article
stringlengths
0
826k
abstract
stringlengths
174
4.34k
despite the development of ever more efficacious and safe pharmacological treatments , cardiovascular diseases are still the leading cause of death and invalidity in the developed countries , and in most of the so called second world ( 1 ) . arterial hypertension is one of the most relevant independent cardiovascular disease risk factor and recent studies show that the maintenance of normal blood pressure level also in not frankly hypertensive subjects is associated to a significant reduced incidence of cardiovascular events ( 2 ) . of course , it is not plausible to pharmacologically treat all subjects with normal - high blood pressure and all international guidelines stress the relevance of an adequate dietary and life - style intervention in order to reach and maintain optimal blood pressure levels . moreover , in our era of multiple pharmacological treatments for cardiovascular diseases , some researchers believe that simple dietary interventions or nutritional supplements may be a more natural and acceptable method of providing benefits , and patients appear very keen to spontaneously use different dietary supplements ( whose efficacy is not always evident ) to reduce their blood pressure , without asking their physicians for information ( 3 ) . both health professionals and the public are increasingly interested in the supposed role of omega-3 polyunsaturated fatty acids ( pufas ) from fish and fish oils in the prevention and management of coronary heart disease ( 4 ) . moreover , the worldwide use of pufa supplementation has recently received a large implementation even in fields unrelated to cardiovascular diseases , such as neurology ( epilepsies ) , psychiatry ( psychosis , severe depressions ) , rheumatology ( osteoarthritis , psoriasis ) , clinical immunology ( allergy ) , gastroenterology ( inflammatory bowel diseases ) , nephrology ( autoimmune nephropathies ) ( i.e. : chronic renal failure , congestive heart failure ) ( 5 ) . if pufas also have a small but significant blood pressure lowering effect , this potential wide use could have a relevant epidemiological effect on blood pressure at the population level , because of the high a priori probability of comorbidity between those conditions and arterial hypertension . the aim of this review is to critically evaluate the available information about pufa effect on blood pressure control and prevention . we searched pubmed and embase for relevant articles by using the key words fish omega 3 fatty acids , polyunsaturated fatty acids , pufa , eicosapentaenoic acid , epa , docosahexaenoic acid , dha and blood pressure or arterial hypertension , using a combined text word and mesh heading search strategy . alpha - linolenic acid ( ala ; 18:3 omega-3 ) together with linoleic acid ( la ; 18:2 omega-6 ) are essential fatty acids for humans . la is the most predominant omega-3 pufa in our diet , which is commonly found in vegetable seed oils . ala is less abundant than la ; ala is also present in some vegetable oils such as perilla , flaxseed , canola , soybean and walnut oils . dietary la is converted to gamma linolenic acid ( gla , 18:3 omega-6 ) and di - homo - gla ( dgla , 20:3 omega-6 ) by specific enzymes ( 6-desaturase , elongase ) that are controlled by genetic hormonal and nutritional factors . then , dgla compete with alpha - linolenic acid ( ala , 18:3 omega-3 ) derived products on the enzyme 5-desaturase for the synthesis of arachidonic acid or eicosapentaenoic ( epa , 20:5 omega-3 ) . epa is yet elongated and desaturated to docosahexenoic acid ( dha , 22:6 omega-3 ) ( fig . 1 ) . fish and fish oils are the main dietary sources of epa and dha . the content of epa and dha in different kinds of fish is reported in table i. even if less concentrated , epa and dha are also available in some vegetables , such as corn ( and corn oil ) , lean meat and meat products , offal , egg yolk , milk and dairy products ( 5 ) . 1- endogenous metabolism omega-6 and omega-3 polyunsaturated fatty acids ( pg= prostaglandin , tx= thromboxane , lt= leukotriene ) . - endogenous metabolism omega-6 and omega-3 polyunsaturated fatty acids ( pg= prostaglandin , tx= thromboxane , lt= leukotriene ) . table i- mean content of omega 3 fatty acids of selected fish and seafoodfishepa/+dha content ( g ) per 100 g serving of fish ( edible portion)amount of fish ( in g ) required to provide 1 g epa+/dhatuna ( fresh)0.281.5166357atlantic salmon1.282.1542.570.9mackerel0.41.8554250atlantic herring2.0150rainbow trout1.1587sardines1.1525087halibut0.471.1885213tuna ( canned)0.31323cod0.28357haddock0.24417catfish0.18556flounder or sole0.49204oyster0.44227shrimp0.32313scallop0.2500cod liver oil capsule0.195epa omega 3 content varies markedly depending on species , season , diet , and packaging and cooking methods , and the figures above are therefore rough estimates . omega 3 content varies markedly depending on species , season , diet , and packaging and cooking methods , and the figures above are therefore rough estimates . as cycloxigenase ( cox ) inhibition is often associated with sodium retention leading to edema and hypertension ( 6 ) , prostanoids appear to have a role in preventing the development of high blood pressure . on the other hand , prostaglandin e2 ( pge2 ) and pgi2 have also been implicated as determinants of renin secretion . a recent study suggests that pgi2 plays a critical role in stimulating renin release and promoting hypertension following renal artery stenosis ( 7 ) . patients with uncontrolled essential hypertension have elevated concentrations of superoxide anion ( o2 ) , hydrogen peroxide ( h2o2 ) , lipid peroxides , endothelin , and transforming growth factor - beta ( tgf - beta ) with a simultaneous decrease in endothelial nitric oxide ( eno ) , superoxide dismutase ( sod ) , vitamin e , and long - chain pufas ( 8) . physiological concentrations of angiotensin ii activate nad(p)h oxidase and trigger free radical generation ( especially that of o2 ) . usually , angiotensin ii - induced oxidative stress is abrogated by adequate production and release of eno , which quenches o 2 to restore normotension . tgf - beta enhances no generation , which in turn suppresses tgf - beta production ( 8) . thus , no has a regulatory role on tgf- beta production and is also a physiological antagonist of endothelin . antihypertensive drugs suppress the production of o2 and tgf - beta and enhance eno synthesis to bring about their beneficial actions ( 9 ) . omega-3 pufas exhibit wide - ranging biological actions that include regulating both vasomotor tone and renal sodium excretion , partly competing with omega-6 pufas for common metabolic enzymes and thereby decreasing the production of prothrombotic and vasocostricting rather than vasodilating , antithrombotic , antiaggregatory , and antiinflammatory eicosanoids ( 10 ) . opposite to saturated and trans - fatty acids , omega-3 pufas contrast the formation of tromboxane a2 ( ta2 ) , a potent vasoconstrictor , and enhance that of pgi2 , a well - known vasodilator . in addition , epa lowers tissue levels of arachidonic acid and enhance that of fgla , the precursor of pge1 , another vasodilator agent ( 10 ) . pufas not only enhance the formation of beneficial pgs , but also suppress angiotensin - converting enzyme ( ace ) activity , reduce angiotensin ii formation , enhance eno generation , and suppress tgf - beta expression ( 11 ) ( fig . it has been observed that the l - arginine - no system upregulates the pufa metabolism , so that a strict correlation between pufa concentration and no endothelial production has been supposed ( 12 ) . following control of hypertension with calcium antagonists , beta - blockers , and ace inhibitors , the concentration of no and o2 reverted to normalcy , whereas those of pufas remain low ( 13 ) : it opens the possibility of further blood pressure improvement by pufa supplementation . the discovery that pufa could have a direct blood pressure lowering effect finally justifies why dha appears to be as effective or even slightly more effective than epa ( 10 ) , even if dha is not a substrate for the cyclooxygenase and lipoxygenase enzymes involved in eicosanoid metabolism . moreover , consumption of breast milk ( which is rich in pufas ) in perinatal life is associated to a higher pu - fa tissue content in infants and to a lower insulin - resistance and hypertension rate in adult life , whereas pufa deficiency in the perinatal period results in raised blood pressure later in life ( 14 ) . the exact mechanism of this phenomenon has yet to be elucidated , however some authors have postulated the hypothesis that perinatal dietary pufa deficiency could lead to developmental alteration of membrane bound receptors related to the sodium metabolism , such as osmoceptors or angiotensin ii receptor ( 14 ) . patients with essential hypertension and population genetically prone to develop arterial hypertension ( 15 ) have low concentrations of various pufas in their plasma phospholipid fraction . based on this , it is proposed that pufas serve as endogenous regulators of ace activity , o2 , eno generation , and tgf - beta expression . further , pufas have actions similar to statins , inhibit ( especially omega-3 pufas ) cyclooxygenase activity and suppress the synthesis of proinflammatory cytokines , and activate the parasympathetic nervous system , all actions that reduce the risk of major vascular events . hence , it is proposed that availability of adequate amounts of pufas during the critical periods of growth prevents the development of hypertension in adulthood ( 15 ) . in addition , pufas have antinflammatory and endothelial action similar to the so called pleyotropic effect of the 3-hydroxy-3-methyl - glutaryl - coenzyme a reductase inhibitors ( statins ) , and also statin use has been observed to slightly but significantly reduce blood pressure level both in clinical trial setting and at population level ( 16 ) . a recent report suggests that pufas could also exert their effect on metabolism and hypertension through induction of cd36 expression whose deficiency underlies insulin resistance , defective fatty acid metabolism and hypertriglyceridemia in spontaneously hypertensive rats ( shrs ) , and whose expression is modulated through peroxisome proliferator - activated receptor ( ppar ) transcription factors , by conditions that alter lipid metabolism such as diabetes mellitus and high - fat feeding ( 17 ) . always in experimental models , fish oil supplementation shows to have protective effects on long - term hypertension - related organ damages such as glomerular enlargement , and glomeruli loss ( 18 ) . from an epidemiological point of view , the inverse association between omega-3 pufa intake and cardiovascular disease morbidity / mortality was established following the observation that the greenland inuit had low mortality from coronary heart disease despite a diet that is rich in fat . in the 1970s the danish investigators bang and dyerberg proposed that this could be because of the omega-3 pufa high content in the inuit diet , which consisted largely of fish , seal , and whale ( 19 ) . in fact , in these subjects , plasma omega-3 pufa concentrations are highly correlated with dietary pufas and inversely correlated with diastolic blood pressure ( 20 ) . compared with traditional diets , patterns of pufa intake in industrialized nations have shifted markedly during the past 150 years toward higher amounts of omega-6 pufas and lower amounts of omega-3 pufas , with parallel increases in coronary heart disease incidence in ecological studies ( 21 ) . the inverse correlation between pufas intake and blood pressure could be not true in each ethnicity : for instance in the tanzania population it has not been observed ( 22 ) . minimally invasive methods allowed repeat measurements in individuals in whom fish oil supplementation was tested in the setting of clinical trials . measurements have included systemic arterial compliance index , flow - mediated dilation of the muscular conduit brachial artery and blood flow in the microcirculation of the forearm and of coronary arteries . endothelial dysfunction that partly explains reduced vascular dilatation appears to predict future adverse coronary heart disease outcomes . fish oil supplementation has significantly improved endothelial function measured in terms of nitric oxide- and flow - mediated dilation and vasodilation of resistance vessels of the forearm ( 23 ) . systemic arterial compliance index , which reflects distensibility in elastic proximal large arteries , was equally improved with 3 g dha ( + 27% ) and 3 g epa ( + 36% ) , whereas consumption of the placebo did not , in a double - blind , parallel design , placebo - controlled randomized trial ( 24 ) . tomiyama et al showed that epa supplementation ( 1.8 g / day ) is able to attenuate age - related increase in arterial stiffness in dyslipidemic patients ( 25 ) . distensibility of the common carotid artery has also been shown to improve with epa alone . left ventricular function also improved in patients taking either epa or dha ( 26 ) . these effects appear not to be related to alterations in vascular responses to norepinephrine , angiotensin ii or potassium ( 27 ) . in a dietary intervention study , 69 overweight ( bmi > 25 kg / m ) medication - treated hypertensive subjects were randomized to either a daily fish meal ( 3.65 gr / dl of omega-3 pufa approximately ) , a weight reduction regimen , the two regimens combined , or a control regimen for 16 weeks . sixty - three subjects completed the study . both systolic ( sbp ) and diastolic ( dbp ) blood pressure , body weight and heart rate significantly decreased in the fish diet group compared with the controlled diet group , even after adjustment for changes in urinary sodium , potassium , or the sodium / potassium ratio , as well as dietary macronutrients . from this data it could be argued that weight loss in overweight people can augment the effects of eating fish on ambulatory 24h blood pressure ( 28 ) . then , an observational study was carried out in which the effects of fish - derived omega-3 pufa on blood pressure , platelet fatty acid levels and heart rate variability ( an independent protective factor against cardiovascular mortality ) , were investigated in 43 subjects ( male 24 , female 19 , aged 18 to 62 years ) with type 1 diabetes mellitus , and 38 subjects ( male 24 , female 14 , aged 37 to 77 years ) with type 2 diabetes mellitus ( 29 ) . the study found that fish intake was significantly associated with platelet membrane dha levels . according to the platelet dha levels , patients were divided into three tertiles : the first tertile ( n = 14 ) had the lowest dha level , the third tertile ( n = 15 ) the highest dha level and the second tertile was in between . compared with the first tertile , the third tertile had a significantly lower dbp . in a further double blind , randomized , placebo - controlled human study , it was found that epa and dha differed in their effects on blood pressure and heart rate ( 30 ) . in this study , 55 overweight ( body mass index = 2530 kg / m ) subjects , aged 2065 years , were randomized to 4 g / d of purified epa , dha , or placebo ( olive oil ) capsules for 6 weeks . compared to the placebo group , dha significantly reduced both sbp and dbp ( measured over 24 hours ) by 5.8 and 3.3 mmhg , and the waking sbp and dbp by 3.5 and 2.0 mmhg , respectively ( p<0.05 ) . compared to the placebo group , heart rate over a 24-hour period , when awake and when asleep , was significantly reduced by 3.5 0.8 , 3.7 1.2 , and 2.8 1.2 bpm , respectively . on the other hand this study has however the limit to not have tested if the epa - dha association has additive or synergic effects on blood pressure , or not . authors explain the antihypertensive effect of dha suggesting that there may be a significant cardiac component , as demonstrated by the concomitant reduction in heart rate , possibly mediated by effects on autonomic nerve function or -adrenoceptor activity . a meta - analysis of 36 randomised trials , including the last cited ones , found a mean reduction in sbp of 2.1 mmhg and in dbp of 1.6 mmhg ( 31 ) , significantly inferior to that reported in some single trials . the main reason of this low observed effect is that in the meta - analysis were included also trials where low dosed or unpurified formulation were used , and where blood pressure reduction was not a main outcome of the study . recently , sanders et al showed that pufas extracted from marine algae ( not from fish ) had no effects on the blood pressure levels of seventy - nine patients randomized to 4 g / day ( providing 1.5 g dha and 0.6 g dpa ) or placebo in a 4-week double - blind randomized trial ( 32 ) . in normotensive adults , pufa supplementation appears not to have significant effect on blood pressure values if compared to saturated and monounsaturated fatty acids ( 33 ) . however , 5 ml fish oil supplementation is significantly associated to lower sbp levels ( 6.3 mmhg 95% ci 0.9 , 11.7 ; p = 0.02 ) in children taking them mixed in milk - formulation for one year , as compared with control children ( 34 ) . further clinical research is needed to evaluate the real antihypertensive effect of epa and dha , their differential effects , and to identify a priori the best responders or candidates for that treatment . of course , any recommendations regarding fish and fish oils should be balanced against safety issues . side effects such as fishy aftertaste are uncommon , and gastrointestinal upset is infrequent at moderate intakes ( 4 ) . some reports show that fish oil may worsen glycemic control in diabetes , but a recent meta - analysis excludes this adverse effect ( 35 ) . concerns have been raised regarding adverse effects on low density lipoprotein ( ldl ) cholesterol and oxidative stress , but increases in ldl cholesterol are modest and studies about oxidative stress have been contradictory . overall these effects are unlikely to be dominant given the apparent cardiac benefits of omega-3 pufas ( 36 ) . more specific concerns regarding dietary fish relate to environmental contaminants , and a recent study showed that mercury in fish may attenuate their cardioprotective effects ( 37 ) . contaminants accumulate in larger , predatory fish , and consumption of a variety of fish should minimise any possible adverse effects ( 4 ) . no significant negative interaction has been observed until now between antihypertensive therapy and fish oil supplementation . we searched pubmed and embase for relevant articles by using the key words fish , fish oils , omega 3 fatty acids , polyunsaturated fatty acids , pufa , eicosapentaenoic acid , epa , docosahexaenoic acid , dha and blood pressure or arterial hypertension , using a combined text word and mesh heading search strategy . alpha - linolenic acid ( ala ; 18:3 omega-3 ) together with linoleic acid ( la ; 18:2 omega-6 ) are essential fatty acids for humans . la is the most predominant omega-3 pufa in our diet , which is commonly found in vegetable seed oils . ala is less abundant than la ; ala is also present in some vegetable oils such as perilla , flaxseed , canola , soybean and walnut oils . dietary la is converted to gamma linolenic acid ( gla , 18:3 omega-6 ) and di - homo - gla ( dgla , 20:3 omega-6 ) by specific enzymes ( 6-desaturase , elongase ) that are controlled by genetic hormonal and nutritional factors . then , dgla compete with alpha - linolenic acid ( ala , 18:3 omega-3 ) derived products on the enzyme 5-desaturase for the synthesis of arachidonic acid or eicosapentaenoic ( epa , 20:5 omega-3 ) . epa is yet elongated and desaturated to docosahexenoic acid ( dha , 22:6 omega-3 ) ( fig . 1 ) . fish and fish oils are the main dietary sources of epa and dha . the content of epa and dha in different kinds of fish is reported in table i. even if less concentrated , epa and dha are also available in some vegetables , such as corn ( and corn oil ) , lean meat and meat products , offal , egg yolk , milk and dairy products ( 5 ) . - endogenous metabolism omega-6 and omega-3 polyunsaturated fatty acids ( pg= prostaglandin , tx= thromboxane , lt= leukotriene ) . table i- mean content of omega 3 fatty acids of selected fish and seafoodfishepa/+dha content ( g ) per 100 g serving of fish ( edible portion)amount of fish ( in g ) required to provide 1 g epa+/dhatuna ( fresh)0.281.5166357atlantic salmon1.282.1542.570.9mackerel0.41.8554250atlantic herring2.0150rainbow trout1.1587sardines1.1525087halibut0.471.1885213tuna ( canned)0.31323cod0.28357haddock0.24417catfish0.18556flounder or sole0.49204oyster0.44227shrimp0.32313scallop0.2500cod liver oil capsule0.195epa = eicosapentanoic acid , dha = docosahexanoic acid . omega 3 content varies markedly depending on species , season , diet , and packaging and cooking methods , and the figures above are therefore rough estimates . omega 3 content varies markedly depending on species , season , diet , and packaging and cooking methods , and the figures above are therefore rough estimates . as cycloxigenase ( cox ) inhibition is often associated with sodium retention leading to edema and hypertension ( 6 ) , prostanoids appear to have a role in preventing the development of high blood pressure . on the other hand , prostaglandin e2 ( pge2 ) and pgi2 a recent study suggests that pgi2 plays a critical role in stimulating renin release and promoting hypertension following renal artery stenosis ( 7 ) . patients with uncontrolled essential hypertension have elevated concentrations of superoxide anion ( o2 ) , hydrogen peroxide ( h2o2 ) , lipid peroxides , endothelin , and transforming growth factor - beta ( tgf - beta ) with a simultaneous decrease in endothelial nitric oxide ( eno ) , superoxide dismutase ( sod ) , vitamin e , and long - chain pufas ( 8) . physiological concentrations of angiotensin ii activate nad(p)h oxidase and trigger free radical generation ( especially that of o2 ) . usually , angiotensin ii - induced oxidative stress is abrogated by adequate production and release of eno , which quenches o 2 to restore normotension . tgf - beta enhances no generation , which in turn suppresses tgf - beta production ( 8) . thus , no has a regulatory role on tgf- beta production and is also a physiological antagonist of endothelin . antihypertensive drugs suppress the production of o2 and tgf - beta and enhance eno synthesis to bring about their beneficial actions ( 9 ) . omega-3 pufas exhibit wide - ranging biological actions that include regulating both vasomotor tone and renal sodium excretion , partly competing with omega-6 pufas for common metabolic enzymes and thereby decreasing the production of prothrombotic and vasocostricting rather than vasodilating , antithrombotic , antiaggregatory , and antiinflammatory eicosanoids ( 10 ) . opposite to saturated and trans - fatty acids , omega-3 pufas contrast the formation of tromboxane a2 ( ta2 ) , a potent vasoconstrictor , and enhance that of pgi2 , a well - known vasodilator . in addition , epa lowers tissue levels of arachidonic acid and enhance that of fgla , the precursor of pge1 , another vasodilator agent ( 10 ) . pufas not only enhance the formation of beneficial pgs , but also suppress angiotensin - converting enzyme ( ace ) activity , reduce angiotensin ii formation , enhance eno generation , and suppress tgf - beta expression ( 11 ) ( fig . it has been observed that the l - arginine - no system upregulates the pufa metabolism , so that a strict correlation between pufa concentration and no endothelial production has been supposed ( 12 ) . following control of hypertension with calcium antagonists , beta - blockers , and ace inhibitors , the concentration of no and o2 reverted to normalcy , whereas those of pufas remain low ( 13 ) : it opens the possibility of further blood pressure improvement by pufa supplementation . the discovery that pufa could have a direct blood pressure lowering effect finally justifies why dha appears to be as effective or even slightly more effective than epa ( 10 ) , even if dha is not a substrate for the cyclooxygenase and lipoxygenase enzymes involved in eicosanoid metabolism . 2- main pharmacological activities involved in omega-3 pufa antihypertensive action . - main pharmacological activities involved in omega-3 pufa antihypertensive action . moreover , consumption of breast milk ( which is rich in pufas ) in perinatal life is associated to a higher pu - fa tissue content in infants and to a lower insulin - resistance and hypertension rate in adult life , whereas pufa deficiency in the perinatal period results in raised blood pressure later in life ( 14 ) . the exact mechanism of this phenomenon has yet to be elucidated , however some authors have postulated the hypothesis that perinatal dietary pufa deficiency could lead to developmental alteration of membrane bound receptors related to the sodium metabolism , such as osmoceptors or angiotensin ii receptor ( 14 ) . patients with essential hypertension and population genetically prone to develop arterial hypertension ( 15 ) have low concentrations of various pufas in their plasma phospholipid fraction . based on this , it is proposed that pufas serve as endogenous regulators of ace activity , o2 , eno generation , and tgf - beta expression . further , pufas have actions similar to statins , inhibit ( especially omega-3 pufas ) cyclooxygenase activity and suppress the synthesis of proinflammatory cytokines , and activate the parasympathetic nervous system , all actions that reduce the risk of major vascular events . hence , it is proposed that availability of adequate amounts of pufas during the critical periods of growth prevents the development of hypertension in adulthood ( 15 ) . in addition , pufas have antinflammatory and endothelial action similar to the so called pleyotropic effect of the 3-hydroxy-3-methyl - glutaryl - coenzyme a reductase inhibitors ( statins ) , and also statin use has been observed to slightly but significantly reduce blood pressure level both in clinical trial setting and at population level ( 16 ) . a recent report suggests that pufas could also exert their effect on metabolism and hypertension through induction of cd36 expression whose deficiency underlies insulin resistance , defective fatty acid metabolism and hypertriglyceridemia in spontaneously hypertensive rats ( shrs ) , and whose expression is modulated through peroxisome proliferator - activated receptor ( ppar ) transcription factors , by conditions that alter lipid metabolism such as diabetes mellitus and high - fat feeding ( 17 ) . always in experimental models , fish oil supplementation shows to have protective effects on long - term hypertension - related organ damages such as glomerular enlargement , and glomeruli loss ( 18 ) . from an epidemiological point of view , the inverse association between omega-3 pufa intake and cardiovascular disease morbidity / mortality was established following the observation that the greenland inuit had low mortality from coronary heart disease despite a diet that is rich in fat . in the 1970s the danish investigators bang and dyerberg proposed that this could be because of the omega-3 pufa high content in the inuit diet , which consisted largely of fish , seal , and whale ( 19 ) . in fact , in these subjects , plasma omega-3 pufa concentrations are highly correlated with dietary pufas and inversely correlated with diastolic blood pressure ( 20 ) . compared with traditional diets , patterns of pufa intake in industrialized nations have shifted markedly during the past 150 years toward higher amounts of omega-6 pufas and lower amounts of omega-3 pufas , with parallel increases in coronary heart disease incidence in ecological studies ( 21 ) . the inverse correlation between pufas intake and blood pressure could be not true in each ethnicity : for instance in the tanzania population it has not been observed ( 22 ) . minimally invasive methods allowed repeat measurements in individuals in whom fish oil supplementation was tested in the setting of clinical trials . measurements have included systemic arterial compliance index , flow - mediated dilation of the muscular conduit brachial artery and blood flow in the microcirculation of the forearm and of coronary arteries . endothelial dysfunction that partly explains reduced vascular dilatation appears to predict future adverse coronary heart disease outcomes . fish oil supplementation has significantly improved endothelial function measured in terms of nitric oxide- and flow - mediated dilation and vasodilation of resistance vessels of the forearm ( 23 ) . systemic arterial compliance index , which reflects distensibility in elastic proximal large arteries , was equally improved with 3 g dha ( + 27% ) and 3 g epa ( + 36% ) , whereas consumption of the placebo did not , in a double - blind , parallel design , placebo - controlled randomized trial ( 24 ) . tomiyama et al showed that epa supplementation ( 1.8 g / day ) is able to attenuate age - related increase in arterial stiffness in dyslipidemic patients ( 25 ) . distensibility of the common carotid artery has also been shown to improve with epa alone . left ventricular function also improved in patients taking either epa or dha ( 26 ) . these effects appear not to be related to alterations in vascular responses to norepinephrine , angiotensin ii or potassium ( 27 ) . in a dietary intervention study , 69 overweight ( bmi > 25 kg / m ) medication - treated hypertensive subjects were randomized to either a daily fish meal ( 3.65 gr / dl of omega-3 pufa approximately ) , a weight reduction regimen , the two regimens combined , or a control regimen for 16 weeks . both systolic ( sbp ) and diastolic ( dbp ) blood pressure , body weight and heart rate significantly decreased in the fish diet group compared with the controlled diet group , even after adjustment for changes in urinary sodium , potassium , or the sodium / potassium ratio , as well as dietary macronutrients . from this data it could be argued that weight loss in overweight people can augment the effects of eating fish on ambulatory 24h blood pressure ( 28 ) . then , an observational study was carried out in which the effects of fish - derived omega-3 pufa on blood pressure , platelet fatty acid levels and heart rate variability ( an independent protective factor against cardiovascular mortality ) , were investigated in 43 subjects ( male 24 , female 19 , aged 18 to 62 years ) with type 1 diabetes mellitus , and 38 subjects ( male 24 , female 14 , aged 37 to 77 years ) with type 2 diabetes mellitus ( 29 ) . the study found that fish intake was significantly associated with platelet membrane dha levels . according to the platelet dha levels , patients were divided into three tertiles : the first tertile ( n = 14 ) had the lowest dha level , the third tertile ( n = 15 ) the highest dha level and the second tertile was in between . compared with the first tertile , the third tertile had a significantly lower dbp . in a further double blind , randomized , placebo - controlled human study , it was found that epa and dha differed in their effects on blood pressure and heart rate ( 30 ) . in this study , 55 overweight ( body mass index = 2530 kg / m ) subjects , aged 2065 years , were randomized to 4 g / d of purified epa , dha , or placebo ( olive oil ) capsules for 6 weeks . compared to the placebo group , dha significantly reduced both sbp and dbp ( measured over 24 hours ) by 5.8 and 3.3 mmhg , and the waking sbp and dbp by 3.5 and 2.0 mmhg , respectively ( p<0.05 ) . compared to the placebo group , heart rate over a 24-hour period , when awake and when asleep , was significantly reduced by 3.5 0.8 , 3.7 1.2 , and 2.8 1.2 bpm , respectively . on the other hand , epa showed no significant effect on blood pressure and heart rate . this study has however the limit to not have tested if the epa - dha association has additive or synergic effects on blood pressure , or not . authors explain the antihypertensive effect of dha suggesting that there may be a significant cardiac component , as demonstrated by the concomitant reduction in heart rate , possibly mediated by effects on autonomic nerve function or -adrenoceptor activity . a meta - analysis of 36 randomised trials , including the last cited ones , found a mean reduction in sbp of 2.1 mmhg and in dbp of 1.6 mmhg ( 31 ) , significantly inferior to that reported in some single trials . the main reason of this low observed effect is that in the meta - analysis were included also trials where low dosed or unpurified formulation were used , and where blood pressure reduction was not a main outcome of the study . recently , sanders et al showed that pufas extracted from marine algae ( not from fish ) had no effects on the blood pressure levels of seventy - nine patients randomized to 4 g / day ( providing 1.5 g dha and 0.6 g dpa ) or placebo in a 4-week double - blind randomized trial ( 32 ) . in normotensive adults , pufa supplementation appears not to have significant effect on blood pressure values if compared to saturated and monounsaturated fatty acids ( 33 ) . however , 5 ml fish oil supplementation is significantly associated to lower sbp levels ( 6.3 mmhg 95% ci 0.9 , 11.7 ; p = 0.02 ) in children taking them mixed in milk - formulation for one year , as compared with control children ( 34 ) . further clinical research is needed to evaluate the real antihypertensive effect of epa and dha , their differential effects , and to identify a priori the best responders or candidates for that treatment . of course , any recommendations regarding fish and fish oils should be balanced against safety issues . side effects such as fishy aftertaste are uncommon , and gastrointestinal upset is infrequent at moderate intakes ( 4 ) . some reports show that fish oil may worsen glycemic control in diabetes , but a recent meta - analysis excludes this adverse effect ( 35 ) . concerns have been raised regarding adverse effects on low density lipoprotein ( ldl ) cholesterol and oxidative stress , but increases in ldl cholesterol are modest and studies about oxidative stress have been contradictory . overall these effects are unlikely to be dominant given the apparent cardiac benefits of omega-3 pufas ( 36 ) . more specific concerns regarding dietary fish relate to environmental contaminants , and a recent study showed that mercury in fish may attenuate their cardioprotective effects ( 37 ) . contaminants accumulate in larger , predatory fish , and consumption of a variety of fish should minimise any possible adverse effects ( 4 ) . no significant negative interaction has been observed until now between antihypertensive therapy and fish oil supplementation . preliminary data suggest that an adequate pufa dietary intake or supplementation ( 24 g / day ) could slightly but significantly reduce systolic and diastolic blood pressure level and prevent blood pressure increase in either dyslipidemic , diabetics , elderly , normotensive and hypertensive subjects , contributing to their cardiovascular protective role . present and future research will identify which categories of subjects will more significantly benefit form pufa supplementation in order to maintain adequate levels of blood pressure . some research lines are trying to clarify which specific sub - categories of subjects at cardiovascular risk could obtain the maximal benefit from an epa / dha supplementation and which is the most cost - effective dosage and epa / dha ratio to be employed . in the specific context of blood pressure management it is probable that the on - going gissi - heart failure study , designed to evaluate the effect of epa / dha supplementation or statin treatment on the prognosis of patients affected by chronic heart failure , could furnish relevant data as it regards the blood pressure control in both groups of treatment . because of the specific mechanism of action of pufa it could be also interesting to study if pufa could improve the antihypertensive action of specific blood pressure lowering drug classes and of statins . future guidelines for hypertension management may suggest to increase the nutritional intake of epa / dha or to supplement it in order to prevent blood pressure increases or improve the blood pressure control , especially in subjects that could have special benefit for other concomitant pathologies ( e.g. dyslipidemias , rheumatological disorders , and perhaps chronic heart failure and chronic renal failure ) .
omega-3 polyunsaturated fatty acids ( pufas ) from fish and fish oils appear to protect against coronary heart disease : their dietary intake is in fact inversely associated to cardiovascular disease morbidity / mortality in population studies . recent evidence suggests that at least part of their heart protective effect is mediated by a relatively small but significant decrease in blood pressure level . in fact , omega-3 pufas exhibit wide - ranging biological actions that include regulating both vasomotor tone and renal sodium excretion , partly competing with omega-6 pufas for common metabolic enzymes and thereby decreasing the production of vasocostrincting rather than vasodilating and anti - inflammatory eicosanoids . pufas also reduce angiotensin - converting enzyme ( ace ) activity , angiotensin ii formation , tgf - beta expression , enhance eno generation and activate the parasympathetic nervous system . the final result is improved vasodilation and arterial compliance of both small and large arteries . preliminary clinical trials involving dyslipidemic patients , diabetics and elderly subjects , as well as normotensive and hypertensive subjects confirm this working hypothesis . future research will clarify if pufa supplementation could improve the antihypertensive action of specific blood pressure lowering drug classes and of statins .
the emerging phenomenon of so - called health tourism has been in europe since the time of ancient greece and rome ( 12 ) . the term health tourism was introduced in 1987 by goodrich ( 3 ) . this multi - faceted topic has been considered as an academic one , from mid-1990s . in addition to some books introducing the tourist targets , there are papers criticized the heath tourism and its different aspects ( 48 ) . gun et al . therefore , to achieve a complete understanding of health tourism , there is a need to study changes over time . the whole process starts from 16 century , which meant a trip to use mineral water supplies , and then use the newly established spa to improve health . currently , we have expanded its meaning which embraces not only the previous meaning but also pre - arranged trip to the hospital for treatment objectives ( 1013 ) . today , health tourism , embraces three separate categories including medical tourism , curative tourism , and wellness tourism . this type of tourism can be seen in all ages , but mostly in older and retired tourists from western countries . on average , women of 45 years age are clients of this type of tourism . these customers typically have high incomes , high levels of education and a lot of time for tourism and personal needs ( 14 ) . currently , health tourism is a major topic of the combination of two components which requires the cooperation of several services running simultaneously , and surveillance organization monitoring and coordinating an enterprise network in the country ( 15 ) . for the first time medical tourism , was considered in iran by the ministry of health in 2002 . islamic countries health tourism congress in mashhad ( 2010 ) considered iran after the jordan of the highest potential in health tourism in these countries . there are several medical centers ; specialty and subspecialty , relatively low cost , enjoyment of natural resources , proximity to arab markets and similarity of culture and language with the some neighboring countries are including advantages in attracting foreign patients and medical tourists in iran . despite the relatively good state of skilled practitioners and efficient health and wellness in the country , attracting tourists for health services hardly had been in the center of authorities thoughts . only in recent years , iranian cultural heritage and tourism organization and the ministry of health , have planned and studied in this context . previous studies conducted in iran shows that this country encompasses the most abilities to attract tourists looking for treatment and enjoy sightseeing simultaneously ( 16,17 ) . because of the lack of comprehensive planning system for health tourism , all related studies have tried to understand the different aspects of this process and provide practical solutions and suggestions which are constructive in terms of planning and strategy of medical tourism ( 1821 ) . shiraz , as a famous city not only in iran , but throughout the world , although has established itself as a high rank place as for having the most pleasant attractive monuments and sightseeing , but unfortunately has not gone through deep survey in terms of absorbing patients . annually hundreds of patients from neighboring countries enter shiraz in hope of seeking health and attractive places . nemazee and khodadoost hospitals , in fact , are famous names among hospitals for many residents of adjacent countries . so far , scientific appraisal could not make clear all positive and negative aspects of this arena . this study aimed to clarify all aspects of health tourism in shiraz city due to studying the demand situation that means health tourists needs in last years . furthermore , this study would like to fill the gap of functional data necessary for health authorities and policy makers . shiraz as the capital of fars province is the fourth most populous city in iran and has a temperate weather . northwest axis of the town because of the natural landscape and temperate climate has been introduced as the health tourism route by the tourism and cultural heritage organization . shiraz has one of the oldest and greatest archaic places in the world , persepolis , which caused this city to be very famus for tourists around the world . geographical and cultural proximity to the persian gulf area countries , foreign direct flights , in addition to be confidence to physicians in shiraz , have provided a favorable matrix for the promotion of health and medical tourism planning . in addition to shiraz university of medical sciences as a prominent unit , there are 12 private and 22 governmental hospitals . this city has been known for liver transpiration operations from almost half a century ago . the efficient authorities on the topic were identified through the hospitals engaging in medical tourism . the research was based on theoretical sampling through which the experienced people of extensive knowledge on medical tourism were interviewed . then the first subjects were asked to introduce more people engaging in that topic based on a snowballing method . accordingly , the questions were categorized based on the research objectives . altogether , 50 respondents were interviewed . for the uniformity of the results , all replies were included in delphi questionnaire , and then it was sent to 30 of respondents , which 25 of them replied it . the process of recognizing the demand for health tourism in shiraz was based on the three principles including ( i ) gathering the number of foreigner health tourists ; ( ii ) identification of the destination country and ( iii ) knowledge on the nature of occupational therapy . determining the supply sector of health tourism has been considered more difficult due to its different parts and tools ( 22 ) . therefore , due to scattering angles presented in supply section , the demand and supply model ( 9 ) was utilized to categorize the supply services ( fig . given the importance of cultural factors in this research , the socio - cultural index was considered as a control and efficient indicator in all steps of the recognizing the supply . the model provides conditions that extensive discussion can be analyzed in relation to the product , services or related schedule . then the output of this chart was designed in ( swat ) based questionnaire and was sent to top ten experts on medical tourism for scoring . shiraz as the capital of fars province is the fourth most populous city in iran and has a temperate weather . northwest axis of the town because of the natural landscape and temperate climate has been introduced as the health tourism route by the tourism and cultural heritage organization . shiraz has one of the oldest and greatest archaic places in the world , persepolis , which caused this city to be very famus for tourists around the world . geographical and cultural proximity to the persian gulf area countries , foreign direct flights , in addition to be confidence to physicians in shiraz , have provided a favorable matrix for the promotion of health and medical tourism planning . in addition to shiraz university of medical sciences as a prominent unit , there are 12 private and 22 governmental hospitals . this city has been known for liver transpiration operations from almost half a century ago . the efficient authorities on the topic were identified through the hospitals engaging in medical tourism . the research was based on theoretical sampling through which the experienced people of extensive knowledge on medical tourism were interviewed . then the first subjects were asked to introduce more people engaging in that topic based on a snowballing method . accordingly , the questions were categorized based on the research objectives . altogether , 50 respondents were interviewed . for the uniformity of the results , all replies were included in delphi questionnaire , and then it was sent to 30 of respondents , which 25 of them replied it . the process of recognizing the demand for health tourism in shiraz was based on the three principles including ( i ) gathering the number of foreigner health tourists ; ( ii ) identification of the destination country and ( iii ) knowledge on the nature of occupational therapy . determining the supply sector of health tourism has been considered more difficult due to its different parts and tools ( 22 ) . therefore , due to scattering angles presented in supply section , the demand and supply model ( 9 ) was utilized to categorize the supply services ( fig . 2 ) . given the importance of cultural factors in this research , the socio - cultural index was considered as a control and efficient indicator in all steps of the recognizing the supply . the model provides conditions that extensive discussion can be analyzed in relation to the product , services or related schedule . then the output of this chart was designed in ( swat ) based questionnaire and was sent to top ten experts on medical tourism for scoring . using interviews conducted in this study , it was found that active hospitals on attraction of foreign patients averagely admitted 15 and 50 foreign patients monthly and annually , respectively . arab countries in the persian gulf were detected as the main marketing for shiraz medical tourism . accordingly oman encompassed the highest rate with 20% of admitted patients . according to fig . 3 , eye treatments with 30% and orthopedic therapies with 6% were demonstrated as the highest and lowest rates in terms of foreign patients needs . the tourist attractions of shiraz , according to health experts were divided into two parts : physical and non - physical . each part of the table 1 shows the importance of each section for arrived patients . these items have been numbered and inserted in the table based on their importance . the most important factor in physical attractiveness it was found that world - famous historical attractions of shiraz were not in the center of consideration for arabs residing in the persian gulf countries and only religious places were welcomed by them . regarding non - physical attractions , 80% of replies determined that closeness of cultural , and religious beliefs and familial relationships on one hand and trusting to iranian physicians on the other hand were amongst the most reasons for selecting iran as a destination for medical tourism by these patients . besides , we found that economical and financial factors had the minimum effect on their decision to select a destination . in the field of transportation , the high quality services were detected as the main pillar for attraction of health tourists especially for patients coming from arab countries settled nearby the persian gulf . table 2 shows that providing a complete package including all aspects of tourism services constituted an important point for improving the outcome with 72% rate . moreover , regarding to accommodation , 84% of patients preferred to stay in luxury hotels ; instead , some of them coming with family preferred the hotel apartments or furnished hotels . ancillary services in this study the need for tourists to spend recovering in the garden area with fresh air , with ease in visa issue was of the same importance ( table 2 ) . among the most effective advertising and marketing methods that were selected by experts , media activities , with 96 percent of respondents encompassed the most important factor in attracting foreign patients . in addition , a sales office in the country of origin with the language of that country , with 88% of comments was identified as the second most effective marketing method . furthermore among the advertising methods , the existence of information and advertising office in origin countries showed the greatest impact on attraction of the city s tourists . based on a thorough understanding of the strengths and weaknesses of health tourism in shiraz , demand and supply conditions were incorporated using the target network model and were included in four methods of create , maintain , abstinence and review ( table 3 ) . this study was conducted to verify the potential aspects of health tourism in shiraz city , southern iran . due to a variety of factors although the outputs extracted from this study are specific to the region , yet , planning and general methods presented in the paper is applicable to other regions of the country as well . the results showed that among the presented facilities in this city , eye care had the highest rank in the context of this demand , while the country of oman could get the top rank in terms of countries of the highest medical tourists . tribal sheikhs and residents of oman from long time ago have had constructive relations with iran . persisted sand storms caused people of oman to travel to iran many times per year . successful reputation in the field of infertility and treatment by a muslim physician caused arabs to trust an iranian physician which justifies traveling 16% of them to iran for medical tourism affairs . from collected data of our study , we can conclude that although geographical distance has a significant impact on the choice of destination therapy , yet this factor is affected by economical , environmental , cultural and social factors . the realities of social and cultural differences have persuaded muslim countries to manage their important care necessities within another muslim country . in the context of intercultural adaptation on tourism , one out of every 10 people is able to adapt to foreign conditions ( 23 ) . preparation and planning , provides tourist trips in the face of possible problems ( 24 ) . another study showed that the patients were looking for medical care of high quality and reasonable price ( 25 ) . our results showed that patients who traveled to shiraz had no concern on the latter fact but mostly considered the prominent muslim physicians , similar cultural affairs and close distance as the most standing factors in selecting this city . our results showed that despite the reputation of nemazee hospital , tourists nowadays prefer to seek treatment in private hospitals in shiraz . the survey also found that tourists are looking for luxury accommodation and prefer hospitals so called 5 stars ( 26 , 27 ) . this study showed that the patients were looking for medical care of high quality and reasonable price . according to kaufman and mueller ( 22 ) , the conditions for health tourism hotels are as follows : 35 star accommodations , health information , health care , personal and cultural programs and a variety of amenities . destination promotion is one of the marketing and manufacturing of marketing mix , it is important in recognizing and developing destinations ( 28 ) . evidence suggests that an office of information and related advertisements in destination media would have an important affect on attracting the patients to shiraz . a research showed that among the variables of notification mechanism , just the advertising media had a significant correlation with attracting the medical tourists ( 29 ) . this implies that the advertising opportunities in the international media in the field of health care , physicians , high quality services , and technology can lead to attracting the medical tourists ( 30 ) . for example , prepare pictures of health centers and putting them up at the airports and terminals ( 31 ) . in this study , the activities of middlemen , so called brokers , were identified as the main attraction factor . due to the familiarity in language and having cultural relations with applicants , these channels show great ability in marketing , attracting and encouraging people to select shiraz for health tourism affairs . all outputs of this study are included in table 3 which contains functional solutions to authorities . in creation section , a bird s eye view on it implies that health tourism in shiraz , although successful in meeting many requirement in this arena , is in a situation which demands different infrastructures to not only satisfy the present set of tourists , but to promote the attraction more numbers of them as much as possible . in the section of maintenance , previous results have been confirmed and it might be concluded that health tourism in shiraz and iran , has its base on close relation between origination and destination , as well as the popular fame of iranian physicians . some studies imply that neglecting the proper planning , not only will result to stop the process , but will cause to demolish even this small package and considering the competitive situation of present period , consequently the patients will be guided to other islamic countries . factors mentioned in restrain section not only have no indication in health tourism system of shiraz but are not requested by applicants . although , these factors might improve the rate of attraction of health tourists but considering that demand section does not need them and executive power should be implemented for other parts , investment on this category only waste the power and energy of the organizations . eventually , revision section , although named as deletion in the main model of targets network , but due to importance of all points in planning for health tourism , nothing should be neglected . deep looking into the case shows that this category has not been considered properly by demand section , so not only it should not be omitted but needs more attention in programming . our findings demonstrated that implementing 4 strategies in planning for medical tourism in shiraz would result into significant improvement of attraction more patients as follows : allocation the responsibility of the executive affairs to specific section to remove the weak points of managing- legislation.proper monitoring of convalescence period and presenting variable packages of tourism.policy making on absorbing the foreign investments to establish the project of shiraz health town.propaganda expands based on cultural closeness between supply and target bazaar , in addition to branding shiraz medical ability . allocation the responsibility of the executive affairs to specific section to remove the weak points of managing- legislation . policy making on absorbing the foreign investments to establish the project of shiraz health town . propaganda expands based on cultural closeness between supply and target bazaar , in addition to branding shiraz medical ability . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
background : the aim of the present study was to appraisal the prose and cone of shiraz city in terms of its potential in the context of health tourism.methods:the statistical sample included medical and health tourism sector in the city of shiraz in the northwest of fars province , south of iran . the efficient authorities on the topic were identified through the hospitals engaging in medical tourism . the research was based on theoretical sampling through which the experienced people of extensive knowledge on medical tourism were interviewed.results:active hospitals on attraction foreign patients averagely admit 15 and 50 foreign patients monthly and annually , respectively . arab countries in the persian gulf were detected as the main marketing for shiraz medical tourism . oman encompassed the highest rate with 20% of admitted patients . eye treatments with 30% and orthopedic with 6% were demonstrated as the highest and lowest rates in terms of foreign patients needs , respectively . closeness of cultural and religious beliefs and familial relationships on one hand and trusting to iranian physicians on the other hand were amongst the most reasons for selecting iran as a destination for medical tourism by patients.conclusion:implementing 4 strategies on monitoring medical tourism would result into significant improvement of attracting more foreigner patients not only into shiraz but all around iran . these items have been discussed in the text .
