the vitreous specimen revealed flower cells that infiltrated into the vitreous ( fig .
the proviral dna for htlv - i ( but not for cytomegalovirus or other types of infectious organisms ) was amplified in the pure vitreous sample .
monoclonal t - cell receptor chain rearrangement was also detected by pcr in the pure vitreous sample ( fig .
the proviral dna for the htlv - i was amplified in the serum sample by pcr and was not found by southern blot analysis .
the rate of cd4 and cd8 double - positive t cells in the peripheral blood was low .
as far as we are aware , this is the first report of a patient with intraocular invasion of smoldering - type atl triggered by cataract surgery .
previously , a patient with smoldering - type atl was reported with severe unilateral intraocular inflammation at the time of acute crisis during the disease process without any intraocular surgery . in the present report
, we speculate that the disruption of the blood - ocular barrier after cataract surgery triggered the intraocular infiltration of atl cells in our patient with smoldering - type atl . we surmise that the atl cells might be affected by postoperative inflammation and a special ocular environment where a high amount of transforming growth factor beta ( tgf- ) is found .
based on this , in the present case we thought that infiltrating atl cells gradually proliferated after the operation into the ocular fluid , where there was a high amount of tgf-. in our patient , there was no recurrence even without additional treatment after vitrectomy .
although this is a rare case , lymphocyte infiltrating disorder may be considered as a differential diagnosis in cases with diffuse vitreous opacity after intraocular surgery .
thorough analysis of vitreous samples is essential for vitrectomy in vitreous opacity from unknown causes .
flow cytometric , cytological , and pcr analysis of vitreous samples is beneficial for determining the cause of uveitis and endophthalmitis .
| adult t - cell leukemia ( atl ) is an aggressive lymphoid proliferation associated with the human t - lymphotropic virus type i ( htlv - i ) .
the intraocular invasion of atl is a rare event .
a 75-year - old man without any systemic disease underwent uneventful cataract surgery of the right eye .
on postoperative day 6 , the patient presented with blurred vision due to severe vitreous opacity in the right eye .
analysis of the vitreous fluid revealed a suspected atl infection based on the flow cytometric analysis .
moreover , cytological examination of the vitreous specimen revealed flower cell infiltration , and htlv-1 dna was detected by pcr analysis of the vitreous sample .
monoclonal t - cell receptor chain rearrangement was also detected by pcr .
thorough analysis of a vitreous sample is essential for vitrectomy in vitreous opacity of unknown cause .
flow cytometric , cytological , and pcr analysis of vitreous samples is beneficial for determining the cause of this kind of severe illness . |
the obstructive sleep apnea syndrome ( osas ) is characterized by repeated collapse of the upper airway during sleep , resulting in nocturnal hypoxemia and fragmented sleep .
associated brain dysfunctions can be expressed , such as abnormal daytime sleepiness and lack of concentration , and these are common causes of traffic accidents .
several studies have associated osas with increased risk of traffic accidents and the majority of the researches were conducted among professional drivers . obtaining data on the frequency of sleep - disordered breathing , nocturnal sleep disruption , and excessive sleepiness among the working population is an important public health problem .
it is noteworthy that the identification and treatment of snoring and osas in workers can potentially reduce the number of occupational injuries , absenteeism , improve productivity , health , and wellbeing of these professionals .
several well - tolerated and effective treatments for osas have demonstrated improvements in the quality of life and reduction in the use of health services and vehicle collisions .
treatments for osas can be clinical or surgical , and the clinical treatment options include behavioral measures , and the use of continuous positive airway pressure device ( cpap ) or oral appliances ( oa ) .
the oa are a noninvasive treatment option for patients with osas and it is considered less uncomfortable than cpap .
the american academy of sleep medicine recommends the oa therapy for patients with mild - to - moderate osas and those with severe osas who can not tolerate cpap and refuse surgery procedures .
the use of cpap is indicated as firstline treatment for people with high levels of apnea - hypopnea index ( ahi ) associated with excessive sleepiness ; however , there are indications that oa improves subjective sleepiness and sleep - disordered breathing
. randomized trials assessing the effectiveness of oa found that it reduced the excessive daytime sleepiness when compared with patients without treatment .
moreover , when the results of cpap and oa were compared , there was no significant difference between both therapies .
a randomized clinical trial presented improvements on energy and fatigue levels and vigilance and psychomotor speed among patients treated with oa when compared with placebo .
other studies also found improvements in neurocognitive function using the oa , which did not differ statistically from the improvements achieved by the cpap therapy . in 2011 ,
a longitudinal study was conducted with patients with mild - to - moderate osas who were randomized regarding the treatment for cpap or oa .
the study showed similar improvement from both therapies regarding the ahi and excessive daytime sleepiness ; however , the survey sample was not representative .
it is worth noticing that changes in the oral appliances design may contribute to different results , once a study comparing devices with different designs showed differences in the improvement of excessive daytime sleepiness .
treatment with oa , in addition to being effective to normalize the respiratory disorders , improved work performance of patients with osas .
however , it still lacks a more comprehensive way to assess the benefit of oa on driving simulation and real driving performance .
this article aimed to revise the prevalence and impact of osa on work performance , occupational impairments , use of health services , and its economic impact . the cost - effectiveness and effects of the cpap therapy and especially the role of oa concerning those issues were also investigated .
these were the inclusion criteria used in this article : articles published from january 1980 to june 2014 concerning patients with a diagnosis of osa , presenting ahi > 5 , snorers , upper airway resistance syndrome , age 18 years ; any study design and the languages were restricted to : english , french , and portuguese .
exclusion criteria were central sleep apnea , coexisting sleep disorders , regular use of sedatives or narcotics , preexisting lung disease , and psychiatric illness .
searches were conducted on medline ( pubmed ) , latin american and caribbean literature data on health sciences ( lilacs ) and scientific electronic library online ( scielo ) , in addition to searches from the references of the identified articles .
the search strategy was performed by combining the following descriptors : apnea , snoring , sleepiness , mandibular advancement devices , oral appliances , continuous positive air pressure , cost , economics , cost - effectiveness , accident , health care utilization , driving , occupational accidents , occupational injury , traffic , commercial vehicle drivers , and work limitation .
subsequently , the common contents were identified , grouped , and tabulated to form the thematic analysis and preparation of a critical discourse .
during the search , 2188 articles were identified , but 2095 were excluded once they did not meet the inclusion criteria , totaling 99 articles included .
sleepiness negatively affects cognitive function , therefore it is assumed that patients with osas suffer impairments in labor capacity , by presenting lack of concentration and attention , memory impairment , and changes in the ability to perform everyday tasks and learning .
moreover , the reduced capacity for executive functions such as completing tasks , can cause loss of motivation and initiative . the national sleep foundations ( nsf ) in the united states assessed the sleep of workers and found that those at risk for osas had a greater chance of having difficulty when performing cognitive tasks , including problems with concentration and organization and also a greater risk of falling asleep at work , decreased productivity , and absenteeism due to sleepiness .
the sleep - disordered breathing was a common finding among brazilian professional drivers who presented an osas prevalence of 38% .
furthermore , the daytime sleep was fragmented and shorter than nocturnal sleep and more drivers presented extreme sleepiness .
it is worth noticing that such deficiencies of sleep can negatively affect performance in driving .
another epidemiological study conducted among brazilian railroad workers suggested age , body mass index ( bmi ) , and alcohol consumption as associated with an increased risk of developing osas and it stressed the need for greater attention to this population , once they are more prone to suffer accidents . in greece , the prevalence of sleep - disordered breathing among drivers of rail transport was similar to other studies , but the study reported a low prevalence of drowsy drivers ( 7.1% ) .
however , this data has to be carefully analyzed once it was used a subjective evaluation criterion by epworth sleepiness scale . among a group of american officers , sleep disorder was identified as an ordinary problem and that it was significantly associated with increased risk of health problems , work performance , and safety outcomes ; osas was the most prevalent disorder ( 33.6% ) .
excessive sleepiness was found in 28.5% of the police officers and there was an increase in the prevalence of physical and mental health disorders , including diabetes , depression , cardiovascular disease , and increased risk of accidents .
a study carried out among soldiers identified that 88.2% of the sample were diagnosed with sleep disorders .
insomnia coexisting with osas was found in 38.2% of the military and they were significantly more likely to meet criteria for depression compared with control subjects and others with only osas . among young soldiers in korea , it was found that the prevalence of snoring and high risk of osas was 13.5% and 8.1% , respectively .
it is worth noticing that this is not a low prevalence considering that the individuals were young and not obese .
it was observed that the treatment of osas resulted in the reduction of occupational accidents and improved the performance of employees .
nevertheless , it has been difficult to establish the exact effect of untreated osas in real driving and traffic accidents .
driving simulators have been used as a cheaper and safer reproducible way to assess the effect of osas on different aspects of driving , but despite the benefits provided , the simulator can not measure all the aspects experienced in a real - life driving situation . in canada , useful data from a study of driving in real life were evaluated . over a period of three years patients with mild , moderate , and severe osas
had an increased rate of traffic accidents when compared with drivers without this condition and had higher rates of road traffic accidents associated with personal injury .
worse performances in driving simulators among subjects with untreated osas was also identified by other studies . nonetheless , after treatment with cpap , there was an improvement in the driving performance .
it is known that the cpap therapy improves driving performance and can potentially reduce the risk of accidents , but the benefits provided by cpap depend on treatment adherence .
the results of a study conducted in 2011 suggest persistent impairment in driving simulator during long trips in patients with severe osas treated with cpap .
these results support the evidence that some neurobehavioral deficits in patients with severe osa are not fully reversed by treatment .
more controlled studies with larger samples are needed to confirm these findings and further researches should investigate the causes of residual driving simulator impairment among patients with osas treated with cpap and its association with increased risk of vehicular accident on highway .
test driving simulator was also used to investigate whether osas patients had worse labor performance than healthy drivers .
the total number of lapses of attention was significantly decreased after both therapies , with oa and cpap , with no significant differences between the two types of treatment . however
, a more comprehensive way to assess the benefits of oa on driving simulation tests , and real - life driving performance are needed to adequately assess its potential role concerning the risk of drowsiness at the wheel represented by osa .
another important issue that should be discussed concerning the impairments in occupational performance is related to the international driving licensing legislation .
a committee established by the european commission on sleep apnea and driving has been discussing about directives with an approach to patients with moderate or severe sleep apnea , particularly associated with significant sleepiness .
those patients will be prevented from driving , or at least will be prevented from holding a driver 's license , until the condition is successfully treated .
the driving licenses may be issued to applicants or drivers with moderate or severe osas who show adequate control of their condition and compliance with appropriate treatment and improvement of sleepiness , if any , confirmed by authorized medical opinion .
applicants or drivers with moderate or severe osas under treatment shall be subject to a periodic medical review with a view to establish the level of compliance with the treatment , the continued good vigilance , and evaluate the need for continuing the treatment .
it is estimated that 20% of accidents are caused by drivers inattention and sleepiness , and the occurrence of drowsiness when driving is a major risk factor for dangerous accidents .
chronic excessive sleepiness and sleep - disordered breathing were common in a sample of drivers of commercial vehicles in australia .
drivers with a high risk for osas and a work schedule with little chance of rest reported more daytime sleepiness and poor sleep quality in a study conducted among belgian truckers and japanese bus drivers . in brazil , 16% of professional drivers admitted having fallen asleep at the wheel ; however , this number increased to 58% when it was reported by colleagues .
it was observed that respiratory disorders and snoring are some causes of fragmentation or reduction of rapid eye movement ( rem ) sleep , which could support the hypothesis that rem sleep deprivation can lead to common complaints such as mental fatigue , irritability , and sleepiness among professional drivers .
the driver screening methods should contain questions about drowsiness at the wheel , habitual snoring , and sleep apneas , as well as the epworth index and bmi .
after an assuredly effective and efficient treatment , including regular checkups for control and evaluation of symptoms , patients are allowed to drive .
nevertheless , during the interim period between the diagnosis and therapy , drivers can still be considered able to drive , but with limitations ( eg , drive short distances and avoid driving on major highways or at night . in brazil , due to the high rate of traffic accidents caused by drowsiness , in 2008 ,
a resolution was approved by the national traffic department to reduce the number of accidents caused by drowsiness , fatigue , sleep - disordered breathing , and changes in biological rhythms .
evaluation of osa was included in this resolution as well as the requirement of new medical and psychological examinations for all professional drivers .
however , drivers with symptoms of drowsiness or sleep - disordered breathing may not report accidents due to concerns of losing their jobs , compromising the results of studies on the association between these disorders and accidents .
a study conducted among long distance truck drivers in the united states found that about 20% of drivers presented symptoms of sleep disorders .
drivers who were working with the same company for over a year were more likely to have daytime fatigue , daytime tiredness , restless sleep , hypertension , and increased bmi .
other studies observed a higher prevalence of osas in railway workers than in the general population , thus necessitating greater attention to this population , due to the greater propensity for accidents . a research conducted with presumably healthy working men also identified a significant association between the complaint of excessive daytime sleepiness and the incidence of sleep apnea . in turkey
, 241 long - distance drivers were interviewed about symptoms of osas , and occupational history .
snoring was detected in 56% of all participants and daytime sleepiness was observed in 26.6% .
there was a significant relationship between the rate of traffic accidents by professionals / year and ahi , lowest saturation , desaturation index , and arousal index .
snoring , which is one of the signals present in osas , has been associated with increased risk for accidents and morbidity .
a study conducted in hungary found that snoring is common in the adult population . through interviews ,
the study showed that especially loud snoring with breathing pauses was strongly associated with health impairment , higher comorbidity , daytime sleepiness , and a higher frequency of accidents .
a retrospective evaluation of snoring workers due to suggestive symptoms of osas found a significantly higher frequency of occupational accidents among these professionals when compared to the general population of snorers . in this study
, all subjects underwent overnight polysomnography in a sleep laboratory and , interestingly , the risk of accidents was high among heavy snorers without apnea and patients with osas .
a prospective study found that men who reported both snoring and excessive daytime sleepiness were with an increased risk of labor accidents during the 10 years of follow - up .
the high risk of traffic accidents among drowsy drivers was mainly determined by the respiratory effort - related arousals ( rera ) than by the presence of apneas and hypopneas .
the reras are secondary to upper airway obstructions during sleep and can occur in the absence of apneas and hypopneas , causing excessive daytime sleepiness .
studies using the esophageal pressure measure were performed in habitually sleepy drivers and drivers without this condition .
sleepy drivers with apnea had higher accident rates in five years than drivers in the control group .
nevertheless , a high rate of rera , but not sleep apnea , was still a risk factor among drivers habitually sleepy .
these findings confirm the importance of identifying rera in routine examinations in sleep laboratories . just like it occurs with civilians ,
excessive sleepiness is a risk to the safety of military that operate dangerous vehicles , machinery , or carry firearms .
military with untreated osa are also at risk for suffering from decreased mental alertness and decreased cognitive function due to drowsiness .
military with mild - to - moderate osa and upper airway resistance syndrome ( uars ) often have abnormal results in the maintenance of wakefulness test and therefore have a pathological tendency to fall asleep .
a study conducted in 2009 among military personnel identified that 32% of the sample had uars and 68% osa .
the patient should be informed about the risks and an appropriate treatment should be instituted .
in addition , the doctor should provide a follow - up plan to determine if the treatment has decreased the patient 's risk for accidents .
although many investigations have pointed out that treatment of primary snoring and osas with cpap or oa contributes to the reduction of vehicle and labor accidents , this review did not find any studies evaluating the effectiveness of oa regarding this outcome .
like several other medical treatments , the efficacy of cpap or oa depends on the degree of identification of osas and the degree of adherence to the treatment among the diagnosed individuals .
treatment with cpap reduces the risk of accidents because it is used by the patient .
nonetheless , adherence to cpap continues to be a major problem when treating osas , although more recent data suggest that adherence may have improved in recent years .
however , a recent study found that only 5% of professional drivers diagnosed with osas showed adequate adherence to cpap .
it is important to include the patients in the treatment decision , offering more than one type of therapy for patients with osa . despite the residual apneas with the use of oa , or the highest rate of effectiveness of cpap in reducing ahi
, the similarities between the results of such treatments may be related to the hours of use per night .
the oa which are considered to have partial efficacy , when used for prolonged hours may lead to similar outcomes when compared with cpap .
although some predictors of success with oa have been evaluated , further studies are needed to better predict which patient will have a higher level of success with the oa therapy .
less obese patients with mild sleep apnea and certain craniofacial characteristics such as mandibular retrognathia proved to be good candidates for the oa therapy .
when analyzing the economic impact of osas , it was highlighted that there was a lack of clarity concerning the epidemiology of accidents in patients correctly treated with cpap .
furthermore , it was suggested that future studies are needed to evaluate the improvement in the labor activities of osas patients before and after treatment , as well as studies evaluating the cost - effectiveness between surgical and clinical treatments .
most studies regarding the adherence to oa use subjective measures to evaluate the therapy compliance .
nevertheless , a study conducted in 2012 objectively evaluated the use of oa among patients undergoing therapy for osa by means of a heat - sensitive microsensor , which was attached to the oa .
the overall mean rate of oa use was 6.7 1.3 h per day with a regular users rate of 82% . despite not having a statistically significant difference between the self - report and the use of microsensor , the safety and feasibility of using this device to objectively measure
although , according to a systematic review , many studies have demonstrated the effectiveness of oa in reducing daytime sleepiness and improve the neurocognitive function , the federal motor carrier safety administration does not recommend the use of the oa in the treatment of osas among professional drivers , once there is no scientific evidence associating the reduction of accidents by using these devices and it is difficult to assess the patients treatment adherence .
furthermore , an updated version of the thoracic society clinical practice guideline recommended the use of cpap to reduce accidents , but again the oa were not listed due to lack of scientific evidence about the effects of this therapy on the risk of accidents .
the diagnosis of sleep - disordered breathing may affect the deployable strength of the military personnel due to the difficulty they might face concerning the use of cpap .
military deployed in desert environment are at a risk of inhaling airborne particulate matter that can harm their health . in this condition , the cpap therapy can facilitate the inhalation of these particles .
therefore , alternatives to solve this problem such as using foam filters have been tested .
obstructive sleep apnea affects the daily lives of millions of people around the world and presents a growing economic impact .
the evidence linking osas with various public health problems such as obesity , diabetes , depression , cardiovascular disease , and accidents has increased .
it is estimated that in the united states , the total costs attributable to sleep apnea - related accidents is quite high . in 2000
, 1400 people died due to vehicular collisions and in 2004 these accidents had a cost of $ 15.9 billion . with regard to the management of accidents
, it is estimated that the treatment with cpap for all drivers who suffer from osas would be of $ 3.18 billion . even taking into account a treatment efficiency of only 70%
, there would be a reduction of $ 11.1 billion in collision costs and 980 lives would be saved per year .
the literature suggests that treating 500 patients for three years would result in savings more than $ 1,000 .
a more recent analysis of osas treatment showed significantly lower costs of the treatment plan .
in addition , it was also observed fewer disability claims ; cost reduction for disability and fewer lost days of work . a prospective study compared the effects of osas between men and women during 1994 - 2005 . an increased risk of absenteeism in subjects with sleep apnea was observed . in women ,
the major risk was present five years before diagnosis , whereas in men the major risk was observed one year before the diagnosis of osas .
education campaigns encouraging members of health plans to seek specific treatment for sleep - disordered breathing resulted in substantial savings .
dentists can play an important role in accident prevention through the detection of risk factors by screening their patients for osas , evaluating oral / jaws anatomical features , and screening for sleep disorders during the anamnesis .
untreated obstructive sleep apnea predisposes patients to various morbidities and consequently increases the use of health services .
the risk assessment of osas among workers can help to reduce the national health care burden .
evidence suggests that patients with untreated sleep apnea require a greater amount of health resources .
moreover , adherence to treatment in patients with osas results in a significant reduction in hospitalizations and medical applications . in 2013
a study comparing the health effects after one month of cpap and oa therapy identified that despite the cpap therapy was more effective in reducing the ahi , the therapy with oa had greater adherence , hence both therapies showed similar results .
concerning cpap therapy , studies in several countries have evaluated its cost - effectiveness some patients have to try more than one treatment option before control of osas is reached .
treatment should be individualized and supported by scientific evidence , and the evaluation of cost - effectiveness is also required .
information about the therapy cost is important for the governments , transport , industry , and insurance agencies to plan actions to decrease the economic impact of untreated osas .
data on types of treatment for snoring and osas suggested that therapy with oa had lower costs when compared with other treatment modalities .
nonetheless , it has not been evaluated yet the use of oa associated with reduced risk of vehicle and labor accidents .
further studies should evaluate from a social perspective the loss of work productivity , increased absenteeism , insurance , and costs and assess the use of oa in preventing occupational accidents .
the cost - effectiveness of cpap was compared with the oa therapy and lifestyle advice using a method of quality - adjusted life year ( qaly ) in a life perspective . on average ,
therefore , regarding adults who suffer from moderate or severe symptomatic osa it was concluded that cpap has better cost - effectiveness when compared with oa and lifestyle advice .
the oa are now widely prescribed for the treatment of osas , either as a primary or as an alternative measure to those patients unwilling or unable to tolerate cpap therapy .
although cpap has been shown to be more effective than oa and highly cost - effective , there are increasing evidences that oa improve drowsiness , blood pressure , and indices of sleep - disordered breathing .
moreover , many patients who respond to both treatments generally prefer to use oa . despite the limited evidence on the cost - effectiveness of oa , through this literature review
it can be observed that oa are economically less attractive than cpap , but remain as a cost - effective treatment for patients who do not want or do not adhere to treatment with cpap .
sleepiness negatively affects cognitive function , therefore it is assumed that patients with osas suffer impairments in labor capacity , by presenting lack of concentration and attention , memory impairment , and changes in the ability to perform everyday tasks and learning .
moreover , the reduced capacity for executive functions such as completing tasks , can cause loss of motivation and initiative . the national sleep foundations ( nsf ) in the united states assessed the sleep of workers and found that those at risk for osas had a greater chance of having difficulty when performing cognitive tasks , including problems with concentration and organization and also a greater risk of falling asleep at work , decreased productivity , and absenteeism due to sleepiness .
the sleep - disordered breathing was a common finding among brazilian professional drivers who presented an osas prevalence of 38% .
furthermore , the daytime sleep was fragmented and shorter than nocturnal sleep and more drivers presented extreme sleepiness .
it is worth noticing that such deficiencies of sleep can negatively affect performance in driving .
another epidemiological study conducted among brazilian railroad workers suggested age , body mass index ( bmi ) , and alcohol consumption as associated with an increased risk of developing osas and it stressed the need for greater attention to this population , once they are more prone to suffer accidents . in greece , the prevalence of sleep - disordered breathing among drivers of rail transport was similar to other studies , but the study reported a low prevalence of drowsy drivers ( 7.1% ) .
however , this data has to be carefully analyzed once it was used a subjective evaluation criterion by epworth sleepiness scale . among a group of american officers , sleep disorder was identified as an ordinary problem and that it was significantly associated with increased risk of health problems , work performance , and safety outcomes ; osas was the most prevalent disorder ( 33.6% ) .
excessive sleepiness was found in 28.5% of the police officers and there was an increase in the prevalence of physical and mental health disorders , including diabetes , depression , cardiovascular disease , and increased risk of accidents .
a study carried out among soldiers identified that 88.2% of the sample were diagnosed with sleep disorders .
insomnia coexisting with osas was found in 38.2% of the military and they were significantly more likely to meet criteria for depression compared with control subjects and others with only osas . among young soldiers in korea , it was found that the prevalence of snoring and high risk of osas was 13.5% and 8.1% , respectively .
it is worth noticing that this is not a low prevalence considering that the individuals were young and not obese .
it was observed that the treatment of osas resulted in the reduction of occupational accidents and improved the performance of employees .
nevertheless , it has been difficult to establish the exact effect of untreated osas in real driving and traffic accidents .
driving simulators have been used as a cheaper and safer reproducible way to assess the effect of osas on different aspects of driving , but despite the benefits provided , the simulator can not measure all the aspects experienced in a real - life driving situation . in canada , useful data from a study of driving in real life were evaluated . over a period of three years
patients with mild , moderate , and severe osas had an increased rate of traffic accidents when compared with drivers without this condition and had higher rates of road traffic accidents associated with personal injury .
worse performances in driving simulators among subjects with untreated osas was also identified by other studies . nonetheless , after treatment with cpap , there was an improvement in the driving performance .
it is known that the cpap therapy improves driving performance and can potentially reduce the risk of accidents , but the benefits provided by cpap depend on treatment adherence .
the results of a study conducted in 2011 suggest persistent impairment in driving simulator during long trips in patients with severe osas treated with cpap .
these results support the evidence that some neurobehavioral deficits in patients with severe osa are not fully reversed by treatment .
more controlled studies with larger samples are needed to confirm these findings and further researches should investigate the causes of residual driving simulator impairment among patients with osas treated with cpap and its association with increased risk of vehicular accident on highway .
test driving simulator was also used to investigate whether osas patients had worse labor performance than healthy drivers .
the total number of lapses of attention was significantly decreased after both therapies , with oa and cpap , with no significant differences between the two types of treatment .
however , a more comprehensive way to assess the benefits of oa on driving simulation tests , and real - life driving performance are needed to adequately assess its potential role concerning the risk of drowsiness at the wheel represented by osa .
another important issue that should be discussed concerning the impairments in occupational performance is related to the international driving licensing legislation .
a committee established by the european commission on sleep apnea and driving has been discussing about directives with an approach to patients with moderate or severe sleep apnea , particularly associated with significant sleepiness .
those patients will be prevented from driving , or at least will be prevented from holding a driver 's license , until the condition is successfully treated .
the driving licenses may be issued to applicants or drivers with moderate or severe osas who show adequate control of their condition and compliance with appropriate treatment and improvement of sleepiness , if any , confirmed by authorized medical opinion .
applicants or drivers with moderate or severe osas under treatment shall be subject to a periodic medical review with a view to establish the level of compliance with the treatment , the continued good vigilance , and evaluate the need for continuing the treatment .
it is estimated that 20% of accidents are caused by drivers inattention and sleepiness , and the occurrence of drowsiness when driving is a major risk factor for dangerous accidents .
chronic excessive sleepiness and sleep - disordered breathing were common in a sample of drivers of commercial vehicles in australia .
drivers with a high risk for osas and a work schedule with little chance of rest reported more daytime sleepiness and poor sleep quality in a study conducted among belgian truckers and japanese bus drivers . in brazil , 16% of professional drivers admitted having fallen asleep at the wheel ; however , this number increased to 58% when it was reported by colleagues .
it was observed that respiratory disorders and snoring are some causes of fragmentation or reduction of rapid eye movement ( rem ) sleep , which could support the hypothesis that rem sleep deprivation can lead to common complaints such as mental fatigue , irritability , and sleepiness among professional drivers .
the driver screening methods should contain questions about drowsiness at the wheel , habitual snoring , and sleep apneas , as well as the epworth index and bmi .
after an assuredly effective and efficient treatment , including regular checkups for control and evaluation of symptoms , patients are allowed to drive .
nevertheless , during the interim period between the diagnosis and therapy , drivers can still be considered able to drive , but with limitations ( eg , drive short distances and avoid driving on major highways or at night . in brazil , due to the high rate of traffic accidents caused by drowsiness , in 2008 , a resolution was approved by the national traffic department to reduce the number of accidents caused by drowsiness , fatigue , sleep - disordered breathing , and changes in biological rhythms .
evaluation of osa was included in this resolution as well as the requirement of new medical and psychological examinations for all professional drivers .
however , drivers with symptoms of drowsiness or sleep - disordered breathing may not report accidents due to concerns of losing their jobs , compromising the results of studies on the association between these disorders and accidents .
a study conducted among long distance truck drivers in the united states found that about 20% of drivers presented symptoms of sleep disorders .
drivers who were working with the same company for over a year were more likely to have daytime fatigue , daytime tiredness , restless sleep , hypertension , and increased bmi .
other studies observed a higher prevalence of osas in railway workers than in the general population , thus necessitating greater attention to this population , due to the greater propensity for accidents . a research conducted with presumably healthy working men also identified a significant association between the complaint of excessive daytime sleepiness and the incidence of sleep apnea .
in turkey , 241 long - distance drivers were interviewed about symptoms of osas , and occupational history .
the drivers who had evidence of osas underwent polysomnography . snoring was detected in 56% of all participants and daytime sleepiness was observed in 26.6% .
there was a significant relationship between the rate of traffic accidents by professionals / year and ahi , lowest saturation , desaturation index , and arousal index .
snoring , which is one of the signals present in osas , has been associated with increased risk for accidents and morbidity .
a study conducted in hungary found that snoring is common in the adult population . through interviews ,
the study showed that especially loud snoring with breathing pauses was strongly associated with health impairment , higher comorbidity , daytime sleepiness , and a higher frequency of accidents .
a retrospective evaluation of snoring workers due to suggestive symptoms of osas found a significantly higher frequency of occupational accidents among these professionals when compared to the general population of snorers . in this study ,
all subjects underwent overnight polysomnography in a sleep laboratory and , interestingly , the risk of accidents was high among heavy snorers without apnea and patients with osas .
a prospective study found that men who reported both snoring and excessive daytime sleepiness were with an increased risk of labor accidents during the 10 years of follow - up .
the high risk of traffic accidents among drowsy drivers was mainly determined by the respiratory effort - related arousals ( rera ) than by the presence of apneas and hypopneas .
the reras are secondary to upper airway obstructions during sleep and can occur in the absence of apneas and hypopneas , causing excessive daytime sleepiness .
studies using the esophageal pressure measure were performed in habitually sleepy drivers and drivers without this condition .
sleepy drivers with apnea had higher accident rates in five years than drivers in the control group .
nevertheless , a high rate of rera , but not sleep apnea , was still a risk factor among drivers habitually sleepy .
these findings confirm the importance of identifying rera in routine examinations in sleep laboratories . just like it occurs with civilians ,
excessive sleepiness is a risk to the safety of military that operate dangerous vehicles , machinery , or carry firearms .
military with untreated osa are also at risk for suffering from decreased mental alertness and decreased cognitive function due to drowsiness .
military with mild - to - moderate osa and upper airway resistance syndrome ( uars ) often have abnormal results in the maintenance of wakefulness test and therefore have a pathological tendency to fall asleep .
a study conducted in 2009 among military personnel identified that 32% of the sample had uars and 68% osa .
the patient should be informed about the risks and an appropriate treatment should be instituted .
in addition , the doctor should provide a follow - up plan to determine if the treatment has decreased the patient 's risk for accidents .
although many investigations have pointed out that treatment of primary snoring and osas with cpap or oa contributes to the reduction of vehicle and labor accidents , this review did not find any studies evaluating the effectiveness of oa regarding this outcome .
like several other medical treatments , the efficacy of cpap or oa depends on the degree of identification of osas and the degree of adherence to the treatment among the diagnosed individuals .
treatment with cpap reduces the risk of accidents because it is used by the patient .
nonetheless , adherence to cpap continues to be a major problem when treating osas , although more recent data suggest that adherence may have improved in recent years .
however , a recent study found that only 5% of professional drivers diagnosed with osas showed adequate adherence to cpap .
it is important to include the patients in the treatment decision , offering more than one type of therapy for patients with osa . despite the residual apneas with the use of oa , or the highest rate of effectiveness of cpap in reducing ahi , the similarities between the results of such treatments may be related to the hours of use per night .
the oa which are considered to have partial efficacy , when used for prolonged hours may lead to similar outcomes when compared with cpap .
although some predictors of success with oa have been evaluated , further studies are needed to better predict which patient will have a higher level of success with the oa therapy .
less obese patients with mild sleep apnea and certain craniofacial characteristics such as mandibular retrognathia proved to be good candidates for the oa therapy .
when analyzing the economic impact of osas , it was highlighted that there was a lack of clarity concerning the epidemiology of accidents in patients correctly treated with cpap .
furthermore , it was suggested that future studies are needed to evaluate the improvement in the labor activities of osas patients before and after treatment , as well as studies evaluating the cost - effectiveness between surgical and clinical treatments .
most studies regarding the adherence to oa use subjective measures to evaluate the therapy compliance .
nevertheless , a study conducted in 2012 objectively evaluated the use of oa among patients undergoing therapy for osa by means of a heat - sensitive microsensor , which was attached to the oa .
the overall mean rate of oa use was 6.7 1.3 h per day with a regular users rate of 82% . despite not having a statistically significant difference between the self - report and the use of microsensor ,
the safety and feasibility of using this device to objectively measure the oa 's compliance was highlighted .
although , according to a systematic review , many studies have demonstrated the effectiveness of oa in reducing daytime sleepiness and improve the neurocognitive function , the federal motor carrier safety administration does not recommend the use of the oa in the treatment of osas among professional drivers , once there is no scientific evidence associating the reduction of accidents by using these devices and it is difficult to assess the patients treatment adherence . furthermore , an updated version of the thoracic society clinical practice guideline recommended the use of cpap to reduce accidents , but again the oa were not listed due to lack of scientific evidence about the effects of this therapy on the risk of accidents . the osas treatment options may become limited by the conditions of the work environment .
the diagnosis of sleep - disordered breathing may affect the deployable strength of the military personnel due to the difficulty they might face concerning the use of cpap .
military deployed in desert environment are at a risk of inhaling airborne particulate matter that can harm their health . in this condition ,
therefore , alternatives to solve this problem such as using foam filters have been tested .
obstructive sleep apnea affects the daily lives of millions of people around the world and presents a growing economic impact .
the evidence linking osas with various public health problems such as obesity , diabetes , depression , cardiovascular disease , and accidents has increased .
it is estimated that in the united states , the total costs attributable to sleep apnea - related accidents is quite high . in 2000
, 1400 people died due to vehicular collisions and in 2004 these accidents had a cost of $ 15.9 billion . with regard to the management of accidents
, it is estimated that the treatment with cpap for all drivers who suffer from osas would be of $ 3.18 billion . even taking into account a treatment efficiency of only 70%
, there would be a reduction of $ 11.1 billion in collision costs and 980 lives would be saved per year .
the literature suggests that treating 500 patients for three years would result in savings more than $ 1,000 .
a more recent analysis of osas treatment showed significantly lower costs of the treatment plan .
in addition , it was also observed fewer disability claims ; cost reduction for disability and fewer lost days of work . a prospective study compared the effects of osas between men and women during 1994 - 2005 . an increased risk of absenteeism in subjects with sleep apnea was observed . in women ,
the major risk was present five years before diagnosis , whereas in men the major risk was observed one year before the diagnosis of osas .
education campaigns encouraging members of health plans to seek specific treatment for sleep - disordered breathing resulted in substantial savings .
dentists can play an important role in accident prevention through the detection of risk factors by screening their patients for osas , evaluating oral / jaws anatomical features , and screening for sleep disorders during the anamnesis .
untreated obstructive sleep apnea predisposes patients to various morbidities and consequently increases the use of health services . the risk assessment of osas among workers can help to reduce the national health care burden .
evidence suggests that patients with untreated sleep apnea require a greater amount of health resources .
moreover , adherence to treatment in patients with osas results in a significant reduction in hospitalizations and medical applications . in 2013
a study comparing the health effects after one month of cpap and oa therapy identified that despite the cpap therapy was more effective in reducing the ahi , the therapy with oa had greater adherence , hence both therapies showed similar results .
concerning cpap therapy , studies in several countries have evaluated its cost - effectiveness some patients have to try more than one treatment option before control of osas is reached .
treatment should be individualized and supported by scientific evidence , and the evaluation of cost - effectiveness is also required .
information about the therapy cost is important for the governments , transport , industry , and insurance agencies to plan actions to decrease the economic impact of untreated osas .
data on types of treatment for snoring and osas suggested that therapy with oa had lower costs when compared with other treatment modalities .
nonetheless , it has not been evaluated yet the use of oa associated with reduced risk of vehicle and labor accidents .
further studies should evaluate from a social perspective the loss of work productivity , increased absenteeism , insurance , and costs and assess the use of oa in preventing occupational accidents .
the cost - effectiveness of cpap was compared with the oa therapy and lifestyle advice using a method of quality - adjusted life year ( qaly ) in a life perspective . on average ,
therefore , regarding adults who suffer from moderate or severe symptomatic osa it was concluded that cpap has better cost - effectiveness when compared with oa and lifestyle advice .
the oa are now widely prescribed for the treatment of osas , either as a primary or as an alternative measure to those patients unwilling or unable to tolerate cpap therapy .
although cpap has been shown to be more effective than oa and highly cost - effective , there are increasing evidences that oa improve drowsiness , blood pressure , and indices of sleep - disordered breathing .
moreover , many patients who respond to both treatments generally prefer to use oa . despite the limited evidence on the cost - effectiveness of oa , through this literature review
it can be observed that oa are economically less attractive than cpap , but remain as a cost - effective treatment for patients who do not want or do not adhere to treatment with cpap .
this review highlights the fact that osa is a prevalent disorder among works , leads to increased risk of occupational accidents , greater use of health services , and has a significant impact on the economy .
furthermore , it has been shown to be cost - effective , improve the work performance , and reduce health burdens . regarding oa , despite showing an improvement in work performance
moreover , there is limited evidence of its cost - effectiveness and its effect on reducing the use of health services . due to the lack of evidence regarding the use of oa for occupational accidents ,
future research should focus on determining the cost - effectiveness , influence , and efficacy of these devices in preventing occupational accidents among workers who suffer from osa . | background : dental practitioners have a key role in the quality of life and prevention of occupational accidents of workers with obstructive sleep apnea syndrome ( osas).aim : the aim of this study was to review the impact of osas , the continuous positive airway pressure ( cpap ) therapy , and the evidence regarding the use of oral appliances ( oa ) on the health and safety of workers.materials and methods : searches were conducted in medline ( pubmed ) , lilacs and sci elo .
articles published from january 1980 to june 2014 were included.results:the research retrieved 2188 articles and 99 met the inclusion criteria .
an increase in occupational accidents due to reduced vigilance and attention in snorers and patients with osas was observed .
such involvements were related to excessive daytime sleepiness and neurocognitive function impairments .
the use of oa are less effective when compared with cpap , but the results related to excessive sleepiness and cognitive performance showed improvements similar to cpap .
treatments with oa showed greater patient compliance than the cpap therapy.conclusion:osas is a prevalent disorder among workers , leads to increased risk of occupational accidents , and has a significant impact on the economy .
the cpap therapy reduces the risk of occupational accidents .
the oa can improve the work performance ; but there is no scientific evidence associating its use with occupational accidents reduction .
future research should focus on determining the cost - effectiveness of oa as well as its influence and efficacy in preventing occupational accidents . |
ameloblastoma , a true neoplasm of enamel organ type tissue , is a slow growing but locally invasive benign epithelial tumor of jaws accounting for about 11% of odontogenic tumors .
ameloblastoma occurs over a broad age range with average age range being fourth decade of life .
radiographically , often presents as expansile lesion with a multilocular appearance and with thinning of the cortical plate . according to the 2005 histological classification of tumors of the world health organization , ameloblastoma
histopathological variants include follicular , plexiform , granular , basal cell , acanthomatous and desmoplastic ameloblastoma . granular cell ameloblastoma ( gca ) is a less common lesion accounting for 35% of all histologic subtypes of ameloblastoma
. this article attempts at highlighting this relatively less common tumor - gca involving the lower jaw .
a 55-year - old male patient reported with a painless swelling on right side of the lower jaw .
patient gave a history of swelling in mandibular right molar region 12 years back for which he got his molar extracted .
he developed a swelling in the same region a year later and was treated for the local infection with incision and drainage .
the swelling persisted for 6 years swelling and then gradually increased to the present size .
extraorally , the swelling was ovoid in shape , firm in consistency and extended from right mandibular molar region to anterior region of the mandible .
intraorally , the swelling extended from mandibular right third molar region to lower left first premolar area with obliteration of buccal and lingual vestibule [ figure 1 ] .
panoramic view revealed a large multilocular radiolucency extending from lower right third molar region to lower left first premolar region [ figure 2 ] .
an incisional biopsy was carried out which histopathologically revealed tumor cells arranged in form of follicles within a fibrous connective tissue stroma [ figure 3 ] .
the follicles were lined by tall columnar ameloblasts like cells organized in palisaded pattern and with stellate reticulum like cells in the center .
most of the follicles showed the presence of large granular cells forming the central mass of the tumor follicles [ figure 4 ] .
the lesion was surgically excised , and the gross specimen was sent for histopathological examination .
gross specimen revealed section of the mandible extending from lower right third molar region to lower left second premolar with buccal and lingual cortical plate expansion [ figure 5 ] . on further histopathological examination ,
clinical image shows intraoral swelling orthopantomogram showing multilocular swelling histopathological image shows follicles with central granular cells ( h and e , 10 ) histopathological image shows eosinophilic granular cells in the center of follicle and peripheral ameloblast like cells ( h and e )
central lesions develop more frequently in molar ramus region in mandible , in molar region in maxilla followed by maxillary sinus and floor of the nose .
gca is a relatively rare lesion and in most instances , it is found as an admixture with other histologic patterns , particularly follicular subtype .
there is a marked transformation of cytoplasm of stellate reticulum like cells so that they appear coarse granular and eosinophilic .
, a layer of stellate reticulum may be seen at the periphery separating the granular cells from tall columnar cells .
ultrastructural studies also suggest that these are lysosomal aggregates and are responsible for granularity of cells .
lysosomal aggregation within the cytoplasm may be due to dysfunction of either lysosomal enzyme or lysosome associated protein involved in enzyme activation , enzyme targeting or lysosomal biogenesis .
leading to accumulation of substrate that would normally be degraded in endosome lysosome system .
it was also considered that lysosomes might have resulted from some genetic alterations of granular cells .
it has been suggested that numerous lysosomes accumulate as a result of decrease in the ability of lysosomes to dispose the unwanted components that accumulates in the cell with age .
an increase in fibronectin expression has been observed in granular cells indicating granular cells changes could be associated with an age - related transformation .
authors suggest that the granularity in gca might be caused by increased apoptosis and associated phagocytosis by neighboring neoplastic cells .
balaji et al . have reported occurrence of numerous apoptotic cell fragments with condensed nuclei in granular cell clusters using annexin v , a marker to detect early apoptosis .
studies suggest a decreased expression of several apoptosis - related factors such as bcl-2 family proteins and p53 protein in ameloblastoma .
immunohistochemical studies have revealed that these granular cells and tall columnar cell lining the follicle are cytokeratin positive indicating epithelial in origin .
it has been suggested immunohistochemically granular cells are positive for cd68 , lysoyme and 1 antichymotrypsin but negative for vimentin , desmin , s-100 neuron - specific enolase ( nse ) and cd15 indicating cytoplasmic lysosomal aggregates are not of mesenchymal myogenic or neurogenic origin .
some studies have suggested the expression of laminin-5 in granular cells and a weak expression in peripheral cells .
the differential diagnosis of gca includes other oral lesions with a similar morphology of granular cell accumulation , including granular cell odontogenic tumor , granular cell tumor , and congenital epulis .
granular cell odontogenic tumor is a rare odontogenic neoplasm with a tendency to occur in the mandibular posterior region and is composed of granular cells and nests or islands of the odontogenic epithelium .
the granular cells are positive for vimentin , cd68 , lysozyme , muscle - specific actin , smooth muscle actin , calponin , neuron specific enolase , cd138 , and bcl-2 .
granular cell tumor is relatively rare benign neoplasm that occurs in any part of the body including orofacial region .
immunohistochemical studies of granular cell tumors suggest a neural or neuroectodermal origin of the granular cells .
histologically congenital epulis does show the presence of large cells with eosinophilic granular cytoplasm within fibrous connective tissue stroma , which stain positively for phosphotyrosine and are s-100 negative .
oncocytomas though rare in the jaws , possibility of occurrence can not be ruled out . in such rare cases , differential
previous studies suggest gca to be most aggressive lesion , whereas some studies suggest that the granular cell are just a transitional phase in life cycle of ameloblastoma , starting with normal stellate reticulum like cells , leading to production of granules and finally leading to degeneration and formation of cystic areas .
however , reichart et al . have reported a 33.3% recurrence rate for gca . a regular follow - up is important because of reports of recurrences even up to 8 years after initial treatment .
understanding the nature of granular cells not only in gca but also in similar lesions will aid in differentiating as well as understanding the clinical behavior of the lesion . | ameloblastoma is an epithelial odontogenic tumor exhibiting diverse microscopic pattern that occurs singly or in combination with other patterns .
this article describes a case of granular cell ameloblastoma ( gca ) involving mandible in a 55-year - old male .
the possibility of granular component is there in other odontogenic and nonodontogenic lesions .
sometimes dilemma exists in the diagnosis of such lesions .
the purpose of this article is to unveil the hidden characteristics in gca , which might help in differential diagnosis of gca . |
trypanosoma cruzi comprises a complex group of parasite populations circulating among humans , vectors , reservoirs , and wild and domestic animals .
this parasite is the causative agent of chagas disease or american trypanosomiasis and is transmitted through triatomine vectors , which are blood - sucking insects , when they feed on the vertebrate host . after an insect feeds on the blood of an infected vertebrate , the development cycle of the parasite begins in the intestinal tract of triatomines . in the anterior midgut ,
some epimastigotes multiply by longitudinal binary fission , and in the insect rectum , a new differentiation occurs ( metacyclogenesis process ) in which epimastigotes are transformed into metacyclic trypomastigotes .
these metacyclic trypomastigotes ( highly infectious ) are shed in feces and reach the bloodstream of a new vertebrate host after this host scratches an insect bite .
the organisms penetrate the mucosa where there are many macrophages ; after intense multiplication in the host cell in the form of amastigotes , they transform into trypomastigotes again , returning to the vertebrate circulation and completing the cycle .
these series of morphological and biochemical transformations in the life cycle may occur in response to external stimuli .
recently , reactive oxygen species ( ros ) and heme have been hypothesized to be important signaling molecules . in this way ,
protozoan parasites , which are specifically located in places where these molecules are constantly released , must evolve special mechanisms to take advantage of them .
this paper will focus on the principal features of heme in t. cruzi biology and how different forms of these parasites are susceptible to ros .
differentiation into each of the five larval stages and the adult stage of these organisms is determined by their food .
these blood - sucking insects ingest 6 to 12 times their original weight in blood .
usually , approximately 10 mm of heme bound to hemoglobin is obtained in a single ingestion .
heme is a ubiquitous molecule usually associated with polypeptide chains through interactions between the iron atom and histidine or methionine residues .
heme catalyzes many oxidation processes in biological systems and is very important in cellular functions , as it is involved in oxygen transport ( hemoglobin and myoglobin ) , in cellular respiration ( cytochromes ) , in antioxidant defenses ( peroxidases ) , in drug detoxification enzyme ( p450 ) , and cell signalling regulation ( nitric oxide synthase ) [ 6 , 7 ] . therefore , heme and hemeproteins are involved in basic functions such as oxygen sensitivity , cellular respiration , metabolism , growth , renewal , and cell differentiation , which are all essential for the survival of organisms .
moreover , heme is a toxic molecule due to its ability to generate reactive oxygen species and its amphiphilic features , to associate with lipid membranes , leading to altered membrane permeabilization and cell disruption [ 811 ] .
the literature reports that there are some organisms that depend on essential hemeproteins but lack a heme biosynthetic pathway in part or in total ; trypanosomatids are included in this group [ 12 , 13 ] .
in fact , biochemical and genomic studies have demonstrated the absence of key enzymes of heme biosynthesis in t. cruzi [ 14 , 15 ] . in this regard , it is plausible that these parasites take up heme from the midgut of their vector .
in fact , during the development of t. cruzi epimastigotes in the digestive tract of insects , parasites utilize exogenous growth factors . using ultrastructural studies ,
it has been noted that these factors are taken up by endocytosis via the flagellar pocket and the cytostome .
the cytostome , present in the anterior region of the cell near the flagellar pocket , is the preferred site of entry of bovine albumin and transferrin , and are reservosomes , the mature form of endosomes .
it has been shown through fluorescence microscopy using fluorescent heme analogues that entry is not modified by lowering the temperature , by preincubation with unlabeled hemoglobin or by reduction of atp production . on the other hand ,
the transport of heme is compromised by the addition of cyclosporine , an inhibitor of atp binding cassette- ( abc- ) type transporters .
this is the first evidence that heme uptake involves the activity of a p - glycoprotein ( pgp ) homologue , an abc transporter .
it has also been inferred that other insect trypanosomatids including crithidia deanei , crithidia oncopelti , and blastocrithidia culicis obtain haem from their bacterial endosymbionts .
although fluorescent analogue of heme is internalized faster than hemoglobin in t. cruzi , suggesting the existence of two different pathways used to target molecules , the intracellular traffic of heme is the same as other various molecules , including several proteins [ 18 , 20 ] .
heme internalization starts at the cytostome , involving vesicles that travel along the cell body ( early endosomes ) , and ends at the reservosomes , which have been described as a site for protein and lipid accumulation .
malaquias and oliveira showed that , when exposed to mitogenic factors present in fetal serum , t. cruzi cells are stimulated by phosphoinositide - specific phospholipase c ( pi - plc ) , leading to the accumulation of phosphatidylinositol 3-phosphate ( ip3 ) and diacylglycerol ( dag ) and increasing their proliferation .
recent studies have shown the importance of second messengers in differentiation of trypanosomatids , including t. brucei - induced camp ( adenosine 3-5 cyclic monophosphate ) .
several serine / threonine kinases , including a cyclin - dependent kinases and a camp - dependent protein kinase ( pka ) , phosphatidylinositol 3-kinase , a calcium - dependent protein kinase ( pkc ) , and a kinase dependent on calcium / calmodulin , have been identified in t. cruzi epimastigotes through biochemical studies , and in some cases , through molecular studies as well , such as pka [ 28 , 29 ] .
also in t. cruzi , before the differentiation of epimastigotes into metacyclic trypomastigotes , camp levels increase three- to fourfold inducing the differentiation of t. cruzi epimastigotes to metacyclic trypomastigotes .
it has been shown that heme , but not hemoglobin or its peptides , stimulates t. cruzi proliferation in vitro in a dose - dependent manner .
different strains were tested ( y and dm28c ) , and both increased in the same manner .
further , a wide heme concentration range was employed , and even at higher concentrations , cells proliferated following the heme addition .
the authors hypothesized that heme could drive t. cruzi proliferation through a kinase cascade .
heme - induced growth of epimastigotes is not affected by inhibitors of cgmp - dependent protein kinase ( pkg ) , pkc , pka , pi3k , or cyclin - dependent kinase
. moreover addition of kn 93 and myr - aip ( inhibitors of calmodulin kinase ) to a culture of these cells reduces the expected growth , indicating the involvement of calmodulin kinase in heme - mediated cell signaling .
furthermore , the authors showed that heme - induced t. cruzi growth is associated with camkii , demonstrating a signaling role for the heme molecule in the biological cycle of trypanosoma cruzi .
recently , heme was shown to modulate a ( na + k ) atpase , via heme receptor - mediated stimulation of the pi - plc / pkc signaling pathway in leishmania amazonensis .
on the other hand , in trypanosoma brucei brucei this biomolecule may be involved in nutritional control ; it was able to inhibit activity of ectonucleoside triphosphate diphosphohydrolases ( e - ntpdases ) , an enzyme that is involved in the generation of free adenosine outside of the cell , together with ecto-5-nucleotidase .
as a protozoan parasite of vertebrate and invertebrate hosts , t. cruzi is susceptible to a number of oxidative killing mechanisms , including reactive oxygen species ( ros ) .
ros can be produced during the degradation of hemoglobin in the midgut of insect vector as a consequence of the release of high amounts of heme or as a byproduct of t. cruzi aerobic metabolism [ 5 , 35 ] . during respiration ,
molecular oxygen can undergo partial reduction , giving rise to relatively stable species , by accepting one , two , or three electrons , with the formation of superoxide anions o2 , hydrogen peroxide ( h2o2 ) , and hydroxyl radicals ( oh ) , respectively .
high rates of o2 can also be produced by the nadph oxidase complex , which becomes active immediately after phagocytosis by macrophages .
superoxide radicals can also generate the formation of h2o2 by spontaneous or sod - catalyzed dismutation .
mitochondrial ros are recognized as the key element in cell signaling processes and in a variety of degenerative mechanisms .
the trypanosomatidae family is characterized by a single long mitochondrion with a dilated region known as the kinetoplast , in which mitochondrial dna ( kdna ) is observed . despite
these peculiar characteristics , mitochondria of trypanosomatids are able to generate and sustain a membrane potential comparable to mammalian mitochondria . like other trypanosomatids
, t. cruzi has an intricate antioxidant defense system that varies with their life stages and is distinct from its mammal host and insect vector in its complexity .
in contrast to their hosts , trypanosomatids lack gsh / glutathione reductase ( gr ) and thioredoxin / thioredoxin reductase systems .
their redox metabolism depends on a particular dithiol called trypanothione and its corresponding reductase , trypanothione reductase ( tryr ) .
moreover , t. cruzi lacks catalase and glutathione peroxidase ( gpx ) , two major eukaryotic enzymes employed in the detoxification of peroxides . in spite of the absence of these two enzymes , t. cruzi possesses two peroxiredoxins , an ascorbate - dependent hemoperoxidase , several distinct peroxidases , of which at least two share sequence homology with gpx , and four iron - containing superoxide dismutases ( sod ) . for a complete review of redox metabolism in t. cruzi ,
see . a controlled balance between extracellular ros production and the ability of the cell to deal with these oxidants may predict the success of certain life stages in colonization and survival within the host .
analysis of 10 strains from t. cruzi demonstrated a significant increase in trypanothione synthetase ( trys ) and in cytosolic and mitochondrial tryparedoxin peroxidase isoforms , during differentiation from the noninfective epimastigote to the infective metacyclic trypomastigote form .
moreover , these elevations in antioxidant enzymes were shown to be more pronounced in the virulent strains than in attenuated ones . at the same time , ascorbate peroxidase and tryr remained unchanged during the different life stages of the parasite .
these differences in sensitivity correlated with the genetic diversity between the lineages t. cruzi . a comparative study between two different strains of t. cruzi , the tulahuen strain ( t. cruzi vi , previously classified as t. cruzi i ) and the y strain ( t. cruzi ii ) , showed significant differences in the resistance to h2o2 treatment .
epimastigote forms of tulahuen strain were shown to be more resistant to h2o2 than y strain , presenting higher activity of glucose-6-phosphate dehydrogenase ( g6pdh ) , an enzyme implicated in the supply of nadph , due to proper function of the trypanothione - dependent system and an increase in the cytosolic tryparedoxin peroxidase ( tccpx ) content [ 35 , 44 ] .