the genes involved in the determination of the gonads comprise the wilms ' tumor suppressor gene wt1 , the orphan nuclear receptor sf-1 and the high mobility group family member sox9 ( parker et al . 1999 ) . after determination , the differentiation of the testis depends on the testis - determining factor sry ( goodfellow and lovell - badge 1993 ) . sry induces the sertoli cells to differentiate and to secrete the mullerian inhibiting substance , which suppresses the development of the female reproductive tract ( gustafson and donahoe 1994 ) . later , under the influence of sertoli cells , the leydig cells develop ( ge et al . the fetal leydig cells originate prenatally and produce androgens required for the masculinization during fetal and neonatal life . they regress thereafter and are substituted during puberty by the adult leydig cells , which supply the testosterone necessary for completion of spermatogenesis and maintenance of male reproductive function . adult leydig cells do not derive from preexisting fetal cells but from undifferentiated mesenchymal stem cells ( mclaren 1998 ) . the factors that regulate the commitment and early differentiation of stem cells to adult leydig cell lineage are unknown . pdgf - a , a high - affinity ligand for the receptor tyrosine kinase pdgf - r , is required for embryonic and postnatal development ( betsholtz and raines 1997 ) . pdgf - a deficient animals develop lung emphysema secondary to the failure of alveolar septation ( bostrm et al . 1996 ) , defective oligodendrogenesis ( calver et al . 1998 ; fruttiger et al . 1999 ) , and skin and hair defects ( karlsson et al . 1999 ) . previous studies have revealed that pdgf - a may play a role in testicular development ( gnessi et al . 1995 ) and that leydig cells express pdgf - r ( gnessi et al . 1992 deficient mouse generated by targeted gene disruption . from this study , we conclude that pdgf - a is an essential factor for adult leydig cells development . pdgf - a null mutant mice , heterozygous , and wild - type ( wt ) littermates were obtained from heterozygous crosses all bred as 129ola / c57 b16 hybrids ( bostrm et al . transgenic mice carrying the reporter gene -galactosidase ( lacz ) under control of a 6-kb regulatory domain of the murine pdgf - r promoter were generated as previously described ( reinertsen et al . nonradioactive in situ hybridization using pdgf - a and pdgf - r probes was performed as described ( bostrm et al . testes to be stained by periodic acid - schiff ( pas)/haematoxylin , bromodeoxyuridine ( brdu ) , tdt - mediated dutp biotin nick end labeling ( tunel ) , pdgf - a , pdgf - r , relaxin - like actor ( rlf ) , and gata-1 immunohistochemistry were fixed in 4% buffered paraformaldehyde and paraffin embedded . for routine histology , sections were stained by pas / haematoxylin according to standard protocols . for brdu labeling , brdu ( sigma - aldrich ) was injected intraperitoneally ( 100 mg / g body mass ) . injected animals were killed 2 h later and the fixed testes were processed as described ( karlsson et al . apoptotic cells were detected by tunel using the apoptag plus in situ detection kit ( oncor ) according to the instructions of the manufacturer . sertoli cells were detected using a gata-1specific antibody ( santa cruz biotechnology ) ; leydig cells were detected using a rat anti - rlf antibody ( generously provided by professor richard ivell , institute of hormone and fertility research , hamburg , germany ) ; pdgf - a and pdgf - rpositive cells were detected using rabbit anti - pdgf - a ( rdi inc . ) and rat anti - pdgf - r ( pharmingen ) antibodies . the antibodies ( anti - gata1 , anti - pdgf - a , and anti - pdgf - r at 1:100 dilution ; anti - rlf at 1:1,000 dilution ) were incubated overnight at 4c . the avidin - biotin immunoperoxidase system with 3-amino-9-ethylcarbazole as chromogen was used to visualize bound antibodies ( histostain - plus kit ; zymed laboratories ) . for lacz staining , transgenic animals were fixed and stained with x - gal for lacz activity , and 10-m cryostat testicular sections were treated as described ( reinertsen et al . serum testosterone and luteinizing hormone ( lh ) levels were determined by radioimmunoassays using diasorin and amersham assay systems according to the manufacturers ' instructions . pdgf - a null mutant mice , heterozygous , and wild - type ( wt ) littermates were obtained from heterozygous crosses all bred as 129ola / c57 b16 hybrids ( bostrm et al . transgenic mice carrying the reporter gene -galactosidase ( lacz ) under control of a 6-kb regulatory domain of the murine pdgf - r promoter were generated as previously described ( reinertsen et al . nonradioactive in situ hybridization using pdgf - a and pdgf - r probes was performed as described ( bostrm et al . testes to be stained by periodic acid - schiff ( pas)/haematoxylin , bromodeoxyuridine ( brdu ) , tdt - mediated dutp biotin nick end labeling ( tunel ) , pdgf - a , pdgf - r , relaxin - like actor ( rlf ) , and gata-1 immunohistochemistry were fixed in 4% buffered paraformaldehyde and paraffin embedded . for routine histology , sections were stained by pas / haematoxylin according to standard protocols . for brdu labeling , brdu ( sigma - aldrich ) injected animals were killed 2 h later and the fixed testes were processed as described ( karlsson et al . apoptotic cells were detected by tunel using the apoptag plus in situ detection kit ( oncor ) according to the instructions of the manufacturer . sertoli cells were detected using a gata-1specific antibody ( santa cruz biotechnology ) ; leydig cells were detected using a rat anti - rlf antibody ( generously provided by professor richard ivell , institute of hormone and fertility research , hamburg , germany ) ; pdgf - a and pdgf - rpositive cells were detected using rabbit anti - pdgf - a ( rdi inc . ) and rat anti - pdgf - r ( pharmingen ) antibodies . the antibodies ( anti - gata1 , anti - pdgf - a , and anti - pdgf - r at 1:100 dilution ; anti - rlf at 1:1,000 dilution ) were incubated overnight at 4c . the avidin - biotin immunoperoxidase system with 3-amino-9-ethylcarbazole as chromogen was used to visualize bound antibodies ( histostain - plus kit ; zymed laboratories ) . for lacz staining , transgenic animals were fixed and stained with x - gal for lacz activity , and 10-m cryostat testicular sections were treated as described ( reinertsen et al . serum testosterone and luteinizing hormone ( lh ) levels were determined by radioimmunoassays using diasorin and amersham assay systems according to the manufacturers ' instructions . most die within a few days , but some individuals survive for as long as 6 wk , eventually dying of pulmonary failure . due to the lethal phenotype of the homozygous mutants , our analysis was restricted to male mice recovered between postnatal day 10 ( p10 ) and p42 , killed before the first signs of respiratory failure were apparent . pdgf - a/ males had no defects in the external genitalia and testicular descent appeared normal . 1 a ) , however , the testicular size reduction in the mutants was more pronounced than the average reduction of the body size , and this feature increased dramatically with age ( fig testis histology revealed profound differences between pdgf - a null mice and wt ( fig . 1 , c j ) . at p10 , / animals showed absence of tubular lumen whose formation was starting in the controls ; no significant difference was observed in tubular diameter and germ cells number . sertoli cells , interstitial cells , peritubular myoid cells ( pmc ) and extracellular matrix layers appeared intact as well ( fig . , the mutant testes had reduced seminiferous tubule diameter and poor lumen formation but , likewise control littermates , spermatogenesis had proceeded up to pachytene spermatocytes ; sertoli cells and pmc were normal . however , the null mice showed an initial reduction in number of morphologically recognizable leydig cells , scattered in the interstitium among small undifferentiated spindle - shaped mesenchymal cells of fibroblastic appearance ( fig . , round spermatids were frequently found in the tubules of + /+ animals and the interstitium was filled with leydig cells ; no spermatids and a further reduction of the interstitial cells population were observed in the mutants ( data not shown ) . at p32 and p42 all stages of the spermatogenic cycle and abundant leydig cells were seen in control testis ( fig . the tubular diameter was greatly reduced and a spermatocytic arrest with further loss of leydig cells was observed ( fig . 1 h ) . p42/ testis displayed a dramatic decrease of spermatocytes , adluminal multinucleated giant cells , and an almost complete absence of leydig cells ( fig . immunostaining of p10-p42/ testicular sections with an antibody against the sertoli cell specific gene gata-1 ( yomogida et al . 1994 ) confirmed the presence of sertoli cells in the null testis , indicating that the lack of mature forms of germ cells in pdgf - a/ mice did not result from a loss of the supporting cells ( data not shown ) . we also performed an immunohistochemical analysis of rlf , which is a specific marker for the mature forms of fetal as well as adult leydig cells ( balvers et al . anti - rlf staining identified mature fetal leydig cells in both mutant and wt p10 testis ( fig . b ) . at p18 , concomitantly with the involution of fetal leydig cells and with the first appearance of the adult leydig cells progenitors , no rlf was expressed in / testis while sporadic punctate staining was seen in the interstitium of + /+ testis ( fig . 2c and fig . here there was no staining in the few interstitial cells of the ko testis , while the majority of the interstitial cells of the wt testis exhibited rlf - specific staining ( fig . f ) . by day 32 and onward , a more homogeneous cytoplasmic distribution of rlf positivity within the interstitial cells of the wt animals was observed while , concomitantly with the progressive depletion of the interstitium , rlf staining in the ko testis was absent ( data not shown ) . this rlf staining pattern indicates that the mutant prepubertal testis contains mature fetal leydig cells and confirms the absence of the adult leydig cell population in older / testis . to analyze whether the reduced size of the pdgf - a mutant testis and its histologic appearance could be due to decreased cell proliferation and/or increased apoptosis , brdu and tunel labeling were performed . at p18 , p25 , p32 , and p42 there was no difference in brdu incorporation of the actively proliferating germ cells between wt and mutant testes ( fig . 3 , a d ; data not shown ) . during the third week of postnatal life , the stem cell precursors of the adult leydig cell proliferate ( ge et al . accordingly , brdu staining was observed in some interstitial cells of p18 wt animals ( fig . 3 a ) ; on the contrary , no brdu labeling was seen in p18 pdgf - a/ littermates ( fig . regarding tunel , few apoptotic cells were seen in the tubules of both wt and / siblings between p10 and p32 ( data not shown ) . however , at p42 a large number of spermatocytes undergoing apoptosis was observed in null mice compared with control ( fig . 3e and fig . thus , an arrest of differentiation followed by increased apoptosis seem to be responsible for the seminiferous tubules aspect in the pdgf - a/ testes . the lack of brdu incorporation and the absence of tunel labeling in the intertitium of / testis , thus , we speculate that in the pdgf - a/ testis the normal pubertal replacement of the fetal leydig cells with the adult population of cells is deranged because of a deficiency in the commitment of the adult leydig cell precursors to proliferate and perhaps to differentiate . such a model requires the knowledge of the localization of pdgf - a and its receptor in normal testis . in situ hybridization for pdgf - a and pdgf - r in embryonic - day-17.5 ( e17.5)-p30 wt testis showed the mrnas expression in seminiferous epithelium and interstitial mesenchymal cells , respectively ( fig . later , some pdgf - a positive tubules and distinct populations of pdgf - rpositive interstitial cells could be seen . pdgf - r expression was moreover localized using transgenic mice carrying the reporter gene -galactosidase ( lacz ) under control of the murine pdgf - r promoter . according to the in situ data , the immunohistochemistry for pdgf - a confirmed the intratubular expression of the growth factor which , in agreement with previous results ( gnessi et al . 1995 ) , was mainly localized in the cytoplasm of the sertoli cells ( fig . 5 ) . at p18 , although with different intensities , all the tubules were stained ( fig . 5 a ) . at p42 , in line with the in situ findings , only the sertoli cells in some tubules , corresponding to spermatogenic stages ix - x ( russell et al . altogether , these results indicate that the pdgf - a expression in sertoli cells depends on the stage of maturation of the associated germ cells . at p42 5 b ) , which is consistent with the reported production of pdgf - a by adult leydig cells in vitro ( gnessi et al . concerning pdgf - r , in prepubertal animals the immunostaining was localized in the interstitial cells of both + /+ and / testis , although in the latter the interstitial cells were less in number ( fig . 5c and fig . the wt testis continued to show pdgf - rpositive cells between the tubules ( fig . 5 e ) , while the null testis showed a steadily decreasing number of positive cells , culminating in their complete absence at p42 ( fig . 5 f ) . the comparison between the testicular defects found in / mice and the normal expression pattern of pdgf - a and its receptor , indicates that paracrine pdgf - a / pdgf - r signaling constitutes a critical part of the epithelial - mesenchymal interaction , essential for adult leydig cells development . pdgf - a does not influence the fetal generation of leydig cells , as suggested by both the normal adrogenization and rlf - positive interstitial immunohistochemical staining of prepubertal / animals . due to the lack of specific markers , we could not produce direct evidence that among the interstitial pdgf - rpositive cells are indeed the precursors of the adult leydig cells , but the spatiotemporal distribution of pdgf - r-interstitial cells in normal mice seems to suggest this possibility . it is also reasonable to predict that a cell type specifically lost in pdgf - a/ mice should carry the receptor for pdgf - a , and should locate close to the source of the ligand , as is the case for the pdgf - rpositive interstitial mesenchymal cells described . however , given the chemotactic activity of pdgf - a ( heldin and westermark 1999 ) , we can not exclude that , similarly to what is described for other pdgf - dependent developmental processes ( bostrm et al . 1997b ; calver et al . 1998 ) , pdgf - a might influence the long - range migration of leydig stem cells , thus preventing their arrival in the gonads from primordial germ layer source besides proliferation and differentiation . regardless of whether pdgf - a influences the migration of the leydig cells precursors or their proliferation / differentiation , the main consequence of the lack of replacement of the fetal leydig cells with adult cells would be a progressive reduction of testosterone , followed by spermatogenic arrest and germ cells degeneration . the testicular phenotype of the null animals strongly indicates that this is the case . in / testis the initiation of spermatogenesis , which depends mainly on follicle - stimulating hormone , occurs normally , while its testosterone - dependent subsequent completion and maintenance ( sharpe 1994 ) are lacking . indeed , serum testosterone levels were similar in prepubertal / early pubertal ( p10-p18 ) wt ( 1.79 0.7 ng / ml ; n = 5 ) and mutant mice ( 2.0 0.89 ng / ml ; n = 3 ) , while in / older animals , circulating testosterone was not detectable , confirming that the spermatogenic arrest and germ line apoptotic regression in pdgf - a/ animals are mediated by androgen deficiency . they were similar in / ( 1.6 0.4 ng / ml ; n = 4 ) and + /+ ( 1.4 0.5 ng / ml ; n = 6 ) animals between p10 and p25 . in agreement with the testosterone reduction , in a null p42 animal the levels of lh ( 7.5 ng / ml ) were higher than in control littermates ( 3.8 0.3 ng / ml ; n = 4 ) . these data indicate that in pdgf - a null animals , the fate of the leydig cells can not be ascribed to an lh deficiency . in conclusion , although lh , androgens and igf-1 are recognized important elements required for the completion of leydig cell maturation , they can not be the factors that regulate the commitment of stem cells to adult leydig cell lineage ( benton et al . in fact , initial proliferation of stem cells can occur when lh is absent ( teerds et al . 1989 ) , and animals with androgen insensitivity ( murphy et al . 1994 ) or igf-1 gene deletion ( baker et al . 1996 ) develop leydig cells , suggesting that a separate factor regulates the earliest stage of adult leydig cell evolution . our findings indicate that pdgf - a may be this factor , and suggest that adult leydig cells arise from pdgf - r progenitors . the pivotal role played by pdgf - a in adult leydig cells development suggests that pdgf - a may be a potential target for the master genes involved in testicular organogenesis . in this respect , it is worth mentioning that wt1 , whose spatio - temporal sertoli cells expression profile ( pelletier et al . 1991 ; mundlos et al . 1996 ) is virtually superimposable on that of pdgf - a , can either repress or activate the pdgf - a gene ( wang et al . 1993b ; gashler et al . , 1992 ) , and has been involved in posttranscriptional processing within the sertoli cells ( larsson et al . the dramatic testicular phenotype of the pdgf - a/ animals is also of interest because recent studies have reported detection of pdgf - a and pdgf - r in the human testis ( basciani , s. , l. gnessi , m. arizzi , n. rucci , s. mariani , s. ulisse , e.a . proceedings of the 81st annual meeting of the endocrine society , san diego , ca . these considerations , coupled with our findings , may furnish a new approach for the understanding of the wt1-mediated mechanisms involved in testicular development and perhaps of wt1-dependent urogenital abnormalities and tumorigenesis ( hastie 1994 ; reddy and licht 1996 ; menke et al . 1998 ) . moreover , a local impairment of the pdgf - a/ pdgf - r system may provide a new conceptual framework for the comprehension of some forms of leydig cells hypoplasia , with high lh , low testosterone , and no mutations of the lh receptor gene ( zenteno et al . 1999 ) , and of cases of spermatogenetic failure , which are probably due to intratesticular testosterone deficiency in man ( sharpe 1994 ) .
platelet - derived growth factor ( pdgf)- a deficient male mice were found to develop progressive reduction of testicular size , leydig cells loss , and spermatogenic arrest . in normal mice , the pdgf - a and pdgf - r expression pattern showed positive cells in the seminiferous epithelium and in interstitial mesenchymal cells , respectively . the testicular defects seen in pdgf - a/ mice , combined with the normal developmental expression of pdgf - a and pdgf - r , indicate that through an epithelial - mesenchymal signaling , the pdgf - a gene is essential for the development of the leydig cell lineage . these findings suggest that pdgf - a may play a role in the cascade of genes involved in male gonad differentiation . the leydig cell loss and the spermatogenic impairment in the mutant mice are reminiscent of cases of testicular failure in man .
therapeutic hypothermia instituted within 6 h of birth has been shown to improve neurodevelopmental outcomes in term newborns with moderate to severe hypoxic ischemic encephalopathy ( hie ) . the majority of infants who would benefit from cooling are born at centers that do not offer the therapy , and adding the time for transport will result in delays in therapy , that may lead to suboptimal or no neuroprotection for some patients . our objective was to evaluate the effect of our center 's experience with therapeutic hypothermia on neonatal transport . retrospective review of all cases of therapeutic hypothermia at a single neonatal intensive care unit from 2005 to 2009 . of 50 infants with hie treated with hypothermia , 40 were outborn and 35 were cooled on transport . the majority of patients were passively cooled by the referring clinicians , then actively cooled by our transport team . overcooling to < 32 c occurred in 34% of patients , but there were no significant differences in admission vital signs or laboratory values between overcooled and appropriately cooled infants . the average time after birth of initiation of passive cooling was 1.4 h and active cooling was 2.7 h compared with the time of admission to our unit of 5.9 h. we discuss the important aspects of our program , including the education of referring and receiving clinicians and avoidance of overcooling . hypoxic ischemic encephalopathy ( hie ) affects approximately 1 per 1000 term newborns , with an estimated 20% mortality and 25% neurodevelopmental impairment in survivors . until recently , treatment for neonates with hie three multicenter randomized controlled trials were published showing that induction of mild hypothermia resulted in significantly improved neurodevelopmental outcome in neonates 36 weeks gestation with acute perinatal hie . timing of induction of hypothermia after an asphyxial brain injury is critical for optimum neuroprotection . studies in animal models suggest that hypothermia should be started within 6 h of an acute asphyxial event , during the latent phase before the onset of secondary cerebral energy failure . studies in near - term fetal sheep with a cerebral ischemic insult showed optimum neuroprotection if hypothermia was induced within 90 min of reperfusion . delayed hypothermia continued to show some benefit if started < 5.5 h after reperfusion but not if delayed until 8.5 h , at which time animals were experiencing post - asphyxial seizures . there is also evidence that the duration of the latent phase between primary and secondary energy failure is inversely proportional to the severity of the ischemic insult , suggesting that the therapeutic window for starting hypothermia therapy may be even shorter than 6 h in profound asphyxial insults . on the basis of these and other studies , most clinical trials of induced hypothermia for asphyxiated neonates have begun treatment within 6 h of birth . asphyxiated neonates have complex medical needs and should be cared for in intensive care units that can provide multidisciplinary subspecialty evaluation and treatment . most neonates who meet the criteria for hypothermia therapy will be born in hospitals that do not provide this high level of care . as the time to transport patients to regional neonatal intensive care units ( nicus ) offering hypothermia therapy may exceed the therapeutic window for neuroprotection , some centers have implemented cooling during neonatal transport . in the pilot study of eicher et al . published in 2005 , in which our center participated , two more recent clinical trials , toby ( total body cooling ) and ice ( infant cooling evaluation ) , cooled some neonates during transport . the toby trial allowed for cooling to 33 to 34 c during neonatal transport , unless it was likely that the infant would be transferred by 3 h after birth . passive cooling was achieved by turning off the radiant warmer and , if necessary , active cooling with gel packs was used to achieve the target temperature . a similar approach to inducing hypothermia during transport was used in the ice trial . passive cooling during neonatal transport ( withholding external heat sources ) was described in a case report of two infants with hie whose rectal temperatures on arrival to the tertiary nicu were 34.3 and 33.4 c . in a recent report , passive cooling was used in 18 babies during transport to a regional hypothermia center . on arrival , only four babies had temperatures in the desired range of 33 to 35 c , whereas eight had admission temperature in the 35 to 37 c range , and six were overcooled . passive overcooling can be a significant problem , particularly in severely asphyxiated neonates in whom temperature is only intermittently monitored . these reports highlight the need for education , experience , and perhaps new protocols for achieving target neuroprotective temperatures during neonatal transport . hypothermia for perinatal hie is a relatively new , evolving therapy and research into long - term outcomes and other issues is ongoing . in 2006 , the national institutes of child health and human development issued a statement recommending that centers choosing to offer hypothermia therapy do so only in the context of protocols published in larger clinical trials and with systematic data collection . in 2008 , we published our first 2 years ' experience with implementing a hypothermia for hie program in our nicu , and in the current report , we describe our 4 year 's experience with therapeutic hypothermia during neonatal transport . in march 2005 , the university of virginia ( uva ) nicu instituted a protocol for therapeutic hypothermia for neonates with moderate to severe hie . the eligibility criteria are similar to those used in published randomized controlled trials , including infants 36 weeks gestation and 6 h of age at the start of therapy with at least one indicator of an acute perinatal hypoxic ischemic event and at least two indicators of moderate or severe encephalopathy on physical examination . parents receive verbal and written information about hie and hypothermia therapy , but signed parental consent is not required . the uva nicu serves as a regional referral center for 10 hospitals and 40% of admissions are outborn . the median one - way travel distance to our referring hospitals is 64 miles ( range 3 to 160 miles ) and 95% of transports are accomplished by ground . several nicus beyond our referral region that do not offer hypothermia therapy also refer patients to our center for cooling . as many outborn patients qualifying for hypothermia therapy would not arrive at the uva nicu before 6 h of age , it was decided that therapy would begin at the referring hospital and continue during transport . after developing written protocols for hypothermia therapy on transport , education sessions additional training sessions were held with the uva neonatal emergency transport system clinicians , which includes specially trained nicu nurses , respiratory therapists and emergency medical technicians . training sessions focused on ( 1 ) rationale for hypothermia and clinical trial results , ( 2 ) eligibility and exclusion criteria , ( 3 ) neurological examination findings of moderate to severe hie and ( 4 ) practical aspects of passive and active cooling before and during the transport . passive cooling by the referring clinicians was recommended in the first 2 years of our program . since 2007 , level iii nicus , which refer patients for hypothermia therapy , have begun active cooling while awaiting arrival of our transport team , but all other centers continue to use passive cooling only . the typical sequence of events for initiating hypothermia therapy for outborn infants referred to our center is as follows : outreach education to referring clinicians includes a recommendation to turn off the radiant warmer as soon as the diagnosis of acute perinatal moderate to severe hie is considered ( with temperature monitoring at least every 15 min).when an infant is born with suspected acute perinatal hie , the referring clinician calls the neonatology attending or fellow to arrange transfer.the uva neonatal emergency transport system team is dispatched.criteria for an acute perinatal hypoxic ischemic event and physical examination evidence of moderate or severe encephalopathy are discussed.if the infant meets the criteria for therapeutic hypothermia , a recommendation is made to continue passive cooling and closely monitor the rectal temperature ( at least every 15 min , or continuously if possible ) . active cooling in primary care hospitals before arrival of the transport team is discouraged.the uva transport team arrives at the referring hospital and initiates continuous rectal temperature monitoring.if necessary , cool gel packs ( 10 c , wrapped in a cloth ) are briefly applied to the head and/or trunk until the rectal temperature is < 34 c ( active cooling).the infant is placed in a room temperature transport incubator.the rectal temperature is continuously monitored during transport and adjustments are made to maintain a target temperature of 33 to 34 c . adjustments include placing a receiving blanket on the baby if the rectal temperature drops below 33 c , or a wrapped cool gel pack if the temperature rises above 34 c . the air temperature of the transport incubator is increased , if the patient 's rectal temperature continues to fall despite covering with a blanket . a warm gel pack is applied if the temperature drops below 31 c and removed once the temperature rises above 32 c.a database of patient information is maintained on all patients undergoing hypothermia therapy in our center . the uva institutional review board has approved the review of de - identified patient information for publication . for this report , we reviewed clinical data on all patients undergoing therapeutic hypothermia in the first 4 years of the program , from march 2005 to february 2009 . vital signs and laboratory values of outborn infants on arrival to uva were compared between infants who were overcooled ( minimum temperature before admission 32 c , n=12 ) and those who remained closer to target temperature ( minimum temperature > 32 c , n=23 ) , by unpaired , two - tailed t - tests using graphpad prism version 4.03 ( graphpad software , la jolla , ca , usa ) , with significance set at p<0.05 . outreach education to referring clinicians includes a recommendation to turn off the radiant warmer as soon as the diagnosis of acute perinatal moderate to severe hie is considered ( with temperature monitoring at least every 15 min ) . when an infant is born with suspected acute perinatal hie , the referring clinician calls the neonatology attending or fellow to arrange transfer . if the infant meets the criteria for therapeutic hypothermia , a recommendation is made to continue passive cooling and closely monitor the rectal temperature ( at least every 15 min , or continuously if possible ) . the uva transport team arrives at the referring hospital and initiates continuous rectal temperature monitoring . if necessary , cool gel packs ( 10 c , wrapped in a cloth ) are briefly applied to the head and/or trunk until the rectal temperature is < 34 c ( active cooling ) . the infant is placed in a room temperature transport incubator . the rectal temperature is continuously monitored during transport and adjustments are made to maintain a target temperature of 33 to 34 c . adjustments include placing a receiving blanket on the baby if the rectal temperature drops below 33 c , or a wrapped cool gel pack if the temperature rises above 34 c . the air temperature of the transport incubator is increased , if the patient 's rectal temperature continues to fall despite covering with a blanket . a warm gel pack is applied if the temperature drops below 31 c and removed once the temperature rises above 32 c . a total of 50 infants underwent hypothermia therapy for moderate to severe hie in the uva nicu from march 2005 to february 2009 . the uva neonatal emergency transport system team transported 39 of these patients ( all by ambulance ) and one patient was transported by helicopter by the referring hospital 's neonatal transport team . of the 40 outborn patients , 35 underwent passive and/or active cooling before and during the transport . altogether , 25 patients had passive cooling initiated by the referring clinicians ( turning off the radiant warmer ) . for 23 of these patients , active cooling ( applying cool packs ) was initiated by our transport team at the referring hospital and continued during transport , and the other 2 patients continued with passive cooling during transport ( one with a very short transport time and one transported by helicopter by the referring hospital team ) . 10 patients at level iii referring nicus had active cooling initiated by the referring neonatologists before the arrival of our transport team . five outborn patients were not cooled until arrival at our center , either because hypothermia was not considered until the infant was assessed at our nicu ( four patients , three in the first year of the program ) or the transport time was very short ( one patient ) . one patient who qualified for hypothermia therapy was excluded because of shock and disseminated intravascular coagulation with active bleeding . figure 1 compares the cooling start time for inborn and outborn patients and the hours of age on arrival to the uva nicu . the time of arrival of the uva transport team to the referring hospital was 2.91.4 h after birth ( range 0.37 to 5.5 h ) . the first rectal temperature recorded by our transport team after arrival at the referring hospital was 34.72.0 c . the patients who were actively cooled at the referring nicu ( n=10 ) had rectal temperature 33.92.1 c when our transport team arrived at the referring hospital , compared with 34.41.9 c in the infants passively cooled ( n=25 ) and 36.60.3 c in those undergoing conventional thermal management ( n=5 ) . the time from birth to achieve core temperature < 34 c was 2.61.8 h for inborn infants ( n=10 ) , 3.91.6 h for infants cooled before and during transport ( n=35 ) , and 9.86.2 h for outborn infants not cooled until the arrival at our unit ( n=5 ) . as shown in figure 1 , one patient admitted in the first year of the hypothermia program was not cooled until 19 h of age due to a late decision to initiate therapy . figure 2 shows the rectal temperature for outborn patients when the transport team arrived at the referring hospital and the temperature on arrival to our unit . the uva admission rectal temperature range was 29.2 to 34.4 c for the 33 infants actively cooled on transport , 34.4 to 34.8 c for the two infants passively cooled on transport and 36.5 to 38.1 c for the five infants not cooled on transport . admission characteristics of the 50 infants in our therapeutic hypothermia program march 2005 to february 2009 are summarized in table 1 . of the 35 infants cooled before and during transport , 23 ( 66% ) maintained temperatures in the range 32 to 35 c over the course of the entire transport . five infants ( 14% ) had at least one core temperature < 30 c , and the duration of temperature < 30 c was 1.00.6 h. seven infants ( 20% ) had at least one core temperature between 30 and 32 c , and the duration of temperature in this range was 1.61 h. no cardiac arrhythmias other than sinus bradycardia were noted in any patient . when comparing patients who were overcooled to < 32 c ( n=12 ) with those who maintained temperature in the 32 to 35 c range ( n=23 ) , there was a trend toward lower birth weight in those infants who were overcooled ( 2948722 g vs 3284693 g , p=0.18 ) . there were no significant differences in admission vital signs or laboratory tests between the groups , although there was a trend toward lower platelet counts ( 14345 vs 19318 , p=0.06 ) and higher blood sugar ( 189101 vs 13965 , p=0.08 ) in overcooled infants vs appropriately cooled infants , respectively . figure 3 shows , by year , the uva admission temperature for patients cooled on transport . the mean admission temperature increased every year and by 2008 two - thirds of patients fell in the target range of 33 to 34 c . the timing of initiation of therapeutic hypothermia is critical , with animal studies showing optimum neuroprotection , if hypothermia is induced within 6 h of an acute asphyxial insult . in our center , 80% of newborns eligible for hypothermia therapy from 2005 to 2009 were born at the referring hospitals , and nearly half of the outborn patients arrived at our center > 6 h after birth . initiating hypothermia therapy at the referring hospital resulted in an average time savings of 3 h , which in some cases may result in improved outcomes . in this report , we highlight our efforts to educate health - care providers about passive and active cooling of neonates with hie and share suggestions for avoiding overcooling . key points in the implementation of a hypothermia therapy on transport program are summarized in table 2 . educating referring clinicians about when and how to initiate therapeutic hypothermia is a cornerstone to a successful program . we recommend that in cases of acute perinatal distress with suspected hie , the radiant warmer should be turned off and the baby 's temperature closely monitored during initial stabilization and neurological assessment . if the neurological examination is not consistent with moderate to severe encephalopathy , the baby can then be transitioned to routine thermal care . if the baby meets criteria for therapeutic hypothermia , passive cooling is continued until the arrival of our transport team . asphyxiated , encephalopathic newborns are notoriously poor at thermoregulation and some will passively cool to a core temperature in the 33 to 34 c range if left uncovered at room temperature . in fact , in some cases in our series , passive cooling resulted in temperatures below the target range . on the other hand , passive cooling did not achieve optimum neuroprotective temperatures in many patients , with 40% of patients having rectal temperature > 35 c on arrival of our transport team and 20% with temperature > 37 c . active cooling of neonates with hie can be accomplished with brief application of a wrapped cool gel pack . in general this , is done by our neonatal transport team , but several level iii nicus referring patients to our center have begun active cooling before the arrival of our team . in either case , it is important to continuously monitor rectal temperature and remove the cool pack when temperature falls below 34 c to avoid overcooling . in our experience , active cooling resulted in at least one recorded temperature < 30 c in 14% of patients and < 32 c in 34% . most patients who were overcooled had only intermittent rather than continuous rectal temperature monitoring , and had ice packs ( 0 to 4 c ) applied rather than cool gel packs ( 7 to 10 c ) . although we did not see statistically significant differences in admission vital signs or laboratory values in overcooled compared with appropriately cooled patients , the number of patients in each group was too small to draw any conclusions about the detrimental effects of overcooling . there were trends toward lower platelet counts and higher blood sugar in the overcooled groups , which , if borne out in larger numbers of patients , could be a result of the hypothermia or simply an indicator of a more severe degree of asphyxia . we did find that overcooled patients were more likely to be classified as severe , rather than moderate , encephalopathy , possibly contributing to a more deranged thermoregulatory state . in any case , efforts should be made to avoid overcooling neonates , and we found that use of continuous rectal temperature monitoring and judicious use of cooling packs has resulted in more patients arriving at our center in the target temperature range in recent years ( figure 3 ) . neonatal transport teams instituting a new protocol for induced hypothermia should consider beginning with either passive cooling or active cooling targeting a slightly higher temperature to avoid overcooling during the start - up phase . as therapeutic hypothermia is increasingly used for neonates with hie , whether and how to cool patients before arrival to a hypothermia center will be an important issue to resolve . results of recently completed clinical trials , which cooled some babies during transport to study centers , are likely to provide important information about this practice . we have found that , with experience and education , our referring and transport clinicians can induce and maintain hypothermia for asphyxiated neonates before and during transport . neuroprotective temperatures are often achieved several hours sooner with this approach , and efforts to develop and evaluate protocols for safe transport of neonates undergoing induced hypothermia are warranted .
objective : therapeutic hypothermia instituted within 6 h of birth has been shown to improve neurodevelopmental outcomes in term newborns with moderate to severe hypoxic ischemic encephalopathy ( hie ) . the majority of infants who would benefit from cooling are born at centers that do not offer the therapy , and adding the time for transport will result in delays in therapy , that may lead to suboptimal or no neuroprotection for some patients . our objective was to evaluate the effect of our center 's experience with therapeutic hypothermia on neonatal transport.study design : retrospective review of all cases of therapeutic hypothermia at a single neonatal intensive care unit from 2005 to 2009.result:of 50 infants with hie treated with hypothermia , 40 were outborn and 35 were cooled on transport . the majority of patients were passively cooled by the referring clinicians , then actively cooled by our transport team . overcooling to < 32 c occurred in 34% of patients , but there were no significant differences in admission vital signs or laboratory values between overcooled and appropriately cooled infants . the average time after birth of initiation of passive cooling was 1.4 h and active cooling was 2.7 h compared with the time of admission to our unit of 5.9 h.conclusion:we discuss the important aspects of our program , including the education of referring and receiving clinicians and avoidance of overcooling .
approximately 20% of lumbar hernias are congenital in nature , while remainder are acquired . congenital lumbar hernia ( clh ) is associated with a multitude of congenital anomalies involving various other organ systems of the body . less than 50 cases of congenital lumbar hernia associated with other congenital anomalies have been reported in english literature making it a rare entity [ 1 , 2 ] . we aim to study the incidence , age at presentation , sex , associated anomalies , surgical management , and postoperative morbidity and mortality of congenital lumbar hernia in pediatric patients . retrospective analysis of all patients admitted with congenital lumbar hernia in the department of pediatric surgery at pt . b. d. sharma , pgims rohtak , haryana , india , over a period of 15 years from january 2000 to december 2015 was analyzed for sex , age , associated anomalies , site of hernia , clinical presentation , radiological investigation , surgical management , and postoperative morbidity and mortality . all the patients were diagnosed clinically with reducible swelling in lumbar region present since birth , which increased in size on crying or coughing ( figure 1 ) . . only 2 of the hernias were found in inferior triangle of petit . left sided hernia ( figure 2 ) mri and ct spine were also done to look for the anomalies of spinal cord . lumbocostovertebral syndrome was found in all the patients in addition to other rare anomalies ( shown in table 2 ) . the patients are waiting for the surgery as they are less than 6 months of age . 1 patient was lost to follow - up and hence could not be operated on . sac was opened ; contents were identified and reduced . in most of the cases , small intestine and large intestine defect was repaired using local healthy fasciomuscular tissue . in our study , 2 cases had large defect ( 7 7 cm ) , where meshplasty was done with drainage ( figure 5 ) . in postoperative period , patients were started orally after 1 day and discharged after day 7 . stitches were removed on day 10 . in case of meshplasty , drain was removed after 72 hours . wound infection was seen in 2 cases which were managed with local dressing and antibiotics . all the operated on cases are doing well on follow - up with no evidence of recurrence of hernia . they are being followed up in orthopaedics also for the correction of disability caused by lumbocostovertebral syndrome . congenital lumbar hernias usually present as large compressible soft - tissue mass in the lumbar region . inferior lumbar triangle is composed of the iliac crest inferiorly and the margins of two muscles latissimus dorsi ( posteriorly ) and external abdominal oblique ( anteriorly ) . superior lumbar triangle is formed medially by the quadratus lumborum muscle , laterally by the internal abdominal oblique muscle , and superiorly by the 12th rib . the floor of the superior lumbar triangle is the transversalis fascia and its roof is the external abdominal oblique muscle . most of the hernias were in superior triangle , while only 2 were in inferior triangle . the hernial sac may be empty or may contain retroperitoneal fat , the bowel , kidney , omentum , colon , stomach , ovary , spleen , appendix , and kidney . in the present study , most common sac contents were gut and retroperitoneal fat . in 1 case , however , kidney was the content . from the etiopathogenic point of view , lumbar hernias may be congenital presenting soon after birth or in the first years of life , or acquired ( spontaneous , posttraumatic , postoperative , and a postregional suppurative process ) [ 1 , 4 ] . about 20% of the lumbar hernias are congenital and the rest are classified as acquired . it is proposed that a single somatic mutation in early embryogenesis , possibly due to transient anoxia , causes derangement of lumbar muscles and aponeuroses resulting in herniation leading to congenital lumbar hernia ; however , the causes of congenital hernias have not been completely defined . the congenital form may be isolated , although it often occurs in association with the lumbocostovertebral syndrome , described by touloukian in 1972 , which includes one or more of the following anomalies : hemivertebra , rib abnormalities ( absence , hypoplasia , fusion , and gap ) , aplasia of dorsolumbar muscles , and scoliosis eventually with the convex curve on the site of hernia . other associated abnormalities reported include absence of the right kidney , eventration of the right hemidiaphragm , inguinal hernia , malrotation of the gut , and arm . in our study a roentgenogram of the lumbar region may detect air filled bowel loops in the sac , whereas ct and ultrasonography are most useful diagnostic tools especially to detect solid organs in the sac . possible complication of lumbar hernia may include incarceration but it is unusual because of the broad neck of sac . early elective surgical intervention to close the defect along with repair using local tissues is the modality of choice [ 1 , 7 ] . the treatment of lumbar hernia is surgical and should be performed in the first year of life [ 8 , 9 ] . if the size of the defect is large or if there is extensive muscular hypoplasia , prosthetic material may be required for surgical repair [ 1 , 10 ] . mainly all the cases of clh reported in literature include case reports of single cases and most of them did not have any other associated anomaly . in literature , there are only two major case series on clh conducted so far , and they have been compared with our study here . unusual features in this study included the relatively high incidence of inferior lumbar hernia , contrary to our study where only 2 of the hernias were found in inferior triangle of petit . other unusual findings in their study were presentation at the age of 6 years in one case , and an association with hydrometrocolpos and anorectal malformation . in seven patients there were two patients with bilateral hernias in this series , similar to our study , where 1 patient had bilateral hernia . all cases studied by sharma et al . were in the age group of 1 day to 6 years . in our study , we have described 14 patients with clh out of whom 11 have already been successfully operated on by open technique , without any recurrence , while surgery is awaited in 2 and 1 patient was lost to follow - up . after this study of 14 patients , we concluded that congenital lumbar hernia is very rare among hernias . surgery should be carried out within 1 year of age . for a defect of < 5 cm , primary repair is done . for a defect of > 5 cm ,
aim . congenital lumbar hernia is an uncommon anomaly with only few cases reported in the english literature . this study was done to study the incidence , age at presentation , sex , associated anomalies , surgical management , and postoperative morbidity and mortality of congenital lumbar hernia in pediatric patients . methods . retrospective analysis of all patients of clh over a period of 15 years ( january 2000 to december 2015 ) was analyzed . results . a total of 14 patients were encountered in this series . all presented within first 2 years of age . 12 were males and 2 were females . all of them presented with swelling in lumbar region . 13 were unilateral and 1 was bilateral . left sided hernia was observed in 2 cases only . lumbocostovertebral syndrome was found in all the patients in addition to other rare anomalies . all cases were managed with open surgical repair . wound infection was seen in 2 cases . there was no mortality in our series . conclusion . clh is very rare among hernias . surgery should be carried out within 1 year of age . for a defect of < 5 cm , primary repair is done . for a defect of > 5 cm , meshplasty should be considered . prognosis is excellent .
lymphoblastic lymphoma ( lbl ) is an aggressive form of non - hodgkin s lymphoma ( nhl ) , comprising approximately 2% of all adult nhl cases . lbl generally shows a high response rate to initial chemotherapy ; however , relapse is common and overall survival is poor with treatment using conventional lymphoma regimens . recently developed chemotherapy regimens include intensive remission induction chemotherapy , central nervous system ( cns ) prophylaxis , consolidation chemotherapy , and subsequent maintenance therapy for 12 - 18 months . here , we report on a case in which complete remission ( cr ) was achieved and the patient survived more than seven years after only one cycle of induction chemotherapy and consolidation therapy . a 30-year - old female presented to our hospital with dyspnea and chest discomfort for three weeks . findings on physical examination were as follows : body temperature , 36.8c ; blood pressure , 140/60 mm hg ; and pulse rate , 112 beats per minute . heart sounds were normal , with no murmur . decreased lung sounds were detected in the right lower lung fields . on palpitation , bilateral supraclavicular lymph nodes were found to be approximately 1 cm in size , non - tender , and fixed . results of laboratory tests were as follows : white cell count , 6,640 /l ; hemoglobin , 15.3 g / dl ; and platelets , 450,000 /l . blood chemistry findings were as follows : aspartate aminotransferase , 34 iu / l ; alanine aminotransferase , 23 computed tomography ( ct ) of the chest showed a large mediastinal mass , right pleural effusion , pericardial effusion , and enlarged lymph nodes in the supraclavicular area , internal mammary area , and both axillae ( fig . abdominal ct scan showed enlarged lymph nodes in the left para - aortic and retrocaval areas ( fig . hematoxylin and eosin staining showed immature nuclei with fine chromatin , and convoluted nuclear contours in most tumor cells ( fig . no evidence of bone marrow involvement was found , and no tumor cells were detected in cerebrospinal fluid . one cycle of hyperfractionated cyclophosphamide , vincristine , doxorubicin , and dexamethasone ( hyper - cvad ) chemotherapy consisting of intravenous hyperfractionated cyclophosphamide ( 300 mg / m every 12 hours on days 1 - 3 ) , vincristine ( 2 mg / m on day 4 ) , doxorubicin ( 50 mg / m on day 3 ) , and dexamethasone ( 40 mg on days 1 - 4 ) was administered . for cns prophylaxis , intrathecal methotrexate ( 12 mg on day 2 ) four days after initiation of remission induction chemotherapy , chest radiography showed that the mediastinal mass had almost disappeared ( fig . one cycle of high - dose methotrexate ( 1 g / m on day 1 ) and cytarabine ( 3 g / m every 12 hours on days 2 and 3 ) was then administered . three additional cycles of hyper- cvad , high - dose methotrexate , and cytarabine were scheduled , but the patient refused all further chemotherapeutic treatment . seven months after hyper - cvad chemotherapy , chest radiography showed no mediastinal mass and positron emission tomography ( pet)-ct scans showed no hypermetabolic lesion ( fig . at the time of preparation of this case report , the patient had been in cr for 87 months . t - lbl is typically seen in adolescents and young adults , predominantly in males ( male : female , 3:1 ratio ) . t - lbl presents as a mediastinal mass in 60 - 70% of cases , and is often accompanied by shortness of breath due either to compression of the superior vena cava or pericardial or pleural effusion . bone marrow involvement is frequent , and a 5 - 10% incidence of cns involvement at presentation has been reported . the pathologic characteristics of lbl at the morphologic , phenotypic , and genetic levels are similar to those of acute lymphoblastic leukemia ( all ) . the world health organization classification of lymphoid neoplasms has unified these entities as precursor t - cell or b - cell lymphoblastic leukemia/ lymphoma . however , some recent studies have suggested different molecular profiles for t - lbl and t - all [ 4 - 6 ] , and the response of t - lbl to therapy appears to differ from that of t - all . therefore , clinical distinction of the two diseases is valid and specific research on lbl treatment has beenconducted . conventional nhl treatment protocols yielded low rates of cr , disease free survival , and high relapse rates . although intensive protocols for aggressive nhl have increased the cr rate , overall survival remains poor . improvements in long - term outcome have been achieved with all type regimens for lbl , and in multiple series , cr rates of 50 - 91% and disease free survival rates of 45 - 67% have been reported [ 9 - 11 ] . no optimal standard induction therapy has emerged ; however , many chemotherapy regimens with similarities to all regimens have recently been developed . the hyper - cvad regimen used in the case reported here normally entails eight induction - consolidation courses alternating hyper - cvad with high - dose methotrexate and cytarabine . maintenance therapy included 6-mercaoptopurine , methotrexate , vincristine , and prednisone ( pomp ) for 24 months . cr was 91% , and 3-year progression - free and overall survival was 66% and 70% , respectively . in the current case , only one cycle of hyper - cvad and one cycle of high - dose methotrexate , and cytarabine were administered . four days after the initiation of remission induction chemotherapy , the mediastinal mass had almost disappeared . after one cycle of consolidation chemotherapy , the patient was temporarily lost to follow - up because of treatment refusal . follow - up pet - ct scan performed seven months after chemotherapy showed cr , which has been maintained . temporary spontaneous remission of t - lbl has been previously reported . however , no report on cr and long - term survival after one cycle of chemotherapy has been published . unlike t - all , no reliable prognostic factors have been identified for t - lbl . the prognosis of b - lbl is known to be better than that for t - lbl . in an md anderson cancer center study , only cns involvement at diagnosis showed significant association with poor outcome . in a childhood all study , no reliable prognostic factors were identified . classified patients into high and low risk groups according to the ann arbor stage , bone marrow involvement , and serum ldh . rates of freedom from relapse in the low risk and high risk groups at five years were 94% and 19% , respectively . however , in the german multicenter study group for adult all ( gmall ) series , no significant difference was observed between the two groups . the value of minimal residual disease as a prognostic factor for lbl should be determined in future studies . sweetenham identified the intensity of induction therapy as essential to long - term survival . this factor was found to have a greater impact on outcome than that by consolidation or maintenance therapy . early intrathecal therapy and cns prophylaxis were effective for treatment of t - lbl in our patient . rapid and deep response may facilitate long - term survival at an early stage of remission induction chemotherapy . lbl is treated with a chemotherapy regimen similar to that used in patients with all . however , due to rarity of the disease and no reliable prognostic factor , no report on reduction of chemotherapy cycle or omission of maintenance therapy has been published . in conclusion , we report on a case of a patient with t - lbl who achieved long - term cr with no post - induction chemotherapy .
t - lymphoblastic lymphoma ( t - lbl ) is a rare form of aggressive non - hodgkin s lymphoma . the standard approach for management of t - lbl involves intensive multiagent chemotherapy regimens for induction and consolidation phases with central nervous system prophylaxis and a maintenance phase lasting 12 - 18 months . we report on a case of long - term survival after one cycle of hyperfractionated cyclophosphamide , vincristine , doxorubicin , and dexamethasone ( hyper - cvad ) and high - dose methotrexate . a 30-year - old woman diagnosed with t - lbl with a large mediastinal mass underwent one cycle of hyper - cvad . four days after the start of treatment , the mediastinal mass was markedly reduced . treatment continued with one cycle of consolidation chemotherapy , comprising high - dose methotrexate and high - dose cytarabine . the patient then refused all further chemotherapeutic treatment . seven years have passed without relapse .