interestingly , tulahuen strain was shown to be more susceptible to benznidazole , a well known prooxidant trypanocidal drug , than y strain [ 45 , 46 ] . in agreement with these findings
, the t. cruzi i strains col1.7g2 and silvio x-10 cl1 displayed more resistance to h2o2 treatment than the t. cruzi ii strains jg and esmeraldo cl3 .
nevertheless , in contrast to the phenotypes observed with the y and tulahuen strains , these differences could not be attributed to differences in the redox potential of the strains analyzed . in this case , the differential sensitivity to oxidative stress was suggested to be due to changes in the activity of msh2 , a central component of the dna mutation and mismatch repair ( mmr ) machinery .
the mmr has a key function in recognizing and repairing base mismatches and frame shift mismatches that escape dna polymerase proofreading during dna replication . with respect to life stage , t.
cruzi epimastigotes seem to be more susceptible to the generation of h2o2 resulting from xanthine oxidase activity in the serum of chagasic patients lacking a complement system .
the treatment of epimastigotes with this serum resulted in an inhibition of cell growth in vitro , a decrease in sod activity , and an increase in membrane lipid peroxidation .
interestingly , the same results were not observed when parasites were treated with serum from healthy individuals .
why epimastigotes have higher susceptibility to human serum than infective forms is unclear , but the exposure of epimastigotes to fresh human serum over a short period of time led to a decrease in cell respiration , loss of mitochondrial membrane potential , increased o2 production , and release of cytochrome c , a process characteristic of programmed cell death .
moreover , it seems that the mitochondrion has a fundamental role in epimastigote - dependent complement activation ; an accumulation of high amounts of ca inside the mitochondrial matrix was observed , causing partial dissipation of the inner membrane potential and o2 production .
in addition to causing an endogenous increase of o2 during contact of epimastigotes with human serum , this noninfective stage also triggers o2 formation by macrophages , with high , almost lethal , toxicity to the cell because of the formation of peroxynitrite [ 5254 ] . on the other hand ,
infective trypomastigotes may be less exposed to peroxynitrite , as these forms may not stimulate the respiratory burst efficiently .
nevertheless , internalization of t. cruzi trypomastigotes by macrophages may activate nadph oxidase , which is involved in o2 production and peroxynitrite formation .
conversely , tanaka et al . demonstrated that h2o2 is the main oxygen metabolite responsible for killing t. cruzi inside macrophages , and t. cruzi trypomastigotes were shown to be more resistant to killing by h2o2 than were the epimastigotes .
the ld50 at which epimastigotes were killed was 6.0 nmol / min / ml of h2o2 , while the ld50 for trypomastigotes was 8.7 nmol / min / ml of h2o2 in vitro .
exposure of metacyclic trypomastigotes to 70 m h2o2 for 6 h caused an increase of 46-fold in g6pdh specific activity , while g6pdh activity from epimastigote forms presented a time - dependent decrease at the same conditions .
it seems that trypomastigotes are more resistant to killing by activated primary macrophages or by increased oxygen radicals than epimastigotes .
nevertheless , overexpression of epimastigote tccpx increased parasite virulence and resistance to macrophage killing . in trypomastigotes , the increased expression of antioxidant enzymes may also be involved to the persistence of these forms in the serum [ 41 , 58 , 59 ] or inside macrophages during phagocytosis . in agreement with this thought
, trypomastigotes with tccpx overexpressed , caused an increase in parasitemia and tissue inflammation during mouse infections .
more severe infections were also observed within metastatic forms of leishmania ; this was suggested to be due to the functional activity of peroxiredoxin .
therefore t. cruzi antioxidant defense could be considered an important virulence factor [ 37 , 57 ] .
although t. cruzi epimastigotes are shown to be more sensitive to ros , these cells can tolerate various levels of oxidants .
pretreatment of t. cruzi epimastigotes with low h2o2 concentrations ( 1520 m ) allowed an increase in cell proliferation of parasites , accompanied by a transient adaptation response to higher h2o2 concentrations .
moreover , transient oxidative stress can also induce t. cruzi epimastigotes growth by heme stimulation via a mechanism mediated by a cam kinase ii - like pathway .
this adaptation mechanism could be related to increasing expression levels of arginine kinase , an enzyme involved in the interconversion between phosphoarginine , a molecule with high energetic potential like creatine , and atp .
the process was suggested to be independent of redox content , indicating the participation of an unknown stress response mechanism .
the drugs currently used against chagas disease are nifurtimox and benznidazole , two nitro chemotherapeutic agents described to have trypanocidal effects and an ability to generate ros .
ros generation may occur through the reduction of the nitro group by the action of nitro anion radical or hydronitroxide radical which then may react with molecular oxygen generating o2 .
susceptibility of t. cruzi to nifurtimox and benznidazole has been described as correlated with the levels of free and conjugated glutathione [ 63 , 65 ] .
treatment of t. cruzi cultures with nifurtimox or benznidazole resulted in a loss of reduced thiol compounds ( gsh , trypanothione and glutathionyl spermidine ) , which was suggested to be probably due to the conjugation of these compounds with reduced metabolites of the nitro drugs rather than an oxidation effect on thiol consumption [ 65 , 66 ] . besides , it was also observed that redox - cycling activity of nifurtimox was only acquired at high concentrations doses ( > 400 m ) , two orders of magnitude higher than that required for antiproliferative activity .
moreover , nifurtimox has been reported to act as an inhibitor of t. cruzi trypanothione reductase , an enzyme responsible for the maintenance of reduced state of the intracellular thiols [ 67 , 68 ] . the total amount of free or conjugated glutathione may vary greatly either between different strains of t. cruzi or between the different life stages of a unique strain , with the following differentiation sequence : epimastigote > trypomastigote > amastigote .
these differences in thiol contents could explain the diversity in resistance of t. cruzi stages to treatment with these drugs and in its sensibility to ros .
the resistance of t. cruzi to trypanocidal drugs can also be associated with higher expression of enzymatic antioxidants . in vitro - induced t. cruzi
resistant to benznidazole presented an increase in the expression of the cytosolic and mitochondrial tryparedoxin peroxidase isoforms and in fesod isoforms , compared with the correspondent sensitive lineage .
interestingly , these observations were not involved in naturally resistant strains [ 6971 ] . in t. brucei ,
null mutants for sodb1 ( cytosolic , glycosomal ) exhibited 3-fold increased susceptibility to nifurtimox than wild - type cells .
it seems that nifurtimox and benznidazole divert thiol compounds from their ability to act as free radical scavengers .
therefore the protection against the toxic effects of ros might rely on enzymatic antioxidant activities .
antioxidant defenses and drug susceptibility of most studied t. cruzi strains are summarized in table 1 . with respect to the search for alternative drugs for chagas disease , the activity of natural compounds such as naphthoquinones , natural products of several families of higher plants , has been extensively investigated . like nifurtimox and benznidazole ,
recently , three derivative compounds of c - allyl lawsone ( 2-hydroxy-3-allyl-1,4-naphthoquinone ) were shown to be effective against intracellular amastigotes , decreasing the percentage of infection in murine macrophages , with low toxicity to host cells .
indeed , it seems that this compound is involved in mitochondrial damage , accompanied by an increase in h2o2 generation .
epimastigotes were shown to be more resistant than trypomastigotes to treatment with these compounds , despite having a more sensitive mitochondrion and higher accumulation of h2o2 within the cells .
another type of naphthoquinone , an -lapachone derivative , was shown to have a trypanocidal effect .
this compound was tested against two strains of t. cruzi , the y strain ( t. cruzi ii ) and the colombian strain ( t. cruzi i ) , which presented higher resistance to the treatment than y. in line with these findings , the y strain is partially resistant and the colombian strain is highly resistant to the chemotherapeutic agents currently in use .
in contrast with the other naphthoquinones , this -lapachone derivative does not have the capacity to generate free radicals , instead , it might function in the inhibition of proteinases .
although sensibility to ros may be related to the different t. cruzi groups , in vitro analysis of prooxidant drugs susceptibility between t. cruzi i and t. cruzi ii strains showed no significant differences [ 45 , 46 ] .
however , correlation between the susceptibility to benznidazole in distinct genetic groups of t. cruzi has been described .
the subject is still controversial , and in this case , geographic distribution and phylogenetic distances of parasites must be considered .
it seems that these cells can deal with external addition of h2o2 , on the other hand , the generation of ros from mammalian sites like serum and the immune system represents a challenge to these cells .
for example , membrane - bound phosphatases from t. cruzi are more resistant to the addition of sublethal doses of hydrogen peroxide than trypanosoma rangeli phosphatase .
interestingly , the concentrations of trypanothione vary between 1.522.1 mm in epimastigotes , 0.5 mm in trypomastigotes , and 0.12 mm in amastigotes . at the same time
, there is an increase in the expression of antioxidant enzymes during the differentiation of t. cruzi from a noninfective form to the infective form , trypomastigotes [ 41 , 58 ] .
in contrast , stress - induced oxidant resistance in leishmania chagasi is not accompanied by an increase in ros scavengers , but instead is suggested to be associated with heat shock proteins like hsp70 [ 79 , 80 ] .
the mechanism by which t. cruzi escape from the oxidative burst of mammalian macrophages is still unknown ; nevertheless , exposure of phosphatidylserine on the surface of trypomastigotes surface induces a deactivating effect on macrophages .
this profile is also seen in apoptotic cells as a means to avoid anti - inflammatory responses .
there is a growing interest in understanding how ros could be involved in the signaling process that permits parasites to colonize such different microenvironments . in this way , especially for t. cruzi , the extreme heterogeneity of this population and its susceptibility to oxygen metabolites must be carefully noted .
these observations , in addition to their epidemiological significance , could permit the development of more effective drugs for the treatment of chagas disease . | trypanosoma cruzi , the protozoan responsible for chagas disease , has a complex life cycle comprehending two distinct hosts and a series of morphological and functional transformations .
hemoglobin degradation inside the insect vector releases high amounts of heme , and this molecule is known to exert a number of physiological functions . moreover
, the absence of its complete biosynthetic pathway in t. cruzi indicates heme as an essential molecule for this trypanosomatid survival . within the hosts ,
t. cruzi has to cope with sudden environmental changes especially in the redox status and heme is able to increase the basal production of reactive oxygen species ( ros ) which can be also produced as byproducts of the parasite aerobic metabolism . in this
regard , ros sensing is likely to be an important mechanism for the adaptation and interaction of these organisms with their hosts . in this paper
we discuss the main features of heme and ros susceptibility in t. cruzi biology . |
cutis marmorata telangiectatica congenita is an uncommon , congenital , vascular malformation composed of capillary and venous sized vessels .
it presents with a fixed reticulate erythema that is similar to physiologic cutis marmorata , however skin lesions do not resolve with warming of the skin surface .
when localized , the lesion tends to remain unilateral and do not cross the midline , and it may be sharply demarcated .
many associated anomalies have been reported to occur in individuals with cutis marmorata telangiectatica congenita .
we report here an eighty day old infant with cmtc involving left upper and lower limbs with underlying atrophic changes seen over the left extremities .
an eighty - day - old female child , first born to nonconsanguineous parents , presented with reduced growth of left upper and lower limbs .
physical examination revealed a fixed , purple , reticulated skin lesion involving left upper and lower limbs [ figure 1 ] with underlying atrophic changes seen over the left extremities [ figure 2 ] .
anthropometric measurements were within the normal limits except for the reduced left upper and lower limb girths .
parents were reassured about the benign nature of the skin lesion and the need for periodic follow up on outpatient basis .
fixed , purple , reticulated skin lesion seen in the left upper and lower limbs atrophic changes seen over the left upper and lower limbs
cutis marmorata telangiectatica congenita ( cmtc ) is an uncommon , congenital , vascular malformation first described by van lohuizen in 1922 .
the skin lesion usually manifests at birth but may also appear up to 3 months to 2 years of age .
however , many studies reported that this condition affects girls more than boys , but their number is minute and the difference is not statistically significant .
the pathogenesis of this condition is not very clear and the etiology may be multifactorial .
a genetic etiology has been suggested ; however it is generally considered a sporadic condition .
lethal gene hypothesis has been suggested by some authors for the patchy distribution of the lesion and its sporadic occurrence .
dermatological findings in cmtc include prominent veins , telangiectasias , cutaneous atrophy , ulceration , and hyperkeratosis . the presence of atrophy , skin ulceration , and sharp demarcation of a localized lesion that does not disappear after warming all distinguish cmtc from physiological cutis marmorata .
there is some controversy regarding these figures as some studies have included patients with definite genetic disorders , including macrocephaly and capillary malformation and there may be overestimation of these rates due to coincidental associated findings .
however , no data exists on the association between the size and severity of the lesion in cmtc and its relationship with dermatological and systemic anomalies .
asymmetry , especially of the limbs , is the most common systemic abnormality seen in cmtc
. the affected limb may be either atrophied or hypertrophied , and overlying cutaneous atrophy is frequently present .
syndactyly , tendinitis stenosans , hip dysplasia , club foot , and cleft palate are other skeletal defects reported to be associated with cmtc .
a detailed musculoskeletal examination is necessary to identify any of the above - mentioned skeletal defects .
our patient had reduced left upper limb and lower limb girth due to underlying atrophy .
the most common ocular association of cmtc is glaucoma , which has been detected in children with facial lesions .
vascular anomalies like port wine stains , angiokeratomas , hemangiomas , and sturge weber syndrome have been reported to be associated with cmtc .
this has led to the designation of a distinct subtype called macrocephaly - cmtc in 1997 .
other features of this syndrome are developmental delay , neonatal hypotonia , segmental overgrowth , syndactyly , asymmetry , and connective tissue defects .
more recently , this entity has been renamed as macrocephaly - capillary malformation , because the skin findings are more consistent with capillary malformation rather than true cmtc .
physicians should assess the development of the child and also measure the head circumference to rule out macrocephaly - capillary malformation .
the most common lesion presenting with reticulate erythema is cutis marmorata , which may be physiological and it disappears during early childhood .
persistent reticulate skin lesions are seen in children with down 's syndrome , de - lange syndrome , homocystinuria , and divry - van bogaert syndrome .
bockenheimer 's syndrome is characterized by diffuse phlebectasia presenting in early infancy and progressing to large painful venous ectasias .
adams oliver syndrome presents as generalized cmtc with associated cardiac , limb and scalp abnormalities .
klippel - trenaunay syndrome consists of vascular malformation , venectasia , and soft tissue hypertrophy .
capillary malformations such as reticular port wine stains , remain a very close differential diagnosis to cmtc .
cmtc tends to fade in color as age progresses , often within the first 2 years of life .
port wine stains have more distinct borders that do not fade and are not associated with underlying atrophy . neonatal lupus erythematosus and other vasculitides
may also enter the differential diagnosis of reticulate telangiectatic atrophy , but congenital lupus is bilateral and symmetrical , with a greater frequency of facial lesions . in our case ,
antinuclear antibodies and anti - ro / ssa antibodies were negative in both mother and child .
once diagnosed as cmtc and other associated anomalies ruled out , these children should be seen annually for a minimum period of 3 years . on follow - up
, limb girth and length measurements are to be monitored along with a thorough physical examination to rule out associated anomalies .
although the vascular lesion often lightens with time , the limb asymmetry tends to persist .
cmtc has a good prognosis with improvement of skin lesions occurring during the first 2 years of life .
this has been attributed to the maturation of the skin along with the growth of the child . | cutis marmorata telangiectatica congenita ( cmtc ) is an uncommon , congenital , vascular malformation , characterised by a fixed , generalised or localised , reticulate erythematous rash .
we report an eighty day old male child who presented with the above lesion involving the left upper and lower limbs with underlying atrophic changes . |
this nationwide survey was conducted in iran with the cooperation of the ministry of health and medical education , ministry of education and training , child growth and development research center , isfahan university of medical sciences , and endocrinology and metabolism research center of tehran university of medical sciences .
this study was conducted as part of a national school - based survey .
a comprehensive verbal description of the nature and purpose of the study was provided to the students , their parents and teachers .
ethical committees of tehran university of medical sciences and isfahan university of medical sciences reviewed and approved study protocols . | background : socioeconomic status ( ses ) is a major determinant of health inequality in children and adolescents .
the aim of this study was to evaluate the association of ses of family and living region with self - rated
health ( srh ) and life satisfaction ( ls ) among children and adolescents .
methods : this study was a part of the fourth survey of a national surveillance program , which was conducted in 30 provinces of iran in 2011 - 2012 .
ls and srh were assessed by a questionnaire based on the world health organization - global school - based student health survey ( who - gshs ) .
family ses was estimated using
principal component analysis ( pca ) and based on family assets , parental education and occupation , and type of
school .
region ses was calculated using pca and some variables including literacy rate , family assets and employment
rate .
results : out of 14,880 invited students , 13,486 ( participation rate : 90.6% ) completed the survey ; of whom , 49.2% were girls , and 75.6% were from urban areas with the mean sd age of 12.473.36 years .
in the multivariate model , ses of family and living region was associated with ls and good srh . in the full models , in
addition to all potential confounders ,
family and living region ses were included simultaneously . however ,
only the association of family ses with ls , and good srh remained statistically significant .
conclusion : the effect of families ses on srh and ls is more important than regional ses .
the presented patterns of srh and ls may be useful in developing better health policies and conducting complementary studies in this field . |
despite the fact that thanks to advancement in medicine , progression of treatment and care equipment , and the constant advancements in gynecology and obstetrics , premature neonates can have a better survival , leading to positive outcomes in pregnancy , the problem of complications and premature neonates still exists .
although weight less than 1500 g occurs in only 1 - 2% of the neonates , it accounts for a high proportion of neonatal mortality , and short- and long - term complications of childhood such as developmental defects .
according to the latest reports of who in 2006 , premature birth accounts for 31% of iranian neonates mortality .
this rate of low weight neonates mortality can be reduced by prevention of infection and provision of appropriate nutrition .
achievement of an appropriate and standard growth of neonates in a short time period and improvement of neural and physical development is among the important goals of premature neonates feeding . the important fact in premature neonates nutrition
is that in most of the cases , transfer of nutrients from the mother to the fetus occurs in the last gestational weeks leading to fetal weight gain ; therefore , the neonates with premature birth are deprived of such nutrition based on their gestational age of birth and mostly experience after birth growth disorder . among the major causes for
after birth growth disorder is the low calorie and protein received by the neonates on the first days after birth , of which compensation is difficult and often leads to serious complications such as a lifelong disorder in neural development , cerebral palsy , and mental retardation .
the quality and quantity of nutritional support in the first weeks after birth not only lead to a higher survival of premature babies and neonates in a very critical condition , but also facilitate their brain and neural development .
the maximum time interval of human brain growth is between the first trimester and 18 months post birth .
there are evidences showing that the brain is more vulnerable to nutritional deprivation and that not providing nutrients may lead to lowered iq and behavioral disorders in the long term . to receive correct nutrition and
with regard to lack of coordination in their sucking and swallowing , premature neonates need to receive adequate fluid and energy either through a venous line or gavage .
they also need a strong sucking ability , coordination in swallowing , blocking larynx and nasopharynx with epiglottis and uvula , and natural movements of the esophagus for oral feeding .
in addition , any feeding method not involving oral nutrition deprives the infant from experiencing sucking and swallowing opportunities and hungry - sated natural cycle ; the longer the non - oral feeding , the more difficult the nutritional problems .
unfortunately , most of the premature neonates do not receive adequate amounts of protein and calorie after birth and are involved in growth limitation and malnutrition , which leave notable effects on their height , weight , and nervous system .
inappropriate weight gain leads to prolonged hospitalization of neonates in the ward and , consequently , more risk of sepsis .
the risk of nutritional problems in neonates and , consequently , the incidence or progression of low weight due to premature birth , or treatment and care processes all act as a barrier in independent oral feeding of neonates .
for instance , tube feeding lowers sucking function and its motor development in premature neonates .
this type of feeding also prevents appropriate mother - neonate interaction during feeding . before discharge , the infants are usually able to take all of their needed nutrients through breastfeeding , which needs an intervention to facilitate their nutritional progression and to let them be discharged from the hospital earlier .
the time interval between initiation of oral feeding and full oral feeding can be a few days or months in premature neonates , leading to a prolonged hospitalization and mothers anxiety .
prolongation of hospitalization may also result in higher financial burden to the family and health system . during premature neonates hospitalization period in neonatal intensive care unit ( nicu ) ,
their feeding method may need a change in cases such as low - volume milk feeding , taking complements with milk , or cessation of mother 's milk due to prolonged hospitalization . in these cases , feeding should be administered through another method and not through breastfeeding .
cup feeding is applicable for the neonates who , despite having proper swallowing ability , do not have appropriate sucking .
it is also recommended for those neonates who can not be breastfed well to reinforce their sucking power .
palady is similar to a teaspoon with a tongue stud and is used for the neonates who can not be directly breastfed .
this tool is traditionally used in india to feed the neonates and is very healthy .
a study conducted in 2012 in india showed that preterm healthy neonates over 30 weeks of gestational age could be fed by palady and reach oral feeding earlier leading to their earlier transfer from nicu to their mothers .
there were no complications reported , such as vomiting and aspiration , among the neonates fed by palady and breastfeeding .
therefore , it seems that palady method has no conflict with breastfeeding . in a study conducted in england in 2007 ,
the results showed that the neonates received a lower volume of milk in palady method compared to bottle feeding ( due to high amount of wasted milk ) and more time was consumed in palady method to feed the neonate .
a study in india showed that the infants fed by palady received the maximum volume of milk in the shortest possible time , and cup feeding had the highest milk wastage .
the infants also experienced a longer period of calmness . with regard to the controversial results of studies conducted on the volume of mother 's milk received through palady and cup methods , and as the neonates are fed by cups in few nicus and no study aiming at comparison of the two feeding methods concerning weight gain and reaching full oral feeding
was found , the researcher conducted the present study to investigate the effect of palady and cup feeding methods on premature neonates weight gain and their reaching full oral feeding time interval .
this is a clinical trial irct registration number irct2015090518561n4 that was conducted on 69 premature neonates in the nicus of al - zahra and shahid beheshti hospitals of isfahan in may - september 2014 after obtaining an informed consent from the subjects .
the study was conducted on 69 premature neonates aged 29 - 32 gestational weeks , selected through convenient sampling .
the subjects were assigned to cup ( n = 34 ) and palady ( n = 35 ) feeding groups by random allocation ( lotto ) .
inclusion criteria were : birth weight 900 - 1000 g , gestational age 29 - 31 weeks ( fertilization age was 32 weeks and did not exceed 33 weeks ) , exclusive breastfeeding or feeding with enriched mother 's milk , neonates hemoglobin not lower than 8 mg / dl and hematocrit not less than 30 , iranian nationality , absence of severe disabling conditions such as cerebral hemorrhage ( grade ii and iii ) , or congenital defects , and no limitation in feeding with mother 's milk .
exclusion criteria were : parents loss of interest to continue in the study , neonates death or critical clinical conditions , neonates discharge before the end of study , and a sudden change affecting neonates nutritional status , such as cerebral hemorrhage or intestinal problems such as necrotizing enterocolitis .
researcher began the intervention after explanation of the research goal and method to neonates parents and obtaining their consent .
data collection tool was a demographic information record note , neonates feeding checklist , and neonates weight monitoring checklist . from the first day after birth , intravenous full nutrition or total parental nutrition ( tpn ) was started based on a standard protocol for the neonates in both groups . the subjects meeting the inclusion criteria received either cup or palady feeding according to relevant physician 's order recorded in neonates medical file . in each shift ,
one oral feeding was administrated ( 3 times a day ) for seven sequential days ( total of 21 feedings through cup or palady method ) .
it should be noted that according to physician 's order , breastfeeding was not administered at all during 7 days of the study . before intervention ,
the researcher washed hands and hugged the neonate in semi - follower 's position based on hands hygiene compliance instruction and used a neonate apron around the neonates neck .
the cup was gently laid on neonate 's lower lip so that the milk would touch the neonate 's lip in a way that the neonate could actively swallow milk .
this process continued until the entire required amount of milk was taken . for palady method , the researcher washed hands , and palady was held by its side and laid on neonate 's mouth corner .
full oral feeding refers to 8 times of oral feeding in a day with observation of no oxygenation disorder , apnea , and bradycardia in neonates during feeding .
the neonates were weighed in equal conditions with identical scales ( seca digital scales , made in germany ; with an accuracy of 10 g ) in nicu before they were fed and while they were not wearing apron , and their weights were recorded .
data were analyzed by descriptive ( frequency distribution tables , distribution , mean , and sd ) and inferential ( chi - square , mann - whitney , and independent t - tests ) statistical tests in spss 14 .
the present study was approved by the ethics committee of isfahan university of medical sciences and all ethical considerations including subjects volunteer participation and confidentiality of their data were respected .
the present study was approved by the ethics committee of isfahan university of medical sciences and all ethical considerations including subjects volunteer participation and confidentiality of their data were respected .
the results showed a significant difference in subjects demographic variables such as sex , gestational age , number of phototherapy days , rank of birth , delivery mode , mother 's disease , multiple neonates , mother 's smoking and addiction , type of feeding , phototherapy , and antibiotic therapy between two groups ( mann - whitney , chi - square , and independent t - tests ) .
independent t - test showed that mean length of hospitalization and the time interval to reach full oral feeding were significantly lower in palady group compared to the cup group ( p < 0.001 ) [ table 1 ] .
independent t - test showed that mean weight change in neonates was significantly higher 7 days after intervention in the palady group than in cup group , compared to the beginning of intervention ( p < 0.001 ) [ table 2 ] .
means of hospitalization length and time interval to reach full oral feeding comparison of weights 1 and 7 days after intervention in the two groups , time to reach full oral feeding compared to the first day after intervention , weight on the 7 day after birth compared to birth weight in the two groups
the present study investigated the effect of palady and cup feeding on premature neonates weight gain and reaching full oral feeding time interval .
results show that weight gain and the time interval to reach full oral feeding were significantly lower in palady group compared to the cup group .
mean weight change in neonates was significantly higher in palady group 7 days after beginning the intervention , compared to the cup group .
a study in 2012 showed that premature neonates with gestational age of 30 weeks could be fed by palady from the second day after birth .
the authors reported that palady feeding could improve premature neonates nutritional function within a couple of days , so that they could be transferred to their mothers .
the fact reported in the study that premature neonates fed by palady could reach full oral feeding earlier is in line with the present study .
the authors suggested feeding the neonates with physiological stability and a gestational age of 30 weeks through palady method from the second day post birth . in the present study ,
the neonates with approximately 30 weeks of gestational age were started on palady feeding based on relevant physician 's order .
most of the studies have investigated the volume of milk taken and the amount of mother 's milk wasted in palady and cup feeding .
narayaran et al . showed that the neonates on palady feeding had more weight gain as they received the highest amount of milk in the shortest time and had longer periods of calmness .
the highest wastage of milk was found in neonates fed through cup feeding , which is consistent with the present study result .
but the time interval of reaching full oral feeding was not compared in neonates being fed by palady and cup methods .
, in a pilot study on premature neonates , concluded that the neonates received lower volume of milk in palady method compared to bottle feeding , and palady method took more time that could lead to less weight gain , which is not in line with the present study result .
a study conducted in turkey in 2013 showed no significant difference in the neonates fed by cup and bottle concerning weight gain , nutritional problems , and the time consumed for feeding .
the authors also reported that cup feeding significantly increased the probability of exclusive feeding with mother 's milk in premature neonates 3 and 6 months after discharge .
they suggested using cup feeding as a transitive traditional method to feed premature neonates during their hospitalization .
compared the effects of bottle and cup feeding on oxygenation and weight gain in premature neonates and reported no significant difference between groups in the weight gained during the first week of oral feeding . meanwhile ,
better effect of cup feeding , compared to bottle feeding , was revealed when the neonates were discharged and they showed more interest in breastfeeding .
a study in tabriz , iran , conducted in 2012 showed that the group that had increased milk volume of 30 ml / kg / day fared better concerning the time needed for reaching birth weight and full oral feeding , compared to the other group . although there is a bulk of research on premature neonates feeding , there is no consensus on the feeding methods and the age of beginning oral feeding in premature neonates .
our obtained results show that the time interval to reach full oral feeding was shorter in palady group compared to cup feeding .
change in mean weight was higher in palady group subjects 7 days after beginning the intervention , compared to that at the beginning of intervention and the cup group .
therefore , palady method is suggested to feed premature neonates with stable physiological condition from the second day after birth or with a gestational age of 30 weeks .
meanwhile , further studies with a larger sample size of premature neonates are needed before recommending this method as a routine .
therefore , conducting another study with a higher number of subjects and focusing on low birth weight infants , and comparing its results with the present study are suggested .
based on the obtained results , it can be concluded that administration of palady feeding for premature neonates with physiological stability at 30 weeks of gestational age in nicu leads to increased weight gain and a shorter time interval to reach full oral feeding .
| background : premature neonates feeding is of great importance due to its effective role in their growth .
these neonates should reach an independent oral nutrition stage before being discharged from the neonatal intensive care unit .
therefore , the researcher decided to conduct a study on the effect of palady and cup feeding on premature neonates weight gain and their reaching full oral feeding time interval.materials and methods : this is a clinical trial with a quantitative design conducted on 69 premature infants ( gestational age between 29 and 32 weeks ) who were assigned to cup ( n = 34 ) and palady ( n = 35 ) feeding groups through random allocation .
the first feeding was administrated either by cup or palady method in each shift within seven sequential days ( total of 21 cup and palady feedings ) .
then , the rest of feeding was administrated by gavage.results:mean hospitalization time ( cup = 39.01 and palady = 30.4 ; p < 0.001 ) and mean time interval to reach full oral feeding ( cup = 33.7 and palady = 24.1 ; p < 0.001 ) were significantly lower in palady group compared to cup group .
mean weight changes of neonates 7 weeks after the intervention compared to those in the beginning of the intervention were significantly more in palady group compared to the cup group ( cup = 146.7 and palady = 198.8 ; p < 0.001).conclusions : the neonates in palady group reached full oral feeding earlier than those of cup group .
subjects weight gain was also higher in palady group compared to the cup group .
premature neonates with over 30 weeks of gestational age and physiological stability can be fed by palady . |
ragweed pollen is a major cause of respiratory allergy . in the pioneering age of allergy in the 19th century , when blackley discovered that grass pollen was the cause of hay fever , wyman demonstrated that the so - called autumnal catarrh ( hay fever ) was due to ragweed pollen.1 ragweed has optimal characteristics to cause allergy because its pollen is able to induce respiratory allergy starting from concentrations as low as five to ten pollen grains per cubic meter of air and because each plant ( as demonstrated for ambrosia artemisiifolia ) can produce up to 60,000 seeds , which can germinate even after lying up to 40 years in the ground.2 for a long time , ragweed allergy was apparently confined to northern america,3 but in the last few decades , a worldwide diffusion of this plant occurred . in europe , the four species of ragweed , a. artemisiifolia ( short ragweed ) , ambrosia trifida ( giant ragweed ) , ambrosia coronopifolia ( perennial ragweed ) , and ambrosia tenuifolia ( slimleaf bur ragweed ) , were accidentally introduced to europe , where previously only ambrosia maritima was known.4 ragweed allergy was first detected in the lyon region in france,5 followed by northern italy , austria , and hungary,6 and more recently , switzerland.7 in italy , a spreading of this allergy also to central regions was found , mainly caused by long distance transport of pollen.8 these aspects make ragweed allergy an individual and social burden in italy , which needs effective treatments . in this study
, we aimed to evaluate the degree of nasal inflammation , assessed by nasal cytology , in children with allergic rhinitis ( ar ) from ragweed pollen according to being monosensitized or polysensitized , ie , sensitized also to grass pollen .
oral informed consent was obtained by both parents before entering the study , and the study was conducted in accordance with good clinical practice guidelines .
allergic sensitization was evaluated by skin prick tests performed by allergen extracts from stallergenes ( antony , france ) using a complete panel of inhalant allergens , which included for grasses dactylis glomerata , phleum pratense , anthoxanthum odoratum , poa pratensis , and lolium perenne . to be included in the study
, the patients must not have any other positive tests in addition to those for grass and ragweed pollen .
the symptomatic periods in the area where patients live are from april to june for grass pollen and from late august to early october for ragweed pollen .
all patients were allowed to use antihistamines as needed to treat their symptoms , while corticosteroids were not permitted to avoid interference with nasal cytology .
the severity of ar was assessed according to the allergic rhinitis and its impact on asthma ( aria ) guidelines,9 and comorbidities were also evaluated .
the local ethical committee , luigi sacco hospital , milan , italy , after being informed about the procedures to be carried out gave the authorization to perform the study .
parents or legal guardians gave their written informed consent allowing the inclusion of children in the study .
in all study subjects , nasal cytology was performed by anterior rhinoscopy using a nasal speculum and adequate lighting .
the cytological sampling consists of collecting the nasal mucosa surface cells by scraping from the middle portion of the inferior turbinate using a rhino - probe ( arlington scientific , springville , ut , usa ) .
when the sampling is obtained , the material is placed on a glass slide , fixed by air drying , and stained using the may - grnwald - giemsa method , which allows the detection of all the cellular components of the nasal mucosa , including those cells that are associated with the immune inflammation process ( such as neutrophils , eosinophils , lymphocytes / plasma cells , and mast cells ) .
the slide is then observed through a light microscope supplied with an object - glass , able to magnify up to 1,000 . for the rhinocytogram analysis ,
at least 50 microscopic fields have to be read in order to detect all the cells present in the sample.10 the sampling was performed in all subjects in mid - may and mid - september , which are periods corresponding to the peak of symptoms from grass pollen and ragweed pollen , respectively , in italy . in the same time periods , the total nasal symptom score as reported by ford
et al11 was calculated for each patient by the sum of four individual scores , nasal congestion , nasal itching , rhinorrhea , and sneezing , in which each symptom was scored on a scale of 03 .
the comparison between the two groups of patients for the variables of the continuous type was performed by means of student s t - test by calculating the 95% confidence interval . in the case of nonhomogeneity of the variances of the two groups , the nonparametric mann
the analysis of discrete or nominal parameters was performed using the fisher s exact test or the chi - square test .
oral informed consent was obtained by both parents before entering the study , and the study was conducted in accordance with good clinical practice guidelines .
allergic sensitization was evaluated by skin prick tests performed by allergen extracts from stallergenes ( antony , france ) using a complete panel of inhalant allergens , which included for grasses dactylis glomerata , phleum pratense , anthoxanthum odoratum , poa pratensis , and lolium perenne . to be included in the study
, the patients must not have any other positive tests in addition to those for grass and ragweed pollen .
the symptomatic periods in the area where patients live are from april to june for grass pollen and from late august to early october for ragweed pollen .
all patients were allowed to use antihistamines as needed to treat their symptoms , while corticosteroids were not permitted to avoid interference with nasal cytology .
the severity of ar was assessed according to the allergic rhinitis and its impact on asthma ( aria ) guidelines,9 and comorbidities were also evaluated .
the local ethical committee , luigi sacco hospital , milan , italy , after being informed about the procedures to be carried out gave the authorization to perform the study .
parents or legal guardians gave their written informed consent allowing the inclusion of children in the study .
in all study subjects , nasal cytology was performed by anterior rhinoscopy using a nasal speculum and adequate lighting .
the cytological sampling consists of collecting the nasal mucosa surface cells by scraping from the middle portion of the inferior turbinate using a rhino - probe ( arlington scientific , springville , ut , usa ) .
when the sampling is obtained , the material is placed on a glass slide , fixed by air drying , and stained using the may - grnwald - giemsa method , which allows the detection of all the cellular components of the nasal mucosa , including those cells that are associated with the immune inflammation process ( such as neutrophils , eosinophils , lymphocytes / plasma cells , and mast cells ) .
the slide is then observed through a light microscope supplied with an object - glass , able to magnify up to 1,000 . for the rhinocytogram analysis ,
at least 50 microscopic fields have to be read in order to detect all the cells present in the sample.10 the sampling was performed in all subjects in mid - may and mid - september , which are periods corresponding to the peak of symptoms from grass pollen and ragweed pollen , respectively , in italy . in the same time periods , the total nasal symptom score as reported by ford et al11 was calculated for each patient by the sum of four individual scores , nasal congestion , nasal itching , rhinorrhea , and sneezing , in which each symptom was scored on a scale of 03 .
the comparison between the two groups of patients for the variables of the continuous type was performed by means of student s t - test by calculating the 95% confidence interval . in the case of nonhomogeneity of the variances of the two groups , the nonparametric mann
the analysis of discrete or nominal parameters was performed using the fisher s exact test or the chi - square test . a p - value of at least < 0.05 was considered significant .
twenty - four children were allergic to grass pollen and ragweed pollen and formed group a , while 23 were allergic only to ragweed pollen and formed group b ( table 1 ) .
the distribution of the clinical forms according to aria classification was as follows : in group a , four ( 16.7% ) children had a mild intermittent ar , one ( 4.2% ) a moderate - to - severe intermittent , eight ( 33.3% ) a mild persistent , and eleven ( 45.8% ) a moderate - to - severe persistent ; in group b , six ( 26.1% ) children had a mild intermittent ar , zero ( 0% ) a moderate - to - severe intermittent , 12 ( 52.2% ) a mild persistent , and five ( 21.7% ) a moderate - to - severe persistent .
asthma was present in 25% of subjects in group a and in 30.4% of subjects in group b. the number of the considered comorbidities in the two groups is reported in table 2 .
the mean total nasal symptom score was 8.54.7 in patients allergic only to ragweed and 8.05.2 in patients allergic to both grass and ragweed pollen .
the cell counts of neutrophils , eosinophils , lymphocytes / plasma cells , and mast cells , as assessed by nasal cytology , were high but not significantly different in subjects of group a and group b ( figure 1 ) .
the process of sensitization takes place when during seasonal exposure the antigenic proteins contained in pollen grains come into contact with antigen - presenting cells , which present them to t and b lymphocytes , with subsequent production of specific antibodies . in atopic subjects , the prevalence of a th2 cytokine pattern results in an ige response.12
then , the fc portion of ige antibodies binds to the high - affinity receptors on the surface of mast cells , and when subsequent exposure to the same allergens occurs , the cross - linking of two or more ige molecules elicits degranulation of mast cells with release of mediators and development of clinical symptoms .
this corresponds to the early phase of the allergic reaction , but the ensuing recruitment of inflammatory cells results in a late - phase reaction that sustains the ongoing symptomatology .
a phenomenon occurring in the initial phases of pollen allergy is the priming effect , by which the sensitivity of the nasal mucosa makes possible that a much reduced dose of allergen can elicit a full response.13 in patients allergic to grass pollen undergoing a nasal challenge with orchard ( d. glomerata ) before the pollen season , bousquet et al showed that subjects polysensitized also to other pollens , such as cypress , olive , and parietaria , had symptoms occurring earlier than subjects monosensitized to grass pollen , this confirming the priming effect.14 of interest , in the same years , it was reported that a priming effect was apparently absent in ragweed - allergic patients , as showed by similar symptom scores in early and late seasonal periods of ragweed pollination , but the patients were allergic only to ragweed.15 in this study , we compared the degree of inflammation , as evaluated by nasal cytology , in two groups of children monosensitized to ragweed pollen or sensitized to grass pollen and ragweed pollen , that have different pollination periods , with no other sensitization to inhalant allergens .
nasal cytology is a useful tool to evaluate ar , and a study demonstrated that the aria classification of ar severity is associated with different patterns of inflammatory cells , because patients with moderate - to - severe ar have an increased number of mast cells / lymphocytes , while the intermittent or persistent nature of the disease does not influence the cytological pattern.16 we chose to limit the study to children to avoid influence on nasal inflammation by factors other than allergy , particularly cigarette smoking .
concerning the main objective of the study , we found an abundant presence of inflammatory cells , but no significant difference was detected in their number , including neutrophils , eosinophils , mast cells , and lymphocytes / plasma cells , comparing children allergic only to ragweed and allergic to grass pollen and ragweed .
the high cell counts in both groups of children may have made it difficult to achieve a statistical significance , but still show that ragweed allergy alone elicits a grade of inflammation similar to double allergy to ragweed and grass pollen .
these findings do not disprove the existence of the priming effect in ragweed allergy , but they may suggest that it is not as robust as previously found for other pollens . on the other hand ,
ragweed pollen contains nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase that induces reactive oxygen species in mucosal cells independent of adaptive immunity , facilitating antigen - induced allergic inflammation.17 in the biology of plants , intrinsic pollen nadph oxidases are required to generate reactive oxygen species and induce pollen - tube growth.18 in addition , the climatic changes associated with the so - called global warming may cooperate , having being reported that ragweed plants grown in co2-enriched environments produced more allergenic pollens.19 such factors are likely to result in a higher inflammation induced by ragweed pollen , as confirmed by our data .
the findings from this study suggest that the nasal inflammation in children with ragweed - induced ar is not influenced by additional allergy to grass pollen .
therefore , ragweed pollen is able to elicit by itself a strong inflammatory response in allergic patients .
this suggests to manage this allergy by treatments not limited to symptomatic action but instead addressing the cause of inflammation , such as allergen - specific immunotherapy . | backgroundin patients polysensitized to pollen allergens , the priming effect , by which the sensitivity of the nasal mucosa to an allergen is increased by the previous exposure to another allergen , is a known phenomenon .
this study was aimed at evaluating the degree of nasal inflammation , assessed by nasal cytology , in children with allergic rhinitis ( ar ) from ragweed pollen according to being monosensitized or polysensitized.methodsthe study included 47 children . of them ,
24 suffered from ar caused by sensitization to grass pollen and ragweed pollen ( group a ) and 23 were sensitized only to ragweed pollen ( group b ) . in all patients , the severity of ar was assessed according to the allergic rhinitis and its impact on asthma guidelines , and comorbidities were also evaluated.resultsin group a , 16.7% of children had a mild intermittent ar , 4.2% a moderate - to - severe intermittent , 33.3% a mild persistent , and 45.8% a moderate - to - severe persistent ; in group b , 26.1% of children had a mild intermittent ar , 0% a moderate - to - severe intermittent , 52.2% a mild persistent , and 21.7% a moderate - to - severe persistent .
no significant difference was detected in the number of the considered comorbidities between the two groups .
the cell counts of neutrophils , eosinophils , lymphocytes / plasma cells , and mast cells were high but not significantly different in the two groups.conclusionthese findings show that the degree of nasal inflammation found in children with ragweed - induced ar is not influenced by additional allergy to grass pollen and confirm the previously reported absence of priming effect in ragweed allergy . |
malignant epithelioid hemangioendothelioma ( meh ) , or high - risk epithelioid hemangioendothelioma , is a low - to intermediate - grade vascular malignancy originally described by weiss and enzinger in 1982 as a vascular neoplasm of endothelial origin . since this original description ,
epithelioid hemangioendotheliomas have been reported in numerous locations , particularly the lungs , liver , soft tissues , viscera , skin and bone .
a few cases of meh have been documented in the head and neck region , including the neck , thyroid gland , larynx and scalp .
only 31 cases of meh in the oral cavity were described in the english literature between 1975 and 2013 .
further , only 11 cases were referred to meh of the maxillary or mandibular gingiva [ table 1 ] .
a 33-year - old male was referred to our oral and maxillofacial service in 2009 for the evaluation of a lesion on the anterior alveolar mucosa .
the growth site was associted with gingival recession ( miller 's class iii ) [ figure 1 ] .
note , the mandibular gingival recession bounded between right central incisor and first left premolar a panoramic radiographic review showed radiolucency between lateral incisor and second premolar roots .
a tissue punch biopsy was performed by removing two punches of tissue ( 0.7 cm 0.5 cm each ) .
optical projection tomography : radiolucency was appreciable between the left mandibular canine and first premolar teeth ( arrow ) ( a ) computed tomography scan ( occlusal view ) showing buccal cortical bone loss .
( b ) computed tomography showing buccal cortical bone loss a microscopic evaluation revealed fragments composed of a proliferation of spindled , ovoid and epithelioid cells arranged in nests , cords and short strands .
the neoplastic cells were large and polygonal with abundant granular cytoplasm , nuclear pleomorphism and nuclear hyperchromatism .
the lesion exhibited small vascular channels with a moderate cellular inflammatory infiltrate , composed mainly of lymphocytes , plasma cells and eosinophils surrounding the vessels [ figure 4 ] .
focal mitotic activity ( 3 mitotic figures per ten high - power fields ) was identified and the ki-67 score was 20% .
( a ) proliferation of ovoid and fusiform epithelioid cells with nuclear and cellular pleomorphism arranged in nests and cords forming small vascular channels ( h&e stain , 100 ) .
the neoplastic cells were positive for ( c ) : cd31 in both stromal and endothelial cells ( ihc stain , 100 ) and ( d ) : cd34 ( ihc stain , 100 ) immunohistochemistry revealed positivity for cd31 and cd34 and negativity for s100 , smooth muscle actin , hmb45 , ck7 , ck20 , p63 , cd20 , cd3 and cd68 .
interestingly , no signs of metastasis were detected ( cn0 ) by an investigation of the patient 's neck nodes , computed tomography and ultrasonography .
therefore , anterior mandibular bone excision , including eight teeth and all related soft tissues , was performed under general anesthesia .
a histologic examination of the lesion confirmed the diagnosis of meh . considering the aggressiveness of the disease , wide local excision was performed , with a 10-mm minimum margin of normal tissue .
mandibular reconstruction and stabilization were obtained by an iliac bone crest graft fixed with titanium reconstruction plates and screws [ figure 5 ] .
the patient was followed up at 15 days , 1 month , 3 months , 6 months and then every 6 months for 4 years with a clinical investigation of soft tissues , clinical and ultrasonographic evaluations of lymph nodes and radiographic assessment of bone healing .
( a - d ) surgical excision and reconstruction of the mandible with an iliac crest bone graft radiographic findings 4 years after bone reconstruction at 4 years after tumor excision , the patient showed lymphatic involvement in the left jugular - digastric and submandibular regions .
no fine needle aspiration biopsy was performed because of the certainty of the suspected diagnosis ; instead , surgical excision was performed under general anesthesia .
after ultrasonography and computed tomography , a bilateral selective neck dissection was performed and those nodes at levels 13 were excised ; in addition , the submandibular glands were removed bilaterally with all associated nodes [ figure 7 ] . of 86 nodes investigated , three ( homolateral iia neck level ) were positive for meh metastasis .
involvement of bone and mucosa by the malignant cells ( a ) h&e stain , 40 , ( b ) h&e stain , 400 .
cells positive for ( c ) ki-67 ( ihc stain , 200 ) and ( d ) cd 31 ( ihc stain , 100 ) .
no consistent clinical or histologic criteria for predicting the biologic behavior of mehs ( including increased numbers of mitotic figures or necrosis ) have been identified .
the lesions exhibit the following histopathologic features : the proliferation of rounded , eosinophilic endothelial cells with frequent cytoplasmic vacuolization , a distinctive epithelioid appearance and growth pattern potentially leading to a mistaken diagnosis of carcinoma , frequent angiocentricity and myxohyaline stroma .
however , certain features are believed to be associated with a more aggressive clinical outcome , including significant cellular atypia , mitotic activity > 1/10 high - power fields , an increased proportion of spindle tumor cells , focal necrosis and metaplastic bone formation .
a higher mortality rate is observed when epithelioid hemangioendotheliomas occur in bone , liver or the lungs .
because of their predominant morphological characteristics , mehs can be confused with other lesions , including hemangiomas or squamous cell carcinomas ; therefore , the importance of immunohistochemical analyses to establish a definitive diagnosis should be emphasized . in this context , a review of published cases verified that the majority of intraoral epithelioid hemangioendothelioma lesions were immunoreactive for cd34 , cd31 , factor viii - rag and vimentin , which characterize the epithelioid endothelial origin of this entity .
as in the literature review , our immunohistochemical findings indicated that the neoplastic cells were cd34 and cd31 .
the literature review indicated a mean age at diagnosis for meh of 17 13.01 years , suggesting a predisposition to disease in young people .
genetic and molecular investigations to identify genes involved in malignant transformation and metastatic events should be performed in future .
systemic metastases have been described in the literature at a rate of 21% , and a mortality rate of 17% has been described for cutaneous meh , in accordance with the histological aspects of the malignancy . in gingival meh ,
no metastases have been described in literature before our case report . because of the potential malignancy of epithelioid hemangioendotheliomas , wide local excision is the treatment of choice for oral cavity cases according to the literature .
surgeons must look for safe and clean margins ; conservative treatment is avoided due to the high rate of recurrence of the disease .
nonetheless , different types of treatment , including chemotherapy and radiotherapy , were proposed without evidence of efficacy . according to our review , the mean follow - up period was 30.11 30.29 months ( except for two papers in which the follow - up period was not reported / available ) .
the mean recurrence time was 21.33 23.44 months . given the possibility of recurrence and metastasis several years after clean and safe excision
, clinicians should apply an adequate follow - up period for this malignancy ( at least 5 years ) .
epithelioid hemangioendotheliomas have unpredictable behavior and accordingly with literature , when histology clearly address to a malignant type , clean and safe excision and investigation for metastases are mandatory . to improve diagnosis , execution of sentinel node biopsy through lymphoscintigraphy in meh cn0 cases could be performed ; specimen sub - seriation and monoclonal antibody marking would help in micrometastases recognition .
| malignant epithelioid hemangioendothelioma ( meh ) , or high - risk epithelioid hemangioendothelioma , is a low- to intermediate - grade vascular malignancy
. a few cases of meh have been documented in the head and neck region , including the neck , thyroid gland , larynx and scalp .
mehs are extremely rare in the oral cavity .
only 31 cases of meh in the oral cavity were described in english literature between 1975 and 2014 .
further , only eleven cases were referred to meh of the maxillary or mandibular gingiva .
no gingival meh metastases have been described in literature .
we report a literature review and a case of meh with a metastatic occurrence 4 years after surgical excision . |
anxiety and mood disorders are frequent among the general adult population and during the reproductive years a significant proportion of women might experience depressive and anxiety disorders .
the point prevalence for major and minor depression ranges from 8.5% to 11.0% during pregnancy 1 . in the overall population , including pregnant women , the most frequently prescribed drugs for treatment of these disorders are serotonin reuptake inhibitors ( sris ) antidepressants , in which are included selective serotonin reuptake inhibitors ( ssris ) ( fluoxetine , paroxetine , sertraline , citalopram , and fluvoxamine ) and serotonin norepinephrine reuptake inhibitors ( snris ) , such as venlafaxine and duloxetine 2 .
it has been suggested that antenatal exposure to these agents can be associated with several neonatal symptoms , comprised under the designation of postnatal adaptation syndrome 3 .
these symptoms include respiratory distress , diarrhea , emesis , feeding difficulties , hypoglycemia , hypothermia , jitteriness , tremor , irritability or agitation , hyperreflexia , hypotonia or hypertonia , excessive crying , sleep disturbances and seizures 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 and they have been specially reported after exposure to paroxetine , fluoxetine , and venlafaxine 3 . since 2005 ,
some studies have documented an increased risk for cardiac malformations in association to prenatal exposure to paroxetine , which were contradicted by recent published results 10 , 11 . with respect to the recently introduced antidepressants like snris , several published studies found similar outcomes to those described with the use of other antidepressant categories 3 , 10 , 11 , 12 .
however , it has been pointed that only a severe teratogenic effect could have been detected with the available data on these more recent antidepressants 12 .