malaria is a disease of global importance resulting in morbidity and mortality worldwide [ 1 , 2 ] . although , since 2000 a reduction in the mortality rate of about 25% has been globally observed , nearly half of the world 's population is still living at risk of infection [ 1 , 3 ] leading to more than 0.5 million deaths annually . five species of the genus plasmodium are known to infect humans ; however , the most severe form of malaria , malaria tropica , is caused by plasmodium falciparum [ 5 , 6 ] . due to the spreading drug resistance against the currently used chemotherapeutics as well as environmental changes , the treatment of the disease is becoming more difficult . resistance to therapeutics such as chloroquine and sulfadoxine - pyrimethamine currently only acts ( artemisin - based combination therapies ) are highly effective against malaria . however , resistances to artemisinin and its derivatives have already been confirmed at the border of cambodia - thailand [ 3436 ] , and therefore the discovery of novel therapeutic agents against malaria is urgently required . proliferation of p. falciparum within the asexual blood stage depends on haemoglobin digestion in the food vacuole . this degradation pathway was already taken into consideration as a new drug target by focussing on the proteases plasmepsin i iv . however , since haemoglobin catabolism occurs in the food vacuole , not only inhibition of the catalytic properties of the digestive enzymes is of interest but also the mode of protein trafficking . the latter was also considered to be druggable for proteins directed to other parasite - specific organelles such as the chloroplast - like organelle , the apicoplast , where several essential metabolic processes take place . additionally to the specific intraparasitic trafficking the malaria pathogen secretes also a variety of proteins to the erythrocytic host cell surface for nutrient transport processes as well as for cytoadherence mediated by proteins for example of the plasmodium falciparum erythrocyte membrane protein ( pfemp)-family . interestingly , the number of exported proteins is in the case of p. falciparum therefore , protein trafficking in p. falciparum represents an attractive drug target ; however , detailed information of its mode of action is required to interfere with this mechanism . the aim of this mini review is to summarise the current knowledge of novel promising drug targets , which are involved in protein trafficking processes in p. falciparum . like other eukaryotic cells , p. falciparum possesses intracellular compartments such as a nucleus , endoplasmic reticulum ( er ) and a mitochondrion . although the apicoplast has its own circular genome encoding for about 30 proteins , the majority of the apicoplast located proteins are nuclear encoded in p. falciparum [ 40 , 41 ] . around 500 proteins are predicted to be trafficked to this organelle , like the enzymes of the isoprenoid fatty acid and iron - sulfur - cluster biosynthesis pathways [ 42 , 43 ] . these proteins possess target information for the transport to the apicoplast , which is encoded at the n - terminal region . first , the signal peptide , a hydrophobic n - terminal sequence , directs the proteins to the er lumen [ 4547 ] , where subsequently a signal peptidase cleaves off the signal peptide . within the n - terminal region the signal peptide is followed by a second domain , the plant - like plastid transit peptide , which contains the information for trafficking the protein to the apicoplast . the vesicular transport to the food vacuole is not yet completely understood . while some proteins like the chloroquine resistance transporter ( pfcrt ) , which modulates resistance to drugs like chloroquine , are transported directly via the classical er and golgi secretory pathway to the food vacuole [ 5053 ] , other proteins such as plasmepsin i , plasmepsin ii or dipeptidyl aminopeptidase 1 ( dpap1 ) , and the secreted acid phosphatase ( sap ) are suggested to be targeted via the parasite plasma membrane ( ppm ) [ 20 , 54 ] or the parasitophorous vacuole to the food vacuole . the occurrence of different trafficking routes is also emphasised by the sensitivity to brefeldin a , an inhibitor of the golgi apparatus [ 56 , 57 ] . whereas the routing mechanisms of some proteins are affected by brefeldin a , other proteins can still be found in the food vacuole after treatment with the inhibitor leading to the suggestion of at least two different transport pathways , er / golgi dependent and independent trafficking routes . since transport to the food vacuole differs , consequently the signal sequences are very divergent . while for plasmepsin iv the first 70 amino acid residues are necessary for proper translocation , a mislocalisation of plasmepsin ii occurs when different positions in the first 120 amino acid residues are deleted or mutated [ 59 , 60 ] . moreover , signal peptides of other hemoglobinases like dpap1 are not yet analysed in detail . additionally to the intraparasitic protein trafficking , p. falciparum secretes proteins to extracellular compartments like the parasitophorous vacuole , the maurer 's clefts , and into the host cell cytosol . therefore , proteins have to enter the classical secretory pathway by a conventional signal peptide . since the signal peptide is unable to transport a protein through the parasitophorous vacuole membrane a second signal sequence of around 2530 amino acid residues after the er signal ( rxlxe / q / d ) called the plasmodium export element ( pexel ) , or vacuolar translocation signal ( vts ) , as about 8% of the parasitic proteome contains this targeting sequence , it is expected that most them have an important role in remodelling the host cell [ 6163 ] . a knockout screen of 85 out of the predicted 200300 exported proteins suggests that about 25% are essential in the blood stage of p. falciparum . after cleaving off the pexel motif via the aspartic protease plasmepsin v , the proteins are transported to the parasitophorous vacuole . within the parasitophorous vacuole membrane the atp - driven plasmodium translocon of exported proteins ( ptex)-complex transports the released proteins across this barrier [ 65 , 66 ] . however , p. falciparum possesses also a pexel - independent trafficking pathway consisting of the pexel - negative exported proteins ( pneps ) . so far no consensus sequence for the export of pneps has precisely been identified , therefore it is hard to predict how many unidentified pneps are encoded by p. falciparum . one of the most interesting compartments in p. falciparum is the four membrane - bound , nonphotosynthetic organelle ( the apicoplast ) , which has been proposed to be derived from secondary endosymbiosis . briefly , while the uptake of a prokaryote by an eukaryote is termed primary endosymbiosis resulting in a plastid surrounded by two membranes , secondary endosymbiosis , the engulfment of an eukaryote possessing a primary endosymbiont , is leading to a four membrane - bound plastid . as already outlined above , most of the apicoplast proteins are encoded in the nuclear genome and are trafficked to the organelle [ 12 , 6971 ] . import into the plasmodial plastid is in contrast to plants a two - step process requiring a signal peptide and subsequently a transit peptide [ 43 , 49 ] . whereas the signal peptide mediates entry into the endomembrane system , the transit peptide directs the protein into the apicoplast [ 49 , 72 ] . plasmodial transit peptides are highly enriched in lysine and asparagine , and acidic residues are depleted suggesting that these characteristics are essential for plastid targeting in p. falciparum , as has been observed in mitochondrial transit peptides [ 73 , 74 ] . as apicoplast transit peptides do not possess a highly conserved sequence motif ( they are varying widely in their length and their composition of positively charged amino acid residues near the n - terminus [ 42 , 76 ] ) , it remains unclear how apicoplast proteins are distinguished from proteins which are intended to be translocated to other compartments . the translocation across the apicoplast periplastid membrane ( second membrane from the cytosol direction ) is assumed to be initiated by a novel er - associated degradation ( erad ) complex . the luminal chaperone binding protein ( bip ) and protein disulphide isomerase ( pdi ) differentiate misfolded proteins from folding intermediates and correctly folded proteins [ 7880 ] . subsequently , misfolded proteins which are recognised by erad are redirected to the cytosol across the er membrane through a channel which consists of either sec61 or der1 [ 82 , 83 ] . another factor suggested to play a role in protein targeting to plant plastids is the binding of hsp70 chaperones to plastid transit peptides [ 84 , 85 ] . a specific hsp70 binding pattern is present , and putative binding sites are abundant in apicoplast transit peptides . 15-deoxyspergualin ( dsg ) is an immunosuppressant with antimalarial activity acting for example on hsp70 molecules within the malaria parasite [ 7 , 8 ] ( table 1 ) . the mode of action is to date unknown , but it is assumed that dsg inhibits chaperone - transit peptide interactions , and thereby preventing apicoplast targeting . another class of drugs interfering with apicoplast targeting is the group of the tetracyclines such as doxycycline ( table 1 ) . tetracyclines are broad - spectrum antibiotics working as protein synthesis inhibitors by binding to microbial ribosomes and blocking the translation process . the inhibition by tetracycline and related drugs occurs probably indirectly by inhibiting the translation of apicoplast - encoded genes such as the clpc gene which is required for protein import . currently no clinical resistance to doxycycline has been reported . whereas doxycycline presumably targets the translation within the apicoplast , rifampicin has been proposed to attack transcription ; both drugs result in delayed death ( table 1 ) . unfortunately the versatile use of the latter supports the development of drug resistance against these antibiotics . the synthesis of isoprenoid precursors is an essential metabolic function of the apicoplast . in p. falciparum , isoprenoids are de novo generated via the doxp ( 1-deoxy - d - xylulose-5-phosphate ) pathway . as the canonical mevalonate pathway is apparently absent in p. falciparum , the apicoplast represents the only place within the parasite where isoprenoid precursor synthesis occurs [ 88 , 89 ] . this biosynthetic pathway consists of seven enzymes , and all are apparently encoded in the nucleus and their deriving proteins are targeted to the apicoplast . the inhibition of the doxp reductoisomerase / ispc by fosmidomycin results in death of the p. falciparum intraerythrocytic stages which underlines the important role of this pathway for the malaria parasite ( table 1 ) . moreover , the inhibition of another enzyme of the doxp pathway , ispf , also leads to the death of the parasite 's intraerythrocytic stages . therefore the apicoplast isoprenoid pathway represents a promising target for the development of novel antimalarials . however , the discovery and validation of the organelle pathways are hindered either by limitations to apply reverse genetics of essential genes or to characterize plasmodial proteins in vitro or to purify the organelle [ 9194 ] . the digestion of haemoglobin is carried out by the malaria parasite within the food vacuole , an organelle that has an acidic ph [ 95 , 96 ] . haemoglobin is taken up via endocytosis and is suggested to be subsequently transported by lysosomal vesicles to the digestive vacuole [ 95 , 97 ] . the initial degradation of the haemoglobin into globin fragments is mediated by aspartic proteases , such as the plasmepsins i , ii , iv , and the histoaspartic protease ( hap ) [ 20 , 98100 ] . in the next step , the cysteine proteases falcipain 2 , 2b , and 3 [ 101 , 102 ] digest these globin fragments into peptides which are subsequently degraded into smaller peptides by the metalloprotease falcilysin . these polypeptides are cleaved into dipeptides by a dipeptidyl aminopeptidase and finally aminopeptidases convert the dipeptides into amino acids . the proliferation of the parasite is repressed by protease inhibitors that block the haemoglobin catabolism . therefore , these endo- and exopeptidases catalyzing this process are attractive targets for the development of novel antimalarial drugs [ 97 , 105107 ] . recent analysis identified the fungal metabolite bestatin as an inhibitor of neutral aminopeptidases such as the m1 aminopeptidase ( pfa - m1 ) and the aminopeptidase p ( pfapp ) [ 95 , 96 ] . furthermore , it has been reported that this inhibitor , a natural phe - leu dipeptide analogue derived from the fungus streptomyces olivoretticuli , prevents growth of the parasite in vitro and in vivo . two phosphinate dipeptide analogues ( compound 4 and 5 ) were also effective against p. falciparum in cell culture ( table 1 ) . both compounds inhibit the m17-family leucine aminopeptidase ( pflap ) with ic50 values of 2040 and 1223 m , respectively ( table 1 ) . additionally , in vivo studies using p. chabaudi resulted in an about 90% reduction of parasitaemia in mice treated with compound 4 . these results clearly confirm that neutral aminopeptidases are serving as promising new antimalarial drug targets . in the food vacuole , haemoglobin degradation is initiated by the aspartate proteases , plasmepsin i - iv ( iii has been renamed to hap ) , which can be inhibited by pepstatin a at the picomolar range . however , at the cellular level , this molecule is only a weak inhibitor . recently , it has been shown that knock outs of plasmepsins result in delayed growth but is not leading even in the presence of specific protease inhibitors to the death of the parasite [ 109 , 110 ] . currently the aim of a new initiative between the johns hopkins university and kyoto pharmaceutical university is focussing on designing adaptive inhibitors ( kni ) which were able to inhibit all four digestive vacuole plasmepsins simultaneously ( table 1 ) . the function of these peptidomimetic inhibitors is based on the strongest and most specific interactions of the inhibitor against the conserved regions of the binding site and at the same time maintaining flexibility of the inhibitor allowing docking to the less conserved regions [ 2224 ] . kni-10006 for example is very potent against plasmepsin ii but has only poor influence on parasite growth . in contrast , compound kni-10283 , which does not contain a basic amine , has been tested for in vivo efficacy in the p. berghei - infected mouse model revealing an expanded increase in lifespan of mice of up to 170% [ 25 , 111 , 112 ] . another group of plasmepsin inhibitors are the nonpeptidomimetic inhibitors containing a number of different structural classes such as n - alkoxyamides , guanidines , amides , ureas , thioureas , hydrazides , and amino alcohols [ 112117 ] . whereas many of them are only poor inhibitors , such as halofantrine , some of them including act-056822 , which extended the survival time of mice of about 160% in the p. berghei mouse model , seem to be promising plasmepsin inhibitors ( table 1 ) . the export of proteins which are located at the surface of the host cell like pfemp1 is responsible for the virulence of p. falciparum . pfemp1 is involved in the knob assembly and is therefore important for mediating cytoadherence of the infected erythrocyte to the endothelial cell of the blood vessels by binding on dc36 , icam-1 , thrombospondin , chondroitin sulfate , and other surface molecules . as already outlined above , a variety of these exported proteins are trafficked via the pexel motif to the surface of the host cell . indeed , the proteolytic enzyme plasmepsin v seems to be a promising drug target candidate , as it is conserved in plasmodium spp . and the fundamental role of this protease for the malaria parasite has been verified by the attempt to disrupt a plasmepsin v orthologous gene ( pbpmv ) in the rodent malaria parasite p. berghei . plasmepsin v is localised in the er and cleaves the pexel motif between position 3 and 4 of the pexel sequence . this protease is therefore responsible for proper processing of pexel mediated transport processes to the host cell . due to the different function of plasmepsin v compared to the other plasmepsins ( e.g. involved in the digestion of haemoglobin inhibitors ) , inhibitors designed to target these aspartic proteases might be therefore not effective against plasmepsin v. fortunately , the hiv-1 protease cleaves a similar motif to that of plasmepsin v , emphasising the suggestion that hiv-1 protease - inhibitors could also be potent against the plasmodial protein . four promising inhibitors , lopinavir , saquinavir , ritonavir and nelfinavir , have already been tested . unfortunately they are only revealing a moderate inhibitory profile [ 64 , 120 ] ( table 1 ) . however , in the future by applying medical chemistry these compounds could lead to a complete inhibition of plasmepsin v , and thereby result in the death of the malaria parasite . recently , kulzer et al . identified a unique parasite - encoded hsp70 ( pfhsp70-x ) , which is exported into the host cytosol forming a complex with pfhsp40s . while in other organisms hsp70/40 complexes are important for protein folding and trafficking [ 122 , 123 ] , kulzer et al . proposed that pfhsp70-x is involved in refolding of other exported proteins and chaperoning these proteins to their final destination one possible target might be pfemp1 , which ( i ) colocalises with pfhsp70-x and ( ii ) is suggested to be transported via a multiprotein complex containing chaperones into the host cell . therefore pfhsp70-x could serve as a promising novel target to interfere with transportation of the major virulence factor of p. falciparum . as outlined here , an approach for identifying novel drug targets is represented by proteins which are trafficked within the parasite or its host cell as well as the mechanism of trafficking . for the survival plasmodium is carrying out metabolic processes in intracellular compartments , such as the food vacuole or the apicoplast . among the targets within the food vacuole , several proteases can be inhibited by different compounds which selectively interfere with the proteolytic digestion of the imported haemoglobin at low micromolar level ( table 1 ) . the apicoplast is an organelle which exhibits metabolic pathways , such as the essential isoprenoid biosynthesis . this pathway has already been exploited as drug target using fosmidomycin ( table 1 ) . a novel mode to impede proliferation of the malaria pathogen is to prevent proper processing of transport sequences of the trafficked proteins . plasmepsin v has been found to participate in the posttranslational cleavage of exportation sequences , and some promising inhibitors were designed to inhibit plasmepsin v , unfortunately so far with only a moderate effect on the parasite 's growth . in the future , these molecules might lead to novel inhibitors that prevent host cell modification by p. falciparum [ 64 , 120 ] . however , further discoveries and adaptations of the current drugs are required to hamper proliferation of the deadly human malaria parasite .
malaria is an infectious disease that results in serious health problems in the countries in which it is endemic . annually this parasitic disease leads to more than half a million deaths ; most of these are children in africa . an effective vaccine is not available , and the treatment of the disease is solely dependent on chemotherapy . however , drug resistance is spreading , and the identification of new drug targets as well as the development of new antimalarials is urgently required . attention has been drawn to a variety of essential plasmodial proteins , which are targeted to intra- or extracellular destinations , such as the digestive vacuole , the apicoplast , or into the host cell . interfering with the action or the transport of these proteins will impede proliferation of the parasite . in this mini review , we will shed light on the present discovery of chemotherapeutics and potential drug targets involved in protein trafficking processes in the malaria parasite .
a 56-year - old male presented with chronic on and off pain in the left eye his systemic examination revealed multiple subcutaneous tumors in distal upper limbs and more than 6 caf - au - lait macules ; but all were < 15 mm in diameter . his vision was 20/30 in right eye and counting fingers at 3 feet in left eye . applanation tonometry readings were 13 mm hg and 50 mm hg in right and left eye , respectively . dark - room gonioscopy showed appositional closure of the drainage angle with multiple peripheral iris convexities in the right eye and 360 synechial angle closure in the left eye . ubm presented a ring - shaped solitary iridociliary cyst spanning 360 in the right and 270 , sparing nasal quadrant , in the left eye . the cysts had hyper - reflectile walls and sonolucent interiors , suggestive of primary neuroepithelial cysts [ fig ultrasound biomicroscopy showing iridociliary cyst in right ( a ) and left ( b ) eye we did nd : yag laser iridotomy , peripheral to the collarette of the right iris at 8 oclock hour where the diameter of the cyst was narrowest on ubm to avoid cyst rupture [ fig . 2 ] . post iridotomy , the angle recess was narrow , but the scleral spur was visible all around on dark - room gonioscopy in the right eye . the right optic disc was healthy , and the left had advanced glaucomatous cupping [ fig . 3 ] . magnetic resonance imaging of brain and orbits was unremarkable , except for a diffuse t2 hyperintense signal in the left optic nerve . note its atypical location at 8 oclock hour optic disc photographs of right ( a ) and left ( b ) eye ultrasound biomicroscopy of right ( a ) and left ( b ) eye . note narrow but open angle recess in a and absence of iridociliary cyst in b the left eye was painful despite maximum antiglaucoma medications . this eye underwent g - probe assisted inferior 180 contact transscleral diode cyclophotocoagulation ( 810 nm laser ; iridex corporation , ca , usa ) . post procedure , severe inflammation of the anterior chamber and neovascularization of the iris occurred , which resolved gradually with steroid and cycloplegic eye drops . the iop in the left eye remained between 40 and 48 mm hg though the patient was pain - free . on repeat ubm , the inferior ciliary processes were shrunken , but the cyst was no longer imaged [ fig . primary iridociliary cysts , in the majority , are stationary lesions located focally and rarely cause visual complications . angle closure , secondary to iris and ciliary body cysts , is related to the forward bulk of the iris cyst and occlusion of the posterior chamber and is scarcely reported.[13 ] a postulated mobility of the ring - shaped iridociliary cyst during movements of the pupil might make an additional contribution to the angle closure . absolute glaucoma , as in the left eye of our patient , is not attributed to iris or ciliary body pigment epithelial cyst(s ) in the past . except for a single report of 7 members of a family with familial aortic dissection and having pupillary margin iris pigment epithelial cysts , no relation of primary cysts of iris or ciliary body epithelium to any systemic disease has been reported . the clinical features of our patient were insufficient to meet the diagnostic criteria of neurofibromatosis ( nf)- 1 . nevertheless , iris pigment epithelium cyst is formed by separation of the 2 layers of epithelium and can not be explained by the pathogenesis of nf . laser iridocystotomy when the cyst could not be visualized in mydriasis by gonioscopy is also reported . this treatment results in pigment dispersion , and carries the potential risk of inflammation and cyst recurrence . however , laser iridotomy did suffice to relieve oppositional angle closure in the right eye of our patient [ fig . the treatment resulted in inadvertent iridociliary cyst rupture with no troublesome sequel over the follow - up . thus , cyst rupture is a potential complication of diode cyclophotocoagulation in eyes with large iridociliary cyst(s ) .
primary iridociliary cysts can induce plateau iris configuration and angle closure glaucoma . we report a patient with bilateral , primary , ring - shaped , solitary iridociliary cysts . the right eye displayed normal intraocular pressure , oppositional iridocorneal angle closure , and healthy optic nerve head . the left eye had advanced chronic angle closure glaucoma . the management strategy varied between eyes and is discussed . this , to the best of our knowledge , is the first report of transscleral diode laser application in an eye with a large iridociliary cyst .
the number of end - stage renal disease patients requiring renal replacement therapy is increasing worldwide . in japan peritoneal dialysis ( pd ) and hemodialysis ( hd ) are the two major dialysis modalities . the prognosis associated with these modalities is a clinically important issue and has been debated for a long time . some studies show that pd is associated with a higher mortality than hd [ 1 , 2 ] . other studies show that pd patients have a higher survival rate than hd patients [ 3 , 4 ] . comprehensive analysis , including the results of large - scale and prospective studies , revealed that the hd and pd patients have a similar overall survival [ 57 ] . another report indicated that the survival rates of pd and hd patients varied greatly depending on the characteristics of patients and observational period . in japan , only a few studies have been performed on this issue . a single - center study showed that the 3-year survival of pd patients was higher than that of the background - unmatched hd patients . to clarify the difference in mortality between pd and hd patients in our prospective cohort study , we recruited clinical parameter - matched 83 pd and 83 hd patients on maintenance dialysis from 6 hospitals in yamagata and miyagi prefectures , administrative districts with a population of 1.2 and 2.3 million , respectively , located in the northern part of japan . the main purpose of this study was to analyze the factors related to survival in dialysis patients . baseline information was collected at entry , and the information for the prognosis was collected at the end of each year . cardiovascular death was defined as the death due to coronary heart disease , heart failure and stroke , or cardiac sudden death that occurred within 1 h after the onset of acute symptoms . this study was performed according to the declaration of helsinki and was approved by the institutional ethics committee . the means and proportions between groups were compared using unpaired student t - test and chi - square tests , respectively . the mann - whitney u - test was used to compare the non - parametric data . survival curves were estimated using the kaplan - meier method followed by the log - rank test . to examine the independent effect of the clinical parameters on prognosis , cox - proportional hazard analysis was used with adjustment for potential confounders . the patients that changed the dialysis modality were censored at the time of changing the modality . data are expressed as mean sd or median ( min - max ) for data not normally distributed . all statistical analyses were performed using stat view version 5 ( sas institute inc . , cary , nc , usa ) . the baseline characteristics of the 166 patients , including 83 pd and 83 hd patients , were as follows : average age , 64.9 years ; men , 53.6% ( n = 89 ) ; diabetic patients , 22.9% ( n = 38 ) ; median duration of dialysis , 48 months . the baseline clinical parameters including , age , gender , duration of dialysis , and the types of administered drugs were not significantly different between the pd and hd patients ( table 1 ) . during the 5-year follow - up period , there were 27 deaths in the pd group ( 16 cardiovascular and 11 noncardiovascular deaths ) , including deaths from congestive heart failure ( n = 8) , stroke ( n = 5 ) , and infection ( n = 2 ) . in hd group , there were 27 deaths ( 14 cardiovascular and 13 noncardiovascular deaths ) , including deaths from congestive heart failure ( n = 6 ) , ischemic heart disease ( n = 3 ) , and infection ( n = 4 ) . there were 8 pd patients switched to hd , and 6 pd patients received renal transplantation . the 5-year mortality associated with pd and hd was compared using kaplan - meier analysis . the survival rate was not significantly different at the end of 5 years ( pd 67.5% versus 67.5% , log - rank p = 0.719 ) ( figure 1 ) . then , we examined the difference in cardiovascular and noncardiovascular mortalities between pd and hd patients . the proportion of cardiovascular deaths among total deaths was not significantly different between pd and hd ( 59.3% versus 51.2% , p = 0.584 ) . the event - free curves of pd and hd patients were almost identical , and event - free rate at the end of 5 years was not significantly different in cardiovascular deaths ( log - rank p = 0.511 ) and noncardiovascular deaths ( log - rank p = 0.844 ) ( figure 2 ) . next , we performed a cox - proportional analysis to examine the independent effect of the dialysis modality on survival ( table 2 ) . the univariate model showed that the factors associated with 5-year survival were age , past history of cardiovascular disease , serum albumin level , and triglycerides level but not the modality of dialysis . multivariate analysis , including the factors significant according to univariate analysis and dialysis modality , showed that the independent predictors of survival were age ( per 10 years increase , hazard ratio [ hr ] , 1.89 ; 95% confidence interval [ ci ] , 1.342.64 ; p < 0.001 ) and serum albumin level ( per 1sd increase , hr , 0.67 ; 95% ci , 0.490.91 ; p = 0.011 ) , and the modality of dialysis was not significantly associated with the outcome . similarly , the modality of dialysis was not associated with the cardiovascular and noncardiovascular mortalities . in this prospective multicenter study , we compared the 5-year survival between background - matched hd and pd patients . our results showed no significant difference in all - cause , cardiovascular , and noncardiovascular mortalities between hd and pd patients , which indicated that the dialysis modality might not be an independent factor for the survival in japanese patients . while many studies have compared the prognosis between pd and hd , consistent results remain to be obtained . although studies with observational periods within 3 years are likely to detect a difference in survival between pd and hd patients [ 1 , 3 , 9 ] , all the studies with long observational periods ( longer than 10 years ) showed no difference in prognosis [ 6 , 7 , 10 ] . , pd is selected as renal replacement therapy in less than 5% of incident patients , which is much lower than that in other countries ( 10%30% in most of european and asian countries , and 8% in the united states ) . this suggests that there might be a bias in selecting the dialysis modality in japan . the selection bias could be a confounding factor , and a proper adjustment for the background of subjects is indispensable for comparative analysis . although a previous japanese report showed that the survival was better in pd patients than in hd patients , the analysis was performed without adjusting for the background of the patients . we performed an adjustment for the clinical parameters , and our results showed that the difference in survival rate was not significant at the end of 5 years . the discrepancy between our findings and those reported previously may be because of the difference in analytical methods , including the adjustment of background and the follow - up period . previous studies have shown that age , comorbidities , and nutritional parameters such as serum albumin level and/or total cholesterol levels are the factors related to the prognosis in dialysis patients . in the current study , our result is consistent with the previous finding and suggests that the nutritional status is more important than the dialysis modality in japanese patients . previously , infection was the leading cause of death in pd patients . however , the incidence of infection was decreased along with recent advances in connecting devices . our study has advantages such as background - adjustment and relatively long observational period ; however , there are several limitations to our study . therefore , the dropout during the initial period of dialysis is not examined in this study . one time measurement of these parameters might underestimate the association between the parameters and the survival . this background - matched 5-year observational study showed that all - cause , cardiovascular , and noncardiovascular mortalities were not significantly different between pd and hd patients in japan .
to examine the relationship between dialysis modality and prognosis in japanese patients , we conducted a prospective multicenter observational study . we recruited 83 background - matched peritoneal dialysis ( pd ) and 83 hemodialysis ( hd ) patients ( average age , 64.9 years ; men , 53.6% ; diabetic patients , 22.9% ; median duration of dialysis , 48 months in all patients ) and followed them for 5 years . during the follow - up period , 27 pd patients ( 16 cardiovascular and 11 non - cardiovascular deaths ) and 27 hd patients died ( 14 cardiovascular and 13 non - cardiovascular deaths ) . there were 8 pd patients switched to hd , and 6 pd patients received renal transplantation . kaplan - meier analysis revealed that the crude survival rate was not significantly different at the end of 5 years ( pd 67.5% versus 67.5% , log - rank p = 0.719 ) . the difference in cardiovascular and non - cardiovascular mortalities between pd and hd was not statistically significant . multivariate cox analysis showed that the independent predictors for death were age and serum albumin levels , but not the dialysis modality . this study showed that the overall mortality was not significantly different between pd and hd patients , which suggests that dialysis modality might not be an independent factor for survival in japanese patients .
past research and/or salary support : national institute of mental health k23 nimh 5 k23 mh070897 - 02 , role : pi ; nih / ncrr 5 ul1 rr024982 - 02 packer ( pi ) role : pilot study pi ; neuronetics grant - in - kind support for supplies and use of equipment ; the defense academy for credibility assessment ( formerly the department of defense polygraph institute ) , cephos corp . , stanley medical research institute , cyberonics ( treatment studies d01 , d02 , d04 , an01 ) 2001 - 2005 ; glaxo smith kline ( interleaved tms - fmri ) 2002 - 2003 paid advisory / consulting : none equity holdings ( exclude mutual funds ) : none royalty / patent , other income : patents pending as an inventor through the medical university of south carolina on fmri detection of deception , guided rtms inhibition of deception , optimizing vns dose with rtms other : 2004 monthly case discussion group leader x1 sponsored by astra zeneca ; unpaid scientific consultant to cephos corp . the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
refinements in the methods of diagnosis for psychiatric disorders are critically needed . these new methods should be based on objectively measured brain characteristics that provide clinically useful information . studying the brain with respect to psychiatric disorders , however , faces numerous challenges . utilizing techniques learned in other areas of medicine to deal with symptoms that lead to complex disorders can provide insight into improving diagnostic models in psychiatry . specifically , many areas of medicine use objective measures of an organ 's function or characteristic to guide clinical management of particular subjective complaints . in psychiatry , an objectively measured brain characteristic that provides clinically useful information is proposed to be that person 's phronotype . important requirements to developing phronotypes are discussed . identifying phronotypes in psychiatry will require a specific investigative approach that must be grounded in rigorous scientific methodology . successfully developing such markers will have a profound impact on clinical care , clinical research , basic science research , and most importantly the lives of those suffering from these illnesses .
if the amplitude of the cnv is related to the value of the temporal accumulator , variations in the cnv should be reflected in timing performance . ( 1999 , experiment 1 ) observed a correlation between the reproduced duration and the cnv amplitude , a finding that has been interpreted as evidence in support of this hypothesis . in macar et al . 's experiment , participants were asked to repeatedly reproduce an interval of 2.5 s. the average cnv amplitude was calculated separately for trials in which participants responded too early ( 2.22.4 s ) , correctly ( 2.42.6 s ) , or too long ( 2.62.8 s ) , and showed a positive correlation with reproduced duration ( see figure 1 in casini and vidal , 2011 for an illustration of these findings ) . at first glance , this correlation between the cnv and the assumed state of the accumulator seems to be strong support in favor of the hypothesis that the cnv directly reflects the accumulation process . however , a careful analysis of the arguments in terms of the default pacemaker - accumulator model reveals a number of inconsistencies . for example , if the speed of the pacemaker is higher , pulses accumulate more quickly , and therefore , the threshold should be reached earlier . in other words , if larger cnv amplitudes reflect more accumulated pulses , then why do n't participants respond before the target duration on high - amplitude cnv trials and after the target duration on low - amplitude cnv trials ? assuming continuous comparisons between the accumulator and threshold , the estimated duration should be shorter with higher pacemaker speeds since the threshold will be reached sooner and vice versa with lower pacemaker speeds . differences in amplitude can , in the context of a threshold - based pacemaker - accumulator account , only be explained when it is assumed that the comparisons between the accumulator and threshold are not continuously made . if comparisons are not made continuously , the number of pulses that reaches the accumulator between two comparisons is the maximum overshoot ( plus one ) that can be observed , yielding a correlation between the speed of the pacemaker and the value of the accumulator at the response . for example , if the threshold is known to be 100 pulses and five pulses reach the accumulator between subsequent threshold - accumulator comparisons , the maximum observed amplitude reflects 99 + 5 = 104 pulses . however , if the speed of the pacemaker is doubled , the maximum amplitude is 99 + 10 = 109 pulses . although this might explain how an increased pulse rate results in an increased cnv amplitude , the threshold will still be reached before ( or at ) the standard time . in other words , it is difficult to explain how a higher speed should result in increased cnv amplitudes and longer estimations if one assumes that the basic pacemaker - accumulator model is correct . an association between short estimations and lower cnv amplitudes is even more difficult to explain in the context of a threshold - driven pacemaker - accumulator model . if the cnv is still below the average value , it is unlikely that the accumulator already has reached the threshold . ( 1999 ) , is that the trials resulting in short , correct , and long durations accumulate up to different thresholds . these investigators assume that the intrinsic properties of the neural system cause an increase in activation after the onset of an interval and that the response is given when the peak of activation is reached ( macar et al . , 1999 ; macar and vidal , 2009 ) . thus , if an onset results in a higher boost of activation , the cnv will have a higher amplitude and a later deflection point , resulting in longer estimations . although the idea of variations in threshold is often found in the literature ( see , for example , computational models of the role of memory in interval timing , e.g. , jazayeri and shadlen , 2010 ; taatgen and van rijn , 2011 ) , this is not typically associated with performance - dependent variations in the cnv . this is not surprising because a link between different thresholds and cnv amplitudes would imply that different durations ( e.g. , durations of 1 , 2 , and 3 s ) are associated with different amplitudes , whereas these correlations are not typically found ( e.g. , elbert et al . , 1991 ; gibbons and rammsayer , 2004 ; praamstra et al . , 2006 , and see praamstra , 2010 for a review of foreperiod effects ) . in light of these theoretical issues , it is relevant to mention that kononowicz and van rijn ( 2011 ) recently failed to replicate the findings of macar et al . ( 1999 ) . in two experiments , which were close replicates of the original study , in addition , kononowicz and van rijn ( 2011 ) found a habituation effect , which is not in line with the predicted role of the cnv , i.e. , if the amplitude of the cnv has a one - to - one mapping to the state of the accumulator , it would be implausible for the cnv amplitude to diminish over the scope of the experiment while the time estimations stay constant . it should be noted that the kononowicz and van rijn ( 2011 ) study is not the only reported failure to replicate these results , as one condition of a study by macar and vidal ( 2002 , labeled condition 1 ) was a close replication of the original experiment , but no performance - dependent variations in the cnv were observed . moreover , although it may be that differences in cnv can not be readily generalized to differences in blood oxygen level - dependent ( bold ) response , no performance - dependent variations in the pre - supplementary motor area ( sma , typically associated with the cnv ) bold signal were found in a functional magnetic resonance imaging ( fmri ) replication of the 1999 study ( macar et al . , 2004 ) . however , other studies have found differences in bold response during the reproduction and estimation of different intervals . for example , a stronger bold response was found in many brain areas , including the sma , during the estimation and reproduction of a 1300 ms interval than during the estimation and reproduction of a 450 ms interval ( pouthas et al . , 2005 ) . interestingly , when participants had to encode and reproduce durations of 918 s in a study by wittmann et al . ( 2010 ) , the activation of the posterior insula resembled an accumulation process , but the sma activation followed an inverse u - shape pattern during encoding . thus , although fmri studies have been able to identify brain areas that are differentially active during the processing of different durations , it appears that the basic effects reported by macar et al . ( 1999 ) are difficult to replicate in both eeg and fmri studies . a second experiment reported in macar et al . ( 1999 ) has also been interpreted in favor of performance - dependent variations in the cnv . in this experiment , participants learned a standard duration and were later asked to categorize presented durations as either shorter , equal , or longer than the standard . the predicted pattern was found between cnv and duration estimation , with trials categorized as long being associated with a higher amplitude cnv than the trials categorized as short . ( 2005 ) in which participants had to indicate whether a 480 or 520 ms tone was longer or shorter than a previously learned standard of 500 ms . however , these performance - dependent variations are difficult to reconcile with studies that show that the cnv deflects or resolves after a standard has been reached ( e.g. , macar and vidal , 2003 , see also , pfeuty et al . , 2003 , 2005 ; ng et al . , 2011 ) . if the decision to categorize a particular trial as long is made on the basis of a comparison to the standard , then in these trials the accumulator should have already reached the value of the standard . , participants were presented a long and a short anchor of 800 and 3200 ms , and were asked to categorize seven intermediate durations as either more similar to the long , or to the short anchor . when combining the three intermediate conditions ( 1270 , 1600 , and 2016 ms ) in which neither answer category was dominant , a partial least squares analysis ( mcintosh and lobaugh , 2004 ) revealed that when a long categorization was given , the cnv was either similar to or had a lower amplitude than when a short categorization was provided . moreover , although eeg differences have been observed in duration bisection for trials participants categorized as short or long , this effect is related to the power of the alpha band in event - related synchronization rather than the amplitude of the cnv ( ng et al . thus , recent electrophysiological studies from a number of labs indicate that the presentation of a stimulus duration longer than the standard is associated with a deflection of the cnv at the time of the standard . as an equal response will be based on the accumulator reaching the threshold at the perceived time of stimulus offset , a response assumes that the accumulator had reached the threshold some time before the offset of the stimulus . this in turn implies that the deflection should already have been observed and thus that the cnv amplitude for long estimations is lower than that for short or estimations . as higher cnv amplitudes were observed for the long estimations in experiment 2 of macar et al . ( 1999 ) , these results are difficult to reconcile with a consistent application of the hypothesis that the cnv reflects function of the accumulator proposed by pacemaker - accumulator models ( gibbon et al . , 1984 ; meck , 1996 ; meck and benson , 2002 ) . to summarize , although stable performance - dependent variations of the cnv would be evidence in favor of the cnv as the signature of a neural substrate of the temporal accumulator , none of the above - mentioned studies provides unequivocal evidence in favor of that view . if the cnv reflects the neural substrate of the temporal accumulator , its location should be fairly stable . and indeed , both fmri and eeg / magnetoencephalography studies ( see , for example , pouthas , 2003 ; meck et al . , in press , for an overview ) have shown that the sma subserves a variety of timing tasks . however , arguing that this proves that the sma serves as the common accumulator for temporal processing is an error of omission . that is , many eeg studies over the years have found cnv - like patterns at different locations . ( 2006 ) have shown in a foreperiod study that the strongest signal was observed at the lateralized pre - motor cortices instead of at sma , a finding that is in line with evidence from primate neurophysiology ( mauritz and wise , 1986 ) and fmri studies ( e.g. , schubotz et al . , 2000 ) . moreover , single - cell recording studies have shown ramping activation in neurons in the posterior parietal cortex ( leon and shadlen , 2003 ) , and the earlier mentioned fmri study by wittmann et al . as all of these locations show a ramping pattern of activation , all of these locations could , in principle , be a neural substrate of temporally mediated response preparation . these findings have , therefore , supported the view ( e.g. , praamstra , 2010 ) that distinct neural substrates are implicated in temporal preparation in a task - dependent manner , probably depending on the type of temporal processing that is required for a particular behavior . in other words , although the activation measured at the smas does have a link with temporal performance , it is unlikely that the smas are the sole receiver of temporal information ( see buhusi and meck , 2005 as well as wiener et al . , 2010 , for a meta - analysis ) . this idea is further supported by a recent fmri study that examined which brain areas were uniquely involved in interval timing , and which brain areas were also influenced by non - temporal tasks ( livesey et al . interestingly , the levels of activation measured in small portions of the inferior frontal gyrus , the anterior insulae and the left supramarginal gyrus , and the putamen were only influenced by time estimation , whereas the pre - sma was also strongly influenced by the difficulty of the non - temporal task . this result led the authors to suggest that areas other than the pre - sma are critically involved in temporal processing , and that activity in the pre - sma is related to cognitive effort or task difficulty . however , what does the buildup of negativity represent if the cnv is not the reflection of the accumulator of temporal information ? two proposals will be discussed here . the first proposes a direct link between oscillatory processes and the cnv and assumes that the cnv increases over time as larger groups of neurons fire simultaneously . many of the cnv results could be viewed as being consistent with an oscillator process if one makes the following assumptions : ( 1 ) scalp detected event - related potential ( erp ) components , like the cnv , reflect postsynaptic potentials ( psps ) synchronized across many ( i.e. , thousands of ) neurons . ( 2 ) the periodic cortical neurons that form a core component of oscillatory models ( e.g. , striatal beat - frequency model of matell and meck , 2000 , 2004see oprisan and buhusi , 2011 ) normally fire at random with respect to each other . hence , summation of the psps that precede those action potentials is maintained at some baseline level . this is true both for neurons that have the same , as well as different periods . ( 3 ) according to the striatal beat - frequency model , a signal emitted from the substantia nigra at signal onset acts as a start - gun to reset the periodic cortical neurons such that neurons with the same periodicity are synchronized and those with different periodicities share the same initial start point . ( 4 ) as the timing signal elapses , the number of near simultaneous psps should increase and , therefore , the eeg mean voltage should move away from the baseline level present when the periodic neurons are active at random with respect to each other . relationship with each other , or when the oscillators are reset to start timing a new interval . such a proposal has some obvious limitations , but it provides a reasonable account of some of the eeg / erp effects that can be accounted for by oscillatory models and , equally important , it should be possible to design ways to test it ( macdonald and meck , 2004 , 2006 ; brannon et al . another explanation of the cnv phenomena assumes that the cnv reflects readiness or preparation for the processing of an event instead of temporal accumulation ( e.g. , elbert , 1993 ) . according to this view , the increased negativity ( which results in decreased information processing thresholds ) reflects the anticipation of an upcoming and relevant event . data that supports this view has both been provided using cnv - related research ( for review see elbert , 1993 ) and more recent fmri research . for example , forstmann and van maanen ( forstmann et al . , 2008 ; van maanen et al . , in press ) have shown in a series of studies that the pre - sma is more active in conditions in which a fast response is required than in conditions in which an accurate response is expected . using similar arguments as elbert ( 1993 ) , forstmann and van maanen link the activity of the pre - sma to a reduction of inhibition at the level of the basal ganglia . combined , this work supports the idea that the buildup of negativity is not a source of temporal information , but a consequence of a temporal preparation for an upcoming event . an analysis of the eeg data showed a negative deflection , which started at the onset of the to - be bisected duration , and reached its maximum at 800 ms , the short anchor duration . interestingly , the amplitude remained stable for about 800 ms , after which the cnv began to resolve . the deflection point at 1600 ms corresponds with the stimulus duration at which the participants switched from predominantly answering short to long , and is as such comparable to the effects found in the temporal generalization study of macar and vidal ( 2003 ) . however , the stable cnv amplitude between 800 and 1600 ms ( and similar stable patterns in elbert et al . , 1991 and gibbons and rammsayer , 2004 ) is difficult to reconcile with a direct link between the cnv and the temporal accumulator , as in this view a stable cnv amplitude indicates a constant subjective perceived duration . a constant subjective duration would have resulted in erratic performance , something that was not observed . 2011 ) interpreted the boundaries of the plateau as two target durations , with the first target duration indicating that a relevant signal might appear from that point on , and the second target duration indicating that any upcoming signal would carry less relevance since the answer ( long ) could already be deduced based on the passage of time . consequently , these findings support the view that the cnv amplitude reflects the expectancy of a relevant event , something that is based on temporal information , but not the source of temporal information . in conclusion , experiments that are often cited in favor of a direct link between the cnv and the temporal accumulator can not be straightforwardly interpreted , and have shown to be difficult to replicate . it is , therefore , our view that proposals based on this direct link need to be re - evaluated in light of the inconsistencies in the supporting eeg data and lack of congruence with physiologically plausible models of interval timing ( see allman and meck , in press ; coull et al . , 2011 ; matell et al . , 2011 ; oprisan and buhusi , 2011 ; portugal et al . , 2011 ; simen et al . , 2011 ) . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
the relation between the contingent negative variation ( cnv ) and time estimation is evaluated in terms of temporal accumulation and preparation processes . the conclusion is that the cnv as measured from the electroencephalogram ( eeg ) recorded at fronto - central and parietal - central areas is not a direct reflection of the underlying interval timing mechanism(s ) , but more likely represents a time - based response preparation / decision - making process .