13 observed that fluoxetine treatment during fetal development in mice could result in dilated cardiomyopathy , but in humans this was not reported previously .
we describe a case of cardiac dysfunction in a neonate exposed to prenatal snris in whom other possible causes were excluded .
a male term neonate was born to a mother who had been taking venlafaxine ( 75 mg / day ) and alprazolam ( 0.5 mg / day ) for treatment of depression and anxiety disorder , throughout pregnancy .
amniocentesis at 16 weeks revealed a normal karyotype and a fetal echocardiogram was normal at 19 and 31 weeks of gestational age .
the baby was born at 39 + 5 weeks gestational , by vacuumassisted delivery in the context of prolonged second stage of labor , with a birth weight of 3590 g ( 50th percentile ) and an apgar score of eight at the first minute and nine at the fifth minute .
he was admitted to the neonatal intensive care unit at 24 hours of life with respiratory distress syndrome and feeding difficulties .
physical examination revealed tachypnea , costal retraction , tachycardia , hepatomegaly , and poor suction reflexes .
initial laboratory evaluation , including complete blood count , plasma electrolytes , creactive protein , glycemia , ph , plasma lactate , serum transaminases , serum creatine kinase and summary urine examination was normal .
an echocardiogram in the second day of life documented dilatation of both ventricles with a left ventricular shortening fraction of 20% ( normal reference value 29% ) and mitral insufficiency . persistent pulmonary hypertension of the neonate was ruled out .
barr virus and parvovirus b19 ; negative stool pcr for enterovirus ; negative cytomegalovirus culture from urine ; negative serologies for herpes simplex 1 and 2 and human herpes virus 6 ; negative newborn screening for inborn errors of metabolism ( 25 diseases screened ) and normal thyroid function .
a cerebral ultrasound scan was normal and the karyotype was normal with negative fluorescence in situ hybridization for chromosome 22 .
serial echocardiograms showed progressive improvement of cardiac function , with a normal left ventricle shortening fraction of 35% and normalization of left ventricular end diastolic diameter at 12 days of age .
feeding difficulties improved slowly and the newborn achieved full oral feeding at the end of the first month of life . at 5 months of age , he was asymptomatic without medication and an echocardiogram showed good ventricular function , normal left ventricular end diastolic diameter , and no mitral insufficiency .
most of those with an identifiable cause will have either a genetic syndrome or an inborn error of metabolism .
other identified etiologies are viral myocarditis , endocrine diseases , neuromuscular disorders , toxic agents , nutritional deficiencies , and ischemic disorders ( coronary anomalies , prolonged arrhythmias ) . in the case reported , all these etiologies were discarded , namely the two major etiological groups .
neonatal metabolic screening in our country includes the most frequent inborn errors of metabolism related to cardiac dysfunction .
our patient had a transient but severe form of cardiac dysfunction , which is not usually associated with genetic syndromes or inborn errors of metabolism .
a possible role of serotonin in cardiac development and function has been identified and therefore a potential harmful effect of sri antidepressants on fetal heart 15 .
although recent data do not demonstrate teratogenic properties of antidepressants in general , for snris such as venlafaxine , the evidences on the level of risk are still numerically inconsistent and need to be clarified by further research .
three large prospective cohort studies 10 , 11 , 12 and three metaanalysis 3 , 16 , 17 that included the snri venlafaxine do not suggest an increased risk of congenital malformations , namely cardiac defects .
in addition , a recent nordic cohort study with emphasis on cardiac birth defects , reinforce these results 18 . on the other hand , a retrospective study suggests associations between periconceptional use of venlafaxine and some birth defects , including atrial septal defect and coarctation of the aorta 19 . in our patient ,
the concomitant presence of respiratory distress syndrome and feeding difficulties , as well as progressive improvement in cardiac function , suggesting acute and transitory rather than chronic or persistent damage to the myocardium , supports exposure to venlafaxine as a possible etiology in this context .
the mother was also taking alprazolam during the entire pregnancy and we could suspect that neonatal symptoms and cardiac dysfunction could be a result of this medication .
nevertheless , a metaanalysis about fetal safety of benzodiazepines published in 2011 , which synthesized nine studies with over one million pregnancies , concluded that these drugs do not appear to increase teratogenic risk in general nor cardiac dysfunction 20 .
one study found that the combination of ssris and benzodiazepines during pregnancy was associated with an elevated risk of congenital heart disease 21 .
another study showed that the combined use of benzodiazepines and ssris or venlafaxine during the first trimester did not increase the risk of birth defects 18 . on the other hand , it is debated whether some of sris adverse neonatal effects are caused by serotonin withdrawal or toxicity 4 , 6 , 7 , 8 .
the serotonin withdrawal syndrome ( neonatal abstinence syndrome ) onset is between 2 days to 1 month from birth and is characterized by sleep disturbances , neurological , gastrointestinal , motor , and somatic changes 4 , 8 .
exposure to venlafaxine during the third trimester of pregnancy carries a risk of approximately 30% for neonatal withdrawal syndrome 22 .
the serotonin toxicity syndrome begins in the first hours after birth and the most common symptoms are neurobehavioral changes and respiratory difficulties 4 , 8 .
based on this chronological and clinical definition , our case seems to fit in the probable toxicity effect rather than withdrawal .
neonates with srirelated syndrome are usually kept on a quiet low light environment with small feedings and motherinfant skintoskin contact .
neonates with severe symptoms need more aggressive treatment such as anticonvulsant therapy , intravenous fluids , and respiratory support 2 , 8 . our case required oxygen therapy , fluid restriction , furosemide , and nasogastric tube feeding for some days .
since the degree of maternal depression plays a significant role in child development , maintaining euthymic mood in the mother throughout pregnancy and preventing postpartum decompensation are important goals of treatment . in women who discontinue antidepressant treatment prior to conception , 68% experience a relapse during pregnancy 22 .
therefore , optimal treatment of maternal depression must remain a primary concern but potential risks of in utero exposure to antidepressant medications must be weighed against risks of untreated psychiatric illness 4 , 6 . to reduce or prevent neonatal symptoms ,
it has been suggested to taper or discontinue sris approximately 2 weeks prior to the due date and resume after delivery 2 , 4 , 8 .
some authors have also proposed a 3day clinical observation period for neonates exposed to sris during the last trimester of pregnancy 7 , 22 . in conclusion , although there is no evidence of causality between prenatal exposure to venlafaxine and cardiac dysfunction in the newborn , in the case described , it seems to be the most probable cause , since other etiologies were ruled out .
as published data on snris effects in the fetus is still conflicting and inconsistent , we emphasize the importance of reporting the upcoming cases , in order to give more insight into the understanding of this complex entity .
| key clinical messagevenlofaxine , a widely used antidepressant , is known to cause a withdrawal syndrome .
we present a case of neonatal transient ventricular dysfunction in a neonate exposed to venlafaxine in utero .
other causes of ventricular dysfunction were excluded .
neonatal ventricular dysfunction can be a possible side effect of maternal use of this drug . |
primary spinal cord tumors are one of the rarest categories of tumors , representing approximately 4 to 16% of all tumors arising from the central nervous system ( cns).1 an epidural location for lymphoma is observed in 0.1 to 6.5% of the cases .
we describe the diagnostic and management of a 45-year - old man who presented an anterior spinal syndrome secondary to an epidural lesion , which had a histological confirmation of a diffuse large b - cell lymphoma ( dlbcl ) .
a 45-year - old man presented with a new onset of high - intensity thoracic pain limiting his movements ; a month later he was accompanied by decrease in the strength of the left pelvic limb . after 2 months , he started with weakness of both lower limbs and impaired urinary sphincter control .
the neurologic examination demonstrated a minor motor impairment of lower limbs and reflexes were hyperactive .
anal sphincter tone was without damage , negative hoffman , trmner and babinski 's sign .
magnetic resonance images showed a paravertebral mass hypointense on t1 and t2 with homogeneous enhancement , which produced medullar compression at t3 ( figs . 1 and 2 ) .
( a ) sagittal thoracic spine t1-weighted image .
( b ) sagittal thoracic spine t2-weighted image.(c ) sagittal thoracic spine contrast material - enhanced t1-weighted image .
vertebral bodies show multiple irregular areas , hypointense on t1 and hypertense on t2 , with heterogeneous enhancement in postcontrast sequence mainly in the vertebral body of t3 , where we also observe a paravertebral mass hypointense on t1 and t2 , with homogeneous enhancement , which produces medullar compression .
( a ) axial thoracic spine t1-weighted image . ( b ) axial thoracic spine t2-weighted image .
the vertebral body at t3 level , with hypointense areas in t1 and hypertense in t2 , with heterogeneous enhancement in postcontrast sequence .
right epidural mass with homogeneous enhancement ; it involved the vertebral body and transverse apophysis that condition radicular compression at the right neural foramen and spinal cord compression the patient was taken into surgery , where we performed a neural decompression by posterior way and biopsy of the extradural spinal lesion .
intraoperatively , we found a fibrotic , gray - colored , vascularized lesion on the right side above the t3t4 level ( fig .
fibrotic , gray colored , vascularized lesion ; approximately 3 1.5 1 cm in diameter .
4 ) . inmunohistochemistry reported cd20 , bcl-2 , cd3 cd5 , cd10 , cd30 , and ki67 positive in 20% of neoplastic cells ( fig .
( b ) proliferation of atypical lymphoid cells with hyperchromatic nuclei and scant amount of cytoplasm is observed .
neoplastic cells were strongly positive for cd20 and bcl-2 , focally positive for cd5 and cd10 , and negative for cd30 ; cd3 was positive in small lymphocytes reactive appearance , and the cell proliferation marker ki67 positivity was found in 20% of neoplastic cells . during the postoperative course , the patient denied pain , walked again without weakness , and also regained control of the urinary sphincter .
the complementary studies were negative to another primary site of lymphoma ; the final diagnosis is a primary spine epidural lymphoma ( psel ) .
extranodal non - hodgkin 's lymphoma ( nhl ) accounts for 24 to 48% of all nhl.2 it is reported that lymphoma limited to the spinal epidural space participates in up to 3.3% of all lymphomas , 9% of epidural spinal tumors,3 and 0.9% of all extranodal nhl .
male preponderance of 69% and a male / female ratio of 2:7 were observed.4 patients clinically present most commonly in the fifth to seventh decade of life with more than 80% being older than 40 years.5 the midthoracic spine ( 69% ) is the most common site of involvement , followed by the lumbar spine ( 27% ) and the cervical spine ( 4%).3 according to this review of the literature , our patient fits in all this statistics .
the pathogenesis of psel is still unclear , and many hypothesis have been formulated , including the role of chronic inflammatory process , chronic infection , autoimmune disease , and the meningoepithelial component.6
dlbcl is the most common category , representing approximately 30% of all nhl .
the dlbcl involving the spinal epidural space could be categorized into germinal center b cell ( gcb ) type ( cd10 o cd10/bcl-6/mum1 ) and non - gcb ( cd10/bcl-6 o cd10/bcl-6/mum1 ) type .
the ratio of the gcb to the non - gcb subgroup was significantly higher in the spine dlbcl ( 17:9 ) than in cns dlbcl ( 5:16).7
spinal cord compression is an uncommon primary manifestation of nhl , occurring in less than 5% of newly diagnosed cases,8 and may be responsible for mayor morbidity in patients with nhl . back pain or radicular pain can be the first symptomatic manifestation , followed by neurologic deficits , such as paresis , ataxia , and sensory disturbance .
bladder and bowel disturbance appear only later in the course.9 two phases of clinical presentation have been described : in the first prodromal phase , they suffer from local pain in the back , sometimes accompanied by radicular pain to legs and abdomen , and this pain persisted for several months to 1 year ; then the phase of spinal cord compression followed and , within 2 to 8 weeks , the rapidly developing signs of compression.10 based on these clinical manifestations , our case was in the second phase , which can lead us to think that the beginning of the pathology was at least 1 year ago .
the diagnosis requires exclusion of a systemic primary lymphoma and does not apply to patients with immunodeficiency conditions.11 myelography and computed tomography , as well as magnetic resonance imaging ( mri ) are useful for detecting epidural compression .
mri appearance was isointense on t1-weighted images and iso- to hyperintense on t2-weighted images , with marked contrast enhancement ; occasionally , mri demonstrates an extraforaminal component.5
the proper management of patients with primary epidural nhl is not yet certain,2 and several studies suggest that patients with features of spinal cord compression require to be treated with surgery for the purpose of both tissue diagnosis and decompression.3 generally , acute paresis and/or loss of bladder / bowel control require emergency decompression of the spinal cord .
the surgical approach depends mainly on the location of the tumor , the degree of spinal cord compression , spinal instability , and the patient 's general condition.9
the researchers suggest that the combination therapy of surgical and radiotherapy and/or chemotherapy should be done.3 radiation therapy doses of at least 25 gy and chemotherapeutic agents such as cyclophosphamide , vincristine , and prednisone have been recommended.5
the prognosis for functional recovery in patients with spinal cord compression due to epidural nhl is relatively better than that of patients with metastatic carcinoma.2 it is reported in many series that nonambulant patients with spinal cord compression have only a 10 to 30% chance of becoming ambulant after therapy ; however , earlier diagnosis and treatment are associated with improved functional outcome.8
our patient presents an excellent evolution , and he has just begin with his chemotherapy and radiotherapy . according to the literature , the prognosis should be to recover motor and sensitive functionality , as our patient presented , but it still reserved about life .
primary spinal epidural lymphoma is a rare pathological entity , which must be considered on a middle - aged man who began with radicular compression .
the use of spinal decompression with biopsy is what promotes better outcome in patients with spinal compression secondary to psel ; however , subsequent handling is still debated , as being a disease with such low prevalence , the chemotherapy or radiation schemes have not yet been fully established . | background primary spinal epidural lymphoma ( psel ) is one of the rarest categories of tumors .
spinal cord compression is an uncommon primary manifestation and requires to be treated with surgery for the purpose of diagnosis and decompression .
case presentation a 45-year - old man presented with a new onset thoracic pain and progress to an anterior spinal syndrome with hypoesthesia and loss of thermalgesia .
magnetic resonance image showed a paravertebral mass that produces medullary compression at t3 .
the patient was taken up to surgery , where the pathology examination showed a diffuse large b - cell lymphoma .
conclusions psel is a pathological entity , which must be considered on a middle - aged man who began with radicular compression , and the treatment of choice is decompression and biopsy . the specific management has not been established yet , but the literature suggests chemotherapy and radiotherapy ; however , the outcome is unclear . |
headache is one of the common complaints for patients who seek treatment at the hospital .
they are classified to a series of diseases , although the exact pathophysiology of headaches remains unknown . the term cervicogenic headache ( ceh )
the classic ceh is characterized as recurrent , long - lasting , severe unilateral or bilateral headache originating from the neck .
the common cause of ceh is the external pressure over the route of the greater and/or the lesser and or the third occipital nerve and the atlantoaxial subluxation .
the injured the second cervical nerve ( c2 ) and c1c2 atlantoaxial joint or c2c3 zygapophysial joint can also induce symptoms .
the typical headache location is in the low occipital region and can radiate towards the periorbit and forehead .
the neuroanatomical basis is the trigeminocervical nucleus in the spinal gray matter of the spinal cord at the c1c3 level , where there is a convergence of the spinal cord neurons receiving both trigeminal and cervical input .
anatomical studies have suggested that the c2 nerve may be more susceptible to injury than the other structures . unlike the other cervical nerve , the c2 ganglion
is not protected within a bony structure , but is covered by the atlantoepistrophic ligament . postulated causes of compression and injury to this nerve include the following : ( 1 ) hypertrophy of the lamina or c1c2 articulation , ( 2 ) osteoarthritis and spondylosis , ( 3 ) hypertrophy of the atlantoepistrophic ligament , and ( 4 ) the movement ( rotary and extension ) between the posterior arches and articular facets of atlas and axis [ 35 ] .
the medial branch of the dorsal ramus of the c2 spinal nerve becomes the greater occipital nerve that classically innervates the occiput medially ; therefore , the region of the greater occipital nerve dominates is the common region where the pain originates from the c2 nerve . because etiologies of headache are so diverse , it is critical for a correct diagnosis to be made prior to initiation of therapy . it is challenging to differentiate between ceh and other forms of headache because not only is there variability in headache presentation , but there is also considerable symptom overlap .
in addition to nausea and unilateral headache , neck pain is also a common symptom of migraines .
the international headache society and international cervicogenic headache study group have both developed different classification systems for the diagnosis of ceh .
there are some slight differences between these classification systems . except for the obvious disorder of the clinical , laboratory and/or imaging evidence accepted as a valid cause of headache , diagnostic blockade of its nerve
the greater and even lesser occipital nerve injections have been recommended to diagnose and treat ceh .
pharmaceutical options range from non - steroidal anti - inflammatory drugs to acetaminophen , but often yield inconsistent results and serious side effects .
nerve blocks may be utilized to relieve pain and elucidate the origin of pain ; yet , they are only temporary measures .
however , the infection and symptoms associated with corticosteroid - related adverse effects make them unacceptable , the major method for the ceh population .
the conventional radiofrequency ( crf ) as a neurodestructive treatment for pain uses a constant high frequency and high temperature . unlike crf
, pulsed radiofrequency ( prf ) delivers high intensity currents in pulses , making heat dissipate so that temperatures are not neurodestructive .
it is neuromodulatory in nature and has not produced side effects , such as allodynia , hyperalgesia and dysesthesias .
these advantages make it an excellent choice for the treatment of referred pain involving the c2 ganglion .
the patients underwent a complete history and physical examination followed by diagnostic testing , such as x - ray and magnetic resonance image scan .
these patients failed to take conservative therapy , including physical therapy , medications , and previous nerve blocks .
pain relief of 90% or more was accepted as a positive response to the nerve blocks lasting for at least 30 min .
the patient was placed in a supine position on the procedure table and the lateral neck area was prepped and draped with sterile towels .
the skin was anesthetized with 1.5% lidocaine using a 25 g needle with 0.5-mm diameter over the location of c - arm fluoroscopic guidance ( flexiview 8800 ) .
sensory stimulation was then performed when the piercing needle reached the bone at 50 hz to ascertain whether the pain is similar to the regular pain that was located in the dermatome of the occipital .
prf was performed at 42 for 4 min as in fig . 1 .
1lateral view of c2 with needle tip directed toward vertebra lateral view of c2 with needle tip directed toward vertebra a 40-year - old woman suffered from left - sided posterior occipital pain .
the pain was described as originated from the neck region and always extended to the area around her left eye for 5 years with the negative x - ray results . a decrease from 5 to 0 on 010 intensity scale lasted for a 6-month period of time . a 66-year - old man presented with a history of left - sided posterior occipital pain with radiation in the periorbital , and parietal region sometimes for 1 year . a decrease from 40 on 010 intensity scale lasted for a 6-month period of time .
the pain was described as originated from the neck region and always extended to the area around her left eye for 5 years with the negative x - ray results . a decrease from 5 to 0 on 010 intensity scale lasted for a 6-month period of time .
a 66-year - old man presented with a history of left - sided posterior occipital pain with radiation in the periorbital , and parietal region sometimes for 1 year . a decrease from 40 on 010 intensity scale lasted for a 6-month period of time .
cervicogenic headache is a known clinical syndrome with multiple causes , but the common treatment has most often consisted of blockade of the greater occipital nerve , the lesser occipital nerve , stellate ganglion block , and other various blocks .
interruption of the cycle of pain and reflex muscle spasm are the most causes to relieve the symptoms ; however , these effects have a short duration .
injection of depot methylprednisolone into the greater and lesser occipital nerve region produced complete headache relief for a period of 1077 days .
most uncommon treatments that involve radiofrequency cervical zygapophyseal joint neurotomy and c2 and or c3 ganglionectomies are destructive [ 10 , 11 ] .
owing to the formation of neuromas , it is possible to cause subsequent hyperpathia and allodynia .
deep cervical plexus block and c2 cervical nerve root block showed the efficiency to treat ceh [ 12 , 13 ] ; however , effective pain relief lasted for 3 months post - treatment , but by 6 months , the pain had returned to pre - treatment levels .
although c2 ganglionectomy is used as a method for long - term occipital neuralgia relief , as a neurodestructive treatment , it precipitates us to find a better therapy .
prf treatment is supposed to be safer , and therefore , should be preferred to the treatment of ceh .
we used the prf for the c2 ganglion and received pain relief for 6 months .
serious complications can occur when cervical nerve root blocks are injected from posterior to frontal under the c - arm fluoroscopic guidance due to injection into the cervical subarachnoid space or into vessels in this region .
we injected from the lateral toward the target of the c2 vertebra under the c - arm fluoroscopic guidance , which will result in fewer complications than the above method . using the anterolateral approach for the c1c2 joint injection , halim et al
. also believed it would reduce the incidence of c2 nerve root injury , epidural injection , and vertebral artery puncture .
we treated our patients with prf for c2 ganglion with successful results and without the potential neurodestructive side effects observed with crf .
however , additional studies should be undertaken to elucidate the nature of prf so that we may more effectively apply this treatment to the patients .
prf is a potential treatment option with good outcomes for patients suffering from ceh related to the c2 nerve .
although prf provides shorter duration of pain relief than the crf , it has fewer complications and is safer . | in this case series report , two patients with cervicogenic headache were selected .
after initial positive response to the greater occipital nerve block , pulse radiofrequency ( prf ) was performed on the position of the second cervical ganglion ( c2 ) .
two patients reported 100% pain relief lasting for 6 months .
the lateral puncture is safer and more comfortable than the posterior site .
this case study demonstrates the effectiveness of prf to treat cervicogenic headache originating from the c2 nerve .
however , we need to further evaluate the results using more samples . |
the exact mechanism of action none in which imiquimod and its analogs activate the immune system is not yet known .
nevertheless , it is known that imiquimod activates immune cells through the toll - like receptor 7none ( tlr7 ) , commonly involved in pathogen recognition , on the cell surface .
cells activated by imiquimod via tlr-7 secrete cytokinesnone [ primarily interferon- ( ifn-)none , interleukin-6none ( il-6 ) and tumor necrosis factor-none ( tnf- ) ] .
there is evidence that imiquimod , when applied to skin , can lead to the activation of langerhans cellsnone , which subsequently migrates to local lymph nodes to activate the adaptive immune system .
other cell types activated by imiquimod include natural killer cells , macrophages and b - lymphocytes .
new research has shown that imiquimod 's antiproliferative effect is totally independent of immune system activation or function .
imiquimod exerts its effect by increasing levels of the opioid growth factor receptornone ( ogfr ) . blocking ogfr function with
topical application of imiquimod elevates the production of cytokines , including the principal cytokine for antiviral activity , interferon-. this is the initial event in an immunological cascade resulting in the stimulation of the innate immune response as well as the cell - mediated pathway of acquired immunity .
this immune modification mediates the indirect antiviral , antiproliferative and antitumor activity of imiquimod in vivo .
these properties highlight the potential of imiquimod as an effective treatment for genital warts and mc .
the present study was carried out to study the efficacy and safety of 5% imiquimod for the treatment of genital molluscum contagiosum and genital warts in female patients .
a randomized study was conducted to study and assess the efficacy and safety of daily applications of 5% imiquimod cream in female patients with external genital warts and mc .
all patients gave written informed consent before enrolment . the protocol and consent forms were reviewed and approved by appropriate institutional review boards at each institution .
patients were randomized by study center to receive daily applications of 5% imiquimod cream for a maximum of 16 weeks . before bedtime
, patients rubbed the study cream into clean , dry , lesional skin until it disappeared and washed the area with soap and water 8 2 h after application .
all female patients were seronegative for the human immunodeficiency virus.female patients who agreed to use effective birth - control measures .
female patients with pre - study pap smear showing a high - grade squamous intraepithelial lesion were excluded from our study.genital wart and mc therapy in the 4 weeks prior to treatment initiation.pregnant or lactating females .
female patients with pre - study pap smear showing a high - grade squamous intraepithelial lesion were excluded from our study .
to investigate wart and mc recurrence , patients who had complete clearance of their baseline lesions at any time during the treatment period stopped treatment and entered a 12-week treatment - free follow - up period .
patients were evaluated weekly for the first 4 weeks and every 2 weeks thereafter for the remainder of the 16-week treatment period as well as during the 12-week follow - up period . a detailed wart and mc assessment , including photographs , measurements , counts and location ,
new lesions that developed during the treatment period were treated with study medication and were followed separately from the baseline target warts and mc . both the patient and study personnel assessed local skin reactions at the treatment sites using a four - point scale from 0 ( no reaction ) to 3 ( severe ) .
clinical laboratory tests ( e.g. , hematology , blood chemistry and urinalysis ) were performed before treatment , at week 8 and after treatment .
all patients were asked about adverse experiences at each evaluation visit and these were recorded on a performa .
the primary efficacy was assessed by the proportion of patients in each treatment group who had complete clearance of their baseline warts and mc during the treatment period .
all female patients were seronegative for the human immunodeficiency virus.female patients who agreed to use effective birth - control measures .
female patients with pre - study pap smear showing a high - grade squamous intraepithelial lesion were excluded from our study.genital wart and mc therapy in the 4 weeks prior to treatment initiation.pregnant or lactating females .
female patients with pre - study pap smear showing a high - grade squamous intraepithelial lesion were excluded from our study .
to investigate wart and mc recurrence , patients who had complete clearance of their baseline lesions at any time during the treatment period stopped treatment and entered a 12-week treatment - free follow - up period .
patients were evaluated weekly for the first 4 weeks and every 2 weeks thereafter for the remainder of the 16-week treatment period as well as during the 12-week follow - up period .
a detailed wart and mc assessment , including photographs , measurements , counts and location , were completed before the study treatment was initiated and at each evaluation visit .
new lesions that developed during the treatment period were treated with study medication and were followed separately from the baseline target warts and mc . both the patient and study personnel assessed local skin reactions at the treatment sites using a four - point scale from 0 ( no reaction ) to 3 ( severe ) .
clinical laboratory tests ( e.g. , hematology , blood chemistry and urinalysis ) were performed before treatment , at week 8 and after treatment .
all patients were asked about adverse experiences at each evaluation visit and these were recorded on a performa .
the primary efficacy was assessed by the proportion of patients in each treatment group who had complete clearance of their baseline warts and mc during the treatment period .
the present prospective randomized , trial evaluated the efficacy and safety of daily patient - applied imiquimod for up to 16 weeks for the treatment of external genital warts and mc . the commonest ( 48% ) age group of patients was between 30 and 40 years , followed by 24% between 20 and 30 years , followed by 20% between 40 and 50 years , followed by 6% between 50 and 60 years and 2% between 10 and 20 years [ table 1 ] .
the genital mc was seen in 72% patients and genital warts were seen in 28% patients [ table 2 ] . in our study , 34% patients had 25 lesions , 50% patients had 510 lesions , 14% patients had 10 - 15 lesions and 2% patients had more than 15 lesions [ table 3 ] .
baseline warts cleared from 7 out of 14 ( 50% ) [ figure 1a c ] and genital mc lesions cleared from 27 of 36 ( 75% ) [ figure 2a c][table 4 ] . in a study conducted by metkar et al .
, complete clearance of molluscum contagiosum was seen in 44% patients with imiquimod . the commonest side effect observed in their study was erythema and crusting . in our study , there were no systemic reactions , although local skin reactions ( generally of mild or moderate severity ) were common .
the most frequently reported local skin reactions were erythema seen in 24% patients , excoriation in 16% patients , itching was seen in 12% patients , erosions were seen in 10% patients , excoriation was seen in 6% patients and pain was seen in 4% patients [ table 5 ] . in a study by diamantis et al .
, imiquimod 5% cream showed an acceptable safety profile ; local inflammatory reactions were the most frequent adverse effects , with local erythema being the most common .
the local reactions noted with imiquimod are most likely due to cytokine - induced inflammation and/or an immune response .
local reactions , which were predominantly of mild and moderate severity , required the discontinuation of treatment in only two patients . in preclinical trials ,
the cumulative rate of irritation produced by 5% imiquimod cream was less than that produced by vaseline intensive care lotion , indicating that imiquimod is not inherently irritating to normal skin .
in this clinical study , there was a significant correlation between the clearance of warts and mc and erythema .
an inflammatory response was not required to achieve clearance of the warts ; however , patients with such a response were more likely to have wart clearance .
age distribution of patients genital warts in a 15 year old female genital warts after 6 weeks of treatment genital warts after 12 weeks of treatment genital mc in a 35 year old female genital mc after 4 weeks of treatment genital mc after 10 weeks of treatment adverse reactions to 5% imiquimod patient applied 5% imiquimod cream is effective for the treatment of external genital warts and genital mc and has a favorable safety profile .
an estimated 30 to 50% of sexually active adults in the united states are infected with hpv , although only 1% may have visible genital warts .
the natural history of genital warts in humans appears to be that they may persist , progress or regress .
most treatments currently available for genital warts ( e.g. , cryotherapy , excision , electrosurgery , coagulation , laser surgery , trichloroacetic acid treatment and podophyllin resin treatment ) are directed at the lesions and not at the etiologic agent , hpv .
interferons ( ifns ) and patient - applied podofilox ( podophyllotoxin ) are currently available therapies that have been evaluated in well - controlled trials .
imiquimod is a new agent , an immune - response modifier , that has been demonstrated to have potent in vivo antiviral and antitumor effects in animal models .
imiquimod , 1-(2-methylpropyl)-1h - imidazo[4,5-c]quinolin-4-amine ( also known as r-837 and s-26308 ) , is a nonnucleoside heterocyclic amine that belongs to a class of products known as immune - response modifiers . in vivo studies have demonstrated that imiquimod is a potent inducer of alpha ifn ( ifn- ) , tumor necrosis factor alpha ( tnf- ) and interleukin-6 ( il-6 ) and that it has adjuvant properties greater than those of freund 's complete adjuvant . in animal models , imiquimod has been demonstrated to have potent antiviral and antitumor effects .
the current study was designed to evaluate the efficacy and safety of imiquimod for the treatment of external genital warts and mc .
non - specific inflammation and dermatitis can occur during use of imiquimod for genital warts and molluscum .
this often occurs where the skin is traumatized from scratching , or between skin folds .
massive blisters , bloody dry eschar , pain and discomfort often follows the use of imiquimod for skin cancers and precancerous growths .
fortunately , after completion of the therapy , the skin often heals with barely any scarring .
this unmasking effect is felt to be of clinical benefit as lesions that may have otherwise have been missed are being treated .
other side effects include headache , back pain , muscle aches , tiredness , flu - like symptoms , swollen lymph nodes , diarrhea and fungal infections . | the clinical effect of imiquimod stems from cytokine - induced activation of the immune system .
a randomized study was conducted to study the efficacy and safety of daily applications of 5% imiquimod cream in female patients with external genital warts and molluscum contagiosum ( mc ) .
the clearance rate of lesions was 75% in genital mc patients and 50% in patients with genital warts .
erythema was the commonest adverse reaction seen in 24% patients with the use of 5% imiquimod .
other side effects were excoriation seen in 16% patients , erosions in 10% patients , excoriation in 6% patients and pain was seen in 4% patients . |
we report on experiments that probe
photosensitized chemistry at
the air / water interface , a region that does not just connect the two
phases but displays its own specific chemistry . here
, we follow reactions
of octanol , a proxy for environmentally relevant soluble surfactants ,
initiated by an attack by triplet - state carbonyl compounds , which
are themselves concentrated at the interface by the presence of this
surfactant .
gas - phase products are determined using ptr - tof - ms , and
those remaining in the organic layer are determined by atr - ftir spectroscopy
and hplc - hrms .
we observe the photosensitized production of carboxylic
acids as well as unsaturated and branched - chain oxygenated products ,
compounds that act as organic aerosol precursors and had been thought
to be produced solely by biological activity .
a mechanism that is
consistent with the observations is detailed here , and the energetics
of several key reactions are calculated using quantum chemical methods .
the results suggest that the concentrating nature of the interface
leads to its being a favorable venue for radical reactions yielding
complex and functionalized products that themselves could initiate
further secondary chemistry and new particle formation in the atmospheric
environment . | |
recently peek has been considered as an ideal choice for spinal fusion cage due to its low modulus of elasticity , excellent chemical stability , resistance to radiation used in sterilization procedures , transparency to radio waves , compatibility with reinforcing agent , and so forth .
food and drug administration of united states ( fda ) accepted the carbon - fiber - reinforced peek ( cfr - peek ) for spinal fusion cages for human use in 1990s .
there is one big disadvantage of peek for orthopedic application , which is its low bioactivity . for enhancement of the bioactivity of peek ,
several methods have been proposed such as plasma surface treatment , laser surface modification , deposition of the ha coating layer , and compounding with bioactive material such as ha and producing bioactive composites .
the current commercial method for improving the bioactivity of peek is deposition of ha via plasma spraying method which has some disadvantages due to the high temperature which is used during the deposition of the ha coating layer and crystallization of the coated ha . in our previous study the ha crystalline particles were deposited on peek and eliminate high temperature in the deposition process . in this
study the bioactivity of the ha coated samples via chemically deposition method was evaluated by in vitro study .
mesenchymal stem cell proliferation and apatite formation via sbf immersion were used for doing the in vitro bioactivity study .
the treated samples were prepared as explained in our previous study . the sulphonation time was chosen as 5 minutes for the samples .
bioactivity can be understood as biologically reaction of the tissue to the surface of the materials .
formation of apatite layer from simulated body fluid ( sbf ) is one of the widely used methods which enables predicting in vivo bone bonding tendency of the material [ 6 , 7 ] .
the first sbf was developed by kokubo and his colleagues in 1987 , to simulate the reaction to the material in vitro instead of in vivo conditions .
it was designed to study the bioactivity of materials in vitro as a preliminary cheap and easy evaluation .
the samples were immersed in sbf solution and kept in water bath with the fixed temperature of 37c .
the ratio of the surface of the sample to the volume of the sbf solution had a value almost equal to 0.02 cm .
sem and edx analysis were used to show the apatite formation on the surface coated and bare peek after immersion in sbf and also for showing the morphology of the attached cells to the samples .
mesenchymal stem cells ( hbmscs ) were harvested and cultured as described by krishnamurithy et al . .
cell experiments were carried out on the control bare peek discs and the surface treated peek discs , which were 12 mm in diameter and 3 mm in thickness . prior to doing the experiments ,
the adhesion of mesenchymal stem cells ( hbmscs ) on disc samples was assessed in individual 6-well culture plate .
the cells were seeded on the samples at a density of 1 10 cells / ml . the seeded test samples were incubated with osteogenic medium ( gibco , invitrogen , usa ) at 37c in a co2 incubator under standard culture conditions .
medium were changed after 1 , 5 , and 10 days and used for cell viability test .
the disc samples at day 10 were fixed overnight in 4% glutaraldehyde in 0.1 m cacodylate buffer and postfixed for 1 hr in 1% aqueous osmium tetroxide .
these samples were processed with three consecutive washing steps in distilled water before being dehydrated through a graded ethanol series ( 50 , 70 , 80 , 90 , 95 , and 100% ) . the samples were subsequently dried overnight at room temperature .
cell viability on ha coated and bare peek samples was assessed using the colorimetric indicator alamar blue assay ( gibco , invitrogen , usa ) .
the assay was carried out based on the % of alamar blue ( ab ) reduction on day 5 , and 10 .
ab was directly added into the dmem media in all preparations at final concentration of 10% and incubated for 10 hrs .
after incubation , 100 l of medium from each plate was transferred into a 96-well plate .
absorbance in each well was measured at testing wavelength of 570 nm and reference wavelength of 600 nm using a micro plate reader ( epoch , usa ) . after the ab ,
the cell - disc samples were then washed with 1x pbs ( phosphate buffered saline 1x : gibco , invitrogen , usa ) and subsequently incubated in new dmem medium .
the concentrations were analyzed by spss statistics 22 ( ibm , usa ) using one - way anova and tukey 's test followed by post hoc lsd , with a significant level set at p < 0.05 .
figure 1 shows the sem images and edx results of the ha coated and bare peek samples after immersion in the sbf up to 14 days .
after 7 days the whole surface of the ha coated samples were covered by spherical apatite layer . the edx analysis for the samples after 1 and 3 days immersion in sbf still showed the sulfur element which belongs to the surface layer of the coated samples , but after 7 days due to the complete covering of the apatite layer the sulfur element does not exist in the surface .
there was no apatite formation observed on the surface of the bare peek samples after 2-week immersion in sbf .
the results showed the coated layer peek has better apatite formation ability which can have better interaction with the surrounding bone in the body .
the effect of the surface treatment on the biocompatibility of the samples was investigated by comparing the cell behavior .
figure 2 shows the morphology of mesenchymal stem cells ( hbmscs ) on the samples after culturing for 10 day . from sem images
, it can be seen that the cells attached and spread on both surfaces indicating that all the surfaces were able to support cell growth and metabolic activity of hbmscs .
samples showing wider coverage of lamellipodial and filopodial extension indicates the improvement in biocompatibility due to surface treatment .
the formation of bridges among the cells indicated that the surface may be favourable for the cells to prolong active metabolism for viability and proliferation .
moreover , the architecture around the cells mimicked extracellular matrix ( ecm ) and formed a continuous layer of fusiform over the surface of the ha treated peek substrate .
the percentage of reduction of ab was monitored on days 5 and 10 ( figure 3 ) .
the data obtained showed a significant difference in cell proliferation on ha treated peek substrate when compared to ha untreated peek substrate on day 5 ( ( p < 0.05 ) and 10 ( p < 0.01 ) ) .
the proliferation rate of cells seeded on the ha treated peek substrate was also found to be significantly higher on day 10 , when compared with that of day 5 ( p < 0.01 ) .
however , there was no significant difference in the cell proliferation rate between days 5 and 10 in ha untreated peek substrate ( p > 0.05 ) .
a previous study also reported similar outcome where the proliferation rate of osteoblast seeded on the ha coated peek was increased , when compared with a bare peek substrate between days 1 and 3 .
this resultant outcome suggested that the surface of ha treated peek substrate is favourable in terms of cell affinity .
in vitro study via simulated body fluid was conducted to compare the bioactivity of bare peek with coated peek with ha particles via chemical deposition .
ha crystals did not grow on the immersed bare peek in sbf , which showed the bioinert property of peek .
for the coated peek with ha particle , in vitro study via sbf immersion showed the growth of ha crystals from the first day of immersion in sbf and the ha crystals growth each day which show the bioactivity property of the coated peek . in vitro study via hbmscs cell attachment and proliferation confirms the improvement of the bioactivity of the coated peek in comparison with the bare peek , although the new method for ha deposition needs more studying such as in vivo study before using in human body .
the bioactivity of the modified peek was studied via mesenchymal stem cell.the apatite formation of the modified peek was studied via sbf immersion .
in vitro study revealed increase in bioactivity of modified peek .
the apatite formation of the modified peek was studied via sbf immersion .
in vitro study revealed increase in bioactivity of modified peek . | polyether ether ketone ( peek ) is considered the best alternative material for titanium for spinal fusion cage implants due to its low elasticity modulus and radiolucent property .
the main problem of peek is its bioinert properties .
coating with hydroxyapatite ( ha ) showed very good improvement in bioactivity of the peek implants . however the existing methods for deposition of ha have some disadvantages and damage the peek substrate . in our previous study a new method for deposition of ha on peek was presented .
in this study cell proliferation of mesenchymal stem cell and apatite formation in simulated body fluid ( sbf ) tests were conducted to probe the effect of this new method in improvement of the bioactivity of peek .
the mesenchymal stem cell proliferation result showed better cells proliferation on the treated layer in comparison with untreated peek .
the apatite formation results showed the growth of the ha on the treated peek but there was not any sight of the growth of ha on the untreated peek even after 2 weeks .
the results showed the new method of the ha deposition improved the bioactivity of the treated peek in comparison with the bare peek . |
polycyclic aromatic hydrocarbons ( pahs )
are produced by the incomplete
combustion of carbon and are of concern as environmental toxicants / carcinogens .
the most recent list of the priority chemicals
at remediation sites by the agency for toxic substances disease registry
( atsdr ) includes individual pahs or pah mixtures as three of the top
10 chemicals of concern .
major sources
of environmental exposure include wood smoke , creosote , and burning
of fossil fuels and tobacco .
pahs consisting
of four rings or less constitute the low molecular weight , volatile
class .
these pahs tend to be less toxic and are typically classified
as level 3 or insufficient weight of evidence as carcinogens in humans
. the major route of exposure to low molecular
weight pahs , such as naphthalene , pyrene , and phenanthrene , is inhalation .
the majority of exposure ( > 95% ) , to high molecular weight pahs
in
nonsmokers , is through the diet in a variety of foods including breads
and cereal grains , vegetables , and smoke - cured or barbequed meats .
the high molecular weight group contains the majority of the carcinogenic
pahs , including benzo[a]pyrene ( bap , class 1 , known
human carcinogen ) and dibenzo[def , p]chrysene ( dbc ,
cas 191 - 30 - 0 , class 2a , probable human carcinogen ) .
dietary intake of total pahs in the u.s . has been
estimated to
be between 160 and 1600 ng / day .
some studies
have reported intake levels of bap alone at 402800 ng / day . a 2005 report from the fao / who joint expert committee on food additives
and contaminants listed a mean bap daily dietary intake of 280 ng
per 70 kg individual with 700 ng considered as a high - level intake .
finally , a report by menzie et al . estimated
total carcinogenic pah intake at 3120 ng / day for a nonsmoking male ,
1950 years of age , of which 96.2% was from the diet .
the european union established a maximum limit
for bap in smoked meats at 5,000 ng / kg fresh weight .
addressed dbc ( also known as dibenzo[a , l]pyrene )
as a component of food from a french market , estimating a daily exposure
of 0.129 ng / kg bw in french adults and 0.208 ng / kg bw in french children .
developed a physiologically
based pharmacokinetic
( pbpk ) model for dbc and bap , relying upon previous studies of in vitro ( human and rodent liver ) bap metabolism and the
metabolic profile in vivo following oral gavage in
rodents . administering an oral dose of
15 mg / kg dbc to mice resulted in a tmax between 2 and 4 h , with detectable dbc in blood 48 h post gavage .
the t1/2 was found to be between 3.4 and
4.8 h. the higher log kow of dbc ( 7.4 ) , compared to that of bap ( 6.1 ) , is believed to contribute
to a prolonged sequestration in blood and other tissues .
the dbc model
development relied heavily upon bap due , in part , to the lack of available
data on dbc metabolism .
accelerator mass spectrometry ( ams )
measures the ratio of c / c with c detection
limits in the attomole
range per mg total carbon , allowing the use of
a microdose , defined as a dose at least 2 orders of
magnitude below that which would be expected to yield a pharmacological
effect .
ams is increasingly being utilized by pharmaceutical companies
to assess pharmacokinetic parameters , metabolism , and excretion in
humans during drug development ( phase 0 trials ) .
these studies
almost exclusively utilized c as the radiolabel , and
doses of 100 ci have been standard .
ams is an attractive method to determine human pharmacokinetics ,
dna binding , and other potential biomarkers of importance in risk
assessment of compounds with potential toxicity .
for example , ams
has been utilized to determine dna binding of [ c]- labeled
amino acid pyrolysis products or cooked meat mutagens , meiq , phip ,
meiqx , as well as bap and the pharmacokinetics
of the potent human dietary hepatocarcinogen , aflatoxin b1 .
the sensitivity provided by ams allows
for safe microdosing of human volunteers with chemical carcinogens ,
such as dbc , at environmentally relevant doses , providing pharmacokinetic
parameters for risk assessment that do not rely solely on high - dose
animal studies . in this study , we determined the human in vivo pharmacokinetics of dbc , following microdosing ,
utilizing ams .
total
elimination of dbceq ( parent and metabolites ) , detected
as [ c ] , are used to determine the pharmacokinetics in
plasma and urine .
solid sample ams is not able to distinguish between
labeled parent compound and metabolites .
total plasma distribution
and urinary elimination are compared to total plasma distribution
and urinary elimination scaled from rodent models .
all protocols and
procedures , including
plans for recruitment and volunteer informed consent documents , were
approved by the osu institutional review board . the use of radioisotopes
was reviewed and approved by an osu radioactive use agreement under
the oversight of the oregon health authority .
healthy adult males
and infertile ( postmenopausal or tubally ligated ) females , between
the ages of 2065 , were recruited for this study . to protect
confidentiality , all specimens were deidentified at the time of collection .
additional inclusion criteria were as follows : good general health ;
nonsmoking ; not using medications that can affect gut motility ; and
no history of gastrointestinal surgeries , kidney or liver disease ,
gastrointestinal diseases such as crohn s , ulcerative colitis ,
or gastritis .
the screening assessment included a careful menopausal history and
a urine pregnancy test for all women .
women who were pregnant or capable
of becoming pregnant were excluded from the study in an abundance
of caution , due to the proven transplacental toxicity of dbc in high
dose rodent models .
individual body weight , height ,
bmi , age , gender , ethnicity , and race were recorded ( table 1 ) .
the 29
ng dbc dose utilized in this study is equivalent to the bap content
of a 5.2 oz .
serving of smoked meat at the european union maximum
legal limit or 28% of the average daily
dietary pah intake .
this chemical dose
was chosen to be relevant to typical dietary exposure in humans .
the
specific activity of [ l - ring - u- c]-dbc was 51.4 nci / nmol ,
resulting in 5 nci of [ c ] in a 29 ng dose .
this
particle radiation dose of 5 nci can be compared to the internal radiation
of consuming 5 bananas , each containing 1 nci [ k ] .
it would require a dose of 200 study capsules
to equal the radioactive dose of a single [ c]-urea diagnostic
test for helicobacter pylori .
the radioactive dose was chosen to be detectable by ams
without appreciable risk to volunteers consistent with the policy
of utilizing doses as low as reasonably achievable ( alara ) or practical
( alarp ) .
dibenzo[def , p]chrysene ( formerly
known as dibenzo[a , l]pyrene ) [ l - ring - u - c ] , mri part no .
u479c , 51.4 mci / mmol , was obtained from the nci
chemical carcinogen standards reference repository , midwest research
institute ( kansas city , mo ) .
the reagents used include ultima flo
m scintillation cocktail , sulfuric acid , hplc grade acetonitrile ,
milli - q water , ethyl acetate , potassium sulfate , 95% ethanol ( pcca
503161 ) , lactose monohydrate ( pcca 30 - 3329 ) and size 0 cellulose
capsules ( spectrum , irvine ca ) .
chromatography utilized a luna 3 m
particle c18 100 150 3 mm phenomenex hplc
column with a c18 2 mm guard column on an agilent 1100
hplc with uv detector .
a portion of the
stock solution of [ c]-dbc ( 1.11 mci / ml , 6.53 mg / ml benzene )
was blown to dryness under argon and then purified , prior to the preparation
of dosing solutions , to 99% radiochemical purity via reverse
phase - hplc .
hplc elution conditions were isocratic 90% acn , 10% h2o with a flow rate of 1 ml / min at a column temperature of
35 c .
the a280 peak containing purified [ c]-dbc ( 6.0 to 6.5 min retention time ) was collected over several
hplc runs . the pooled eluent was evaporated to dryness under a stream
of argon and resuspended in ethanol thrice to produce the dosing solution .
an hplc run of the dosing solution was collected in 15-s fractions
for scintillation counting to assess radioactive purity ( 99% ) .
the dosing solution was diluted with additional ethanol to 0.16 nci/l ,
representing a final target dose of 29 ng dbc/30 l dose incorporated
into each cellulose capsule .
the stock solution was stored at 80
c under argon and protected from light .
all neat dbc powder
was handled by a trained carcinogen specialist in an enclosed glovebox ,
per the osu extreme carcinogen handling protocol .
dbc solutions were
stored in a locked laboratory dedicated to carcinogens , and all waste
was discarded in accordance with osu radiation safety and hazardous
material protocols .
capsules
were prepared by filling empty cellulose capsules with pharmaceutical
grade lactose monohydrate .
thirty microliters of 0.16 nci/l
dosing solution was applied to the capsule and sealed by allowing
the ethanol to evaporate , inverting the capsule to create a lactose
layer above the dosing solution to prevent any possible integrity
loss upon moistening , and the capsule cap was pinched closed over
the capsule body .
every capsule batch manufactured included a dosing
capsule per volunteer plus at least 3 extra for quality control .
capsules
were stored at 20 c until time of use and utilized within
5 days of preparation .
quality control was performed by scintillation
counting 3 randomly chosen capsules per batch , individually dissolved
by vortex in 5 ml of water prior to the addition of 15 ml of scintillation
cocktail .
the variability between capsules per batch was 5% .
the exact dosage a volunteer received , measured by scintillation ,
is included in table 2 .
[ c]-dbceq elimination ( ng ) per total urine volume in a
given pooled time point .
the percent excreted is reported as the total urine elimination divided
by the total oral dose . at 8 a.m.
, volunteers
who had fasted overnight were orally administered a cellulose capsule
containing c - dbc ( target dose of 29 ng dbc , 5 nci c ) , which was swallowed with 100 ml of water .
food and water
were made available at 10 a.m. blood was drawn by a registered nurse
at 0 , 0.25 , 0.5 , 0.75 , 1.0 , 1.5 , 2.0 , 2.5 , 3 , 4 , 8 , 12 , 24 , 48 , and
72 h post - consumption and collected into glass vacutainer tubes containing
the anticoagulant , edta .
catheter was used for
the first 4 h of blood collection ; the remaining time points were
collected by needle sticks .
initial studies using whole blood for
ams analysis resulted in high signal - to - noise based upon background
endogenous c that obscured the c attributable to [ c]-dbc .
therefore , whole blood was centrifuged for 10 min
at 1,000 g and 0.75 ml plasma aliquots transferred
to glass culture tubes containing 0.75 g of k2so4 , to prevent emulsion , and stored at 4 c until extracted for
ams analysis .
urine was pooled by 06 ,
612 , 1224 , 2448 , and 4872 h batches
for homogenized sampling and volume record by pool .
coded plasma
and plasma extracts and urine samples were stored at 20 c
prior to shipment to lawrence livermore national laboratory ( llnl )
for analysis by ams .
the samples were acidified with 0.75 ml of 0.9
m h2so4 , vortexed for 20 s , then extracted thrice
with 1 ml of ethyl acetate , and centrifugated at 750 g for 10 min .
the combined extracts were evaporated under argon to
dryness in an 8 ml amber glass vial with a ptfe cap liner , then stored
at 20 c until shipped on dry ice to llnl for ams analysis .
as pahs can adsorb to plastic , care was taken to use glass containers
( amber when possible ) for protection from light and argon or nitrogen
capping to prevent oxidation of samples .
urine was aliquoted in 1
ml volumes for shipping , requiring no additional processing prior
to ams preparation .
the extraction
efficiency for
[ c]-dbc from plasma was determined by spiking plasma
with known amounts of [ c]-dbc using dilutions of the
[ c]-dbc microdosing ethanol stock solution . following
ethyl acetate extraction and reconstitution with 50:50 methanol / water
( v / v ) used for ams analysis ( described below ) , the recovery was 51
10% ( n = 3 ) as determined by ams .
in a separate
test of extraction efficiency , fresh or thawed frozen plasma , 0.75
ml , was spiked with 1.25 nci [ c]-dbc solution prior to
extraction resulting in 55 7% recovery of [ c]-dbc
as detected by scintillation counting .
this process was repeated with
several [ c]-dbc concentrations and with detection by
ams and scintillation counting .
overall , across a number of concentrations ,
55 7% ( at the low end of previously reported recoveries of
61101% in human studies with pharaceuticals , perhaps due to the much lower mass of the dose utilized
in this study ) was the average dbc recovery when reconstituted in
methanol / water , and this value was used for efficiency corrections
in the pk parameters reported below .
recent work by crowell et al . had determined this to be the optimal extraction
method for dbc , as well as the diol , and tetraol metabolites . upon arrival at llnl
plasma
extract samples were reconstituted with 100 l of 50:50 methanol / water
and converted to graphite by the method of ognibene et al .
urine samples ( 100 l ) were converted ,
without prior processing , by the same graphitization method .
all voided urine was collected ,
pooled by time point , and volumetrically recorded prior to aliquoting
and storing pooled samples .
briefly , the samples were evaporated and
flame - sealed in a quartz tube containing cu(ii ) and combusted to 900
c , producing co2 . the co2 is then transferred
to a septa sealed glass tube containing zn and co and heated to 525
c , producing graphite on the co catalyst .
ams
analysis was conducted on the 1 mv ams , constructed and maintained
by the center for accelerator mass spectrometry at llnl .
the current
ams operating conditions are optimized to determine the ratio of c / c with a precision of 3% and sensitivity of 0.4 attomol c per mg of total carbon .
solid
sample standards containing c / c content of 1.5
modern are measured intermittently throughout the analysis to assess
the ionization and counting efficiency of the spectrometer .
the biochemical
samples are measured 410 times with the collection of at least
10,000 c counts or for 30 s each time .
pharmacokinetic
analysis of data utilized an excel based add - on developed at allergan ,
inc .
briefly , the formulas
rely on noncompartmental analysis of six functions : peak concentrations
in plasma ( cmax ) , time of peak plasma
concentration ( tmax ) , plasma elimination
half - life ( t1/2 ) , apparent elimination
rate constant ( kel ) , and area under the
plasma concentration curve ( auc0-t and auc0- ) using standard regression techniques .
urinary clearance ( cl , ml / min ) was calculated by dividing
the cumulative amount of c eliminated in the urine over
72 h by the plasma auc072h .
we were able to empirically determine the environmentally relevant in vivo pharmacokinetics of [ c]-dbc in human
volunteers utilizing ams .
the pool of nine volunteers included both
sexes and was characterized by an age range from 20 to 65 years of
age and bmis from 23 to 35 ( table 1 ) .
this study
was intended to assess the range of pharmacokinetics in a cross section
of human volunteers ; as such , it is not statistically powered to assess
parameters such as gender , age , or bmi .
differences in age could lead
to differences in gut motility , possibly resulting in changes in absorption .
the range of bmi likely results in a range of blood volumes and distribution .
because of a necessary change in plasma collection and processing
method , three volunteers were excluded from the plasma pharmacokinetic
analysis ( table 3 and figure 2 ) ; however , urine data from all nine volunteers are included
( table 2 and figure 1 ) .
a sample of 1 ml of urine was measured for [ c]-dbceq by ams per pool , as described in experimental procedures .
[ c]-dbceq plasma elimination curve in 6
volunteers ( a ) and averaged ( b ) .
( a ) plasma levels of [ c]-dbceq over time are depicted for 6 individual volunteers
as measured by ams as described in experimental procedures .