viruses are important causes of morbidity and mortality in elderly patients , and respiratory viral infections , particularly influenza , remain a significant cause of death in community - dwelling older adults . influenza vaccination may have limited efficacy in this population , possibly due to age - associated declines in both humoral and cell - mediated immune responses [ 1 , 2 ] . cases of influenza in influenza - vaccinated seniors represent vaccine failure , and a therapy that can enhance the anti - influenza response in influenza - vaccinated seniors would be of therapeutic benefit in this population . cvt - e002 ( cold - fx ) , a patented poly - furanosyl - pyranosyl - saccharide - based extract of panax quinquefolius is known to have immunomodulatory properties [ 3 , 4 ] . evidence from numerous in vitro and animal studies indicates that cvt - e002 acts through toll - like receptors to stimulate both innate and acquired immunity and enhance immune responses to viral infections.for example , in a study of human peripheral blood mononuclear cells cultured with live influenza virus , cvt - e002 was found to enhance the production of il-2 and ifn- . in another study , cvt - e002 increased the expression of ifn- in natural killer ( nk ) cells cultured with influenza virus ( y. a. jing , internal report ) . daily administration of cvt - e002 for 6 weeks to mice with viral - induced leukemia was found to increase the proportions of macrophage and nk cells in the bone marrow and spleen of treated animals . clinical efficacy of cvt - e002 has also been demonstrated for the prevention and treatment of viral upper respiratory infections ( uris ) , in particular , influenza , in healthy adults , and institutionalized and community - dwelling seniors [ 68 ] . the present study was the largest multicenter study to date to examine the efficacy of daily dosing of cvt - e002 in the prevention of uris in community - dwelling seniors who had received current - season influenza vaccine . it was also the only study to date to systematically assess a full panel of viral causes for respiratory infection in seniors taking cvt - e002 preventatively and the first study to look at the impact of cvt - e002 dose on efficacy . it was hypothesized that regular supplementation of cvt - e002 during influenza season would maintain immune stimulation and , therefore , would reduce the incidence , severity , and duration of viral uris in otherwise healthy influenza - vaccinated seniors . it was also hypothesized a dose response would be observed resulting in improved efficacy of 800 mg / d of cvt - e002 over that observed with 400 mg / d . the specific objectives of the study were ( 1 ) to determine the dose - related prophylactic efficacy of cvt - e002 in community - dwelling influenza - vaccinated seniors on the incidence of laboratory - confirmed - clinical uris , ( 2 ) to evaluate the effects of cvt - e002 on the incidence and frequency of all uris meeting a jackson - based criteria , ( 3 ) to determine the efficacy of cvt - e002 supplementation on the severity and duration of uris , and ( 4 ) to assess the safety and tolerability of chronic administration of two dosages of cvt - e002 in older adults . this study was a multicenter , randomized , double - blind , placebo - controlled , three - arm trial . influenza - vaccinated , community - dwelling seniors 65 years were recruited through four different health regions in canada located in edmonton , ab , toronto , on , vancouver , bc , and halifax , ns . the study was approved by all 4 local site rebs and was registered in the online registry , http://clinicaltrials.gov/ ( identifier nct00240461 ) . the 6 month study periods extended from approximately the middle of october , 2005 through april 2006 and from the middle of october , 2006 through april 2007 . recruitment of seniors was done by disseminating study details through information sessions and the distribution of study advertisements at local influenza immunization clinics and community seniors ' centers and groups . eligible participants included those seasonally vaccinated for influenza who were available for follow - up visits , and also willing and able to sign a written informed consent . subjects with the following medical conditions were excluded : hiv infection , malignancy , unstable cardiovascular disease , renal abnormalities , pulmonary disease , acute or active chronic liver disease , neurologic or psychiatric disease , active tuberculosis , multiple sclerosis , bleeding disorders , or planned surgery over the course of the trial . those currently taking immunosuppressive therapy , oral steroids at dose equivalent of prednisone 10 mg / day or more , phenelzine , pentobarbital , haloperidol , warfarin , and heparin additionally , those with a history of alcohol / drug abuse or known allergies to ginseng were not allowed to participate . participants logged their daily dosing and recorded any concomitant medication(s ) consumed during the study . because uris were considered an experimental endpoint , they were not included in the adverse event listings . aes classified as infections included bladder infections , bone infections , skin infections , and lower respiratory tract infections such as pneumonia . it should be noted that since pain and pulmonary aes could refer to non - uri - related events ( e.g. , arthritis pain ) and since the uri definition required multiple symptoms of a certain intensity and duration , there is not a direct correlation between aes in these categories and the incidence of jackson - confirmed uri . subjects maintained the same dosing , even during an uri , and were told to try and avoid any additional medications for their uris unless prescribed by their physician . initially , a one - month supply of the medication was given to the subjects . they were also required to immediately call the study coordinator if they developed any symptoms of a respiratory infection . a nasopharyngeal swab was obtained by the study coordinator within 5 days of the onset of uri symptoms and tested for influenza a and b , parainfluenza 1 , 2 , and 3 , respiratory syncytial virus , adenovirus , coronavirus , and rhinovirus . all specimens were processed by a central viral laboratory using standard virologic methods consisting of viral culture , pcr , and direct fluorescent antibody analysis of the swabs . the study agent was cvt - e002 , a proprietary product of afexa life sciences inc . , standardized using a patented dual fingerprinting technique chembioprint to ensure chemical and pharmacological consistency . the study compared the effects of two dosages of cvt - e002 , 400 , and 800 mg / day , with a placebo . the placebo capsules , containing microcrystalline cellulose ( mcc ) , were indistinguishable in appearance , color , and size from the treatment capsules . the capsules contained either 100 mg cvt - e002 + 100 mg mcc or 200 mg cvt - e002 or 200 mg mcc . the bottle labels were identical ( patient i d number was the only differentiator between bottles ) . subjects for whom consent had been obtained were randomized by the study coordinator(s ) using a one - to - one - to - one allocation of placebo and the two cvt - e002 arms using block randomization ( block size of 12 ) created by ega biosciences , an independent company . treatment consisted of taking 2 capsules of study medication twice every day for 6 months following the onset of the influenza season . blinding could be broken in case of a serious adverse event by use of the treatment codes provided by ega biosciences to the investigators in individual sealed opaque envelopes . during an uri , subjects completed a daily log of the severity of their uri - related symptoms on a scale of 03 ( 0 = no symptom , 1 = mild symptom no change in daily activities , 2 = moderate symptom some decrease in ability to carry out daily activities , and 3 = severe symptom confined to home or bed ) . the following symptoms were evaluated : sore throat , runny nose , nasal congestion , cough , myalgia , sneezing , ear aches , headache , fever , chills , and fatigue . daily symptom scores for all days in which a score exceeding 4 were reported were summed to calculate the total symptom score ( tss ) [ 7 , 9 , 10 ] . the primary end point of the study was the incidence of acute respiratory illness referred to as laboratory - confirmed - clinical uris over the 6-month study period . laboratory confirmation was defined as a positive result for any of the viruses tested in the swab samples . clinical infection was defined by the presence of at least two of the following symptoms : cough , headache , sore throat , and fever . subjects were considered to have a jackson - confirmed uri if the tss over two successive days was greater than or equal to 14 and at least one of the following symptoms was present : sore throat , runny nose , nasal congestion , and cough [ 7 , 11 ] . adequacy of blinding was assessed by completion of a study medication perception questionnaire which subjects completed during their last visit to the center . compliance was assessed by counting the capsules returned and was verified by checking the subjects ' daily logs . sample size was calculated assuming that the proportion of subjects with laboratory - confirmed - clinical uri in the control group would be 10% and that cvt - e002 supplementation at either dose would reduce the incidence to 3% or less . to detect an absolute reduction of 7% with 80% power at 5% significance level ( two - sided ) , 194 subjects per group were required . to allow for multiple comparisons and loss to followup , a total of 260 subjects per group were enrolled , resulting in a total sample size of 780 subjects . all randomized subjects who had received at least one dose of study medication were included in the primary efficacy analysis . this group was referred to as an intention - to - treat ( itt ) population . between - group comparisons for the primary end point were made using the log - rank statistic for the time - to - infection approach for itt group and using a chi - square test for comparing proportions for which only subjects completing the study were included . the secondary efficacy variables included the 6-month rate of jackson - confirmed uris , severity and duration of uris , and safety of chronic administration of cvt - e002 . for the itt group , between - group comparisons of the uris were made using the log - rank statistic . for subjects completing the study , the total symptom scores and the total days of infection in the three groups were compared using wilcoxon two - sample tests . the incidence of adverse events , adverse events by category , and serious adverse events were compared using chi - square tests for comparing proportions . between - group comparisons of measured compliance and the proportion of patients who were at least 80% compliant were made using an analysis of variance and a chi - square test , respectively . the percentage of subjects in each treatment group that thought they were taking cvt - e002 and the percentage of subjects perceiving treatment to be effective were compared using chi - square tests for comparing proportions . following the screening process a total of 783 volunteers were recruited from 4 centers across canada ( figure 1 ) . of these , 264 , 264 , and 255 received placebo , cvt - e002 400 mg / day , and cvt - e002 800 mg / day , respectively . thirty five of these 783 subjects ( 11 from placebo group , 15 from cvt - e002 - 400 , group and 9 from cvt - e002 - 800 group ) were excluded from the analysis . a total of 748 subjects were included in the statistical analysis for primary efficacy endpoint , 253 in the placebo group , 249 in cvt - e002 - 400 group , and 246 in cvt - e002 - 800 group . a total of 145 subjects ( 19.4% ) , 56 ( 22.1% ) in placebo group , 39 ( 15.7% ) in cvt - e002 - 400 group , and 50 ( 20.3% ) in cvt - e002 - 800 group withdrew from the study ( figure 1 ) . thus , a total of 197 , 210 , and 196 subjects in the placebo group , cvt - e002 - 400 group , and cvt - e002 - 800 group , respectively , completed the study ( p = 0.17 ) . the three groups were found to be balanced in terms of age , gender , smoking status , weight , height , body mass index , and blood pressure ( table 1 ) . compliance was found to be similar among the groups in study completers ( data not shown ) , however , significantly greater in the cvt - e002 groups than the placebo group in the itt population ( p = 0.036 , table 1 ) . the primary end - point in the study was the 6-month rate of lab - confirmed - clinical uris . the 6-month rate of these uris in the itt group ( n = 748 ) was found to be 5.5% , 5.2% , and 4.6% in the placebo , cvt - e002 - 400 , and cvt - e002 - 800 group , respectively ( p = 0.89 , table 2 ) . for subjects completing the study ( n = 603 ) , the rate of laboratory - confirmed - clinical uris was found to be 6.1% , 4.3% , and 4.6% in the placebo , cvt - e002 - 400 , and cvt - e002 - 800 group , respectively ( p = 0.67 ) . the infection rates for the individual viruses tested in the study were found to be similar among the groups , with no statistically significant between - group differences seen ( table 3 ) . use of clinical criteria for uri , such as a jackson - based criteria , is valid and improvement in this type of measure is clinically relevant . the proportion of subjects in the itt group ( n = 748 ) with jackson - confirmed uris was 26.7% in the placebo group , 21.8% in the cvt - e002 - 400 group , and 19.3% in the cvt - e002 - 800 group ( p < 0.23 , table 2 ) . because a previous study demonstrated that efficacy of cvt - e002 was only apparent in the final 8 weeks of a 16-week treatment period , an analysis was completed including only those participants who had completed the entire course of study . among subjects completing the study ( n = 603 ) , the 180-day rate of jackson - confirmed uris was found to be 28.9% in the placebo group , 20.0% in the cvt - e002 - 400 group , and 19.4% in the cvt - e002 - 800 group ( p < 0.04 ) . both the doses of cvt - e002 were found to significantly reduce the number of these uris ( p < 0.04 for 400 mg / day and p < 0.03 for 800 mg / day ) . in subjects completing the study , the effects of the treatments on the number , duration , and severity of the uris are also presented in table 2 . overall between - group comparisons revealed that the treatments had no significant effects on the number , severity , or duration of lab - confirmed clinical uris . however , the number of jackson - confirmed uris / subject was found to be significantly reduced in those taking cvt - e002 ( p < 0.04 ) . in addition , regular dosing of cvt - e002 at either 400 mg / day or 800 mg / day resulted in statistically significant reductions in symptom duration ( total days of uri , p < 0.05 ) and symptom severity ( tss , p < 0.05 ) of the jackson - confirmed uris . the incidence of all adverse events reported as well as serious adverse events is presented in table 4 . the percentage of subjects experiencing adverse events did not differ between the groups ( p = 0.81 ) . there were no among - group differences except for cardiovascular adverse events which were found to be significantly lower in the cvt - e002 - 400 and cvt - e002 - 800 groups ( p = 0.05 ) . a total of 36 subjects ( 4.8% ) experienced serious adverse events during the study , 12 ( 4.7% ) in the placebo group ( myocardial infarction , hypotension , 2 angina , 2 gastroenteritis , 2 bowel resection for polyp removal , appendectomy , hernia surgery , ataxia , prostate cancer , and severe pain in back and legs ) , 14 ( 5.6% ) in the cvt - e002 - 400 group ( atrial fibrillation , 2 chest pain , fatal heart attack , 2 gall bladder surgery , appendicitis , fractured arm , broken sternum , bone infection , prostate cancer , asthmatic bronchitis , cerebrovascular accident , and fainting ) , and 10 ( 4.1% ) in the cvt - e002 - 800 group ( pulmonary embolism , cardiac arrest , basal cell carcinoma , 2 diarrhea and nausea , epistaxis , bruised ribs , chest pain , bladder infection , and mass in prostate ) ( p = 0.72 ) . of the saes , 6 were deemed possibly related to study medication : 2 in the placebo group ( ataxia and gastroenteritis ) , 2 in the cvt - e002 - 400 group ( asthmatic bronchitis and appendicitis ) , and 2 in the cvt - e002 - 800 group ( pulmonary embolism and cardiac arrest ) . one fatal myocardial infarction , in the cvt - e002 - 400 group , was also reported and was deemed unlikely to be related to study medication . the treatment codes were broken for 2 subjects , one in the placebo group and one in the cvt - e002 - 400 group . comparison of treatment groups revealed no differences in the percentage of those believing they were taking cvt - e002 ( p = 0.45 ) or those perceiving the treatment to be effective ( p = 0.58 , data not shown ) . the proportion of subjects taking concomitant medications in different groups was found to be 98.0% , 97.2% , and 96.8% in the placebo , cvt - e002 - 400 , and cvt - e002 - 800 groups , respectively ( data not shown ) . cvt - e002 ( cold - fx ) , a proprietary product of afexa life sciences inc . , has been found to be effective in the prevention of uris , including influenza , in a variety of populations including healthy adults , institutionalized seniors , and community - dwelling adults [ 6 , 8 ] . the present study was designed to evaluate possible dose - related effects of cvt - e002 when administered to influenza - vaccinated , otherwise healthy , community - dwelling seniors ( 65 years ) . in particular , subjects with a seasonal immunization against influenza were recruited to determine if cvt - e002 supplementation would provide additional prophylaxis to that provided by the vaccine , which is not always protective in this population . the results indicate that regular supplementation of cvt - e002 during winter months was effective in reducing the number of jackson - confirmed respiratory infections in healthy seniors . cvt - e002 treatment , however , was not found to have any significant effect on the incidence of laboratory - confirmed clinical uris . these results are somewhat different from an earlier study in which regular dosing of cvt - e002 was found to be effective in reducing the incidence of acute respiratory illnesses due to influenza and rsv in influenza - vaccinated institutionalized seniors . this discrepancy in the results could be explained , in part , by the lower than usual incidence rate of influenza reported at all 4 study sites during the present study . a report from health canada indicates that the overall percentage of influenza positive tests in the 2005 - 2006 season ( 8.5% ) was lower than in the 2004 - 2005 and 2003 - 2004 seasons ( 12.7% and 12.3% , resp . ) and a further lower incidence rate of 5.5% was observed in the present study ( table 2 ) [ 12 , 13 ] . in addition , the age group accounting for the greatest proportion of cases during the 2005 - 2006 and 2006 - 2007 flu seasons was reported to be 014 age group ( 45% ) as compared with the 2004 - 2005 season in which 46% of the cases were represented by the 65-year age group . in the present study , the milder nature of the influenza outbreaks and the lower rate of positivity for respiratory viral infections among participants ( 5.5% ) may have resulted in an insufficient power to manifest treatment effects . delays in collection and transportation of swab samples may also have contributed to the unexpectedly low rate of laboratory - confirmed infections and resulted in the lack of efficacy of cvt - e002 in meeting the primary end point . the design of this clinical trial was based on designs used to study products with direct impact on the virus . in the period of time since this clinical trial was designed , increasing knowledge about the mechanism of action of cvt - e002 has led to the understanding that cvt - e002 belongs to a new therapeutic class of polymolecular botanical drugs that impact the host immune system rather than the virus . this new information indicates that endpoints , such as incidence of lccu , designed to study efficacy of antiviral medications are not as relevant to the study of cvt - e002 as clinical endpoints are . despite the insufficient number of laboratory - confirmed infections to validate primary outcome measures , cvt - e002 supplementation was found to affect secondary outcome measures significantly among subjects completing the study the population of subjects completing the study was used in the analysis because of evidence from a previous trial that there is a threshold of time required for the treatment effect size to be measurable . cvt - e002 was particularly effective in reducing the number of uris meeting a jackson - based criteria , a criteria based upon the subjects own perception of severity of the symptoms . use of these clinical criteria of uri is valid and improvement in this measure is clinically relevant . cvt - e002 supplementation at 400 mg / day and 800 mg / day was found to reduce the relative risk of jackson - confirmed uris by 31% and 33% , respectively ( table 2 ) . the number needed to treat with cvt - e002 doses of 400 mg / day and 800 mg / day was found to be 11.2 and 10.5 , respectively . the results are in agreement with an earlier study on healthy adults in which regular dosing of cvt - e002 during an influenza season was found to be effective in reducing the number , severity , and duration of jackson - confirmed uris . although the underlying mechanism(s ) of these effects was not determined in the present study , evidence from earlier studies indicates that immune modulating properties of cvt - e002 may have been involved . cvt - e002 is known to act through toll - like receptors to stimulate innate and th1-type immune responses [ 3 , 4 , 14 , 15 ] . it is , therefore , possible that by enhancing inflammatory responses of innate and t cells to the respiratory viruses , cvt - e002 may have reduced the viral load and hence prevented or shortened the duration of respiratory symptoms . the observed reduction in cardiovascular adverse events in participants taking cvt - e002 was unexpected and warrants further evaluation . the present study also compared the efficacy of two different doses of cvt - e002 on the incidence , duration , and severity of uris in this high risk population . despite the fact that the dose of 800 mg / day produced greater reduction in the number , severity , and duration of jackson - confirmed uris than the dose of 400 mg / day , the differences between these 2 groups were not significant . both doses of cvt - e002 were safe and well tolerated when taken regularly as seasonal prophylaxis with no observed differences in the incidence of adverse events between subjects in the treatment and placebo arms and no treatment - related serious adverse events were observed . in conclusion , although no significant between - group differences were seen for lccus , the data indicate that cvt - e002 at a dose of 400 mg / day or 800 mg / day is safe and well tolerated and results in a reduction in the number , severity , and duration of jackson - confirmed uris when taken as seasonal prophylaxis by healthy , community - dwelling older adults . further studies with larger sample size are warranted to determine possible dose - related effects of cvt - e002 .
cvt - e002 ( a proprietary extract ) was found to be effective in the prevention of upper respiratory infections ( uris ) in healthy adults , and institutionalized and community - dwelling seniors . a multicenter , randomized , double - blind , placebo - controlled trial was carried out to determine effects of cvt - e002 in the prevention of uris in influenza - vaccinated community - dwelling adults . 783 community - dwelling adults were randomized to receive placebo , 400 mg or 800 mg treatment / d ( 1 : 1 : 1 ) for 6 months . primary analysis on the incidence of laboratory - confirmed - clinical uris ( lccus ) , including influenza a and b , was performed on those receiving at least one dose . secondary analysis was performed on study completers and included incidence , severity , and duration of uris meeting a jackson - based criteria and safety of cvt - e002 . the incidence of lccus in the itt group was 5.5% , 5.2% , and 4.6% in the placebo , 400 mg and 800 mg groups , respectively ( p = 0.89 ) . jackson - confirmed uris were significantly lower in the treated groups ( p < 0.04 ) . cvt - e002 supplementation reduced the severity and duration of jackson - confirmed uris . the results indicate that cvt - e002 can be safely used by similar groups and may prevent symptoms of uris ; larger sample size is warranted .
during 20042007 , serum samples from 1,036 sheep and goats in turkey were serologically screened for infection with pestiviruses of small ruminants . of these , 11 serum samples from 7 sheep herds gave positive or doubtful reactions in the csfv antibody specific elisa ( herdchek , idexx ) and were subjected to commonly used virus neutralization testing ( vnt ) ( 7 ) . vnt against the 2 established csfv strains alfort187 ( genotype 1.1 ) and diepholz ( genotype 2.3 ) and against the bdv strains moredun ( genotype 1 ) and gifhorn ( genotype 3 ) revealed higher bdv titers in only 3 serum samples ( table 1 ) . equal or slightly higher titers against the csfv reference strains became evident in 8 of the 11 serum samples , which came from 5 regions of turkey . further vnt analyses with the 2 previously obtained isolates , aydin/04 and burdur/05 , demonstrated neutralizing antibody titers that were equal or higher than those against bdv and csfv test strains . to elucidate the reason for strong serologic reactivity in csfv assays , we genetically and antigenically characterized pestiviruses aydin/04 and burdur/05 . * boxes indicate virus neutralization test titers for homologous serum ; boldface indicates results for aydin/04 and burdur/05 . csfv strains : alfort187 ( genotype 1.1 ) , diepholz ( genotype 2.3 ) , paderborn ( genotype 2.1 ) . bdv strains : moredun ( genotype 1 ) , frijters ( genotype 1 ) , x818 ( genotype 1 ) , reindeer ( genotype 2 ) , gifhorn ( genotype 3 ) . the genome sequence of burdur/05 was determined by next - generation sequencing on an illumina miseq platform ( 2 250-bp paired end run , 593,328 reads ) as recently described ( 9 ) . template total cellular rna was extracted from supernatant of sheep fetal thymus cells . of all reads , reads , 89.9% assembled into a single sequence contig encompassing the entire pestivirus burdur/05 genome ( coverage 196-fold ) . sequence and phylogenetic analyses were performed with complete genome sequences and deduced amino acid sequences of new pestiviruses aydin/04 ( genbank accession no . genetic distances were calculated by using the kimura 2-parameter substitution model , and phylogenetic analyses were conducted by applying the neighbor - joining method as commonly used for csfv phylogeny ( 11 ) . with the same set of sequences , a grouping scan was performed by using the sse platform ( 12 ) . comparison of the complete coding sequences of aydin/04 and burdur/05 revealed a genetic distance of 16.5% . phylogenetic analyses based on deduced polyprotein sequences showed that isolates aydin/04 and burdur/05 form a distinct group located between csfv and bdv ( figure 1 , panel a ) . phylogenetic and antigenic tree displaying relatedness of pestiviruses aydin/04 and burdur/05 to other pestivirus species . a ) for phylogenetic analysis , deduced polyprotein sequences from genbank were used ( csfv : j04358 , gu233734 , jx218094 , ay568569 , gq902941 , kj619377 , ay382481 , af326963 , x87939 , af099102 , ay578687 , ay646427 ; bdv : af037405 , u70263 , kc963426 , af144618 , gq902940 , kf918753 , gu270877 ; bvdv-1 : ef101530 , af220247 , m96751 , af091605 ; bvdv-2 : ab567658 , gq888686 , af502399 , u18059 ; hobi - like : ab871953 , nc012812 ; giraffe - like : nc003678 , kj660072 ; pronghorn and bungowannah : nc024018 , nc023176 ) . bootstrap values were calculated for 1,000 iterations . only significant bootstrap values ( 700 ) of major nodes are given in the tree . b ) antigenic tree based on coefficients of antigenic similarity ( r values ) displaying antigenic relatedness of pestiviruses aydin/04 and burdur/05 to representative csfv and bdv strains . r values < 25 indicate significant antigenic differences as representing > 4-fold differences in titers . r values > 25 are considered not significant and are therefore not drawn to scale . bdv , border disease virus ; bvdv , bovine viral diarrhea virus ; csfv , classical swine fever virus ; g , genotype . systematic antigenic characterization was performed by using cross - neutralization assays ( table 2 ) . for this purpose , csfv and bdv reference strains for which homologous serum was available were tested by vnt as described ( 7 ) . in general , neutralization of both isolates was more efficient when performed with different csfv antiserum than with bdv antiserum . in addition , the aydin - specific antiserum obtained from animal experiments neutralized the csfv reference strains with titers higher than those for the bdv strains ( table 2 ) . because no experimental infection with burdur/05 has been performed , burdur/05-specific antiserum was not available ; however , close antigenic relatedness of both isolates was demonstrated by the high neutralization titers of the aydin - specific antiserum for isolate burdur/05 ( table 2 ) . to quantify and to depict the antigenic relatedness , we calculated coefficients of antigenic similarity ( r values ) as described previously ( 13 ) . an antigenic tree graphically displaying the r values clearly shows 2 distinct clades , one representing csfv and the other comprising bdv strains ( figure 1 , panel b ) . furthermore , aydin/04 is antigenically more closely related to csfv than to bdv , but it also clearly differs from these 2 pestivirus species . * bdv , border disease virus ; csfv , classical swine fever virus ; boxes indicate virus neutralization test titers for homologous serum ; boldface indicates results for aydin/04 and burdur/05 . csfv strains : alfort187 ( genotype 1.1 ) , diepholz ( genotype 2.3 ) , paderborn ( genotype 2.1 ) . bdv strains : moredun ( genotype 1 ) , frijters ( genotype 1 ) , x818 ( genotype 1 ) , reindeer ( genotype 2 ) , gifhorn ( genotype 3 ) . because of their close relationship to csfv , it was of particular interest to determine the ability of these ruminant pestiviruses to infect pigs and induce clinical disease . therefore , 3 clinically healthy and pestivirus uninfected weaner ( 6 weeks of age ) piglets were inoculated with 1 10 50% tissue culture infectious doses of isolate aydin/04 and given a booster of 3 10 50% tissue culture infectious doses 2 weeks later . pigs showed no clinical signs of disease , no fever , no platelet or leukocyte depletion , and no viremia ( data not shown ) . for all 3 animals , strong seroconversion was found ( 50% neutralizing titer of serum for homologus virus was 240640 on postinoculation day 77 ) . several new genetically diverse groups of pestiviruses have emerged in domestic livestock and wild animals , adding to the continuously growing list of approved and tentative pestivirus species ( 1 ) . according to phylogenetic analyses of short partial genome sequences , 2 pestivirus isolates , aydin/04 and burdur/05 , recently circulating in sheep and goat herds in different regions of turkey , however , the data from this study demonstrate that these novel aydin - like pestiviruses are representatives of a new pestivirus species , genetically and antigenically located between csfv and bdv ( figure 1 ) . the genetic distance of 16.5% between these isolates indicates that distinct ruminant aydin - like pestiviruses circulate in different regions of turkey . for some genomic regions , both ruminant pestivirus isolates display an even higher similarity to csfv than to bdv ( figure 2 ) . the close genetic relatedness to csfv is in line with the antigenic characterization by cross - neutralization assays as depicted in the antigenic tree ( figure 1 , panel b ) . this finding is in contrast with findings for pestivirus isolates from tunisia , another group of ruminant pestiviruses genetically closely related to csfv but antigenically more closely related to bdv ( 14 ) . the close antigenic relationship to csfv explains the observed strong cross - reactivity of serum from sheep and goat in csfv - specific elisas , even when the variable e2 protein is used as diagnostic antigen ( table 1 ) . in routine diagnosis , questionable elisa results are further investigated by vnt against csfv and other pestiviruses ( e.g. , bvdv and bdv ) . remarkably , even if representatives of the aydin - like pestiviruses were included as test strains in the vnt , csfv infection still could not be ruled out . amino acid similarity of pestiviruses aydin/04 and burdur/05 to representative csfv and bdv polyprotein sequences . the same csfv and bdv polyprotein sequences as in figure 1 were used for analysis . grouping scan was performed with the sse software platform as described previously , by using a window of 200 aa with 20-aa increments ( 12 ) . for calculation of genetic distances , bdv , border disease virus ; csfv , classical swine fever virus ; c , core protein ; e , envelope protein ; rns , ribonuclease secreted ; n , n - terminal autoprotease ; ns , nonstructural protein ; p7 , protein p7 . although these novel pestiviruses are the closest known relatives of csfv , experimental infection of pigs with aydin/04 did not result in detectable viremia and clinical signs . nevertheless , these ruminant pestiviruses are candidates for a switch to porcine hosts after ongoing virus evolution , which would have severe consequences for serologic diagnosis of classical swine fever , affecting control and monitoring programs performed in many parts of the world .
to determine why serum from small ruminants infected with ruminant pestiviruses reacted positively to classical swine fever virus ( csfv)specific diagnostic tests , we analyzed 2 pestiviruses from turkey . they differed genetically and antigenically from known pestivirus species and were closely related to csfv . cross - reactions would interfere with classical swine fever diagnosis in pigs .
to report on a case that developed an atypical form of occult choroidal neovascularization ( cnv ) after successful macular hole surgery . visual acuity change , color fundus photographs , fluorescein and indocyanine green angiograms , and optical coherence tomography results were compared throughout the follow - up duration . a 64-year - old woman with a macular hole in the right eye and drusen in both eyes underwent pars plana vitrectomy , internal limiting membrane peeling , and gas tamponade . one month after the operation she developed occult cnv , in which pigment epithelial detachment and fine retinal pigment epithelial ( rpe ) layer wrinkles were observed under the completely sealed macular hole . cnv can develop after otherwise successful macular hole surgery , especially in patients with pre - existing aging changes in the macula , such as drusen . care should be taken in such patients , to prevent the development of cnv after macular hole surgery . full - thickness macular holes are effectively managed by pars plana vitrectomy and gas tamponade with a high anatomic success rate . however , vision - threatening complications such as retinal detachment , cystoid macular edema , and endophthalmitis can occur in some patients after macular hole surgery.13 a few cases of choroidal neovascularization ( cnv ) after successful macular hole surgery have been reported in the literature.36 we report a case that developed an atypical form of occult cnv after an otherwise successful macular hole surgery , and was treated using intravitreal injection of ranibizumab . a 64-year - old woman presented with a 3-week history of decreased vision in the right eye . her best corrected visual acuity was 0.2 in the right eye and 0.8 in the left eye . on fundus examination , multiple soft drusen were seen in the macula of both eyes ( figure 1a and b ) . in the right eye , a full - thickness macular hole was observed and was confirmed by optical coherence tomography ( oct ) ( figure 1c ) . fluorecein angiogram ( fag ) revealed a window defect at the corresponding area of the macular hole . no evidence of cnv was found either in fag or in indocyanine green ( icg ) angiography ( figure 1d and e ) . pars plana vitrectomy , internal limiting membrane ( ilm ) peeling after icg staining , and perfluoropropane ( c3f8 ) gas tamponade were performed to treat the macular hole of the right eye . one month after the surgery , fluid accumulation under the macula and multiple blot subretinal hemorrhages near the inferotemporal vascular arcade were observed ( figure 2a ) . oct showed retinal pigment epithelial detachment ( ped ) under the successfully sealed macular hole ( figure 2b ) . the patient was followed up for another month without any intervention to see whether there was further change . the next month , her visual acuity had slightly decreased to 0.1 . however , more opaque fluid accumulation and fine wrinkles under the macula were noted , obscuring the detail of the drusen at the region ( figure 3a ) . on oct examination , reduction in the height of the ped and rpe layer wrinkling were noted ( figure 3b ) . fag and icg angiography showed distinct hypofluorescent lines at the macula throughout the study of the angiogram ( figure 3c and d ) . an early - phase icg angiogram showed a radiating fine cnv network ( figure 3c ) . late fag pictures showed pinpoint leakages and pooling at the corresponding ped area ( figure 3d ) . monthly intravitreal injections of 0.5 mg/0.05 ml ranibizumab ( lucentis ; genentech , south san francisco , ca ) were given to the patient . the boundary of the lesion showed some fibrotic change along the superotemporal and superonasal border , and the subretinal wrinkles became more obvious ( figure 4a ) . to date , there are only a few case reports of cnv that have developed after macular hole surgery.26 tabandeh et al6 reported characteristics of cnv occurring after macular hole surgery . typically , the cnv showed a predominantly classic pattern ( eight in nine eyes , 89% ) , and moderate to severe leakage ( eight in nine eyes , 89% ) on fag . the size of the cnv was 2 macular photocoagulation study disc diameter in eight of nine eyes ( 89% ) . the patient in the present study , however , showed larger occult - type cnv . a unique feature of the patient was fine wrinkling of the rpe layer , as evidenced by the angiogram and the oct ( figures 3 and 4 ) . these wrinkles were not evident at the initial stage of the cnv development ( figure 2 ) . one month later , the fine wrinkles became more prominent , and the height of the ped decreased . however , the exact location of the rpe tear was not evident either on the fag or on the oct . another possible explanation includes conversion from pure serous ped or ped with latent cnv to fibrous ped . the oct finding of the ped at 1 month postoperatively is compatible with pure serous ped . however , subretinal hemorrhage and rather flattened contour of the ped could be signs of an occult vascular component . fag and/or icg at this time should have provided more information regarding the nature of the ped . as contraction of the fibrous component of cnv continued along the cnv , the fine rpe wrinkles , more clearly seen on fag ( figure 3c , fag ) , seem to have been formed perpendicular to the axis of the cnv ( figure 3c , icg ) . however , the most plausible explanation is age - related degenerative changes in the rpe and bruch membrane , as evidenced by old age and a high prevalence of drusen in both eyes of most patients who showed cnv development after macular hole surgery.6 the patient in the present report also showed bilateral multiple drusen and was 64 years old . however , in the reports by berinstein et al,4 in which 34 eyes of 32 patients who had intermediate to large - sized macular drusen at the baseline underwent macular hole surgery , only one eye was complicated by cnv development after the surgery . another possible explanation is trypan blue toxicity , which was used for ilm staining.3 in the present study , icg dye was used for the ilm staining and peeling . icg dye could be toxic to the neurosensory retina and rpe,7 although it is widely used for macular surgery . the vital dye can easily pass through the macular hole to the rpe , and may have resulted in toxic damage to the vulnerable rpe , with drusen facilitating cnv formation . mechanical trauma during the ilm peeling could have played a role in the pathogenesis as well . therefore , measures have to be taken to minimize mechanical and toxic insults to the retina and rpe in patients with macular hole and drusen , to limit the risk of cnv development . ilm peeling without staining . however , triamcinolone - assisted ilm peeling8 using safer dye such as brilliant blue g9 or using viscoelastic material to cover the macular hole during the staining may be reasonable options for less experienced surgeons . focal laser photocoagulation or photodynamic therapy has been used to treat cnv arising after macular hole surgery.3,6 in the present report , ranibizumab was used to treat the occult cnv . after 3-monthly intravitreal injections , the lesion and visual acuity did not change significantly . in summary , we report on a case that developed occult cnv with ped and fine rpe wrinkles after an otherwise successful macular hole surgery . toxic and mechanical damage to the rpe , which already had aging changes , as shown by drusen , may have facilitated the formation of the cnv . intravitreal injection of ranibizumab did not induce complete resolution of the ped while maintaining visual acuity . care should be taken in patients with macular hole accompanied by aging changes in the macula , such as drusen , to prevent development of cnv after macular hole surgery .
purposeto report on a case that developed an atypical form of occult choroidal neovascularization ( cnv ) after successful macular hole surgery.methodsvisual acuity change , color fundus photographs , fluorescein and indocyanine green angiograms , and optical coherence tomography results were compared throughout the follow - up duration.patientsa 64-year - old woman with a macular hole in the right eye and drusen in both eyes underwent pars plana vitrectomy , internal limiting membrane peeling , and gas tamponade . one month after the operation she developed occult cnv , in which pigment epithelial detachment and fine retinal pigment epithelial ( rpe ) layer wrinkles were observed under the completely sealed macular hole . after 3-monthly intravitreal injections of ranibizumab , the lesion did not change significantly.conclusioncnv can develop after otherwise successful macular hole surgery , especially in patients with pre - existing aging changes in the macula , such as drusen . care should be taken in such patients , to prevent the development of cnv after macular hole surgery .
two years previously , a mass involving the left thigh had been diagnosed after wide excision as multiple myeloma and the patient had undergone chemotherapy . after 6 months , the disappearance of serumal monoclonal protein and a free light chain in the urine indicated complete remission . ugis demonstrated a luminal protruding mass in the anterior wall of the gastric cardia and along the greater curvature of the body ( fig . 1a ) , while contrast - enhanced ct revealed marked thickening of the gastric wall , with subtle contrast enhancement ( fig . mr imaging depicted a well - defined , homogeneous mass with prominent gastric wall thickening , but no necrotic portion . as demonstrated by t1-weighted imaging sequences , the signal intensity of the mass was less than that of the liver , though t2-weighting showed it as slightly higher , and homogeneous ( fig . after the administration of contrast material , the observed homogeneous enhancement was similar to that of hepatic parenchyma ( fig . 1d ) . fiberoptic gastroscopy depicted a large , protruding , luminal mass and multiple biopsies were performed . histopathologic examination revealed dense and monotonous infiltration by both mature and immature plasma cells ( fig . the extraskeletal spread of multiple myeloma occurs more frequently than is currently recognized , but clinical involvement of the gut is rarely reported . where it does occur , the small bowel is most commonly involved , followed by the stomach , colon , and esophagus . patients with gastric myeloma have presented with nonspecific gastrointestinal symptoms such as epigastric pain , weight loss , and upper gastrointestinal bleeding ( 1 - 4 ) . pathologically , gastric myeloma is thought to originate from lymphoid follicles in the submucosa , or from plasma cells in the submucosa or mucosal lamina propria ( 5 ) . the most advanced form of gastric myeloma infiltrates the deep muscular layer or serosa , and to avoid misdiagnosis , deep endoscopic biopsy may be required ( 3 ) . gastric myeloma can manifest in various forms : nodular , infiltrative , ulcerative , and polypoid ( 5 ) , among which the nodular type is most common . in our case the infiltrative form occurred , manifesting as diffuse thickening of the anterior wall of the gastric cardia and along the greater curvature of the body . the radiologic findings of gastric myeloma have been reported in the literature ( 2 , 3 ) . ugis has indicated the presence of infiltrative and polypoid mass lesions , though to differentiate on the basis of those findings between gastric myeloma and a gastric stromal tumor , lymphoma , neuroendocrine tumor , or adenocarcinoma is difficult . yoon et al . ( 3 ) describe the ct findings in two patients with gastric myeloma : in both , homogeneous gastric wall thickening was apparent , and contrast enhancement was poor and similar in degree to that of paraspinal muscle . t1-weighted mr imaging sequences indicated that the signal intensity of the mass was less than that of the liver , while t2 weighting showed it as slightly higher . the administration of contrast material revealed no necrotic portion , and the homogeneous enhancement observed was similar to that of hepatic parenchyma . although these findings simulate those of lymphoma , neuroendocrine tumor and gastric stromal tumor ( 6 ) , differentiation is based on the fact that in lymphoma the nodes are usually bulkier , while a neuroendocrine or stromal tumor usually has a necrotic portion . in conclusion , gastric myeloma is an uncommon entity that may mimic other malignant gastric tumors and tends to present as a homogeneous solid mass without a necrotic portion . correct diagnosis depends upon a correctly interpreted biopsy combined with the immunohistochemical study of immunoglobin .
we report a case of multiple myeloma with gastric involvement occurring in a patient who underwent an upper gastrointestinal series ( ugis ) , ct and mri . ugis depicted a luminal protruding mass , while contrast - enhanced ct demonstrated marked thickening of the gastric wall , with subtle contrast enhancement . at t1- and t2-weighted mr imaging , the mass showed iso- and intermediate signal intensity , respectively . after the administration of contrast material , subtle homogeneous enhancement was apparent .
incarcerated hernia frequently requires emergency surgery since it is associated with intestinal obstruction and ischemia . however , emergency surgery for intestinal obstruction has a high mortality and morbidity.1,2 recently , we were able to perform elective laparoscopic repair of a morgagni hernia causing obstructive ileus in a very elderly patient by preoperative colonoscopic placement of a transanal decompression tube . the patient was an 88-year - old woman who had experienced vomiting and abdominal distention for three days . plain radiographs showed up an inverted u - shaped pocket of air in the lower mediastinum , and dilated bowel loops ( fig . 1 ) . abdominopelvic ct revealed an incarcerated transverse colonic loop through the diaphragm ( fig . 2 ) . emergency colonoscopy for decompression demonstrated two luminal constriction sites with convergence of mucosal folds at the transverse colon ( fig . 3 ) ; these were consistent with the diaphragmatic indentations of the incarcerated hernia seen by fluoroscopy . we were able to pass the endoscope ( gif - xq240 ; olympus optical co. , tokyo , japan ) through the constrictions with resistance and see the dilated large bowel proximal to the constrictions . however , the endoscope could not be advanced further because of the presence of a walking stick - shaped loop . transanal decompression by inserting an 18 fr levine tube over the guidewire after removing the endoscope failed since the tube could not be advanced beyond the first constriction . accordingly we placed a thinner catheter ( enbd-7-liguory , 7 fr , 250 cm ; cook medical inc . , winston - salem , nc , usa ) , which is designed for nasal biliary drainage , through the working channel of the endoscope beyond the constrictions ( fig . 4 ) . the catheter was irrigated periodically with normal saline to prevent obstruction , and the intestinal contents and gas were drained successfully . follow up abdominal radiograph the next day demonstrated marked regression of the obstructive ileus ( fig . 5 ) and the patient was able to undergo elective laparoscopic repair of the hernia after a week . laparoscopy revealed omental herniation restricted to the anteromedial portion of the left diaphragm , and integrity of the bowel . the omentum was reduced into the abdomen , the hernia sac was excised , and the defect was repaired with a 56 cm mesh patch ( proceed surgical mesh , ethicon inc . , somerville , nj , usa ) . morgagni hernia is a diaphragmatic hernia that accounts for 3% of total intestinal obstructions.3 repair can be performed either by transthoracic or transabdominal approach , and good results with laparoscopic transabdominal repair have been reported recently.3,4 colostomy ( or ileostomy ) , followed by a second operation for its repair , is performed in many cases of colonic obstruction since primary anastomosis is not always feasible.5 however , we were able to safely perform one - step elective laparoscopic repair for the patient with advanced age by endoscopic decompression ; this procedure relieved the symptoms of obstruction , led to medical recovery and a favorable bowel preparation . drainage was successful even though we could place only a thin catheter beyond the constrictions . in fact , catheters of small diameter have the great advantage that they can be positioned through the endoscope . drainage can be effective in spite of the narrow lumen of the catheter if it is prevented from causing obstruction by , for example , periodic irrigation . thus , when it is difficult to position a transanal decompression tube of large diameter by the seldinger technique , insertion of a catheter of smaller diameter through the endoscope can be a useful option . finally , this case suggests that appropriate endoscopic placement of a decompression tube for incarcerated morgagni hernia permits elective and less invasive laparoscopic repair in patients at greater risk from emergency surgery .
plain radiographs of an 88-year - old woman who had experienced vomiting and abdominal distention for 3 days revealed a severely obstructed ileus , and abdominopelvic computed tomography revealed an incarcerated morgagni hernia . the endoscope was passed through the constrictions from the diaphragmatic indentations and a thin catheter was placed for decompression . the obstructive ileus regressed markedly after the procedure ; the patient underwent elective laparoscopic repair of the hernia 1 week later . this is believed to be the first case of endoscopic preoperative decompression for an incarcerated morgagni hernia .
lymphomatoid granulomatosis ( lg ) is a systemic , epstein barr virus ( ebv ) associated , b cell lymphoproliferative disorder with angiocentric / angiodestructive pattern . lg occurs more frequently in patients with immunosuppressive conditions ( acquired immunodeficiency syndrome , wiskott - aldrich syndrome , and post - transplantation ) and autoimmune conditions ( sjogren 's syndrome , rheumatoid arthritis , systemic lupus erythematosus , and crohn 's disease ) . skin , central nervous system ( cns ) , kidney , and liver can also be involved . lymph node , spleen , and bone marrow involvement is rare and occurs in late stages of the disease . histopathologic triad consists of nodular polymorphic lymphoid infiltrate ( lymphocytes , atypical mononuclear and plasma cells ) , angiitis ( transmural lymphocytic infiltration of vessels ) , and granulomatosis ( lymphoid nodules with central necrosis ) . in rare cases , isolated cns disease can occur , with about 25 cases being described in literature till now . here we report a case of isolated cns lg , its clinical , imaging , and histopathologic features , and response to therapy . a 53-year - old male presented with progressive neuropsychiatric symptoms of 4 years duration , with decreasing social interaction , apathy , altered sleep , poor appetite , emotional disturbances , slowness during routine activities , and intermittent involuntary movements involving both the upper limbs . since the last 1 year , he had been having progressive decline in memory , with recurrent seizures . at presentation , he had glasgow coma scale ( gcs ) 10/15 ( e2 , m 4 , v4 ) , generalized rigidity , and sphincter incontinence . mri ( siemens 1.5 tesla avanto germany 2005 ) of brain [ figure 1a d ] showed multiple small enhancing nodules in subependymal and ependymal regions , along the vessels , and gray - white junction . nodules were numerous in the anterior / basal regions , and were also seen in the brain stem and spinal cord . cerebrospinal fluid ( csf ) analysis showed 190 cells / mm(polymorphs 1% , lymphocytes 99% ) , 221 mg% proteins , and 56 mg% glucose , without atypical cells . csf polymerase chain reaction for herpes , ebv , cytomegalovirus , varicella , and adenovirus was negative . screening for hepatitis ( b and c ) and human immunodeficiency virus ( hiv ) was negative . ( 28 u / l ) . bone marrow and computed tomography ( ct ) ( philips brilliance 6 cleveland usa 2005 ) thorax - abdomen were unremarkable . histopathology [ figure 1e and f ] from right temporal lobe biopsy showed cerebral gray and white matter with reactive astrocytosis , densely infiltrated by sheets of small and medium - sized cd3 + t cells with coarse clumped chromatin and scant cytoplasm . also seen were cd20 + b cells , with vesicular nuclei , prominent nucleoli , and moderate cytoplasm . immunostaining for cd56 , cd30 , and ebv latent membrane protein 1 ( lmp-1 ) was negative . overall features were of atypical lymphohistiocytic infiltrate , and immunomorphologic features were in favour of lg . based on the investigations , a diagnosis of lg , isolated to the cns , without any evidence of systemic involvement was made . he was treated with pulse cyclophosphamide and methylprednisolone . at 3 months follow - up , he was seizure free , had deficits in recent memory , bilateral rigidity , and exaggerated reflexes . he was ambulant without support , but required minimal assistance for activities of daily living . his repeat mri brain showed atrophy , with reduction in the number and size of the enhancing nodular lesions and perilesional edema [ figure 2 ] . ( a ) t2 axial image shows multiple small t2-isointense lesions ( arrows ) with perilesional edema ( b ) diffusion - weighted image ( dwi ) shows restricted diffusion of the lesions ( arrow ) ( c ) post - contrast axial image shows enhancing lesions in the subependymal ( double arrows ) and gray - white junction ( arrowhead ) distribution . also note the brainstem and cervical cord lesions in the post - contrast sagittal ( d ) image ( arrows ) ( e and f ) photomicrographs illustrating lymphohistiocytic infiltrate in an angiocentric pattern ( h and e , x90 ) mri brain images at 3 months follow - up ( a ) t2 axial image shows decrease in the number of t2-isointense lesions and perilesional edema ( arrow ) ( b ) dwi does not show any restriction ( c and d ) post - contrast images show fewer enhancing nodular lesions in the subependymal regions and deep gray nuclei ( arrows ) common symptoms described in the previous reports include headache , disorientation , memory loss , spastic gait , hemiparesis , visual blurring , involuntary movements , incontinence , and seizures . our case had presented with behavioral changes , chorea , and later had decline in memory , rigidity , bradykinesia , seizures , and incontinence , similar to those in previous reports . radiological features previously reported include multifocal enhancing intraparenchymal lesions or masses with perilesional edema , enhancement of leptomeninges , cranial nerves , and choroid plexus . punctuate / linear enhancement can be seen in lg , as it mainly affects the perivascular tissue and vessel walls . isolated cns disease presents usually as mass lesions which are uncommon in systemic lg with cns involvement . however , these imaging features are non - specific and can be seen in vasculitis , encephalomyelitis , lymphoma , malignant glioma , metastasis , neurosaroidosis , leptomeningeal carcinomatosis , and infections , especially tuberculosis in cases with associated pulmonary involvement . in a case report by nishihara et al . , magnetic resonance spectroscopy of the lesions showed increased peak of choline and lactate and a decreased peak of n - acetylaspartate ( naa ) , suggesting the presence of abnormally proliferating cells , loss of nervous tissue , and necrosis , respectively . mri in our case showed multiple enhancing nodules , mainly subependymal , ependymal , and perivascular . no mass lesions were seen in our case , but were common in isolated cns cases in previous reports . spinal lesions were not mentioned in the previous reports , but were seen in our case . in a case report by nishihara et al . , 18f - fluorodeoxyglucose ( fdg)-positron emission tomography ( pet ) scan showed low uptake in the lesion suggestive of necrotizing lesion and methionine ( met ) pet scan exhibited a high uptake in the lesion suggestive of highly cellular proliferative lesion . they proposed that the mismatch in accumulation of fdg- and met pet could be characteristic of lg . kawai et al . have suggested that pet imaging with kinetic analysis is effective in lg of the cns , which would show increased hexokinase activity in the lesions due to accelerated glycolytic metabolism . histopathologic findings reported consist of infiltration of the meninges , blood vessels , and brain by atypical cells with plasmocytoid characteristics . the differentials to be considered on histopathology include vasculitis and lymphoma . the angiocentric pattern and polymorphic nature of the infiltrate favor the diagnosis of lg over lymphoma . compared to vasculitis , angiocentric pattern of infiltrates and absence of eosinophils and giant cells our case showed atypical lymphohistiocytic infiltrate with angiocentric pattern of distribution and negative immunostaining for ebv lmp-1 . these features were similar to those described in earlier reports , including negative ebv status in isolated cns cases compared to cases with systemic involvement where it is positive . response to steroids and cyclophosphamide was seen in our case , similar to that in previous reports . there was improvement in functional status , with mri brain showing decrease in size and enhancement of the lesions , and cerebral atrophy . resolution of the lesions after treatment has been reported , but the cerebral atrophy seen in our patients has not been well described in literature . other modalities of therapy used in lg include , cisplatin , cytarabine , methotrexate , rituximab , combination of cyclophosphamide , doxorubicin , vincristine and prednisolone ( chop regimen ) , radiotherapy , and surgical excision of lesions . isolated cns lg , though rare , is an important differential diagnosis in patients presenting with enhancing cerebral mass , diffuse punctuate lesions , and with disease isolated to the cns . brain biopsy for the characteristic histopathologic findings and ebv status will aid in diagnosis . in view of the protracted course and response to treatment , steroids with immunotherapy can result in good outcome in isolated cns lg .
lymphomatoid granulomatosis is a rare systemic angiocentric / angiodestructive , b cell lymphoproliferative disorder . central nervous system involvement occurs as part of systemic disease . isolated central nervous system disease is rare with only few case reports . a 53-year - old male presented with progressive cognitive decline , extrapyramidal features , and altered sensorium with seizures over the last 4 years . his magnetic resonance imaging ( mri ) of brain showed multiple small enhancing nodules in subependymal / ependymal regions and along the vessels . brain biopsy showed atypical lymphohistiocytic infiltrate suggestive of lymphomatoid granulomatosis . there was no evidence of systemic disease ; thus , isolated central nervous system lymphomatoid granulomatosis was diagnosed .
typically , a complex cascade of events follows cutaneous injury aiming to repair the skin in sequential and overlapping phases beginning with an acute inflammatory response , matrix degradation , and tissue remodeling which subsides to the formation of a mature tissue . adverse wound healing can lead to excessive scar tissue formation , wound contraction , or nonhealing wounds , which present a major clinical issue in healthcare today . current approaches at minimizing such adverse wound healing include topical administration of anti - inflammatory agents , inhibitors of gene transcription , inhibitors of growth factors , physical occlusion , and advanced surgical techniques . biomaterial scaffolds have garnered much attention as mediators of scar formation as they enable increased hydration of the epidermis covering the scar and minimize the risk of infection in the healing wound . these biomaterials include extracellular ( ecm ) matrix derived scaffolds , serving as physical support to promote tissue organization , resist aggressive wound contraction and scar tissue formation . they also have the potential to deliver bioactive substances such as cytokines , growth factors , living cells , and vectors of gene therapy . the current tenet of regenerative medicine encompasses the use of biomolecules such as growth factors , pharmaceutical agents , or mediators of genetic engineering . genetic engineering has progressed to include inhibitors of gene expression , namely , interfering rna ( rnai ) . rnai delivery from a biomaterial enables a localized therapy as the scaffold can act as a reservoir of rnai , thereby enhancing delivery . additionally , delivery from a topical scaffold has the potential to maintain effective levels of payload and nucleotide bioactivity for extended periods which increases the likelihood of transfection . the rate of delivery from such a scaffold can be dictated by a combination of the interaction of the therapeutic payload ( in the case of this study ; rnai ) with the matrix and release during degradation of the scaffold . microrna ( mir)-29b has been specifically correlated with the regulation of fibrosis in a number of tissues including renal , bone , pulmonary , hepatic , and cardiac . mir-29b has been demonstrated repeatedly to be associated with tgf-1 directed fibrogenesis and widely reported to directly target ecm genes such as fibronectin , collagen type i , and collagen type iii . additionally , mir-29b has been observed to be reduced in expression or completely lost in fibrotic diseases , hence , mir-29b is believed to have a potential antifibrotic role . after being transcribed and processed from the nucleus , an mir duplex becomes loaded into a rna induced silencing complex and activated to bind to mrna and repress gene transcription . the target mrna is not purely specific as the seed sequence of a mature mir encompasses the first 27 or 22 nucleotides from its 5 end and imperfect matches in the 3 end of the mir strand can be tolerated . as a result , a single mir can regulate multiple cellular targets and , conversely , each gene can be controlled by many mirs . additionally , mirs can have indirect targets through the silencing of transcriptional factors and dysregulation of molecular pathways . this alone implies an elaborate and multifaceted mechanism of gene regulation , which has yet to be fully elucidated . even so , exogenous mirs are being delivered as potential therapeutics in many forms such as pre - mirs transcribed from plasmid dna or viral vectors , or in their mature form as mir duplexes ; such as were employed in this study . in this study ; the in vitro and in vivo evaluation of a collagen - based scaffold crosslinked with four - arm poly ( ethylene glycol ) terminated succinimidyl glutarate ( 4s - starpeg ) doped with mir-29b mature duplexes was performed . the effect of this scaffold on wound healing processes , specifically its impact on ecm remodeling following injury , was evaluated in vivo . it is hypothesized that this scaffold , when functionalized with mir-29b and applied to a rat excisional wound model , will modulate the wound healing response by reducing collagen type i production ( which is a protein directly silenced by mir-29b ) and subsequently ameliorate the collagen type iii / i ratio in the remodeling dermis . it is also proposed that mir-29b in combination with the scaffold will work synergistically towards an improvement in wound healing which can be dictated by the dose of mir-29b present in the scaffold . ecm derived biomaterials as delivery platforms of nonviral therapeutics have been previously documented both in vitro and in vivo , with beneficial outcomes . previously , the in vitro effects of 4s - starpeg crosslinked collagen type i scaffolds have been investigated as a delivery platform for delivering mesenchymal stem cells . with the four - arm structure of 4s - starpeg , theoretically , one expects one mole of 4s - starpeg to react with four moles of free amines available in collagen type i ( essentially a 1:4 molar ratio ; supplementary figure s1 ) . with this assumption in mind , determining the effectiveness of crosslinking via tnbsa quantification of free amine groups indicated a decrease in free amine groups that was inversely proportional to an increase in 4s - starpeg concentration ( figure 1a ) . the percentage of free amines available could be reduced to 9.5% with a 1 mmol / l crosslinking density . although there was no significant difference between the most effective crosslinking concentrations ( 1 and 2 mmol / l ) , there is a trend towards more free amines at 2 this is understandable as a saturation of 4s - starpeg crosslinker can cause steric hindrance to other 4s - starpeg molecules , thereby incurring less efficient crosslinking . this is supported by the effect of crosslinker on resistance to enzymatic degradation ( figure 1b ) . resistance to enzymatic degradation was increased in all scaffolds crosslinked with 4s - starpeg with a significantly higher mass ( 85% ) remaining when crosslinked at a concentration of 1 mmol / l . additionally , the 4s - starpeg concentration had a significant effect on the release of sirna embedded within the sample ( figure 1c ) . this is due to both an interaction of the sirna with the 4s - starpeg and the crosslinker - dependent degradation profile of the collagen scaffold . as rna has amine , groups present in its backbone it is possible that the crosslinker interacts with these free amines . such an interaction , however , would be minimal as cy3 labeling of the rna occurs via interaction of the cy3 dye with the free amines available in the rna . additionally , the crosslinker is added to the collagen solution first , and then the rna is added in order to minimize its interaction with 4s - starpeg . as crosslinker density has an effect on the degradation profile of the scaffold , it is apparent , especially at 0.05 mmol / l crosslinking density , that this degradation plays a key role in the release profile of the rna . at 2 days , the cy3 labeled rna has been completely released , although it should be noted that at this time point and at this concentration , complete degradation of the scaffold had occurred . the 0.5 and 1 mmol / l scaffolds survived the 10-day experiment without complete degradation , and showed a more delayed release of rna , with 85.45 and 73.88% rna , respectively , at the final time - point . further analyses revealed that the nucleic acid , in this case double stranded rna , can not interact electrostatically with the 4s - starpeg crosslinked scaffold and hence is not strongly bound to the scaffold ; this is reflected in the electrophoresis data ( supplementary figure s3 ) . the collagen used in this study has been crosslinked using the free amine groups ( nh2 ) present in its backbone , and not the negatively charged carboxyl ( cooh ) groups , which offers the collagen a net negative charge . noncrosslinked scaffolds containing rna present a net positive charge . however , when the scaffolds are crosslinked with 4s - starpeg , they lose their ability to bind electrostatically with rna , which accounts for the increased rate of release when embedding naked rna within the scaffold . based on the ability to control the release from this platform , it was sought to achieve a functional effect of this collagen scaffold doped with mir-29b in vitro . delivering naked mir-29b to monolayer cultures did not affect silencing of collagen type i and collagen type iii ( supplementary figure s2 ) ; however , when embedded within the scaffold , naked mir had a significant silencing effect ( figure 2 ) . a profound silencing of collagen type i mrna occurred ( 0.66 , 0.59 , and 0.59 at days 3 , 7 , and 14 , respectively , yet this was only statistically significant at 7 days ) . mir silencing routinely effects maximum silencing to a degree of 50% which makes these results particularly interesting collagen type iii silencing was not as pronounced up to 14 days in all groups investigated ( figure 2 ) and a recovery in collagen type iii mrna was observed . collagen has proved to be an effective reservoir of pdna and sirna in the past and therefore the observations obtained in this study are consistent with those reported previously . embedding sirna within a collagen scaffold offers greater protection from rnases and limits its degradation . furthermore , cells interact favorably with collagen and this can enable enhanced uptake of a therapeutic nucleic acid . full thickness excisional dermal wounds were created on the dorsum of female lewis rats and the collagen scaffold ( crosslinked with 1 mmol / l 4s - starpeg for in vivo studies ) , the scaffold doped with 0.5 g of mir-29b , or the scaffold doped with 5 g of mir-29b , were placed on the wounds . the migration of the wound margins to the central axis of the wound was evaluated histologically ( wound contraction , figure 4 ) and in all cases , the use of the collagen scaffold with or without mir-29b had a significantly reduced wound contraction when compared with the no treatment control . wound contraction in the empty scaffold group was reduced significantly by 10% ( figure 3a ) . contraction of the wound edges is further reduced to 15% when the scaffold is doped with either a low or a high dose of mir-29b when compared with a no treatment control , and this effect is significant . cutaneous wounds heal through a combination of epithelial migration from the wound margins and contraction of the wound bed to bring the wound margins closer . as these wound edges , come together , collagen fibrils organize parallel to the epidermis , increasing the mechanical strength of the tissue . wound contraction and scarring , which occur after large injuries can , however , lead to substantial loss of function and poor aesthetic appearance . wounded areas that can be restricted due to contracted scars will potentially benefit from scaffolds that resist contraction and therefore tension until healing is complete . the reduced contraction in the 5 g mir-29b scaffold group is corroborated when measuring the volume fraction of granulation tissue , revealing a significant increase in volume fraction of granulation tissue when compared with no treatment ( 55 versus 30% , figure 3b ) ; an effect that was statistically significant when compared with all other groups . this granulation tissue forms the basis upon which new tissue is formed in the wound and is highly vascularized and metabolically active and forms the mechanical substrate upon which the wound exerts contractile forces . the use of mir-29b reduces this contraction resulting in an increased granulation tissue which demonstrates that the mechanism of contraction has been impaired . in view of this significant effect of the treatment on wound contraction and granulation volume fraction , polarized light microscopy ( figure 4 ) was employed to obtain simultaneous imaging of collagen type i like fibers and collagen type iii like fibers ( figure 3c ) . in comparison to native , unwounded skin ( which was tissue taken from a remote part of the dorsum and not subjected to any excisional wounding or exposed to any of the treatment groups ) , all groups , with the exception of the scaffold doped with 5 g mir-29b , had a statistically significant reduced collagen type iii : collagen type i ratio . alterations in the ratio of collagen type iii : collagen type i are hallmark indicators of injury and aging in the skin , which makes this result particularly significant . a reduced collagen type iii : collagen type i ratio suggests a stiffer , predominantly collagen type i granulation tissue whereas a higher collagen type iii : collagen type i ratio suggests a more compliant , less stiff granulation tissue which accords with the previous quantitative analyses of wound contraction and granulation volume fractions . this result also suggests , that the mir-29b , at a dose of 5 g in the scaffold , has a significant effect in restoring the natural balance of collagen type iii : collagen type i which otherwise can become deregulated following traumatic injury . furthermore , immunohistochemical staining of collagen type iii expression showed that collagen type iii expression was increased in wounds treated with the scaffold and a high dose of mir-29b ( figure 4 ) . to further understand the influence of this platform on wound healing , a biotin label - based rat antibody array , capable of detecting the expression levels of 90 rat proteins was employed . the proteins affected are clustered for clarity ; and these include : growth factors such as vegf , egfr ; apoptotic factors such as fas ligand , fadd ; ecm remodeling proteins activin , tgf-s , tissue inhibitor of metalloproteinase ( timps ) , matrix metalloproteinase ( mmps ) ; and inflammatory cytokines ; il-1 , il-1 , mcp-1 ( figure 5 ) . the proteins associated with apoptosis , namely fas tnfsnf6 and fas ligand tnfsnf6 are downregulated when this scaffold is applied ( figure 5 ) . apoptosis is a morphologically and biochemically distinct process of cell death which is a crucial control mechanism for the development of organs during embryogenesis , and also for the maintenance of tissue homeostasis in mature organisms . it has been identified as a key player in the transition between granulation tissue and the formation of a definitive scar after soft tissue injury as significant apoptosis of fibroblasts , endothelial cells , and pericytes occurs , and appears to affect cell types in successive waves after wound closure . when a wound closes and evolves into a scar , there is a dramatic decrease in cellularity . when applying the platforms developed in this study , complete maturation of granulation tissue and formation of a definitive scar has not evolved based on the evaluation of granulation tissue volume fractions and contraction of the wounds . indeed , this is in agreement when wound contraction was reduced using a scaffold in any case ( figure 3a ) . however , when doping the scaffold at the high dose of 5 g of mir-29b , apoptotic factors are upregulated . it demonstrates that the mir-29b has an effect on the upregulation of apoptotic proteins and this effect is also dose dependent . for instance , mir-29b is known to have many targets , one of which is the antiapoptotic protein mcl-1 . therefore , increased presence of mir-29b can downregulate the transcription of mcl-1 thereby reducing the inhibition of apoptosis . this accords some agreement with the data obtained from the protein array in which an upregulation of apoptotic proteins is seen when delivering 5 g of mir-29b in conjunction with a crosslinked scaffold . the application of a scaffold resulted in a reduction in the expression of inflammatory cytokines . this suggest that the scaffold elicits a minimal host response as it is made of a tellocollagen , a form of collagen without the terminal peptides , eliminating antigenic regions by proteolytic processing . the incorporation of mir-29b into the scaffold elicits an upregulation of some inflammatory cytokines ( il-1 , il-1 ) and this pattern exists for both 0.5 and 5 g of mir-29b . it is possible that the exogenous mirs are eliciting a mild inflammatory response due to possible activation of toll like receptors or engagement with unidentified genetic targets ( directly or indirectly ) that promote inflammation . based on the observations from the biotin label - based rat antibody array and histological analyses , enzyme - linked immunosorbent assays ( elisas ) were performed to quantify and determine the influence of the treatments on the levels of timp-1 , mmp-8 , and tgf-1 ( figure 6a c ) . the observations detected in the membrane protein array with regard to tgf-1 , timp-1 , and mmp-8 expression are , for the most part , in agreement with the elisas . considering the profiles of the key proteins involved in ecm remodeling , tgf-1 is deregulated ( in this case , downregulated ) when the scaffold is applied ( based on protein array data and elisa quantification ) . this is accompanied by the downregulation of mmp-2 and mmp-13 ( in the membrane protein array ) , which are known to be stimulated by tgf-1 . tgf- is a key mediator of ecm production and has been delivered with biomaterials in order to enhance ecm production . tgf-1 is beneficial in increasing the healing rates of wounds that do not need to be aesthetically appealing ; yet the ideal scenario of tissue regeneration requires controlled healing through which there is no exaggerated deposition of fibrillar ecm proteins that contribute to unsightly , compromised scar tissue . it is established that mir-29b acts posttranscriptionally on many of the ecm proteins that are stimulated by tgf-1 ; however , there are many conflicting reports regarding the direct crosstalk between mir-29b and tgf-1 . tgf-1 has not been established to be a direct target of mir-29b . on the contrary , have documented that tgf-1 can attenuate the differentiation of myogenic cells by increasing the expression of histone deacetylase 4 , a key inhibitor of myogenic commitment . the underlying mechanism of the increased histone deacetylase 4 was the downregulated expression of mir-29b , which acts as a translational repressor of histone deacetylase 4 . a similar pattern has been noted in renal fibrosis where smad3 mediated tgf-1 has downregulated mir-29b by binding to the promoter of mir-29 . finally in the context of remodeling ; mmps and their inhibitors , timps , specifically mmp-8 and timp-2 , play important roles in the degradation and regeneration of wounded tissue . mmps are inactivated by timp-1 , timp-2 , timp-3 , and timp-4 which act by forming a 1:1 complex with the catalytic zinc in the mmps site . it has been suggested that elevation of timp-1 may be a surrogate marker for increased ecm turnover . timp-1 is a tissue inhibitor of mmp-8 which in turn breaks down collagens type i , ii , and iii in tissue and mmp-8 is established as a predominant collagenase in healing wounds . the scaffold dosed with 5 g mir-29b had the lowest level of timp-1 expression compared with the other treatments , and this level was statistically significant in comparison with the no treatment control and scaffold with 0.5 g of mir-29b alone . mmp-8 expression was increased in the wounds treated with a scaffold containing both mir-29b doses in the membrane protein array . conclusively , the elisa results show that an empty scaffold had the lowest mmp-8 expression , which was statistically significant when compared with a scaffold with 0.5 or 5 g of mir-29b in a scaffold . appertaining to the levels of mmp-8 and timp-1 , the ratio of mmp-8 to timp-1 ( figure 6d ) brings further understanding to the results of this study . the use of a scaffold with 5 g mir-29b resulted in a significantly higher mmp-8 : timp-1 ratio when compared with all other groups analyzed in this study . this implies that ecm remodeling is on - going as a ratio of 1:1 indicates that the mmp-8 : timp-1 ratio is balanced but with the application of a scaffold doped with 5 g mir-29b ; this ratio is ~1.4 . although this ratio is not excessively high , it is higher than all the other groups , the greatest of which has a mmp-8 : timp-1 ratio of 0.5 . a linear regression analysis was performed to ascertain if there was a significant trend between the input parameters and the output parameters investigated , and this revealed a statistically significant correlation between the degree of mir-29b doping of the scaffold and the mmp-8 : timp-1 ratio ( figure 6d , pearson 's coefficient r = 0.9996 ; p = 0.0047 ) . this analysis reveals that the dose of mir-29b within the scaffold dictates a positive increase in the mmp-8:timp-1 ratio based on the dose of mir-29b . therefore , the employment of a scaffold with mir-29b affects wound healing in which the level of mmp-8 to timp-1 is greater , suggesting increased matrix turnover and that this is dependent on the mir-29b dose . this significant ratio is also reflective of the collagen type iii : collagen type i ratios investigated in figure 3c . the higher mmp-8:timp-1 ratio suggests increased matrix turnover and indeed mmp-8 breaks down collagen type i. therefore , the significance of the findings of both these investigations can be taken as being connected . a wound healing polymerase chain reaction ( pcr ) array analysis revealed a number of genes upregulated and downregulated , which were in agreement with results from the protein membrane array and elisa results ( supplementary figures s4 and s5 ) . four groups which showed significant results from the membrane protein array and elisas were investigated , namely : the scaffold alone , the scaffold with 5 g mir-29b , the no - treatment control for comparison and healthy skin on which to base the relative expression of the treatments and control upon . b2 m , hprt1 , rpl13a , gapdh were chosen as internal housekeeping controls within each group . for ease of representation , the genes which were upregulated and also downregulated are presented in the form of venn diagram ( supplementary figure s5 ) ; a cut off of a fold change of five was chosen . gene expression analysis of the scaffold alone versus the scaffold doped with 5 g mir-29b was conducted to investigate the mechanism underlying improved collagen type iii / i ratio when mir-29b is incorporated into the scaffold . interestingly , this analysis yielded results that contradicted some of the protein expression study results . the most likely explanation for the opposing observations is that , in this study , wound healing gene expression regulation is not occurring only at the mrna level . gene expression can be controlled at the posttranscriptional level by modulating the degradation rates of mrna ( as is the function of mirs ) and thereby increasing the number of proteins translated per mrna molecule . it is possible that there are other posttranscriptional controls that are still being unraveled , such as processes that can increase / decrease the affinity between the desired mrna and ribosomes . it has been observed that protein and mrna transcript levels do not consistently correlate and that it is not valid to assume that correlation implies causation in this context . additionally , rt - pcr of tissue explants encompasses the analysis of cells and different sections of the tissue ( i.e. , dermis and epidermis ) which could have discordant expressions of genes and proteins which are more predominant in some cell types . notably , col1a1 , col1a2 , col3a1 , col4a1 , and col4a3 were downregulated in the scaffold doped with 5 g mir-29b compared with the scaffold alone . this is in agreement with numerous reports that document a decrease in ecm gene transcription following delivery or forced overexpression of mir-29b . however , tgf-1 gene expression remained unchanged between the samples and unchanged tgf-1 expression would normally correlate with an unchanged col1a1 , col1a2 , and col1a3 gene expression ; however , in the scaffold doped with 5 g mir-29b , these genes were downregulated . notably , the fivefold downregulation of the col1a1 , col1a2 , and col3a1 gene expression was unique to the scaffold with 5 g mir-29b . in conclusion , multiple aspects of the remodeling response were evaluated in this study and from these evaluations there was a significant impact when excisional wounds were treated with the scaffold developed in this study , and when this scaffold was doped with 0.5 or 5 g mir-29b . granulation volume fraction was greatest in the wounds treated with scaffolds containing 5 g of mir-29b . this treatment did not have a significantly lower collagen type iii / i ratio when compared with native skin , and also had a statistically significant higher mmp-8 : timp-1 ratio when compared with all other treatments . the dose of mir-29b in the scaffold had an effect in the majority of the parameters investigated . notably , there was a significant correlation between the dose of mir-29b when delivered through the scaffold and the mmp-8 : timp-1 ratio , which indicates that , not only is the combination of these parameters important , but the dose of mir-29b also has a significant effect on the parameters investigated . it can be concluded , that although the scaffold developed in this study alone is beneficial towards reduced wound contraction , incorporation of mir-29b in a dose - dependent manner ameliorates the wound healing process through modulation of mmp-8 and timp-1 , collagen type i degradation , and the posttranscriptional inhibition of ecm proteins which are being stimulated by tgf-1 . ecm derived biomaterials as delivery platforms of nonviral therapeutics have been previously documented both in vitro and in vivo , with beneficial outcomes . previously , the in vitro effects of 4s - starpeg crosslinked collagen type i scaffolds have been investigated as a delivery platform for delivering mesenchymal stem cells . with the four - arm structure of 4s - starpeg , theoretically , one expects one mole of 4s - starpeg to react with four moles of free amines available in collagen type i ( essentially a 1:4 molar ratio ; supplementary figure s1 ) . with this assumption in mind , determining the effectiveness of crosslinking via tnbsa quantification of free amine groups indicated a decrease in free amine groups that was inversely proportional to an increase in 4s - starpeg concentration ( figure 1a ) . the percentage of free amines available could be reduced to 9.5% with a 1 mmol / l crosslinking density . although there was no significant difference between the most effective crosslinking concentrations ( 1 and 2 mmol / l ) , there is a trend towards more free amines at 2 this is understandable as a saturation of 4s - starpeg crosslinker can cause steric hindrance to other 4s - starpeg molecules , thereby incurring less efficient crosslinking . this is supported by the effect of crosslinker on resistance to enzymatic degradation ( figure 1b ) . resistance to enzymatic degradation was increased in all scaffolds crosslinked with 4s - starpeg with a significantly higher mass ( 85% ) remaining when crosslinked at a concentration of 1 mmol / l . additionally , the 4s - starpeg concentration had a significant effect on the release of sirna embedded within the sample ( figure 1c ) . this is due to both an interaction of the sirna with the 4s - starpeg and the crosslinker - dependent degradation profile of the collagen scaffold . as rna has amine , groups present in its backbone it is possible that the crosslinker interacts with these free amines . such an interaction , however , would be minimal as cy3 labeling of the rna occurs via interaction of the cy3 dye with the free amines available in the rna . additionally , the crosslinker is added to the collagen solution first , and then the rna is added in order to minimize its interaction with 4s - starpeg . as crosslinker density has an effect on the degradation profile of the scaffold , it is apparent , especially at 0.05 mmol / l crosslinking density , that this degradation plays a key role in the release profile of the rna . at 2 days , the cy3 labeled rna has been completely released , although it should be noted that at this time point and at this concentration , complete degradation of the scaffold had occurred . the 0.5 and 1 mmol / l scaffolds survived the 10-day experiment without complete degradation , and showed a more delayed release of rna , with 85.45 and 73.88% rna , respectively , at the final time - point . further analyses revealed that the nucleic acid , in this case double stranded rna , can not interact electrostatically with the 4s - starpeg crosslinked scaffold and hence is not strongly bound to the scaffold ; this is reflected in the electrophoresis data ( supplementary figure s3 ) . the collagen used in this study has been crosslinked using the free amine groups ( nh2 ) present in its backbone , and not the negatively charged carboxyl ( cooh ) groups , which offers the collagen a net negative charge . noncrosslinked scaffolds containing rna present a net positive charge . however , when the scaffolds are crosslinked with 4s - starpeg , they lose their ability to bind electrostatically with rna , which accounts for the increased rate of release when embedding naked rna within the scaffold . based on the ability to control the release from this platform , it was sought to achieve a functional effect of this collagen scaffold doped with mir-29b in vitro . delivering naked mir-29b to monolayer cultures did not affect silencing of collagen type i and collagen type iii ( supplementary figure s2 ) ; however , when embedded within the scaffold , naked mir had a significant silencing effect ( figure 2 ) . a profound silencing of collagen type i mrna occurred ( 0.66 , 0.59 , and 0.59 at days 3 , 7 , and 14 , respectively , yet this was only statistically significant at 7 days ) . mir silencing routinely effects maximum silencing to a degree of 50% which makes these results particularly interesting collagen type iii silencing was not as pronounced up to 14 days in all groups investigated ( figure 2 ) and a recovery in collagen type iii mrna was observed . collagen has proved to be an effective reservoir of pdna and sirna in the past and therefore the observations obtained in this study are consistent with those reported previously . embedding sirna within a collagen scaffold offers greater protection from rnases and limits its degradation . furthermore , cells interact favorably with collagen and this can enable enhanced uptake of a therapeutic nucleic acid . full thickness excisional dermal wounds were created on the dorsum of female lewis rats and the collagen scaffold ( crosslinked with 1 mmol / l 4s - starpeg for in vivo studies ) , the scaffold doped with 0.5 g of mir-29b , or the scaffold doped with 5 g of mir-29b , were placed on the wounds . the migration of the wound margins to the central axis of the wound was evaluated histologically ( wound contraction , figure 4 ) and in all cases , the use of the collagen scaffold with or without mir-29b had a significantly reduced wound contraction when compared with the no treatment control . wound contraction in the empty scaffold group was reduced significantly by 10% ( figure 3a ) . contraction of the wound edges is further reduced to 15% when the scaffold is doped with either a low or a high dose of mir-29b when compared with a no treatment control , and this effect is significant . cutaneous wounds heal through a combination of epithelial migration from the wound margins and contraction of the wound bed to bring the wound margins closer . as these wound edges , come together , collagen fibrils organize parallel to the epidermis , increasing the mechanical strength of the tissue . wound contraction and scarring , which occur after large injuries can , however , lead to substantial loss of function and poor aesthetic appearance . wounded areas that can be restricted due to contracted scars will potentially benefit from scaffolds that resist contraction and therefore tension until healing is complete . the reduced contraction in the 5 g mir-29b scaffold group is corroborated when measuring the volume fraction of granulation tissue , revealing a significant increase in volume fraction of granulation tissue when compared with no treatment ( 55 versus 30% , figure 3b ) ; an effect that was statistically significant when compared with all other groups . this granulation tissue forms the basis upon which new tissue is formed in the wound and is highly vascularized and metabolically active and forms the mechanical substrate upon which the wound exerts contractile forces . the use of mir-29b reduces this contraction resulting in an increased granulation tissue which demonstrates that the mechanism of contraction has been impaired . in view of this significant effect of the treatment on wound contraction and granulation volume fraction , polarized light microscopy ( figure 4 ) was employed to obtain simultaneous imaging of collagen type i like fibers and collagen type iii like fibers ( figure 3c ) . in comparison to native , unwounded skin ( which was tissue taken from a remote part of the dorsum and not subjected to any excisional wounding or exposed to any of the treatment groups ) , all groups , with the exception of the scaffold doped with 5 g mir-29b , had a statistically significant reduced collagen type iii : collagen type i ratio . alterations in the ratio of collagen type iii : collagen type i are hallmark indicators of injury and aging in the skin , which makes this result particularly significant . a reduced collagen type iii : collagen type i ratio suggests a stiffer , predominantly collagen type i granulation tissue whereas a higher collagen type iii : collagen type i ratio suggests a more compliant , less stiff granulation tissue which accords with the previous quantitative analyses of wound contraction and granulation volume fractions . this result also suggests , that the mir-29b , at a dose of 5 g in the scaffold , has a significant effect in restoring the natural balance of collagen type iii : collagen type i which otherwise can become deregulated following traumatic injury . furthermore , immunohistochemical staining of collagen type iii expression showed that collagen type iii expression was increased in wounds treated with the scaffold and a high dose of mir-29b ( figure 4 ) . to further understand the influence of this platform on wound healing , a biotin label - based rat antibody array , capable of detecting the expression levels of 90 rat proteins was employed . the proteins affected are clustered for clarity ; and these include : growth factors such as vegf , egfr ; apoptotic factors such as fas ligand , fadd ; ecm remodeling proteins activin , tgf-s , tissue inhibitor of metalloproteinase ( timps ) , matrix metalloproteinase ( mmps ) ; and inflammatory cytokines ; il-1 , il-1 , mcp-1 ( figure 5 ) . the proteins associated with apoptosis , namely fas tnfsnf6 and fas ligand tnfsnf6 are downregulated when this scaffold is applied ( figure 5 ) . apoptosis is a morphologically and biochemically distinct process of cell death which is a crucial control mechanism for the development of organs during embryogenesis , and also for the maintenance of tissue homeostasis in mature organisms . it has been identified as a key player in the transition between granulation tissue and the formation of a definitive scar after soft tissue injury as significant apoptosis of fibroblasts , endothelial cells , and pericytes occurs , and appears to affect cell types in successive waves after wound closure . when a wound closes and evolves into a scar , there is a dramatic decrease in cellularity . when applying the platforms developed in this study , complete maturation of granulation tissue and formation of a definitive scar has not evolved based on the evaluation of granulation tissue volume fractions and contraction of the wounds . indeed , this is in agreement when wound contraction was reduced using a scaffold in any case ( figure 3a ) . however , when doping the scaffold at the high dose of 5 g of mir-29b , apoptotic factors are upregulated . it demonstrates that the mir-29b has an effect on the upregulation of apoptotic proteins and this effect is also dose dependent . for instance , mir-29b is known to have many targets , one of which is the antiapoptotic protein mcl-1 . therefore , increased presence of mir-29b can downregulate the transcription of mcl-1 thereby reducing the inhibition of apoptosis . this accords some agreement with the data obtained from the protein array in which an upregulation of apoptotic proteins is seen when delivering 5 g of mir-29b in conjunction with a crosslinked scaffold . the application of a scaffold resulted in a reduction in the expression of inflammatory cytokines . this suggest that the scaffold elicits a minimal host response as it is made of a tellocollagen , a form of collagen without the terminal peptides , eliminating antigenic regions by proteolytic processing . the incorporation of mir-29b into the scaffold elicits an upregulation of some inflammatory cytokines ( il-1 , il-1 ) and this pattern exists for both 0.5 and 5 g of mir-29b . it is possible that the exogenous mirs are eliciting a mild inflammatory response due to possible activation of toll like receptors or engagement with unidentified genetic targets ( directly or indirectly ) that promote inflammation . based on the observations from the biotin label - based rat antibody array and histological analyses , enzyme - linked immunosorbent assays ( elisas ) were performed to quantify and determine the influence of the treatments on the levels of timp-1 , mmp-8 , and tgf-1 ( figure 6a c ) . the observations detected in the membrane protein array with regard to tgf-1 , timp-1 , and mmp-8 expression are , for the most part , in agreement with the elisas . considering the profiles of the key proteins involved in ecm remodeling , tgf-1 is deregulated ( in this case , downregulated ) when the scaffold is applied ( based on protein array data and elisa quantification ) . this is accompanied by the downregulation of mmp-2 and mmp-13 ( in the membrane protein array ) , which are known to be stimulated by tgf-1 . tgf- is a key mediator of ecm production and has been delivered with biomaterials in order to enhance ecm production . tgf-1 is beneficial in increasing the healing rates of wounds that do not need to be aesthetically appealing ; yet the ideal scenario of tissue regeneration requires controlled healing through which there is no exaggerated deposition of fibrillar ecm proteins that contribute to unsightly , compromised scar tissue . it is established that mir-29b acts posttranscriptionally on many of the ecm proteins that are stimulated by tgf-1 ; however , there are many conflicting reports regarding the direct crosstalk between mir-29b and tgf-1 . tgf-1 has not been established to be a direct target of mir-29b . on the contrary , winbanks et al . have documented that tgf-1 can attenuate the differentiation of myogenic cells by increasing the expression of histone deacetylase 4 , a key inhibitor of myogenic commitment . the underlying mechanism of the increased histone deacetylase 4 was the downregulated expression of mir-29b , which acts as a translational repressor of histone deacetylase 4 . a similar pattern has been noted in renal fibrosis where smad3 mediated tgf-1 has downregulated mir-29b by binding to the promoter of mir-29 . finally in the context of remodeling ; mmps and their inhibitors , timps , specifically mmp-8 and timp-2 , play important roles in the degradation and regeneration of wounded tissue . mmps are inactivated by timp-1 , timp-2 , timp-3 , and timp-4 which act by forming a 1:1 complex with the catalytic zinc in the mmps site . it has been suggested that elevation of timp-1 may be a surrogate marker for increased ecm turnover . timp-1 is a tissue inhibitor of mmp-8 which in turn breaks down collagens type i , ii , and iii in tissue and mmp-8 is established as a predominant collagenase in healing wounds . the scaffold dosed with 5 g mir-29b had the lowest level of timp-1 expression compared with the other treatments , and this level was statistically significant in comparison with the no treatment control and scaffold with 0.5 g of mir-29b alone . mmp-8 expression was increased in the wounds treated with a scaffold containing both mir-29b doses in the membrane protein array . conclusively , the elisa results show that an empty scaffold had the lowest mmp-8 expression , which was statistically significant when compared with a scaffold with 0.5 or 5 g of mir-29b in a scaffold . appertaining to the levels of mmp-8 and timp-1 , the ratio of mmp-8 to timp-1 ( figure 6d ) brings further understanding to the results of this study . the use of a scaffold with 5 g mir-29b resulted in a significantly higher mmp-8 : timp-1 ratio when compared with all other groups analyzed in this study . this implies that ecm remodeling is on - going as a ratio of 1:1 indicates that the mmp-8 : timp-1 ratio is balanced but with the application of a scaffold doped with 5 g mir-29b ; this ratio is ~1.4 . although this ratio is not excessively high , it is higher than all the other groups , the greatest of which has a mmp-8 : timp-1 ratio of 0.5 . a linear regression analysis was performed to ascertain if there was a significant trend between the input parameters and the output parameters investigated , and this revealed a statistically significant correlation between the degree of mir-29b doping of the scaffold and the mmp-8 : timp-1 ratio ( figure 6d , pearson 's coefficient r = 0.9996 ; p = 0.0047 ) . this analysis reveals that the dose of mir-29b within the scaffold dictates a positive increase in the mmp-8:timp-1 ratio based on the dose of mir-29b . therefore , the employment of a scaffold with mir-29b affects wound healing in which the level of mmp-8 to timp-1 is greater , suggesting increased matrix turnover and that this is dependent on the mir-29b dose . this significant ratio is also reflective of the collagen type iii : collagen type i ratios investigated in figure 3c . the higher mmp-8:timp-1 ratio suggests increased matrix turnover and indeed mmp-8 breaks down collagen type i. therefore , the significance of the findings of both these investigations can be taken as being connected . a wound healing polymerase chain reaction ( pcr ) array analysis revealed a number of genes upregulated and downregulated , which were in agreement with results from the protein membrane array and elisa results ( supplementary figures s4 and s5 ) . four groups which showed significant results from the membrane protein array and elisas were investigated , namely : the scaffold alone , the scaffold with 5 g mir-29b , the no - treatment control for comparison and healthy skin on which to base the relative expression of the treatments and control upon . b2 m , hprt1 , rpl13a , gapdh were chosen as internal housekeeping controls within each group . for ease of representation , the genes which were upregulated and also downregulated are presented in the form of venn diagram ( supplementary figure s5 ) ; a cut off of a fold change of five was chosen . gene expression analysis of the scaffold alone versus the scaffold doped with 5 g mir-29b was conducted to investigate the mechanism underlying improved collagen type iii / i ratio when mir-29b is incorporated into the scaffold . interestingly , this analysis yielded results that contradicted some of the protein expression study results . the most likely explanation for the opposing observations is that , in this study , wound healing gene expression regulation is not occurring only at the mrna level . gene expression can be controlled at the posttranscriptional level by modulating the degradation rates of mrna ( as is the function of mirs ) and thereby increasing the number of proteins translated per mrna molecule . it is possible that there are other posttranscriptional controls that are still being unraveled , such as processes that can increase / decrease the affinity between the desired mrna and ribosomes . it has been observed that protein and mrna transcript levels do not consistently correlate and that it is not valid to assume that correlation implies causation in this context . additionally , rt - pcr of tissue explants encompasses the analysis of cells and different sections of the tissue ( i.e. , dermis and epidermis ) which could have discordant expressions of genes and proteins which are more predominant in some cell types . notably , col1a1 , col1a2 , col3a1 , col4a1 , and col4a3 were downregulated in the scaffold doped with 5 g mir-29b compared with the scaffold alone . this is in agreement with numerous reports that document a decrease in ecm gene transcription following delivery or forced overexpression of mir-29b . however , tgf-1 gene expression remained unchanged between the samples and unchanged tgf-1 expression would normally correlate with an unchanged col1a1 , col1a2 , and col1a3 gene expression ; however , in the scaffold doped with 5 g mir-29b , these genes were downregulated . notably , the fivefold downregulation of the col1a1 , col1a2 , and col3a1 gene expression was unique to the scaffold with 5 g mir-29b . in conclusion , multiple aspects of the remodeling response were evaluated in this study and from these evaluations there was a significant impact when excisional wounds were treated with the scaffold developed in this study , and when this scaffold was doped with 0.5 or 5 g mir-29b . granulation volume fraction was greatest in the wounds treated with scaffolds containing 5 g of mir-29b . this treatment did not have a significantly lower collagen type iii / i ratio when compared with native skin , and also had a statistically significant higher mmp-8 : timp-1 ratio when compared with all other treatments . the dose of mir-29b in the scaffold had an effect in the majority of the parameters investigated . notably , there was a significant correlation between the dose of mir-29b when delivered through the scaffold and the mmp-8 : timp-1 ratio , which indicates that , not only is the combination of these parameters important , but the dose of mir-29b also has a significant effect on the parameters investigated . it can be concluded , that although the scaffold developed in this study alone is beneficial towards reduced wound contraction , incorporation of mir-29b in a dose - dependent manner ameliorates the wound healing process through modulation of mmp-8 and timp-1 , collagen type i degradation , and the posttranscriptional inhibition of ecm proteins which are being stimulated by tgf-1 . all solvents were of analytical or hplc grade and were obtained from sigma - aldrich chemical ( arklow , ireland ) unless otherwise stated . all oligonucleotides and primers were purchased from eurofins mwg gmbh ( ebersberg , germany ) . mir-29b mimic was obtained from qiagen ( hilden , germany ) with the sequences for rno - mir-29b : 5-uagcaccauuugaaaucaguguu-3. atelocollagen / poly ( ethylene glycol ) ether tetrasuccinimidyl glutarate scaffold preparation . nine parts of collagen solution ( 3.5 mg / ml w / v ) was gently and thoroughly mixed with one part 10 pbs . the solution was neutralized by the drop - wise addition of 2 mol / l sodium hydroxide ( naoh ) until a final ph of 77.5 was reached and kept in an ice bath to delay gel formation . 4s - starpeg was then added at a final concentration of 0.125 , 0.25 , 0.5 , and 1 mm in a volume of 200 l . the solutions were incubated for 1 hour at 37 c in a humidified atmosphere to induce gelation . residual primary amine groups of type i atelocollagen hydrogels were determined using 2,4,6-trinitrobenzenesulfonic acid ( tnbsa ) detection of amine groups assay as previously described . briefly , after crosslinking and gel formation , the hydrogels were incubated in 0.1 mol / l sodium bicarbonate ph 8.5 . 0.01% of tnbsa was added to the samples and incubated for 2 hours at 37 c . the reaction was stopped using 10% sodium dodecyl sulphate and 1 mol / l hydrochloric acid ( hcl ) . absorbance of each sample was read at 335 nm and the free amine groups quantified by interpolating values from a linear standard curve of known concentrations of glycine . briefly , hydrogels were incubated for 1 hour in 0.1 mol / l tris hcl ( ph 7.4 ) , containing 50 mmol / l calcium chloride ( cacl2 ) at 37 c . subsequently , bacterial collagenase type iv ( 770 units / mg , extracted from clostridium histolyticum ) , reconstituted in 0.1 mol / l tris - hcl at a concentration of 10 units / mg collagen type i was added . after incubation for 48 hours at 37 c , the enzymatic reaction was stopped by the addition of 0.25 mol / l ethylenediaminetetraacetic acid . after vacuum dehydration , the remaining mass was weighed and normalized to the remaining mass of glutaraldehyde crosslinked hydrogels . the characterization of the 4s - starpeg collagen type i hydrogel release profile of interfering rna was performed used sirna as a model oligonucleotide labeled with cy3 . sirna was labeled using silencer sirna labelling kit cy3 ( ambion ; life technologies , carlsbad , ca ) according to the manufacturer 's instructions . release of the mirna complexes was evaluated using the fluorescence from the control sirna , which was labeled with cy3 . briefly , the gels were prepared as described above , in a 48-well plate with the additional step of adding 2 g of cy3 labeled sirna . the effect of crosslinking density on the release profiles of sirna from the scaffolds was investigated using three conditions : a crosslinking density of 1 , 0.5 , and 0.05 mmol / l . the loaded scaffolds were incubated for 2 hours at room temperature to allow the complexes to associate with the scaffold and for complete gelation to occur . after this time , the gels were individually removed and transferred to the bottom of a 24-well well plate . to this , an equal volume of tris ( hydroxymethyl ) aminomethane ( tris)-n / ethylenediaminetetraacetic acid buffer ( 10 mmol / l tris - hcl and 1 mmol / l ethylenediaminetetraacetic acid , ph = 7.5 ) was added . at each time point , this process was repeated . at the end of the experiment , the sirna content of the solutions was quantified by measuring the fluorescence with a varioskan flash spectral scanning multimode reader ( thermo scientific , vantaa , finland ) and the cumulative release of sirna complexes from the scaffold was calculated following comparison with a standard curve . silencing studies were performed on six - well plates seeded with 1 10 cells per well . after 1-day incubation to ensure adherence and acclimatization , scaffolds were placed on the cells . the scaffolds were applied directly to ensure direct contact with cells and also to bring about a direct interaction between the cells and the scaffold . the use of a 250 l volume applied in a six - well enabled a very thin scaffold to be produced which maintained diffusion of nutrients to ensure viability of the cells . rna extraction . rna extraction was performed on the cells exposed to scaffolds with or without mirna at 7 , 14 , and 21 days . one milliliter of tri reagent ( applera ireland , dublin , ireland ) was added to each construct and incubated for 5 minutes at room temperature . phase separation was performed by adding chloroform ( sigma - aldrich ) , and total rna was purified using an rneasy kit ( qiagen ) , according to the supplier 's recommended procedure were determined using spectrophotometry at 260 and 280 nm using an ultraviolet spectrophotometer ( nanodrop nd-1000 spectrophotometer ; nanodrop technologies , wilmington , de , ) . rna integrity was checked electrophoretically using the rna 6000 nano labchip kit with an agilent bioanalyser 2100 ( agilent technologies , cork , ireland ) . reverse transcription ( rt ) was performed using the improm - ii rt system according to the manufacturer 's protocol ( promega , southampton , uk ) . reactions were performed and monitored using an abi 7000 sequence detection system ( applied biosystems , foster city , ca ) using taqman real - time gene expression mastermix ( taqman ; applied biosystems ) and specific primers which are detailed in supplementary table s2 . the primers were designed and their specificity checked using primer - blast ( www.ncbi.nlm.nih.gov ) and their efficiency determined by rt - pcr on tenfold serial dilutions of template cdna . gene transcription was inferred from calibration samples and normalized in relation to transcription of the housekeeping gene ; glyceraldehydes-3-phosphate dehydrogenase ( gapdh ) . the 2 method was used to calculate relative gene expression for each gene . in vivo rodent skin excisional b100/4342 granted by the irish department of health and approved by the animals ethics committee of the national university of ireland , galway . in addition , animal care and management followed the standard operating procedures of the animal facility at the national centre for biomedical engineering science ( ncbes ) . fourteen lewis female rats obtained from harlan laboratories ( bicester , uk ) were allowed to acclimatize to housing conditions for at least seven days prior to use . the agents used to anaesthetize the animals were intra - peritoneal xylazine and ketamine ( xylapan and narketan , vetoquinol , uk ) at a dose rate of 100 and 10 mg / kg , respectively . the objective of this study was to evaluate the effect of the system developed in vivo on the maturing phase during wound healing which is characterized by matrix remodeling , terminal and collagen deposition . therefore , the experimental design included one time period of 28 days , which is an appropriate timepoint at which to evaluate the effect of treatments on ecm remodeling and composition of the maturing wound . the animals were anaesthetized , shaved and the dimensions of the wounds marked with a permanent ink marker . four full thickness 1 cm wounds were then placed at least 1 cm apart on the back of each rat . the wounds were covered with transparent polyurethane scaffold ( opsite ; smith & nephew , london , uk ) . numbered jackets were used on all the animals with the intention of preventing wound disturbance and facilitating the identification of experimental groups . extra measures were taken to minimize wound disruption by housing all the animals individually for the duration of the study . the 1 mmol / l 4s - starpeg collagen scaffold and mir-29b were independently and jointly examined . to investigate the optimal dose delivery regimen through a scaffold , two dosing regimens were employed : a low dose ( 0.5 g ) and a tenfold higher , high dose ( 5 g ) . the higher dose of 5 g was chosen as there exist some , albeit few , reports of topical sirna delivery which range from 1 ( ref . ) to 8.7 g . , 0.5 g was chosen as a low dose as it is a tenfold decrease and is also within the range of sirna doses employed in vitro . animals were sacrificed by co2 asphyxiation at the postimplantation time period ( 28 days ) . the half section was fixed in 10% neutral buffered formalin for 12 hours maximum to be subsequently embedded in paraffin and sectioned perpendicularly to the wound surface in 3 m consecutive sections . a modified movatpentachrome stain was carried out with the russel movat pentachrome - stain kit ( mastertechs ; lodi , ca , ) to stain ecm components . wound closure was determined by comparing the distance between the wound boundaries at the initial time of surgery with the distance between the wound boundaries at day 28 . attempts were made to determine wound closure using tracing paper on the wounds at day 0 and day 28 but no significant difference between any of the groups could be detected using this method . therefore , wound closure was evaluated using histological data . to account for shrinkage effects due to dehydration and paraffin embedding , wounds were excised at day zero and processed in an identical fashion to those at day 28 . wound closure was calculated using the following formula : where w0 is the distance of the wound bed at day 0 and wt is the distance of the wound bed at day 28 . movat 's pentachrome staining in which granulation tissue stained blue / cyan in contrast to a mature yellow dermis . micrographs were obtained at a magnification of 5 ; in each case the epithelium was horizontal to the image plane . the area of the granulation tissue was determined using imagej imaging software ( national institute of health , bethesda , md ) and the volume fraction of granulation tissue calculated using the following formula : where agt is the area of the granulation tissue on the slide , at is the area of total tissue present on the slide and t is the thickness . quantitative polarized microscopy was performed on paraffin embedded sections stained with sirius red dye ( biocolor , belfast , northern ireland ) , a bifringence enhancer of collagens . the sirius red dye enhancement of bifringence was used to differentiate between collagens types i and iii . collagen type i - like fibers were identified as yellow and red and collagen type iii - like fibers in green . in the visualization of the images , a simple polarizing attachment bx - pol ( olympus , south end - on - sea , uk ) was used in a bright field microscope . this device consists of a polarizer ( u - pot ) inserted in the illumination path and an analyzer ( u - ant ) oriented orthogonal to the polarized beam . images were taken at 200 magnification in the newly formed tissue within the wound bed and analyzed . this analysis was performed using imagej threshold functions and the ratios calculated by dividing the output of collagen type iii by collagen type i fiber analysis . collagen type iii production by the infiltrated fibroblasts in the wound area was elucidated using immunohistochemistry of representative sections . hydrated sections were subjected to heat - induced antigen retrieval in ph 6.0 citrate buffer in a pressure cooker . the antibody used in the identification was mouse monoclonal to collagen iii ( abcam plc ; cambridge , uk ; dilution : 1:50 ) ; applied overnight at 4 c following blocking with goat - block . endogenous peroxidase was blocked using hydrogen peroxide ( dakocytomation , ireland ) for 5 minutes . an antigoat horse radish peroxidase ( hrp ) labeled secondary antibody ( dakocytomation , ireland ) was applied for 30 minutes followed by addition of 3,3 diaminobenzidine ( dab ) chromagen ( dakocytomation , ireland ) and the samples were counterstained with mayer 's hematoxylin . volume fractions of collagen type iii were analyzed using a grid size of 2.5 m . tissue was thawed slowly on ice and incubated in a lysis buffer containing a cocktail of protease inhibitors for 5 minutes . the tissue was mechanically disrupted using a bead mill homogenizer ( tissuelyserlt ; qiagen ) for 5 minutes at least twice until tissue was completely homogenized and centrifuged at 15,000 g for 15 minutes . the protein fraction of the centrifuged sample was extracted , aliquoted and stored at 80 c until further use . the protein content of the samples was determined using a protein quantification assay kit ( biorad , hercules , ca ) and probed for 90 proteins simultaneously using a biotin label - based rat antibody array ( raybio ; norcross , ga ) according to the manufacturer 's instructions . briefly , four samples were pooled according to the treatment group to a total of 1 mg / ml and dialyzed overnight to remove remaining lysis buffer and the protein membranes were blocked using a provided blocking buffer . the proteins were labeled with biotin using amines present in proteins and incubated with the antibody - labeled membranes overnight . following this , hrp - conjugated streptavidin was reacted with the membranes and subsequently treated with the incubation buffer provided . membranes were exposed using a kodak image station 4000 mm pro ( kodak , japan ) . membrane exposures were evaluated using imagej software ( nih , bethesda , md ) plug - ins . the images obtained were imported into imagej and analyzed using a protein array analyzer plug - in by normalizing to the given positive control signals on the membranes . for relative comparison , all samples were normalized to healthy native skin , which was not wounded and untreated . three elisas were performed using protein , which had been aliquoted from the protein isolated for the protein membrane array . the elisas included one for transforming growth factor ( tgf)-1 ( abcam plc , cambridge , uk ) , mmp-8 ( abcam plc , cambridge , uk ) , and timp-1 ( r&d systems , minneapolis , mn ) . an equal amount and concentration of each protein sample was added to each well for each elisa plate which was determined using a protein assay kit ( biorad ) . one milliliter of trireagent ( applera ireland , dublin , ireland ) was added to each tissue sample and incubated for 5 minutes at room temperature . the tissue was mechanically disrupted using a bead mill homogenizer ( tissuelyserlt ; qiagen ) at least twice for 5 minutes until the tissue was completely homogenized . phase separation was performed by adding chloroform , and total rna was purified using an rneasy kit ( qiagen ) , according to the supplier 's recommended procedure . contaminating dna was eliminated from rna preparations using dnase i. the yield and quality of total rna was determined according to the ratio of spectrophotometric absorbance values at wavelengths of 260 and 280 nm . cdna synthesis was performed using dnase - treated rna and random decamer primers using an rt first strand kit ( qiagen ) . this mixture was added to 384 wells in an rt profiler pcr array , rat wound healing array ( parb-0121z ; qiagen ) . fold changes in gene expression between the affected and control groups were calculated using the 2ct method in the pcr array data analysis template . an examination of ct value consistency for the housekeeping genes indicated that normalization was performed adequately . a similar evaluation of the built - in rna controls verified an absence of genomic dna contamination and inhibitors of either the reverse transcription or pcr . graphpad prism ( v.5 graphpad software ; san diego , ca ) was used for statistical analysis . analysis of variance ( anova ) was used followed by tukey 's post hoc test to determine statistical significance between groups . anova was performed assuming normal distribution of the data , which was tested and verified using the anderson darling test . outliers were calculated using grubb 's test and eliminated from the results to be analyzed . where appropriate , linear regression analysis was performed where significance was set at p < 0.05 . succinimidyl glutarate is an nhs - ester which binds with amine groups and therefore the succinimidyl groups react with the amine groups present on the molecules of type i atelocollagen at 37 c qrt - pcr data demonstrating the effect of mir-29b in silencing collagen type i and type iii mrna in vitro in rat cardiac fibroblasts compared to scrambled control 48 hours after delivery of mir mimics . agarose gel electrophoresis to indicate the binding of rna complexes to the collagen 4s - starpeg scaffold . an example heat map of gene expression data obtained from wound healing rt - pcr array . overview of number of genes altered in the different comparisons studied in the pcr array analysis with fold change cut off being five .
directing appropriate extracellular matrix remodeling is a key aim of regenerative medicine strategies . thus , antifibrotic interfering rna ( rnai ) therapy with exogenous microrna ( mir)-29b was proposed as a method to modulate extracellular matrix remodeling following cutaneous injury . it was hypothesized that delivery of mir-29b from a collagen scaffold will efficiently modulate the extracellular matrix remodeling response and reduce maladaptive remodeling such as aggressive deposition of collagen type i after injury . the release of rna from the scaffold was assessed and its ability to silence collagen type i and collagen type iii expression was evaluated in vitro . when primary fibroblasts were cultured with scaffolds doped with mir-29b , reduced levels of collagen type i and collagen type iii mrna expression were observed for up to 2 weeks of culture . when the scaffolds were applied to full thickness wounds in vivo , reduced wound contraction , improved collagen type iii / i ratios and a significantly higher matrix metalloproteinase ( mmp)-8 : tissue inhibitor of metalloproteinase ( timp)-1 ratio were detected when the scaffolds were functionalized with mir-29b . furthermore , these effects were significantly influenced by the dose of mir-29b in the collagen scaffold ( 0.5 versus 5 g ) . this study shows a potential of combining exogenous mirs with collagen scaffolds to improve extracellular matrix remodeling following injury .