( b ) this graph depicts the average and standard deviation of [ c]-dbceq in plasma for the same 6 volunteers as
those in panel a. there were some similarities
in the temporal pattern ( but not magnitude )
of absorption / excretion between individuals ( figures 1 and 2 ) .
levels of [ c ]
in plasma rose rapidly following oral administration of [ c]-dbc to volunteers that had been fasted overnight ( tables 3 and 4 , and figure 2 ) .
a tmax at 2.25 h was observed , followed
by a rapid -phase elimination prior to a slower -phase
elimination .
this study was limited to the appearance and disappearance
of c - labeled dbceq from plasma and the levels
appearing with time in urine ( a true mass balance study would have
required fecal analysis as well as determination of tissue levels
( not possible in a human study without subsequent diagnostic surgery ) ) .
considering differences in absorption based on motility , distribution
based on bmi , and metabolism based on polymorphisms , the pharmacokinetics
were notably consistent .
recovery of urinary c
over 72 h yielded 1.24
0.49% of the dose administered ( table 2 ) . because
of the high hydrophobicity ( log kow 7.4 ) ,
the majority of dbc is likely unabsorbed and eliminated in the feces
unlike 3- or 4-ring pahs , which were reported to be rapidly absorbed
from the intestine .
however , if we had
collected urine over a longer period and observed a pattern similar
to plasma , it could be concluded that sequestered dbc is released
slowly from the system .
oral bioavailability could be expected to
be strongly linked to the fat content of vehicle administered at dosing .
previous high dosing studies of bap in rodents
have resulted in minimal elimination in urine , 0.220.35% and
0.100.08% of oral dose administered , detected as known metabolites .
oral gavage of mice with 15 mg / kg of dbc with corn oil vehicle yielded
4.9 to 7% urinary excretion of the total oral dose . administering
an oral dose of 15 mg / kg dbc to mice resulted
in a tmax between 2 and 4 h , with detectable
dbc in blood 48 h post - gavage .
as environmental pahs
occur in complex mixtures , ingestion / elimination
kinetics in humans from pah exposures are difficult to discern .
the
translation of high dose animal experiment data for human risk assessment
is often criticized as being of questionable relevance for human exposures .
because of the sensitivity of ams , we are able to assess the in vivo human metabolic parameters of one of the most carcinogenic
pahs in animal models , dbc , while maintaining risk to volunteers at
a de minimus level . our pharmacokinetic data set
following human dbc exposure at environmentally relevant levels offer
an excellent biomonitoring tool for agencies charged with risk assessment
and modeling to humans of high molecular weight carcinogenic pahs .
pahs are pro - carcinogens , requiring enzymatic activation to electrophilic
metabolites such as epoxides , dihydrodiol - epoxides , and quinones .
these electrophiles have numerous nucleophilic targets in the cell
including dna . in the case of dbc , cytochrome p450 ( p450)-dependent
11,12-epoxygenation followed by hydrolysis ( epoxide hydrolase ) and
a second epoxygenation produces the 11,12-dihydrodiol-13,14-epoxide
( dbcde ) . of the four possible enantiomers ,
the ( )-anti-11r,12s - dihydrodiol-13s,14r - epoxide or ( )-anti - dbcde is thought to be the most efficient at forming dna adducts
at a number of sites on purine bases especially
at n - da and n - dg .
understanding the extent
of metabolism , both bioactivation and detoxication ( conjugation by
sults , ugts , and gsts ) , following exposure to environmentally relevant
doses would greatly add to the impact of bio - ams studies such as this
one .
the same is true for the determination of the extent and identity
of dna adducts in peripheral blood mononucleocytes following microdosing .
a current strength and drawback to the solid sample bio - ams technology
employed in this study is that only total [ c ] label is
detected .
while providing sensitivity in the attomole range , this
method is not capable of speciation , i.e. , chemical identification
and quantification of the parent compound and metabolites .
previously ,
to identify metabolites , plasma extracts would have to be separated
by hplc and collected as discrete fractions , based on the retention
time of metabolite standards , prior to graphitization .
this approach is burdened with the same limitations
of hplc fraction collection for uncoupled traditional ms .
hplc fraction
selection is based on the retention time of commercially available
standards for downstream ms analysis .
only select fractions can be
analyzed due to study limitations , including manual sample preparation .
new instrumentation at llnl provides liquid sample ams through
the interface of uhplc and ams and determination of the metabolite
profile .
moving wire coupled uhplc - bio - ams
( liquid sample bio - ams ) technology combusts column eluent to co2 , prior to ams carbon isotope detection across
an entire chromatographic run .
parent , metabolite , and all conjugated
species present from a biological matrix such as plasma , urine , or
isolated dna adducts can be detected and quantitated .
standards are
necessary for identification based on retention time , but all species
resulting from metabolism would be represented in the c tracing .
future work will focus on utilizing liquid sample bio - ams
to identify the species and concentration of pah metabolites over
time and examination of interindividual differences such as genetics
or previously environmental exposures , elucidating gene - environmental
interactions at microdoses .
one such study is currently underway in
our laboratory . a targeted total of 75 enrollees will be dosed with
5 nci ( 46 ng ) of [ c]-bap .
plasma and urine levels of
parent [ c]-bap and [ c]-bap metabolites will
be assessed over a 72 h period employing uhplc - ams ( fda
ind # 117175 ; osu irb # 5644 ) .
preliminary results to date ( figure 3 ) show that the majority of the c counts
in plasma coelute with dbc with minor amounts of [ c]-dbc-11,12-dihydrodiol
tentatively identified by coelution with unlabeled standard ( synthesized
and provided by dr .
it should be noted
that this is the first sample run by uhlpc and is from plasma ( not
urine , where metabolites should predominant ) .
extraction at later
time points ( or pooling of some time points ) and from higher volumes
of plasma should allow us to better quantify these putative metabolites .
uhplc - ams
of [ c]-dbc and putative metabolites from
plasma of volunteer 5 3 h following dosing .
plasma samples were extracted
twice with 50 l of ethyl acetate and the extract transferred
to an hplc vial with a 300 l insert .
the ethyl acetate was
evaporated in a vacuum chamber and the residue reconstituted with
50 l of acetonitrile prior to injection .
five microliters of
plasma extract ( volunteer 5 , 3 h after dosing ) was injected onto a
phenomenex kinetex 2.6 m c18 100 ( part no :
00f-4462-an ) column ( 150 2.1 mm ) fitted with a c18 guard column and eluted with 45% acetonitrile for 03 min
followed by a linear gradient ( 310 min ) to 100% acetonitrile ,
which was maintained from 10 to 13 min before a return to initial
conditions ( flow rate of 0.12 mlmin ( 25
c ) ) .
following passage through a dual channel uv / vis detector
( 280 and 315 nm ) , the eluent was deposited onto a moving nickel wire
and the [ c]-dbceq converted to co2 prior to ams analysis .
multiple channels allow for the simultaneous determination of a280 and a315 as well as counts of c
and c. only the c profile is shown here .
the use of unlabeled parent dbc and standards ( dbc-()-11,12-diol
and dbc-()-11,12,13,14-tetraol ) allow for tentative identification
of c peaks ( top panel ) .
the polar putative metabolite
eluting between 2 and 2.5 min is currently unknown but could be a
conjugate formed by sulfotransferases or udp - glucuronosyl transferase
( sample not treated with sulfatase or -glucuronidase prior
to analysis ) .
the plasma sample from volunteer 5 ( lower panel ) shows
a detectable peak at 13.5 min , which is the retention time ( top panel )
of dbc-()-diol .
the major c - containing peak in
plasma at 3 h postdosing coelutes with parent dbc .
we used a previously published pbpk model developed
for the rat to evaluate how well the
human [ c]-dbceq pharmacokinetic profile compared
with that of
other species . for this comparison ( figure 4 ) , we scaled the initial step in the human metabolism of dbc from
rate constants determined from rats .
otherwise , the human pbpk model
was based upon average anatomy and physiology of a 70 kg adult male
under the dosing conditions used in this study . when human metabolism
was scaled from the rat , the pbpk simulation of parent dbc pharmacokinetics
in plasma was remarkably close to the measured data during the first
12 h postdosing . at later time points ,
the model simulations of dbc
kinetics began to significantly under predict the total c data , which likely represented an increasing proportion of dbc
metabolites .
as described above , studies are ongoing to quantitate
dbc and its major metabolites in plasma and urine samples from this
study to more directly compare with pbpk predictions .
these data ,
along with recently published data on species differences in metabolic
rate constants associated with dbc metabolism , will be incorporated into the next generation pbpk model
to improve cross - species comparisons .
pharmacokinetic
profile of [ c]-dbceq in
humans : comparison to a rat pbpk model .
the symbols are plasma
levels over time of [ c]-dbceq ( with error
bars depicting sd ) following microdosing of humans with 5 nci
( 29 ng ) of [ c]-dbc .
the solid curve is pbpk model prediction
with metabolic rate scaled from the rat as calculated by crowell et
al . the pharmacokinetics of phenanthrene ( a 3-ring pah ) and its
diol
and tetraol metabolites have been conducted in humans following oral
or inhalation exposure to 10 g of [ d10]-phenanthrene
and analysis of plasma and urine over time by gc - electron impact - ms / ms .
phenanthrene can act as a surrogate for larger molecular weight
carcinogenic pahs as it has a bay region
and is metabolized in a manner similar to that of bap but is designated
a class c pah by iarc and has been given
an rpf of 0 by epa . in our subsequent
studies characterizing the pharmacokinetics of bap and its metabolites
by uhplc - ams following microdosing with 46
ng , we hope to examine
the impact of genetic polymorphisms in bap - metabolizing enzymes as
was done by wang et al .
likewise , we
plan to examine [ c]-pah - derived dna and protein adducts
from peripheral blood mononuclear cells ( pbmcs ) as potential biomarkers
of exposure and perhaps risk following microdosing .
the use of moving
wire technology may provide the opportunity to identify macromolecular
adduct profiles .
the ability to determine the pharmacokinetic
parameters , safely
in humans , of carcinogenic chemicals found in the environment and
their metabolites is an advancement in risk assessment .
further development
and application of this technology could have a major impact in the
arena of human environmental health . | dibenzo(def , p)chrysene
( dbc ) , ( also known as dibenzo[a , l]pyrene ) , is a high
molecular weight polycyclic aromatic
hydrocarbon ( pah ) found in the environment , including food , produced
by the incomplete combustion of hydrocarbons .
dbc , classified by iarc
as a 2a probable human carcinogen , has a relative potency factor ( rpf )
in animal cancer models 30-fold higher than benzo[a]pyrene .
no data are available describing the disposition of high
molecular weight ( > 4 rings ) pahs in humans to compare to animal
studies
.
pharmacokinetics of dbc was determined in 3 female and 6 male human
volunteers following oral microdosing ( 29 ng , 5 nci ) of [ 14c]-dbc .
this study was made possible with highly sensitive accelerator
mass spectrometry ( ams ) , capable of detecting [ 14c]-dbc
equivalents in plasma and urine following a dose considered of de minimus risk to human health .
plasma and urine were collected
over 72 h. the plasma cmax was 68.8
44.3 fgml1 with a tmax of 2.25 1.04 h. elimination occurred in two distinct
phases : a rapid ( )-phase , with a t1/2 of 5.8 3.4 h and an apparent elimination rate constant ( kel ) of 0.17 0.12 fgh1 , followed by a slower ( )-phase , with a t1/2 of 41.3 29.8 h and an apparent kel of 0.03 0.02 fgh1 .
in spite of the high degree of hydrophobicity ( log kow of 7.4 ) ,
dbc was eliminated rapidly in humans , as are
most pahs in animals , compared to other hydrophobic persistent organic
pollutants such as , ddt , pcbs and tcdd .
preliminary examination utilizing
a new uhplc - ams interface , suggests the presence of polar metabolites
in plasma as early as 45 min following dosing .
this is the first in vivo data set describing pharmacokinetics in humans of
a high molecular weight pah and should be a valuable addition to risk
assessment paradigms . |
video - laparoscopic cholecystectomy ( vlc ) , which is considered the gold standard for treating gallbladder lithiasis , finds its greatest challenge in acute cholecystitis .
vlc has been quickly accepted due to the advantages it provides in the following areas : return to physical activity and work in 5 to 7 days ; a reduced hospital stay ; safety due to magnified visualization of intraabdominal structures ; low morbidity , reduced costs ; less tissue trauma ; a better cosmetic effect ; and less pain in the postoperative period , which was observed in almost every published series .
for these reasons , many surgeons have adopted this method without carrying out randomized studies .
in addition , patients have been stimulated by information about the procedure provided by the media and have begun to demand video - laparoscopic treatment .
conventional surgery , in most cases in brazil , has been reserved for patients who are not covered by the health security program .
the applicability of the laparoscopic method has already been demonstrated in the management of acute disease , but the general opinion is that a large number of technical difficulties can be present that increase the need for conversion to open surgery.even today , few studies are available that compare a laparoscopic approach with the conventional method .
this study is aimed at comparing the laparoscopic approach with conventional surgery for acute cholecystitis .
from january 1992 to december 1996 , 1182 cholecystectomies were carried out at the general surgery service of so rafael hospital in the city of salvador , state of bahia , brazil .
the anatomicopathological diagnosis of acute cholecystitis was confirmed in 155 ( 13.11% ) of the patients .
group i was formed by the patients who underwent video - laparocholecystectomy ( vlc ) , and group ii comprised patients who underwent open cholecystectomy ( oc ) .
the open surgery was performed in patients who were not entitled by their health security plan to undergo the laparoscopic method .
open cholecystectomy was carried out with the standard technique , through a right subcostal incision , followed by the release of adhesions , dissection of the linking pedicle , sectioning of the cystic artery and cystic duct , and cholecystectomy .
if the anatomical dissection of the pedicle was hard to perform , a fundus first technique was used .
the vlc operations were performed by the same staff surgeons , using a standard technique ( the european method ) , modified by dr enrico croce , italy 's pioneer of this method .
the pneumoperitoneum was established through the closed technique , except when abdominal distension was present .
the first trocar ( 10 mm ) was placed via the umbilicus , and the others were placed at the epigastrium ( 5 mm ) to the left of the round ligament , the mesogastrium ( 10 mm ) on a equidistant point between the previously mentioned trocars and to the left of the middle line , and the last trocar was inserted on the right ( 5 mm ) parallel to the umbilicus .
dissection of the gallbladder pedicle elements was performed with the aid of blunt dissectors and gauze .
this was followed by isolation , clipping , and sectioning of the cystic artery and duct .
most of the time , a standard cholecystectomy was performed , except when anatomic difficulties arose in dissecting the pedicle , and then a fundus fist
intraoperative cholangiography was performed in patients with anatomical variations , and common bile duct dilatation without preoperative evidence of stones in the common bile duct . when these signs were found before the surgery , endoscopic retrograde cholangiopancreatography ( ercp ) or cholangioresonancy ( ca ) was performed to confirm and remove the stone .
all patients were operated upon within the first 72 hours after admission ; they were corrected for fluid and electrolyte imbalance , nausea , vomiting , and pain .
a first - generation cephalosporin was used for antibiotic prophylaxis given before the induction of anesthesia .
we analyzed the following data : age , sex , previous surgery , surgical risk , signs and symptoms , laboratory evaluation , surgical time , morbidity , mortality , conversion to open surgery , microbiological analysis of aspirated bile , time of hospital stay , and use of drains .
the statistical analysis was performed using the chi - square test , fisher 's exact test , student 's t test , and the kruskal - wallis anova test .
both groups were predominantly female , with ages ranging from 12 to 90 years ( table 1 ) .
patients from both groups underwent other surgeries of the upper abdomen , 1.77% ( vlc ) and 4.76% ( oc ) .
surgical risk was classified according to the criteria of the american society of anesthesiology ( table 2 ) .
pain in the upper right quadrant , fever , and a palpable gallbladder were the prevalent signs and symptoms , as shown on table 3 .
the required laboratory exams , which included a leuko - gram , amylase , got ( aspartate aminotransferase , serum ) , gpt ( alanine aminotransferase , serum ) , bilirubin , and ap ( alkaline phosphatase serum ) , revealed small nonsignifi - cant variations when the two groups were compared ( table 4 ) .
got = aspartate aminotransferase , serum ; gpt = alanine aminotransferase , serum ; vlc = video - laparocholecystectomy . the surgical time for
cholangiography was carried out in 7.96% of the vlc group compared with 14.28% of group ii ( p = 0.247 ) .
a bile culture , was positive in 20.3% in group i and 16.67% in group ii .
surgical drainage was used more in group i , but had no statistical significance ( p = 0.074 ) .
no intraoperative complications ( lesion of the main bile ducts , vascular or intestinal injury , or injury of the hepatic parenchyma ) related to surgical technique occurred in either group .
the most frequent postoperative complication in group i was atelectasis ( 4 cases ) , followed by respiratory tract infection ( rti ) , and bilirachia , with 2 cases each . in group
ii , the most common complication was rti , in 4 patients , followed by bilirachia ( 3 cases ) , and atelectasis ( 2 cases ) .
the incidence of complications was greater in group ii ( p = 0.006 ) ( table 6 ) .
the need to convert to open surgery was due to the presence of adhesions in 5 cases and difficulty in anatomical identification of the pedicle elements ( table 7 ) .
the total mortality was 0.75% ( 1 case ) in group ii due to sepsis and multi - organs system failure ( dmos ) .
the hospital stay was significantly longer in group ii with p = 0.0003782 ( table 8) .
the statistical analyses demonstrate that as far as the distribution for sex , age , signs and symptoms , laboratory data , surgical risk , and previous surgeries is concerned , the groups do not have significant differences and can be matched , in spite of the fact that no previous randomiza in 14 patients ( 12.4% ) the need to convert to open surgery was due to the presence of adhesions in 5 cases and difficulty in anatomical identification of the pedicle elements ( table 7 ) .
the total mortality was 0.75% ( 1 case ) in group ii due to sepsis and multi - organs system failure ( dmos ) .
the hospital stay was significantly longer in group ii with p = 0.0003782 ( table 8) .
the statistical analyses demonstrate that as far as the distribution for sex , age , signs and symptoms , laboratory data , surgical risk , and previous surgeries is concerned , the groups do not have significant differences and can be matched , in spite of the fact that no previous randomization has been performed . as for age and sex distribution ,
leukocytosis was present in 55% of patients , a finding compatible with the analysis of 198 cases of acute cholecystitis reported by grurber in 1996 . jaundice occurred in 21.9% of the patients .
a significantly greater fever ( > 38c ) in the open surgery group was the only factor not matched in the comparative analysis , its total incidence being 18.7% versus 32% found in the grurber series . as for the surgical risk , most patients ( 81.9% ) were asa i and ii.28 the asa 3 and 4 patients were also operated upon with video - laparoscopy .
several reports support the use of laparoscopy in the critically ill patient , because the casual deleterious effect of pneumoperitoneum can be promptly corrected .
several authors have reported on the use of laparoscopy for acute cholecystitis , independent of surgical risk , except in cases of hemodynamic instability .
the presence of upper abdominal surgery in 1.7% of the patients did not prevent performance of the laparoscopic method .
the surgical time was similar in both methods , which is compatible with reports in the literature .
surgical drainage was employed when dissection of the hepatic bed was laborious ( bleeding ) , a common occurrence with acute cholecystitis .
drainage was carried out without incident in both groups ( 46.7% ) ; reports in literature indicate that drainage is performed in 48 to 100% of cases .
numerous studies either support or do not support the routine use of intraoperative cholangiography . in the present study , selective cholangiography was carried out in both groups ( 9.67% of the cases ) when intraoperative indications of choledocholithiasis was noted .
bickel in 1996 reported 1 case of injury of the bile ducts in each group in a total of 182 patients .
cox in 1993 reported 1 injury in 98 patients operated on with vlc , and unger in 1994 reported 1 case in 270 .
the 3 postoperative complications in both groups could be overlapping , except for the respiratory tract infection , which was more common in group ii .
the increased incidence of atelectasis in open surgery of the upper abdomen has already been widely reported . in vlc ,
this fact , together with the occurrence of greater pain in the period following operation in group ii , may be factors that facilitate causing respiratory tract infection in this group .
bilirachia occurred in 2 patients in group i and in 3 patients in group ii , without any statistical significance , in a total of 3.22% of cases . this same index was reported by cox in 1993 .
a subphrenic collection took place in 1 vlc patient , without systemic repercussions and was treated in the conservative way . in group ii , 1 patient with intra - cavity abscess was treated though image - guided drainage . an abdominal wall infection and
the low - wall infection incidence with video - surgery has also been largely documented .
mortality in patients with acute cholecystitis and who were operated upon with vlc has varied from 0% to 4% .
in spite of its being a nonrandomized study , patients in our study ( matched for sex , age , signs and symptoms presenting on admission , laboratory data , and anesthetic risk ) who underwent laparoscopic cholecystectomy compared favorably with those who underwent the traditional open technique . the data presented in this study demonstrate that a video - laparoscopic method can be safely performed when acute cholecystitis is present , resulting in low morbidity and mortality rates and shortened hospital stays . | it has been shown that a video - laparoscopic approach is the preferred method for treatment of cholecystitis . however ,
when we consider acute cholecystitis , many questions must be answered .
the aim of this study is to compare video - laparoscopic and conventional surgery in the management of acute cholecystitis . |
porphyria is a class of disorders of porphyrin and porphyrin - precursor metabolism resulting from aberrations in the control of the heme biosynthetic pathway .
erythropoietic protoporphyria ( epp ) is an autosomal dominant / recessive porphyric disorder characterized by the accumulation of protoporphyrin in blood , erythrocytes and tissues resulting from a deficiency in the enzyme ferrochelatase.1 - 3 the incidence of epp in the population ranges from 1:75,000 to 1:200,000.4 epp manifests clinically as immediate painful photosensitivity of the skin , with stinging , prickling and burning of exposed areas being the initial symptoms experienced during or shortly after exposure to the sun.4 long sunlight exposure may result in erythema , edema , petechia and/or bulla formation.4 because protoporphyrin is a lipophilic molecule that is excreted by the liver , epp patients are at risk of cholelithiasis with obstructive episodes , and a small minority of epp patients develop chronic liver disease due to pigment - loading of hepatocytes and bile canalicular sludging.4,5 inadequate biliary excretion of protoporphyrin has toxic effects on hepatobiliary structure and function .
exposure of cultured hepatocytes to protoporphyrin has been found to inhibit cell metabolism and to increase cellular fragility.6 - 8 the resultant bile may damage the bile duct epithelium , resulting in biliary fibrosis.4,5 patients with severe epp and hepatic involvement frequently undergo hepatic or bone marrow transplantation.9 - 12 we describe here a patient with acute - on - chronic liver failure from epp who was treated by urgent liver transplantation ( lt ) , with special attention to specific shielding from light exposure .
the patient , a 31-year old male with photosensitivity since childhood , had a family history on his mother 's side of photosensitivity of unknown cause .
two years earlier , he had been diagnosed with porphyria and liver cirrhosis by skin and liver biopsy .
fatigue and abdominal distention continued for 10 months despite medical treatment . due to a lack of improvement of liver cirrhosis - related symptoms ,
he was enrolled on the waiting list for deceased - donor lt . while on the waiting list , however , he experienced two episodes of hepatic encephalopathy . a genetic study , using polymerase chain reaction followed by sequencing , confirmed the diagnosis of epp and the presence of a fech gene mutation ( 18q21.3 ) .
his symptoms and laboratory profiles aggravated rapidly : total bilirubin 25.4 mg / dl , albumin 2.2 g / dl , creatinine 2.5 mg / dl , and prothrombin time 2.71 inr .
he finally fell into acute - on - chronic liver failure with hepatorenal syndrome , with a model for end - stage liver disease ( meld ) score of 39 .
we then searched for a living donor for lt , but his younger brother had the same genetic mutation , making the latter ineligible for donation .
his condition worsened as he became semicomatose and his total bilirubin concentration increased to 45.6 mg / dl .
just after laparotomy , his entire viscera were protected from light in the operating room ; this was because exposure to intense light is a risk factor for bowel perforation in patients with epp .
we therefore used low - powered light emitting diode ( led ) light sources and a wavelength - adjusted filter film .
the patient 's native liver weighed 1427 g ; the parenchyma was colored dark and brownish green and had multiple cirrhotic nodes ( fig .
microscopically , we observed regenerating submassive hepatic necrosis with accumulation of dark - brown pigments and severe cholestasis ( fig .
polarizing microscopy showed that these pigments had yellow and red birefringence in a maltese cross pattern ( fig .
all of these findings supported the diagnosis of epp.5,6,9,13 posttransplant recovery was slow but the patient improved progressively .
he recovered consciousness , but tracheostomy was performed on posttransplant day 18 due to weak respiratory muscle power . after weaning from the ventilator , the tracheostomy cannula was removed on day 42 .
he was kept on continuous renal replacement therapy and conventional hemodialysis for 2 months until his renal function recovered .
total porphyrin concentrations in his blood and urine were measured serially , disappearing on qualitative analysis after recovery from lt .
his immunosuppressive regimen included cyclosporine ( target trough concentration , 120 - 150 ng / ml for the first 3 months ) mycophenolate ( target trough concentration , 1 - 3 ng / ml for the first 3 months ) and methylprednisolone .
the safety of all drugs was checked using the drug database for acute porphyria ( http://www.drugs-porphyria.org ) , to avoid the use of porphyrogenic agents.5 he was hospitalized for 3 months after transplantation due to the requirement for rehabilitative treatment , enabling him to stand and walk . at present , 24 months after lt , the patient is doing well , with no complications .
epp is a rare disease , with an incidence in the general population ranging from 1:75,000 to 1:200,000.3 - 5 the first lt for epp - related liver failure was reported in 1979.9 in korea , epp is very rare , and this patient is the first in korea with epp to undergo lt . of 2500 adult lts performed at our center , this patient was the only one with epp . epp results from abnormalities in ferrochelatase activity.2,3,9,14,15 this enzyme converts protoporphyrin to heme in the final step of the heme biosynthetic pathway . in the absence of ferrochelatase activity , protoporphyrin accumulates in blood , erythrocytes , bone marrow and other tissues . as protoporphyrin is excreted by the liver , excess protoporphyrin results in high concentrations of protoporphyrin within hepatocytes , producing crystalline deposits and additional cell injury .
altered bile composition and inadequate biliary excretion of protoporphyrin has toxic effects on hepatobiliary structure and function.4,8,9 bile formation is impaired and bile duct epithelium is damaged , resulting in biliary fibrosis.4 thus , patients with epp are at risk of cholelithiasis with obstructive episodes , and a small proportion develops chronic liver disease .
progression of protoporphyric hepatic deterioration leads to splenomegaly , splenic sequestration of erythrocytes with hemolysis and protoporphyrin generation , ending in fulminant hepatic failure.5,8 epp is an inherited disorder with both recessive and dominant patterns of inheritance.5,13 most patients with epp have one allele with a fech mutation and the low - expression allele.3,5 the fech gene was cloned and sequenced in 1990 and localized to the long arm of chromosome 18 ( 18q21.3).2,3,13,16 the patient in the present study had the fech gene mutation c.386del ( p.gly129aspfsx16 ) , which had not been reported previously .
his younger brother had the same mutation , but he did not have symptoms of epp . the latter is therefore an asymptomatic gene carrier and thus could not be a liver donor . because he has 50% fech activity and a normal phenotype , the pedigrees of this patient and his brother should be evaluated extensively .
bowel protection is important during surgery in porphyria patients because laparotomy itself may carry risks of bowel perforation.6,7,9 the visceral organs can be damaged by phototoxic reactions of astral lamps and the operating room lights , resulting in third - degree burns and delayed bowel perforation .
we therefore used low - powered led lights and a wavelength - adjusted filter film . since blue , violet and ultraviolet - a ( 400 - 410 nm wavelength ) light
excite protoporphyrin , they must be blocked effectively in the operating room.7 led light releases less ultraviolet radiation than the lights usually used in the operating room .
the led lights were covered by a wavelength - adjusted yellow film that could block blue , violet and ultraviolet light .
although the power of the light source was decreased and operating field was much darker than during usual laparotomy , the lt operation was not compromised because it was a routine surgical procedure .
even after lt , we lowered the intensity of ambient light during intensive care due to possible photosensitivity .
after full physical recovery , no light barrier was applied except for direct exposure to sunlight .
the intraoperative light protection is very similar to the patients undergone photodynamic therapy , but the period for posttransplant protection was relatively shorter in epp patients than in patients receiving photodynamic therapy .
the immunosuppressive regimen for this patient consisted of the triple combination of cyclosporine , mycophenolate and methylprednisolone .
cyclosporine is a safe immunosuppressant for patients with porphyria , according to the drug database for acute porphyria.7 in addition , cyclosporine has been reported to inhibit the mitochondrial permeability transition of hepatocytes that is induced by protoporphyrin ix , whereas tacrolimus does not.15 reduced hepatotoxicity may enhance biliary excretion and account for the marked decrease in plasma protoporphyrin concentrations .
cyclosporine has been suggested as the calcineurin inhibitor of choice and may be beneficial in the treatment of nontransplant protoporphyrin hepatopathy.15 several reports have assessed survival after epp - related lt .
for example , the overall 1- , 5- , and 10-year patient and graft survival rates in 20 epp patients who underwent lt in the united states between 1979 and 2004 were 85% , 69% , and 47% , respectively.9 in pediatric patients , the 1- , 5- , and 10-year patient and graft survival rates were 100% , 75% , and 50% , respectively.9 recurrent epp liver disease occurred in 11 ( 65% ) of 17 patients who survived more than 2 months after lt .
recurrent epp liver disease occurred as early as 8 months after lt , and three patients required retransplantation , at 1.8 , 12.6 , and 14.5 years , respectively .
three additional patients who died with recurrent epp liver disease had extensive protoporphyrin deposits and bridging fibrosis or cirrhosis on liver biopsy .
recently , european multi - center study , including uk data , showed the overall patient survival rates of 77% at 1 year and 66% at 5 and 10 years in 31 patients.17,18 although the effective treatment of liver failure caused by epp is lt,14 it does not ameliorate the underlying protoporphyrin overproduction in the native bone marrow , thus leaving the recipient at risk for recurrent disease.9 bone marrow produces 80% of protoporphyrin ix and an optimal therapy for epp would correct the defect in heme synthesis.5,9 - 12 sequential liver and bone marrow transplantation may be used to treat patients with epp.10,12 bone marrow transplantation can alter the genotype of bone marrow , resulting in phenotypic reversal , thus protecting patients from future protoporphyric liver disease.12,19 bone marrow transplantation may be indicated for epp patients without advanced liver fibrosis after reversal of liver failure , for older patients with recurrent graft disease after lt , for younger patients after lt , and for patients with progressive liver disease .
the patient described here may undergo future bone marrow transplantation because he is young and considered at high risk for epp - related liver disease.12 we have performed bone marrow transplantation in a lt recipient to treat hematologic malignancy . owing to his familial history , an extensive search for
future prevention and treatment of liver disease in this patient may include erythrocyte transfusion , plasmapheresis , ursodeoxycholic acid , cholestyramine , charcoal and tocopherol , as well as bone marrow transplantation.3,5,9 - 12,20 | erythropoietic protoporphyria ( epp ) is an inherited disorder of the heme metabolic pathway that is characterized by accumulation of protoporphyrin in the blood , erythrocytes , and tissues , and cutaneous manifestations of photosensitivity , all resulting from abnormalities in ferrochelatase ( fech ) activity due to mutations in the fech gene .
protoporphyrin is excreted by the liver , and excess protoporphyrin leads to cholelithiasis with obstructive episodes and chronic liver disease , finally progressing to liver cirrhosis .
patients with end - stage epp - associated liver disease require liver transplantation .
we describe here a 31-year - old male patient with epp who experienced acute - on - chronic liver failure and underwent deceased - donor liver transplantation .
surgical and postoperative care included specific shielding from exposure to ultraviolet radiation to prevent photosensitivity - associated adverse effects .
the patient recovered uneventfully and was doing well 24 months after transplantation .
future prevention and treatment of liver disease are discussed in detail . |
a 48-year - old lady , gravida 3 , para 3 , presented with right inguinal mass associated with menometrorrhagia for eight weeks .
she had a history of period pain at the groin during menses . on examination ,
the right inguinal mass measured 4 5 cm and was tender and relatively fixed .
fine - needle aspiration ( fna ) biopsy of the inguinal mass was performed and revealed endometriosis . in view of her vaginal bleeding , bulky uterus , and inguinal mass ,
the patient was advised to have a dilatation and curettage along with excision of the groin mass .
a 6 5 cm solid , fibroid - like tumor was removed from the right groin ( see figures 1 and 2 ) .
endometriosis is defined as the presence of endometrial glands and stroma outside the endometrial cavity and uterine musculature .
most common sites of endometriosis are within the pelvis , while unusual locations include bladder , intestine , surgical scars , diaphragm , umbilicus , and groin [ 3 , 4 ] .
more specifically , the lesions can be found in the extraperitoneal portion of the round ligament , in the inguinal lymph nodes , in the subcutaneous adipose tissue , and even in the wall of sacs of inguinal or femoral hernias [ 69 ] .
this paper aims to elucidate the incidence , pathogenesis , and management of this rare clinical problem .
inguinal endometriosis was first reported by allen in 1896 , but since then only a little more than 30 cases have been described [ 3 , 6 , 10 , 11 ] .
battista candiani et al . reported six cases of inguinal endometriosis and they noted the mean age at diagnosis was 31 years .
the size of the mass reported ranges from 1 to 6 cm in diameter [ 811 ] .
about 90% of reported cases of extraperitoneal endometriosis occur in the right inguinal area [ 4 , 6 , 10 , 11 ] as was noted on the patient in this case .
malignant transformation to carcinoma had been reported , with three cases of clear cell carcinoma documented .
thus , it is of significance to remove the inguinal mass for pathology confirmation .
the actual incidence of inguinal endometriosis is difficult to ascertain . due to the nonpelvic location of the lesion
, patients would most often consult a general surgeon rather than a gynecologist , with a preoperative diagnosis of inguinal pathology .
they reported that 91% of inguinal endometriosis cases are associated with coexisting pelvic endometriosis . yet
quagliarello et al . reported a patient with inguinal endometriosis with no evidence of pelvic endometriosis on laparoscopy .
laparoscopy was not performed on this patient because she was asymptomatic with no dysmenorrhoea or pelvic pain suggestive of the presence of pelvic pathology . although the typical complaints of patients with pelvic endometriosis include dysmenorrhoea , menstrual irregularities , dyspareunia , and infertility , patients with extrapelvic endometriosis like inguinal endometriosis present with unusual symptoms and occasionally , a diagnostic dilemma .
periodic menstrual pain at the mass is sometimes the primary complaint [ 3 , 10 , 11 ] .
patients often present with a painful lump in the groin and premenstrual tenderness and/or swelling [ 6 , 9 , 10 ] .
a history of a previous gynecologic procedure or surgical trauma is also contributory [ 3 , 6 ] .
some patients may have no history of dysmenorrhoea , pelvic pain , or dyspareunia as in our patient .
described the gross findings of an inguinal endometrioma removed during surgery as multilobulated dark brown - colored tissue with hard consistency .
the histological diagnosis of endometriosis was based on the finding of characteristic endometrial glands with stromal cells within the fibrous connective tissue [ 3 , 8 , 9 , 11 ] as was seen in this case .
there was also chronic inflammatory cells and hemosiderin - laden histiocytes [ 7 , 11 ] found in some sections .
inguinal endometriosis may develop in the inguinal region as a mass from direct implantation , coelomic metaplasia , tubal regurgitation lymphatic spread .
they contest that , in view of the extraperitoneal location of the endometriotic lesions , tubal regurgitation seems unlikely .
furthermore , in terms of coelomic metaplasia , there does not appear to be an adequate embryologic explanation for the disproportionate predominance of endometriotic lesions on the right inguinal region , as compared to the left .
these theories do not offer an adequate explanation for the pathogenesis of inguinal endometriosis , especially in terms of patients with neither history of pelvic endometriosis nor previous surgery . according to separate accounts by quagliarello et al . and seydel et al .
, inguinal endometriosis is difficult to explain if it is not found in the pelvic lymph nodes [ 3 , 8 ] . in separate reports , several authors have documented cases of inguinal endometriosis without evidence of concomitant pelvic endometriosis [ 710 ] .
the lesions were localized either in the round ligament or the hernial sac [ 79 ] .
the asymmetrical lymphatic drainage in favor of the right inguinocrural region might explain this phenomenon but according to battista candiani et al .
endometriosis of the inguinal canal can be difficult to detect , with the correct preoperative diagnosis made less than 50% of the time .
the presumptive diagnosis is most often confused with conditions such as incarcerated hernia , lymphadenopathy , suture granuloma , neuroma , abscess , hydrocoele of the inguinal canal , primary or metastatic cancer , lymphoma , lipoma , hematoma , sarcoma , and subcutaneous cyst [ 3 , 10 ] .
very often , the final diagnosis is made only after the pathology , either from biopsy or at exploration , and demonstrates the histological presence of endometriosis .
a history of periodic menstrual pain and tenderness associated with an inguinal mass is important in distinguishing this condition from other inguinal pathology .
diagnostic modalities such as radiological studies , ultrasound , and computed tomography scan have not been specifically helpful in the diagnosis .
these modalities can not differentiate an endometrioma from a mass of similar density such as hematoma , lymphoma , sarcoma , or desmoid tumor . on the other hand ,
magnetic resonance imaging is more accurate since it can identify the presence of iron in the haemosiderin deposits contained in an endometrioma .
fine needle aspiration biopsy has also been shown to aid in the diagnosis of a case of endometriosis associated with an inguinal hernia [ 6 , 7 ] .
. believe that this procedure should probably be the first step in the diagnosis of inguinal endometriosis due to its ease in performing and accuracy in results .
the finding of small groups of nonatypical epithelial cells in an inflammatory and proteinaceous background in fna biopsy was similar to those of endometriosis in other sites .
the absence of atypia helps to differentiate inguinal endometriosis from metastatic carcinoma to the inguinal region .
hormonal therapy has shown to be a useful adjunct in the management of these cases .
batistta candiani et al . reported that in one out of the six patients with inguinal endometriosis treated by surgical excision , the inguinal mass recurred 14 years after the initial surgery .
this patient underwent a second exploration which revealed a multinodular subinguinal endometriotic lesion with ill - defined borders mixed with scar tissue and infiltrating the thigh muscles .
excision was incomplete and patient was given danazol 400 mg / day for the residual endometriosis . in terms of the usage of prophylactic hormonal therapy for endometriosis , quagliarello et al .
( 1985 ) cautioned that , due to its side effects , suppressive therapy with danazol should be reserved only for patients with laparoscopic evidence of coexisting pelvic endometriosis .
majeski recommends performing pelvic laparoscopy for all patients who have endometriosis in the extraperitoneal part of the round ligament or in a scar .
this view is shared by other authors ( goh and flynn 1994 ; batistta candiani et al .
1991 ) because of the association with pelvic endometriosis and subfertility [ 10 , 11 ] . on the other hand , seydel et al .
did not see the need to perform laparoscopy in patients who do not present with signs of pelvic endometriosis . for the patient in this case , simple excision was performed .
it was not deemed necessary to perform laparoscopy since this patient did not present with signs of pelvic endometriosis .
we present a case of a 48-year - old woman with right inguinal mass associated with inguinal pain during menses .
it usually presents as painful / tender inguinal mass and is most often mistaken for incarcerated hernia and other inguinal lesions .
clinicians should not underscore the importance of a carefully taken history and physical examination , an increased awareness of this disease entity and a high index of suspicion in coming up with a correct diagnosis .
failure to recognize this syndrome and treatment with adequate excision may predispose to symptomatic recurrence . on the other hand , an accurate preoperative diagnosis may spare both the patient and physician the undue stress of performing an unnecessary emergency operation . | inguinal endometriosis can present as a rare tumor when it occurs outside the abdomen and pelvis .
we present a patient with a painful tumor in the right inguinal region , where its diagnosis was made before the operation .
this enabled a conservative excisional surgery to be performed .
the literature is reviewed and the diagnosis as well as management are discussed . |
stroke is the single largest cause of global adult disability and secondary stroke is more likely to be fatal or cause major disability . on a global scale ,
secondary stroke prevention strategies and risk factor treatment and management have been shown to reduce stroke recurrence .
causes of stroke are multi - factorial , however , the most important behavioural risk factors of heart disease and stroke include smoking , unhealthy diet , physical inactivity and harmful use of alcohol .
these behavioural risk factors are responsible for about 80% of coronary heart disease and cerebrovascular disease . it has been suggested that patients with an established risk factor are more aware of their risk for future stroke , however other studies still suggest knowledge and awareness of stroke risk factors is poor amongst high - risk populations . despite improvements in the treatment of cardiovascular disease through medical advances and government targets , adherence to secondary prevention measures
is reportedly low with one study of over 2000 ischaemic stroke patients reporting one - quarter discontinuing one or more of their prescribed secondary prevention medications within 3 months .
moreover , after one year following a stroke , 22% continue to smoke , 36% remain obese and 4% are drinking excessively .
different behavioural risk factors tend to be associated with specific socio - demographic groups within a stroke population , e.g. younger , white males were more likely to smoke while non - white women were more likely to be obese .
although in coronary artery disease ( cad ) illness beliefs have been shown to influence behaviour with perceptions of more serious consequences predicting better adherence , this has not been the case for stroke survivors .
the reasons for this are unclear but the differences may have something to do with the patient 's perception of their risk of further illness .
international studies have shown that patients are unlikely to call for urgent attention if they or a family member suffer a stroke .
this suggests for primary stroke , they and/or their family members either do not see the urgency in the need for attention for stroke or believe even if they hurry to hospital nothing can be done .
a systematic approach was taken to identify and examine the current literature with regard to secondary stroke prevention , stroke patient risk awareness and stroke risk factor management . a search of the following databases pubmed , medline and google scholar identified journal articles as well as reports from organisations such as the world health organisation with information regarding the current status of cardiovascular disease prevention and risk factor management .
studies addressing knowledge of future event risk of stroke have focussed on the general public ( and then predominantly the caucasian population ) , but one study which looked at knowledge of risk in high - risk patients showed that only 42% of patients with a history of previous stroke were aware of their future stroke risk and only 27% recalled being informed of their risk by a physician .
previous work by the authors has also identified low levels of risk awareness in high - risk stroke patients with only 41% reporting being at risk of a future event .
the public 's under - appreciation of the potential seriousness of stroke may be a reason for decreased compliance with secondary stroke prevention measures .
poor patient awareness and knowledge have resulted in sub - optimal adherence to risk modifications .
conversely , providing information about atherosclerosis may improve adherence to intervention protocols such as medications and lifestyle modifications as we have seen in educational marketing campaigns , public awareness of the signs and symptoms of stroke have improved early recognition resulting in the provision of new treatment advances such as thrombolysis for acute ischaemic stroke . specialist charitable organisations have been responsible for improvements in public awareness with recent surveys suggesting an increase in knowledge of stroke signs and symptoms from 45% to 85% mainly due to media campaigns such as face , arm , speech and time ( f.a.s.t . ) . however , stroke patients are still slower than cardiac patients at attending hospital urgently with their symptoms and stroke patients may not recognise future signs and symptoms of stroke which differ from their original symptoms .
awareness of the future risk of another stroke differs from knowledge or awareness of individual stroke risk factors .
increased knowledge of stroke risk factors is significantly associated with younger age , a higher educational level and not living alone .
well educated patients from high social classes are known to be more knowledgeable and compliant with health care advice than those from less privileged backgrounds . indeed ,
even knowledge about hypertension and its aetiological role as a risk factor for stroke is not only poorly realised but partly associated with educational background .
therefore , the challenge for health professionals is how to educate members of the public and patients about risk factors and other health messages , however , this challenge has been on - going for decades and is linked to health literacy . more research on patient
behaviours post stroke will inform future campaigns to improve the effectiveness of health messages to all members of society particularly those at high risk from vascular disease .
it has been suggested that knowledge of risk factors appears to be higher amongst those who already have an established risk factor . despite this
, only 41% of high - risk people in one study were aware that they were at greater risk of stroke .
however , nicol and thrift identified that people with risk factors more commonly identify those risk factors when asked and suggest those people who can identify risk factors are more likely to identify themselves as being at risk of stroke .
this is an important factor for health professionals to understand during consultations with patients to ensure the health message education is understood and retained as it could impact on future risk factor awareness and influence possible choices of behaviour .
barriers to risk awareness have also been identified as socio - economic and age - related as well as gender - specific .
several barriers to risk factor control have been identified in various studies and include inadequate follow - up and monitoring of stroke survivors by health care professionals , inadequate prescribing of secondary prevention therapies , poor information provision and inadequate self - management of risk factors by patients .
studied general practice records between 1995 and 2005 and found only 25.6% of men and 20.8% of women received secondary stroke prevention .
it is also important to consider an individual is not likely to initiate , change or maintain health behaviour in the face of barriers , unless they have a core belief they have the personal resources to do so .
an individual 's motivational and self - regulatory skills are imperative in any behaviour change intervention and will happen if they have the personal belief that they are able to successfully achieve the change .
these strategies have largely relied upon health professionals providing information , support and monitoring of patients ' conditions and control of individual risk factors for stroke such as bp , cholesterol , diabetes and smoking status .
however , these strategies are not always initiated possibly due to conflict between providing a patient centred approach and the goals of public health .
social influences impact on patient beliefs , adherence to medication and lifestyle advice as well as the socio - economic challenges of low economic status and educational levels as well as ethnicity and cultural disparities .
studies to identify specific risk differences in varying ethnic populations are useful to understand which groups are at high risk from certain vascular risk factors , e.g. south asians are 50% more likely to have an mi or angina and bangladeshi 's have the highest rates of cvd . in contrast , men born in the caribbean and living in the uk are 50% more likely to die of a stroke than the general population . despite the biological differences
, ethnicity also involves cultural and religious variables which effect behaviour of patients and health professionals .
racial origin may be a determinant of the type and level of health care received and patient 's values and beliefs influence behaviour .
variations also exist in cultural diversity training for health care professionals across the uk depending on profession and region with a quarter ( 25% ) of health care professional trainees not receiving any formal cultural diversity training .
provision of information alone is rarely sufficient to affect health behaviour change ( there are few smokers , if any , who are unaware of the message that smoking kills ) ; however , it remains a crucial element of health education . due to the challenge this presents and the rise in the need for communication of risk to patients and the general public in order to increase self - management of chronic health conditions , the communication of risk information has recently received increased national attention through policy development .
individuals are more responsive to information about relative risk than absolute risk , with the former having greater influence over decision making . it has also been suggested that an individual 's perceptions of severity of the targeted health threat are as influential as perceptions of risk in relation to motivating behaviour change .
provision of risk information should also be accompanied by a personally tailored action plan of where and how the risk reducing behaviour may be implemented within the context of that individual 's current lifestyle .
explicit in any risk communication should be an explanation of the process whereby the risk leads to the disease and the process through which that risk is reduced when health behaviour is altered or undertaken .
suggest risk information is important to increase risk awareness , which may influence patients ' health behaviour choices , however how the risk information is understood and retained by patients remains the biggest challenge for health professionals .
studies have shown that the provision of information may improve knowledge but has not been found to improve perceived health status .
patient 's own perspectives about stroke illness and recovery may be as important as influence over emotional adjustment and adherence to medical recommendations .
suggested that information about one 's risk of stroke may provide the impetus for risk factor modification .
risk awareness after first stroke has been observed to influence behaviour post stroke and in relation to prevention of further stroke .
the dissemination of risk information is necessary if reductions in risk are to be achieved and studies which include interventions to communicate risk are useful to identify if risk awareness can improve adherence to secondary prevention strategies or the likelihood that patients will participate in behaviour changes to reduce risk .
studies have been performed using strategies such as enhanced educational programmes to impact on behaviour and improve adherence to secondary prevention strategies following stroke . from reviews of interventions to improve adherence or alter behaviours , few have had significant results , and of the randomised controlled trials performed specifically in stroke , the most effective study used an integrated care model of multiple components and an integrated management system to demonstrate improved effects on risk - factor management .
the complete multidisciplinary team commitment is an example of a gold standard of stroke care , but the multiple intervention components would be costly and difficult to coordinate in the long term and would require excellent communications between secondary and primary care .
although these elements should be expected , it would be challenging to implement these strategies across every stroke service in the country . nevertheless , in - hospital initiation of secondary prevention therapies yielded high rates of adherence in the stroke preventing recurrence of thrombo - embolic events through co - ordinated treatment ( protect ) program .
this project delivered eight medication / behavioural secondary prevention measures known to improve outcomes in patients with cerebrovascular disease .
the medication goals were
antithromboticstatinacethiazide diureticthe four behavioural goals weresmoking cessation counsellingexercise counsellingdiet counsellingeducation about personal risk factors the four behavioural goals were smoking cessation counselling education about personal risk factors high rates of adherence to the measures were observed at 3 months and suggest the inpatient setting provides a unique window of opportunity for the initiation of secondary prevention measures . the initiation of secondary prevention measures as an inpatient have been shown to be effective in other diseases such as coronary heart disease where good outcomes were demonstrated and led to a revision of national guidelines to endorse the approach as a national standard of care in patients with cardiac disease .
currently , stroke care guidelines provide evidence - based treatment targets but do not suggest how secondary prevention should be initiated or managed .
however , they do suggest , as the risk of stroke following the initial event is high , prevention ought to be initiated as soon as possible after the event .
urgent use of existing preventive treatments was associated with an 80% reduction in risk of early recurrent stroke following a prospective study with the primary outcome as risk of stroke within 90 days of first seeking medical attention following stroke .
the literature demonstrates the lack of risk awareness in patients at high risk of secondary stroke and identifies factors that influence risk awareness as well as the barriers to understanding and awareness .
this review has identified how risk awareness differs from risk factor knowledge and suggests perception of risk may influence individuals adherence and behaviours post stroke .
studies have highlighted effective educational programmes to improve knowledge and awareness which are effective but costly .
health professionals should consider risk awareness education as a tool for improving adherence and lifestyle modification during consultations with high - risk patients .
further studies are required to investigate ways in which the risk awareness health message can be conveyed in such that patients understand their risk of future stroke and alter their behaviour in response to the risk .
js is an associate editor of jrsm cardiovascular disease and ps is editor of jrsm cardiovascular disease .
this research received no specific grant from any funding agency in the public , commercial or not - for - profit sectors . | despite improvements in the diagnosis and treatment of cardiovascular disease through medical advances , it remains the largest single cause of disability and the second leading cause of death on a global scale . despite this , patient awareness of cardiovascular risk is low and adherence to secondary prevention measures is inadequate .
this combined with an ageing population could have serious consequences for both personal and health care costs .
risk management has been used to design strategies to prevent both primary and secondary stroke .
these strategies have largely relied upon health professionals providing information , support and monitoring of patients conditions and control of individual risk factors .
however , these strategies have not always been successful in the long - term management and prevention of secondary cardiovascular disease .
this review explores the literature surrounding risk awareness as a tool to improve patient adherence to medications and lifestyle behaviours to reduce risk of secondary stroke . |
according to the previously conducted studies around the world , musculoskeletal disorders ( msds ) are the most prevalent disorders among computer operators .
the prevalence of the neck and shoulders pain is reported to be high , in comparison with the pains in the other limbs that leading to sickness absence and disability , decreasing work efficiency , and extensive costs upon the organizations and societies . as a matter of fact
, developing appropriate programs and prevention of work - related msds among workers is a national precedence in several countries .
however , predictors of these diseases are relatively weak . in addition , previously conducted studies have indicated that the related factors of persistent neck / shoulder pains can be different from the etiological factors . in a study conducted by grooten et al .
, it is reported that merely almost of only one - third of those who suffer from the neck / shoulder pains could release from these pains after 5 - 6 years .
although the relationship between msds and both individual and work - related factors have been studied and confirmed through various researches , these recognized risk factors do not clarify unusual progressive modifications that have been detected in chronic pains and disabilities attributed to the prevalent msds . in 1980s , for instance , a disability resulted from arm pain became epidemic in australia , which could not be found in the other countries with similar work conditions .
furthermore , rate of disability due to back pain increased during the years of 1953 - 1992 in britain , although the required physical load at work was largely decreasing .
these findings have encouraged the hypothesis that the progress and persistence of nonspecific msds and related disabilities are influenced by culturally - determined health beliefs , in addition to mental health and physical activities .
furthermore , several observations have been conducted which support the role of somatization tendency ( i.e. , a
( nonmusculoskeletal symptoms ) on msds . in a longitudinal study conducted by solidaki et al . among 518 nurses , office workers and postal clerks in crete ,
it was found that persistence of msds significantly associated with somatising tendency , physical loading of work , and beliefs about work - causation of pain with odds ratio ( or ) ( 95% confidence interval [ ci ] ) of 2.6 , 2.3 and 1.9 respectively .
ryall et al . in their studies on patients , who were receiving primary care and physiotherapy services , found that fear - avoidance beliefs and mental health are prognostic factors for arm pain .
in addition , based on the study of warnakulasuriya et al . among 852 computer operators , sewing machinists , nurses and postal workers in sri lanka , low mood and tendency to somatize were identified to be constantly associated with musculoskeletal pains .
coggon et al . , indicated that somatizing tendency , health beliefs , and low mood could influence the persistence of msds and related disabilities more than the rate of acute complaints .
this study conducted considering above - mentioned findings , points and international differences in the prevalence of msds and related disabilities among occupational groups who are carrying out similar tasks , which is not completely clarified by the individual and psychosocial risk factors .
therefore , this study is aimed to assess the relationship of these new factors with persistence of neck / shoulder pains among computer office workers in shahroud , iran .
all eligible computer office workers ( n = 182 ) who were employed in four different universities of shahroud university of medical sciences and its subsidiary units and hospitals , shahroud university of technology , shahroud university of quranic sciences and shahroud azad university and its subsidiary hospital were selected and followed - up for 1-year .
inclusion criterion was at least 1-year experience of being a computer operator with at least 4 h / day of working with computer . a standardized cultural and psychosocial influences on disability questionnaire completed at the baseline ( from july 2008 to march 2009 ) and
1-year later at follow - up was applied to collect the required data . considering the base - line questionnaire ,
the first section was about the individual characteristics ( e.g. gender , age , education etc . ) .
for the second one , physical and psychosocial work - related factors ( e.g. , using a computer keyboard for longer than 4 h / day , manual lifting of weights 25 kg , repeated movements of the wrist or fingers for longer than 4 h in an average working day , time pressures , control at work , support from colleagues or supervisor , job satisfaction , decision latitude , job security , etc . ) were included . in the third section
, 14 questions were included regarding the neck and shoulder pains ( elements of nordic questionnaire ) and their disabilities for getting dressed and doing normal household jobs .
furthermore , a question about the expectation of pain ( i.e. , if you expect your neck / shoulders pain would be a problem for you in next 12 months too ? ) was added to this section .
the next section , included with four questions about other people 's pain ( e.g. , do you know anyone who has had neck pain in the past 12 months at work or outside ) . in the section five , each worker was faced with five statements taken from fear - avoidance beliefs questionnaire which were about their beliefs regarding the causation and prognosis of neck / shoulder pains .
three of the statements applied in this section were as the following : how strongly the participant agreed with statements of the form ,
your work may cause you to develop musculoskeletal pain , and rest is needed to get better these problems .
the answers were categorized as agree in the cases that the one agrees completely with the statement or tended to agree . in the sixth section , seven questions ( components of the brief symptom inventory ( bsi ) questionnaire ) , ( faintness or dizziness , pains in the heart or chest , nausea or upset stomach , trouble getting breath , numbness or tingling in parts of your body that had been distressing during the past 7 days regarding the somatizing tendency ) were applied .
mental health by applying the relevant subscale of the short form-36 questionnaire with five questions was the subject of the last section .
some of the questions included in that section are as the following : during the past month were you a happy person ? ,
have you felt calm and peaceful ? and have you been a very nervous person ? .
validity and reliability of these questionnaires have confirmed in many studies . in somatization tendency section , each symptom was scored 0 - 4 , depending on the distress it caused .
furthermore , the optional answers for mental health section were as the followings : all of the time , most of the time , a good bit of the time , some of the time , a little of the time , none of the time .
the scores attributed to these answers ranged 0 - 6 . in somatization tendency and mental health section of questionnaire scores
were summed and subjects were categorized into three bands , representing approximate thirds of the distribution ( denoted low , middle , and high ) for the whole sample . at the base - line , the participants were asked about pains in their neck / shoulders lasted for at least a day over the past 12 months .
the follow - up questionnaire was shorter and after an interval of 12 months asked about pain in the last 1 month .
participants , who had declared their agreement for take part at follow - up , filled this questionnaire .
the original questionnaire by the author was translated from english to farsi , and then by bilingual person it was back translated to english , also confirmed by occupational medicine specialists .
the pilot study was conducted among 60 workers who were not included in this study in order to test whether the farsi version of the questionnaire could be satisfactorily understood and completed .
reliability of the questionnaire was tested with chronbach alphas of 0.76 . in this study ,
neck / shoulder pains , was defined as the pains in the neck and/or either the shoulders .
furthermore , reported neck / shoulder pain lasting for at least a day over the previous 12 months at baseline and continuing presence of pain lasting for at least a day over 1-month at follow - up defined as persistent pain .
ethical approval required to conduct this study was applied and received from the research committee of shahroud university of medical sciences .
all eligible computer office workers ( n = 182 ) who were employed in four different universities of shahroud university of medical sciences and its subsidiary units and hospitals , shahroud university of technology , shahroud university of quranic sciences and shahroud azad university and its subsidiary hospital were selected and followed - up for 1-year .
inclusion criterion was at least 1-year experience of being a computer operator with at least 4 h / day of working with computer .
a standardized cultural and psychosocial influences on disability questionnaire completed at the baseline ( from july 2008 to march 2009 ) and 1-year later at follow - up was applied to collect the required data . considering the base - line questionnaire ,
the first section was about the individual characteristics ( e.g. gender , age , education etc . ) .
for the second one , physical and psychosocial work - related factors ( e.g. , using a computer keyboard for longer than 4 h / day , manual lifting of weights 25 kg , repeated movements of the wrist or fingers for longer than 4 h in an average working day , time pressures , control at work , support from colleagues or supervisor , job satisfaction , decision latitude , job security , etc . ) were included . in the third section
, 14 questions were included regarding the neck and shoulder pains ( elements of nordic questionnaire ) and their disabilities for getting dressed and doing normal household jobs .
furthermore , a question about the expectation of pain ( i.e. , if you expect your neck / shoulders pain would be a problem for you in next 12 months too ? ) was added to this section .
the next section , included with four questions about other people 's pain ( e.g. , do you know anyone who has had neck pain in the past 12 months at work or outside ) . in the section five , each worker was faced with five statements taken from fear - avoidance beliefs questionnaire which were about their beliefs regarding the causation and prognosis of neck / shoulder pains .
three of the statements applied in this section were as the following : how strongly the participant agreed with statements of the form ,
your work may cause you to develop musculoskeletal pain , and rest is needed to get better these problems .
the answers were categorized as agree in the cases that the one agrees completely with the statement or tended to agree . in the sixth section , seven questions ( components of the brief symptom inventory ( bsi ) questionnaire ) , ( faintness or dizziness , pains in the heart or chest , nausea or upset stomach , trouble getting breath , numbness or tingling in parts of your body that had been distressing during the past 7 days regarding the somatizing tendency ) were applied .
mental health by applying the relevant subscale of the short form-36 questionnaire with five questions was the subject of the last section .
some of the questions included in that section are as the following : during the past month were you a happy person ? ,
validity and reliability of these questionnaires have confirmed in many studies . in somatization tendency section , each symptom was scored 0 - 4 , depending on the distress it caused .
furthermore , the optional answers for mental health section were as the followings : all of the time , most of the time , a good bit of the time , some of the time , a little of the time , none of the time .
the scores attributed to these answers ranged 0 - 6 . in somatization tendency and mental health section of questionnaire scores were summed and subjects were categorized into three bands , representing approximate thirds of the distribution ( denoted low , middle , and high ) for the whole sample . at the base - line ,
the participants were asked about pains in their neck / shoulders lasted for at least a day over the past 12 months .
the follow - up questionnaire was shorter and after an interval of 12 months asked about pain in the last 1 month .
participants , who had declared their agreement for take part at follow - up , filled this questionnaire .
the original questionnaire by the author was translated from english to farsi , and then by bilingual person it was back translated to english , also confirmed by occupational medicine specialists .
the pilot study was conducted among 60 workers who were not included in this study in order to test whether the farsi version of the questionnaire could be satisfactorily understood and completed .
reliability of the questionnaire was tested with chronbach alphas of 0.76 . in this study ,
neck / shoulder pains , was defined as the pains in the neck and/or either the shoulders .
furthermore , reported neck / shoulder pain lasting for at least a day over the previous 12 months at baseline and continuing presence of pain lasting for at least a day over 1-month at follow - up defined as persistent pain .
ethical approval required to conduct this study was applied and received from the research committee of shahroud university of medical sciences .
in order to investigate the associations between persistence of neck / shoulder pains and all of the variables , initially univariate logistic regression was applied . then in order to investigate the simultaneous relationships between these variables and the persistence of neck / shoulder pains ( i.e. , with the aim of effects of likely confounding factors can be controlled ) , all of the variables in the former process with age , job experience and educational level were entered into the multiple logistic regression analysis model . and , they were summarized as ors with associated 95% cis . the level of significance was set up at p < 0.05 . for data analysis ,
from 208 computer office workers employed in shahroud universities , 182 ( response rate 88% ) completed the questionnaire at the baseline and 91.2% ( 166 ) of them participated at follow - up in 1-year later .
characteristics of the selected participants at the base - line and follow - up are summarized in table 1 .
characteristics of study population at baseline and follow - up mean age of the participants and weekly work hours were respectively 32.1 6.7 ( mean standard deviation [ sd ] ) years and 47.4 8.2 ( mean sd ) . 50% ( n = 81 ) of the study population had longer than 5 years experience of work .
most of the participants ( 64.8% ) were females and 68.3% reported working under time pressure . in comparison with the females ,
the males significantly had more second jobs ( p < 0.001 ) . at the baseline of the study ,
54.9% ( 100 ) of computer operators reported neck / shoulder pains at previous 12 months .
prevalence of neck / shoulder pains among the females ( 63.6% ) significantly ( p < 0.002 ) was more than the males ( 39.1% ) .
57 ( 34.3% ) of the participants who reported pains at the baseline , reported the pains 1-year later at follow - up .
persistence of neck / shoulder pains also among females was greater than males ( 40.4% vs. 22.8% ) .
however , based on the results derived from the follow - up , disability due to neck / shoulder pains was found to be higher among the females than the males .
disability in getting dressed was 57.7% among the females , in comparison with 28.6% found among the males .
furthermore , disability in performing the chores was 92.2% and 42.9% in the female and male participants . referring to physician was 19 ( 57.6% ) and the number of males who were visited by physicians was higher than the females ( 57.1% vs. 44.4% ) .
sickness absence due to neck / shoulder pains was just reported among the female participants at follow - up ( 25% ) .
based on the results from surveying the related risk factors for persistent neck / shoulder pains which was conducted with using univariate logistic regression , significant relationships between persistent neck / shoulder pain and somatization tendency ( p = 0.0 ) , mental health ( p = 0.002 ) and negative expectation of pain ( p = 0.003 ) were found .
the or of this outcome was 5.9 times more in those categorized as the middle and high of somatization tendency , in comparison with the low category of somatization tendency and 3.2 times more in those with low and middle mental health scores versus high .
furthermore , persistent of neck / shoulder pains among participants with negative beliefs about expectation of pain was 4 times more than others havent this belief .
all variables in the former process with age , job experience and educational level were entered into the logistic regression analysis model .
finally , associated risk factors of persistent neck / shoulder pains among computer office workers were found to be somatization tendency ( p = 0.01 ) , and negative expectation of pain ( p = 0.002 ) [ table 2 ] .
thus , after adjustment for confounding variables the or for persistent neck / shoulder pain was 6.5 ( 1.6 - 27.4 ) in the middle and high versus the low category of somatization tendency score and 8.3 ( 2.1 - 32.9 ) in those with negative beliefs about expectation of pain .
it means persistent of neck / shoulder pain among participants with middle and high score of somatization tendency is 6.5 times more than others with low score .
participants with negative beliefs about expectation of pain 8.3 times more exposed to these persistent pains . in our study , although no associations were found between persistent neck / shoulder pain and belief about work - relatedness of neck / shoulder pain and avoidance from physical activity in these pains , result showed these beliefs 1.8 times increase risk of persistent pain .
physical , organizational , beliefs , somatization tendency and mental health , risk factors for neck / shoulder disorders adjusted for age , gender , and education this study did nt show significant association between individual factors includes work experience and work hours per week with persistent neck / shoulder pain , although work experience increases these pains ( or = 1.5 ) . furthermore , physical and psychosocial risk factors includes , lifting weights of 25 kg or more by hand , working with hands above shoulder height , working under pressure to complete tasks by a fixed time , deciding at work , support from colleagues / supervisor , security at work did not indicate significant association with persistent neck / shoulder pain .
on basis of the results , knowing someone at work and outside with pain in the neck , arm , shoulder and mental health did not indicate significant association with persistent neck / shoulder pain , but theses pains among workers with low and middle score of mental health were 2.3 times more than high score .
in this study , prevalence of neck or shoulder pains among computer operators was found to be 54.9% , which is < 63% reported in a similar study conducted in usa , and more than the results of studies conducted in nicaragua ( 30% upper extremely pain ) and the netherlands ( neck / shoulder , arm 54% ) . in a cross - sectional study performed by choobineh et al .
, among computer operators working in banks of shiraz , iran , neck and shoulder pains with 59.6% and 58.2% , respectively , in previous 12 months of frequency were the most prevalent reported pains , which are higher than the results of the present study .
some of the other studies have indicated a range of 10 - 62% of neck / shoulder pains among computer users . based on the results , 34.3% of the subjects which reported neck / shoulder pains at base - line showed also persistence of these pains at follow - up , which is less than some studies . in a study conducted in germany , 41% of the office workers reported persistence of shoulder pains after 1-year follow - up .
juul - kristensen and jensen , indicated in their studies that 61% of office workers in 11 danish companies showed the symptoms of persistence of neck / shoulder symptoms in days after 1-year follow - up while persistence of low back or elbow / hand region , were 53% and 41% , respectively .
these differences in prevalence and persistence of neck / shoulder pains could be related to different cultures , different compensation and insurance systems . in this study , prevalence and persistence of neck / shoulder pains among female computer operators
were found to be higher than the males which are consistent with the results of several previously conducted studies .
repetitive work with not as much of rest , increased contact with etiological causes and gender imbalance in domestic work are interlinking factors that explain gender differences in neck / shoulder pains .
our results showed that the persistence of neck / shoulder pains at follow - up was strongly influenced by somatization tendency and negative expectation of pain at the baseline , raising risks some 6.5- and 8-fold .
however , in a study conducted in australia on three groups of workers including office workers , it was indicated that the relations between msds and somatization tendency was weak . at the present ,
cognitive behavior therapy is suggested for somatizing tendency and negative belief about pain in many studies . in a study in england among 1798 participants in working age , persistent arm pain was significantly prevalent in persons who believed that arm pain would be a problem in future 12 months which is consistent with our findings .
however , nocebo effects create completely from psychological bases and in many studies are related to anxiety ; it can be either psychological or physiological .
studies have shown brain processes of pain and the central nervous system , especially nociceptive portions of insula , cingulate and thalamus may be influenced by expectations as psychological factor .
although in this study mental health was found to have significant relation with neck / shoulder pains , persistent of neck / shoulders pains among persons with low and medium score of mental health were 2.3 times more than others with high score .
in study by palmer et al . , persistent arm pain in persons with low score of mental health were significantly prevalent .
, among workers who were performing monotonous and repetitive work ; it was shown that neck / shoulder disorders are strongly associated with decreasing of health - related quality of life .
however , in this study , beliefs about causation and prognosis of neck / shoulder pains were not found to have significant relationships ; it was greater among participant with these beliefs . in studies conducted by gimeno et al .
health beliefs about prognosis of pain were associated with the change from nondisabling to disabling msds ( or 3.7 ) .
furthermore , the results of this study showed that refereeing to physician for neck / shoulder pains was 57.6% and sickness absence due to neck / shoulder pain was 25% which both are higher than some previously conducted studies ( 21 - 38% ) and ( 13 - 21% ) , respectively .
it may be related to sickness absence compensation , work conditions , and belief about recovery of pain .
this study introduces several potential psychological risk factors , which could be helpful for healthcare in assessing the prognosis of patient with neck / shoulder pain .
our study confirms the importance of somatizing tendency and negative expectation about pain as risk factors for persistence of neck / shoulder pain among computer office workers .
this finding is novel in our country and needs to be independently replicated in other occupations .
however , it suggests that interventions with the aim of reducing the persistence of neck / shoulder pain should focus on recognizing somatization tendency by clinicians and modifying negative expectation about neck shoulders pain and generally ergonomic intervention should be account not only for prevention of injury but also for pleasing workplaces and reducing psychological risk factors .
this study was self - reported questionnaire based survey and this is the limitation of this work
. however , standardized questionnaire of many important risk factors , including physical , psychological , social and cultural , with follow - up design and high response rate are the points of strength in this study .
future studies should consider the importance of all the risk factors during longer follow - up interval and workplace interventions about worker 's health beliefs and somatization tendency and cognitive behavior therapy .
this study showed that neck / shoulder pains still pose a major problem among computer office workers and somatization tendency and negative expected pain at the baseline of the study are risk factors for persistent neck / shoulder pain after 1-year follow - up .
this confirms similar studies in europe countries and importance of psychological factors on work related msd in recent years . | background : neck and shoulder pains are the prevalent complaints among computer office workers .
the purpose of this study was to assess the relationship of somatization tendency , expectation of pain , mental health and beliefs about causation of pain with persistence of neck / shoulder pains among computer office workers.methods:this research is a kind of prospective cohort study with 1-year follow - up .
it has done among all eligible computer office workers of shahroud universities ( n = 182 ) in 2008 - 2009 and 1-year later .
data were collected using the cultural and psychosocial influences on disability questionnaire .
multiple logistic regression analysis was used to analyze the data through spss ( p < 0.05).results : at the baseline 100 ( 54.9% ) of participants reported neck / shoulder pains and at follow - up 34.3% of them reported persistence pains .
significant relationships were found between persistence of neck / shoulder pains and negative expectation about pain in next 1-year p = 0.002 , ( odds ratio [ or ] = 8.3 , 95% confidence interval [ ci ] : 2.1 - 32.9 ) and somatization tendency p = 0.01 , ( or = 6.5 , 95% ci : 1.6 - 27.4).conclusions : pain expectation and somatization tendency recognized as associated risk factors of persistent neck / shoulder pain among computer operators .
this confirmed some other similar studies on work - related musculoskeletal disorders in europe countries in recent years . |
. there are certain prophylactic and therapeutic indications for bilateral dj stenting like bilateral calculus obstruction , following bilateral lower ureteric reimplants , in cases of malignant ureteral obstruction and after bilateral uretero - renoscopy ( urs ) .
after the purpose of stents is over , patients are subjected to dj stent removal .
we present the technique of removing both the dj stents in one go with stent removal forceps obviating the need for inserting the cystoscope twice .
6 patients were subjected to bilateral dj stent removal from february 2011 to november 2011 after written and informed consent .
indications for bilateral dj stenting were following bilateral urs in 4 patients and bilateral extracorporeal shock wave lithotripsy for pelvic calculi in 2 patients .
rigid cystoscopy was done using 19 fr sheath and 30 degree lens ( karl storz , germany ) in all patients .
5 fr stent removal forceps is passed through the channel of the cystoscope bridge into the bladder .
the bladder is kept partially filled , otherwise the two crossing stents will diverge apart .
the two stents appear to be crossing like a x when seen cystoscopically [ figure 1 ] . with the help of stent removal forceps , both
the dj stents are grasped at the point of crossing i.e. at the mid - point of x and retrieved simultaneously along with the cystoscope [ figure 2 ] .
cystoscopic appearance of two dj stents crossing like a x cystoscopic appearance of 5 fr stent removal forceps grasping both the dj stent at the mid point of x ( or at point of crossing ) and being retrieved
all the patients underwent successful removal of both the dj stent in one go without any complications .
mean operative time from introduction of cystoscope till complete removal of bilateral stents simultaneously was 1 min 45 secs .
it was ensured by imaging studies ( x - ray and usg kub ) in all patients , prior to dj stent removal that there will not be any chance of recurrent obstruction on either side .
we recommend that our technique should be practiced in calculus disease after confirmation of stone clearance .
it is not recommended for simultaneous removal of bilateral dj stents in cases of bilateral lower ureteric reimplants and in situations of malignant ureteral obstruction wherein the usual practice is to remove / replace one side stent followed by another .
the dual dj removal concept is more relevant when dj stent is being removed with the help of flexible cystoscope in which case the entire scope needs to be passed again to retrieve the second dj stent .
other described simplified techniques for stent retrieval include a nylon thread attached to the end of the stent , which dangles from the external meatus , enabling manual withdrawal of the stent without anesthesia .
this solution is for the short term only because the dangling suture some - times causes unintentional dislodgment of the stent and may also be associated with a slight degree of incontinence .
also , a wire introducer with a snail head coil at its distal end has been described for blindly grasping the stent within the bladder of women only .
magnetic retrieval of stents by using a magnet on the retrieval urethral catheter and attaching a magnetically attractive , stainless steel bead to the end of a stent has also been used in the past .
all these methods may be applied for removal of both stents simultaneously but their simplicity appears questionable .
first , we have not compared the operative time with the standard technique of removing one stent after other .
secondly , some may argue that during rigid cystoscopy , stents can be removed in succession with sheath left in situ but in our opinion removing stents with endoscope alone may damage the delicate instrument .
our technique holds a special value in the era of flexible cystoscopy where repeated instrument manipulation for retrieval of stents can be avoided .
our technique is a simple method of removing both the dj stents simultaneously in one go and thus , avoid the need of reinserting the scope to remove the second dj stent and logically , saves operating time . | there are many urological and non - urological indications which require bilateral double j stenting .
we describe a point of technique for simultaneous removal of both the double j stents .
both the stents are held by stent removing forceps at a point where they cross each other and then removed in one go with the help of cystoscope .
medline search did not reveal any techniques of removing two dj stents in one go . |
view confronted the notion that the history of healing is par excellence the history of doctors. antithetical to a physician - centred approach was porter s call to do
at present , porter declared , we remain profoundly ignorant of how ordinary people in the past have actually regarded health and sickness. an alternative vision for the history of medicine would be written from the patient s point of view. thirty years on , there remains a concerted effort to elucidate the sufferer s role in the history of health and healing .
recent developments , however , most notably in the history of psychiatry , reveal a groundswell of dissatisfaction among scholars who argue that the historian can no longer be content with describing the theories and practices of the psychiatrist , or , inversely , the subjective experience of the patient alone .
rather , they claim , researchers need to explore the interactive dimensions of the doctor patient relationship and beyond . to facilitate this shift in focus from a history of patients to a history of these complex clinical dynamics ,
specifically , patient case notes have long been recognised as a potentially fruitful archival resource . in this paper
i chart my own engagement with the patient records of glasgow s gartnavel mental hospital by focusing on superintendent dr david kennedy henderson and his introduction to gartnavel of a so - called
dynamic approach to mental health care in the 1920s . in order to appreciate the significance of such records ,
the article begins with henderson s articulation of his psychotherapeutic method , before proceeding to an in - depth hermeneutic investigation into samples of gartnavel s case notes . in the process ,
i explore patient psychiatrist relationships , not as distinct entities , but as mutually dependent and interrelated subjects of historical enquiry .
these materials reveal a complex and multi - faceted clinical picture that involves various strategies of negotiation deployed by all members of the clinical encounter .
although henderson promoted sensitivity to the stories , patients compliance or resistance was based largely on their gender , social class and admission status .
these elements , which often determined their willingness to tell their stories , directly or indirectly , made their way into the case notes . therefore , gartnavel s patient records involve processes of construction and reconstruction at various levels by patients , psychiatrists , medical staff and historians alike .
dr david kennedy henderson ( 18841965 ) , gartnavel s superintendent during the period of interest ( 192132 ) , trained under some of the most eminent psychiatrists of his time .
these included thomas clouston in edinburgh , adolf meyer in baltimore , august hoch in new york and emil kraepelin in munich . between 1908 and 1919
, he worked at the royal edinburgh asylum , the pathological laboratories of the new york state hospitals , the nussbaumstrasse clinic in munich , the henry phipps psychiatric clinic in baltimore , the lord derby war hospital in lancashire and gartnavel mental hospital in glasgow , publishing scholarly articles on such topics as cerebral syphilis , war psychosis , and catatonia . entering the profession at a time of scepticism regarding nascent psychoanalytic theories and kraepelinian classificatory systems , henderson s blend of kraepelinian , freudian , and meyerian teachings was in many ways pioneering .
long before any other centre in great britain began to stir in response to the remarkable things which were being done on the north american continent , wrote henderson s colleague donald ewan cameron in 1965 , [ henderson ] began to send his young men to train with adolf meyer. the influence of meyer who by the inter - war years had become a leading figure of north american psychiatric thought played a particularly significant role in bringing new therapeutic practices to britain .
specifically , it led to the introduction at gartnavel of what meyer and henderson called a dynamic psychotherapeutic approach .
meyer , hailed during his lifetime as the dean of american psychiatry , was instrumental in shaping and promoting a new conception of the mind in early twentieth - century north america .
a swiss - born migr , meyer came to reject the rigid somaticism of late nineteenth - century psychiatry as it was then practised in north america .
rather , he saw mental illness as the cumulative result of unhealthy reactions of the individual mind to its [ physical and social ] environment ; he thus replaced the concept of mental illness as disease with that of mental illness as a reaction type that required both physical and psychological explanation. it was during henderson s early years of training under meyer , first in new york ( 190811 ) and later in baltimore ( 191215 ) , that he was taught to combine psychological studies of experience and individual subjectivity with pathological anatomy . surrounded by colleagues such as august hoch , who pioneered north american personality studies in the early twentieth century ,
henderson became engrossed in a field of research which took as its subject matter the relationship between patients thoughts , feelings and the external world .
the focus of this interrelationship was often to be ascertained through conversation with the patient . according to meyer , [ t]he psychiatrist
the user of biography must help the person himself to restore the capacity for self - regulation. here , the patient s own language and own understanding of his or her illness was used as the basis for any advice and further elucidation. in the wake of the psychoanalytic movement s increasing popularity both in the continent and in north america , personality studies , dream analyses , word association tests and talking therapies became part of these psychiatrists investigatory and therapeutic arsenal .
unlike freud , however , meyer taught his students and colleagues to desist from transforming patient stories into complex , theory - laden narratives .
rather , he advised that the psychiatrist use the patient s own story as the basis for therapeutic intervention .
this would be achieved through trust and co - operation . to transform individual stories into clinically
objective facts , meyer s long - lasting contribution to psychiatry was to standardise methods of examination and case note - taking procedures .
all of the potentially relevant factors in a case were to be made objectively evident through longitudinal studies of an individual s life history , recorded in uniform and systemic fashion. as ruth leys writes : [ meyer ] provided his students with a basic outline to be followed , specifying the order of procedure and actual questions to be put to the patient , something that had been lacking in previous handbooks of psychiatry .
[ meyer ] provided his students with a basic outline to be followed , specifying the order of procedure and actual questions to be put to the patient , something that had been lacking in previous handbooks of psychiatry .
another novelty that meyer introduced to north american institutions was the practice of holding so - called staff meetings , the proceedings of which were recorded by clinical stenographers .
the art of history - taking , henderson later observed when reflecting upon meyer s teachings , was invaluable in relation to prognosis , diagnosis and treatment. such methods became the cornerstone of north american psychiatric practice in the decades to come . upon henderson s promotion to physician - superintendent of gartnavel mental hospital in 1921 , he instigated new clinical practices based on meyer s methods .
remarks , examinations , staff conferences , nursing reports , laboratory testing , diagnosis and prognosis ; each formed a constituent element of the meyerian - inspired dynamic case note at gartnavel . leaning heavily upon meyer s 1918 case - taking guides and those of his american colleague , dr george hughes kirby ,
henderson typically divided the gartnavel patient records in tripartite fashion , consisting of the anamnesis ( personal history ) , the physical examination and the mental examination .
the duty of writing case notes fell to clinical clerks and stenographers as well as more senior medical officers .
the marks these authors made on the page are highly revelatory as to the processes of selection and interpretation by which medical knowledge was produced .
meyerian case - taking guides aimed to capture a live and continued account of examinatory procedures .
case notes include inverted commas , used to denote verbatim recordings of speech , while colons , dashes and question marks were used to highlight pauses , rhythms and silences that punctuated patients spoken words .
brackets , used to insert the writer s own observations of tone , emotional content or actions that accompanied speech , add another layer of interpretative depth .
all of this was ultimately intended to enable the psychiatrist to better understand the organic , as well as psychological , components of a patient s ills .
meyer s teachings motivated henderson to push scottish psychiatry away from its former emphasis on the description of symptoms , classification and brain pathology , and towards the study of the individual s personality as a reaction to his or her environment .
gartnavel s resident medical officers were encouraged to embrace the clinical teachings of kraepelin , the personality studies of meyer , august hoch and george amsden , and the
case notes reveal occasions where therapeutic interventions effectively took the form of talking and occupational therapies . rejecting the seeming rigidity of somatic - pathological interpretations then largely prevalent in the british psychiatric profession , henderson declared that
general descriptions of clinical syndromes , while interesting , are not of first importance. what is wanted, he noted in the preface to his jointly authored text - book of psychiatry ( 1927 ) , is an understanding of the patient as a human being , and of the problems which he is meeting in a morbid way with his
[ t]he physical and the psychological can not be divorced the individual must be treated as a whole. this philosophy , shared by meyer and henderson alike , guided henderson to pursue psychiatry as a
living subject in relation not only to general medicine , but to the social problems of everyday life. it is in accordance with these principles , he wrote , and with what is called the dynamic view , that we have utilised clinical records so extensively. the resulting records , based on the practices of north american colleagues , reveal materials in which the doctor patient dialogues are preserved in an attempt to faithfully reproduce the patient s voice .
these case notes capture , with remarkable clarity , some of the narratives , actions and anxieties exhibited by patients and psychiatrists as they interacted with one another .
contextualised against a backdrop of waiting rooms , patient dormitories , examination and consultation spaces , gartnavel s dynamic case notes can be used by the historian to reconstruct a historical human geography of patient psychiatrist interactions within these clinical confines . yet , as we shall see , the question remains as to precisely how much construction and reconstruction is involved in the production and later interpretation of these records .
upon henderson s promotion to physician - superintendent of gartnavel mental hospital in 1921 , he instigated new clinical practices based on meyer s methods .
remarks , examinations , staff conferences , nursing reports , laboratory testing , diagnosis and prognosis ; each formed a constituent element of the meyerian - inspired dynamic case note at gartnavel . leaning heavily upon meyer s 1918 case - taking guides and those of his american colleague , dr george hughes kirby ,
henderson typically divided the gartnavel patient records in tripartite fashion , consisting of the anamnesis ( personal history ) , the physical examination and the mental examination .
the duty of writing case notes fell to clinical clerks and stenographers as well as more senior medical officers .
the marks these authors made on the page are highly revelatory as to the processes of selection and interpretation by which medical knowledge was produced .
meyerian case - taking guides aimed to capture a live and continued account of examinatory procedures .
case notes include inverted commas , used to denote verbatim recordings of speech , while colons , dashes and question marks were used to highlight pauses , rhythms and silences that punctuated patients spoken words .
brackets , used to insert the writer s own observations of tone , emotional content or actions that accompanied speech , add another layer of interpretative depth .
all of this was ultimately intended to enable the psychiatrist to better understand the organic , as well as psychological , components of a patient s ills .
meyer s teachings motivated henderson to push scottish psychiatry away from its former emphasis on the description of symptoms , classification and brain pathology , and towards the study of the individual s personality as a reaction to his or her environment .
gartnavel s resident medical officers were encouraged to embrace the clinical teachings of kraepelin , the personality studies of meyer , august hoch and george amsden , and the
case notes reveal occasions where therapeutic interventions effectively took the form of talking and occupational therapies . rejecting the seeming rigidity of somatic - pathological interpretations
general descriptions of clinical syndromes , while interesting , are not of first importance. what is wanted, he noted in the preface to his jointly authored text - book of psychiatry ( 1927 ) , is an understanding of the patient as a human being , and of the problems which he is meeting in a morbid way with his
[ t]he physical and the psychological can not be divorced the individual must be treated as a whole. this philosophy , shared by meyer and henderson alike , guided henderson to pursue psychiatry as a
living subject in relation not only to general medicine , but to the social problems of everyday life. it is in accordance with these principles , he wrote , and with what is called the dynamic view , that we have utilised clinical records so extensively. the resulting records , based on the practices of north american colleagues , reveal materials in which the doctor
these case notes capture , with remarkable clarity , some of the narratives , actions and anxieties exhibited by patients and psychiatrists as they interacted with one another .
contextualised against a backdrop of waiting rooms , patient dormitories , examination and consultation spaces , gartnavel s dynamic case notes can be used by the historian to reconstruct a historical human geography of patient psychiatrist interactions within these clinical confines . yet , as we shall see , the question remains as to precisely how much construction and reconstruction is involved in the production and later interpretation of these records .
during the summer of 1930 , two male attendants accompanied a general practitioner to the house of a middle - aged male patient , mr patrick johnstone . upon their arrival
, the attendants remained outside mr johnstone s front room and , after much talk and argument between doctor and patient , they were asked to enter .
i looked round the room , an attendant later wrote , and noticed that lying near the door on the floor [ were ] a hatchet and splinters of glass.
softly laying a hand on mr johnstone s arm , he led the patient out of the room , but having reached the front door of the house mr johnstone made to run away. while the attendant held him back , johnstone began to shout for the police and [ mentioned ] something about a warrant. the doctor looked for a constable , but after it was made clear to mr johnstone that his wife would accompany him to gartnavel , he was finally coerced into the awaiting motorcar . on the way to the hospital mr johnstone sat in silence . upon reaching the entrance of gartnavel ,
, he alighted the steps to the front door and , with a rapidity of pace , walked briskly into the male reception hall .
he then stopped , pausing in order to light his pipe and , after having caught sight of one of the medical officers , johnstone strode forward ,
cordially offering his greetings to the medical officer , and stated his pleasure at meeting him .
it is at this moment , when patient and practitioner met upon the threshold of the hospital , that the construction of a patient s case notes began .
this was the point at which an individual became subsumed within the socially and diagnostically diverse yet somewhat amorphous
mass of patients at gartnavel ( which reached an annual average of 450 predominantly middle - class residents ) .
nursing attendants and general practitioners gave information as to the immediate actions of the person before admission .
then , gradually , as he or she entered the hospital , family and friends were invited to give information about the patient s history , so that case notes built up a picture of the individual from the joint perspectives of medical professionals and lay informants . for gartnavel
s psychiatrists , the point at which their attention shifted from the narrative of lay informants and medical certificates towards first - hand clinical observation marked a distinct turning point in the medical record . at this juncture ,
the temporality of the case note changed to the immediate observation of the patient as he or she adapted to hospital routines . during admission , when forms were presented and/or letters signed ( based on whether the individual was a
certified or voluntary patient ) , the waiting room signalled an individual s legal , temporal and physical transition to institutional care .
it was from within such a liminal space that gartnavel s practitioners were presented with their first opportunity to capture a
live and continued account of the patient s story as he or she entered the hospital .
meyer viewed this moment of transition as a valuable experimental phase which provided one of the most decisive opportunities to observe first - hand the individual s adaptive strategies to the demands of a new environment . in accordance with meyer s investigational techniques , the process of admission thus allowed gartnavel s medical officers to observe these adaptive strategies in a set of controllable , easily replicable environmental conditions .
the journeys , waiting rooms and wards here became the backdrop to individual life histories .
pathological laboratory to which the patient was observed to adapt , consigned in vignettes of the admission process which were thought to afford a natural picture of psychobiological maladaptation. while henderson similarly envisaged gartnavel as a
pathological laboratory , he also saw it as a therapeutic space in which one could potentially cure patients allegedly dysfunctional behaviours .
it was crucial to henderson s approach that a patient recognise his or her condition as a mental illness that necessitated treatment within a hospital by medical professionals .
as such , conforming to the hospital regime and accepting the authority of the psychiatrist was considered one of the first steps to therapeutic success , requiring the patient to adapt to this new
one of the most important factors affecting an individual s reaction to this new setting , as observed by henderson , was his or her status as a voluntary or certified patient .
early in his career he stressed that the line of division between those patients predisposed to recovery and those who failed was often drawn between the cooperative and non - cooperative patients , not between any supposed standard of sanity or insanity. throughout the 1920s gartnavel s admission staff therefore diligently recorded whether patients showed fear and/or ambivalence upon admission , or , by way of contrast , demonstrated acceptance and eagerness to submit to the hospital s treatments .
my analysis suggests that there was , indeed , a correspondence between level of compliance to the hospital regime and patients admission status .
sources show numerous occasions on which certified patients were recorded as resisting , evading and distrusting the legitimacy and efficacy of hospital care , while voluntary patients more often took on the role of what would now be called
service user by cooperating with , or even negotiating , the terms of their treatment .
this crucial ( if under - studied ) dimension of hospital care distinguishes scottish patient stories from those of their english and especially continental counterparts .
indeed , voluntary boarding was generally seen in the nineteenth century as a typically scottish feature . in england , on the other hand , voluntary admission to rate - aided mental hospitals was not widely practised until the 1930 mental health act . in gartnavel
s annual report for the year 1923 , 45 per cent of patients admitted that year were classified as voluntary .
this rose to an average of 50 per cent in 1924 , and 60 per cent in 1927 .
( further research into the background of voluntary patients may show that such admissions may have been related to social class . yet
preliminary investigations suggest that voluntary patients ranged from the highest fee - paying boarders , paying 160 per annum for their treatment , to the lowest ones paying 1 10s per week . )
this contrast between voluntary and certified patients is illustrated in the case notes of harriet paterson , a young female patient who entered gartnavel as a certified patient in 1924 .
after being transferred from a nursing home , she arrived dressed in what was described as a
flimsy evening frock and , through a cascade of tears , she protested against her
, it was reported that paterson regarded her father as having no legal right to force her into an asylum because she was a married woman . still crying and showing herself as very distressed to the medical officers
physical marriage a scotch marriage , and that there was nothing immoral about her.
annabel brown , another young female patient , is similarly recorded as having sat in the reception room : clinging to her father , very pale faced and distressed , not demanding to be taken away , but making no move to go to the ward with sister , and expressing fear doubt imploring her father to give her just another minute , kissing embracing him in a manner painful to observe .
he , himself , showed much indecision of mind , encouraging her in her embraces , asking [ medical officer ] if he were sure this was the best place for her , enquiring how she would be treated etc .
clinging to her father , very pale faced and distressed , not demanding to be taken away , but making no move to go to the ward with sister , and expressing fear doubt imploring her father to give her just another minute , kissing embracing him in a manner painful to observe .
he , himself , showed much indecision of mind , encouraging her in her embraces , asking [ medical officer ] if he were sure this was the best place for her , enquiring how she would be treated etc . in the introduction to a social history of madness , roy porter called for in - depth investigation into the socio - historical contexts that inform the narratives of those considered mentally ill .
focusing on the ways in which patients negotiated definitions of their illnesses as well as how they viewed themselves as patients and individuals , porter explored illness as a mutable , indefinite concept , aligned to changing notions of individual and social identity .
the vividness of these descriptions in the gartnavel records is valuable in that it throws light on the social processes behind dynamic case note construction .
these sources enable readers to engage with the wider socio - historical contexts as well as the subjective and interpersonal relationships that gave meaning to an individual s actions .
harriet patterson s case , for example , illustrates that conflicting inter - war notions of morality , authority and legality played a role in her attitude .
her behaviour suggests that her own perception of her admission was based upon ( and shaped by ) cultural norms rather than strictly medical notions of health and illness .
therefore , factors such as class and gender are integral to our understanding of this story . these patient narratives shed light on what it meant to be classified as mentally ill in a period in which common cultural understandings of mental illness were interwoven with notions of sexual ( a)morality and transgressive gender roles .
they also show that patients ( especially certified ones ) developed complex strategies of resistance to counter the medical authority and preserve their sense of agency .
duncan barrowman , a voluntary boarder transferred from stirling district mental hospital , declared that he was glad to arrive at gartnavel as he was
also voluntarily admitted in late november 1925 , he plunged straight into a long rambling discourse about his symptoms beginning with pimples on his anus ending with a heat in his throat all while signing the voluntary forms in the male reception room .
haggling for his treatment , armstrong stated that he was willing to pay anything up to 20 weekly , but the clinical clerk noted that he insisted that he should have things done exactly as he wanted them.
one of the most important factors affecting an individual s reaction to this new setting , as observed by henderson , was his or her status as a voluntary or certified patient .
early in his career he stressed that the line of division between those patients predisposed to recovery and those who failed was often drawn between the cooperative and non - cooperative patients , not between any supposed standard of sanity or insanity. throughout the 1920s gartnavel s admission staff therefore diligently recorded whether patients showed fear and/or ambivalence upon admission , or , by way of contrast , demonstrated acceptance and eagerness to submit to the hospital s treatments .
my analysis suggests that there was , indeed , a correspondence between level of compliance to the hospital regime and patients admission status .
sources show numerous occasions on which certified patients were recorded as resisting , evading and distrusting the legitimacy and efficacy of hospital care , while voluntary patients more often took on the role of what would now be called
service user by cooperating with , or even negotiating , the terms of their treatment .
this crucial ( if under - studied ) dimension of hospital care distinguishes scottish patient stories from those of their english and especially continental counterparts .
indeed , voluntary boarding was generally seen in the nineteenth century as a typically scottish feature . in england
, on the other hand , voluntary admission to rate - aided mental hospitals was not widely practised until the 1930 mental health act . in gartnavel
s annual report for the year 1923 , 45 per cent of patients admitted that year were classified as voluntary .
this rose to an average of 50 per cent in 1924 , and 60 per cent in 1927 .
( further research into the background of voluntary patients may show that such admissions may have been related to social class . yet
preliminary investigations suggest that voluntary patients ranged from the highest fee - paying boarders , paying 160 per annum for their treatment , to the lowest ones paying 1 10s per week . )
this contrast between voluntary and certified patients is illustrated in the case notes of harriet paterson , a young female patient who entered gartnavel as a certified patient in 1924 .
after being transferred from a nursing home , she arrived dressed in what was described as a
flimsy evening frock and , through a cascade of tears , she protested against her
, it was reported that paterson regarded her father as having no legal right to force her into an asylum because she was a married woman . still crying and showing herself as very distressed to the medical officers
legal marriage but rather a physical marriage a scotch marriage , and that there was nothing immoral about her.
annabel brown , another young female patient , is similarly recorded as having sat in the reception room : clinging to her father , very pale faced and distressed , not demanding to be taken away , but making no move to go to the ward with sister , and expressing fear doubt imploring her father to give her just another minute , kissing embracing him in a manner painful to observe .
he , himself , showed much indecision of mind , encouraging her in her embraces , asking [ medical officer ] if he were sure this was the best place for her , enquiring how she would be treated etc .
clinging to her father , very pale faced and distressed , not demanding to be taken away , but making no move to go to the ward with sister , and expressing fear doubt imploring her father to give her just another minute , kissing embracing him in a manner painful to observe .
he , himself , showed much indecision of mind , encouraging her in her embraces , asking [ medical officer ] if he were sure this was the best place for her , enquiring how she would be treated etc . in the introduction to a social history of madness ,
roy porter called for in - depth investigation into the socio - historical contexts that inform the narratives of those considered mentally ill . focusing on the ways in which patients negotiated definitions of their illnesses as well as how they viewed themselves as patients and individuals , porter explored illness as a mutable , indefinite concept , aligned to changing notions of individual and social identity .
the vividness of these descriptions in the gartnavel records is valuable in that it throws light on the social processes behind dynamic case note construction .
these sources enable readers to engage with the wider socio - historical contexts as well as the subjective and interpersonal relationships that gave meaning to an individual s actions .
harriet patterson s case , for example , illustrates that conflicting inter - war notions of morality , authority and legality played a role in her attitude .
her behaviour suggests that her own perception of her admission was based upon ( and shaped by ) cultural norms rather than strictly medical notions of health and illness .
therefore , factors such as class and gender are integral to our understanding of this story .
these patient narratives shed light on what it meant to be classified as mentally ill in a period in which common cultural understandings of mental illness were interwoven with notions of sexual ( a)morality and transgressive gender roles .
they also show that patients ( especially certified ones ) developed complex strategies of resistance to counter the medical authority and preserve their sense of agency .
duncan barrowman , a voluntary boarder transferred from stirling district mental hospital , declared that he was glad to arrive at gartnavel as he was fed up with his former co - patients .
as for george armstrong , also voluntarily admitted in late november 1925 , he plunged straight into a long rambling discourse about his symptoms beginning with pimples on his anus ending with a heat in his throat all while signing the voluntary forms in the male reception room .
haggling for his treatment , armstrong stated that he was willing to pay anything up to 20 weekly , but the clinical clerk noted that he insisted that he should have things done exactly as he wanted them.
the physical examination played an important part in the hospital routine and , as such , featured prominently in case notes . here
, records similarly capture vignettes of patients reactive strategies towards the rules , regulation and reality of their new status .
typical of these examination records are statements attesting to the individual s general health , with observations made about pulse , cleanliness of tongue , physical build , distribution of hair , reflexes , and so on .
it was in this part of the hospital routine , following admission , that patient
stories began to emerge more clearly in records , leading to the more in - depth
mental examination. however , as this section indicates , various factors determined the patients willingness to tell their stories . in cases where the reactions of a patient to the physical examination provoked him or her to enter into conversation with the psychiatrist to discuss symptoms and experiences
, these dialogues could find their way into the case note . before discussing these processes of authorial selection by medical authorities , it is important to get a picture of the way in which an array of power structures , narrative conventions and spatial parameters shaped the dialogues that passed between patients and doctors .
their experiences are recorded as ranging from compliance and passivity to fear , hostility and resistance : she was extremely unwilling to allow a physical examination to be done .
she refused to allow the chest to be examined saying that she understood this to be a mental hospital and that she did not see what examination of a patient s chest had to do with mental disease .
the necessity of making a physical examination was explained to her but she still persisted in her unreasonable attitude after a great deal of delay and persuasion she allowed the examination asking in a sarcastic tone as it proceeded if the mo [ medical officer ] could find any evidence of mental disease from his examination .
she refused to allow the chest to be examined saying that she understood this to be a mental hospital and that she did not see what examination of a patient s chest had to do with mental disease .
the necessity of making a physical examination was explained to her but she still persisted in her unreasonable attitude after a great deal of delay and persuasion she allowed the examination asking in a sarcastic tone as it proceeded if the mo [ medical officer ] could find any evidence of mental disease from his examination .
patient narratives , whether elicited upon admission during the physical and mental examination or later in the open ward , sometimes held aetiological significance .
one morning in july 1929 , a medical officer was conducting his rounds when , upon entering one of the female wards , he observed miss elizabeth murray , a newly admitted voluntary patient , acting in what he characterised as a high state . upon
miss murray s admission to the hospital the previous day it had been recorded that she spoke to herself a great deal and at times got very impulsive. during the latter part of the morning she had lain in bed : her eyes , observed a clinical clerk , were flashing and she immediately made strange signs. the notes indicate that as the day went on [ s]he blew from her mouth and made movements of her arms which seemed to indicate that she was pushing or brushing away the medical officer. the next day miss murray remained in bed and reportedly became very antagonistic when a doctor came to sit next to her . speaking in a
loud declamatory voice , she warned that if he remained seated in front of her she would spit on him .
she spat on me , three times ; and then she said something like thank god , thank god , he does not flinch. as she calmed down , curtains were drawn around the bed and miss murray allowed the nursing sister to arrange her dress for the physical examination .
again she showed momentary flashes of antagonism and proceeded to sing aloud danny boy , danny boy as the physician attempted to auscultate the thorax . gradually , this period of excitement subside[d] and he was
no ( definite ) miss murray then made reference to the coming of heaven , and stated how when she was a child she had a fancy .
she looked into a looking glass and saw another room ; and [ said ] that she had wished to get into that other room , the other side of the glass .
she looked into a looking glass and saw another room ; and [ said ] that she had wished to get into that other room , the other side of the glass .
miss murray smiled when the medical officer mentioned alice through the looking glass , but he remarked :
she seemed to suggest we were now through the glass we were through the veil of death into heaven. in cases such as this , the psychiatrist primarily studied the patient for signs of disease and physical disorder .
however , he also used common cultural discourses , metaphor and metonymy to engage with the patient s inner world . while the clinical encounter was recorded from the perspective of the psychiatrist , the narrative from below ( including non - verbal forms of communication , such as a glance or spit ) was accorded a high degree of significance and made its way into the case notes . to be sure , the organic origins of mental disorders were given etiological importance , as suggested by the above psychiatrist s attempt to auscultate the thorax ; yet records show that it was also crucial to let the patient tell her story . by forging a linguistic bridge between the reality of the patient s own world and the world jointly shared by patient and psychiatrist , henderson sought to promote an empathic , non - reductionist approach . for him ,
rather , it was considered of great value to get an exact description of the delusions and hallucinations [ if any were present ] , and how the patient has reacted to them. it is not the situation itself that matters , he noted , but what the subject feels about it , that was of greatest significance . yet precisely what psychiatrists did with the patient s story is made most evident in the ensuing mental examination .
as mentioned above , by the early 1920s dynamic case - taking guides were being published in north america , and an analysis of gartnavel s case notes reveals a resemblance to these published procedures .
these guides advised that medical officers begin the examination by assessing the patient s stream of mental activity and studying their emotional reaction ( affect) , their mental trend : content of thought as well as their insight and judgement. patients inner worlds , feelings and mode of communication were to be judged in relation to their appreciation of the shared
several cases suggest , both patient and psychiatrist could fight to establish the reality of that shared world .
indeed , as with the physical examination , the flow of the conversation could be resisted or disrupted by the patient s actions .
thus robert norton , admitted in 1926 as a voluntary boarder , rather resented being asked questions. reflecting on the encounter , the examining psychiatrist wrote : he discussed the way in which the questions were put , was suspicious of my motives in questioning him , and he refused to allow me to take any notes .
he said that if i took notes he would refuse to speak to me at all
he constantly repeated the questions i asked him , he found fault with it in various ways , he complained about the manner in which it was asked , he took exception to the way i sat on a chair besides his bed , and eventually he refused to co - operate any further , finishing up by saying that he considered i was just as insane as he was .
he discussed the way in which the questions were put , was suspicious of my motives in questioning him , and he refused to allow me to take any notes .
he said that if i took notes he would refuse to speak to me at all
he constantly repeated the questions i asked him , he found fault with it in various ways , he complained about the manner in which it was asked , he took exception to the way i sat on a chair besides his bed , and eventually he refused to co - operate any further , finishing up by saying that he considered i was just as insane as he was . in this case , the patient interpreted the act of note - taking as intrusive
the record of harriet smith indicates that she : showed a natural anxiety that what she said was not overheard by anyone else in the ward . at one point in the examination she asked anxiously if anyone saw the report and said she did not like notes being taken of what she said . showed a natural anxiety that what she said was not overheard by anyone else in the ward . at one point in the examination she asked anxiously if anyone saw the report and said she did not like notes being taken of what she said .
the spaces in which these initial examinations were conducted are important to understanding this resistance from below. case notes reveal that patients often remained within their dormitory beds , surrounded by other patients and ward nurses . the open dormitories that housed many of gartnavel s lower - class patients necessitated
indeed , there is evidence to suggest that mental examinations , conducted in such a public place behind only the flimsiest of partitions , could prove an inconducive environment for the revelation of patient stories . without the establishment of trust , henderson and his colleagues
were denied access to the patient s story and therefore deprived of the dialogue that was so central to their investigative methods . case notes highlight the fact that obtaining the illness narrative was often a thing to be hard won , not given over lightly or indeed entirely by the patient .
it was not atypical , then , for medical officers to have to fight to establish such a dialogue .
on a morning in may 1921 , a certain miss margaret beaton lay crying in bed as henderson and an accompanying clinical clerk entered the ward and sat beside her . a preliminary discussion between henderson and miss beaton ensued , followed by the formal mental examination .
having been informed by a ward nurse that the patient had not slept since her arrival , henderson found her to be in a highly emotional state . frequently sobbing throughout the interview ,
her general sullen appearance was noted by the clinical clerk , while henderson began an analysis of his patient by systematically exploring the different mental fields ( grouped under
henderson opened the conversation with a succession of simple questions , asking miss beaton to confirm her name and her general complaints , with the purpose of eliciting spontaneous speech . he obtained a perfectly lucid response from her and no evidence of organic disturbance was noted in the interview transcript .
henderson therefore proceeded to enquire about the degree of insight miss beaton had into her condition . endeavouring to ascertain whether she considered herself mentally ill and whether she would co - operate or resist the examination process , he asked :
i was foolish , selfish and stubborn and rather a bad temper and this is what they ve done.who ?
i was foolish , selfish and stubborn and rather a bad temper and this is what they ve done. who ? your mother and brother ? yes .
her home , she replied , was depressing , characterised by poverty and unhappiness. her mother was described as a woman who would never give into anything , was suspicious of everyone and whose old - fashioned ways clashed with her own .
henderson suggested that her mother s suspicions may have been justified , as he reminded miss beaton that she had herself threatened her mother in various ways .
i did nt mean it , she responded . as henderson drew the conversation towards the domestic sphere ,
miss beaton s present actions and emotions began to take meaning in the context of his psychotherapeutic model .
he sought out a longitudinal history that would show whether her emotional outbursts and depressive states periodically reoccurred throughout her life history , or whether such incidents were more dependent upon present environmental factors ( and might therefore be more amenable to treatment ) . after he had asked miss beaton whether she could explain her general irritability
i havent had anything that other girls have had.lifes hard? suggested henderson.yessick of the thing?not all together. [ sic ]
i havent had anything that other girls have had. life s hard? suggested henderson .
not all together. [ sic ] when asked about her friends , miss beaton replied that she was always
one too many , that no one took her side and that everything was always blamed on her .
as henderson reflected upon miss beaton s self - reported history of fraught familial relationships and social isolation , he began to analyse the depression and anger she exhibited within the mental examination from a longitudinal perspective . since she projected the source of her troubles on to others , henderson tried to reassure her that her family wanted to make her better .
do many a thing for punishmentwe want to help youi do nt think it s the way to make me not people , the type of people.dr henderson said it worked out although not apparently likely on surface.that is nt so this has ruined me .
they ll triumph over me ; they do nt care a bitthis idea was disagreed by dr henderson ; but she persisted it was so .
i do nt think it s the way to make me not people , the type of people. dr henderson said it worked out although not apparently likely on surface. that is nt so this has ruined me . they ll triumph over me ; they do nt care a bit this idea was disagreed by dr henderson ; but she persisted it was so . here , we see the patient s narrative conflicting with henderson s , both aiming to establish the
miss beaton insisted that her confinement to gartnavel was a form of punishment ; that her family had sullied her reputation and cast her from her home .
the intensity of her emotions , depth of despair and strength of her antagonism flowed out in one long tirade .
also highlighted in this case is the multi - vocal nature behind the production of such records .
at one point , miss beaton momentarily turned her attention away from henderson to confront the attendant clinical clerk . i know you re taking notes , she stated , thus breaking away from the enclosure of a two - way dialogue .
all at once we are reminded that this interview was not carried out within an enclosed and private space , but in an open ward , among medical staff of whose gaze she was fully aware . behind the overt content of the mental examination report
, we are subtly alerted to her surroundings , to the recording mechanisms that actively shaped her dialogue and to an indistinct , yet pervasive , sense of the clinical atmosphere still infusing the transcript .
these examples point to the complex physical and social conditions behind note production , which directly or indirectly made their way into patient narratives . on a formal level
the various grammatical choices and narrative stylistics ( for example , quotation marks within quotation marks ) , while revealing something of the tempo and rhythm of speech , are not reproduced uniformly throughout case note records ; indeed they are also prone to inconsistencies in punctuation .
my approach here is to replicate , as far as possible , the original layout , as well as any grammatical errors or inconsistencies that appear within the original sources . by retaining such inconsistencies ,
i retain layers of authorial agency to highlight that case notes can not , alone , be used to understand the subtleties of these narratives from below. in this respect , it also becomes important to draw a distinction between records produced at the time of a clinical encounter and those retrospectively compiled in an administrative environment .
this is significant when considering the kinds of information recorded by the first - person observer and that which may have been revised and altered in the hours , days and months after clinical observations .
for instance , upon the arrival of a new patient at gartnavel the task of the clinical clerk was to transpose admission data ( such as medical certificates ) into the case note record .
the information was often typewritten and produced in an administrative , rather than a specialist clinical environment .
other records of mental and physical examinations , however , were often penned by hand in the ward , in close proximity to the patient .
meyer wrote , unequivocally , that notes should be written down at the time of observation ; for him , this offered a more immediate , unrevised investigation of events as they unfolded .
however , mental and physical examination records show revisions and overlays of additional handwritten , sometimes typed , observations . different handwriting styles and typewritten sections attest to the thought development of one or more medical officers , showing the process of case note construction to be a fluid , sometimes unstable and often collaborative process .
staff meeting was , for a number of patients , the next stage in their analysis , as gartnavel s medical officers endeavoured to construct clinically rigorous
[ i]n order to get at the dynamic factors it is usually necessary to have repeated interviews and finally to make a careful analysis of the entire material. staff meeting records , which were reproduced in verbatim transcriptions , bear marks of the introduction of new recording technologies and further stylistic forms of narrative representation .
the following section illustrates how the disparate parts of the physical and mental examination were drawn together in the staff meeting , highlighting the marriage of voices from below and from above in case note construction .
staff meetings , which pre - dated the contemporary case conferences , were put into use at gartnavel from 1921 onwards . following meyer s practices in the united states , henderson instigated the routine by which gartnavel s staff gathered within a meeting room three mornings a week and were introduced to newly admitted patients to discuss their cases . used as an educational and training exercise , the staff meeting consisted of a single examining psychiatrist directing questions towards the patient , while a trained stenographer , who sat silently among the staff , recorded in verbatim fashion the conversation that passed between patient and practitioner . in accordance with meyer
so , while the acts and utterances of patients were recorded , so too were the provoking actions of the psychiatrist . transcribed from the perspective of the stenographer who sat clicking away at their stenographic machine , these materials reveal , most clearly , the interactive dimensions of those clinical encounters . by preserving the raw dialogues that passed between the various actors , such sources allow an in - depth hermeneutic enquiry into the illness narrative as it was shared , modified and negotiated by both medical officer and patient .
these transcripts are , in many ways , a more direct source of patient narratives than the case note record .
for instance , they contain a more uniform application of grammar , with the dialogues of patients and medical officers recorded in straightforward question - and - answer format .
they are also the product of single typists rather than a conglomerate of writers who recorded , word - for - word , the events of the staff meeting at the time it was conducted .
finally , these materials reveal the presence of other members who also , directly or not , contributed to shaping these dialogues .
several days , sometimes weeks , after arriving at the hospital , many of gartnavel s newly admitted patients were encouraged to attend the staff meeting
. escorted by a nurse from their respective wards to the ground floor meeting room , the patient was greeted by a medical practitioner upon arrival . asked to sit down ,
he or she was directed to face the interviewing medical officer , while a gathering of gartnavel s resident staff were seated behind the patient .
i usually try to see every person who comes here in this way , henderson stated to one patient during a staff meeting in 1925 , to have a talk over things with them. as within all mental examinations carried out in gartnavel during this period , the perceived efficacy of this approach depended a great deal upon the patient s willingness to co - operate
. however , for a number of individuals , the social setting of this event was itself a significant factor in shaking their confidence .
speaking in the presence of several members of staff created a further loss of intimacy .
a certain miss mary smith , for example , was very agitated , and very averse to coming into the room. asked by henderson what makes you so frightened? , miss smith failed to respond and became very anxious that the nurse who accompanied her , and dr henderson and dr thomson , should be seated , while she herself insisted on standing throughout the interview. another staff meeting transcript highlights how the presence of multiple staff members could alter the tone and content of a patient s narrative .
complaining about her hospital conditions , mrs mary cranford exclaimed : i am just kept like any common prisoner .
the board of medical officers , who were sitting behind her , had gone unnoticed until this point ; she then turned around in her chair and said : excuse me , gentlemen , i did not know you were sitting there or i would have been a little bit more cautious. patients did not easily confide during these encounters . in order to establish confidence and encourage the patient to speak ,
henderson and meyer both advised that he or she be treated absolutely on an equal footing with the physician. if an adequate level of trust was established between the two parties , one of the first steps taken to understand the patient s supposedly dysfunctional behaviour was to develop a sensitivity to the stories , [ which ] the patient may just by chance tell. delusional statements , wrote meyer , must be accepted as one would accept the religious convictions of a person of a different denomination , while remarks made to other psychiatrists must show the same consideration ; no pressure must be used. moreover , in order not to disturb [ the patient s ] sense of safety or make [ her ] suspicious that confidences are being betrayed , the physician should as far as possible only engage in topics of conversation that have been worked out and discussed conjointly with the patient. rather than the medical officer s narrative running counter to the alleged delusional beliefs or
rigidly conceived premises held by the patient , the practitioner engaged and indeed endorsed
meyer advised that , through a process of compromise , ideas pertaining to this shared
common reality gradually be introduced into the conversation . by encouraging their interlocutors to elucidate further the meaning of concepts and phrases particularly pertinent to the case within the staff meeting
, medical officers endeavoured to comprehend a patient s own , sometimes unique , usage of language : patient .
i can always do much as i like but i do nt function properly .
you have heard of such cases before , but it is a freakish state ; you have heard of men who can do unnatural things with their bodies you have heard about the clincher ?
it made my nerves worse . a man who is in proper condition has a proper spine
i can always do much as i like but i do nt function properly .
you have heard of such cases before , but it is a freakish state ; you have heard of men who can do unnatural things with their bodies you have heard about the clincher ?
well , he does not work as any other natural man would dr henderson .
it made my nerves worse . a man who is in proper condition has a proper spine
it has turned the wrong way. contextualising and further clarifying the meaning of phrases such as working from his head , having one s spine twist or to get the
wind up enabled gartnavel s practitioners to establish a shared , common language through which to establish confidence and understanding .
this was considered an initial step in the process of correcting a patient s faulty adaptations . in this respect , it is interesting to note that while patients were encouraged to act as
collaborator[s ] in the treatment endeavour , these stories could undergo revision as the meeting progressed . at the beginning of her interview , for example , a patient named helen davidson was determined to reveal nothing on the subject of spirituality .
after having earlier intimated her belief that she was the virgin mary , she was interviewed by the medical practitioner :
q. was there any intimation conveyed to you from any outside source in regard to this ?
did you have a feeling as if there was some heavenly presence intimating this thing to you?a .
no.q . as if there was a heavenly voice that said this thing to you ?
did it seem to come from your own inner consciousness , or what ? was it something that seemed to grow up inside you?a . no.q .
how was the information conveyed to you then?a . by reading.q . by reading what?a
q. was there any intimation conveyed to you from any outside source in regard to this
q. did you have a feeling as if there was some heavenly presence intimating this thing to you ? q. as if there was a heavenly voice that said this thing to you ?
did it seem to come from your own inner consciousness , or what ? was it something that seemed to grow up inside you ? q. how was the information conveyed to you then ?
q. what was it that specially seemed to convey that idea to you ? as tensions between this patient s narrative and that of the psychiatrists saw the patient contradict herself , denying , then confessing that these ideas sprang from reading the bible , the reader is made aware of the active re - negotiation of a patient s life history within this setting .
we are reminded that we can not unearth an essential truth about a patient s history ; instead what appears is an active co - construction of the patient s narrative .
the reader is confronted not with the meeting of two dichotomous narratives , but with an array of stories , being continually reshaped and revised in ( and beyond ) the meeting . amidst these processes of co - construction and reconstruction , new meanings and new identities emerge . how to interpret and compare the authorial presence behind the semi - verbatim transcriptions of the physical and mental examinations with the verbatim transcriptions of the staff meeting ?
though barely considered by meyer and not at all by henderson , the presence of this significant player in the staff meeting ( which by then was becoming widely practised in north america due to meyer s influence and teaching ) was given some consideration in a 1937 article published in the american journal of psychiatry : presumably for the sake of the records a stenographer is present .
it is a pity she can not be made invisible . upon the other hand , a clever one can be trained to make running comments and notes upon the patient s responses when these concern solely matters of fact , thus avoiding in part the long series of questions and answers which present such a hopeless array upon many staff conference records .
a signal system can be readily devised for informing the stenographer when to make verbatim records , when to summarize and when to make no notes whatever . presumably for the sake of the records
it is a pity she can not be made invisible . upon the other hand , a clever one can be trained to make running comments and notes upon the patient s responses when these concern solely matters of fact , thus avoiding in part the long series of questions and answers which present such a hopeless array upon many staff conference records .
a signal system can be readily devised for informing the stenographer when to make verbatim records , when to summarize and when to make no notes whatever .
this wish for invisibility of the stenographer is , in many ways , a reflection of the stenographer s discretion on the pages of gartnavel s staff meeting transcripts . unlike case note records , which intersperse verbatim samples of speech with clinical observation
, gartnavel s stenographers leave only the barest of clues upon the transcript as to their authorial presence .
only occasionally do the stenographer s own observations break through into the transcript , to offer summaries of staff members comments or give brief indications as to the actions and behaviours of patients .
it is from these brief asides that we glean a sense of the pace and tone of the conversation , of the groups and individuals to which certain statements were directed , and of the movement and unspoken interactions within these enclosed meeting rooms .
the third - person narrative of the stenographer contrasts sharply with the first - person authorial tone of the medical officer . indeed , verbatim samples of speech are clearly distinguished from the stenographer s own summaries .
when examining the stenographer s use of punctuation and descriptive inserts , we notice , in many cases , that the pace and tempo of the patient s voice is preserved in the way of stage directions ( for example , very slowly and deliberately ) .
indications are also given to mark those points where dialogue jars , with voices cutting across or over - spilling into one another .
as for exclamation marks , although used sparingly , most appear within text that records henderson s speech ; and , although we can not be sure of the exact tone or pitch of his voice , it appears to have been raised on a number of occasions : patient .
i will investigate that you will be punished for keeping me staying here.dr h. i am perfectly innocent
i have nothing to do with your coming here , you must not punish me ! patient .
i will investigate that you will be punished for keeping me staying here. dr h. i am perfectly innocent
i have nothing to do with your coming here , you must not punish me ! despite the above
, records show that patient narratives in the staff meeting were not always transcribed in fully verbatim fashion . when confronted with the colloquial use of words , stenographers tried to retain the characteristic phrases and mannerisms that marked patients language ; but on occasion a certain accent or dialect could present too difficult to replicate .