creating order and complexity through self - assembly of simple molecular building blocks is an important area of contemporary science . yet , it is the external control over the molecular order that brings about technological disruptions , as well exemplified by the success of liquid crystals in display industry . liquid crystals ( lcs ) constitute perhaps the best platform for exploring the interplay between self - assembly , molecular alignment , and stimuli - responsiveness , as they combine order and mobility in a unique way . as a remote , highly controllable energy source , light is a particularly attractive stimulus to control the lc phases . through incorporation of light - responsive units into lc systems , several schemes for photomodulation of lc alignment have been devised , the main application potential lying in tunable photonics , functional surfaces , and light - to - mechanical energy conversion . azobenzene unit is a particularly efficient molecular switch for controlling the molecular alignment in lc systems , because of its large and reversible shape change upon photoisomerization and the incompatibility of the bent cis - azobenzene configuration with calamitic mesophases . the focus of azobenzene - based lc research can be simplistically divided into two main directions . on one hand , there is a thrust to develop tunable materials whose properties ( e.g. , surface topography ) can be rapidly and reversibly changed between the undisturbed and photomodulated states . on the other hand , several photonic applications would benefit from bistable photomodulation , i.e. , temporally stable switching between two states , using distinct wavelengths that drive the reverse photoisomerization reactions . various structures for bistable azobenzene photoswitches have been developed , and , among them , ortho - fluorinated azobenzenes appear particularly promising . fluorination is also an effective strategy to tailor the anisotropy and viscoelastic properties of lcs , and boost intermolecular interactions for the self - assembly of supramolecular lcs . combining these design principles , here , we target a new family of azobenzene - based , fluorinated supramolecular lcs with predictable phase behavior and efficient light - control over the molecular alignment . in supramolecular lcs , specific noncovalent interactions drive the formation of supramolecular mesogens , even when starting from non - liquid - crystalline building blocks . they are pertinent from the viewpoint of increasing the modularity and tunability of conventional lc systems and obtaining functionalities not met in single - component or doped lcs . the majority of works in the field have concentrated on the design and structural characterization of supramolecular lcs . their photochemical control , on the other hand , has not received much attention , whereas detailed studies have been conducted in single - component and doped lc systems . understanding the dynamics of the light - induced processes , as well as the conditions under which photoinduced phase transitions occur in supramolecular systems , are not only fundamentally important , but also provide important design principles for supramolecular functional materials . targeting photoresponsive , fluorinated supramolecular lcs , halogen bonding is the noncovalent interaction of choice . halogen bonding is an attractive interaction between an electrophilic region associated with a halogen atom in a molecular entity and a nucleophilic site . the benefits of halogen bonding , such as the high directionality and tunability , have recently been recognized in the design of functional materials . in particular , halogen - bonded , azobenzene - containing co - crystals and ( amorphous ) supramolecular side - chain polymers have shown extremely interesting photoresponsive properties , even superior to their hydrogen - bonded counterparts . since the first demonstration in 2004 , several halogen - bonded lcs have been reported . photoresponsive halogen - bonded lc complexes were first reported by some of us in 2012 , and , in 2014 , yu et al . demonstrated photoinduced phase transitions in complexes between azopyridines and molecular halogens . however , neither of these studies detailed the photochemistry of the halogen - bonded lcs , which is crucial in terms of understanding their potential use in , e.g. , supramolecular photonic devices and photoactuators . herein , we bridge this gap and report a detailed study on a small library of neutral halogen - bonded lcs , whose lc - to - isotropic phase transitions can be efficiently controlled with light . we show that < 4% of the mesogenic units in the bent cis - configuration suffice to induce a complete order - to - disorder transition of the materials . we also report a light - induced and reversible crystal - to - isotropic phase transition , which has not been previously observed in supramolecular complexes . we assembled 15 dimeric co - crystals 1-m2-n in which the photoactive alkoxyazobenzene molecules 1-m contain an iodo - tetrafluoroarene ring acting as halogen - bond donor moiety , while 4,4-alkoxystilbazoles 2-n were used as halogen - bond acceptors . details about the synthesis , characterization , and sample preparation of the 1-m molecules and of their complexes are given in the experimental section . recently , a complex of 2 - 1 with a halogen - bond - donating azobenzene substituted with a dimethylamino group has been reported to yield interesting photoresponsive behavior . herein , we replaced the dimethylamino group of the azobenzene with an alkoxy chain because ( i ) long alkoxy chains should increase the mesophase stability , compared to the dimethylamino group , and ( ii ) by decreasing the electron - donating ability of the substituent , the lifetime of the cis - form of the azobenzene should significantly increase . studied halogen - bonded photoresponsive lcs 1-m2-n are formed by self - assembly of the halogen - bond donors 1-m and the acceptor stilbazoles 2-n . the photochemical properties of 1-m were first studied in 10 m dmf solution , and were observed to be identical for all three azobenzenes . cis isomerization is attested by a decrease of the * band at 363 nm and an increase of the n * band at 436 nm ( figure 2 ) . the photostationary states were deduced by using the fischer s method , and they comprised 88% , 84% , and 24% of cis - azobenzenes upon illumination with 365 , 395 , and 457 nm , respectively . note that the absorption spectrum of 2-n partly overlaps with that of 1-m ( figure 2 ) , and upon irradiation at 365 nm , the stilbazoles also undergo photoisomerization . therefore , 395 nm was the wavelength of choice for this work , yielding efficient isomerization of the azobenzenes while leaving the stilbazoles unchanged . at 20 c in dmf , the cis - isomers of the 1-m molecules are highly stable , as illustrated in the inset of figure 2 . the thermal relaxation behavior is exponential , and the characteristic lifetime of the cis - isomer is ca . 12 days for all three molecules , confirming the design assumption ( ii ) of the previous paragraph . on time scales significantly shorter than the characteristic lifetime , the molecules can be considered to be bistable , which can be attributed to fluorination of the halogen - bond - donating phenyl ring . normalized absorption spectra of the 1-m and 2-n molecules , represented by 1 - 10 and 2 - 2 , respectively . the figure shows also the photostationary spectra under illumination wavelengths of 365 , 395 , and 457 nm , and the calculated spectrum of the cis - isomer for the 1 - 10 molecule . inset shows the thermal cis - to - trans isomerization of the molecules at 20 c indicating a cis - lifetime of ca . 12 days . the 15 halogen - bonded co - crystals 1-m2-n were obtained by slow room - temperature evaporation of chloroform solutions containing the starting materials 1-m and 2-n in 1:1 molar ratios , which take into account the pairing of the respective strongest halogen - bond donor ( i ) and acceptor ( pyridyl n ) sites.1 - 82 - 2 , 1 - 102 - 1 , and 1 - 122 - 1 were obtained as good - quality single crystals that were analyzed using single - crystal x - ray diffraction ( xrd ) , with the aim of elucidating the supramolecular organization of the starting materials in the co - crystals ( see figure 3 , as well as figures s1s7 in the supporting information ) . ball - and - stick representation of the halogen - bonded co - crystals 1 - 82 - 2 , 1 - 102 - 1 , and 1 - 122 - 1 . strong and directional in halogen bonds drive the formation of the supramolecular calamitic structures . color code : gray , c ; white , h ; red , o ; blue , n ; green , f ; and magenta , i. halogen bonds are represented by black dotted lines . 1-m and 2-n are assembled into supramolecular dimers by short and highly directional in(pyr ) halogen bonds ( see figure 3 ) . in angles are given as follows : 2.771(2 ) and 178.6 in 1 - 82 - 2 , 2.792(1 ) and 174.3 in 1 - 102 - 1 , and 2.817(2 ) and 174.5 in 1 - 122 - 1 . the observed halogen - bond distances roughly correspond to a 20% reduction of the sum of van der waals radii of i and n. the strength of such a halogen bond was calculated to be 6.5 kcal / mol in the reported complexes , which is very consistent with previous calculations . the high directionality of the halogen bond determines that calamitic structures are obtained , with aromatic rings of the two modules nearly coplanar in 1 - 102 - 1 and 1 - 122 - 1 , and orthogonal in 1 - 82 - 2 . the complexes 1 - 102 - 1 and 1 - 122 - 1 also exhibit arene perfluoroarene quadrupolar interactions between neighboring 1 - 10 and 1 - 12 molecules in different planes . because of these quadrupolar interactions , cho interactions , and ch interactions , the halogen - bonded dimers pack head - to - tail in an antiparallel fashion . finally , powder x - ray diffraction ( pxrd ) analysis ( figures s8s10 in the supporting information ) confirmed that the crystalline bulk samples have the same crystal structures , as determined on the analyzed single crystals . the lc phase behaviors of the complexes were analyzed by hot - stage polarized optical microscopy ( pom ) and differential scanning calorimetry ( dsc ) . all complexes exhibited enantiotropic lc phases , with the exception of 1 - 122 - 12 , which was monotropic . nematic phases ( figure 4 , left ) were common to all complexes , while smectic a ( sma ) phases ( figure 4 , right ) were observed only for complexes with the longest alkyl chains at both ends . we emphasize here that none of the starting compounds is liquid - crystalline as pure material , which implies that the halogen bond between the azobenzene and stilbazole units survives in the mesophase and drives the liquid crystallinity of the supramolecular structures . polarized optical microscopy ( pom ) micrographs for nematic ( left , obtained at 111 c ) and smectic a ( right , obtained at 107 c ) phases in the complex 1 - 122 - 8 . the mesomorphism of the halogen - bonded liquid crystals described above is similar to that of analogous stilbazole complexes reported earlier , showing nematic phases at short chain lengths and sma phases with longer chains . apart from the complexes with the shortest chain - length stilbazole , the transition temperatures reveal a destabilization of the nematic phases with increasing n ( figure 5 ) , which is a common behavior for calamitic mesogens with two terminal chains . a similar picture emerges when considering the variation of the alkoxy chain length on the azobenzene derivatives . interestingly , the nematic phase extends over a broad temperature range , even exceeding 30 c for many of the complexes . by preparing mixtures of several complexes , we were able to further suppress the onset temperatures for the lc phases , compared to single supramolecular entities . for instance , a mixture of 1 - 12 with 2 - 2 and 2 - 12 ( in molar ratio of 1.0:0.5:0.5 ) exhibited a crystal - to - nematic transition at 79.5 c , which is more than 10 c lower than that of the pure 1 - 122 - 2 . color legend : blue , crystal phase ; red , sma phase ; and green , n phase . all the transitions are reported upon heating , with the exception of the 1 - 122 - 12 complex , which was monotropic . because of the presence of the azobenzene molecules , the complexes are photoresponsive and undergo a fast and reversible isothermal lc - to - isotropic phase transition upon irradiation with ultraviolet ( uv ) light ( 395 nm , 40 mw / cm ) . this is illustrated for 1 - 102 - 8 at 110 c in the pom micrographs shown in figure 6 , obtained using a planar lc cell with a thickness of 2 m . we note that ( i ) the complex 1 - 102 - 8 was used as a model system , and ( ii ) similar behavior is observed also for other complexes and over the entire lc temperature range . prior to uv irradiation , the sample exhibited a uniformly colored bright image when viewed between crossed polarizers with the director axis set to 45 , with respect to the polarizer / analyzer ( figure 6a ) , whereas a black image was obtained when the axes coincided . as an example , the order parameter of molecular alignment is 0.44 for the nematic complex 1 - 102 - 8 at 105 c , as determined from polarized absorption spectra . under illumination , the birefringence due to the anisotropic molecular alignment disappeared within <3 s ( figure 6b ) , indicating the efficient photoinduced phase transition into an isotropic phase . further illumination , continued in total for 35 s , did not induce further changes into the micrographs . upon ceasing the illumination , the lc phase reappeared as small domains after a significant delay ( figure 6c ) , and , with time , the domains recombined and oriented along the rubbing direction ( figure 6d ) . the small isotropic droplets visible in the bottom right micrograph disappeared upon longer recovery times . we attribute the small lc domains ( figure 6c ) as well as the isotropic droplets ( figure 6d ) to phase separation between trans - rich liquid - crystalline and cis - rich isotropic domains that recombine once the cis - azobenzene fraction is sufficiently low . photoinduced nematic - to - isotropic transition and the reverse transition of 1 - 102 - 8 observed under pom at 110 c : ( a ) pom image before illumination , ( b ) pom image after illumination , ( c ) pom image at the onset of the isotropic - to - nematic transition , and ( d ) pom image after almost fully reversed transition . ( e ) attenuance measurements depicting absorbance ( 400 nm ) and optical scattering ( 700 nm ) and birefringence measurements of the photoinduced nematic - to - isotropic transition of 1 - 102 - 8 at 110 c . from the pom images , we can deduce that the complexes exhibit a sequence of different photoinduced processes , and that the lc - to - isotropic phase transition happens relatively fast . in order to further quantify the photochemical processes , we simultaneously monitored the changes in absorbance , birefringence , and optical scattering at different stages of the illumination cycle , as shown in figure 6e . such measurements allowed us both to monitor the dynamics of the photoinduced lc - to - isotropic phase transition and to correlate the photoinduced phase separation with the phase transition process . furthermore , they provided us with an estimate on how much cis - azobenzene is needed to induce phase transitions . to the best of our knowledge , such an effort has not been previously undertaken in supramolecular lcs . the high birefringence prior to irradiation indicates that the molecules are initially well - oriented , and the decrease in birefringence once the uv illumination is started indicates rapid disappearance of the lc phase , in response to light irradiation . the photoinduced phase transition is accompanied by a rapid increase in both the attenuance at 400 nm ( coinciding with the absorption band of the azobenzene ) , and attenuance due to optical scattering monitored at 700 nm , where neither of the compounds absorbs . the peak in scattering ( the red curve in figure 6e ) indicates that photoinduced phase separation to lc and isotropic domains also occurs upon lc - to - isotropic phase transition . the abrupt increase in the attenuance at 400 nm once the irradiation is started ( the blue curve in figure 6e ) arises from the combination of increased scattering due to phase separation , and changes in the uv - vis absorption spectrum due to a red - shift of the * absorbance band of the azobenzenes , attributed to disrupted molecular packing under uv illumination . the scattering peak disappears within a few seconds , whereas the absorbance at 400 nm continues to decrease steadily due to trans cis isomerization for the entire illumination duration , or until the photostationary state is reached . once the irradiation is ceased ( 35 s ) , the absorbance starts to immediately recover as the azobenzene molecules relax back to the thermally stable trans - form . 51 s at 110 c ( while the half - life at room temperature in a dilute dmf solution is 12 days ) . however , there is a significant delay of 130 s before the birefringence starts to recover . the onset of birefringence recovery is accompanied by the phase separation process shown in figure 6c , which , based on the scattering peak , is now significantly slower than upon starting the illumination as it is driven thermally , not by light . based on our observations , there is a clear threshold in the cis - azobenzene concentration that determines the onset of the photoinduced phase transition at a given temperature ( figure s11 in the supporting information ) . by determining the spectra of the trans- and cis - isomers at the isotropic state ( a detailed description is given in the supporting information ( figures s12 and s13 ) ) , the absorbance measurements allowed us to estimate that the onset cis - fraction of azobenzene molecules for the isotropic - to - lc phase transition is 7.6% 0.4% . this corresponds to the cis - fraction needed for the full lc - to - isotropic transition . therefore , we can conclude that , similar to azobenzene - doped lcs , the bent shape of the cis - isomer effectively disrupts molecular order also in supramolecular lcs . considering the 1:1 ( azobenzene : stilbazole ) nature of the complexes , and the fact that the stilbazole units are not isomerized under the irradiation conditions used , the overall number of cis - isomers needed to achieve the complete lc - to - isotropic phase transition is < 4% . the richness of the photoinduced processes in the complexes under investigation is further highlighted by the fact that , in addition to lc - to - isotropic phase transitions , they also undergo reversible crystal - to - isotropic transitions under irradiation with uv light . photoresponsive crystalline materials have recently attracted much interest from the viewpoint of energy conversion , actuation , reversible adhesion , and controllable gas adsorption . photoinduced crystal - to - isotropic transitions have been studied in azobenzene - based tetragonal compounds , ionic crystals , and cyclophanes . however , no such reversible isotropization has been previously reported in supramolecular complexes . figure 7a shows a pom image of the complex 1 - 102 - 8 at 85 c , i.e. , 10 c below the melting point and 30 c below the clearing point of the complex . upon illumination ( 395 nm , 40 mw / cm ) , a clear and reversible cr i transition occurred within 30 s ( figure 7b ) . upon ceasing the irradiation , recrystallization occurred in ca . 3 min , through a partial nematic lc phase ( figure 7c ) , and the end result was a homogeneous crystalline phase ( figure 7d ) . the significant delay and the partial nematic phase indicate that the effect is due to photoisomerization rather than a photothermal effect . isotropization of a crystalline sample of 1 - 102 - 8 upon irradiation with 395 nm light at 85 c : ( a ) the initial crystals melt into an isotropic liquid ; ( b ) crystals after ca . 30 s of illumination ; ( c ) recrystallization occurs through a partial nematic phase formation 3 min after the illumination was ceased ; and ( d ) the end state is again a fully crystalline material without phase separation . we have shown that halogen - bond - driven supramolecular liquid crystals ( lcs ) between alkoxy - substituted azobenzene and stilbazole molecules exhibit a rich variety of photoinduced processes , including photoinduced lc - to - isotropic and crystal - to - isotropic phase transitions . simultaneous analysis of light - induced changes in birefringence , absorption , and optical scattering allowed us to conclude that < 4% of the mesogenic units in the cis - form suffices to trigger the full lc - to - isotropic phase transition . to the best of our knowledge , this is the first quantitative analysis of the phase transition process in supramolecular liquid crystals . in our materials design , fluorination plays an important role as it both increases the lifetime of the cis - form of the azobenzene units , and enables the strong and directional halogen bonding to happen . our future goals are to ( i ) suppress the temperature at which the complexes exhibit liquid crystallinity , and ( ii ) devise cholesteric , phototunable lcs driven by halogen bonding . overall , our results demonstrate the versatility of halogen - bonded complexes as functional liquid - crystalline assemblies and pinpoint their potential toward tunable photonic devices and , eventually , supramolecular actuators . commercial hplc - grade solvents were used without further purification , except for acetonitrile , which was used as a solvent for the synthesis of azobenzenes , which was dried over cah2 and distilled prior to use . h , c , and f nmr spectra were recorded at room temperature on a bruker av400 or av500 spectrometer , using cdcl3 as the solvent . h nmr and c nmr spectroscopy chemical shifts were referenced to tetramethylsilane ( tms ) using residual proton or carbon impurities of the deuterated solvents as standard references , while f nmr spectroscopy chemical shifts were referenced to an internal cfcl3 standard . the attenuated total reflection fourier transform infrared ( atr - ftir ) spectra were obtained using a nicolet nexus ftir spectrometer . the values , given in wave numbers , were rounded to 1 cm using automatic peak assignment . the lc textures were studied with a leica dm4500p pom system that was equipped with a linkam scientific model lts 350 heating stage and a canon eos 60d camera . the melting points were also determined on a reichert instrument by observing the melting process through an optical microscope . toledo dsc823e differential scanning calorimeter , using 40 l aluminum sample pans and mettler stare software for calculation . the photoresponsivity of the halogen - bonded lcs was studied in planar lc cells ( e.h.c . the temperature was controlled with linkam scientific model lts 350 heating stage , and the spectra were measured with a model usb 2000 + spectrometer ( ocean optics , inc . ) with nonpolarized light from a deuterium the samples were illuminated with 365 and 395 nm high - power leds ( thorlabs , inc . ) , equipped with 10 nm , od 4.0 , band - pass filters ( edmund optics , ltd . ) , or with a 457 nm laser . the birefringence ( n ) was measured using a 820 nm laser and crossed polarizers . the sample was placed between the polarizers with a director oriented at angles of 45 , with respect to the polarizer / analyzer , and the transmitted intensity was measured with a photodiode . using the intensity , the birefringence is then defined as follows : the order parameter was determined by measuring the polarized absorption spectra with polarizers positioned parallel ( a ) and orthogonal ( a ) to the director of the liquid crystal . the order parameter ( s ) was then calculated by determining the absorbances at = 420 nm and using the following equation : the characterization of the cis - fraction at the onset of the isotropic - to - lc transition ( see the supporting information for a detailed explanation ) is done ( i ) by determining the trans- and cis - spectra at the isotropic state at 120 c , and ( ii ) by assuming the absorbance to be the sum of the trans- and cis - isomers , allowing us to deduce the cis - fraction from the absorption spectra at the onset of the isotropic - to - lc transition . in determining the cis - spectrum , the fact that the absorption spectra are different when measured in dilute dimethyl formamide ( dmf ) , in the lc state , and in the isotropic state , must be noted , and also the thermal isomerization must be taken into account . because of the thermal isomerization at elevated temperatures ( where the samples are isotropic ) , the photostationary states are measured at different illumination intensities and the photostationary states are extrapolated to infinite irradiation intensities to remove the effect of thermal isomerization . these photostationary spectra are then used , with the help of fischer s method , to determine the cis - spectrum . to deduce the cis - fraction at the second stage , the absorbance of the fully trans - state must be determined to be able to use the deduced spectra of trans- and cis - isomers , and this is done by fitting an exponential curve to the time development of the absorbance . with the spectral information on cis- and trans - states deduced by fischer s method , and knowing the absorbance spectra of the fully trans - state through the exponential fitting , the cis - fraction can be determined from the absorbance measurements . alkoxystilbazoles are well - known premesogens , while the iodoperfluorinated azobenzenes were prepared by a nobf4-mediated diazotization reaction between 4-iodo-2,3,5,6-tetrafluoroaniline and the relative alkoxybenzene . reactions were carried out in oven - dried glassware under a nitrogen atmosphere . a solution of 4-iodo-2,3,5,6-tetrafluoroaniline ( 3.715 mmol ) in dry acetonitrile ( 5 ml ) was added dropwise into a solution of nitrosonium tetrafluoroborate ( 3.715 mmol ) in dry acetonitrile ( 5 ml ) at 30 c . after 1 h of additional stirring at 30 c , a solution of the appropriate alkoxybenzene ( 7.43 mmol ) in dry acetonitrile , was added dropwise . the resulting solution was stirred overnight at room temperature and then water ( 15 ml ) was added . the organic layers were collected and dried over na2so4 , and the solvent was removed under reduced pressure . the residue was purified by column chromatography using hexane as eluent to yield the 1-m molecules ( 20%25% ) . h nmr ( 500 mhz , cdcl3 ) : = 7.94 ( d , j = 8 hz , 2h ) , 7.01 ( d , j = 8 hz , 2h ) , 4.06 ( t , j = 6 hz , 2h ) , 1.83 ( quintet , j = 8 hz , 2h ) , 1.48 ( quintet , j = 8 hz , 2h ) , 1.28 ( m , 16h ) , 0.89 ppm ( t , j = 4 hz , 3h ) ; c nmr ( 126 mhz , cdcl3 ) : = 163.68 , 147.66 , 147.61 ( ddt , jcf = 246 hz , jcf = 13 hz , jcf = 5 hz ) , 139.90 ( dd , jcf = 265 hz , jcf = 15 hz ) , 133.32 ( t , j = 14 hz ) , 125.85 , 115.08 , 71.60 ( t , j = 28 hz ) , 68.76 , 32.08 , 29.9029.65 ( 4c ) 29.51 ( 2c ) , 29.27 , 26.13 , 22.84 , 14.25 ppm ; f nmr ( 471 mhz , cdcl3 ) : = 121.74 ( m , 2f ) , 150.60 ppm ( m , 2f ) . ir : 2919 , 2850 , 1599 , 1578 , 1472 , 1407 , 1252 , 1143 , 980 , 836 , 587 , 525 cm . h nmr ( 500 mhz , cdcl3 ) : = 7.97 ( d , j = 8 hz , 2h ) , 7.01 ( d , j = 8 hz , 2h ) , 4.06 ( t , j = 6 hz , 2h ) , 1.83 ( quintet , j = 8 hz , 2h ) , 1.48 ( quintet , j = 8 hz , 2h ) , 1.28 ( m , 12h ) , 0.89 ppm ( t , j = 4 hz , 3h ) ; c nmr ( 126 mhz , cdcl3 ) : = 163.69 , 147.67 , 147.61 ( ddt , jcf = 246 hz , jcf = 13 hz , jcf = 5 hz ) , 139.90 ( dd , jcf = 265 hz , jcf = 15 hz ) , 133.32 ( t , j = 14 hz ) , 125.86 , 115.10 , 71.43 ( t , j = 28 hz ) , 68.78 , 32.05 , 29.9029.70 ( 3c ) , 29.51 , 29.27 , 26.14 , 22.83 , 14.24 ppm ; f nmr ( 471 mhz , cdcl3 ) : = 121.77 ( m , 2f ) , 150.65 ppm ( m , 2f ) . ir : 2919 , 2850 , 1599 , 1575 , 1472 , 1408 , 1252 , 1144 , 980 , 858 , 587 , 525 cm . h nmr ( 500 mhz , cdcl3 ) : = 7.94 ( d , j = 8 hz , 2h ) , 7.01 ( d , j = 8 hz , 2h ) , 4.06 ( t , j = 6 hz , 2h ) , 1.83 ( quintet , j = 8 hz , 2h ) , 1.48 ( quintet , j = 8 hz , 2h ) , 1.30 ( m , 8h ) , 0.90 ppm ( t , j = 4 hz , 3h ) ; c nmr ( 126 mhz , cdcl3 ) : = 163.68 , 147.66 , 147.61 ( ddt , jcf = 246 hz , jcf = 14 hz , jcf = 5 hz ) , 139.90 ( dd , jcf = 265 hz , jcf = 15 hz ) , 133.32 ( t , j = 13 hz ) , 125.81 , 114.99 , 71.67 ( t , j = 28 hz ) , 68.69 , 31.95 , 29.74 , 29.48 , 29.24 , 26.12 , 22.81 , 14.25 ppm ; f nmr ( 471 mhz , cdcl3 ) : = 121.75 ( m , 2f ) , 150.66 ppm ( m , 2f ) . ir : 2924 , 2855 , 1601 , 1578 , 1474 , 1408 , 1245 , 1146 , 979 , 849 , 567 , 531 cm . the azobenzene derivatives and the stilbazoles were separately dissolved in chcl3 at room temperature in 1:1 ratio , under saturated conditions . the two saturated solutions containing the halogen - bond donor and the halogen - bond acceptor were then mixed in a clear borosilicate glass vial , which was left open . the solvent was allowed to slowly evaporate at room temperature for 3 days until the formation of good - quality single crystals occurred ( 1 - 102 - 1 , 1 - 122 - 1 , and 1 - 82 - 2 ) . single - crystal xrd data were collected on a bruker axs kappa - apex ii ccd diffractometer using mo k radiation ( = 0.71073 ) equipped with bruker kryoflex low - temperature device . structures were solved using shelxs-97 ( direct methods ) and refined using shelxl-2008 ( full - matrix least - squares on f ) contained in apex ii and wingx v1.80.01 software packages . hydrogen atoms were placed in geometrically calculated positions and included in the refinement process using a riding model with isotropic thermal parameters . pxrd data were collected on a bruker axs d8 powder diffractometer was used for all measurements with experimental parameters as follows : cu k radiation ( = 1.54056 ) ; scanning interval , 530 2 ; step size , 0.016 ; and exposure time , 1.5 s / step . small shifts in 2 values between the powder patterns of the simulated from single crystal and the experimental xrd spectra are due to different acquisition temperatures . single crystal structures were collected at 103 or 150 k , while bulk powder materials were recorded at 298 k. all geometry minimizations were performed with the m06 - 2x / def2-tzvp method , using gaussian 09 , revision d.01 . the complexation energy between 2 - 1 and 1 - 1 was further obtained with a single - point energy calculation employing the full counter - poise method to correct for the basis set superposition error .
here , we present a new family of light - responsive , fluorinated supramolecular liquid crystals ( lcs ) showing efficient and reversible light - induced lc - to - isotropic phase transitions . our materials design is based on fluorinated azobenzenes , where the fluorination serves to strengthen the noncovalent interaction with bond - accepting stilbazole molecules , and increase the lifetime of the cis - form of the azobenzene units . the halogen - bonded lcs were characterized by means of x - ray diffraction , hot - stage polarized optical microscopy , and differential scanning calorimetry . simultaneous analysis of light - induced changes in birefringence , absorption , and optical scattering allowed us to estimate that < 4% of the mesogenic units in the cis - form suffices to trigger the full lc - to - isotropic phase transition . we also report a light - induced and reversible crystal - to - isotropic phase transition , which has not been previously observed in supramolecular complexes . in addition to fundamental understanding of light - responsive supramolecular complexes , we foresee this study to be important in the development of bistable photonic devices and supramolecular actuators .
multiple sclerosis ( ms ) is a chronic , autoimmune disease of the central nervous system characterized by demyelination of nerve cells with resultant scarring known as plaques . it mostly occurs between the ages 20 and 40 and has more prevalence in female than male . in iran , fatigue is the most prevalent and disabling symptoms of ms which may associate to disease direct or indirectly . ( 2012 ) reported that 7590% of ms patients complain of fatigue , and 60% of them mentioned it as the most tiring symptom . fatigue interferes with peoples ' daily activities , their social roles , life quality , and lifestyle and causes deterioration of ms or appearing other symptoms . included three psychosocial variables in her model for prediction of fatigue in adults with rheumatic illness : depression , learned helplessness , and social support . social support is a complicated and multi - dimension structure and an important source of compatibility that plays a significant role in the consequences of ms patients ' psychological compatibility and function . social support refers to some different types of supports which people get from others and includes emotional , functional , and informational support . emotional support implies that someone would love and care for the patient , functional support implies tangible support , which is provided for a person by others like home support , economic aids , and information support . nishida et al . reported that providing physical and emotional support play a key role in the quality of life of people with mental diseases . , also believed that social support predicts the health - related behavior such as self - care behaviors in diabetes patients . therefore , family members ' involvement , especially the partner support , significantly impacts the self - care process . on the other hand , the results of alipour et al . study revealed that there was no significant relationship between conceptualized social supports with a disability of ms patients . although , there was a negative correlation between conceptualized social support with the physical symptoms and friend support with social function of the females with ms . as our knowledge , there is no indexed domestic study targeting social support in relation to fatigue syndromes of ms patients . therefore , considering increasing high prevalence of ms patients , destructive effects of fatigue on their life and the key role of mental support in recovery and disability of chronic disease , the researcher aimed to investigate the relationship of social support and fatigue in ms patients . this descriptive - analytical study conducted after approving in mashhad university of medical sciences , iran with code of 87694 . the study population included all ms patients referred to the neurological clinic of mashhad university of medical sciences , iran ( n = 46 ) . the inclusion and exclusion criteria consisted diagnosis of ms based on revised mcdonald criterion , the physical disability level < 7 using expanded disability status scale ( edss ) , lack of ms relapse 1 month before the study , lack of severe stress experiences during last 6 months ( divorce , family death etc . ) , lack of other chronic disease . the data collection tools included following parts : the demographic characteristics and the information , i.e. , age , education , marital status , disease duration , medication , etcfatigue severity scale is a method of evaluating fatigue in ms and other conditions including chronic fatigue immune dysfunction syndrome and systemic lupus erythmatosismodified fatigue impact scale ( mfis ) has been classified as multi - dimensional scale and is intended to analyze different aspects of fatigue by assessing impact on physical , cognitive , and psychosocial functioning . the combination of nine items for physical status ( pmfis ) , ten items for cognitive status ( cmfis ) , and two items for psychosocial function status mfis , renders the global score of the mfisfatigue descriptive scale as a tool to evaluate the severity and quality of fatigue in a group of patients suffering from msmodified social support scale : this instrument provides an assessment of several domains of social support including tangible support , emotional support , affective support , and positive supportthe patients ' disability level was measured by the tool edss . the demographic characteristics and the information , i.e. , age , education , marital status , disease duration , medication , etc fatigue severity scale is a method of evaluating fatigue in ms and other conditions including chronic fatigue immune dysfunction syndrome and systemic lupus erythmatosis modified fatigue impact scale ( mfis ) has been classified as multi - dimensional scale and is intended to analyze different aspects of fatigue by assessing impact on physical , cognitive , and psychosocial functioning . the combination of nine items for physical status ( pmfis ) , ten items for cognitive status ( cmfis ) , and two items for psychosocial function status mfis , renders the global score of the mfis fatigue descriptive scale as a tool to evaluate the severity and quality of fatigue in a group of patients suffering from ms modified social support scale : this instrument provides an assessment of several domains of social support including tangible support , emotional support , affective support , and positive support the patients ' disability level was measured by the tool edss . the data analysis conducted by the statistical software of statistical package for the social sciences version 18 . chicago ) descriptive ( mean and standard deviation ) and analytical statistical ( pearson correlation co - efficient ) methods applied . the study population included all ms patients referred to the neurological clinic of mashhad university of medical sciences , iran ( n = 46 ) . the inclusion and exclusion criteria consisted diagnosis of ms based on revised mcdonald criterion , the physical disability level < 7 using expanded disability status scale ( edss ) , lack of ms relapse 1 month before the study , lack of severe stress experiences during last 6 months ( divorce , family death etc . ) , lack of other chronic disease . the data collection tools included following parts : the demographic characteristics and the information , i.e. , age , education , marital status , disease duration , medication , etcfatigue severity scale is a method of evaluating fatigue in ms and other conditions including chronic fatigue immune dysfunction syndrome and systemic lupus erythmatosismodified fatigue impact scale ( mfis ) has been classified as multi - dimensional scale and is intended to analyze different aspects of fatigue by assessing impact on physical , cognitive , and psychosocial functioning . the combination of nine items for physical status ( pmfis ) , ten items for cognitive status ( cmfis ) , and two items for psychosocial function status mfis , renders the global score of the mfisfatigue descriptive scale as a tool to evaluate the severity and quality of fatigue in a group of patients suffering from msmodified social support scale : this instrument provides an assessment of several domains of social support including tangible support , emotional support , affective support , and positive supportthe patients ' disability level was measured by the tool edss . the demographic characteristics and the information , i.e. , age , education , marital status , disease duration , medication , etc fatigue severity scale is a method of evaluating fatigue in ms and other conditions including chronic fatigue immune dysfunction syndrome and systemic lupus erythmatosis modified fatigue impact scale ( mfis ) has been classified as multi - dimensional scale and is intended to analyze different aspects of fatigue by assessing impact on physical , cognitive , and psychosocial functioning . the combination of nine items for physical status ( pmfis ) , ten items for cognitive status ( cmfis ) , and two items for psychosocial function status mfis , renders the global score of the mfis fatigue descriptive scale as a tool to evaluate the severity and quality of fatigue in a group of patients suffering from ms modified social support scale : this instrument provides an assessment of several domains of social support including tangible support , emotional support , affective support , and positive support the patients ' disability level was measured by the tool edss . the data analysis conducted by the statistical software of statistical package for the social sciences version 18 . chicago ) descriptive ( mean and standard deviation ) and analytical statistical ( pearson correlation co - efficient ) methods applied . the participants were in the age range of 1854 years with age mean of 32.6 8.7 years . the majority of the participants were females ( 91% ) , 52.2% were married , and 6.5% were divorced . in term of education , 45.7% hold a diploma , 37.0% had academic degrees and rest primarily . 63.0% of the patients had a monthly income between $ 100 and 200 . 95.7% took ms modifying medicines 80.4% were in minor disability development level ( 03.5 ) . the first symptom of ms in 28.3% of the patients was eyesight disorders and in 13.0% were sensory disorders . 26.1% of the patients reported movement disorder and 87% reported fatigue as the most important disabling problem of ms . 58.7% of the patients had no relapse history of ms during one past year , and 37.0% had relapse history of once or twice during 1 past year . about 67.4% of the participants had normal bmi ( 19.826 ) , 21.7% less than normal level . 45.7% have had ms for < 5 years , and 28.3% were suffering from ms for 5 to 10 years . the mean score of fatigue severity was 4.3 1.6 , fatigue perception 34.6 19.5 , fatigue quality 6.2 3.9 , and social support 65.6 23.1 . based on pearson statistical test the patients with more social support reported a lower level of fatigue severity ( r = 0.474 , p = 0.002 ) . according to the pearson statistical test , there was signification association between social support with fatigue severity ( p = 0.002 and r = 0.474 ) , fatigue perception ( p = 0.001 and r = 0.478 ) , and fatigue perception sub - scales , i.e. , physical ( p = 0.005 , r = 0.432 ) , cognitive ( p = 0.003 , r = 0.457 ) , and psychosocial ( p = 0.009 , r = 0.341 ) , respectively . there was no significant relation between social support with fatigue quality ( p = 0.59 ) . there was no significant relationship between social support with disability level , duration of illness , age , sex , educational level , and marital status ( p > 0.05 ) . social support may reinforce the immunity system directly by promoting self - confidence and positive feelings and in this way accelerate the illness improvement and reduction of vulnerability to the illness . in addition , supportive behaviors to others may help people protect health by reinforcing , promoting , and increasing healthy behavior . based on the results of the present study , there was a significant relationship between fatigue severity , fatigue perception , and its sub - scales with social support . the patients with higher social support reported lower fatigue perception and fatigue severity . however , there was no significant statistical relation between social support and fatigue quality . no indexed article was found about the relationship between social support and fatigue in the patients with ms in order to compare the results , but some studies in term of positive effect of social support on quality of life and mental health of the patients with chronic diseases are available . the results of jahanbakhsh et al . study investigating the relation of social support and quality of life in ms patients suggest that social support has a significant role in life satisfaction and hope in ms patients . study results showed that social support is a predicting factor and has a significant effect on life quality of ms patients . reported social support of ms patients ' family and friends largely depends on conceptual mental health situation and leads to higher physical general health schwartzs ' study results ( 2005 ) also indicated , there is a strong link between social support and quality of life in ms patients . the results of a study conducted by cheng et al . revealed that social support leads to depression reduction in parkinson patients . study found that social support can reduce the side effect of chronic diseases and increases the patient 's adjustment with diseases . hence , that increased social support from different sources can reduce physical problems of hemodialysis patients . goldstein et al . also showed that negative social support or dissatisfied social support is a source of high distress . study results shows that less satisfaction with social support leads to higher scores of depression , anxiety , and distress in patients . social support always act as an obstacle against stressful events and factors and protects a person from unwelcome incidents , patient with social support feels like he or she is valuable and this enhances the patients self - efficiency . the patients with ms due to psychological and physical changes prefer to be far from others and feel withdrawn due to the illness symptoms and the disability . if they stay away society and groups , it may lead to mental , nervous diseases and abnormalities or disorders , so social support in forms of financial , educational , service , and economic aid is critical for their relative improvement . patients ' friends and family can help him or her by giving information to better identification more effective coping strategies . these coping strategies can reinforce and encourage health positive behaviors and reduce high - risk behaviors and mental or nervous reactions leading to stress . talking freely about an illness in a noncritical and supportive atmospheres lets patients and people learn the skills of coping with the illnesses . in the present study , there was a significant negative relationship between social support with fatigue severity and fatigue perception so that people with higher social support reported lower fatigue perception , but there was no significant relationship between social supports with the quality of fatigue . it can be explained by sub - scales and content of fatigue perception questionnaire which included ; cognitive , social mental , and physical function . considering the content of fatigue severity is closely related to behavioral changes and behavioral changes leads to attracting social support sources which consequently leads to higher self - efficiency , positive changes and reduced fatigue perception and severity . the descriptive questionnaire of fatigue measures severity , frequency , and quality of fatigue , the effect of heat or temperature on fatigue which completed by physician mostly . in this scale , it seems these aspects of fatigue needs other kinds of support such as psychotherapy or medication . as any cross - sectional study , this study was involved with some limitations such as small sample size , nonrandom sampling , and nonhomogeneity sample . regarding high prevalence of fatigue among ms patients , it is suggested for future studies to conduct an interventional study and design native modules for effective educational and psychological aids . in conclusion , this study revealed that social support correlate with fatigue of patients with ms . it is already mentioned in several studies that social support positively predicts quality of life and mental health also . the results of this study may have practical suggestions on the improvement of mental and physical health of patients with ms , because the findings highlighted importance of social support in monitoring the level of fatigue and its aspects which is useful for rehabilitation . therefore , authors suggests to health care professional and care givers of these patients to provide a systematic program for social , family and friends support in order to rehabilitating ms patients .
background and aim : the psychological changes and physiological limitations during multiple sclerosis ( ms ) disease diminish the social relations . consequently , losing social supports leads to more physical and psychological complications such as fatigue syndromes . therefore , this study aimed to investigate the relationship of social support and fatigue syndromes in ms patients.methods:this study was a descriptive - analytic which randomly selected 46 patients with ms . the patients evaluated through demographic information , standard modified social support scale , fatigue severity scale , modified fatigue impact scale , and fatigue descriptive scale . gathered data analyzed using descriptive and inferential statistical pearson 's correlation coefficient.results:mean score for variables were as following : fatigue severity 4/3 1/6 , perceived fatigue 34/6 19/5 , quality of fatigue 62 3/9 , and social support 65/6 23/1 , respectively . according to the pearson statistical test , there was signification association between social support with fatigue severity ( p = 0.002 and r = 0.474 ) , fatigue perception ( p = 0.001 and = 0.478 ) , and fatigue perception sub - scales , i.e. physical ( p = 0.005 , r = 0.432 ) , cognitive ( p = 0.003 , r = 0.0457 ) , and psychosocial ( p = 0.009 , r = 0.341 ) , respectively . however , there was not significant relationship between social support and fatigue quality ( p = 0.59).conclusion : according to the results of current study , all aspects of social support can impact fatigue symptoms in ms patients . therefore , it is suggested to develop educational programs for caregivers of patients to improve the mental and physical quality of life of patients .
bruxism is defined as diurnal or nocturnal parafunctional jaw muscle activity that is characterized by clenching , bracing , gnashing , and grinding of teeth . parafunctions play an important role in oral and general health [ 2 , 3 ] . muscle pain , headaches , tooth wear , temporomandibular joint disorders , and even tooth loss are some of the consequences of sleep bruxism and awake bruxism [ 2 , 4 , 5 ] . there are two types of bruxism : awake bruxism and a sleep bruxism with different etiologies . awake bruxism is characterized by clenching - type activity and sleep bruxism is characterized by a combination of clenching and grinding - type activity . most of the studies were done on sleep - related bruxism , which is more suitable for a reliable diagnosis in a scientific research setting . self - reported bruxism was recently shown to be coherently associated with stress and stress - related disorders and a possible indicator of intrapersonal or interpersonal reactivity [ 1 , 7 ] or dissatisfaction in a healthy population . furthermore , disrupted sleep was found to be associated with bruxism and orofacial pain , suggesting a vicious circle among these factors . the origin of this stress may lie in the process of dental education [ 10 , 11 ] , with known stressors including time and schedule pressures , management of uncooperative patients , commercial issues , and the highly technical and intensive nature of work . these factors may result in inadequate sleep , which increases the risk of accidents and illnesses . research shows that sleep deprivation results in daytime sleepiness and impaired neurocognitive and psychomotor performances [ 12 , 13 ] . there is an important relationship of sleeping patterns with learning abilities and consequent academic performance . the aim of this cross - sectional study was to identify sleeping patterns among dental students and their association with self - reported bruxism in riyadh colleges of dentistry and pharmacy ( rcsdp ) . the study protocol was approved by the ethics committee of riyadh colleges of dentistry and pharmacy ( rcsdp ) and a consent form attached to each questionnaire was signed by each student who agreed to participate in the study . a total of 549 students aged 1824 years participated in this study ( 67 males and 482 females ) which fulfilled the following inclusion and exclusion criteria . all dental students with different age and gender were included aged 1824 years . exclusion criteria . the dental students with history of cardiac diseases and pulmonary diseases and students receiving psychiatric medication and sleep apnea are excluded from the study as these conditions may affect the sleeping pattern . a questionnaire was distributed during lecture classes among the participants from preclinical and postclinical levels ( from level 1 to level 12 ) of dental students by clinical instructors participating in the study for a month from november to december 2014 . in the study , we use three samples : first sample from level 1 students , second sample from level 6 students , and third sample from level 12 students . a structured questionnaire was a comprehensive instrument including items determining usual sleep / waking behaviors over the previous month . this questionnaire was adopted from a validated questionnaire of psqi ( pittsburgh sleep questionnaire index ) and arabic version of the psqi assessing sleep quality [ 15 , 16 ] and also from a questionnaire used in a previous study designed in iran . the questionnaire included additional questions asking the students if they were aware of tooth grinding during the day or night or if they were informed about tooth grinding during sleep by their partner . the first category questioned the students about their sleeping habits and determined the following : whether they faced any difficulty in initiating sleep ( dis ) , slept continuously till morning , had a fixed time for sleeping , consumed coffee before sleeping , consumed sleeping pills , or indulged in daytime naps ; night sleep duration ; time taken to fall asleep ; and duration of daytime naps . the second category assessed the following sleep - related symptoms : awakening early in the morning , facing difficulty in sleeping again , falling asleep in class , experiencing tiredness or sleepiness during the day , and facing difficulty awakening in the morning . in addition , the frequency of nightmares was assessed by this category . for analysis of the data ( individuals who reported that they had not ground their teeth while asleep or clenched their teeth while awake in the last 30 days ) and yes ( individuals who reported that they had ground their teeth while asleep or clenched their teeth while awake in the last 30 days ) . the former indicated a sleepy state , not actual sleep , while the latter indicated actual sleep . the subjects provided responses on a 15-point ordinal scale , where number 1 represented never and number 5 represented almost every day or night . four questions required categorical answers and assessed the time of going to bed , time taken to fall asleep , duration of daytime naps , and number of nocturnal awakenings . all data were analyzed using chi - square tests ( ) through spss software for windows version 17 ( spss inc . , chicago , il , usa ) . there were 12.2% men and 87.8% women providing valid responses . from the entire study population , 168 ( 31.1% ) students , including 25 males ( 37.9% of the total male population ) and 143 females ( 30.3% of the total female population ) , reported awareness of tooth grinding . the overall proportion of students with frequent or daily dis was significantly higher among the bruxers ( 28.9% , n = 48 ) than among the nonbruxers ( 14% , n = 52 , chi - square test , 22.6 , p = 0.000 , p < 0.05 ) . among the men , nine bruxers ( 36% ) complained of dis almost every night , as opposed to only four ( 9.8% ) nonbruxers ( = 8.56 , p = 0.014 ) . among the women , 38 ( 27.3% ) bruxers and 46 ( 14.2% ) nonbruxers complained of dis almost every night ( = 15.9 , p = 0.000 ) . there was no significant difference in the incidence of dis between male and female bruxers ( p < 0.05 , figure 1 ) . a significant difference was found in the number of students who always experienced disturbed sleep until morning between bruxers ( 36.8% , n = 61 ) and nonbruxers ( 20.7% , n = 77 , = 19.2 , p = 0.001 ) . with regard to gender , there was no significant difference in the number of students who slept undisturbed until morning between male bruxers and nonbruxers ( p < 0.05 ) , whereas a significant difference was observed between the female bruxers ( 25.9% , n = 36 ) and nonbruxers ( 39.4% , n = 128 , = 13.02 , p = 0.01 , figure 1 ) . the majority of bruxers ( 40.3% , n = 67 ) slept for 69 h , and the tendency to sleep for more than 9 h was significantly higher among bruxers ( 38% , n = 63 ) than among nonbruxers ( 20.8% , n = 75 ) . among nonbruxers , although the majority ( 44.2% , n = 159 ) slept for 69 h , the tendency to sleep for less than 69 h was significantly high ( 35% , n = 126 , = 20.2 , p = 0.000 ) . most male students slept for 69 h , with no significant difference between bruxers and nonbruxers and a tendency toward sleeping for more than 69 h. the majority of female students also slept for 69 h , although there was a significant difference between bruxers ( 39.6% , n = 55 ) and nonbruxers ( 44.2% , n = 140 , = 19.25 , p = 0.001 , table 2 ) . the time of going to bed was fixed for 28.6% ( n = 48 ) bruxers and 29.9% ( n = 110 ) nonbruxers , while it varied for 71.4% ( n = 120 ) bruxers and 70.1% ( n = 258 ) nonbruxers . there was no significant difference in the time of going to bed between bruxers and nonbruxers among both men and women , and most bruxers and nonbruxers ( men and women ) slept at 12 am . female bruxers showed a tendency to sleep early , while female nonbruxers showed a tendency to sleep late ( table 2 ) . the majority of students , regardless of gender or the presence or absence of bruxism , did not report coffee consumption late in the evening or sleeping pill intake , with no significant differences between groups ( figure 1 ) . there was no significant difference in the time taken to fall asleep , regardless of gender or the presence or absence of bruxism ; most students fell asleep within 3060 min ( table 2 ) . most students indulged in daytime naps , with some even napping twice a day , and there was no significant difference according to gender or the presence or absence of bruxism ( figure 1 ) . the proportion of students who napped for more than 3 h a day was significantly higher among bruxers ( 56.9% , n = 82 ) than among nonbruxers ( 37.4% , n = 108 , = 28.35 , p = 0.000 ) . bruxers took longer naps compared with nonbruxers , regardless of gender ( table 2 ) . compared with nonbruxers ( 16.4% , n = 61 ) , a significantly higher number of bruxers ( 30.4% , n = 51 ) woke up early in the morning without a cause ( = 16.52 , p = 0.000 ) . with regard to gender , 44% ( n = 11 ) male bruxers frequently woke up early without a cause , while only 14% ( n = 6 ) of their nonbruxer counterparts complained of the same problem ( = 7.23 , p = 0.03 , figure 2 ) . interestingly , 44% ( n = 11 ) male bruxers never or seldom awoke early in the morning without a cause . among the women , 35.5% ( n = 50 ) and 50.2% ( n = 163 ) bruxers and nonbruxers , respectively , never or seldom awoke early without a cause ( = 10.22 , p = 0.006 , figure 2 ) . the majority of bruxers and nonbruxers never or seldom faced difficulty in falling asleep again . the majority of male bruxers frequently or always faced difficulty in falling asleep again , while the majority of male nonbruxers never or seldom faced difficulty in falling asleep again . most of the female bruxers and nonbruxers seldom or never faced difficulty in falling asleep again ( = 4.22 , p = 0.12 , figure 2 ) . the majority of students never or seldom felt sleepy in class , regardless of gender or the presence of absence of bruxism . although the difference was not significant , a higher proportion of female bruxers felt sleepy in class compared with their nonbruxer counterparts ( = 2.16 , p = 0.34 , figure 2 ) . there were no significant differences in the number of bruxers and nonbruxers who felt tired and sleepy during the day ( = 0.24 , p = 0.89 , figure 3 ) . a similar proportion of bruxers and nonbruxers reported difficulty in awakening in the morning . among the men , a significantly higher ( 28% , n = 7 ) proportion of bruxers reported difficulty in awakening in the morning compared with that of nonbruxers ( 4.9% , n = 2 , = 7.06 , p = 0.029 ) . no significant difference was observed between female bruxers and nonbruxers ( = 0.875 , p = 0.646 , figure 3 ) . the incidence of frequent or almost daily nightmares was significantly higher for bruxers ( 14.9% , n = 25 ) than for nonbruxers ( 6.2% , n = 23 , = 13.7 , p = 0.001 ) . more precisely , compared with that of male nonbruxers ( 4.9% , n = 2 ) , a higher proportion of male bruxers ( 24% , n = 6 ) experienced nightmares often or almost daily , with no significant difference ( = 5.56 , p = 0.06 ) . on the other hand , a lower proportion of female bruxers ( 13.5% , n = 19 ) experienced nightmares often or almost daily compared with that of female nonbruxers ( 6.5% , n = 21 ) , with no significant difference ( = 8.56 , p = 0.014 , figure 3 ) . in total , 20% ( n = 33 ) bruxers and 14.6% ( n = 54 ) nonbruxers fell asleep in class , with no significant difference . among the men , 80% ( n = 20 ) bruxers and 87.2% ( n = 34 ) nonbruxers did not sleep in class ; the corresponding values were 79.7% ( n = 110 ) and 84.9% ( n = 276 ) , respectively , for the women ( = 2.41 , p = 0.12 ) . the present study demonstrated the disturbance of sleeping habits and sleeping related symptoms among the students who reported bruxism in rcsdp . a significant association was found in bruxism , with 28.9% bruxers experiencing regular dis compared with 14% nonbruxers . these values were higher than those in a study conducted in finland among media personnel with irregular working hours ; only 11.9% bruxers experienced regular dis . insomnia or dis is related to stressful events when mediated by certain predisposing emotional factors such as a personality trait of neuroticism , internalization of stressful events [ 21 , 22 ] , and inadequate coping mechanisms [ 23 , 24 ] . there is a positive association of psychosocial factors such as reactions to frustrating experiences , anxiety , and stress with self - reported bruxism . neither stress nor personality was associated with the intensity of bruxism measured by electromyography , and those nonspecific personality characteristics of individuals with bruxism have never been identified . moreover , according to schneider et al . ( 2007 ) , less positive coping strategies were exhibited by individuals with sleep bruxism than by those without . a significant correlation was observed between disturbed sleep until morning and bruxism , with 36.8% bruxers complaining of regularly disturbed sleep . this finding is consistent with that of a previous study where individuals with sleep bruxism reported a significantly lower frequency of deep sleep compared with the normal subjects . the present study found that , for bruxism and nighttime sleep duration , bruxers reported significantly longer sleep durations compared with nonbruxers . individuals who slept for longer durations exhibited higher levels of subjective sleepiness after sleep deprivation , while those who slept for shorter durations exhibited no significant increase in sleepiness levels . with regard to the duration of daytime naps , 56.9% bruxers napped for longer than 3 h , as opposed to only 37.4% nonbruxers . the world health organization recommended a minimum of eight hours ' sleep per night as ideal amount of a good quality on night sleep . moreover , individuals who sleep for shorter durations tend to develop subclinical hypomania , whereas those who sleep longer tend to be depressed more frequently or almost daily [ 3133 ] . bruxers were found to be more anxious and depressed compared with nonbruxers . when asking about the frequency of nightmares , there were 14.9% bruxers reporting nightmares often or almost every night . this value was higher than that in a previous study where 8.5% subjects experienced bruxism at least one night every week , which is within the range of 6%20% reported for the general population . bruxism was also suggested to be related to anxiety sensitivity , regardless of the severity of anxiety or depressive symptoms . the present study found an association between self - reported bruxism , sleep disturbance , and habitual sleep efficiency . the physiology and pathology of self - reported bruxism is not widely known , but emotional problems , anxiety , and stress can be risk factors for this parafunction . the student life is full of pressures which may lead to stress and also lead to the release of tensions by clenching the teeth . in this study a structural questionnaire was used which was based on a validated questionnaire of the psqi ( the pittsburgh sleep questionnaire index ) . the psqi is an instrument which was validated in different languages and widely used as a simple tool in different studies concerned with sleep . another limitation of this study was that there was an imbalance between males and females participating in the study as the female volunteers in our study were more than males . the other limitation was the use of the questionnaire as a tool in this study for evaluation of sleep bruxism and awake bruxism from answering the questions as self - reported or partner - reported . self - reported sleep bruxism and awake bruxism results were previously used in another study . evaluations of sleep and its related symptoms by polysomnography are more accurate but on the other hand involve more equipment , resulting in increased financial costs [ 40 , 41 ] . evaluation using electronic instruments is more difficult to be applied on a large number of participants and the use of the psqi is commonly recommended for epidemiological studies [ 42 , 43 ] . cross - sectional studies are commonly used in epidemiological studies to know risk factors and associations , but not to evaluate causes . the findings of the present study reveal that poor sleeping pattern is an important factor among dental students , who reported sleep bruxism ; therefore , the management of bruxism may modify or improve sleeping patterns and we suggest further researches for studying this condition .