( this patient spoke with a marked brogue , and in a low voice at times , and it was difficult indeed impossible frequently to catch what he said). these notes , which endeavour to represent textually the structure , fluidity , tempo and intonations of spoken dialogue , not only highlight the interpersonal relations shaping one another s responses .
they also emphasise the subjectivity of their authors . by casting light on the mediatory role of the stenographer , such passages interrogate the nature of ( purportedly transparent ) verbatim records in the making of patient stories from below.
words are both crucially reflective of the goings - on in the human world , but also unavoidably generative of that world , write chris philo and cheryl mcgeachan . as such
, one must explore how psychiatrists , clinical clerks and stenographers not only recorded but also actively shaped reconstructed the discursive happenings of the clinical encounters at gartnavel mental hospital .
while these records allow glimpses into the patients subjective worlds , they also reveal a process by which patient narratives were collected , compared and classified ; that is , they highlight the epistemic virtue of such records in this rapidly changing context .
as michel foucault theorised , the arrival of the case note facilitated the process by which patients were described , judged , measured , compared with others so they may be precisely understood through their very individuality , and yet
simultaneously corrected , classified , normalized or excluded so that their identities became fixed by the
medical gaze. with these case notes revealing the profoundly polyphonic nature of mental examinations at that time and place , we may , therefore , question precisely how such sources while rich in patient psychiatrist dialogues capture words that exposed , and were generative of , the world around them . unlike contemporary psychoanalytic case notes which were effectively used to verify specific theoretical models , dynamic case notes , as used by henderson and meyer , were intended to record the patient s verbally expressed
wishes , desires and emotions as standing above or in implicit precedence to any particular interpretation. these materials , while infused with the authorial agency of their psychiatrists , unveil a history of patient
psychiatrist dialogues in which the power to define the story of illness ebbs and flows between both parties . they show that physical as well as the interpersonal spaces in which the two parties spoke significantly shaped the content and delivery of their dialogues .
moreover , while psychiatrists endeavoured to penetrate the more intimate , interior spaces of the patient s mind memory , thought , emotion and imagination
it had to be given freely by patients themselves , whose stories were in many ways considered the key to unlocking the origins , meanings and possible treatments of their conditions .
patients willingness to reveal their stories depended on a number of factors such as gender , social class and admission status .
undoubtedly , dynamic case notes offer a rare window into the patient s view at that seminal period . wishing to distance himself from psychoanalytic case studies , which placed patients language within a rigid and specialised framework of understanding and interpretation
, henderson went to considerable lengths to reproduce a faithful , coherent account of complex clinical events .
but how far do these textual sources represent the reality they pertain to capture ? due to new techniques of transcription introduced at that period ,
the historian can get a fuller picture of the complex social interactions between all members of the medical encounter and , in the process , analyse the important role played by patients in shaping this history from below. yet the conditions of production must also be taken into account when interpreting such materials . as jonathan andrews has shown in his study of gartnavel s case notes in the nineteenth century , the influence of prevailing conceptualisations of mental illness has played a significant role in the changing degree to which physicians included the patient s voice in these records .
some of the greatest challenges for the historian reside in the areas of incompleteness and inter - textual discrepancies. in the same vein , if we know little about the process of case note selection in the 1920s , we also tend to overlook the process of interpretation by contemporaneous psychiatrists and historians alike , adding yet more levels of ( re)construction . as such , when considering the incorporation of sources from below , historians ought to keep in mind the context in which these stories were generated .
this becomes all the more relevant in a setting in which verbatim and semi - verbatim transcripts are presented as narrative
truth. as i have shown , the analysis of institutional spaces , clinical practices and psychiatric forms of knowledge must also be taken into account when following porter s call to explore the | this article contextualises the production of patient records at glasgow s gartnavel mental hospital between 1921 and 1932 .
following his appointment as asylum superintendent in 1921 , psychiatrist david kennedy henderson sought to introduce a so - called dynamic approach to mental health care .
he did so , primarily , by encouraging patients to reveal their inner lives through their own language and own understanding of their illness .
to this effect , henderson implemented several techniques devised to gather as much information as possible about patients .
he notably established routine
staff meetings in which a psychiatrist directed questions towards a patient while a stenographer recorded word - for - word the conversation that passed between the two parties . as a result ,
the records compiled at gartnavel under henderson s guidance offer a unique window into the various strategies deployed by patients , but also allow physicians and hospital staff to negotiate their place amidst these clinical encounters . in this paper ,
i analyse the production of patient narratives in these materials .
the article begins with henderson s articulation of his
dynamic psychotherapeutic method , before proceeding to an in - depth hermeneutic investigation into samples of gartnavel s case notes and staff meeting transcripts . in the process , patient
psychiatrist relationships are revealed to be mutually dependent and interrelated subjects of historical enquiry rather than as distinct entities .
this study highlights the multi - vocal nature of the construction of stories from below and interrogates their subsequent appropriation by historians . |
atypical hemolytic uremic syndrome ( ahus ) involves congenital or acquired chronic systemic alternative complement pathway dysregulation .
this causes reduced host cell protection , dysfunctional complement activation of platelets and endothelial cells , inflammation , and thrombotic microangiopathy.1,2 terminal complement inhibition with eculizumab safely reversed our patient s neurologic changes and eliminated the need for dialysis . while the optimal duration and frequency of therapy remains to be determined ( and varies in the literature ) , complete and sustained terminal complement inhibition has been considered necessary for adequate control of ahus.3 previous publications have indicated that long - term eculizumab therapy helps avoid ahus relapse and maintenance therapy is used in current ahus clinical trials.16 eculizumab has been reported to be safe and effective in ahus , a condition of chronic systemic uncontrolled complement activation.415 eculizumab is a high - affinity humanized monoclonal anti - c5 antibody that blocks terminal complement activity .
eculizumab binds to and blocks cleavage of the terminal complement protein c5 into its pro - inflammatory , prothrombotic , and lytic products : c5a and the cytotoxic membrane- attack complex c5b-9 .
upstream components of complement , most notably c3b , are left intact.3,7,15,16 while eculizumab is not yet fda approved for ahus , this update describes how long term eculizumab maintains and improves renal function , despite being used at doses lower than currently used in clinical trials .
this update also reports the results of our patient s genetic and antibody tests , all of which were normal .
a previously described 50-year - old caucasian woman was transferred to our intensive care unit with sepsis , pancolitis , acute renal failure , and thrombocytopenia .
low complement levels were noted : c3 was 35 ( 83184 ) mg / dl and c4 was 6 ( 1759 ) mg / dl .
she underwent colectomy and was confirmed to have scattered fibrin microthrombi on her bowel specimen .
severe renal failure , profound neurologic changes , severe hemolysis , thrombotic microangiopathy , and low complement levels were all suggestive of atypical hemolytic uremic syndrome ( ahus ) . by hospital day 5 , there were occasional schistocytes on the peripheral smear .
since ahus is characterized by chronic systemic uncontrolled complement activation,2 the anti - c5 monoclonal antibody eculizumab ( 900 mg iv ) was administered on hospital day 6 .
it was continued weekly for four doses , followed by maintenance therapy that was gradually reduced.16 because eculizumab increases the risk of neisseria meningitidis , the meningococcal vaccine was given prior to the first dose , and 14 days of ciprofloxacin was prescribed for meningococcal prophylaxis.16 her renal recovery was remarkable with eculizumab and she has remained off dialysis with long - term eculizumab treatment . our patient s rapid and profound neurologic deterioration resulted from significant thrombotic microangiopathy .
mri showed a right parietal lobe infarction ( images shown in original paper ) . despite thrombotic microangiopathic brain injury
the initial dosing schema used for our patient is similar to that used in the clinical trials of eculizumab in ahus , but maintenance therapy has gradually been reduced over time to a dose lower than what is used in the trials .
maintenance therapy , starting on week 5 , was planned to be 1200 mg every 2 weeks , as in the trials ; however , this dose was only continued for doses five and six.1719 due to nausea at the 1200 mg dose , the seventh dose was delayed by 1 day because the patient refused it , but then agreed to a reduced dose of 600 mg weekly .
her dose was subsequently reduced to 600 mg every 2 weeks and her improved renal function has been maintained despite the dose reduction . additionally , her creatinine has continued to decrease on maintenance therapy with recent levels as low as 1.64 mg / dl ( normal 0.51.3 mg / dl ) , despite maintenance dosing reduced to 600 mg every 2 weeks .
figures 16 show treatment responses over time with respect to creatinine , c3 , c4 , ldh , haptoglobin , and platelets .
several authors have described how long - term eculizumab therapy helps avoid ahus relapse.16 mache et al describe how ahus relapsed after discontinuation of eculizumab and resulted anuric end stage renal disease.1 they describe another patient who experienced improvement in renal function , as well as normalization of platelets and haptoglobin , within 5 days of receiving eculizumab 600 mg .
unfortunately , atypical hemolytic uremic syndrome relapsed 2 weeks after recovery of complement - mediated hemolytic activity , suggesting the need for sustained complement inhibition to prevent relapse .
chtelet et al described a transplant patient who was on a maintenance eculizumab 1200 mg every 14 days.2 they reported that a 6-day delay in administering the ninth dose resulted in recurrent hemolysis and deterioration of transplant function .
the authors consequently resumed eculizumab as permanent therapy for their patient , with recovery of renal function .
similarly , in our patient , when the seventh dose was due , laboratory investigations suggested relapsing hemolysis , with haptoglobin < 6 mg / dl , indicating her continued need for the drug .
zuber et al mention similar cases which emphasize the importance of long - term eculizumab therapy.3 they describe two post - transplant ahus cases in which a single dose of eculizumab resulted in long - term remission in both patients .
relapse occurred after 11.5 months for one patient and eculizumab was resumed , resulting in a remission .
the other patient relapsed after 21 months , but when eculizumab was resumed , graft loss could be not prevented .
zuber et al suggest that a single dose of eculizumab is less effective than prolonged therapy and argue that the interval between doses be no more than 14 days.3 approximately 60% of ahus cases
( familial and sporadic ) have been associated with genetic mutations in complement regulatory proteins of the alternative complement pathway or auto - antibodies to the complement regulatory factor cfh.19,20 consequently , we ordered the following genetic and antibody tests for our patient : cfh , cfb , cfi , cfhr3-cfhr1 ( deletion testing ) , mcp , thbd , c3 , and cfh auto - antibodies ( serum test ) .
as gene sequencing is very time consuming , it can take several months for all of the genetic tests to return . in the case of our patient ,
furthermore , very few clinical laboratories do genetic testing for ahus , but such labs may be found on the national center for biotechnology information ( ncbi ) website : http://www.genetests.org/.21 our patient s genetic tests were performed at university of iowa , which , to our knowledge , may be the only lab in the us that does these tests.22 atypical hus has been linked to the chromosome 1q32 locus containing genes for complement factor h ( cfh ) , the plasma regulator of the alternative complement pathway , as well as for other complement regulators . over
the frequency of cfh mutations is 20%.19,20 the various genetic abnormalities and antibody abnormalities currently identified in ahus are summarized below .
more information on genetic mutations in ahus can be obtained from two comprehensive papers by noris and remuzzi.19,20 cfh regulates the alternative complement pathway ( ap ) . in ahus , most cfh mutations are heterozygous.19,20 mutant cfh heterozygotes usually carry normal levels of cfh but 50% of the molecules are dysfunctional .
only 15%20% of cfh mutations in ahus are homozygous , resulting in quantitative cfh deficiency and very low c3 levels .
the hybrid gene results from aberrant crossover between cfh and cfhr1 , a gene located in tandem to cfh .
the gene product has decreased endothelial complement regulatory activity.19,20 deletion testing for cfhr1 and cfhr3 was ordered because these gene deletions are considered a risk factor for ahus.23 approximately 6%10% of ahus patients acquire anti - cfh antibodies , which emulate cfh mutations by binding to the cfh c - terminus and decreasing cfh binding to c3b and surface cofactor activity.19,20 furthermore , some ahus patients acquire autoantibodies to factor h in the setting of deletions of cfhr1 and cfhr3.24 cfi is a plasma serine protease that regulates all three complement pathways by cleaving c3b and c4b .
19,20 as a proteolytic enzyme , cfi prevents hemolytic and immune - adherence activities of activated , cell - bound c3.22 mcp encodes the membrane cofactor protein ( mcp ) , which is a cofactor for cfi to cleave c3b and c4b on cell surfaces . around 10% of ahus cases involve mcp mutations , the majority of which are heterozygous.19,20 some patients have gain of function mutations that affect genes encoding cfb and c3 , which are the ap c3 convertase components .
cfb mutations , accounting for only 1%2% of ahus cases , result in chronic ap activation with low c3 level and normal c4 levels.19,20 approximately 4%10% of ahus cases have heterozygously mutated c3 , associated with reduced c3b binding to cfh and mcp , significantly hindering degradation of mutant c3b and resulting in low c3 levels.19,20 around 5% of ahus patients have heterozygously mutated thbd , resulting in inefficient inactivation of c3b .
thbd encodes thrombomodulin that is involved in complement activation on cell surfaces.19,20 thrombomodulin is actually a negative regulator of the complement system , which suppresses leukocyte trafficking , inflammation , and complement activation.22,25 of note , 3%5% of ahus patients possess combined mutations , often in cfh along with either mcp or cfi .
few also possess anti - cfh antibodies.19,20 although genetic testing did not change the management of our patient , genetic testing in ahus can provide the clinician with information about disease process and long - term renal transplant outcome.19,20 for example , mutations of cfh , cfi , cfb , and c3 have been associated with post - transplant recurrence .
this is due to the fact that the mutations give rise to abnormalities in circulating proteins that mostly come from the liver , and thus can exist even after kidney transplant.19,20
several authors have described how long - term eculizumab therapy helps avoid ahus relapse.16 mache et al describe how ahus relapsed after discontinuation of eculizumab and resulted anuric end stage renal disease.1 they describe another patient who experienced improvement in renal function , as well as normalization of platelets and haptoglobin , within 5 days of receiving eculizumab 600 mg .
unfortunately , atypical hemolytic uremic syndrome relapsed 2 weeks after recovery of complement - mediated hemolytic activity , suggesting the need for sustained complement inhibition to prevent relapse .
chtelet et al described a transplant patient who was on a maintenance eculizumab 1200 mg every 14 days.2 they reported that a 6-day delay in administering the ninth dose resulted in recurrent hemolysis and deterioration of transplant function .
the authors consequently resumed eculizumab as permanent therapy for their patient , with recovery of renal function .
similarly , in our patient , when the seventh dose was due , laboratory investigations suggested relapsing hemolysis , with haptoglobin < 6 mg / dl , indicating her continued need for the drug .
zuber et al mention similar cases which emphasize the importance of long - term eculizumab therapy.3 they describe two post - transplant ahus cases in which a single dose of eculizumab resulted in long - term remission in both patients .
relapse occurred after 11.5 months for one patient and eculizumab was resumed , resulting in a remission .
the other patient relapsed after 21 months , but when eculizumab was resumed , graft loss could be not prevented .
zuber et al suggest that a single dose of eculizumab is less effective than prolonged therapy and argue that the interval between doses be no more than 14 days.3
approximately 60% of ahus cases ( familial and sporadic ) have been associated with genetic mutations in complement regulatory proteins of the alternative complement pathway or auto - antibodies to the complement regulatory factor cfh.19,20 consequently , we ordered the following genetic and antibody tests for our patient : cfh , cfb , cfi , cfhr3-cfhr1 ( deletion testing ) , mcp , thbd , c3 , and cfh auto - antibodies ( serum test ) .
as gene sequencing is very time consuming , it can take several months for all of the genetic tests to return . in the case of our patient ,
furthermore , very few clinical laboratories do genetic testing for ahus , but such labs may be found on the national center for biotechnology information ( ncbi ) website : http://www.genetests.org/.21 our patient s genetic tests were performed at university of iowa , which , to our knowledge , may be the only lab in the us that does these tests.22 atypical hus has been linked to the chromosome 1q32 locus containing genes for complement factor h ( cfh ) , the plasma regulator of the alternative complement pathway , as well as for other complement regulators . over
the frequency of cfh mutations is 20%.19,20 the various genetic abnormalities and antibody abnormalities currently identified in ahus are summarized below .
more information on genetic mutations in ahus can be obtained from two comprehensive papers by noris and remuzzi.19,20 cfh regulates the alternative complement pathway ( ap ) . in ahus , most cfh mutations are heterozygous.19,20 mutant cfh heterozygotes usually carry normal levels of cfh but 50% of the molecules are dysfunctional .
only 15%20% of cfh mutations in ahus are homozygous , resulting in quantitative cfh deficiency and very low c3 levels .
the hybrid gene results from aberrant crossover between cfh and cfhr1 , a gene located in tandem to cfh .
cfhr1 encodes complement factor h related protein ( cfhr1 ) . the gene product has decreased endothelial complement regulatory activity.19,20 deletion testing for cfhr1 and cfhr3 was ordered because these gene deletions are considered a risk factor for ahus.23 approximately 6%10% of ahus patients acquire anti - cfh antibodies , which emulate cfh mutations by binding to the cfh c - terminus and decreasing cfh binding to c3b and surface cofactor activity.19,20 furthermore , some ahus patients acquire autoantibodies to factor h in the setting of deletions of cfhr1 and cfhr3.24 cfi is a plasma serine protease that regulates all three complement pathways by cleaving c3b and c4b .
19,20 as a proteolytic enzyme , cfi prevents hemolytic and immune - adherence activities of activated , cell - bound c3.22 mcp encodes the membrane cofactor protein ( mcp ) , which is a cofactor for cfi to cleave c3b and c4b on cell surfaces . around 10% of ahus cases involve mcp mutations , the majority of which are heterozygous.19,20 some patients have gain of function mutations that affect genes encoding cfb and c3 , which are the ap c3 convertase components .
cfb mutations , accounting for only 1%2% of ahus cases , result in chronic ap activation with low c3 level and normal c4 levels.19,20 approximately 4%10% of ahus cases have heterozygously mutated c3 , associated with reduced c3b binding to cfh and mcp , significantly hindering degradation of mutant c3b and resulting in low c3 levels.19,20 around 5% of ahus patients have heterozygously mutated thbd , resulting in inefficient inactivation of c3b .
thbd encodes thrombomodulin that is involved in complement activation on cell surfaces.19,20 thrombomodulin is actually a negative regulator of the complement system , which suppresses leukocyte trafficking , inflammation , and complement activation.22,25 of note , 3%5% of ahus patients possess combined mutations , often in cfh along with either mcp or cfi .
few also possess anti - cfh antibodies.19,20 although genetic testing did not change the management of our patient , genetic testing in ahus can provide the clinician with information about disease process and long - term renal transplant outcome.19,20 for example , mutations of cfh , cfi , cfb , and c3 have been associated with post - transplant recurrence .
this is due to the fact that the mutations give rise to abnormalities in circulating proteins that mostly come from the liver , and thus can exist even after kidney transplant.19,20
six months after initial diagnosis , our patient continues to have improved renal function on maintenance doses of eculizumab as low as 600 mg every 2 weeks .
this dose is much lower than what is used in the current clinical trials , suggesting that complement inhibition needs vary among patients .
clinical trials are underway to determine the optimal dosing schema . although genetic abnormalities in complement regulatory factors or anti - cfh antibodies have been identified in approximately 60% of cases,19,20 genetic testing did not change the management of this patient . | objectiveto describe how maintenance eculizumab sustains improved renal function in severe atypical hemolytic uremic syndrome ( ahus).case reporta previously described 50-year - old woman with ahus had a remarkable recovery with eculizumab , which safely reversed profound neurologic damage and eliminated the need for dialysis .
her recovery has been sustained on long - term eculizumab treatment .
she initially received eculizumab 900 mg weekly for four doses . on week 5
she commenced maintenance therapy starting at 1200 mg every 2 weeks . due to nausea and vomiting at that dose
, the maintenance dosing was reduced to 600 mg weekly , beginning on dose seven . after receiving 600 mg weekly for nine doses , eculizumab
was then reduced to 600 mg every 2 weeks , with continued improvement in renal function .
this dosing is lower than the usual 1200 mg every 2 weeks described in the adult literature and used in current clinical trials of ahus.conclusionsix months after the initial diagnosis , our patient continues to have improved renal function on maintenance doses of eculizumab as low as 600 mg every 2 weeks . |
to establish occlusal plane while recording maxillomandibular relation during fabrication of complete denture , many methods have been tried in the past .
needless to say that correct orientation of the occlusal plane plays a vital role in providing optimal esthetic and functional satisfaction.1 improper orientation of this plane jeopardizes the coordination between the components of oro - facial articulatory complex.2 the plane of occlusion is formed after joining the incisal edges of the mandibular central incisors to the disto - buccal cusps of the mandibular first molars .
the occlusal plane is defined as the common plane established by the incisal and occlusal surfaces of the teeth ( glossary of prosthodontic terms-8 ) .
it is not a plane in the true sense of the word , but represents the mean of the curvature of the inciso - occlusal surfaces of teeth .
there is a controversy for the orientation of the occlusal plane during complete denture fabrication .
various landmarks and techniques had been used over the years by clinicians and researchers for establishing this plane which include : establishing the occlusal plane according to aesthetic requirements anteriorly and parallel to the ala - tragus line posteriorly ( craddock,3 1951 ; schlosser & gehl,3 1953 ) , positioning the occlusal plane parallel to and midway between the residual ridges ( nagle and sears,3,4 1962 ; boucher et al.,5 boucher6 1964 ) , orientating the occlusal plane with the buccinator grooves and the commissure of the lips ( lundquist and luther,7 1970 ) , terminating the occlusal plane posteriorly at the middle or upper third of the retromolar pad ( ismail and bowman,8 1968 ) , positioning the occlusal plane on the same level as the lateral border of the tongue ( ismail and bowman,8 1968 ; yasaki,9 1961 ) and many more concepts are reported in literature .
however , the most acceptable method of orienting the occlusal plane is to make it parallel to the ala - tragus or camper 's line as reported in several modern text books . in spite of its widespread acceptability ,
it is surprising to note that the exact location of the point on tragus while marking ala - tragus line is unclear .
this has created lot of confusion while selecting a point for marking ala - tragus line .
so this study was therefore undertaken to decide the most appropriate point on tragus to be used as a reference point while marking ala - tragus line .
this study was carried out using simple and economical instruments and materials . for the study , following two devices
1 ) was developed to verify the parallelism of the occlusal plane of maxillary occlusal rim with ala - tragus line in posterior and interpupillary line in the anterior region .
it comprises of lower plate having outer " u " shaped frame which will be located over the face and inner fork plate having a shape of average arch .
three metal scales having holes at both the ends to pass through four threaded vertical rods - two lateral scale and one frontal scale and these scales can be adjusted and fixed at a desired height on vertical rods using nuts to simulate parallelism of the occlusal plane with ala - tragus line and interpupillary line .
four threaded vertical rods with the corresponding nuts were used to fix the lower frame with the upper two lateral and frontal plate at a desirable vertical height to check parallelism of the occlusal plane with ala - tragus line which was marked using superior point on tragus with ala .
the occlusal rim was positioned over the edentulous foundation and was supported by the fork plate of the lower frame .
the maxillary occlusal rim was adjusted for : height , labial inclination and arch form .
the occlusal plane was then adjusted to achieve parallelism - anteriorly with interpupillary , posteriorly with ala - tragus line ( fig .
the metal foil was then adapted over the adjusted occlusal surface of the rim ( fig .
the lateral scales were adjusted in line with the ala - tragus line and were fixed in position by tightening the nuts over the threaded vertical rods .
the frontal scales was also adjusted at the level of interpupillary line and secured tightly in position using the nuts ( fig .
the transpar ent plastic angle measuring device:- rectangular acrylic sheet ( transparent ) measuring 16 13 cm was used as a platform plate . over this plate 3 plastic ( transparent ) scales
were fixed ( one horizontal at the bottom and two in lateral sides in such a way that the inner angles between these scales were exactly measured 90 ( fig .
the protractor was modified to obtain reading between 0 - 90. this modified protractor has provided the opportunity to measure the angles between various planes used in this study .
the transparency of this device offered clarity while measuring the angles by positioning it over the tracing line(s ) of the cephalograph accurately .
data was collected for two groups of the subjects : ( a ) dentulous group , ( b ) edentulous group having sample size of 30 for each group with equal gender distribution .
selection criteria for dentulous group includes -subjects aged between 18 - 30 years , having 28 to 32 teeth and ideal arch alignment with angle 's class i molar relationship , andno history of orthodontic treatment with normal profile .
selection criteria for edentulous group includes subjects aged between 50 - 70 years , havingh no history of tmj disorder and associated pathology , neurological disorder and maxillofacial trauma with clinically healthy oral mucosa .
three points were indentified on tragus of ear as superior ( s ) , middle ( m ) and inferior ( m ) .
the stainless steel balls ( 3 mm in diameter ) were fixed at these selected points and also at the ala of the nose with fine quality double sided adhesive tape to ensure perfect placement to capture the recording on cephalographs ( fig .
lateral cephalographs were then shooted , developed and fixed by using standard technique . for edentulous patients
, the maxillary ( wax ) occlusal rim was adjusted forlabial inclination , arch form , midline and canine lines were marked and occlusal plane was adjusted using occlusal plane analyzer ( anteriorly parallel to the interpupillary and posteriorly parallel to the ala - tragus line ) . now
this adjusted maxillary occlusal rim with adapted metal foil on the occlusal surface was positioned over the maxillary foundation .
the ala - tragus line was marked by joining superior point of tragus with base of the ala of the nose .
the points used for tracing were orbitale ( or ) , porion-(po ) , superior ( s ) , middle ( m ) , inferior ( i ) point of tragusand inferior point of the ala of nose ( a ) .
various planes marked were frankfort horizontal plane ( fh ) , occlusal plane ( op ) and three planes formed by joining s to a ( sa plane ) , m to a ( ma plane ) and i to a ( ia plane ) .
various angles evaluated in this study were ca nt of occlusal plane ( coo ) , angle between fh plane with sa plane ( sfh ) , ma plane ( mfh ) and ia plane ( ifh ) . the angles between op plane and sa plane ( sop ) ma plane ( mop ) and ia plane ( iop)were also measured ( fig .
angle coo was used as a standard which is the angle formed between the fh plane and the occlusal plane . in downs analysis ,
the occlusal plane used was formed by marking a line bisecting the occlusal surfaces of permanent molars and incisal overbite .
mean value of angle coo was found to be 9.3 and ranges between 1.5 to 14 in those samples used in downs study.10 - 12 this angle measures the slope of the occlusal plane relative to frankfort horizontal plane .
over the traced cephalographs of dentulous patient , the values of angles coo , sfh , mfh , and ifh were measured , tabulated and compared with the value of average coo angle from downs analysis . along with this ,
the value of angles sop , mop , iop were also measured and tabulated . on the cephalographs of edentulous subjects ,
the angle between fhp and sa , ma and ia was measured , tabulated and compared with the value of average coo angle from downs analysis ( fig .
the measurements recorded for dentulous and edentulous subjects were tabulated and subjected for the statistical analysis ( statistica- version 6 , stas.soft . ,
comparitive evaluation of the angles - coo , sfh , mfh , ifh , sop , mop , iop in dentulous subjects and sfh , mfh , ifh in edentulous subjects were carried out to find out the significance and its usefulness in deciding the most appropriate point on tragus to be used as a reference point while marking the ala - tragus line .
statistical tests used were descriptive analysis , student 's unpaired t - test and pearson 's correlation coefficient .
after statistical analysis the results were tabulated and following results were drawn:- table 1 ( dentulous group ) demonstrated mean value of coo in male and female was 9.93 and 9.60 , respectively . with average value of 9.76 .
mean ifh in male and female was 11.20 and 9.60 , respectively with average value of 10.40 .
the mean iop in male and female was 2.26 and 2.66 , respectively with average value of 2.46 .
the mean ifh was closest to mean coo and mean iop was closest to 0 compared to the sop and mop . in table 2
, the edentulous group shows that the mean ifh in male and female was 10.93 and 10.20 , respectively with average value of 10.56 .
the mean ifh was closest to average coo 9.3. correlation and probability of coo with sfh , mfh , and ifh of the dentulous group was calculated and positive correlation was observed between coo and sfh , mfh , ifh .
student 's unpaired t test exhibits the mean difference in means of sfh , mfh , ifh with coo found to be statistically significant sfh ( p=.007 ) , mfh ( p=.005 ) and ifh ( p=.007 ) .
the mean angle of ifh in male was 11.2 with standard deviation of 2.45 and ifh in female was 9.6 with standard deviation of 3.13 , which is closest to average coo mean 9.3 compared to sfh and mfh . in tables 3 and 4
, it is noticed that the mean difference in mean angle was found to be statistically significant for sfh ( t = 14.90 , p=.000 ) , mfh ( t = 9.65 , p=.000 ) , ifh ( t = 2.99 , p=.006 ) in male and for sfh ( t = 12.37 , p=.000 ) , mfh ( t = 5.88 , p=.000 ) in female but statistically insignificant for ifh in female(t = 0.37 , p=.714 ) .
the mean angle of ifh in male was 10.93 with standard deviation of 2.89 and in female was 10.20 with standard deviation of 3.42 , which is closest to average coo 9.3 when compared to sfh and mfh .
tables 5 and 6 demonstrate student 's unpaired t test which shows that the mean difference in mean angle was found to be statistically significant for sfh ( t = 13.24 , p=.000 ) , mfh ( t = 5.52 , p=.000 ) , ifh ( t = 2.18 , p=.037 ) in female and for sfh ( t = 11.56 , p=.000 ) , mfh ( t = 6.93 , p=.000 ) in female , but was statistically insignificant in female ( t = + + 1.01 , p=.318 ) .
some of the existing concepts regarding orientation of the occlusal plane in the edentulous patients are of the opinion that the occlusal plane has relation with camper 's line .
it would seem desirable to locate it accurately and propagate its use while establishing the occlusal plane.13 the definitions of the ala - tragus line has created confusion .
the exact points of references on tragus and ala are not categorically specified.14 spratley14 described it as running from the center of the ala to the center ( middle ) of the tragus .
boucher5,6 defines it as " the line running from the inferior border of the ala of the nose to the superior border of the tragus of the ear .
" however , out of the seven texts that propound its use , only one has provided proper definition and it cites boucher's5,6 definition .
two texts recommended the concept without defining or illustrating it , while three provided only pictorial representation .
the latter are of immediate concern , for in each illustration ; camper 's line is clearly depicted as extending to a point , not at the superior border , but at the center of the tragus of the ear .
this pictorial representation corresponds to the definition given by of ismail and bowman8 ( 1968 ) and evidently reflects an understanding of the concept , which predates boucher 's definition.15 camper 's plane is defined as ( i ) a plane established by the inferior border of the left or right ala of the nose and the superior border of both ears ; ( ii ) a plane passing from the acanthion to the centre of the bony external auditory meatus ( gpt 1999 ) .
the occlusal plane is considered to be parallel to this plane.15 in this study , the widely accepted downs analysis10 was used as a base line for comparison .
downs analysis on variations in facial relationship indicates that the ca nt of the occlusal plane ( coo ) , the angular relation between the occlusal plane and the frankfort plane , ranged from 1.5 to 14 with a mean value of 9.3.10 - 12 the frankfort horizontal plane is a fixed anatomical craniometrical landmark , thus being used as a skeletal guideline while locating occlusal plane posteriorly.16 it has no effect of the loss of teeth and it can be easily located with the help of lateral cephalograph and therefore fh plane was used in this study .
the mean value of coo was observed to be 9.7 in this study which is within acceptable range of 1.5 to 14 and closest to mean value of 9.3 as demonstrated in the downs study .
the difference of 0.4 degree is clinically insignificant and may be accredited to the variations in racial population .
the mean angle ( total ) ifh found in dentulous subjects and edentulous subjects was 10.40 and 10.56 , respectively .
thus , the mean value of ifh angle is comparable with the mean value of the angle established in downs analysis.10 - 12 the mean angular value of iop 2.46 2.48 , is least among sop and mop .
this observation of the present study is similar to the observation of van niekerk et al.15 ( 1985 ) who recorded an angle between the occlusal plane of complete dentures and the ala tragus line ( inferior point on tragus was used ) as 2.45 ( sd = 3.24 ) .
this means that the line marked from the inferior point of tragus to ala of nose was the most parallel line with the occlusal plane in dentulous subjects as compare to the lines from superior and middle point of tragus with ala of nose .
this underlined the importance of using " inferior point " for marking ala - tragus line during recording of jaw relation for edentulous patient .
the results of this study are in agreement with the previous studies by clapp13 ( 1910 ) , dalby13 ( 1912 and 1914 ) , wilson13 ( 1917 ) , giffen13 ( 1925 ) , gillis13 ( 1933 ) and hartono17 ( 1967 ) .
the statistical analysis carried out for males and females for the various angles in dentulous and edentulous , males and females shows no significant difference ( p > .005 ) .
this indicates that gender difference does not cause any variations in the angular relationship between the ala - tragus line and frankfort horizontal plane and alatragus line and occlusal plane .
therefore it was concluded that inferior point on the tragus is the most valid point for males as well as female while marking ala - tragus line for establishing occlusal plane . in accordance to the results obtained in this
study the order of preference out of three tragus point for marking ala - tragus line is inferior point ( i ) , middle point ( m ) and superior point ( s ) .
it is also observed that when posterior occlusal plane was established using ala - tragus line marked from the superior or middle point , the occlusal plane was placed at a higher position which is in agreement with the results of the previous studies.2,5,6,18 - 22 but , it is contrary to the study of nissan et al.23 where superior point on tragus was recommended .
the middle point on the tragus was also recommended as a point for establishing occlusal plane in some studies.13,21,24 - 26 these variation may be due to effect of racial and ethnic populations .
the values of sfh , mfh , ifh this study for both dentulous and edentulous subjects confirms that the inferior point gives closest value of coo closer to downs analysis .
statistically significant difference was observed between average coo and mean angular values of sfh , mfh , ifh for all groups , except for ifh values for female in both dentulous ( p=.714 ) , and edentulous ( p=.318 ) group where there was no significant difference found .
therefore , as indicated by the results of this study , the inferior point in females gives closer angle with fhp , to average value of coo .
the inferior point marked on tragus is the most appropriate point for marking ala - tragus line for establishing occlusal plane in edentulous subjects . | purposethe purpose of this study was to decide the most appropriate point on tragus to be used as a reference point at time of marking ala tragus line while establishing occlusal plane.materials and methodsthe data was collected in two groups of subjects : 1 ) dentulous 2 ) edentulous group having sample size of 30 for each group with equal gender distribution ( 15 males , 15 females each ) .
downs analysis was used for base value .
lateral cephalographs were taken for all selected subjects .
three points were marked on tragus as superior ( s ) , middle ( m ) , and inferior ( i ) and were joined with ala ( a ) of the nose to form ala - tragus lines .
the angle formed by each line ( sa plane , ma plane , ia plane ) with frankfort horizontal ( fh ) plane was measured by using custom made device and modified protractor in all dentulous and edentulous subjects . also , in dentulous subjects angle between frankfort horizontal plane and natural occlusal plane was measured .
the measurements obtained were subjected to the following statistical tests ; descriptive analysis , student 's unpaired t - test and pearson 's correlation coefficient.resultsthe results demonstrated , the mean angle coo ( ca nt of occlusal plane ) as 9.76 , inferior point on tragus had given the mean angular value of ifh [ angle between ia plane ( plane formed by joining inferior point -
i on tragus and ala of nose- a ) and fh plane ) as 10.40 and 10.56 in dentulous and edentulous subjects respectively which was the closest value to the angle coo and was comparable with the values of angle coo value in downs analysis .
angulations of ala - tragus line marked from inferior point with occlusal plane in dentulous subject had given the smallest value 2.46 which showed that this ala - tragus line was nearly parallel to occlusal plane.conclusionthe inferior point marked on tragus is the most appropriate point for marking ala - tragus line . |
gastrointestinal problems often present with postprandial bloating , epigastric burning , nausea , vomiting , indigestion , sour eructations , and early satiety .
biliary tract disorders are a common cause of symptomatic gastrointestinal disease , and it , therefore , becomes necessary to identify and characterize this segment .
hepatobiliary imaging using tc - mebrofenin ( an iminodiacetic acid derivative ) is a clinically relevant technique in this situation as it permits noninvasive assessment of the functional status of the biliary systems by tracer excretion dynamics .
being objective , it is reproducible at various time intervals and allows the simultaneous assessment of both morphological and physiological changes .
cholescintigraphy with sincalide ( intravenous octapeptide of cholecystokinin [ cck ] ) is the gold standard to assess gallbladder function .
its nonavailability and high cost warrants an alternative that can be easily administered with minimal side effects .
a fatty meal fulfills these criteria besides being a physiological stimulus as it stimulates the release of endogenous cck .
however , a great amount of variability in ejection fraction has been seen with various fatty meal assessments as it depends on the amount of fat present in it , and the methodology used .
hence , there is a need to standardize fatty meal for normal subjects so as to define optimum time and gallbladder ejection fractions ( gbef ) cut - off .
the study was approved by the institutional ethics committee and written informed consent was obtained from all the subjects .
a detailed history was taken , and rome iii questionnaire for functional biliary disorders was used .
all the subjects were prescreened with ultrasonography ( usg ) of the upper abdomen and upper gastrointestinal endoscopy to rule out organic causes of disease .
fifty - nine volunteers ( mean age 42 years , 31 males , and 28 females ) participated in the study .
the volunteers had no symptoms ( i.e. , right upper quadrant / epigastric pain , nausea , vomiting ) , no history of gall bladder or hepatobiliary disease , diabetes mellitus , abdominal surgery or family history of hepatobiliary disease .
the patients were referred to the department of nuclear medicine for evaluation of recurrent right upper quadrant pain for the duration of 6 months by cholescintigraphy .
the patients who fulfilled rome iii diagnostic criteria of functional gallbladder disorder were included in the study analysis .
a total of 61 patients ( mean age 42 years , 40 males , and 21 females ) were included in the study .
diabetic patients were requested to avoid antidiabetic medications on the day of test to avoid hypoglycemia .
patients with gallstones on usg or peptic ulcer disease on endoscopypatients with previous history of gallbladder surgerypatients with history of lactose intolerancepatients fasting for less than 4 h or longer than 24 h or are on total parenteral nutritionpregnant or lactating womenpatients on medications affecting gall bladder contraction ( prokinetics like cisapride or itopride , cholinomimetics such as bethanechol , prostigmine , and erythromycin , inhibitory hormones such as somatostatin , nitric acid releaser such as arginine , calcium channel antagonist nifedipine , progesterone , trimebutine , loperamide , ondansetron ) .
patients with gallstones on usg or peptic ulcer disease on endoscopy patients with previous history of gallbladder surgery patients with history of lactose intolerance patients fasting for less than 4 h or longer than 24 h or are on total parenteral nutrition pregnant or lactating women patients on medications affecting gall bladder contraction ( prokinetics like cisapride or itopride , cholinomimetics such as bethanechol , prostigmine , and erythromycin , inhibitory hormones such as somatostatin , nitric acid releaser such as arginine , calcium channel antagonist nifedipine , progesterone , trimebutine , loperamide , ondansetron ) .
a minimum of 4 h fasting was ascertained for all subjects , and a written informed consent was obtained . in the pretest 4 h fasting , drinking of water was not allowed and no specific dietary precautions were followed .
the patient was made to lie supine underneath a large - field - of - view gamma camera ( siemens symbia t6 ) fitted with a low - energy , high - resolution collimator .
patient was positioned under the gamma camera centering the right upper quadrant of the abdomen .
after an intravenous injection of 3 mci of tc - mebrofenin , sequential images of 1 min / frame in anterior projection were acquired , on a 64 64 computer matrix , for 120 min .
an in - house fatty meal was given at 45-min in the supine position with the help of a straw , to provoke gallbladder contraction .
an in - house fatty meal prepared by the dietary department of our institute was used for the study .
ingredients : milk , butter , yogurt , saltpreparation : add 25 g of butter in 50 ml of hot milk and mix it properly . then add 150 ml of curd and 1 g of salt into the mixture and blend it in the mixer grinder to make it a homogenous drink . serve 200 ml of a fatty meal .
the composition of the meal is depicted in table 1consumption : 200 ml of the fatty meal is consumed as a single meal .
it should be used within 6 h of its preparationintake method : a minimum of 4 h of fasting is required .
after 45-min of study acquisition , it is to be consumed orally immediatelystorage : keep in cool and dry place since its preparationoverdose : it does not have any side effects .
ingredients : milk , butter , yogurt , salt preparation : add 25 g of butter in 50 ml of hot milk and mix it properly
. then add 150 ml of curd and 1 g of salt into the mixture and blend it in the mixer grinder to make it a homogenous drink .
the composition of the meal is depicted in table 1 consumption : 200 ml of the fatty meal is consumed as a single meal .
it should be used within 6 h of its preparation intake method : a minimum of 4 h of fasting is required .
after 45-min of study acquisition , it is to be consumed orally immediately storage : keep in cool and dry place since its preparation overdose : it does not have any side effects . no fat toxicity was reported .
composition of in - house fatty meal tc - mebrofenin was used in our study of the gall bladder emptying kinetics .
reconstitution with tc - pertechnetate is done under strict aseptic precautions at room temperature .
studies were analyzed for hepatic uptake and excretion of tracer into the biliary system , time to visualization of activity in the small bowel , time to visualization of the gall bladder .
tc - mebrofenin is rapidly cleared from the bloodstream by the hepatocytes after an intravenous injection .
the extrahepatic bile ducts and gallbladder are visualized normally at 1530 min and the small intestine at 3060 min .
a tight region of interest ( roi ) was drawn over the gallbladder and on hepatic parenchyma for background correction in a composite image .
decay - corrected counts from the gallbladder roi 's were used to calculate the gbef with the help of formula as follows : premeal counts in gb were obtained from the 45 frame .
gbef was calculated at 30-min , 45-min , and 60-min using the above - mentioned formula .
time activity curves were generated and analyzed for various patterns of gallbladder emptying [ figure 1 ] .
dynamic images of normal gallbladder after injection of 2 mci of tc - mebrofenin with the fatty meal being given at 45 min .
it also shows ejection fraction curve , from which gall bladder ejection fractions is calculated .
gallbladder ejection fractions at 30-min 77% , at 45-min 91% , and at 60-min 92% data entry and validation was done by ms - excel spreadsheet ( microsoft office excel 2007 ) spss software ( version 11.0 , chicago : spss inc ) .
all the continuous variables were assessed for the normality using shapiro wilk test and kolmogorov smirnov test . as the sample size was small ,
continuous variables which followed gaussian distribution were expressed as mean standard deviation ( sd ) , otherwise median ( 75 percentile ) .
all the categorical variables were expressed as percentages . the statistical difference between the two groups which was normally distributed
was derived by independent sample t - test and by anova test if more than two groups along with tukey 's honestly significant difference ( hsd)test as post - hoc analysis .
receiver operating characteristic ( roc ) curve was used to assess the diagnostic accuracy of gbef calculated at 30-min , 45-min , and 60-min and area under curve ( auc ) was obtained .
fifty - nine volunteers ( mean age 42 years , 31 males , and 28 females ) participated in the study .
the volunteers had no symptoms ( i.e. , right upper quadrant / epigastric pain , nausea , vomiting ) , no history of gall bladder or hepatobiliary disease , diabetes mellitus , abdominal surgery or family history of hepatobiliary disease .
the patients were referred to the department of nuclear medicine for evaluation of recurrent right upper quadrant pain for the duration of 6 months by cholescintigraphy .
the patients who fulfilled rome iii diagnostic criteria of functional gallbladder disorder were included in the study analysis .
a total of 61 patients ( mean age 42 years , 40 males , and 21 females ) were included in the study .
diabetic patients were requested to avoid antidiabetic medications on the day of test to avoid hypoglycemia .
patients with gallstones on usg or peptic ulcer disease on endoscopypatients with previous history of gallbladder surgerypatients with history of lactose intolerancepatients fasting for less than 4 h or longer than 24 h or are on total parenteral nutritionpregnant or lactating womenpatients on medications affecting gall bladder contraction ( prokinetics like cisapride or itopride , cholinomimetics such as bethanechol , prostigmine , and erythromycin , inhibitory hormones such as somatostatin , nitric acid releaser such as arginine , calcium channel antagonist nifedipine , progesterone , trimebutine , loperamide , ondansetron ) .
patients with gallstones on usg or peptic ulcer disease on endoscopy patients with previous history of gallbladder surgery patients with history of lactose intolerance patients fasting for less than 4 h or longer than 24 h or are on total parenteral nutrition pregnant or lactating women patients on medications affecting gall bladder contraction ( prokinetics like cisapride or itopride , cholinomimetics such as bethanechol , prostigmine , and erythromycin , inhibitory hormones such as somatostatin , nitric acid releaser such as arginine , calcium channel antagonist nifedipine , progesterone , trimebutine , loperamide , ondansetron ) .
a minimum of 4 h fasting was ascertained for all subjects , and a written informed consent was obtained . in the pretest 4 h fasting , drinking of water was not allowed and no specific dietary precautions were followed .
the patient was made to lie supine underneath a large - field - of - view gamma camera ( siemens symbia t6 ) fitted with a low - energy , high - resolution collimator .
patient was positioned under the gamma camera centering the right upper quadrant of the abdomen .
after an intravenous injection of 3 mci of tc - mebrofenin , sequential images of 1 min / frame in anterior projection were acquired , on a 64 64 computer matrix , for 120 min .
an in - house fatty meal was given at 45-min in the supine position with the help of a straw , to provoke gallbladder contraction .
an in - house fatty meal prepared by the dietary department of our institute was used for the study .
ingredients : milk , butter , yogurt , saltpreparation : add 25 g of butter in 50 ml of hot milk and mix it properly
. then add 150 ml of curd and 1 g of salt into the mixture and blend it in the mixer grinder to make it a homogenous drink .
the composition of the meal is depicted in table 1consumption : 200 ml of the fatty meal is consumed as a single meal .
it should be used within 6 h of its preparationintake method : a minimum of 4 h of fasting is required .
after 45-min of study acquisition , it is to be consumed orally immediatelystorage : keep in cool and dry place since its preparationoverdose : it does not have any side effects .
ingredients : milk , butter , yogurt , salt preparation : add 25 g of butter in 50 ml of hot milk and mix it properly
. then add 150 ml of curd and 1 g of salt into the mixture and blend it in the mixer grinder to make it a homogenous drink .
the composition of the meal is depicted in table 1 consumption : 200 ml of the fatty meal is consumed as a single meal .
it should be used within 6 h of its preparation intake method : a minimum of 4 h of fasting is required .
after 45-min of study acquisition , it is to be consumed orally immediately storage : keep in cool and dry place since its preparation overdose : it does not have any side effects .
reconstitution with tc - pertechnetate is done under strict aseptic precautions at room temperature .
studies were analyzed for hepatic uptake and excretion of tracer into the biliary system , time to visualization of activity in the small bowel , time to visualization of the gall bladder .
tc - mebrofenin is rapidly cleared from the bloodstream by the hepatocytes after an intravenous injection . the extrahepatic bile ducts and gallbladder
a tight region of interest ( roi ) was drawn over the gallbladder and on hepatic parenchyma for background correction in a composite image .
decay - corrected counts from the gallbladder roi 's were used to calculate the gbef with the help of formula as follows : premeal counts in gb were obtained from the 45 frame .
gbef was calculated at 30-min , 45-min , and 60-min using the above - mentioned formula .
time activity curves were generated and analyzed for various patterns of gallbladder emptying [ figure 1 ] .
dynamic images of normal gallbladder after injection of 2 mci of tc - mebrofenin with the fatty meal being given at 45 min .
it also shows ejection fraction curve , from which gall bladder ejection fractions is calculated .
gallbladder ejection fractions at 30-min 77% , at 45-min 91% , and at 60-min 92%
data entry and validation was done by ms - excel spreadsheet ( microsoft office excel 2007 ) spss software ( version 11.0 , chicago : spss inc ) .
all the continuous variables were assessed for the normality using shapiro wilk test and kolmogorov smirnov test . as the sample size was small ,
continuous variables which followed gaussian distribution were expressed as mean standard deviation ( sd ) , otherwise median ( 75 percentile ) .
all the categorical variables were expressed as percentages . the statistical difference between the two groups which was normally distributed
was derived by independent sample t - test and by anova test if more than two groups along with tukey 's honestly significant difference ( hsd)test as post - hoc analysis .
receiver operating characteristic ( roc ) curve was used to assess the diagnostic accuracy of gbef calculated at 30-min , 45-min , and 60-min and area under curve ( auc ) was obtained .
in volunteers , the gbef at 30-min after fatty meal ingestion ranged from 58% to 92% ( mean sd : 74.42% 8.26% ) .
gbef at 45-min ranged from 65% to 94% ( mean sd : 82.61% 6.5% ) and at 60-min ranged from 74% to 95% ( mean sd : 89.37% 4.48% ) .
a comparison of gbef between volunteers and patients at various time points ( 30- , 45- , 60-min ) in table 2 .
comparison of gbef in volunteers and patients at various time points using an independent sample t - test , we compared the gbef at various time intervals ( 30- , 45- , and 60-min ) in controls and cases .
we found that gbef measurements at each time point ( 30- , 45- , and 60-min ) provided reasonably good separation between healthy controls and cases p < 0.05 .
roc curve analysis was used to assess the diagnostic accuracy of gbef measured at 3-time points [ figure 2 ] .
area under roc curve was largest for 30-min gbef ( auc 0.952 ; 95% confidence interval [ ci ] = 0.9140.989 ) , followed by 45-min ( auc 0.939 ; 95% ci = 0.8920.986 ) , and 60-min ( auc 0.064 , 95% ci = 0.01840.110 ) .
receiver operating characteristic curves for gall bladder ejection fractions measurements at 30-min , 45-min , and 60-min .
area under receiver operating characteristic curve was largest for 30-min ( area under curve 0.952 ; 95% confidence interval = 0.9140.989 ) followed by 45-min ( area under curve 0.939 ; 95% confidence interval = 0.8920.986 ) since the auc was maximum for 30-min gbef , we considered 30-min as the appropriate time point to assess gbef .
and also the majority of the volunteers had 74% of gall bladder emptying at 30-min itself though gall bladder continued to contract slowly later [ figure 3 ] .
as the data of gbef at 30-min followed gaussian distribution , the lower limit of gbef was calculated using mean 2sd , which was 58% .
those patients with gbef at 30-min < 58% were considered as having hypokinetic gall bladder [ figure 4 ] .
64% dynamic images of hypokinetic gall bladder after injection of 2 mci of tc - mebrofenin .
14% all the patients with gbef < 58% were treated with ursodeoxycholic acid in a dose of 300 mg / day for 6 months .
patients reported to follow - up after 6 months and clinical assessment was done in terms of symptomatic relief and development of new symptoms .
all the patients with gbef < 58% were treated with ursodeoxycholic acid in a dose of 300 mg / day for 6 months .
patients reported to follow - up after 6 months and clinical assessment was done in terms of symptomatic relief and development of new symptoms .
cholescintigraphy is a reproducible , nonobserver dependent , and noninvasive method to assess gallbladder function .
nonavailability of cck warrants use of a physiological stimulus and fatty meal is used as an alternative .
a variety of fatty meals such as lactose - free fatty meal , a corned beef , and cheese sandwich with milk , dried egg yolk , lipomul , corn oil emulsion , chocolate , yoghurt , and chocolate , humana , whipped cream , half and half milk , and whole milk have been tried .
fatty meal , however , has been institution - specific usually and probably lacked standardization . as the precise timing of cessation of gb emptying is debated , fatty meal ejection fraction values do not have established normal values . hence , standardization of times for calculating gbef is to be evolved .
a fatty meal stimulates the release of endogenous cck from the endocrine cells lining the mucosa of the duodenum , jejunum , and ileum .
it may take as much as 626 min after a meal for endogenous cck level to rise above the threshold to initiate gall bladder contraction and emptying .
our data in 59 controls showed that the mean gbef at 30-min after fatty meal ingestion was 74.4% 8.27% , at 45-min was 83% 6.6% , and at 60-min was 89.37% 4.48% .
different methods have been used to establish normal ranges and identify individuals requiring treatment . when the frequency distribution of population data resembles a gaussian curve , it is traditional to use mean 2sd or 95% confidence limits to set the lower limit of normal gbef values .
the lower limit of gbef at 30- and 45-min was 58% and 69% , respectively .
gbef at 60-min did not follow gaussian distribution , hence we considered 5 percentile , which was 81% as the lower limit .
( n = 36 ) in their study had mean gbef of 69.54% 21.04% at 30-min and 84.26% 11.41% at 60-min .
they used 120 ml of the fatty meal ( 10 g fat ) using a commercially available formula ( humana ) as a cholecystagogue .
the lower limit of normal gbef values were 27.46% at 30-min and 61.44% at 60-min . in our study ,
the mean gbef at 30-min was 74.4% 8.27% and at 60-min was 89.37% 4.48% .
the lower limit of gbef at 30- and 60-min is 58% and 81% , respectively .
both the mean gbef as well as the lower limit of gbef were high in our study .
shafer et al . studied 7 healthy volunteers and found mean gbef sd to be 31% 11% with the use of lipomul .
studied 17 healthy volunteers and found that the lower limit of normal for gbef at 60-min is 33% using a lactose - free food supplement ( 240-ml supplement containing 11.4 g of fat , 355 kcal , 50 g of carbohydrate ) .
krishnamurthy and brown studied 13 healthy subjects using half and half milk ( 240 ml/70 kg containing 24 g fat , 8 g carbohydrate , 8 g protein , 320 calories ) as a cholecystagogue .
the number of subjects in their study was too small , and the gbefs did not have a gaussian distribution .
the mean sd of gbef at 60-min was 89.37% 4.48% , which is more in comparison to the above study .
the lower limit of gbef in our study was high in comparison to other studies .
it is probably reflective of the high fat ( 26.12 g ) content in the meal .
has suggested that 4 g of fat does not result in gallbladder contraction , and at least 10 g of fat is required to produce gb emptying .
fat intake in indian population is probably income dependent and , therefore , is highly skewed , the intake being low among the rural and urban low - income groups .
the fat stimulus in this study is based on an indian council of medical research study group report and was standardized at 26.12 g. this is a 200 ml liquid meal , which was prepared by mixing curd , milk , and butter .
normal values of fatty meal cholescintigraphy are also likely dependent on the content of the meal , the amount of fat in the meal , and the methodology used .
. delayed gastric emptying may delay endogenous production of cck from the proximal small bowel .
postural variation like upright position may stimulate earlier production of endogenous cck and result in greater gallbladder emptying during acquisition time .
the longer latent period using fatty meals as compared to the cck-8 is probably due to the time taken for the release of endogenous cck . as it can take about 1020 min after a meal for the serum cck level to rise above a threshold and induce contraction and emptying of the gallbladder .
the mean latent period ( time from fatty meal ingestion to the beginning of gallbladder emptying ) was 15.5 min .
postprandial serum cck levels stay above the threshold for 23 h postmeal and the gallbladder emptying is maintained as long as the serum cck levels remain above the threshold for contraction .
variability of results in various other studies may be due to the small sample size , and different methodologies .
bartel et al . using roc analysis found that 60-min gbef provided the best separation between normal and diseased gb .
the area under roc curve was maximum for 60-min ( 0.963% at 95% ci ) . using corn oil emulsion ( 170 calories per 30-ml patient dose ) as a fatty meal , in 23 healthy subjects , they found gbef at 30- , 60- , and 90-min were 30% 22% ( range , 085% ) , 57% 24% ( range , 599% ) , and 72% 23% ( range , 25100% ) , respectively . on the contrary
, in our study , we found that the area under roc curve was largest for 30-min gbef ( 0.954 ) .
for our study , gbef at 30-min provided the best separation between healthy and diseased gb .
however , it is interesting to note that the gallbladder was still emptying even at 75-min after ingestion of fatty meal in few patients .
this may be due to continuous gastric emptying of fatty meal into the duodenum , which would further stimulate the release of endogenous cck followed by subsequent contraction of the gallbladder .
in - house fatty meal could be a cheaper reproducible noninvasive equivalent to cck in the assessment of gall bladder kinetics .
the fat causes release of endogenous cck and its ease of preparation , administration , and lack of side effects makes it an economical alternative .
| aim : this study was aimed at standardizing the in - house fatty meal methodology in cholescintigraphy and to determine gall bladder ejection fraction ( gbef ) with this standardized meal.materials and methods : this is a prospective case control study where 61 patients having right upper quadrant pain and postprandial bloating and 59 healthy volunteers were included .
they underwent 99mtc - mebrofenin fatty meal cholescintigraphy following a standard protocol .
dynamic acquisitions over 120 min were done , with a fatty meal being given between 45- and 60-min .
gallbladder emptying kinetics was studied by assessing the time activity curves and calculation of gbefs were made at 30-min , 45-min , and at 60-min and assessed.results:the gbef at 30-min was 74.42% 8.26% ( mean standard deviation ) , at 45-min was 82.61% 6.5% , and at 60-min was 89.37% 4.48% in the volunteer group .
the lower limit of gbef in volunteers at 30-min was 58% , 45-min was 69% , and at 60-min was 81% .
receiver operating characteristic ( roc ) analysis showed that 30-min gbef provided the best separation between healthy and diseased subjects with an area under curve of 0.952 ( 95% confidence interval = 0.9140.989 ) .
the lower limit of gbef at 30-min was 58%.conclusions : an in - house standard fatty meal could be a reproducible alternative to cholecystokinin as it is well - tolerated . based on roc curve analysis , we propose that 30-min gbef provides good separation between healthy and diseased people with this in - house fatty meal .
hence , dynamic acquisitions beyond 30-min postingestion of the fatty meal may not be warranted . |
venous cannulation is often a painful procedure with the potential to cause significant anxiety , distress , and discomfort.[13 ] pain relief prior to venous cannulation using topical analgesics is a growing practice as healthcare providers strive for a pain - free and pleasant hospital stay for patients .
eutectic mixture of local anesthetic ( emla ) is the most widely used topical analgesic since the early 1980s .
it is formulated as an oil - in - water emulsion , yielding an 80% concentration in the oil droplets , which facilitates its skin penetration . despite its proven efficacy ,
these include a long onset time of 60 min , a potential for complicated venous cannulation due to blanching of the skin , a duration of only 3060 min , and risk of methemoglobinemia in children below 1 year of age .
amethocaine is an ester local anesthetic which is more lipophilic than either lignocaine or prilocaine , facilitating its passage across the stratum corneum . in a 4% preparation
, it has a more rapid onset of action of 30 min after application with occlusive dressing , lasts 46 h , causes slight erythema which may aid cannulation , and can be used in infants from 1 month of age . with a seemingly better tolerability profile , amethocaine has been shown to be more superior , if not just as efficacious as emla in reducing pain during venous cannulation , especially in children .
as most of the data available were on the pediatric population , we carried out this study to compare the analgesic efficacy of emla 5% versus amethocaine 4% cream for venous cannulation in adults .
our study hypothesis was that amethocaine was more superior to emla in reducing venous cannulation pain in the adult population .
our major outcome was pain as assessed by visual analogue score ( vas ) during venous cannulation , while minor outcomes were ease of cannulation and cutaneous effects such as blanching , local induration , or erythema .
this prospective randomized double - blind clinical trial compared the analgesic effects of emla 5% and amethocaine 4% during venous cannulation .
eighty asa i ii patients aged between 18 and 65 years were recruited following approval from the institution 's medical research and ethics committee .
subjects receiving concurrent analgesics or with a history of allergy to local anesthetics were excluded .
also excluded were pregnant or breastfeeding women , diabetic patients with peripheral neuropathy , and patients with poorly visible veins .
patients who were recruited were given detailed explanation about the study and written informed consent was obtained .
they were briefed on the use of vas between 0 mm ( no pain ) to 100 mm ( the worst pain imaginable ) for pain assessment .
the intended site for cannulation was examined to make sure the skin was intact and healthy .
syringes containing 1 ml of either emla 5% or amethocaine 4% were prepared and sealed in envelopes .
the test drug was applied on the dorsum of the patient 's hand to form a 2-cm diameter circle and covered with an occlusive dressing ( tegaderm , 3 m ) for at least 60 min prior to venous cannulation .
venous cannulation using an 18 g cannula ( venofix , b.braun ) was performed by a blinded investigator who had at least 3 years anesthetic experience .
ease of cannulation was scored using a four - point scale , ranging from insertion at first attempt ( 1 ) , a number of minor adjustments needed ( 2 ) , a second attempt required ( 3 ) , or failure of 2 or more attempts ( 4 ) .
venous cannulation was deemed to have failed when it was unsuccessful at the designated site after three attempts .
subsequent cannulation was attempted at another site by a senior anesthetist following skin infiltration with 12 ml of lignocaine 2% .
the presence of cutaneous manifestations following application of test drugs , such as localized induration , erythema , blanching , or urticaria , was recorded .
allergic reactions , if any , were noted and treated with standard rescue measures . sample size estimation was based on the mean standard deviation ( sd ) of a similar study performed by browne , which showed a vas score of 25.3 16.6 after cannulation with emla . to detect a 20% change in vas , with an alpha error of 0.05 and a power of 80%
, we calculated that sample size should be at least 32 patients per group . estimating an approximately 20% dropout rate , we included 39 patients in each group .
the differences in patient 's age and bmi were compared using student 's t test , while differences in gender , race , ease of cannulation , and cutaneous manifestations were analyzed using fisher 's exact test .
the differences in vas were tested using the mann - whitney u test . a p value of < 0.05 was considered to be statistically significant .
a total of eighty patients were recruited , of which 39 patients were in the emla group and 41 patients in the amethocaine group .
one patient in the emla group had to be withdrawn from the study as the patient was an undisclosed intravenous drug user , the history of which was only revealed after the patient had been recruited .
no significant differences were observed between the two groups in terms of demographic data and duration of application of test drug .
patient characteristics and duration of application of test drug , expressed as mean sd and numbers ( percentage ) where appropriate mean vas scores at initial venous cannulation , 27.9 9.8 mm ( emla ) and 19.1 14.1 mm ( amethocaine ) , showed no statistically significant difference ( p > 0.05 ) .
the box - plot distribution of vas [ figure 2 ] showed a greater dispersion in the amethocaine group , while the distribution in the emla group was skewed to the left by the presence of an outlier ( patient number 13 ) in the group .
median vas for the emla group was higher at 30 mm compared to 20 mm for the amethocaine group but this did not achieve statistical significance .
the lowest vas noted was zero in the amethocaine group and 5 mm for the emla group .
comparison of pain score distribution mann - whitney u test used to compare vas no significant difference in ease of cannulation was noted between the two groups .
cannulation was successful at the initial attempt in 35 patients ( 92.2% ) in the emla group and 36 patients ( 87.8% ) in the amethocaine group .
one patient from each group ( 2.6% from emla group and 2.4% from amethocaine group ) had failure of 2 or more attempts .
local induration and erythema were noted in three patients ( 7.3% ) in the amethocaine group and mild blanching in eight patients ( 21.1% ) in the emla group .
the distress of needle puncture during venous cannulation or venepuncture is a particular problem in children and needle - phobic individuals .
this is further influenced by age , anxiety , and past experience , in which anticipatory anxiety correlated with high pain ratings .
thus , the alleviation of such pain and distress would be beneficial to all concerned .
administration of topical anesthetics to control pain during venous cannulation avoids the use of local anesthetic infiltration , which may cause pain and obscure visibility of the vein .
the ideal properties of a topical anesthetic should include ease of application , rapid onset of action , effective analgesia , long duration of action , minimal side effects , and suitability for use in all age groups .
the search for an ideal topical anesthetic over the years led to the development of emla in 1981 .
since emla became commercially available in 1986 , its use has expanded to include analgesia for arterial puncture , venepuncture , split skin grafts , removal of port wine stain , fistula cannulation , and many more procedures .
the onset , depth , and duration of dermal analgesia on intact skin provided by emla depend primarily on the duration of application . to provide sufficient analgesia for venous cannulation and venepuncture
, emla should be applied under an occlusive dressing for at least 1 h. to provide dermal analgesia for procedures such as split skin graft harvesting , emla should be applied for at least 2 h. this limitation , coupled with its relatively short duration of action of 3060 min , often means that it is inconvenient and impractical in an operating theatre setting .
in contrast , amethocaine is an ester local anesthetic with desirable features such as comparatively longer duration of analgesia , greater potency , fewer side effects , and a faster onset of action of 30 min .
however , its onset of action was not investigated in this study , as an application - to - cannulation interval of at least 60 min was necessary to double blind the trial and to cater for the long onset time of emla .
many studies have reported amethocaine to be equal or superior to emla in terms of analgesic efficacy .
the observed differences may be due to methodological variations in the dose of topical analgesic , surface area of application , or the size of intravenous cannula used .
it should be noted that most of these studies were carried out on pediatric patients , possibly because pain and distress to the children and their families were thought to warrant more active intervention . unlike other studies , we failed to show significant differences in vas between emla and amethocaine .
as the mean and median vas were less than 30 mm in both groups , it would appear both drugs were equally efficacious in providing analgesia for venous cannulation .
there was a much greater dispersion for amethocaine compared to emla , implying heterogeneity in the patient response to venous cannulation following amethocaine .
the distribution for emla group was skewed to the left due to the presence of an outlier .
first , the recommended storage temperature for amethocaine 4% gel is 28c even though it may be stored up to a month at 25c at the point of use , while emla should be stored at 25c or less .
temperature maintenance is vital during transport or storage and any increase in temperature above those stated might reduce its efficacy and affect the outcome of the study .
second , the vas is a subjective scoring system which depends on the individual 's perception and description of pain .
a more objective assessment could include alterations in the patients hemodynamic parameters in response to venous cannulation , which may be recorded and analyzed for correlation with pain scores .
a third factor is the possible component of anxiety toward venous cannulation , which might influence pain perception and hence pain scores given by the patients .
our patients comprised mostly of day care surgery patients who did not receive premedication prior to anesthesia and surgery . in a study on venepuncture in children
, choy found that anticipatory anxiety of both parent and child were correlated with higher ratings of pain , emphasizing the fact that pain is not purely a sensory experience .
however , speirs investigated the anxiety and discomfort associated with venous cannulation in adults and found no significant relationship between the two . in our study , the size of intravenous cannula was standardized to 18 g to enable us to make a fair comparison .
our results were similar to the study done by molodecka using 18 g cannula , which showed no difference in the analgesic effect between emla and amethocaine . however , significant differences were shown in many other studies using various sizes of cannula ranging from 20 - 22 g to 16 g .
arendts , on the other hand , did not specify the diameter of cannula used for cannulation and left this to the discretion of the person inserting it , as is usual clinical practice .
the role of cannula size remains unclear , but it did not appear to play a significant part in affecting the outcome of our study .
the vascular response to cutaneous application of emla was investigated by bjerring by means of skin reflectance spectroscopy and laser doppler blood flowmetry . in healthy subjects ,
emla cream produced a biphasic vascular response with an initial vasoconstriction , maximal after 1.5 h of application .
after prolonged application ( > 3 h ) , vasodilatation occurred , presumably because of a smooth muscle relaxant effect of the analgesics . in our study , eight patients were noted to have blanching of the skin while no erythema was noted .
the biphasic vascular response was not seen in this study because the average time before cannulation was less than 2 h. the vasoconstrictive effect of emla may potentially cause difficulty in intravenous cannulation , while the erythema effect of amethocaine can facilitate cannulation , as postulated by the cochrane review on this subject . in our study , we noted that three patients receiving amethocaine developed redness and swelling , consistent with the documented side effect of amethocaine .
we did not find significant difference in the ease of cannulation using amethocaine or emla or the number of attempts needed before successful cannulation .
similar results were also shown by choy , romsing , and newbury during venous cannulation in children .
the vasoactive effects of emla and amethocaine have minimal influence on the ease of cannulation .
first , the most common method of analgesia for venous cannulation in our institution is by means of local infiltration of 12% lignocaine , rather than topical analgesia .
the use of topical analgesia should ideally be compared to the standard analgesic technique to see whether there is justification to maintain status quo or adopt a new technique .
second , a placebo group with sham topical ointment would indicate whether topical analgesia is indeed indicated before venous cannulation .
this was rejected as it is our institution protocol to provide analgesia prior to insertion of large - bore venous cannula ( 18 g and above ) .
we studied topical emla and amethocaine in terms of analgesic efficacy and ease of venous cannulation in adult patients and found no significant differences in their characteristics . | background : venous cannulation is often a painful procedure for the patient .
eutectic mixture of local anesthetic ( emla ) is the commonest topical analgesic used but suffers from disadvantages such as slow onset and skin blanching , which may interfere with venous cannulation .
amethocaine is a newer topical analgesic which seems to be devoid of such problems.materials and methods : this prospective randomized double - blind study compared the analgesic efficacy of emla with amethocaine during venous cannulation in adults .
eighty asa i - ii patients , aged 1865 years , were recruited .
the test drug was applied on the designated site of venous cannulation and covered with an occlusive dressing for at least 60 min prior to the procedure .
data collected included visual analogue score ( vas ) during first attempt at venous cannulation , the ease and success rate at cannulation , and cutaneous changes at the application site.results:mean and median vas for the emla group were 27.9 9.8 and 30 mm , respectively ; while for the amethocaine group were 19.1 14.1 and 20 mm , respectively .
differences in vas did not reach statistical significance .
no statistically significant differences were observed in the ease and success rate at cannulation .
cutaneous changes in the form of local induration and erythema ( three patients in the amethocaine group ) and blanching ( eight patients in the emla group ) were mild , localized , and required no further treatment .
no patient developed severe allergic reactions.conclusion:topical emla and amethocaine were comparable in terms of analgesic efficacy and ease of venous cannulation in adult patients . |
an analysis of the phylogenetic distribution and virulence genes of escherichia coli isolates which predispose this bacteria to translocate from the urinary tract to the bloodstream is presented .
one - dimensional analysis indicated that the occurrence of p fimbriae and -hemolysin coding genes is more frequent among the e. coli which cause bacteremia .
however , a two - dimensional analysis revealed that a combination of genes coding two adherence factors , namely , p + dr , p + s , s + dr , s + fim , and hemolysin + one adherence factor , were associated with bacteremia and , therefore , with the risk of translocation to the vascular system .
the frequent and previously unrecognized co - existence of pro - inflammatory p fimbriae with the invasion promoting dr adhesin in the same e. coli isolate may represent high - risk and potentially lethal pathogens . | |
central serous chorioretinopathy ( cscr ) is a relatively frequent ocular disorder characterized by the accumulation of subretinal fluid at the posterior pole , causing a circumscribed area of retinal detachment .
the detachment frequently involves the macular area , such that patients usually complain of metamorphopsia , micropsia , macropsia , or central scotoma .
visual acuity is often moderately decreased and , in most cases , the cscr spontaneously resolves within a few months .
the pathophysiology remains unclear [ 1 , 2 , 3 , 4 , 5 , 6 ] .
a 28-year - old man presented at the department of ophthalmology , university clinic hospital of valladolid , with a 3-month history of progressive bilateral vision loss , blurred vision , and metamorphopsia in both eyes .
he denied any remarkable past medical history and concurrent systemic treatment ; he also denied a history of abuse of tobacco , alcohol , or illegal drugs .
his best - corrected visual acuity was 20/25 in the right eye and 20/40 in the left eye .
fundus oculi evaluation revealed retinal pigmentary abnormalities in the macula of both eyes ( fig .
there was also a serous detachment of the neurosensory retina associated with a small retinal pigment epithelium ( rpe ) detachment in the left eye .
1c , d ) by optical coherence tomography ( 3d oct-1000 ; topcon , tokyo , japan ) .
there was no evidence of intraocular inflammation , retinal holes , tears , or retinal choroidal neovascularization .
autofluorescence images ( trc-50ex , imaginet 2000 ; topcon ) showed diffuse areas of increased autofluorescence and reduced intensity in the macular and peripapillary areas . upon fluorescein angiography , there were multiple pinpoint areas of hyperfluorescence in the macula and peripapillary areas .
there were also areas of independent leakage with a mottled appearance and low activity from early stages without later changes ( fig .
no specific treatment was prescribed for the cscr , and 6 months later it remained unchanged . the patient 's best - corrected visual acuity and fundus oculi evaluation revealed minimal changes
however , he suffered progressive systemic changes , including a 10-kg increase in body weight , supraclavicular fat accumulation around the neck and face ( moon face ) , dorsocervical fat pad ( buffalo hump ) , purple striae , and thin skin ( fig .
a tentative diagnosis of hypercortisolism was made , and the patient was sent to the endocrinology department of the university clinic hospital to confirm the diagnosis .
his urinary free cortisol was 264.7 g/24 h , confirming the tentative diagnosis of hypercortisolism . a low - dose ( 1 mg ) dexamethasone suppression test
was performed , revealing a mean cortisol level of 19.94 g/100 ml . a follow - up high - dose ( 8 mg ) dexamethasone suppression test was performed , and a suppressed adrenocorticotropic hormone serum level assay value of < 5 pg / ml confirmed the previous dexamethasone suppression test .
subsequently , an abdominal ct scan without contrast was performed and revealed the presence of a left adrenal oval - shaped mass with irregular enhancement ( fig .
following these tests , the patient was treated with ketoconazole and steroid replacement therapy before consulting surgeons performed a laparoscopic left adrenalectomy .
hydrocortisone was administered after surgery to restore the physiologic hypothalamic - pituitary - adrenal axis .
one month after surgery , the patient 's best - corrected visual acuity improved to 20/20 in both eyes .
the fundus examination showed only rpe abnormalities , but there were no signs of cscr .
psychological stress , hormonal changes in pregnancy , and glucocorticoid treatments [ 1 , 2 , 3 , 4 ] can all contribute to the development of cscr , though the influence each of these circumstances has on cscr is not well understood .
corticosteroids may inhibit collagen synthesis and increase choriocapillaris fragility and permeability by altering ion transport across the rpe
. other proposed mechanisms of corticosteroid - dependent increases in capillary fragility and permeability include inhibition of fibroblast proliferation , alteration of leukocyte migration , and release of proteolytic enzymes [ 4 , 5 ] .
corticosteroids could also cause local ischemia by reducing choroidal fibrinolysis , leading to choroidal endothelial and rpe injury with consequent increased permeability .
cscr has been reported in only 5% of patients with cushing 's syndrome , all of whom had a pituitary adenoma . in each of these cases ,
the cscr occurred during the period of active , untreated disease while plasma cortisol levels were high .
however , 2 new cases of cscr have been reported as a result of hypercortisolism due to an adrenocortical adenoma . because both cscr and adrenocortical adenomas are not very common diseases , a coincidental association is highly improbable . furthermore
, considering the resolution of cscr in our patient without any systemic treatment following the adrenocortical adenoma resection , we suggest that hypercortisolism could be an important risk factor for cscr .
our case underscores the importance of considering the possibility of a diagnosis of endogenous cushing 's syndrome in patients with cscr as an initial symptom .
| a 28-year - old man with bilateral central serous chorioretinopathy ( cscr ) and body weight gain was diagnosed with cushing 's syndrome secondary to an adrenocortical adenoma .
the patient had high levels of free cortisol and the tumor was confirmed by histopathology .
after surgery , cortisol levels decreased and the cscr spontaneously resolved .
this case highlights the role of cortisol in the pathogenesis of cscr .
a diagnosis of endogenous cushing 's syndrome should be considered in patients with cscr as an initial symptom . |
the last 50 years have witnessed an impressive evolution in the antibiotic armamentarium at the clinician s disposal .
the availability of effective antibiotic treatment has substantially impacted on overall mortality of patients with lower respiratory tract infections ( lrtis ) .
international guideline drafting and implementation have been important in highlighting key factors in improving care in community - acquired pneumonia ( cap ) and acute exacerbation of chronic bronchitis ( aecb ) ( woodhead et al 2005 ; mandell et al 2007 ) .
this reflects the paucity of appropriately designed large scale clinical trials addressing such an important treatment issue .
conventionally , antibiotics are continued until clinical and laboratory indices of infection are normal in patients with lrtis .
it is recognized that patients tend to interupt treatment once they feel better , decreasing compliance to treatment after that time point .
antibiotic exposure is unavoidably associated with the phenomenon of antibiotic resistance due to a selection pressure on bacterial strains with natural or acquired resistance .
ideally , antibiotics should be maintained only up until bacteria are effectively cleared as further protraction of therapy increases unnecessary bacterial exposure to drugs .
currently , antimicrobial resistance is a global problem resulting in high hospitalization rates , mortality and costs in lrtis ( sahm 2003 ) .
for example , low dose and prolonged duration of -lactam antibiotic treatment may contribute to promoting pharyngeal carriage of drug - resistant streptococcus pneumoniae ( guillemot et al 1998 ) , whereas high - dose short course amoxicillin may be associated with significantly lower penicillin - resistant s. pneumoniae carriage ( schrag et al 2001 ) .
patient adherence to prescribed antibiotic regimens is affected by variables including dosing interval , treatment duration , adverse effects , and palatability in pediatric patients .
adherence to once - daily regimens has been shown to be far superior to that of twice- ( kardas 2007 ) or thrice - daily dosing schemes ( claxton et al 2001 ) .
it is fairly well established that patient compliance with antibiotic therapy begins to drop after 37 days of treatment ( kardas 2002 ) .
additional potential benefits of short course antibiotic therapy in lrtis patients include diminished impact on human endogenous flora , decreased total drug exposure with reduced side effects , reduced health care worker time expenditure , and reduced costs . in order to avoid falling short of effectively controlling infection
, short - course antibiotic therapy should be based on robust pharmacokinetic and pharmacodynamic considerations .
candidate drugs for short - course regimens should be able to achieve adequate tissue penetrations and concentrations at the site of infection for a sufficiently long length of time to ensure bacterial eradication ( nicolau 2001 ) .
the development of an effective short course regimen requires a concentration - dependent antimicrobial effect . the rate and extent of bacterial killing increase with increasing drug concentrations . for such agents the pharmacodynamic / pharmacokinetic predictors of efficacy are the area under the concentration - time curve / mic ratio ( auc / mic ) and the maximal serum drug concentration / mic ratio ( cmax / mic ) ( nicolau 2001 )
it acts by interfering with bacterial protein synthesis through binding of the 50s ribosomal subunit of susceptible microorganisms .
azithromycin is an ideal candidate for short - course antibiotic regimens for a number of reasons .
compared with earlier macrolides , azithromycin shows improved pharmacokinetic / dynamic properties that determine a prolonged half - life and excellent tissue penetration .
the drug rapidly moves from the bloodstream into the interstitial compartment resulting in low serum concentrations but high and persistent tissue concentrations ( amsden et al 1997 ) .
characteristically , azithromycin concentration in lung tissue may be over a 100-fold greater than in the circulation .
considering that respiratory tract infections reside in the interstitial space , tissue accumulation of azithromycin may guarantee high drug concentrations in the active site of infection .
a further interesting characteristic is the ability of azithromycin to concentrate within inflammatory cells , particularly neutrophils and monocytes within the bloodstream , and tissue macrophages ( mandell et al 2001 ) .
the ongoing inflammatory process in the lung recalls azithromycinladen neutrophils from the circulation which then unload the drug in the presence of bacteria within inflammation sites ( hand et al 2001 ) .
inflammatory cells therefore act as a trojan horse delivering local concentrations of azithromycin that are several orders of magnitude greater than that in plasma .
neutrophil unloading and the extended half life of azithromycin ( ~60 hours ) sustain therapeutic drug concentrations at the site of infection for prolonged periods of time ( blumer 2005 ) . furthermore , inflammatory cell uptake of azithromycin is non - saturable and concentration dependent , suggesting that administration of higher doses of the drug early in the course of the infection may result in even greater drug concentration at the sites of infection .
short - course treatment of cap patients with azithromycin has been shown to be effective , with the 3-day ( 500 mg single daily dose ) regimen and the 5-day ( 500 mg first day , 250 mg following days ) regimens obtaining comparable results ( socan 1998 ) .
clinical studies have shown that a 3-day or 5-day treatment with azithromycin is at least as effective as more prolonged regimens of benzylpenicillin or erythromycin ( bohte et al 1995 ) , and clarithromycin ( odoherty et al 1998 ) .
azithromycin and comparators were similar in terms of clinical , microbiological , and radiological results in outpatient or hospitalized cases of mild - to moderate cap .
similarly , 3 or 5-day azithromycin regimens were clinically and microbiologically as effective as more prolonged treatment with amoxicillin - clavulanic acid ( hoepelman et al 1997 ) , levofloxacin ( amsden et al 2003 ) , clarithromycin ( bradbury et al 1993 ) or 5-day courses of moxifloxacin ( deabate et al 2000 ) or dirithromycin ( castaldo et al 2003 ) in patients with aecb .
table 1 shows a summary of clinical data for the quoted studies on azithromycin versus comparators in lrtis .
given its prolonged half - life , propensity to accumulate in tissues and inflammatory cells , and post antibiotic effect , attempts have been made to condense conventional treatment into single large dose schemes of azithromycin ( 1.5 g in adults , 30 mg / kg in children ) for the management of lrtis .
administration of a single , higher dose of azithromycin has been shown to achieve more rapid bacterial eradication and enhanced survival than the same dose divided over several days in pre - clinical infection models of otitis media , murine pneumonia and septicemia ( girard et al 2005 , babl et al 2002 ) .
this suggests that antibiotic front - loading , attaining higher systemic exposure early in the course of infection ( ie , the auc from time zero to 24 hours [ auc024 ] post dosing ) , may result in more rapid and efficient bacterial clearance following the single - dose regimen .
this may offer benefits in terms of minimizing emergence of resistance . in an open randomized study ,
the efficacy and safety of a single 1.5 g oral dose of azithromycin was compared with the standard 3-day regimen in the treatment of 100 patients with community - acquired atypical pneumonia ( schnwald et al 1999 ) .
side effects were observed in 2 patients in the single - dose group , and one patient in the 3-day group . due to the relatively small number of patients studied ,
however , the study does indicate that a single 1.5 g dose of azithromycin may be an alternative to the standard 3-day azithromycin regimen in the treatment of outpatients with atypical pneumonia syndrome .
a later study analyzed the serum and white blood cell pharmacokinetic behavior of 1.5 g single dose azithromycin compared to the same dose over 3 days ( amsden et al 2001 ) .
the single drug bolus resulted in significantly higher peak serum concentration compared to the 3-day regimen , although the subjects overall drug exposure did not differ significantly . at 10 days from the start of therapy both regimens showed intracellular white blood cell concentrations that were above the mic90 values of the vast majority of community - acquired respiratory pathogens .
the highest single oral dose of azithromycin currently approved is an immediate - release 2.0 g sachet formulation of oral powder for suspension in the treatment of chlamydial and gonococcal urethritis and cervicitis ( handsfield et al 1994 ) .
the reported 34% incidence of nausea and 14% incidence of diarrhea indicate that this formulation is likely to achieve limited clinical diffusion due to the high level of gastrointestinal intolerance .
recently , microspheres have been developed as a means of effectively delivering antibiotics in periodontal ( paquette 2007 ) and ocular diseases ( pijls et al 2006 ) , for minimizing toxicity of antimycobacterial treatment ( rastogi et al 2006 ) , and as an aid in helicobacter pylori eradication ( patel et al 2007 ) .
a novel azithromycin microsphere formulation ( recently approved as zmax in the usa ) has been developed to address the challenge of administering a higher oral dose of the drug as a single dose while maintaining tolerability .
the characteristics of the microspheres , with a mean diameter ranging from approximately 100300 m , were selected based on a combination of palatability , release profile , and manufacturability .
azithromycin is released slowly via diffusion through pores formed in - situ in the microspheres .
alkalinizing agents ( sodium phosphate tribasic and magnesium hydroxide ) were incorporated in the formulation .
following ingestion , the alkaline nature of the microsphere formulation delays initial release of drug in the stomach .
local drug activation of the motilin receptors is thought to mediate much of the macrolide - related gastrointestinal side effects ( takeshita et al 2006 ) .
all the drug is released prior to the colon , thus ensuring maximal bioavailability ( approximately 83% ) ( chandra et al 2007 ) . in an open - label ,
randomized , parallel - group study of 24 healthy adult subjects the pharmacokinetic profiles of azithromycin given as 2.0 g microspheres were characterized in serum and white blood cells and compared with those of a 3-day regimen totaling 1.5 g ( liu et al 2007 ) . compared with the conventional 3-day 1.5 g azithromycin treatment ,
the single - dose 2.0 g microsphere formulation obtained a 2-fold higher maximum plasma concentration ( cmax ) and a 3-fold higher 24-hour area under the concentration - time curve ( auc024 ) at day 1 .
the total systemic exposure in serum over 5 days following the start of dosing ( auc0120 ) was similar for the two regimens .
similarly , in white blood cells , threefold higher drug exposure and maximal concentrations were found at day 1 following single dose administration compared with the 3-day regimen . in an observer - blind , parallel group , single - dose study , the tolerability profiles of azithromycin 2.0 g microspheres were compared with the immediate - release azithromycin 2.0 g sachet formulation of oral powder for suspension ( chandra et al 2007 ) .
this was a complex study that also evaluated pharmacokinetic profiles of the two compounds and the effect of food ( high fat meal and a standard meal ) and an antiacid on the rate of drug absorption .
compared with the sachet oral powder suspension , the microsphere formulation was associated with a slower absorption rate ( 57% decrease in mean cmax with a 2.5 hour delay in time to reach cmax ) . however , because the auc values were comparable , overall drug exposure was similar .
the incidence of gastrointestinal side effects ( abdominal pain , nausea , vomiting , and diarrhea ) was significantly lower with azithromycin microspheres compared to the immediate - release formulation .
one non - gastrointestinal adverse event common to azithromycin slow - release and immediate release was headache ( 12% and 6% , respectively ) . in both groups over 90% of adverse events were mild in intensity and occurred within the first 2 hours after dosing .
both the high fat meal and the standard meal increased the rate of drug absorption ( 2-fold higher cmax values , and 2- to 4-hour shortening of time to maximal concentration ) but were associated with an increased incidence of nausea and vomiting .
it was assumed that meal - triggered gastric acid secretions led to faster release of azithromycin from the microspheres ( chandra et al 2007 ) .
because of the decreased tolerability of the formulation when taken with food , it was suggested that azithromycin micro - spheres be taken on an empty stomach .
pharmacokinetic properties of the azithromycin microspheres were not significantly affected by co - administration of an antiacid .
two phase iii multinational , multicenter , double - blind , double - dummy studies analyzed the efficacy and safety of a new microsphere ( ms ) formulation of azithromycin , 2.0 g given as a single dose , compared with either the extended - release formulation of clarithromycin ) ( 1 g od for 7 days ) ( drehobl et al 2005 ) or with levofloxacin ( 500 mg od for 7 days ) ( dignazio et al 2005 ) in the treatment of adults with mild - to - moderate cap . in the clarithromycin extended - release comparator trial , eligible subjects were required to be 16 years of age or older , with cough productive of sputum and a diagnosis of pneumonia as demonstrated by two or more of the following signs or symptoms : auscultatory findings on pulmonary examination of rales and/or evidence of pulmonary consolidation ; dyspnea or tachypnea ; body temperature > 38 c ( oral ) ; or an elevated total peripheral white blood cell count ( > 10,000/mm ) or > 15% immature neutrophils ( bands ) . in addition , subjects had to have a prospectively calculated modified fine risk score of ~70 ( fine classes i and ii ) ( fine et al 1997 ) .
patients were recruited at 58 centers in 7 countries among the us , canada , europe , and asia . in the levofloxacin trial , subjects were aged 18 years or older with a clinical diagnosis of mild - to - moderate cap with a fine mortality risk class of i , ii , or iii ( ie , a risk score of ~90 ) . in total , 427 patients were randomized , of whom 423 received study medication .
patients were enrolled at 56 centers in 8 countries among north and south america , europe , and asia . in both studies ,
clinical assessments were conducted at baseline ( day 1 ) , during treatment ( days 35 ) , at the end of treatment ( days 811 ) , post treatment at the test of cure ( toc ) visit ( days 1421 ) and at a long - term follow - up visit ( days 2835 ) .
subjects with a clinical response of cure at the toc visit were assessed for relapse at the long - term follow - up visit ( days 2835 ) .
bacteriological response was assessed in those subjects from whom a pathogen was identified at baseline .
table 2 shows the demographics and baseline characteristics of the patients enrolled in the two studies .
no differences in terms of either clinical response or bacteriological response were noted between azithromycin microspheres and comparators at the toc visit ( days 1421 ) ( table 3 ) . in the azithromycin vs clarithromycin study , at the long - term follow - up visit ( days 2835 ) , only 1 subject ( 0.6% ) in the azalide study arm and 5 subjects ( 2.8% ) in the clarithromycin study arm were classified as having relapsed .
clinical cure rates in patients with multilobar pneumonia were only slightly lower than those in patients with single lobe pneumonia ( 88.5% vs 94.4% ) .
two azithromycin - treated subjects and one clarithromycin - treated subject were hospitalized for worsening of pneumonia . in this study
there were 4 deaths , all of which were in the clarithromycin extended release arm .
none of the deaths were attributed to study therapy or progression of cap . in the study comparing azithromycin microspheres with levofloxacin , 6 subjects ( 2 azithromycin and 4 levofloxacin ) were hospitalized for worsening pneumonia ; 2 of the levofloxacin - treated and 1 of the azithromycin - treated subjects ultimately died of causes other than pneumonia . in the azithromycin vs clarithromycin study a pathogen was identified in 281/499 ( 56% ) of treated patients , with evidence of mixed infection in 16% .
an atypical pathogen was identified in 24% of azithromycin - treated subjects . in the azithromycin vs levofloxacin study a pathogenic microrganism was identified in 219/423 ( 52% ) of treated patients , a mixed infection being present in 11% .
data on s. pneumoniae eradication rates and clinical response , according to bacterial susceptibility to macrolides and penicillin , were analyzed in both studies ( tables 4 and 5 ) .
no clear relationship between resistance patterns and clinical and bacteriological outcomes was observed . in the two studies combined ,
13 azithromycin - resistant s. pneumoniae strains were found , 7 of which were treated with azithromycin , with clinical cure and bacteriological eradication ( presumed or documented ) being obtained in 4/7 .
however , the clinical significance of this finding is still debated as resistance has been associated with clinical failure in some ( fogarty et al 2000 ) but not all studies ( aspa et al 2004 ) .
particularly , treatment failure is not unusual in cases of bacteremic pneumococcal pneumonia ( lonks 2002 ) , although most clinical failures showed underlying conditions that would have contraindicated the empirical choice of a macrolide as first line treatment . as mentioned above
, the administration of a single high dose of azithromycin is likely to result in concentrations of azithromycin in lung tissue and fluids that would be effective against s. pneumoniae with low - level macrolide resistance .
for azithromycin microspheres , most adverse events occurred on the day of administration and resolved within 2 days .
table 6 shows the adverse reactions recorded in the two studies . in both studies ,
the azithromycin group showed a greater number of diarrhea and loose stools adverse events . in most cases the effect was limited to the day of therapy or the following day .
owing to the single - dose nature of the regimen , all azithromycin - treated patients completed the treatment course , whereas 15 of 254 subjects ( 5.9% ) randomized to the clarithromycin xl arm did not complete the entire 7-day course of active treatment and 10 of the 212 levofloxacin - treated subjects ( 4.7% ) did not complete the full 7-day treatment course .
the results of these controlled trials in cap demonstrated that a single 2.0 g dose of azithromycin microspheres is at least as effective as a 7-day treatment with either clarithromycin extended release or levofloxacin , confirming the suitability of the new formulation of azithromycin .
proper management of an aecb should result in rapid resolution of the acute episode and decrease in the likelihood of treatment failure and of an early recurrence ( martinez 2005 ) .
it is felt that only approximately 50% of exacerbations are sustained by bacteria ( monso et al 1995 ) and the issue is complicated by the fact that approximately 25%40% of copd patients present stable bacterial colonization of the airways outside periods of acute deterioration ( cabello et al 1997 ) .
attempts have been made to identify patients more likely to present bacterial aetiology of an exacerbation based on the presence of at least 2 out of 3 of the clinical anthonisen criteria ( increased cough , increased in sputum production , change in sputum color ) ( anthonisen et al 1987 ) . among the three symptoms ,
sputum purulence has been most strongly associated with bacterial exacerbation ( stockley et al 2000 ; allegra et al 2005 ) .
additionally , patient baseline severity must also be considered as antibiotics have a greater beneficial effect in patients with more severe disease ( allegra et al 2001 ) , which translates into a survival advantage in those sufficiently severe to require mechanical ventilation ( nouira et al 2001 ) .
regrettably , in most older antibiotic efficacy studies on patients with exacerbations a precise definition of copd was often absent , with enrolment of young , non - obstructed never - smokers , unsatisfactory definitions of exacerbation , high population severity heterogeneity , and lacked stratification for steroid use .
a recent double - blind , double - dummy study compared azithromycin microspheres ( 2 g single dose ) with levofloxacin ( 500 mg once daily for 7 days ) in patients with aecb ( zervos et al 2005 ) .
patients were clearly defined with stratification for the use of systemic steroids , and strict inclusion and exclusion criteria .
a total of 551 subjects were randomized and 438 were treated at 62 centers in 13 countries .
most enrolled subjects were advanced - age patients with a past history of smoking , documented airflow obstruction , at least one aecb in the previous year , and presented all three cardinal anthonisen symptoms in the current exacerbation .
the clinical cure rate at the test - of - cure ( toc ) visit ( days 1421 ) in the treated population was comparable between the two agents ( 93.6% for azithromycin compared with 92.7% for levofloxacin ) .
baseline microbiological testing yielded positive results in approximately 49% of subjects . in these patients ,
the overall bacteriological eradication rate was comparable between the two treatment regimens ( 91.9% for azithromycin versus 94.4% for levofloxacin ) .
additional post hoc analyses of the 272 subjects in this study with spirometric evidence of airway obstruction suggests equal efficacy of azithromycin microspheres compared with levofloxacin across all strata of copd severity using the gold and ats / ers stratification schemes ( pauwels et al 2001 ; celli et al 2004 ) ( table 8) .
the majority of enrolled patients presented advanced disease severity . during the course of the trial and the follow - up period ,
eight of these occurred in the levofloxacin - treated arm while 4 occurred in azithromycin microsphere - treated patients .
there was no clear pattern noted , although the majority of hospitalized patients had more severe airway obstruction at baseline . among the patients treated with azithromycin microspheres ,
all patients were reported as clinically cured . in 1 patient with the highest macrolide mic values ( > 256
g / ml ) , persistence of the baseline pathogen was established at the 10-day toc visit despite clinical resolution of the acute symptoms .
optimal duration for antimicrobial treatment in lower respiratory tract infections ( lrtis ) is still undetermined .
short - course treatments may be a means for maintaining clinical efficacy while containing antibiotic resistance spread , increasing patient compliance , and limiting drug - related adverse events . as recently pointed out by thomas m.
file ( file 2004 ) , the basic rationale behind short - course antibiotic treatment in cap is to hit hard and stop early . candidate drugs must show favorable pharmacokinetic and pharmacodynamic properties allowing high and prolonged antimicrobial concentrations at the site of infection .
the novel azithromycin microsphere formulation takes the concept of short - course treatment one step further by allowing single - dose antibiotic administration in lrtis .
use of this formulation allows greater peak concentrations of the drug early in the course of infection with similar overall total antimicrobial exposure compared to traditional 3- to 5-day dosing regimens .
the results of controlled trials in cap and copd exacerbations demonstrate that a single dose of azithromycin microspheres is at least as effective and well tolerated as a 7-day treatment with either extended release clarithromycin or levofloxacin .
an undoubted advantage of single - dose azithromycin administration is the facility in ensuring that patients complete their prescribed course of therapy .
failure to complete therapy may be associated with deterioration in the patient s condition , treatment failure , and increased use and cost of healthcare resources such as the requirement for additional drugs and hospital admission .
another advantage of single - dose therapy is the potential for use as directly observed therapy ( dot ) .
the use of a dot in lrtis is intriguing , particularly in congested clinical situations ( such as emergency departments ) where assuring patient compliance may be troublesome or barriers to filling prescriptions may exist .
physicians may be doubtful as to whether a single dose regimen may be reliable and effective for the treatment of their patients with lrtis .
similarly , patients are accustomed to taking medications everyday while they are sick , with interruption of treatment often coinciding with symptom resolution .
clearly , further sound clinical demonstration of efficacy and recognition of patient subsets most likely to benefit are needed before widespread use of this approach to lrtis can be considered . | few adequately designed clinical trials have addressed optimal treatment duration in lower respiratory tract infections .
drugs possessing favourable pharmacokinetic and pharmacodynamic profiles may obtain early bacterial eradication allowing shorter treatment duration .
this may be associated with a number of advantages including reduced resistance induction , increased compliance , lesser adverse events , and cost containment . recently , a novel 2.0 g single dose of azithromycin microspheres has been compared with 7-day levofloxacin 500 mg or extended release clarithromycin in over 400 patients with community - acquired pneumonia .
clinical cure and bacteriological eradication rates , hospitalizations , and deaths were similar between azithromycin and comparators .
azithromycin 2.0 g microspheres proved as effective as 7 days of levofloxacin 500 mg in acute exacerbation of chronic bronchitis patients across all degrees of obstruction severity . in both settings azithromycin microspheres obtained clinical cure in most patients harbouring macrolide - resistant streptococcus pneumoniae strains
.
the drug was well tolerated in clinical studies and in healthy volunteers with modest and transitory adverse events .
an undoubted advantage of single - dose azithromycin administration is the facility in ensuring that patients complete their prescribed course of therapy .
a further advantage of single - dose therapy is the potential for use as directly - observed therapy , which may be useful in specific clinical conditions . |
fatigue is a common symptom in palliative care patients , and virtually , every intervention used to treat cancer , as well as the primary disease itself , may cause or contribute to fatigue . in a study of 1000 patients in an american palliative care programme , fatigue , weakness , and lack of energy were three of the five most frequently reported symptoms with a prevalence of 84% , 66% , and 61% , respectively.1 fatigue is also commonly reported in noncancer patients with progressive lifethreatening diseases , such as multiple sclerosis and .amyotrophic lateral sclerosis,2 chronic obstructive pulmonary disease,3 heart failure,4 hiv,5 as well as chronic heart , kidney , or lung diseases.6 , 7 several drugs , such as the new antineoplastic therapies , or drugs regularly used in palliative care have sedative properties , for example , opioid analgesics , benzodiazepines , antidepressants , or anticonvulsants can cause fatigue.8
the pathophysiology of fatigue in palliative care patients is not fully understood .
diseaserelated symptoms , such as sleep disturbances , may also account for fatigue and may be termed
we selected the definition of the european association of palliative care : fatigue is a subjective feeling of tiredness , weakness , or lack of energy.8
assessment of fatigue will depend on subjective selfassessment by the patient , substituted by caregiver or medical staff estimations only where self assessment is not possible .
singleitem scales have been proposed , and a multitude of checklists and questionnaires with multiple dimensions have been validated.9 it is possible that a number of hindrances such as lack of consensus on the definition of fatigue or on significant cutoff levels of evaluation instruments limited structured approach with assessment and treatment steps have led to underestimation and undertreatment fatigue . if possible , a causative treatment approach should be addressed .
some studies10 , 11 have examined the role of nondrug treatments for cancerrelated fatigue , such as patient education with provision of information on fatigue and its treatment , keeping a diary , energy expenditure planning , and physical exercise . on the other hand
, there is a growing body of evidence that gives examples of effective pharmacological treatments for fatigue.12 , 13 , 14 several recent systematic reviews15 , 16 , 17 have covered some drugs used to treat fatigue in cancer patients .
this paper provides an executive summary of a recent cochrane collaboration systematic review,18 which synthesizes evidence for the evaluation of the efficacy of pharmacological treatments for fatigue in palliative care , with a focus on patients at an advanced stage of disease , including patients with cancer and other chronic diseases .
the review updated the original review,19 pharmacological treatments for fatigue associated with palliative care and also incorporated the review
criteria for review entry were randomized controlled trials with focus on pharmacological treatment involving adults ( 18 years , both sexes ) , suffering fatigue in palliative care or in terminal illness .
patientreported fatigue and the improvement of fatigue were the primary outcomes of this review , while the secondary outcomes included asthenia , weakness , tiredness , exhaustion , and treatmentrelated burden .
we reengineered the search strategy ( filter ) of the previous review by peuckmannpost et al .
19 to facilitate the combination with another review by minton et al.16 to identify studies for inclusion in this updated review , we developed a detailed search strategy for each electronic database and other resources . to validate the search strategy ,
we selected sentinel studies.20 , 21 the following electronic databases were searched from their inception until 28 april 2014 central , medline ( ovid ) , psycinfo ( ovid ) , and embase .
additional information was obtained from standard textbooks on palliative medicine , unpublished literature through searches of conference proceedings and also from experts in the field of palliative care .
two review authors extracted the data ( m. m. and m. c. ) using a standard data extraction form and reviewed the data from the included studies .
two other authors ( l. r. and h. c. ) crosschecked and subsampled the data .
two authors ( m. m. and m. c. ) independently assessed risk of bias for each study using the criteria outlined in the cochrane handbook for systematic reviews of interventions and adapted from those used by the cochrane pregnancy and childbirth group , with any disagreements resolved by discussion or by involving other review authors ( l. r. and h. c. ) .
subgroup analysis was performed for dealing with following different criteria ; type of drug , type of disease , and type of assessment tools .
criteria for review entry were randomized controlled trials with focus on pharmacological treatment involving adults ( 18 years , both sexes ) , suffering fatigue in palliative care or in terminal illness .
patientreported fatigue and the improvement of fatigue were the primary outcomes of this review , while the secondary outcomes included asthenia , weakness , tiredness , exhaustion , and treatmentrelated burden .
we reengineered the search strategy ( filter ) of the previous review by peuckmannpost et al .