objectives . the aim of this cross - sectional study was to identify sleeping patterns among dental students and their association with self - reported bruxism in riyadh colleges of dentistry and pharmacy ( rcsdp ) . methods . a cross - sectional study was performed including 549 students ( 67 men and 482 women ) . a structured questionnaire was adopted from the psqi ( the pittsburgh sleep questionnaire index ) used for data collection . it included questions which are categorized into sleeping habits , sleep - related symptoms , and additional questions concerning bruxism . this questionnaire was randomly distributed among all college preclinical and postclinical students . sleep bruxism diagnosis was based on self - reported data . the data were analyzed using chi - square tests through spss software for windows . results . statistical analyses revealed significant correlations between self - reported bruxism and sleeping habits including sleep initiation ( 2 = 22.6 , p = 0.000 ) , continuous sleep until morning ( 2 = 19.2 , p = 0.001 ) , nighttime sleep duration ( 2 = 20.2 , p = 0.000 ) , and length of daytime naps ( 2 = 28.35 , p = 0.000 ) . there was an association between self - reported bruxism and sleeping - related symptoms including awakening early in the morning before the usual time without a cause ( 2 = 16.52 , p = 0.000 ) and increased nightmares ( 2 = 13.7 , p = 0.001 ) . conclusions . poor sleeping pattern was an important factor among dental students , who reported sleep bruxism .
the pulp and paper industry is modifying its pulping , bleaching , and effluent treatment technologies to reduce the environmental impact of mill effluents . prebleaching of kraft pulps with xylanases lowers chlorine charges , which reduce chloroorganic discharges [ 13 ] . tremblay and archibald reported the delignification of unbleached softwood and hardwood kraft pulps . thus reducing the cl2 required to achieve a given degree of bleaching [ 3 , 57 ] . the public concern on the impact of pollutants from paper and pulp industries , which use chlorine as the bleaching agent act as strong driving force in developing biotechnology aided techniques for novel bleaching that is biobleaching [ 8 , 9 ] . the occurrence of cellulase contamination is posing a major threat in applying the xylanases in biobleaching . the cellulases easily result in the hydrolysis of cellulose , which should be the main recovered product in paper industry . however , the enzyme preparations from microorganisms producing higher levels of xylanases with no cellulase activity can be applied in paper industry because the loss of pulp viscosity is at minimum level . xylanases have been reported from bacteria , fungi , actinomycetes , and yeasts [ 1114 ] . the use of abundantly available and cost - effective agricultural residues to achieve higher xylanase yields and simple and rapid purification procedures provide suitable means to reduce the manufacturing cost of biobleached paper . the present paper reports partial purification , properties , and the bleaching effects of an thermo - alkali stable xylanase from cellulosimicrobium sp . mtcc 10645 was isolated from the compost sample collected at kolhapur ( m.s . , india ) . the culture was purified and maintained on xylan agar ( ph 7.0 ) supplemented with 0.1% oat spelt xylan . the xylanase production was carried out in 250 ml erlenmeyer flasks , each containing 18 ml basal salt solution supplemented with 10 g of wheat bran ( 1 : 1.8 moisture ratio ) in static conditions . each flask was inoculated with 2% bacterial inoculum and incubated at 40c for 7 days . xylanase activity was determined by measuring the release of reducing sugars from birchwood xylan ( 1% w / v ) using the dinitrosalicylic acid method . one unit of xylanase activity was defined as the amount of enzyme that liberates 1 mol of reducing sugars equivalent to xylose per minute under the assay conditions ( 50c , 50 mm sodium phosphate buffer ph 7.0 ) . the cell free supernatant ( 75 ml ) was precipitated using fractional ( 3580% ) ammonium sulphate saturation . the precipitate was dialysed and the protein thus obtained was treated as partially purified enzyme and used for further experiments . the thermal stability was determined by incubating the equal volume of enzyme solution at temperatures ranges between 30c80c for 4 h. optimal ph for xylanase activity was determined using different buffers 50 mm sodium phosphate ( ph 6.0 , 7.0 ) , 50 mm tris hcl ( ph 8.0 , 9.0 ) , 50 mm carbonate bicarbonate buffer ( ph 10.0 ) and 50 mm glycinenaoh buffer ( ph 11.0 ) . the ph stability was determined by incubating the equal volume of enzyme solution with different buffers ranging from 6.011.0 at 50c and the residual activities were determined after 1 h. the effect of various metal ions solution of chloride salts of either ca , hg , fe , cu , mn , na , co , pb , and zn at 1 mm , 5 mm , and 10 mm concentration on enzyme activity was determined by incubating the enzyme with respective compounds at room temperature for 1 h followed by determination of residual activities under standard assay conditions . substrate specificity of the xylanase was studied by using 1% xylan , cellobiose , starch , carboxy methyl cellulose ( cmc ) , p - nitrophenyl xylopyranoside , and avicel as substrates . effect of additives like parachloromercuric benzoate , iodoacetamide , potassium permanganate , cysteine , and cystine ( 0.5 mm ) was tested on xylanase activity . the enzymatic bleaching studies were performed at ph 8.0 at 50c , unless otherwise mentioned . the optimization of enzyme dose , pulp consistency and reaction time was carried out by treating the pulp with different doses of xylanase from cellulosimicrobium sp . mtcc 10645 at 2 u / g , 5 u / g , 10 u / g , and 25 u / g oven dried pulp of consistency 3.0% , 5% and 10% for variable time intervals 3 h and 5 h. the chemical characteristics of kraft pulp : kappa number ( t 236 cm-85 ) , release of reducing sugars , release of phenolic compounds ( a237 nm and 280 nm ) , and hydrophobic compounds ( a465 the test organism was isolated from compost sample collected at kolhapur ( ms , india ) . it was identified as cellulosimicrobium sp . and deposited with microbial type culture collection no . xylanase activity appeared after day 1 and reached maximum ( 960 u / ml ) after day 2 at ph 7.0 and 40c . the extracellular xylanase from cellulosimicrobium sp . mtcc 10645 was partially purified at 80% ( nh4)2so4 saturation with a yield of 52.03% and a purification fold of 16.0 . the partially purified xylanase from cellulosimicrobium sp . mtcc 10645 was optimally active at 50c and ph 7.0 ( figures 1(a ) and 1(b ) ) . the xylanase was stable at temperature 50c for 1 h and retained up to 86% of the activity . interestingly at 50c relative activity was comparatively constant up to 4 h of incubation at ph 7.0 . most of the thermostable xylanases are produced by mesophilic bacteria [ 15 , 20 ] . two xylanases which gave the highest activity at 50c were purified cell - free extract of cephalosporium sp . . mtcc 10645 was stable in a broad ph range of 6.011.0 for 1 h at 50c . it showed highest activity at ph 7.0 and found more stable at ph 7.0 even after 4 h of incubation . mathrani and ahring isolated a thermophilic and alkaliphilic xylanase from dictyoglomus isolate and reported that almost 100% activity shown by the xylanase at ph 5.5 to 9.0 . as shown in table 1 , metal ions ca , hg , and pb were inhibitory for cellulosimicrobium sp . , mtcc 10645 xylanase retaining 72.3% , 35.07% , and 36.7% relative activity at 10 mm concentration , while fe , cu , mn , na , co , and zn were inducers at concentrations 5 mm and 10 mm . sreenath and joseph reported the stimulatory effect of ca and na on xylanases of streptomyces exfoliates . gessesse reported the inhibitory activity of pb on xylanase at 1 mm concentration in an alkaliphilic bacillus sp . the xylanase was active on oat spelt and birchwood xylans but not on avicel , cmc , cellobiose , starch , or p - nitrophenyl xylopyranoside . purified xylanase was not active on avicel , cmc , cellobiose , starch , and p - nitrophenyl xylopyranoside even when the enzyme concentration was 5 times greater than used in normal assay at an incubation period of 20 minutes rather than 5 minutes suggesting that enzyme is a true xylanase . two endo-1,4--xylanases from irpex lacteus ( polyporus tulipiferae ) were purified , named xyl i and iii which did not showed activity towards glycans such as starch , pachyman , and avicel ( microcrystalline cellulose ) but showed one twentieth activity towards carboxymethyl cellulose . additives parachloromercuric benzoate and iodoacetamide were found stimulatory , while potassium permanganate , cysteine , and cystine markedly reduced the enzyme activity . similar observation was reported by anthony et al . in case of high - molecular - weight cellulase free xylanase from alkali tolerant aspergillus fumigatus ar1 . iodoacetamide was found to be stimulatory for xylanase activity at 0.5 mm and 1.0 mm concentrations . the xylanase dose for biobleaching of kraft pulp at 50c was optimized as 2.0 u / g of moisture free pulp ( figure 2 ) . reducing sugars released were 3.235 mg / g , 4.75 mg / g , 7.34 mg / g , and 9.321 mg / g of the pulp , when the enzyme dose given 2 u / g , 5 u / g , 10 u / g , and 25 u / g , respectively . at wavelengths 237 nm , 280 nm , and 465 nm , the absorbance was found to be increased from 0.247 to 0.321 , 0.471 to 0.521 , and 0.325 to 0.378 with increased dose of enzyme , respectively . li et al . reported that the amount of reducing sugars released from wheat straw pulp by the xylanase isolated from thermomyces lanuginosus cbs 288.54 was significantly greater with increasing time . when kraft pulp was treated with xylanase from cellulosimicrobium sp . mtcc 10645 , the release of light absorbing material and reducing sugars increased with increase in consistency . release of absorbing materials at 237 nm , 280 nm , and 465 nm can be correlated with release of lignin . the absorbance measured was highest at 280 nm wavelength as compared to 237 nm and 465 nm at 10% pulp consistency . at 237 nm wavelength , the absorbance measured was 0.215 , 0.231 , and 0.256 at 3% , 5% , and 10% consistency of pulp , respectively . at 0% pulp consistency , the reducing sugars released were 0.75 mg / g , 1.15 mg / g , 1.65 mg / g , and 2.161 mg / g of pulp at 0% , 3% , 5% , and 10% consistency , respectively ( figure 3 ) . reported that the release of chromophores correlates well with total sugar release and this can be considered as a simple method to determine the efficacy of the enzyme treatment . reported that the decrease in the lignin content of the pulp did correlate with the degree of solubilization of carbohydrates . in the xylanase treatment , the increase in absorbance at 280 nm as well as the increase in the liberation of reducing sugars indicated the effective action of xylanase on pulp . in the present study , the brightness increased from 30.13% ( brightness of unbleached pulp ) to 70.45% after the treatment of the kraft pulp with xylanase 25 u / g of pulp with a retention time of 5 h at 10% consistency . the kappa number was reduced from 14.90 ( kappa number of unbleached pulp ) to 1.62 . reported that when wheat straw pulp was treated with the xylanase isolated from thermomyces lanuginosus cbs 288.54 , brightness was improved by 3.93% iso . studied the effect of two xylanases ( xylanase p and crude xylanase from thermomyces lanuginosus ) in the bleaching of kraft pulp and found that , xylanase p ( at an enzyme dose 5 u / g pulp ) increased the brightness of kraft pulp by 5.1% while xylanase from thermomyces lanuginosus ( at an enzyme dose 5 u / g pulp ) increased 2.1% . kulkarni and rao reported an increase in brightness of 2.5% and 21% reduction in kappa number by a xylanase ( at an enzyme dose 10 u / g pulp ) from bacillus sp . reported that xylanases from three fungi aspergillus indicus , aspergillus flavus , and aspergillus niveus increased brightness of 42.045.0 iso units from 19.83 iso units and reduced kappa number of 5.06.8 from 18.60 of the kraft pulp . to the best of our knowledge , this is the first paper on the thermo - alkali stable xylanase production from cellulosimicrobium sp .
the most promising application of xylanases ( e.c . 3.2.1.8 ) is in the prebleaching of kraft pulp . the present paper reports bleaching effects of a thermoalkali stable xylanase from cellulosimicrobium sp . mtcc 10645 . the bacterium produced thermo - alkali stable xylanase in a basal medium supplemented with wheat bran ( 1% w / v ) , which was optimally active at ph 7.0 and 50c . the xylanase was stable at temperature 50c for 1 h and retained up to 86% of the activity . the xylanase was stable in a broad ph range of 6.011.0 for 1 h at 50c . metal ions ca+2 , hg+2 , and pb+2 were inhibitory for xylanase retaining 72.3% , 35.07% and 36.7% relative activity at 10 mm concentration , whereas fe+2 , cu+2 , mn+2 , na+2 , co+2 , and zn+2 were inducers at concentrations of 5 mm and 10 mm . the enzyme exhibited greater binding affinity exclusively for xylans but not for avicel , cmc , cellobiose , starch , or p - nitrophenyl xylopyranoside . parachloromercuric benzoate and iodoacetamide were found stimulatory , while potassium permanganate , cysteine , and cystine markedly reduced the activity . the xylanase dose of 2.0 u / g dry weight pulp of 10% consistency gave optimum bleach boosting of kraft pulp at ph 8.0 and temperature 50c for 5 h reaction time .
the development of hepatic portal venous gas ( hpvg ) is rare but clinically important radiographic finding ( 1 , 2 ) . it has been reported to have an association with numerous abdominal conditions , including inflammatory bowel diseases , bowel obstruction , and bowel necrosis ( 2 ) . recently hpvg was also reported as a rare complication of endoscopic and radiologic procedures such as endoscopic retrograde cholangiopancreatography ( ercp ) , liver transplantation , esophageal variceal band ligation and percutaneous endoscopic gastrostomy ( peg ) ( 2 - 5 ) . we present a case of hpvg following endoscopic balloon dilatation in a patient with pyloric stricture . a 31-yr - old man was admitted with corrosive acids ingestion on july 13 , 2010 . endoscopic findings showed long and deep linear ulceration and black pigmented mucosal change in the esophagus and stomach . 1a ) . the next day , we conducted endoscopic balloon dilatation , through an 8 mm balloon for 40 seconds . there was no evidence of perforation and only mild mucosal injury was observed ( fig . however , 1 hr after the balloon dilatation procedure , he complained of diffuse abdominal pain . the abdomen was soft and slightly distended with whole abdomen tenderness . however , no involuntary guarding or rebound tenderness was detected . laboratory data showed white blood cell count of 8,930/l , hemoglobin of 10.0 g / dl , c - reactive protein of 0.16 mg / dl , lactate dehydrogen level of 333 u / l . abdominal ct showed large amounts of hpvg in the peripheries of the liver ( fig . the patient was moved to intensive care unit and an emergency operation was considered . however , we decided to go on conservative treatment because there was no clinical evidence of bowel necrosis or perforation and vital signs returned to normal range . the patient was monitored closely and received fluid replacement , levin tube with natural drainage , broad - spectrum antibiotics . five days later , we performed follow - up abdominal ct ; hepatic portal gas showed complete spontaneous resolution ( fig . the patient was then transferred to the gastro - intestinal surgical team for elective surgery for gastrojejunostomy , and was discharged in good condition without any complication of hepatic portal venous gas . in this report , we first described a case of hpvg following by endoscopic balloon dilatation . hpvg was first described by wolfe and evens in 1955 in infants with necrotizing enterocolitis ( nec ) ( 6 ) . it has been reported in many abdominal conditions such as inflammatory bowel disease , diverticulitis , intraabdominal sepsis , pneumatosis intestinalis , pancreatitis , bowel obstruction and suppurative cholangitis ( 2 , 7 ) . it also has been reported as iatrogenic complications of as endoscopic retrograde cholangiopancreatography ( ercp ) , liver transplantation , esophageal variceal band ligation and percutaneous endoscopic gastrostomy ( peg ) ( 2 - 5 ) . the clinical presentation of hpvg is usually consistent with acute abdomen but occasionally shows vague abdominal symptoms and nonspecific laboratory findings ( 1 , 8) . the major predisposing factor of the development of hpvg is the damage of intestinal mucosa combined with bowel dilatation or bacterial gas production ( 1 , 8) . most authors agree that the formation of hpvg is a multiplex event in which two or three of these conditions are combined ( 1 , 8) . we speculated that the main cause of hpvg in our case was gastric dilatation . increased intraluminal pressure forces intraluminal gas to pass through a damaged bowel wall , allowing the intraluminal gas to enter the portal circulation . like this , the development of hpvg secondary to gastric dilatation has been reported in cases of ileus , barium enema and blunt abdominal trauma ( 9 ) . originally the diagnosis of hpvg was based on plain abdominal radiography , primarily left lateral decubitus views ( 10 ) . however , along with the development of ct scan , we found ct is more sensitive than plain film radiography . the pattern for hpvg in ct scan is described as a tubular lucency branching from the porta hepatis to the liver capsule ( 10 , 11 ) . the gas travels peripherally in the portal vein consequent to the centrifugal flow of blood , and the branching pattern with a peripheral distribution extending to within 2 cm of the liver capsule ( 10 , 11 ) . additionally , in abdomen ct finding , hpvg must be differentiated from gas in the biliary tracts such as pneumobilia , which tends to move with the centripetal flow of bile toward the hilum , and whose central air lucencies do not extend to within 2 cm of the liver capsule ( 10 ) . gas in the portal venous system was once regarded as a fatal event ( 12 ) . however , in most clinical settings , the finding of hpvg alone can not be a predictor of mortality or an indication for emergency exploration . the key point when making a decision of its surgical management is the presence of peritonitis or bowel perforation ( 13 , 14 ) . in our case in addition , if there is a gastric dilatation due to endoscopy , inserting of a levin tube for gastric decompression plays an essential role in rapid removal of portal vein gas ( 9 ) . in conclusion , we report the first case of hpvg followed by endoscopic balloon dilatation . gas in the portal vein in our case may occur as a transient incidental finding with gastric dilatation and mucosal damage . hpvg resulting from iatrogenic causes , the amount of portal vein gas may be not an indication of surgical management and medically stable patients without sign of bowel peritonitis or perforation could be effectively managed with supportive care .
the development of hepatic portal venous gas ( hpvg ) is rare but it might be associated with serious disease and poor clinical outcome . recently , several iatrogenic causes of hpvg have been reported . hpvg as a complication of endoscopic balloon dilatation is a previously unreported event . we experienced a case of hpvg after endoscopic balloon dilatation in a 31 yr - old man with pyloric stricture due to corrosive acids ingestion . the patient was treated conservatively with fluid resuscitation , antibiotics and levin tube with natural drainage . five days later , the follow - up ct scan showed spontaneous resolution of hpvg . this case reminded us the clinical importance and management strategy of hpvg . we report here a case of iatrogenic hpvg with a review of relevant literature .
conjugated linoleic acid ( cla ) is a fatty acid mixture of positional geometric isomers of octadecadienoic acid ( linoleic acid 18 : 2n-6 ) with a conjugated double - bond system ( 1 ) . different isomers of cla have varied biological functions , such as reducing carcinogenesis , decreasing adipose mass , and modulating immune function and type 2 diabetes ( 2 ) . however , the effects of cla supplementation on skeletal muscle are still unclear ( 4 ) . it is well known that diet control and physical exercise are the two main approaches to suppress obesity ( 6 , 7 ) . previous studies reported that a hfd increases the total energy intake , and that excess dietary fat is greater stored than excess dietary carbohydrate or protein . thus , an increase in excessive energy intake from fat can reduce physical activity , and this decline of physical activity causes obesity ( 8 , 9 ) . physical activity has been considered as a cornerstone in the treatment of obesity ( 10 , 11 ) . among various types of physical activities , endurance exercise has long been reported to reduce body weight , ameliorate postprandial triglyceride response , increase the rate of fat oxidation , and improve insulin sensitivity ( 12 - 15 ) . however , the physiological and molecular mechanisms for these benefits have not been completely understood ( 16 ) . glucose transporter-4 ( glut-4 ) translocation to the plasma membrane through the insulin signaling pathway is well proven ( 17,18 ) . in addition , thiazolidinediones , which are peroxisome proliferator - activated receptor- ( ppar- ) agonists that decrease insulin resistance , are widely used as a treatment for patients with type 2 diabetes ( 19 ) . although ppar- is highly expressed in adipose tissue than in muscle , muscle specific - ppar- depletion is susceptible to developing insulin resistance in mice ( 20 ) . previous studies reported that exercise had improved insulin sensitivity due to an increase in ppar- protein expression ( 20 - 21 ) . the aim of this study was to investigate the effects of cla supplementation on the insulin resistance and ppar- and glut-4 protein expression in the skeletal muscles of rats on a hfd during endurance exercise . six - week - old male sprague - dawley rats weighing 230 to 250 g were obtained ( samtako co. , osan , korea ) and individually housed in a controlled environment at 231 c with 505% relative humidity , under a 12-hr light - dark cycle . after an acclimatization period of 1 week , all rats were randomly divided into 3 groups : hs , hfd ( 35% fat of total diet weight ) ( 22 ) sedentary group ; cs , cla supplemented hfd sedentary group ; and ce , cla supplemented hfd exercise group . for cla supplementation , 1.0% cla ( 76.82% cla mixture ; 36.8% cis-9,trans-11 cla , 37.8% trans-10 , cis-12 cla , and 1.2% trans-9,trans-11 cla ) ( hk biotech co. , gyeongnam , korea ) was substituted for dietary fat in the adjusted hfd ( table 1 ) . during this period , dietary intake was measured daily , and the change in the body weight of each animal was noted weekly . the dietary regimens were based on ain-76 of the animal diet and were modified from a previous study ( 23 ) . all of the experimental protocols were approved by the animal study committee of sunmoon university . composition of experimental diets 1 ) 35% fat of total diet weight were supplied for the hs group 2 ) 1.0% cla was added and adjusted to the high - fat diet ( hfd ) for the cs and ce group 3 ) 76.81% cla mixture cla : conjugated linoleic acid , cs : cla supplemented hfd sedentary , ce : cla supplemented hfd exercise , hs : hfd sedentary the exercised rats swam for 60 min a day , 5 days a week for 8 weeks . the water temperature of the swimming pool was maintained at approximately 351 c in a plastic barrel ( depth ; 50 cm , radius ; 25 cm ) . at the end of the experimental protocol , in an overnight - fasted state , the rats were sacrificed by exsanguination , and blood was drawn from the left ventricle under light diethyl ether anesthesia after the 12-hr fasting period . the skeletal muscles : soleus muscles ( som ) as slow muscle fiber and extensor digitorum longus muscle ( edl ) as fast muscle fiber ( 24 ) and abdominal fat ( aft ) as fat tissue were dissected and immediately snap - frozen in liquid nitrogen . the skeletal muscles and fat tissue were stored at -70 c until they were analyzed . the serum glucose , triglycerides ( tg ) , total cholesterol ( tc ) , and high - density lipoprotein cholesterol ( hdlc ) levels were analyzed using commercial enzymatic kits ( asan pharmaceutical co. , yongin , korea ) . the fasting insulin level was measured using standard radio - immunity kits ( linco research , inc . , st . the serum low - density lipoprotein cholesterol ( ldlc ) level was calculated from tg , tc , and hdlc concentrations using the following friedwald formula : { tc - ( hdlc + ( tc/5))}. insulin resistance was calculated according to the homeostasis model assessment of insulin resistance ( homa - ir ) using the following formula : { fasting glucose level ( mmol / l ) fasting insulin level ( uu / ml)}/22.5 . in order to analyses ppar- and glut-4 protein expression , muscles ( the som and edl ) were homogenized on ice with a polytron homogenizer in 20 mmol / l tris - hcl buffer ( ph 7.5 ) containing 5 mmol / l ethylenediaminetetracetic acid , 2 mmol / l phenylmethylsulfonyl fluoride , and 1:200 protease inhibitor cocktail ( sigma , st louis , mo , usa ) . the protein concentrations were determined using the bradford method ( bio - rad , hercules , ca , usa ) with bovine serum albumin as the standard . an aliquot of tissue extract containing 20 g of protein was separated on a 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) gel . after electrophoresis , the proteins were transferred to a polyvinylidene fluoride ( pvdf ) membrane ( millipore , bedford , ma , usa ) in a semi - dry blotting apparatus ( bio - rad , hercules , ca , usa ) . after treating with blocking buffer ( phosphate - buffered saline ( pbs ) containing 10% skim milk ) for 90 min , the membrane was incubated with primary polyclonal antibodies for 2 hr , followed by five 10-min washes with pbs ( 5% tween 20 ) . the membranes were washed and then incubated with horseradish peroxidase ( hrp)-conjugated anti - goat immunoglobulin g ( igg ) or anti - rabbit igg ( santa cruz , ca , usa ) for 1 hr , followed by five 10-min washes with pbs ( 5% tween 20 ) . the target proteins were detected using an enhanced chemiluninescence kit ( amersham pharmacia biotech , piscataway , nj , usa ) . the films were photographed and the protein bands of interest were quantified with band analyzer software ( bio - rad , hercules , ca , usa ) . the data were expressed as the means standard error of the mean ( sem ) using the spss / pc program statistical analyses were conducted using one - way anova followed by lsds[a5 ] post hoc test to verify significant difference among groups . six - week - old male sprague - dawley rats weighing 230 to 250 g were obtained ( samtako co. , osan , korea ) and individually housed in a controlled environment at 231 c with 505% relative humidity , under a 12-hr light - dark cycle . after an acclimatization period of 1 week , all rats were randomly divided into 3 groups : hs , hfd ( 35% fat of total diet weight ) ( 22 ) sedentary group ; cs , cla supplemented hfd sedentary group ; and ce , cla supplemented hfd exercise group . for cla supplementation , 1.0% cla ( 76.82% cla mixture ; 36.8% cis-9,trans-11 cla , 37.8% trans-10 , cis-12 cla , and 1.2% trans-9,trans-11 cla ) ( hk biotech co. , gyeongnam , korea ) was substituted for dietary fat in the adjusted hfd ( table 1 ) . during this period , dietary intake was measured daily , and the change in the body weight of each animal was noted weekly . the dietary regimens were based on ain-76 of the animal diet and were modified from a previous study ( 23 ) . all of the experimental protocols were approved by the animal study committee of sunmoon university . composition of experimental diets 1 ) 35% fat of total diet weight were supplied for the hs group 2 ) 1.0% cla was added and adjusted to the high - fat diet ( hfd ) for the cs and ce group 3 ) 76.81% cla mixture cla : conjugated linoleic acid , cs : cla supplemented hfd sedentary , ce : cla supplemented hfd exercise , hs : hfd sedentary the exercised rats swam for 60 min a day , 5 days a week for 8 weeks . the water temperature of the swimming pool was maintained at approximately 351 c in a plastic barrel ( depth ; 50 cm , radius ; 25 cm ) . at the end of the experimental protocol , in an overnight - fasted state , the rats were sacrificed by exsanguination , and blood was drawn from the left ventricle under light diethyl ether anesthesia after the 12-hr fasting period . the skeletal muscles : soleus muscles ( som ) as slow muscle fiber and extensor digitorum longus muscle ( edl ) as fast muscle fiber ( 24 ) and abdominal fat ( aft ) as fat tissue were dissected and immediately snap - frozen in liquid nitrogen . the skeletal muscles and fat tissue were stored at -70 c until they were analyzed . the serum glucose , triglycerides ( tg ) , total cholesterol ( tc ) , and high - density lipoprotein cholesterol ( hdlc ) levels were analyzed using commercial enzymatic kits ( asan pharmaceutical co. , yongin , korea ) . the fasting insulin level was measured using standard radio - immunity kits ( linco research , inc . , st . the serum low - density lipoprotein cholesterol ( ldlc ) level was calculated from tg , tc , and hdlc concentrations using the following friedwald formula : { tc - ( hdlc + ( tc/5))}. insulin resistance was calculated according to the homeostasis model assessment of insulin resistance ( homa - ir ) using the following formula : { fasting glucose level ( mmol / l ) fasting insulin level ( uu / ml)}/22.5 . in order to analyses ppar- and glut-4 protein expression , muscles ( the som and edl ) were homogenized on ice with a polytron homogenizer in 20 mmol / l tris - hcl buffer ( ph 7.5 ) containing 5 mmol / l ethylenediaminetetracetic acid , 2 mmol / l phenylmethylsulfonyl fluoride , and 1:200 protease inhibitor cocktail ( sigma , st louis , mo , usa ) . the protein concentrations were determined using the bradford method ( bio - rad , hercules , ca , usa ) with bovine serum albumin as the standard . an aliquot of tissue extract containing 20 g of protein was separated on a 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) gel . after electrophoresis , the proteins were transferred to a polyvinylidene fluoride ( pvdf ) membrane ( millipore , bedford , ma , usa ) in a semi - dry blotting apparatus ( bio - rad , hercules , ca , usa ) . after treating with blocking buffer ( phosphate - buffered saline ( pbs ) containing 10% skim milk ) for 90 min , the membrane was incubated with primary polyclonal antibodies for 2 hr , followed by five 10-min washes with pbs ( 5% tween 20 ) . the membranes were washed and then incubated with horseradish peroxidase ( hrp)-conjugated anti - goat immunoglobulin g ( igg ) or anti - rabbit igg ( santa cruz , ca , usa ) for 1 hr , followed by five 10-min washes with pbs ( 5% tween 20 ) . the target proteins were detected using an enhanced chemiluninescence kit ( amersham pharmacia biotech , piscataway , nj , usa ) . the films were photographed and the protein bands of interest were quantified with band analyzer software ( bio - rad , hercules , ca , usa ) . the data were expressed as the means standard error of the mean ( sem ) using the spss / pc program statistical analyses were conducted using one - way anova followed by lsds[a5 ] post hoc test to verify significant difference among groups . the body weight , weight gain , and aft in the cs and ce were significantly lower than those in the hs ( p<0.001 ) . additionally , the body weight ( p<0.05 ) , weight gain ( p<0.01 ) , and aft mass ( p<0.05 ) in the ce were significantly reduced compared to those in the cs . in the weight of the skeletal muscles , the som in the cs and ce were significantly increased compared to those in the hs ( p<0.001 ) , whereas the edl did not show any significant differences among the groups . the level of body weight , weight gain , fat weight , and skeletal muscles weight among groups the serum tg , tc , hdlc , and ldlc levels in the cs and ce were significantly lower than those in the hs ( p<0.001 ) . furthermore , the serum tc concentration was found to have significantly reduced in the ce compared to that in the cs ( p<0.01 ) . the level of serum total cholesterol , high density lipoprotein cholesterol , low density lipoprotein cholesterol , and triglycerides among group data are presented as the meansem . p<0.001 compared with the hs group ; p<0.01 compared with the cs group . tg ; triglycerides , tc ; total cholesterol , hdlc ; high density lipoprotein cholesterol , ldlc ; low density lipoprotein cholesterol . cla ; conjugated linoleic acid , cla ; conjugated linoleic acid , cs ; cla supplemented hfd sedentary , ce ; cla supplemented hfd exercise , hs ; hfd sedentary as shown in figure 1 , the serum glucose and insulin contents and homa - ir value of the cs ( glucose : p=0.001 , insulin : p=0.006 , homa - ir : p=0.004 ) and ce ( glucose : p=0.001 , insulin : p=0.001 , homa - ir : p=0.001 ) were significantly decreased compared to those of the hs . furthermore , the glucose content of the ce was significantly reduced compared to that of the cs ( p=0.005 ) changes of serum glucose and insulin contents and homeostasis model assessment of insulin resistance ( homa - ir ) level among groups as shown in figure 2 , ppar- protein expressions in the som ( p=0.005 ) and edl ( p=0.043 ) were higher in the ce than those in the hs . in addition , the ppar- protein expression in the som of the cs ( p=0.035 ) was significantly higher than that in the hs . on the other hand , the glut-4 protein expression of the som in the ce was significantly higher compared to that in the hs ( p=0.034 ) . however , there was no significant difference in the glut-4 expression of the edl among the groups ( figure 3 ) . changes of peroxisome proliferator - activated receptor gamma ( ppar- ) protein expression level in skeletal muscles . som ; soleus muscle , edl ; extensor digitorum longus muscle changes of glucose transporter type 4 ( glut-4 ) protein expression level in skeletal muscles . the body weight , weight gain , and aft in the cs and ce were significantly lower than those in the hs ( p<0.001 ) . additionally , the body weight ( p<0.05 ) , weight gain ( p<0.01 ) , and aft mass ( p<0.05 ) in the ce were significantly reduced compared to those in the cs . in the weight of the skeletal muscles , the som in the cs and ce were significantly increased compared to those in the hs ( p<0.001 ) , whereas the edl did not show any significant differences among the groups . the level of body weight , weight gain , fat weight , and skeletal muscles weight among groups the serum tg , tc , hdlc , and ldlc levels in the cs and ce were significantly lower than those in the hs ( p<0.001 ) . furthermore , the serum tc concentration was found to have significantly reduced in the ce compared to that in the cs ( p<0.01 ) . the level of serum total cholesterol , high density lipoprotein cholesterol , low density lipoprotein cholesterol , and triglycerides among group data are presented as the meansem . p<0.001 compared with the hs group ; p<0.01 compared with the cs group . tg ; triglycerides , tc ; total cholesterol , hdlc ; high density lipoprotein cholesterol , ldlc ; low density lipoprotein cholesterol . cla ; conjugated linoleic acid , cla ; conjugated linoleic acid , cs ; cla supplemented hfd sedentary , ce ; cla supplemented hfd exercise , hs ; hfd sedentary as shown in figure 1 , the serum glucose and insulin contents and homa - ir value of the cs ( glucose : p=0.001 , insulin : p=0.006 , homa - ir : p=0.004 ) and ce ( glucose : p=0.001 , insulin : p=0.001 , homa - ir : p=0.001 ) were significantly decreased compared to those of the hs . furthermore , the glucose content of the ce was significantly reduced compared to that of the cs ( p=0.005 ) changes of serum glucose and insulin contents and homeostasis model assessment of insulin resistance ( homa - ir ) level among groups as shown in figure 2 , ppar- protein expressions in the som ( p=0.005 ) and edl ( p=0.043 ) were higher in the ce than those in the hs . in addition , the ppar- protein expression in the som of the cs ( p=0.035 ) was significantly higher than that in the hs . on the other hand , the glut-4 protein expression of the som in the ce was significantly higher compared to that in the hs ( p=0.034 ) . however , there was no significant difference in the glut-4 expression of the edl among the groups ( figure 3 ) . changes of peroxisome proliferator - activated receptor gamma ( ppar- ) protein expression level in skeletal muscles . som ; soleus muscle , edl ; extensor digitorum longus muscle changes of glucose transporter type 4 ( glut-4 ) protein expression level in skeletal muscles . to the best of our knowledge , this is the first study to investigate the effects of cla supplementation with / without endurance exercise on insulin resistance and ppar- and glut-4 protein expression by analyzing the skeletal muscle fiber types of rats on a hfd . our results suggest that cla supplementation and endurance exercise independently affected the insulin sensitivity and ppar- and glut-4 protein expression according to the skeletal muscle fiber type . previous studies have reported that cla decreases body mass and fat mass , while improving serum lipids profiles ( 25 - 28 ) . our results show that not only weight - related parameters such as body weight , weight gain , and fat tissue weight , but also serum parameters such as tg , tc , hdlc , and ldlc in the cla - supplemented groups with / without endurance training were significantly reduced compared to the control group . some studies reported that endurance exercise results in the significant decrease of fat mass and body mass as well as an improved serum lipids profiles ( 29 , 30 ) . however , in our study , in the case of cla supplementation , the endurance exercise group have tended lower in body weight , weight gain[aga6 ] , aft mass , and glucose and tc concentrations compared to the cs . these results suggest that endurance exercise during cla supplementation might result in the utilization of fat as a substrate during exercise , and that endurance exercise reduces body mass and body fat mass . previous studies reported that the lipid profile values did not increase above the normal range in six - week - old male sprague - dawley rats fed with hfd for 8 weeks ( 20 , 23 ) . however , in our study , statistically significant differences were shown in the serum lipid profile concentrations after 8 weeks of treatment . those levels may ameliorate serum lipid profiles when one engages in at least 8 weeks of endurance exercise with / without cla supplementation . these results suggest that the combination of cla supplementation and endurance exercise may be[aga7 ] recommended for utilizing fat as a substrate , reducing body mass and body fat mass , and ameliorating serum lipids profiles compared to cla supplementation or endurance exercise alone rather than in conjunction with each other . many animal studies have tried to induce a model of obesity using a dietary composition of approximately 35 to 40% lard and also shown that hfds induce hyperglycemia , hyperinsulinemia and insulin resistance ( 31 - 34 ) . it is also reported that endurance exercise ameliorates the serum insulin concentration and homa - ir level in rats fed a hfd ( 35 ) . in this study , cla supplementation with / without endurance exercise decreased the insulin content and homa - ir value . these results suggested that cla supplementation could potentially results in lower insulin resistance regardless of participation in endurance exercise . the most pronounced effect of cla isomer feeding was a stimulation of protein synthesis , which enhanced lean body mass . this stimulatory effect was mainly observed in the muscles of sedentary rats ( 36 - 39 ) . regular physical activity leads to a number of adaptations in skeletal muscle ( 40 ) . slow twitch and fast twitch according to their expression of myosin heavy chain isomers . the slow twitch fibers mainly depend on oxidative pathways , and the fast twitch fibers mainly depend on glycolytic pathways for atp production ( 41 ) . in this study , the som and edl , which are hind - limb muscles , were selected as typical slow and fast twitch fibers , respectively . we found a considerably increased som mass in the case of cla supplementation regardless of participation in endurance exercise , while there was no significant difference in edl mass . this result seems to indicate that the increase in som mass is a result of swimming exercise . it is well established that the mechanism for elevating glucose uptake is mainly by the translocation of glut-4 vesicles from the intracellular pool to the plasma membrane through insulin binding to its receptor ( 42 - 44 ) . although the exact correlation between ppars and glut-4 protein expression is not clearly understood , ppar- protein is reported to play an important role for regulation of glut-4 gene expression in skeletal muscle tissues ( 45 ) . our study also showed that the ppar- protein expression in the som and edl of the ce was significantly higher compared to that in the hs , and the ppar- protein expression in the som of the cs tended to be significantly higher than that in the hs . previous studies have shown that ppar- protein expression increases with exercise in plasma and adipose tissue ( 46 , 47 ) , and is upregulated by endurance or a moderate level of intense exercise ( 48 , 49 ) . our finding is in accordance with previous studies , which show that the ppar - r protein expression of the som in the ce rats was significantly higher than that of the hs rats . however , the ppar- protein expression of the cla - supplemented non - exercised group in the edl did not show significant improvement compared to the hs group . as mentioned above , the soleus muscle , as slow twitch fibers , were mainly activated during swimming , and it might be assumed that changes in protein expression are affected by external factors such as obtained muscle type during exercise and the type and duration of the exercise . thus , further studies considering the time and type of exercise including prolonged exercise and muscular exercise are needed to better elucidate the relationship between exercise and protein expression . our study showed that the muscle glut-4 protein expression of the som in the ce was significantly higher than that in the hs , while the glut-4 protein expression of the som in the cs was not significantly different compared to that in the hs . it is reported that the slow twitch fibers are more responsive to insulin than the fast twitch fibers ( 50 ) . these results are likely due to the fact that swimming exercise mainly mobilizes the som , which increases in response to endurance training , thus facilitating glucose uptake into the trained muscle . in our study taken together , our results indicate that the combined case of cla supplementation and endurance exercise improve not only the glut-4 expression level , but also the ppar- expression level in the som . skeletal muscle comprises a relatively large mass in the body and is an important target tissue for glucose metabolism by insulin ( 51 , 52 ) . therefore , we can assume that the significant changes in the glut-4 activity of the ce in the som may have significant physiological effects because the soleus muscle is the major target tissue of insulin for glucose uptake during swimming . taken together , even when accompanied by a hfd , cla supplementation with / without endurance exercise plays a role in the suppression of obesity and the improvement of insulin sensitivity . when cla supplementation was accompanied by endurance exercise , the ppar- protein expression in the som and edl and the glut-4 protein expression in the som were enhanced compared to the control group . in addition , the ppar- protein expression in the som of the cs was enhanced by only cla supplementation . in conclusion , cla supplementation under a non - endurance exercising condition in rats may play a role in enhancing the ppar- protein expression in red muscles . in addition , cla supplementation under an endurance exercise condition in rats may enhance the ppar- protein expression in the som and edl and the glut-4 protein expression in the som . however , there was no synergic effect of cla supplementation and endurance exercise on insulin resistance in the serum and protein expression in skeletal muscles of rats under the condition of cla supplementation with / without endurance exercise .
objective(s):this study examined whether conjugated linoleic acid ( cla ) supplementation affects insulin sensitivity and peroxisome proliferator - activated receptor gamma ( ppar- ) and glucose transporter type 4 ( glut-4 ) protein expressions in the skeletal muscles of rats during endurance exercise.materials and methods : sprague - dawley male rats were randomly divided into hs ( high - fat diet ( hfd ) sedentary group , n = 8) , cs ( 1.0% cla supplemented hfd sedentary group , n = 8) , and ce ( 1.0% cla supplemented hfd exercise group , n = 8) . the rats in the ce swam for 60 min a day , 5 days a week for 8 weeks.results:the serum glucose and insulin contents and homeostasis model assessment of insulin resistance ( homa - ir ) value of the cs and ce were significantly decreased compared to those of the hs . the ppar- protein expressions in the soleus muscle ( som ) and extensor digitorum longus muscle ( edl ) were significantly higher in the ce than in the hs . in addition , the ppar- protein expression in the som of the cs was significantly higher than that in the hs . on the other hand , the glut-4 protein expression of the som in the ce was significantly higher compared to that in the hs . however , there was no significant difference in glut-4 protein expression in the edl among the groups.conclusion:cla supplementation with / without endurance exercise has role in improvement of insulin sensitivity . moreover , when cla supplementation was accompanied by endurance exercise , the ppar- protein expression in som and edl and the glut-4 protein expression in som were enhanced compared with the control group .