19 to facilitate the combination with another review by minton et al.16 to identify studies for inclusion in this updated review , we developed a detailed search strategy for each electronic database and other resources . to validate the search strategy ,
we selected sentinel studies.20 , 21 the following electronic databases were searched from their inception until 28 april 2014 central , medline ( ovid ) , psycinfo ( ovid ) , and embase .
additional information was obtained from standard textbooks on palliative medicine , unpublished literature through searches of conference proceedings and also from experts in the field of palliative care .
two review authors extracted the data ( m. m. and m. c. ) using a standard data extraction form and reviewed the data from the included studies .
two other authors ( l. r. and h. c. ) crosschecked and subsampled the data .
two authors ( m. m. and m. c. ) independently assessed risk of bias for each study using the criteria outlined in the cochrane handbook for systematic reviews of interventions and adapted from those used by the cochrane pregnancy and childbirth group , with any disagreements resolved by discussion or by involving other review authors ( l. r. and h. c. ) .
subgroup analysis was performed for dealing with following different criteria ; type of drug , type of disease , and type of assessment tools .
after we removed 186 duplicate studies , we retrieved articles against the inclusion criteria and found 45 studies , which met the inclusion criteria ( figure
1 ) . in total , we analysed data from 18 drugs , nine type of disease , and 4696 participants .
only two21 , 22 of the treatment groups in this review were large enough to give a low risk of bias ( 200 participants or more per treatment arm ) .
most studies reported some benefit of the active treatment . in general , adverse reactions were mild and had little or no impact .
study flow diagram.18
we used studies investigating pemoline and modafinil in participants with multiple sclerosisassociated fatigue and methylphenidate in participants suffering from cancer and fatigue for metaanalysis .
however , the us food and drug administration ( fda ) has decided to withdraw pemoline products ( marketed as cylert ) because of the risk of liver toxicity , which outweighs the benefits of the drug . metaanalysis was performed for two studies,23 , 24 which used the functional assessment for chronic illness therapy fatigue as the assessment tool in fatigue , comparing methylphenidate with placebo .
the studies showed a slightly superior effect of methylphenidate compared with placebo ( standardized mean difference 0.49 , 95% confidence interval 0.15 to 0.83 ; figure
2 ) .
forest plot of comparison of methylphenidate vs. placebo in cancer : functional assessment for chronic illness therapy fatigue score change.18
modafinil was tested in 115 patients with multiple sclerosis,25 but failed to demonstrate the superiority of modafinil vs. placebo .
another recent study of 21 patients with multiple sclerosis showed positive effect of modafinil.2 however , this result must be interpreted with caution because of the small participant numbers .
metaanalysis of these two studies also failed to demonstrate a significant effect , with a standardized mean difference of 0.14 ( figure
3 ) .
metaanalysis was performed for two studies,23 , 24 which used the functional assessment for chronic illness therapy fatigue as the assessment tool in fatigue , comparing methylphenidate with placebo .
the studies showed a slightly superior effect of methylphenidate compared with placebo ( standardized mean difference 0.49 , 95% confidence interval 0.15 to 0.83 ; figure
2 ) .
forest plot of comparison of methylphenidate vs. placebo in cancer : functional assessment for chronic illness therapy fatigue score change.18
modafinil was tested in 115 patients with multiple sclerosis,25 but failed to demonstrate the superiority of modafinil vs. placebo .
another recent study of 21 patients with multiple sclerosis showed positive effect of modafinil.2 however , this result must be interpreted with caution because of the small participant numbers .
metaanalysis of these two studies also failed to demonstrate a significant effect , with a standardized mean difference of 0.14 ( figure
3 ) .
the aim of the cochrane review18 was to evaluate the efficacy of pharmacological treatments for fatigue in palliative care , with a focus on patients at an advanced stage of disease , including patients with cancer and other chronic diseases .
we identified 45 studies for inclusion , with a wide range of underlying diseases and drug interventions .
treatment results pointed to weak and inconclusive evidence for the efficacy of amantadine , pemoline , and modafinil in multiple sclerosis and for carnitine and donepezil in cancerrelated fatigue .
metaanalysis shows an estimated superior effect for methylphenidate in cancerrelated fatigue , but not for modafinil in multiple sclerosis .
further studies about the efficacy and safety of potential medicines for fatigue treatment such as acetylsalicylic acid , mistletoe extract , megestrol acetate , and medroxyprogesterone acetate are needed .
many of the included studies involved only a small number of participants and did not follow a consistent research methodology . in some cases , the investigated population was very heterogeneous , and any outcome may have been associated with depression , making it difficult to distinguish from primary fatigue .
unfortunately , little evidence from randomized trials is available on the efficacy of these treatments . in clinical practice ,
the results of the literature search indicate that recent research interest focuses on modafinil , which seems a promising agent to diminish fatigue for palliative care patients .
there is insufficient evidence to support the use of a specific medicine to treat fatigue in palliative care patients . in this
regards , amantadine showed the promised benefit in patients with multiple sclerosis with fatigue and methylphenidate in patients with cancerrelated fatigue .
further trials are needed for several medicines , which were used in some studies with positive results such as dexamethasone , methylprednisolone , acetylsalicylic acid , armodafinil , amantadine , and lcarnitine . to enhance the interpretation and generalization of findings from relevant study populations ,
| abstractbackgroundin palliative care patients , fatigue can be severely debilitating and is often not counteracted with rest , thereby impacting daily activity and quality of life . further complicating issues are the multidimensionality , subjective nature and lack of a consensus definition of fatigue . the review aimed to evaluate the efficacy of pharmacological treatments for fatigue in palliative care , with a focus on patients at an advanced stage of disease , including patients with cancer and other chronic diseases.methodswe considered randomized controlled trials concerning adult palliative care with a focus on pharmacological treatment of fatigue compared with placebo , application of two drugs , usual care or a nonpharmacological intervention .
the primary outcome had to be nonspecific fatigue ( or related terms such as asthenia ) .
we searched the central , medline , psycinfo and embase , and a selection of cancer journals up to 28 april 2014 .
two review authors independently assessed trial quality and extracted the data.resultswe screened 1645 publications of which 45 met the inclusion criteria . in total , we analysed data from 18 drugs and 4696 participants
. there was a very high degree of statistical and clinical heterogeneity in the trials .
metaanalysis of data was possible for modafinil , pemoline , and methylphenidate.conclusionsdue to the limited evidence , we can not recommend a specific drug for the treatment of fatigue in palliative care patients .
some drugs , which may be beneficial for the treatment of fatigue associated with palliative care such as amantadine , methylphenidate , and modafinil , should be further researched . |
while there are many ambiguities in terms of explaining the behaviour of metastases , the theory of cell migration for the origin of metastases remains accepted today .
convincing evidence in favour of this is the cytological identity of the metastatic cells and the cancer cells in the primary tumour .
however , no evidence exists that explains the known uncertainties . with its focus on charting the genetic background of the origin of tumours and their more effective treatment ,
the easily understandable process of cell migration is favoured over processes that would help to explain the extremely complex events that have been observed , reflected in the broad panorama of knowledge of the genetic pathogenesis of malignant tumours .
while the current concept of the migration theory carefully describes certain pathophysiological actions in the metastasizing process , there are several aspects of the phases of the multifaceted course of the process that are unclear . in the parts of the process that have yet to be explained , we use a logical interpretation of certain phenomena that occur in the metastatic process , while we use assumptions to shed light on others .
the phenomenon of different cancer forms preferring to metastasize in certain organs , i.e. they show a pattern of priority , has still not been explained .
some authors assume that anatomo - circulatory conditions can play a role , as well as metabolic properties in the recipient organ , adhesion characteristics of the vascular endothelium , and the histogenic properties of the tumour .
the lymphogenic metastases also fail to comply with strict rules , and lymph nodes located relatively far from the primary tumour are often invaded by metastases an example is the so called virchow s metastases in stomach cancer .
as evidence for their origin is lacking , it is assumed that they are signs of haematogenous metastases via the ductus thoracicus
.
furthermore , it is not known why the spleen and the skeletal musculature are extremely infrequently affected by metastases . because of the many uncertainties in the process of metastasis , together with the mostly unsolved riddle of cancer , one is encouraged to look beyond the current theories .
it has been shown that cancer cells are found in the blood of cancer patients but , remarkably , only in 5% of these patients .
this is not surprising , but it is hardly sufficient as evidence for cell migration as the origin of metastases .
cancer cells are also found in pleural fluid and abdominal fluid , for example , although in these cases probably via an implantation mechanism .
before i arrived at the hypothesis presented below , i thought in particular about two phenomena ( see below ) that have to do with ambiguities in the origin of metastases and that are in violation of the concept of cell migration .
the two phenomena prompted me to consider other possible paths for the origin of metastases , namely at the subcellular level .
the microembolism phenomenon is clearly not a part of the clinical picture in most forms of cancer with an intravascular invasion into the venous system .
if the cancer cells have reached the lungs and been able to survive , metastases are formed , with resulting symptoms . the cancer cells may pass further into the pulmonary circulation via arteriovenous shunts , but it must be noted that these are open only under certain haemodynamic conditions .
from the perspective of biology and pathophysiological microcirculation , the clinician would expect to observe an episodic microembolism syndrome in lung cancer , as released cancer cells enter the arterial system ( see two well - known phenomena below ) .
one arrives at this reasoning by considering the relationship between the diameter of the capillaries ( from 410 m ) , the diameter of the arterioles ( less than 50 m ) , and the size of the cancer cells ( varying from 14 m to 4060 m , and in some cases up to 180 m ) . in addition
, it has been noted that cancer cells are bound to thrombocytes , lymphocytes , and other blood corpuscles , i.e. their joint diameter exceeds the diameter of the capillaries and in certain cases also that of the arterioles .
thus , with an incidence of cancer cells in the arterial blood that are of the size given above , a clinician would expect a microembolism syndrome of the type sporadically encountered in e.g. mitral valve prolapse and atrial fibrillation as well as in amaurosis fugax or cerebral microembolism phenomenon tia ( transitory ischemic attack ) .
in addition to the above , it is important to consider what we have learned in biology and respect the strict criteria in the biological system .
the sinusoids in the bone marrow release blood cells such as erythrocytes , leukocytes , monocytes , and thrombocytes to the circulatory system under normal conditions .
somewhat larger blood cells can sometimes occur in diseases such as leukaemia , such as myeloblasts ( 12 m 20 m ) , promyelocytes ( 15 m 24 m ) , and metamyelocytes ( 14 m 20 m ) .
however , larger blood cells such as megacariocytes ( 30 m 100 m ) , megacarioblasts ( > 30 m ) , and promegaloblasts ( 26 m 35 m ) are not released from bone marrow .
75 m 80 m ) in the case of lymphogranulomatosis released from the bone marrow or from lymph nodes .
there are two alternatives : either cancer cells are released from a lung tumour and in the clinical picture should belong to the microembolus phenomenon or , if cancer cells are not released , we must ask what pathway according to the cell migration theory metastases take from a lung cancer , for example to the vertebrae , pelvis etc . the concepts discussed above clearly lead to thoughts of a subcellular mechanism for the formation of metastases .
krukenberg metastases in the ovaries , which are characterized by so called signet ring cells that are abundant in mucin , occur in most cases of stomach cancer but can also originate from the colon , appendix , or breast .
these authors point out , " for some unclear reason , the usual type of gastro - intestinal cancer , which lacks signet ring cells , does not have anything like the same tendency to metastasize to the ovaries .
it was stated that the signet ring type of stomach cancer spreads to the ovaries in 41% of cases , whereas common stomach cancer does so in only 17% of cases " .
it was also claimed that , in the signet ring cancer form , both ovaries were involved in over 80% of cases .
these two facts show two separate metastasizing patterns to the ovaries by different cancer cells from cases of stomach cancer . as there is no clarity in this phenomenon ,
this then provokes the thought that , in the light of the cell migration theory for the origin of the metastases , there can not exist different migration rules so that signet ring cells from this type of stomach cancer metastasize to the ovaries in 41% of cases while cancer cells from an ordinary stomach cancer do so in only 17% of cases .
this is another phenomenon that clearly provokes consideration of a possible subcellular mechanism behind the origin of metastases .
all the facts in the two phenomena described above provoke a strong suspicion of the migration theory indeed offering the absolute truth ; at the same time , they are a challenge to search in other areas for the origin of metastases . over the years
, the literature has raised doubts about whether the origin of metastases actually depends on cell migration .
as early as 1993 , professor michael baum began to question whether metastases instead depend on a subcellular transfer with the help of a mechanism for in vivo transfection .
his new paradigm was prompted by the limited success of the established scientific methods for breast cancer treatment that were used for two decades .
professor baum issued a further report in 1995 and again in 1996 . in these recent reports
, he discusses the problem of breast cancer , stating that , although the apparent progress in diagnosis and treatment was often emphasized , only modest success in reducing mortality had been observed in the preceding 20 years .
he offers another conceptual revolution and repeats that it is probable that not all metastases are a cellular phenomenon .
he writes : " therapeutic interventions that may control rather than cure breast cancer using biological specific modalities rather than non - specific cytotoxic drugs could provide some of the answers . "
the microembolism phenomenon is clearly not a part of the clinical picture in most forms of cancer with an intravascular invasion into the venous system .
if the cancer cells have reached the lungs and been able to survive , metastases are formed , with resulting symptoms . the cancer cells may pass further into the pulmonary circulation via arteriovenous shunts , but it must be noted that these are open only under certain haemodynamic conditions .
from the perspective of biology and pathophysiological microcirculation , the clinician would expect to observe an episodic microembolism syndrome in lung cancer , as released cancer cells enter the arterial system ( see two well - known phenomena below ) .
one arrives at this reasoning by considering the relationship between the diameter of the capillaries ( from 410 m ) , the diameter of the arterioles ( less than 50 m ) , and the size of the cancer cells ( varying from 14 m to 4060 m , and in some cases up to 180 m ) . in addition , it has been noted that cancer cells are bound to thrombocytes , lymphocytes , and other blood corpuscles , i.e. their joint diameter exceeds the diameter of the capillaries and in certain cases also that of the arterioles .
thus , with an incidence of cancer cells in the arterial blood that are of the size given above , a clinician would expect a microembolism syndrome of the type sporadically encountered in e.g. mitral valve prolapse and atrial fibrillation as well as in amaurosis fugax or cerebral microembolism phenomenon tia ( transitory ischemic attack ) .
in addition to the above , it is important to consider what we have learned in biology and respect the strict criteria in the biological system .
the sinusoids in the bone marrow release blood cells such as erythrocytes , leukocytes , monocytes , and thrombocytes to the circulatory system under normal conditions .
somewhat larger blood cells can sometimes occur in diseases such as leukaemia , such as myeloblasts ( 12 m 20 m ) , promyelocytes ( 15 m 24 m ) , and metamyelocytes ( 14 m 20 m ) . however , larger blood cells such as megacariocytes ( 30 m 100 m ) , megacarioblasts ( > 30 m ) , and promegaloblasts ( 26 m 35 m ) are not released from bone marrow .
neither are sternberg cells ( 30 m 75 m 80 m ) in the case of lymphogranulomatosis released from the bone marrow or from lymph nodes .
there are two alternatives : either cancer cells are released from a lung tumour and in the clinical picture should belong to the microembolus phenomenon or , if cancer cells are not released , we must ask what pathway according to the cell migration theory metastases take from a lung cancer , for example to the vertebrae , pelvis etc .
the concepts discussed above clearly lead to thoughts of a subcellular mechanism for the formation of metastases .
krukenberg metastases in the ovaries , which are characterized by so called signet ring cells that are abundant in mucin , occur in most cases of stomach cancer but can also originate from the colon , appendix , or breast .
these authors point out , " for some unclear reason , the usual type of gastro - intestinal cancer , which lacks signet ring cells , does not have anything like the same tendency to metastasize to the ovaries .
it was stated that the signet ring type of stomach cancer spreads to the ovaries in 41% of cases , whereas common stomach cancer does so in only 17% of cases " .
it was also claimed that , in the signet ring cancer form , both ovaries were involved in over 80% of cases .
these two facts show two separate metastasizing patterns to the ovaries by different cancer cells from cases of stomach cancer . as there is no clarity in this phenomenon ,
this then provokes the thought that , in the light of the cell migration theory for the origin of the metastases , there can not exist different migration rules so that signet ring cells from this type of stomach cancer metastasize to the ovaries in 41% of cases while cancer cells from an ordinary stomach cancer do so in only 17% of cases .
this is another phenomenon that clearly provokes consideration of a possible subcellular mechanism behind the origin of metastases .
all the facts in the two phenomena described above provoke a strong suspicion of the migration theory indeed offering the absolute truth ; at the same time , they are a challenge to search in other areas for the origin of metastases . over the years
, the literature has raised doubts about whether the origin of metastases actually depends on cell migration .
as early as 1993 , professor michael baum began to question whether metastases instead depend on a subcellular transfer with the help of a mechanism for in vivo transfection .
his new paradigm was prompted by the limited success of the established scientific methods for breast cancer treatment that were used for two decades .
professor baum issued a further report in 1995 and again in 1996 . in these recent reports
, he discusses the problem of breast cancer , stating that , although the apparent progress in diagnosis and treatment was often emphasized , only modest success in reducing mortality had been observed in the preceding 20 years .
he offers another conceptual revolution and repeats that it is probable that not all metastases are a cellular phenomenon .
he writes : " therapeutic interventions that may control rather than cure breast cancer using biological specific modalities rather than non - specific cytotoxic drugs could provide some of the answers . "
the lack of the microembolus phenomenon in the clinical picture of lung cancer and krukenberg metastases in stomach cancer , which can not be explained by the theory of cell migration , were the basis for considering subcellular agents as the origin of metastases .
the concept of the subcellular level is particularly associated with the first phenomenon , which must obey the strict biological rules for limits for the size of cells in the arterial system .
the reasoning in the hypothesis is that the subcellular substrate is gene transformation in a primary tumour , i.e. that cancer genes are transferred to recipient cells .
this cancer gene transferral must , however , take place via some transport mechanism , and the hypothesis points to what is known from medical practice , the so called virus - vector function .
it is important to remember that the goal of the virus is to survive in infected , active cells .
further , cancer itself has a cancer - related inflammatory component . in this case , the cancer cells in a primary tumour are in an excellent environment for this purpose ; they can multiply in a primary tumour and , with their capacity to steal genomes , the hypothesis proposes that they participate in the metastasis process as vector bearers .
humans already use viruses as vectors but it should not be neglected that humans do nothing that nature has not done before ! here we can consider viruses of different kinds , such as many of the human retro , adeno , herpes viruses and human papillomavirus ( hpv ) . to develop metastases in recipient cells , these cells must have a regenerative potential .
examples include stem cells , multipotent cells , or cells in an early phase of division which , in incorporating gene material , further develop in these different cell types .
moreover , such cells are found in the favourite locations for metastases , namely bone marrow , vertebrae , lymph nodes , liver , lungs , ovaries etc .
, the change in the cancer cell that lodges in e.g. a stem cell must be replicated in the subsequent stem cell division , with its malignant character , and form a metastasis .
the stem cell thus develops to become a tumour cell that is a copy of the primary tumour s cell .
it must carry all the characteristics of the primary tumour s cells and have a continuous , uninhibited cell division as a result of a strong interaction between oncogenes and tumour suppressor genes , which genetics has demonstrated .
the tumour suppressor genes will probably be of the same kind and have the same inactivation competence as in the primary tumour because they have specific tissue effects .
two background concepts can be perceived through the unpredictable biological phenomenon in krukenberg metastases described above : selection and/or attraction .
the hypothesis also offers other perspectives , including whether the occurrence of signet ring cancer in the stomach may be caused by viruses that have gastric mucosa cells as a goal , similar to hpv in genital cancer . of these ,
hpv is also more prolific more than 15 variants are known and they show clear tropism to the genitalia .
stina syrjnan writes : " the probable goal of the papilloma virus infection is the basal cells of squamous cell tissue . hpv exploits the receptors on the surface of the target cell to infect the cell .
two primary alternatives in the hypothesis are whether the origin of stomach signet ring cell cancer can have any viral mechanism of origin , as in genital cancer , or whether a virus has found its means of replication in an already developed signet ring cancer and been infected with an oncogenic genome . however , as the infection travels further and is directed especially to the ovaries to build metastases there , there is a third alternative : that krukenberg metastases are possibly also directed by specific receptors in the cells of the ovaries to cells that can be used by the virus - vector bearers with a cancer - transformed gene in them in order to replicate themselves .
consequently , in the case of the origin of krukenberg metastases , it should also be suspected in the virus - vector explanatory mechanism that there is some participation of specific receptors , as in the case of hpv .
such reasoning can also support the well - known but still unclear phenomenon that certain cancer forms give metastases in specific organs .
krukenberg metastases should be a challenge to science . with the constellation of concepts in the hypothesis
, it would appear more credible to seek an explanation for the origin of metastases in remote , non - regional lymph nodes via the virus - vector function .
however , metastases in regional lymph nodes would also according to the hypothesis have the same path of origin .
it has been reported that , when metastases occur in the lymph nodes , the cancer cells are seen first in the cortical zone of the nodes .
the explanation offered for this is that the afferent lymph nodes exit peripherally via the capsule and that the incoming cancer cells would lodge there first .
i would like to emphasize , however , that this phenomenon does not conflict with my hypothesis : quite the opposite , it can support this theory owing to the fact that the follicles , whose central section consists of cells in the division phase , are also found in the cortical zone of the nodes .
it is not surprising that there are cases of breast cancer and an occurrence of metastases in the regional lymph nodes , especially as the distance to the regional lymph nodes is so small , and can be considered as an almost prime example of the migration theory .
however , it is not clear what mechanisms exist allow migration to the axillary lymph nodes .
three driving components exist in this mechanism for the migration of cancer cells to the regional lymph nodes in this cancer form : a ) the cohesion between the cancer cells in the tumour , b ) the pressure in the lymph node , and c ) the lymph flow rate .
primarily glycoproteins , but also several other factors , have been discovered to maintain adhesion between cells in all the organs of the body to the extent that no cell can liberate itself during its lifetime .
, there is extremely low pressure in the lymph capillary in the surrounding healthy tissue .
lymph fluid enters the lymph capillary system vis a tergo , and the flow speed is very low .
thus , no dynamic force exists in lymph flow that allows it to contribute to loosening and taking along cancer cells for migration .
if this nevertheless does take place , i.e. cancer cells do follow the lymph flow , then we must accept that the breast cancer cells are completely loose without reasonably competent adhesion components , which can not be the case .
thus the involvement of two components of the above named triad flow rate and pressure has no decisive function and lacks sufficient dynamic effect in the context , and the third ( the necessary action of adhesion ) is not involved .
there is thus a constellation of physiological facts that complicates the acceptance that , in the case of breast cancer as well , the metastases in the axillae nodes are there simply via the cell migration theory .
there further appears a factor that is of interest and that is not in lymphodynamic harmony , namely : a histopathological fact ( mentioned above ) that , in the building of breast cancer metastases in axillae lymph nodes , the cancer cells lodge first in their cortical zone .
why do they lodge there instead of following the easier flow into the large lymphatic labyrinths and sinuses of the glands as would logically be expected ?
it should be observed that the cancer cells lodge first in the lymph nodes cortical zone , where the follicles exist , and there are large numbers of cells in an early phase of division .
this again supports the reasoning in the hypothesis that there is possibly a genetic pathway for the origin of metastases , also in the case of the regional lymph nodes in breast cancer : that viruses carrying a cancer - transformed gene from the primary tumour exploit replicating themselves in the cells of the follicles in an early phase of division that have a regenerative potential .
in addition , they can occur long after the discovery of the primary tumour , sometimes many years after .
viruses also have life cycles , and it is known that some of them can become dormant in some organs .
the fact that metastases seldom occur in the spleen can be due to characteristics of viruses .
it is known that antibodies to antigens are manufactured in the white pulp of the spleen .
a ) normal cell , b ) cancer cell , c ) cancer cell with cancer - related inflammation element , d ) virus attracted into the cancer cell , e ) virus incorporates a cancer gene in a stem cell , f ) stem cell is transformed into a cancer cell , m - m ) metastatic cells .
there are a great many metastatic phenomena that can not in any way be explained by cell migration , either by any haemodynamic or physiologic mechanism .
two such phenomena are presented in the article : the lack of the microembolus phenomenon in the clinical picture of lung cancer and krukenberg metastases in stomach cancer .
they were also a basis for the present hypothesis , namely that the origin of metastases would take place on a subcellular level .
the teachings of biology , with the strict rule that cells that exist in the arterial blood must be of a certain limited size , is evidence for the first phenomenon that supports the subcellular concept for the origin of metastases .
migration of cancer cells from lung cancer that come into the arterial blood and whose size far exceeds the biological limitations should cause the microembolus phenomenon , which is lacking in the clinical picture of that form of cancer . in the case of the peculiar phenomenon of krukenberg metastases , which can absolutely not be explained by cell migration or by any physiological or haemodynamic mechanism ,
the reasoning in the hypothesis is that there would almost be a transfer of subcellular substrate in their origin as well . as such
, the hypothesis discusses transfer of a cancer - transformed gene , namely substrate , that differentiates the cancer cell from a normal cell .
as regards the transport mechanism , the hypothesis calls upon something that is known in medical practice , the so called virus - vector function , that is , a virus of some type carries out this cancer gene transfer .
the specific aspect of the reasoning in the hypothesis is that this cancer - transformed gene is incorporated in stem cells , omnipotent cells and multipotent cells , and cells in an early phase of division , which are transformed into cancer cells and in each special case of gene type become identical to that which exists in the primary cancer . finally , a supporting fact in the reasoning in the hypothesis is that the places in which the above named immature - regenerative cells exist are favourites of metastases : bone marrow , lymph nodes , liver , ovaries etc .
however , consideration must be given to the occurrence of some metastases via the transplantation mechanism .
the subcellular concept for the origin of metastases in this hypothesis should be a challenge to research .
as long as there are ambiguities in the origin of metastases , new research steps should be taken to find a way to break the path for the building of metastases and open new paths for treatment .
hopefully in the spirit of these new ideas , there will be a development of safer antiviral agents to be used for early discovery of a malignancy , safer vaccines and vaccination programs , probably primarily against virus forms in a dormant state in the human body . | abstracta new hypothesis for the origin of metastases is presented .
it assumes that a cancer - transformed gene in a primary tumour is incorporated in its identical form via a virus - vector function into biologically potent recipient cells in other organs , such as stem cells , multipotent cells or cells in an early phase of division .
the origin of metastases may thus possibly occur via a genetic pathway . |
the major mechanisms that have been recognized to contribute to the anemia of uremia are increased destruction and decreased production of red blood cells .
radioactive iron turnover studies have been done in uremic patients to measure erythropoietic activity or to investigate the effect of hemodialysis on iron metabolism .
plasma iron turnover was normal or increased or decreased . despite reports of improvement in iron metabolism and decrease in inhibitor of erythropoiesis in some patients on hemodialysis , anemia continues to be a problem in most patients on hemodialysis . in many patients on continuous ambulatory peritoneal dialysis ( capd )
furthermore , many patients previously treated with hemodialysis show an increase in hematocrit while on capd .
a rise in the hematocrit was accompanied by an increase in red cell mass , thus a true improvement of anemia or by an increase in serum erythropoietin level .
we performed ferrokinetic studies in patients on capd to measure erythropoietic activity and to investigate the effect of capd on iron metabolism in these patients .
erythropoiesis was less than adequate for the degree of anemia in capd patients and in uremic patients not yet on dialysis and a significant reduction in plasma volume ( to normal value ) was observed in capd patients with higher hematocrit values .
studies were performed on 11 patients who had been on capd for at least 3 months : 7 patients with hematocrit 30% or above ( capd i ) , and 4 with hematocrit below 30% ( capd ii ) , 6 patients with uremia not yet on dialysis ( uremia ) , 6 patients with iron deficiency anemia ( ida ) and normal renal function and 5 healthy volunteers ( normal ) .
a blood sample was obtained in the morning on the first day of ferrokinetic studies for the usual hematologic parameters .
serum iron and total iron binding capacity were measured by colorimetric method using fe b test kit and supplementary reagent kit ( wako ) .
ferrokinetic studies used fe - citrate ( amersham , u.k . , 100 ci / ml ) and were done by techniques described by huff et al . and finch et al .
blood samples were withdrawn into syringes containing acid citrate dextrose and plasma was separated . to 8 ml of plasma , 20 ci of fe - citrate was added and allowed to stand at room temperature for 30 minutes , and exactly 5ml of this was reinjected intravenously .
blood samples were obtained at 15 , 30 , 45 , 60 , 120 and 180 minutes after reinjection and plasma was separated .
the radioactivity of plasma samples and standard were counted in a well type scintillation counter ( picker spectroscaler 4 ) for 10 minutes and the plasma radioactivity data were plotted on semilogarithmic paper .
plasma volume ( pv ) was determined from the initial dilution of injected radioactive iron by extrapolation of the disappearance slope of the iron in plasma to zero time :
pv(ml)=fe59 cpm / ml of standard injected volume mlfe59 cpm / ml of plasma at time zerototal blood volume ( tbv ) and red cell volume ( rcv ) were derived from this pv and hematocrit ( hct ) of the first day s sample :
tbv(ml)=pv 100100hct0.91
rcv(ml)=tbvpv plasma iron turnover ( pit ) was calculated from the serum iron concentration and the initial rate of disappearance of radioiron(pid ) :
pit(mg / kg / day)=serum iron mg / mlpv ml0.6931440 minpid min weight kg the initial slope of pid was determined from the individual radioactivity points drawn on semilog paper , and the half - time was expressed in minutes .
whole blood samples were then obtained in 1 , 3 , 5 , 7 , 9 and 15 days after reinjection of the fe - labelled plasma and was stored at room temperature until the last day when the radioactivity of whole blood samples and the standard was counted .
red cell iron utilization ( rciu ) was calculated by comparing the whole blood activity with the radioactivity injected :
rciu(%)=fe59 cpm / ml of whole blood tbv ml 100fe59 cpm / ml of standard injected volume ml red cell iron turnover ( rcit ) was calculated from pit and rciu :
rcit(mg / kg / day)=pit mg / kg / dayrciu % 100 marrow transit time ( mtt ) was derived from the rciu(% ) subtracted form 100 plotted on semilog paper as the time interval ( days ) required for release of 50% of the radioiron measured in circulation .
statistical analysis : unpaired t - test , two tailed , was used to compare the differences between groups .
serum iron and total iron binding capaity ( tibc ) are shown in table 2 . serum iron was significantly reduced and tibc significantly increased in the iron deficiency anemia group when compared to other groups .
there were no differences in serum iron and tibc among normal control , uremia and capd groups i and ii .
serum ferritin was low in iron deficiency anemia and elevated in uremia and capd groups as shown in table 3 .
plasma volume , as shown in table 4 , was significantly larger in uremia ( 53.3 8.3 ml / kg ) and capd group ii ( 57.7 6.4 ml / kg ) than in normal control ( 39.7 4.2 ml / kg ) and capd group i ( 40.1 7.6 ml / kg ) .
there was no difference in plasma volume between normal control and capd group i. red cell volume ( table 4 ) was significantly smaller in ida , uremia and capd groups i and ii than in normal control .
capd group i had slightly larger red cell volume than in uremia and capd group ii but the difference did not reach statistical significance .
plasma iron disappearance rate ( pid ) and plasma iron turnover rate ( pit ) are shown in table 5 and rate of disappearance of injected fe during the first 60 minutes is shown in fig .
pid was significantly faster in ida ( 28.5 9.3 min ) than in the rest of the groups .
pit was significantly faster in ida than in capd groups i and ii . there were no differences in both pid and pit among normal control , uremia and capd groups i and ii .
red cell iron utilization ( rciu ) and red cell iron turnover rate ( rcit ) 15 days after injection of fe are shown in table 6 and percent incorporation of fe into circulating erythrocytes from 1 to 15 days after injection of fe is shown in fig .
rciu was significantly higher in ida ( 104.1 14.6% ) than in normal control ( 84.4 3.8% ) .
rcit was significantly higher in ida ( 0.80 0.27 mg / kg / day ) than in normal control ( 0.35 0.12 ) , uremia ( 0.25 0.11 ) and capd group ii ( 0.330.07 ) .
marrow transit time ( mit ) is shown in table 7 and was significantly shorter in ida ( 3.1 days ) than in normal control ( 4.0 days ) and uremia ( 4.0 days ) .
no differences were observed among normal control , uremia and capd groups i ( 3.9 days ) and ii ( 3.8 days ) .
a substantial increase in hematocrit is commonly observed in uremic patients early after they go on capd and , in some , the hematocrit values reach normal range .
de paepe et al . observed that the early rise of hematocrit in capd patients was due to a combination of an increase in red cell mass , thus a true improvement of anemia and a decrease in plasma volume .
reported that serum erythropoietin level was higher in patients with normalized hematocrit than in patients with persistently low hematocrit . since uremic toxins were shown to have no inhibitory effect on erythropoietin production by kidneys previously exposed to hypoxia , capd probably had no role in increased production of erythropoietin by diseased kidneys .
it is more likely that those patients who normalized their hematocrit values on capd had higher erythropoietin level to begin with since 3 of zap - pacosta s 4 patients had polycystic kidney disease .
recent studies suggest that retained inhibitors or toxic metabolites in uremic serum may be the primary factor responsible for the anemia of chronic renal failure by more directly inhibiting erythroid progenitor cell formation .
the increase in hematocrit associated with decrease in inhibitor levels during long - term hemodialysis suggest that inhibitory substances may be more efficiently removed by capd if these substances were in the middle molecular range since clearance of some middle molecular substances is 6 times greater with capd than with hemodialysis .
observed doubling of red cell iron turnover in 5 patients on hemodialysis for 1035 months .
increased red cell production was observed in 4 patients . a sharp increase in plasma iron turnover
reported improvement in ferrokinetics and effective erythropoiesis after a single hemodialysis in all 6 patients .
this study was conducted to evaluate erythropoietic activity in capd patients and to gain insight into the mechanisms by which the hematocrit increases in capd patients .
plasma iron disappearance rate , plasma iron turnover rate , red cell iron utilization rate , red cell iron turnover rate and marrow transit time were all normal in uremic patients not yet on dialysis , capd patients with persistently low hematocrit ( less than 30% ) and capd patients with improved hematocrit ( 30% or above ) . despite
values , total and effective erythropoiesis in the 3 uremic groups are still less than adequate for the degree of anemia since the group with iron deficiency anemia and normal renal function showed significantly more active erythropoiesis under the same study condition .
a significant reduction in plasma volume ( to normal range ) was observed in capd patients with hematocrit at or above 30% when compared with uremic patients not yet on dialysis and capd patients with hematocrit below 30% .
red cell volume was slightly larger in capd patients with higher hematocrit than in uremia patients not on dialysis and capd patients with persistently low hematocrit but the difference was not significant .
ferrokinetic data in this study are valid since normal control data are in good agreement with previous reports in the literature and those of patients with iron deficiency anemia and normal renal function are entirely appropriate with rapid plasma iron disappearance and marrow transit time and increased red cell iron utilization and red cell iron turnover .
concomittent iron deficiency may explain normal iron kinetics in uremia and capd patients .
the results of this study suggest that erythropoiesis is inadequate for the degree of anemia in capd patients as well as uremic patients not on dialysis and further suggest that the hematocrit increases in capd not so much as a result of improved erythropoiesis but , in large part , due to decrease in plasma volume . | ferrokinetic studies were performed with 59fe - citrate to evaluate erythropoietic activity in capd patients and to investigate the mechanism(s ) by which the hematocrit increases in capd patients . plasma iron disappearance rate ( pid ) , plasma iron turnover rate ( pit ) , red cell iron utilization ( rciu ) , red cell iron turnover rate ( rcit ) and marrow transit time ( mtt ) were all normal in uremic patients not yet on dialysis ( hct 23.83.4% ) , capd patients with persistently low hematocrit ( hct 24.91.8% ) and capd patients with improved hematocrit ( hct 32.43.1% ) . compared to these uremic patients , patients with iron deficiency anemia and normal renal function ( hct 28.05.1 % ) had significantly faster pid and mtt and significantly higher rciu and rcit .
plasma volume was significantly reduced ( to normal level ) in capd patients with improved hematocrits.the results of this study suggest that erythropoietic activity is inadequate for the degree of anemia in capd patients as well as uremic patients not on dialysis and further suggest that the hematocrit increases in capd as a result of decreased plasma volume . |
the aberrant anatomy has been reported in up to 17% of cases with bile duct injury .
one such rare anomaly is congenital absence of the common bile duct ( cbd ) . in our case ,
the cbd was absent and the common hepatic duct ( chd ) was opening into the gallbladder ( gb ) through which bile was draining into the duodenum through the cystic duct ( cd ) .
a 36-year - old lady was presented to us with symptoms of abdominal pain ; ultrasonography ( usg ) of the upper abdomen suggested cholelithiasis and the cbd was reported as normal .
dissection was performed posterior to the cd and the cbd could not be seen in the porta . in view of the unclear structural anatomy , we started mobilizing the gb by fundus - first method . during dissection ,
laparoscopic surgery was terminated and converted to open , and it was found that a duct was opening into the gb wall through the bed and no cbd was present .
intraoperative cholangiogram was performed through the ductal opening in the gb fossa that revealed both right and left biliary ductal systems ; the anomaly was confirmed as congenital absence of the cbd , with bile draining into the gb through the chd and gb draining into the duodenum by the cd .
cholecystectomy was performed and roux - en - y hepaticojejunostomy ( hj ) was performed with chd [ figure 1 ] .
postoperative course of the patient was uneventful , and she was discharged on the 4 postoperative day .
congenital absence of the cbd is a rare anomaly of the extrahepatic biliary tract with right and left biliary radicals directly opening into the gb . in this situation ,
cd is the sole pathway for the biliary drainage . the possible explanation for this condition could be the presence of persistent connections between the foetal hepatic ducts and the gb with failure of complete recanalization of the extrahepatic biliary tract .
variants of interposition of the gallbladder the differential diagnosis for this clinical condition could be mirizzi 's syndrome type iii / iv and choledochal cyst .
mirizzi 's syndrome can be distinguished by the presence of signs of inflammation in the calot 's and the presence of large impacted stone in the gb neck .
awareness of this anomaly and performing cholangiogram at the slightest suspicion are the possible intraoperative methods of the diagnosis .
if detected intraoperatively , gb resection with roux - en - y hj ( most preferred ) , partial cholecystectomy with closure of residual gb over t - tube ( cholecysto - choledochoplasty ) or end - to - end chd
cholecysto - choledochoplasty could be a preferred option in type iii b but there is always a risk of recurrent stone formation in the residual gb leading to biliary obstruction and end - to - end chd
if the diagnosis is known preoperatively , cholecystojejunostomy can be a possible option as well .
| congenital absence of the common bile duct ( cbd ) is an extremely rare developmental anomaly with right and left hepatic ducts draining directly into the gallbladder ( gb ) .
other synonyms for this clinical condition are cholecystohepatic ducts , transverse lie of the gb or
interposition of the gb .
the potential for iatrogenic injury is high , because of either inadvertent division or ligation of the ducts .
diagnosis is mostly made intraoperatively , and needs some form of biliary reconstruction .
herein , we are reporting a case of congenital absence of the cbd in a 36-year - old lady that was detected intraoperatively . |
we used data for june 2004may 2014 from a sentinel laboratory surveillance system , as described ( 2 ) .
cumulative incidence ratios ( cirs ) with 95% cis were calculated for comparisons of pre - pcv7 ( june 2004may 2006 ) , pre - pcv10 ( june 2009may 2011 ) , early post - pcv10 ( june 2011may 2013 ) and 3-year post - pcv10 ( june 2013may 2014 ) periods .
we discerned ipd caused by pcv7 ( 4 , 6b , 9v , 14 , 18c , 19f , 23f ) , non - pcv7 , pcv107 ( present in pcv10 but not pcv7 ; 1 , 5 , 7f ) , non - pcv10 , and pcv10-related ( 6a , 6c , 6d , 7a , 7b , 7c , 9a , 9l , 9n , 18a , 18b , 18f , 19a , 19b , 19c , 23a , 23b ) serotypes .
we used nationwide laboratory surveillance data for children < 5 years of age available from 2006 to compare ipd incidence rates for a pcv7-eligible cohort ( children born march 2008feb 2011 , > 3 months of age , and given a diagnosis of ipd before june 2011 ) and a pcv10-eligible cohort ( children born march 2011feb 2014 , > 3 months of age , and given a diagnosis of ipd before june 2014 ) .
differences between irrs were tested by calculating p values for interaction between birth cohort and serotype ; the irr for serotypes not related to pcv10 was used as reference .
a total of 6,292 ipd cases were included in sentinel surveillance during june 2004may 2014 . by 20092011 ,
overall ipd incidence had decreased by 57% for children < 2 years of age , 47% for children 24 years of age , and 22% for persons > 65 years of age ( figure 1 ; table 1 ) .
pcv7 ipd incidence decreased for all age groups , and the decrease continued and showed an overall reduction of 90% by 20132014 ( figure 2 , panel a ) .
non - pcv7 ipd incidence increased by 38% for all age groups from 20042006 to 20092011 ( figure 2 , panel b ; table 1 ) . age - specific incidence of invasive pneumococcal disease caused by any serotype of streptococcus pneumoniae per epidemiologic year ( june may ) , the netherlands .
vertical dashed lines indicate introduction of 7-valent pneumococcal conjugate vaccine in june 2006 and 10-valent pneumococcal conjugate vaccine in may 2011 .
* pcv7 , 7-valent pneumococcal conjugate vaccine ; pcv107 , serotypes present in pcv10 but not pcv7 ( 3 additional serotypes ) ; pcv10 , 10-valent pneumococcal conjugate vaccine ; cir , cumulative incidence ratio ; nc , not calculated ( numbers too low to be informative or relevant ) .
age - specific incidence of invasive pneumococcal disease caused by different streptococcus pneumoniae serotypes per epidemiologic year ( june may ) , the netherlands .
a ) 7-valent pneumococcal conjugate vaccine ( pcv7 ) serotypes ; b ) non - pcv7 serotypes ; c ) pcv107 pneumococcal conjugate vaccine serotypes , d ) non - pcv10 serotypes ; and e ) serotype 19a .
vertical dashed lines indicate introduction of pcv7 in june 2006 and pcv10 in may 2011 .
overall pcv107 ipd incidence increased slightly after pcv7 introduction ( cir 1.21 , 95% ci 1.021.43 ) ( figure 2 panel c ; table 1 ) .
for children < 2 years of age , pcv107 ipd incidence decreased 2 years after the switch to pcv10 , although not significantly , because of a low number of cases ( cir 0.51 , 95% ci 0.132.02 ) . in the third year
( 20132014 ) after pcv10 introduction , no ipd cases were caused by serotypes 1 , 5 , and 7f in children < 2 years of age .
for other age groups , pcv107 ipd incidence did not change in the 2 years after pcv10 introduction , but in the third year , incidence decreased by 42% and 47% for persons 1849 years of age and 5064 years of age , respectively ; a 25% decrease was observed for persons > 65 years of age ( figure 2 panel c ; table 1 ) .
non - pcv10 ipd incidence increased for most age groups in the 2 years after pcv10 introduction ( overall cir 1.25 , 95% ci 1.131.38 ) but did not increase further in 20132014 ( figure 2 , panel d ; table 1 ) , partly because of a decrease in 19a ipd ( figure 2 , panel e ; table 1 ) .
the ipd incidence rate for the pcv10-eligible cohort was lower than that for the pcv7-eligible cohort for pcv107 serotypes ( irr 0.04 , 95% ci 0.010.27 ) , pcv7-related serotypes ( irr 0.38 , 95% ci 0.190.77 ) , and non - pcv10 serotypes ( irr 0.67 , 95% ci 0.460.99 ) ( table 2 ) .
the decrease in pcv107 ipd was greater than that for non - pcv10 serotypes ( pinteraction = 0.005 )
. however , irrs for pcv10-related ipd and specifically serotype 19a were not different from the irr for pcv10-unrelated ipd ( pinteraction = 0.229/0.165 ) .
* ipd , invasive pneumococcal disease ; pcv7 , 7-valent pneumococcal conjugate vaccine ; pcv107 , serotypes present in pcv10 but not pcv7 ( 3 additional serotypes ) ; pcv10 , 10-valent pneumococcal conjugate vaccine ; irr , incidence rate ratio ; na , not applicable ; nc , not calculated ( numbers too low to be informative or relevant ) .
we observed a decrease in pcv7-type ipd > 8 years after pcv7 introduction for all age groups .
however , this decrease was lessened by an increase in non vaccine - type ipd , a finding similar to that reported in other countries ( 6,7 ) .
there was an overall 80% decrease in ipd incidence for children < 5 years of age and a 25% decrease for persons > 65 years of age .
pcv10 introduction caused a decrease in pcv107 ipd incidence in pcv10-eligible children , providing evidence for a direct effect from pcv10 .
potential cross - protection of pcv10 against serotype 19a , as corroborated by a case control study showing 82% effectiveness against 19a ipd ( 5 ) , is still debated . in our study , the incidence rate for 19a ipd was lower in the pcv10-eligible cohort than the pcv7-eligible cohort , but the decrease in 19a ipd was not different from the decrease in pcv10-unrelated ipd , which precludes drawing conclusions about cross - protection against 19a ipd .
in addition , 19a carriage had already decreased in toddlers before pcv10 introduction ( 8) .
pcv10 ipd in the pcv10-eligible cohort but have no indication that surveillance sensitivity changed over time .
the decrease might be caused by natural fluctuations or different viral seasons ( 9 ) .
a study in canada reported lower incidence rates for 19a ipd and other non vaccine - type ipd in a pcv10-eligible cohort ( 4 ) .
it was hypothesized that lower antibody levels induced by pcv10 ( 10,11 ) might lead to smaller disturbances of the nasopharyngeal niche and replacement by new serotypes against which there is no immunity , which might result in a lower incidence of non - pcv10 ipd .
however , a randomized controlled trial showed similar carriage rates for non - pcv10 serotypes , including 19a , for infants vaccinated with pcv7 and those vaccinated with pcv10 ( 12 ) . in the third year after pcv10 introduction , pcv107 ipd incidence also decreased in nonvaccinated age groups , which might indicate herd effects .
non - pcv10 ipd incidence did not increase in the second and third years after pcv10 introduction , which was partially caused by a reduction in 19a ipd .
longer follow - up times are needed to distinguish whether these observations were caused by cross - protection against 19a in children through herd effects of pcv10 , reduced nonvaccine serotype replacement by pcv10 , or temporal fluctuations .
we used data from a stable surveillance system with constant coverage over time ; age and serotype data were nearly complete ( 99.9% ) .
also , we have limited data on ipd before pcv7 introduction and after the switch to pcv10 . in conclusion ,
stabilization of non - pcv10 ipd in the second and third years after pcv10 introduction might indicate reduced serotype replacement by pcv10 or cross - protection against 19a .
however , we can not make firm conclusions on cross - protection of pcv10 against serotype 19a .
continued surveillance of serotype - specific ipd is crucial for evaluating long - term effects of pneumococcal conjugate vaccines in human populations . | three years after a 7-valent pneumococcal conjugate vaccine was replaced by a 10-valent pneumococcal conjugate vaccine in the netherlands , we observed a decrease in incidence of invasive pneumococcal disease caused by streptococcus pneumoniae serotypes 1 , 5 , and 7f . our data do not support or exclude cross - protection against serotype 19a . |
the haller index ranged from 2.6 to 13 , with a median value of 5.0 .
all patients received oral benzodiazepines ( lorazepam 0.02 - 0.1 mg / kg / dose ) the night before the surgery .
the mean duration of anaesthesia was 2.9 hours ( 2.3 - 3.2 ) and the time for surgery ranged between 1 to 3 hours , with a median duration of 1.1 hours .
ea was activated with 0.375% levobupivacaine and a clonidine 1 - 2 ug / kg injection , and as per protocol , continuous epidural infusion of fentanyl 0.2 - 0.4 ug / kg / h in 0.1% levobupivacaine associated with intravenous paracetamol 15 - 20 mg / kg / dose was administered at the end of the operation . during ea , 23 patients ( 38% ) experienced side effects as reported in the table ( table 1 ) . the epidural catheter was kept in place for 74 hours ( 72 - 96 ) .
malfunctioning , which required catheter removal , was presented in 5 patients ( 8% ) due to obstruction .
additional drugs ( ketorolac , morphine , tramadol ) were administered when necessary ( nrs > 4 ) .
after ea suspension , patients received both slow release oral oxycodone ( starting with 10 mg twice / day then reduced to 5 mg once / day ) and oral paracetamol ( 15 - 20 mg / kg / dose ) .
drugs that were the same ( ketorolac , morphine , tramadol ) were administered when required ( nrs > 4 ) . during this period ,
43 patients ( 72% ) required additional analgesics , mostly during the critical change over phase from the ea to the oral analgesia regimen .
patients were discharged with oral therapy if required ( paracetamol 500 mg and codeine phosphate 30 mg ) .
the daily pain score assessments , via nrs , demonstrated that pain increased since the operative day with a maximum being reached in the first postoperative day ( fig .
the following postoperative days , the pain score decreased progressively , reaching an nrs below 4 after the fourth postoperative day ( fig .
both gender and age seemed to have a significant overall impact on the mean pain experienced : p = 0.0417 and p = 0.0199 , respectively ( fig .
2 ) . pectus severity did not correlate with the pain level though ( p > 0.05 - data not shown ) . during hospitalization
, additional oral benzodiazepines were administered in 19 patients when highlighted with an anxiety condition ( 32% ) .
cumulative oral opiates dose was 97.5 mg ( 20 - 270 ) . patients who consumed benzodiazepines had a significant decrease in postoperative oral oxycodone intake in comparison to those who had just oral analgesia , which were administered respectively at 90 mg and 109 mg in dosage ( p = 0.0408 ) ( fig .
comparative groups were established based on , age ( patients > 16 years - old and patients 16 years - old ) , gender ( male and female ) , and eventually on anxiety management ( administration of benzodiazepines and no benzodiazepines in association with oxycodone ) .
groups were compared by means of the student t - test for unpaired values and anova .
in this study , we provided the description of the entire management process of postoperative pain at our institution for a consecutive group of patients submitted for mirpe .
we evaluated the patients from the moment the epidural catheter was inserted , while following the critical transitional period between epidural and oral analgesia , concluding with the complete oral pain medication regimen until discharge .
moreover , we analyzed the influence of benzodiazepines on the cumulative opioid intake after surgery .
pain is undoubtedly a dominant factor that determines the quality of the postoperative course of patients with pectus bar placement . by abruptly elevating the sternum anteriorly ,
a substantial amount of pain in the chest and back of the skeletally mature patient is generated .
the increased pressure on the bar , due to a less plastic chest , increases the magnitude of pain which involves dermatomes t1 - 10 . in our study ,
a group of patients who underwent mirpe was , to some extent , older in comparison to several other reports .
this discrepancy reflects the rationale of subjecting patients to pe correction only if the patients themselves demand the surgical correction .
an adequate peri- and postoperative pain management regiment has become an important part of thoracic anaesthesia .
ea has proven to be effective for thoracic procedures , which have an intense pain as a consequence of the surgery , and is currently proposed for mirpe .
the opioids currently in use for ea , such as fentanyl , being lipophilic with a proportional short half - life , have limited rostral spread and less respiratory depression than morphine .
opioids have been associated with local anaesthetics to block spinal nociceptive pathways in the epidural administration , thus reducing the dose - related adverse effects of both classes of drugs . in our series , both the duration of ea and oral medication administration were , to some extent , in line with previous studies . however , in contrast to some reports , during both the ea period and after the removal of the epidural catheter , most of our patients required additional analgesics , despite the regular administration of a strong oral opioid . regarding the adverse effects during ea therapy and the incidences of accidental premature discontinuation of the epidural catheters , due mainly to block failure , our data are in accordance with previous studies . concerning pain control , we observed a slow but progressive improvement in the pain score over time , with a reduction in score below 4 being considered as the threshold for rescue medication , which was determined between the 4th and 5th postoperative day .
both gender and age seemed to have an overall significant impact on the pain score , which decreased in the female population and increased in older patients .
the latter most likely reflects the difference in anatomical plasticity and moldability of the rib cage in early adolescents to that found at adult age .
interestingly enough , pectus severity did not correlate with the pain level experienced by our patients .
benzodiazepines are commonly used for a wide range of conditions and are known to have sedative , hypnotic , anticonvulsant , muscle relaxant , and amnesic properties , making them useful in treating anxiety .
anxiety may increase sensitivity and the intensity of pain , which in turn influences the anxiety state into a self - maintaining mechanism .
anxiety that follows pain determines a stressful condition , with various symptoms , such as muscle tension , which cause a reduction of the pain threshold . in this context
, anxiolytic drugs may have a beneficial role by giving the patient a reduced sensation of pain in the postoperative period , thanks to the mutual reinforcement mechanism between anxiety and pain . from our limited experience ,
we confirm that postoperative oxycodone consumption , during the oral drug intake period , was reduced in the group of patients that used benzodiazepines conjunctively . in summary , with this retrospective study , we provided additional data regarding pain management after the surgical repair of pe .
the current data showed good overall pain control , the need of five or more days of oral medication with strong opioids after the epidural discharge , and additional analgesic administration if requested by the patients both during the intravenous and oral analgesic period .
we also assumed that , for better pain management , it is advisable to evaluate the pain and anxiety state during hospitalization , which was thought to be necessary when taking into consideration postoperative anxiolytic treatment of patients after the nuss procedure . in any case , given these preliminary results , a prospective study is warranted in order to establish the value of the routine use of benzodiazepines in mirpe , especially during the first postoperative days when postoperative pain is most severe . | the nuss procedure for the correction of pectus excavatum ( pe ) is associated with intense postoperative pain .
our strategy to control early postoperative pain is to combine epidural with intravenous analgesia .
our aim was to analyse our pain control strategy by reviewing all the pe cases treated at our institution .
sixty consecutive patients , aged between 12 and 26 years old , received the pe operation at our institution from january , 2007 to september , 2010 .
the median age was 16 ( 12 - 27 ) with a male / female ratio of about 7/1 .
an epidural catheter was employed in all the cases , with 38 patients ( 63% ) requiring additional drugs to control pain , which remained in place for 74 hours ( 72 - 96 ) .
the pain score was higher in male patients , but lower in those younger than 16 years old .
moreover , patients that consumed benzodiazepines had a significant decrease in cumulative opioid intake ( p = 0.0408 ) . both gender and age had an impact on pain control , while we noticed a synergistic effect between opiates and tranquillizers . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.