adhesion to dentin may be achieved either following an etch - and - rinse or a self - etch approach . self - etch approach has been claimed to be user - friendlier and less technique - sensitive . another important clinical benefit of self - etch adhesives is the absence of , or at least lower incidence of postoperative sensitivity . this has been attributed to their less aggressive and more superficial interaction with dentin leaving tubules largely obstructed by smear . however , some studies have shown a potential disadvantage in incorporating the smear layer into the hybrid layer [ 35 ] . although the smear layer is reinforced by impregnated resin , bonding defects may be produced . since such defects may decrease the resistance and stability of the hybridized smear layer , its removal by incorporating a separate etching step may be necessary to obtain reliable , strong resin - dentin bonds [ 79 ] . therefore , a conditioning system capable of changing the tooth surface by removing the smear layer and partially removing the surface layer of hydroxyapatite while simultaneously not destroying the organic portion of the dentin may be beneficial as pretreatment for mild self - etch adhesives . some studies have demonstrated that separate phosphoric acid etching of dentin could decrease the bond strength and durability of self - etch adhesives [ 10 , 11 ] . therefore , conditioning with a mild etchant like edta may prove to be beneficial for bonding of mild self - etch adhesives to dentin . whereas phosphoric acid etching of dentin leads to dissolving both the extra and the intrafibrillar minerals resulting in recession and collapse of the collagen matrix , only partial removal of the smear layer with the maintenance of about 30% of the smear plugs and no morphological alterations of the dentin surface phosphoric acid - etching of dentin causes collagen fibrils to become slightly denatured and swollen compared to edta - treatment . jacques and hebling reported that pretreatment with a mild etchant such as 0.5 m edta improved the bond strength of the clearfil se bond . torii et al . also reported that edta conditioning was effective in improving dentin bonding for all - in - one adhesives . therefore , it may be anticipated that edta conditioning may improve the bonding efficacy of mild all - in - one self - etch adhesives to dentin . moreover edta has been shown to have a mmp inhibitory effect which may help in improving the durability of resin - dentin bond . degradation of the resin - dentin bonds , due to hydrolysis of the collagen fibrils , involves the participation of endogenous matrix metalloproteinases ( mmps ) which become entrapped within the dentin substrate during tooth development [ 18 , 19 ] . therefore , the use of mmp inhibitors and collagen cross - linkers have been suggested as a valid alternative in an attempt to prolong the resin - dentin bond stability by overcoming this self - degradation process . chlorhexidine ( chx ) , galardin ( gl ) , cmt , sb-3 ct , proanthocyanidins ( pa ) , 1-ethyl-3-(3-dimethylaminopropyl ) carbodiimide ( edc ) , tetracycline , and quaternary ammonium methacrylates or benzalkonium chloride have been employed in various studies to improve the durability of resin - dentin bond [ 2125 ] . the potential of cross - linkers is related to the possibility to improve the mechanical strength of the collagen network , improve the resistance to enzymatic degradation , and inactivate exposed mmps bound to matrix collagen . when acid - etched dentin containing activated matrix - bound mmps is treated with cross - linking agents , they inactivate the catalytic site of proteases . carbodiimide [ edc , 1-ethyl-3-(3-dimethylaminopropyl ) ] has been described as a collagen cross - linker with mmp inhibitory properties . edc have been used as alternative cross - linking agents to glutaraldehyde , since they contain no potentially cytotoxic aldehyde residuals [ 27 , 28 ] . edc effectively improves the durability of resin - dentin bonds by increasing the mechanical properties of the collagen matrix . most of the research regarding the effect of edc on dental adhesion has been done using etch - and - rinse adhesives ; however the effect of edc on bonding of contemporary self - etch adhesives needs to be evaluated . moreover the effect of prior edta conditioning on the bonding of specific all - in - one adhesive systems still needs to be determined . hence , the aim of this study was to investigate the effect of ( i ) edta conditioning , ( ii ) edc pretreatment , or ( iii ) combined effect of edta preconditioning and edc application on the immediate and long - term bonding efficacy of two different all - in - one self - etch adhesives . the null hypothesis tested was that there is no effect of edta or edc pretreatment on the immediate and delayed bond strength of two different all - in - one self - etch adhesives to dentin . the study was performed in one hundred and sixty freshly extracted noncarious , human molars . the teeth were examined under stereomicroscope ( olympus , tokyo , japan ) and teeth free of caries , cracks , or any developmental defects were included . calculus was removed using ultrasonic scaler and then the teeth were stored in 0.5% chloramine t trihydrate ( sigma aldrich , bangalore , india ) for no more than 3 months . tooth crowns were flattened using a low - speed diamond saw ( isomet , buehler ltd . , lake bluff , il , usa ) under water irrigation unless superficial dentin was visible and a standardized smear layer was created with 600-grit silicon - carbide ( sic ) paper . the samples were embedded in an autopolymerizing resin at the level of cementoenamel junction with long axis perpendicular to the acrylic resin surface . teeth were randomly divided into eight groups according to two different self - etch adhesives used ( g - bond ( gc corp . , tokyo , japan ) and optibond - all - in - one ( kerr , orange , ca , usa ) ) ( table 2 ) and four different surface pretreatments . each group was further divided into two subgroups for immediate ( a ) and delayed ( b ) bond strength evaluation . dentin conditioning with 24% edta gel for 1 minute ( trisodium edta gel , pyrex pharmaceuticals , roorkee ) , followed by rinsing with distilled water , blot dried prior to application of g - bond . group 3 ( gb - edc ) . application of edc ( 0.3 m for 1 minute ) on smear covered dentin surface and blot dried before application of g - bond . dentin was conditioned with 24% edta gel for 1 minute , rinsed with distilled water , and blot dried . this was followed by application of edc ( 0.3 m ) for 1 minute and then blot dried , followed by application g - bond adhesive . dentin conditioning with edta ( 24% gel for 1 minute ) followed by rinsing with water blot dried prior to application of optibond - all - in - one . group 7 ( ob - edc ) . application of edc ( 0.3 m for 1 minute ) on smear covered dentin surface and blot dried before application of optibond - all - in - one . dentin was conditioned with 24% edta gel for 1 minute , rinsed with distilled water , and blot dried . this was followed by application of edc ( 0.3 m ) for 1 minute and then blot dried , followed by application optibond - all - in - one adhesive . transparent plastic tubes 54-hl ( tygon medical tubing , saint gobain , akron , oh , usa ) of internal diameter 3 mm and 2 mm height with thickness 0.5 mm were precut and placed perpendicular to the prepared surface . a hybrid resin composite ( filtek z350 xt , body shade a1 , nanohybrid , 3 m espe ) was filled into the precut tubes . each bonded specimen was light - cured for 20 seconds using spectrum 800 ( dentsply , caulk , milford , usa ) at light intensity of 600 mw / cm . the plastic tubes were gently cut and carefully removed with a number 11 surgical blade after polymerization . half of the specimens ( 1a8a ) were then stored in distilled water at 37c for 24 hours for immediate testing . the remaining half samples from each group ( 1b8b ) were stored in artificial saliva ( icpa , wet mouth ) for 6 months before shear bond strength evaluation [ 30 , 31 ] . shear bond strength was determined using a universal testing machine ( instron , admet , enkay enterprises , new delhi ) using the corresponding computer software . the specimens were placed and stabilized by the jig , while a straight knife - edge rod ( 2.0 mm ) was applied at the tooth restoration interface at a crosshead speed of 1 mm / minute . load was applied until restoration failure . the mode of failure was determined by observation under a stereomicroscope ( olympus , tokyo , japan ) at 10x magnification and classified into adhesive ( a ) , mixed ( m ) , and cohesive ( c ) failures in either dentin or resin . the statistical analysis was done using three - way anova and post hoc tukey 's test spss 16.0 version ( statistical package , spss inc . , mean shear bond strength values and standard deviation of all the groups are presented in table 1 . there was no significant difference in bond strengths between the two adhesives when used according to manufacturer 's instructions ( table 2 ) . edta pre - conditioning had no significant effect on the immediate bond strength of either of the adhesives ( groups 1a and 2a ; p = 0.707 ; groups 5a and 6a ; p = 0.959 ) . edc pretreatment alone also had no significant effect on the immediate bond strength of g - bond ( groups 1a and 3a ; p = 0.836 ) and optibond - all - in - one ( groups 5a and 7a ; p = 0.999 ) . mixed fractures were the most common failure mode in all the groups ( figure 1 ) . there was no significant difference in the mode of failure between the two tested adhesives . there was a significant reduction in bond strength for both adhesives g - bond and optibond all - in - one after six months storage ( groups 1a and 1b ; p = 0.022 ; groups 5a and 5b ; p = 0.020 ) . edta preconditioning could not prevent the fall in bond strength over a six - month storage period ( groups 2a and 2b ; p = 0.018 ; groups 6a and 6b ; p = 0.006 ) . however , edc pretreatment alone ( groups 3a and 3b ; p = 0.429 ; groups 7a and 7b ; p = 0.344 ) or edc application on edta conditioned dentin surface ( groups 4a and 4b ; p = 0.286 ; groups 8a and 8b ; p = 0.403 ) resulted in preservation of resin - dentin bond strength of both the adhesives with no significant fall over six months . failure mode analysis revealed mixed fractures to be the most common in groups 3b : 4b ; 7b and 8b . an increase in adhesive fractures was observed in groups 1b : 2b ; 5b : 6b ( figure 1 ) . in the present study , no significant difference was observed between the immediate shear bond strength values of g - bond and optibond - all - in - one adhesives and mixed fractures were the most common failure mode . bond strength of polymerized adhesives depends upon various factors such as the type of cross - linking monomers , presence and type of filler particles , degree of conversion , and the amount of residual organic solvents . the carboxylic group of 4-met ( 4-methacryloyloxyethyl trimellitic acid ) renders g - bond monomers hydrophilic , but less reactive than udma ( urethane dimethacrylate ) in hydrogen bonding with water and it functions as a proton donor that bonds ionically with calcium in hydroxyapatite crystalites [ 32 , 33 ] . thus , an extremely thin interface nanointeraction zone ( 300 nm ) is formed as opposed to the traditional hybrid layer appellation that provides resistance to acute debonding stresses and better bond durability and survival of adhesion , minimizing voids . strong air blowing of the primed surface as suggested in g - bond accelerates the evaporation of solvent - acetone and the resultant water droplets formed due to phase separation . the excess of nonpolymerizable hydrophilic components ( water , acetone , and glutaraldehyde ) may give rise to hydration forces that repel water at film boundaries and hence less water sorption . optibond - all - in - one contains 35 to 45% acetone and 49% ethanol . as the vapor pressure of acetone is high , it volatilizes rapidly and may dehydrate the dentin . the presence of water in self - etch adhesives is necessary to ensure the ionization of the acidic monomers , but it is not as efficient as acetone or ethanol as a solvent because of its lower vapor pressure . the presence of acetone and ethanol in optibond - all - in - one might balance the solvent evaporation without dehydrating dentin , because ethanol ensures the wetness of the substrate , and its vapor pressure is intermediate between acetone and water . another explanation for the good performance of optibond - all - in - one could be the content of glycerol phosphate dimethacrylate monomer in its formulation , a surfactant monomer that may have facilitated the penetration of hydrophobic components into dentin , reducing the phase separation [ 37 , 38 ] . g - bond is hema ( 2-hydroxyethyl methacrylate ) free adhesive whereas optibond - all - in - one is hema containing adhesive [ 33 , 3941 ] . the hydrophilic monomer , hema , in various concentrations is frequently added to one - step self - etch adhesives because of its positive influence on adhesion to dentin , the miscibility of hydrophilic and hydrophobic components in the adhesive blend , and prevention of phase separation . the hydrophilic monomer of hema tends to cluster together before polymerization , leading to creation of hydrophilic domains . moreover , hema attracts water even after polymerization . when hema is cured in the presence of water , polymerization is incomplete and a porous hydrogel is formed that allows water to permeate through the adhesive layer , compromising bonding effectiveness . it was reported that the amount of water sorption of adhesive polymers increased proportionally to their hema concentrations . some studies have shown that the removal of hema from self - etch adhesives would minimize water sorption , while others have observed that the 10% hema content would be beneficial for the adhesive system performance . there is still a controversy about the role of hema in the bonding performance of adhesives . in the study by felizardo et al . it was concluded that the influence of hema on bond strength to dentin was material dependent . as there are numerous factors involved in bond degradation , several methods have been proposed ( i.e. , load cycling , thermal cycling , prolonged water , and artificial saliva incubation ) for reproducing clinical situations and simulating the oral environment to test the durability of dentin bonding . in our study , after storage in artificial saliva for six months , both g - bond and optibond - all - in - one depicted significant reduction in the bond strength when used without any pretreatment . several studies have provided morphological evidence of resin elution and/or hydrolytic degradation of collagen matrices after long - term storage . accordingly , more adhesive failures were observed after 6-month period . it has been widely used to dissolve the mineral phase of dentine without altering dentin proteins , thereby avoiding major alterations of the native fibrillar structure of dentin collagen . further , edta has an inhibitory effect on the matrix - bound mmps of demineralized dentin . in the current study , edta preconditioning had no significant effect on the immediate bond strength of the tested self - etch adhesives . reported that edta application before one - step self - etch adhesive significantly improved the bond strength . however , they used liquid edta at 0.5 m concentration for 30 seconds and the adhesives evaluated were also different from our study . soares et al . also depicted increased bond strength of self - etch adhesive systems used with edta preconditioning . however , they conducted the study on bovine incisors using two - step self - etch adhesives whereas , in our study , one - step all - in - one adhesives were used . it has been reported that the efficiency of edta depends on many factors : penetration depth of the material , hardness of the dentin , duration of application , ph , form ( liquid or gel ) , and concentration of material . although edta is an excellent mmp inhibitor , it is also water soluble ; hence it might be rinsed off edta - treated dentin . therefore , in the current study no improvement in durability could be observed after edta pretreatment with significant reduction in bond strength after six months , along with an increase in the number of adhesive failures . another important aspect that must be considered is edta delivery form . even at a higher concentration , a 24% edta gel might not be able to etch dentin in the same manner as edta in aqueous solution due to its lower wetting capacity . evaluated the effect of 24% edta on bond strength of resin cements to dentin and concluded that the effect varied with the different resin cements . parihar and pilania also concluded that the effect of edta preconditioning on bonding of self - adhesive resin cement was product dependent . edc , a cross - linking agent with very low cytotoxicity , has shown promising results in eliminating dentin collagen degradation and preserving dentin bond strength with clinically acceptable procedure time . it is the most stable cyanamide isomer , which is able to assemble amino acids into peptides . however , application of edc alone in this study , on the dentin surface , without prior edta conditioning had no significant effect on the immediate bond strength of both self - etch adhesives . probably as there was no exposed collagen , edc was not able to strengthen the collagen matrix by increased cross - linking , whereas most of the studies , which report improved bonding effectiveness with edc , have been performed using etch and rinse adhesives where edc is applied to dentin previously demineralized by phosphoric acid which exposes the collagen fibrils . because edta does not denature collagen in comparison to phosphoric acid , it creates thinner hybrid layers that are more easily infiltrated with resin [ 4952 ] . conditioning with 24% edta for 1 minute has been shown to demineralize the dentin and expose the collagen fibrils . thus , in the present study , dentin pretreatment with edc ( with and without edta ) resulted in bond strength preservation after 6 months of storage in artificial saliva for both adhesives used . all edc treated groups at 6 months revealed mixed fracture patterns to be the most common failure mode . a previous in vitro study also reported that edc application for 1 minute was effective in inactivating soluble rhmmp-9 and matrix - bound dentin proteinases . our results are supported by the study of mazzoni et al . , who reported preservation of resin - dentin bond with 1 minute edc pretreatment and by the study of bedran - russo et al . who also reported increased durability of resin - dentin bonds in edc pretreated group [ 54 , 55 ] . edc is capable of cross - linking proteins through covalent peptide bonds by activating the free carboxyl group of glutamic and aspartic acids present in protein molecules to form o - acylisourea intermediate that reacts with the epsilon amino group of lysine or hydroxylysine in an adjacent polypeptide chain to form a stable amide cross - link [ 56 , 57 ] . cross - linking increases the mechanical properties of dentin collagen and makes the fibrils more resistant to degradation . furthermore edc shows no transdentinal cytotoxicity on odontoblast - like cells and is able to increase the mechanical properties of the collagen matrix [ 25 , 58 ] . further studies are required to evaluate the effect of different concentration , time , ph , and form of application of edta and edc on the long - term bonding efficacy of different contemporary adhesive systems to dentin . effect of incorporation of edc in the adhesive composition on the resin polymerization also needs to be investigated . carbodiimide pretreatment of dentin surface resulted in significant preservation of resin - dentin bond over six - month storage period for both all - in - one self - etch adhesives tested . edta pretreatment of dentin surface before application of self - etch adhesives had no effect on the durability of resin - dentin bond .
objective . this study evaluated the effect of ethylenediaminetetraacetic acid ( edta ) conditioning and carbodiimide ( edc ) pretreatment on the shear bond strength of two all - in - one self - etch adhesives to dentin . methods . flat coronal dentin surfaces were prepared on one hundred and sixty extracted human molars . teeth were randomly divided into eight groups according to two different self - etch adhesives used [ g - bond and optibond - all - in - one ] and four different surface pretreatments : ( a ) adhesive applied following manufacturer 's instructions ; ( b ) dentin conditioning with 24% edta gel prior to application of adhesive ; ( c ) edc pretreatment followed by application of adhesive ; ( d ) application of edc on edta conditioned dentin surface followed by application of adhesive . composite restorations were placed in all the samples . ten samples from each group were subjected to immediate and delayed ( 6-month storage in artificial saliva ) shear bond strength evaluation . data collected was subjected to statistical analysis using three - way anova and post hoc tukey 's test at a significance level of p < 0.05 . results and conclusion . edta preconditioning as well as edc pretreatment alone had no significant effect on the immediate and delayed bond strengths of either of the adhesives . however , edc pretreatment on edta conditioned dentin surface resulted in preservation of resin - dentin bond strength of both adhesives with no significant fall over six months .
primary amyloid light - chain ( al ) amyloidosis is a rare form of plasma cell dyscrasia characterized by tissue deposits commonly made of monoclonal immunoglobulin light chain . involvement of the heart , kidney , liver , and autonomic nervous systems is responsible for the poor prognosis of al amyloidosis . patients survival significantly improved during the last 15 years with the use of more effective conventional - dose chemotherapy and/or autologous stem cell transplantation ( asct ) . we report an unusual case of al amyloidosis with bilateral kidney infarcts at presentation and predominantly renal vascular amyloid deposits , associated with a severe cardiomyopathy . this case is exceptional because it first reports bilateral kidney infarcts caused by al amyloidosis and illustrates the groundbreaking advances in the therapy of this dreadful disease . a 34-year - old man was referred because of acute pain of the left flank associated with macroscopic hematuria . two months before admission the patient underwent a cardiac evaluation for progressive dyspnea , thoracic pain , and palpitations . transthoracic ultrasound revealed severe hypertrophic cardiomyopathy with biventricular wall thickening and altered left ventricular ejection fraction ( 45% ) . on admission , physical examination showed a low blood pressure of 100/50 mmhg and new york heart association class ii heart failure . acute kidney injury was present with serum creatinine level of 1.9 mg / dl ( 167 mol / l , glomerular filtration rate estimated by the modification of the diet in renal disease ( mdrd ) equation [ gfrmdrd ] 44 ml / min/1.73 m ) , abnormal urine protein creatinine ( 180 mg / mmol ) , and albumin creatinine ratios ( 92 mg / mmol ) . urine excretion of a monoclonal lambda light chain ( 15% of total proteinuria ) associated with serum increase of free lambda light chain ( 912 mg / l , n 5.726.3 ) was detected . serum lactate dehydrogenase level was 10-fold upper the normal level , brain natriuretic peptide ( bnp ) was 1751 ng / l ( n < 100 ) with troponin i elevation at 0.52 g / l ( n < 0.05 ) a contrast - enhanced abdominal computed tomography - scan performed 2 days after admission because of the recurrence of flank pains showed multifocal bilateral renal infarcts ( figure 1 ) , with normal renal artery and vein , and liver and spleen enlargement . repeated transoesophageal echocardiography showed increased echogenicity and thickening of the myocardium that was highly suggestive for amyloid infiltration , without intracardiac thrombus . light microscopy showed normal glomeruli and large areas of acute tubular necrosis associated with interstitial edema and nonspecific inflammatory infiltrates . congo red stain disclosed vascular amyloid deposits , and immunofluorescence showed positive staining for lambda light chain in the kidney vessel walls only , with no labeling of the glomeruli . electron microscopy examination confirmed fibrillary organization of the vascular deposits , but also disclosed fine fibrillar deposits in the glomerular basement membrane . ( a ) amorphous , green , hyaline material replacing , and expanding the normal vessel wall with partial occlusion of the lumina . note apparent lack of glomerular involvement ( original magnification 100 ) . inset : apple green birefringence of arteriole wall under polarized light after staining with congo red ( original magnification 200 ) . note bright staining of arterioles ( arrows ) with lambda light chain antibody and negative stain for kappa light chain ( original magnification 100 ) . ( c ) electron microscopy revealed amyloid deposition in glomerulus at the endothelial side of the glomerular basement membrane ( arrow ) ( original magnification 10000 ) , with a fibrillary appearance on higher magnification ( inset , original magnification 100000 ) . the deposits are positive with congo red ( inset myocardic wall ) ( original magnification 200 ) . a search for coexisting b - cell malignancy , including multiple myeloma , was negative . due to the advanced amyloid cardiomyopathy , the patient was referred for emergency heart transplantation , which was performed 2 weeks after the admission . native heart showed hypertrophic cardiomyopathy with a weight of 604 g. there were no macroscopic lesion in pericardium , coronary arteries , and myocardium . on microscopy , amyloidal deposits were present on fat tissue , epicardial vessels , and myocardium . he subsequently received chemotherapy with high - dose prednisone ( 60 mg / m ) , melphalan ( 9 mg / m ) , and bortezomib ( 1.3 mg / m twice weekly every 21 days ) for 4 cycles and then bortezomib and dexamethasone ( 10 mg / m ) for 6 cycles between september 2009 and october 2011 . on last follow - up , 40 months after cardiac surgery , the patient had a stable chronic kidney disease stage 3 with serum creatinine of 139 mol / l ( gfrmdrd 50 ml / min/1.73 m ) , a protein creatinine ratio of 40 mg / mmolc , and a sustained remission of al amyloidosis with normal level of serum free light chain , normal troponin i , and n - terminal pro - brain natriuretic peptide . the kidney biopsy tissue collection was approved by the commission informatique et libert and declared to the french ministry of health . we present an exceptional case of al amyloidosis remarkable for its unusual clinical presentation with bilateral kidney infarcts , predominant amyloid vascular deposits on the kidney biopsy and favorable outcome after heart transplantation and chemotherapy . renal involvement is the most frequent manifestation of al amyloidosis , with proteinuria , mainly composed of albumin , being detected in 55% of patients at presentation . combined glomerular and vascular amyloid deposits are common , whereas restricted vessel involvement is observed in < 10% of kidney biopsy specimens and is usually associated with low level of proteinuria . in the present case , the renal presentation was very unusual with hematuria , loin pain , and acute renal failure related to multiple renal infarcts . renal amyloid deposits were restricted to vessels by light microscopy . however , significant albuminuria was present , suggesting the presence of glomerular deposits that were not detected by congo red stain and immunofluorescence examination but only found by electron microscopy . the primary structure of the light chain may play a central role in determining tissue localization . the strong association of vlambda 6a light chains with predominant kidney involvement comforts this hypothesis . the particular tropism of vlambda 6a light chains for the kidney might be explained by a receptor - mediated interaction with mesangial cells . recently , an association between dominant cardiac involvement and the gene iglv144 and l. 3 family has been described . however , other factors such as somatic mutations and post - translational modifications are likely to be involved . arterial thromboembolic events are rare in al amyloidosis and mainly responsible for ischemic stroke , although peripheral arterial occlusions have been reported , affecting mesenteric , iliac artery , or optical nerve arteries . to our knowledge , renal infarcts have not been previously reported . amyloid cardiomyopathy may promote thromboembolic events , mainly due to intracardiac thrombus formation that is detected by transoesophagial echocardiography or at autopsy in 27% and 33% of patients , respectively . atrial fibrillation , left ventricular diastolic dysfunction , and increased right ventricular wall thickness are associated with increased risk of intracardiac thrombus . however , in some patients , cardiac evaluation failed to detect an intracardiac thrombus , as in the present case . hypercoagulability states have been identified as contributing factor to arterial thromboembolic events in al amyloidosis , in patients receiving thalidomide and oestroprogestogen , or presenting with extracellular volume disturbance and nephrotic syndrome . moreover , myocardial infarcts caused by coronary obstruction related to extensive vascular amyloid deposits have been reported . in our case , the respective contribution of renal vascular amyloid lesions and cardioembolic events in the occurrence of renal infarcts is difficult to assess . although our patient presented with clinical , biochemical , and echocardiographic evidence of severe amyloid cardiomyopathy , transoesophagial echocardiography , and histological examination of native heart at transplantation failed to detect intracardiac thrombus . conversely , no arteriolar thrombosis was observed in the biopsy kidney specimen despite the presence of vascular amyloid deposits . in addition to its unusual renal presentation , this case underlines that the sequential therapeutic approach of heart transplantation followed by high - dose dexamethasone - based chemotherapy with or without asct is feasible . such strategy should therefore be discussed in selected patients with predominant , severe cardiac involvement at diagnosis , which is the main prognostic factor in al amyloidosis , with a median survival being less than 6 months at the stage of congestive heart failure . in recent series , 3-years survival was approximately 80% and median survival time ranged from 26 to 56 months in patients with al amyloidosis treated with cardiac transplantation plus asct - high - dose melphalan or melphalan prednisone , a rate being comparable to those of cardiac transplantation for other indications . in conclusion , we present the first case of bilateral kidney infarcts due to al amyloidosis associated with prominent massive renal vascular amyloid deposits . this patient received chemotherapy and heart transplant and 40 months later , he is doing very well , which illustrates the huge progress made in the treatment of systemic al amyloidosis .
abstractprimary amyloid light - chain ( al ) amyloidosis is a rare form of plasma cell dyscrasia characterized by tissue deposition of monoclonal immunoglobulin light chain . kidney involvement is the most frequent manifestation , and patients usually present with glomerular disease.we report an exceptional case of bilateral kidney infarcts caused by al amyloidosis . a 34-years - old man presented with progressive dyspnea , loin pain , recurrent macroscopic hematuria , and acute kidney injury . computed tomography showed bilateral kidney infarcts.the diagnosis of al amyloidosis was established on the kidney biopsy with the characterization of major vascular amyloid deposits that selectively stained with antilambda light chain antibody . an amyloid restrictive cardiomyopathy was also present , responsible for the life - threatening conduction disturbance , but without patent cardioembolic disease . the patient then underwent emergency heart transplantation , followed by a conventional chemotherapy with bortezomib , melphalan , and dexamethasone . more than 3 years later , the patient has subnormal renal function , a well - functioning heart transplant , and a sustained hematologic response.in addition to the very uncommon presentation , this case illustrates the tremendous progress that has occurred in the management of severe forms of al amyloidosis .
lymphomatoid granulomatosis ( lyg ) is a rare epstein - barr virus ( ebv)-associated b - cell lymphoproliferative disorder that has similar characteristics as lymphomatous and granulomatous diseases . the disease is pathologically classified as a large angiocentric and angiodestructive b - cell lymphoma that consists of small numbers of ebv - positive neoplastic b - cells , along with a diffuse background predominantly expressing reactive cd3 and/or cd4 t - cells . patchy , occasionally painful erythematous macules , papules , and plaques are typically observed in the gluteal regions and in the extremities . erythema may sometimes involve nodosum - like subcutaneous nodules that tend to ulcerate but are often limited to the trunk . in this paper , we report a rare case of erythema that initially presented with erythrodermic skin lesions and progressed to pulmonary symptoms . a 70-year - old japanese man presented with a progressively worsening cutaneous papuloerythematous rash on the trunk . during the initial assessment , laboratory investigations showed only hypereosinophilia in the peripheral blood without atypical lymphocytes . the initial skin biopsy revealed moderate infiltration of lymphocytes and eosinophils in the surrounding vessels of the superficial dermis . because he had received indapamide ( a sulfonamide - derived diuretic ) , doxazosin mesylate for hypertension , and other medications for benign prostate hypertrophy 1 year before the onset of the condition , drug eruption was suspected , and all his medicines were suspended . no human t - cell leukemia virus type 1 or human immunodeficiency virus antibodies were detected in the serum . the serum levels of antibodies against the ebv - specific antigens were as follows : anti - viral capsid antigen ( vca):immunoglobulin g ( igg ) , 1:40 ; vca : igm , negative ; vca : iga , negative ; early antigen : igg , negative ; early antigen : iga , negative ; and ebv - determined nuclear antigen : igg , 1:10 . his whole - body ct scan showed no lymph node swellings in the neck and the thoracic and abdominal cavities . the second skin biopsy showed superficial and deep dense mixed infiltrates in the dermis without epidermal involvement . the infiltrates were angiocentric , and they predominantly consisted of small lymphocytes and histiocytes with multinucleated giant cells . although angiodestruction and necrosis were absent , cellular infiltration vaguely showed a granulomatous appearance . in situ hybridization yielded negative findings for ebv - encoded rnas . although topical corticosteroid therapy was further continued , his cutaneous lesions continued to spread on to nearly his whole body . two months after the onset , the lesions merged and took an erythrodermic appearance , with superficial lymph node swelling ( fig . the third skin biopsy revealed a large number of infiltrating lymphocytes , whereas no necrosis or large lymphocytes were seen ( fig . the ig heavy - chain or t - cell receptor beta - chain rearrangements in the skin were not detected in pcr and southern blot analyses . three months after the onset of the condition , the patient had sustained high fever and cyanosis . however , he did not have cough or chest pain . his chest ct scan showed diffuse infiltrative lesions in the bilateral lungs and pleural effusion without nodules or lymph node swelling . his arterial blood gas examination revealed severe hypoxemia ( po2 29.9 mm hg ; pco2 37.4 mm hg ; ph 7.462 , a - ado2 79.1 ) . although a lung biopsy was not done because of severe hypoxemia , lyg was diagnosed on the basis of the cutaneous pathological findings and the pulmonary symptoms . he was treated with corticosteroid pulse therapy ( methylprednisolone 1 g / day for 3 days ) for acute respiratory distress syndrome . soon after , his hypoxemia improved and the diffuse reticular shadows of the lungs disappeared on the third day of the pulse therapy . furthermore , the erythrodermia and the hypereosinophilia improved with the intravenous corticosteroid therapy . in the course of the corticosteroid dosage tapering , mild hot flashes on his face , trunk , and arms occasionally appeared , and gradually , the number of eosinophils increased . although cyclophosphamide ( 50 mg / day ) was taken with prednisolone ( 12 mg / day ) , mild recurrence with several small nodular lesions in the perineal areas without erythrodermia was observed 7 months after the onset of the condition . however , the lesions disappeared gradually with the sustained therapy , and the patient has been continuously been taking prednisolone at a dose of 11 mg / day and cyclophosphamide at a dose of 50 mg every other day , without recurrence , for 4 years up to date . lyg was first described by leibow et al . in 1972 and was initially thought to be a t - cell lymphoproliferative disorder owing to the prominence of cd4 t - cells observed in biopsy specimens . it was later demonstrated that lyg is an ebv - associated b - cell lymphoproliferative disorder , in which a large number of infiltrating t - cells are reactive [ 4 , 5 , 6 ] . therefore , currently lyg is considered as an ebv - related t - cell - rich monoclonal b - cell lymphoproliferative disorder with a broad pathological spectrum and variable malignant potential . angiocentric infiltration with vasculitis and necrosis is pathognomonic and results from the angiodestructive potential of the polymorphous lymphoid infiltrate , with predominantly reactive t - lymphocytes and sparse clonal ebv - positive b - cells . . however , most patients show multiple erythematous , dermal , and subcutaneous papules and nodules on the extremities and/or on the trunk [ 3 , 5 ] . angiodestruction , necrosis , and cellular atypia are much more common in the deeper subcutaneous nodules . lipford et al . divided lyg lesions into 3 histologic grades on the basis of the degree of cytologic atypia in the lymphoid cells and the extent of the inflammatory background . grade iii lesions show marked cytologic atypia present in small and large lymphoid cells , which is termed angiocentric lymphomas . previous studies [ 5 , 6 ] have shown that the number of ebv - positive cells correlates with histologic grade . the ebv - positive lesions contained large cytologically atypical cells and were associated with marked necrosis . our case predominantly presented erythematous plaque lesions that resulted in erythrodermia and a negative reaction to ebv . according to the histologic grading described above , our case was grade i , which corresponded to the results of the in situ hybridization for ebv and the pcr assay for the igh gene . cutaneous lesions appear before the onset of the pulmonary disorder in 15% of lyg cases , such as in our case . pulmonary lesions in lyg present a variety of radiographic features , from diffuse infiltrates to nodules , as well as the presence of cutaneous lesions [ 3 , 6 ] . although there were no pulmonary nodular lesions , our case showed severe hypoxemia due to diffuse infiltrates . a similar case of lyg mimicking interstitial pneumonia without cutaneous lesions the immunophenotypes of the infiltrating lymphocytes in lyg previously reported are cd3 , cd4 , cd8 , cd20 , and cd79a [ 2 , 57 , 9 ] . in lyg , ebv is localized to cd20 b - cells in the lungs and the skin [ 4 , 10 , 11 ] . several reports indicate that ebv was more difficult to identify in skin lesions than in the lungs in lyg [ 4 , 5 ] . mcniff et al . postulated that ebv - containing b - cells are few or ebv - containing b - cells did not consistently home to skin , which is the reason for the difficulty in detecting lyg in the skin . the immunohistochemical stainings of the cutaneous lesions in our case showed a few b - cells in the skin , which might show false - negative results for ebv . in addition , serological analysis revealed only the past infection , without reactivation of ebv . the mechanism by which the condition of the present case progressed to erythrodermia is unclear . however , it is often observed that the number of atypical cells differ greatly from specimen to specimen in the same patient . abel et al . found that the lymphocyte phenotypes of their patients with erythrodermia caused by mycosis fungoides / sezary syndrome or benign disease were strikingly similar . they suggested that erythrodermic mycosis fungoides / sezary syndrome skin lesions compromise a greater proportion of cells involved with host response than other types of mycosis fungoides . it is very likely that numerous host response t - cells lead to symptoms of erythrodermia . macon et al . revealed that the presence of interleukin ( il)-4 in t - cell - rich b - cell lymphomas ( tcrbcls ) but not in other diffuse large b - cell lymphomas and reactive lymph nodes indicated that il-4 may be a major factor involved in the pathobiology of tcrbcls . in addition , several interesting studies [ 14 , 15 ] suggested that il-4 not only have proliferative effects on resting b - cells but also anti - proliferative effects on activated neoplastic b - cells . il-4 may influence the pronounced t - cell reaction in the tcrbcls and contribute to the low numbers of neoplastic b - cells . we speculate that some cytokines like il-4 may cause host response by abundant production of t - cells , suppress proliferation of neoplastic b - cells , and advance skin lesions to erythrodermic features . a number of studies trying to find an effective way to treat lyg have been reported . however , a standard therapy has not yet been established , and treating lyg remains a challenge . the variety of symptoms and the clinical course make this condition difficult to diagnose and treat . grading the disease by immunohistological examination and in situ hybridization is an important basis for choosing the right treatment that is currently available . initial use of combination chemotherapy , such as chop , was recommended for all aggressive cases that could develop to malignant lymphoma . interferon- has been a promising therapy because lyg grades i and ii without monoclonal b - cell population is not an autonomous malignant proliferation but rather an ebv - driven lymphoproliferative disorder . however , in the present case , which was categorized as grade i and showed erythrodermia without b - cell monoclonality , the low maintenance doses of corticosteroid and cyclophosphamide were adequate to suppress the abundant activated t - cells and sustain clinical remission for a long period .
a 70-year - old man was admitted to our hospital for evaluation of a rapidly progressive erythrodermia . he had superficial lymph node swelling and gluteal / inguinal nodosum - like lesions . a skin biopsy of the erythrodermia showed dense mixed infiltrates distributed throughout the whole dermis , predominantly consisting of small lymphocytes and histiocytes with multinucleated giant cells presenting with a granulomatous appearance . the dense infiltrates showed a characteristic angiocentric pattern surrounding the upward vasculature interconnecting the subcutaneous / subpapillary plexus in the dermis . some infiltrating lymphocytes showed mild atypia with somewhat irregularly shaped nuclei . their immunologic staining profiles supported the diagnosis of lymphomatoid granulomatosis . despite the dense angiocentric infiltration in the dermis , typical angiodestructive infiltration with necrotic changes was not seen on pathological examination . in this case , in situ hybridization yielded negative findings for epstein - barr virus - encoded rnas . three months after the onset of erythrodermia , the patient developed pulmonary lymphomatoid granulomatosis . corticosteroid pulse therapy was effective for the treatment of severe pulmonary infiltrations and erythrodermia . however , there had been mild recurrence of the condition or hypereosinophilia during the 4 years of follow - up . low maintenance doses of cyclophosphamide and corticosteroid provided the patient symptomatic relief to date .
. however , symptoms may arise due to occasional obstruction or perforation ( 1 ) . these objects and long , narrow , or pointed foreign bodies are associated with a high risk of impaction and perforation of the bowel walls ( 2 , 3 ) . the ingestion of foreign bodies may also lead to penetrating injuries with complicating abscess formation . symptoms are nonspecific , and foreign bodies may not be obvious on plain films , ultrasounds , or computed tomographic images . patients may also give vague or non - specific information , making it difficult for clinicians to determine proper treatment . we present herein a patient who underwent surgery to rule out a primary omental tumor , an impression that had been suggested by radiologists based on the results of multiple diagnostic modalities . we were not then aware that the patient had eaten the korean delicacy " kanjang - gaejang , " which is raw crab seasoned with soy sauce . a crab leg was found during surgery , and the patient was diagnosed with an antral perforation with abscess formation in the omentum due to foreign body migration . a 59-yr - old man presented to the emergency department complaining of continuous epigastric and right upper quadrant pain for the previous 3 weeks on 23th march , 2009 . he had smoked one pack of cigarettes every day for 40 yr and was a social drinker . the patient had undergone a gastrofiberoscopy and colonoscopy 20 days earlier in a local clinic . his initial vital signs were : blood pressure 110/60 mmhg , pulse rate 88/min , respiratory rate 20/min , and temperature 36.3. six hours after presentation , he complained of chills with a high body temperature of 38.0. the complete blood count showed a white blood cell count of 16,800/l , hemoglobin concentration of 14.1 g / dl , and platelet count of 350,000/l . blood chemistry data revealed severe increases in c - reactive protein ( 346 mg / l ) and erythrocyte sedimentation rate ( 55 mm / hr ) , with mildly elevated levels of aspartate aminotransferase and alanine aminotransferase ( 127 and 175 bilirubin , albumin , and other blood component chemistries were all within the normal range . pre - contrast and contrast enhanced computed tomography ( ct ) showed an approximately 6.0 cm , ill - defined heterogeneous enhancing hypodense mass lesion in the gastrocolic ligament ( fig . the mass extended to its peripheries , with ill - defined infiltration of the surrounding omentum . radiologists called for further workup to differentiate among metastatic mass , primary omental tumor , and omental infarction . viral and tumor markers , including carcinoembryonic antigens , alpha - fetoproteins , ca 19 - 9 , and ca 125 , were within normal ranges . abdominal ultrasonography displayed an ill - defined , heterogeneous echogenic mass between the stomach and transverse colon ( fig . 2 ) . further imaging with positron emission tomography ct revealed a large intense hypermetabolic mass in the gastrocolic ligaments without evidence of metastasis . the operative field revealed a 4-cm crab leg embedded within the approximately 6-cm abscess in the perforated antrum of the stomach ( fig . the patient underwent antrectomy , vagotomy , and transverse colon wedge resection . a detailed history taken after surgery uncovered the kanjang - gaejang ingestion three weeks before , one day prior to the onset of abdominal pain . twenty days after admission , the patient was discharged from the hospital with no complications . sharp objects carry the risk of perforation , while toxic materials , such as button batteries , may need emergency endoscopic extraction . less than 1% of ingested foreign bodies perforate the gastrointestinal tract , and most foreign bodies pass through the gastrointestinal tract within one week without any complications . when perforation does occur , the most commonly involved areas are the duodenum , ileocecal , and rectosigmoidal regions ( 1 , 4 , 5 ) . ingested foreign bodies mostly cause non - specific symptoms . however , when ingestion is accompanied by intra - abdominal perforation , patients may present with abdominal pain ( 95% ) , fever ( 81% ) , or localized peritonitis ( 39% ) . several studies report complications that include liver abscess , deep neck infection , and thyroid abscess ( 6 , 7 ) . an endoscopy may also be helpful if performed before the foreign body migrates and the mucosa starts to heal . the high density lesion in the pre - enhanced and contrast enhanced phases of the abdominal ct in our patient could have been the foreign body . free pneumoperitoneum is rare as the foreign body is gradually impacted and the perforation is locally covered with fibrin ( 1 , 8) . our patient did not initially recall the ingestion and had non - specific symptoms and laboratory results . ultrasonography and . the migrating foreign body had remained unproblematic until forming an abscess in the gastrocolic ligament . mass lesions of the omentum may originate from omental tumors , such as sarcoma and mesenteric embryoma , as well as from omental hernias , infarctions , or abscesses . non - neoplastic omental tumors are rare and include hamartomas , cryptococcosis , inflammatory pseudotumors , and foreign body granuloma . they tend to be male dominant and develop adjacent to the transverse colon ( 6 , 9 ) . fish is a major part of the japanese diet , and there are numerous reports of bowel perforation caused by fishbone in the japanese literature ( 5 ) . however , no previous case of bowel perforation from eating crab legs has been published to date . crab leg ingestion should not be overlooked as a possible cause of bowel perforation and abscess formation in patients with unexplained abdominal pain . a solitary foreign body granuloma or pseudotumor can be difficult to diagnose without the appropriate history . this case demonstrates that , in the absence of a reliable history , the migration of an ingested foreign body into the intraabdominal omental area may result in chronic inflammation , a silent clinical course , and radiologic features suggestive of a neoplasm .
foreign body ingestion is not uncommon in clinical practice , and it may occasionally lead to penetration injuries . emergency physicians and radiologists sometimes fail to obtain complete histories including ingestion and may overlook the possibility of foreign body - induced complications . herein , we report a case of stomach antrum perforation due to foreign body migration . we were unaware of the patient 's history of eating the korean delicacy " kanjang - gaejang , " which is raw crab seasoned with soy sauce . several imaging diagnostic modalities had suggested the possibility of a malignant mass in the gastrocolic ligament area . during the operation , a crab leg was discovered as the cause of an intra - abdominal abscess . the patient underwent an antrectomy , a vagotomay , and a transverse colon wedge resection . we present this unusual case of a pseudotumorous lesion caused by ingestion of kanjang - gaejang .
basal cell carcinoma ( bcc ) is a slow growing malignant cutaneous tumor that is locally aggressive but it rarely metastasizes . histopathological examination of the excision biopsy has been the mainstay for diagnosis . fine needle aspiration cytology ( fnac ) has been recently employed as a simple alternative tool in diagnosing various cutaneous tumors , however , extensive search of literature revealed only few reports of cytological diagnosis of bcc . we report the cytomorphological features of two unusual cases of cutaneous bcc and compare them with their corresponding histopathology to explain the diagnostic difficulties encountered on cytology . a 65-year - old female presented to the ophthalmology outpatient department with a polypoidal painless swelling in the lateral canthus involving both the eyelids of the right eye for the last 15 years . the swelling had gradually increased to the present size of 1.8 cm 1 cm . the swelling was nodular , firm , nontender , and black in color with focal overlying skin ulceration . smears prepared were highly cellular showing islands of interconnected epithelial fragments embedded within the stroma [ figure 1b ] . few of these fragments showed evidence of glandular / tubular differentiation [ figure 1a ] . the cells were small basaloid , having scant cyanophilic cytoplasm , indistinct cell borders , and round hyperchromatic nuclei showing coarse granular chromatin and inconspicuous nucleoli [ figure 1c ] . many epithelial fragments showed cells embedded in metachromatic basement membrane - like matrix with numerous fibroblasts and melanophages . fair amount of brown - black pigment was seen within the tumor cells and the stromal macrophages [ figure 1b ] . ( a ) aspirate smear shows cohesive round - to - oval , basaloid tumor cells arranged in gland - like structures ( arrow ) along with metachromatic material ( mgg 200 ) ( b ) aspirate smear shows islands of tumor cells in myxoid stroma . the tumor cells have intracytoplasmic brown black pigment ( red arrow ) ( pap stain 100 ) . ( c ) higher magnification shows small round basaloid cells with scant cytoplasm and hyperchromatic nuclei with coarsely granular chromatin ( pap stain 400 ) keeping in view the clinical and cytomorphological features , differential diagnoses of : a melanocytic lesion , inconclusive for malignancy with the possibility of dysplastic nevus andbcc were offered . a melanocytic lesion , inconclusive for malignancy with the possibility of dysplastic nevus and excision with a 1-cm margin was performed . gross specimen consisted of a skin covered hyperpigmented polypoidal tissue measuring 2.5 cm 2 cm 1.5 cm . the frozen section revealed a predominantly circumscribed nodular tumor composed of glands and tubular lumina filled with some amorphous material . the loss of tumor cells and the collection of blood along the fnac needle track in the center of the lesion were clearly evident . paraffin - embedded hematoxylin and eosin ( h&e ) sections confirmed the frozen section findings . higher magnification showed small basaloid cells surrounding the lumina , which were filled with pink amorphous material . the periphery of the tumor islands showed characteristic palisading and focal areas of retraction artifacts . at places , the tumor cells showed melanin surrounded by melanophages present in the stroma . a final diagnosis of bcc - mixed histology ( mh ) ( adenoid , pigmented , and micronodular ) a 70-year - old male , a known case of chronic actinic dermatitis , presented to the dermatology outpatient department with a hyperpigmented painless plaque measuring 2.5 cm in diameter over the scalp in the right temporal region for the last 3 years . on examination , it was a firm , nontender , black colored hyperpigmented plaque - like lesion with rolled out margins and central ulceration . fna smears were highly cellular showing many syncytial , branching epithelial fragments with peripheral palisading of the nuclei in some of them [ figure 2 ] . these fragments comprised predominantly of small basaloid cells with mild pleomorphism , having scant cytoplasm , indistinct cell borders , round hyperchromatic overlapping nuclei with coarse granular chromatin , and inconspicuous nucleoli [ figure 2b ] . few fragments were embedded in the metachromatic basement membrane - like material with numerous fibroblasts and melanophages [ figure 2a ] . black pigment was seen within the tumor cells and the stromal macrophages [ figure 2d ] . based on clinical and cytological features , a diagnosis of bcc was offered . ( a ) aspirate smear shows a cellular tumor comprising of epithelial fragments along with metachromatic material in the background ( mgg 100 ) . ( b ) cohesive clusters of round - to - oval basaloid cells having scant cytoplasm that show peripheral palisading of hyperchromatic nuclei ( c ) cohesive syncytial cluster comprising of basaloid cells with branching ( pap stain 200 ) ; ( d ) intracytoplasmic brown black pigment in the tumor cells and melanophages ( pap stain 200 ) microscopic examination of the excision biopsy revealed a dermal tumor composed of basaloid cells originating from the epidermis and predominantly in the form of interlacing strands . it was noted that most of the tumor islands in the biopsy had peripheral palisading , which was missing in the areas where the tumor was in the form of interlacing strands and glandular / tubular structures ) . a final diagnosis of bcc - mh ( adenoid and pigmented ) was rendered on histopathology . a 65-year - old female presented to the ophthalmology outpatient department with a polypoidal painless swelling in the lateral canthus involving both the eyelids of the right eye for the last 15 years . the swelling had gradually increased to the present size of 1.8 cm 1 cm . the swelling was nodular , firm , nontender , and black in color with focal overlying skin ulceration . smears prepared were highly cellular showing islands of interconnected epithelial fragments embedded within the stroma [ figure 1b ] . few of these fragments showed evidence of glandular / tubular differentiation [ figure 1a ] . the cells were small basaloid , having scant cyanophilic cytoplasm , indistinct cell borders , and round hyperchromatic nuclei showing coarse granular chromatin and inconspicuous nucleoli [ figure 1c ] . many epithelial fragments showed cells embedded in metachromatic basement membrane - like matrix with numerous fibroblasts and melanophages . fair amount of brown - black pigment was seen within the tumor cells and the stromal macrophages [ figure 1b ] . ( a ) aspirate smear shows cohesive round - to - oval , basaloid tumor cells arranged in gland - like structures ( arrow ) along with metachromatic material ( mgg 200 ) ( b ) aspirate smear shows islands of tumor cells in myxoid stroma . the tumor cells have intracytoplasmic brown black pigment ( red arrow ) ( pap stain 100 ) . ( c ) higher magnification shows small round basaloid cells with scant cytoplasm and hyperchromatic nuclei with coarsely granular chromatin ( pap stain 400 ) keeping in view the clinical and cytomorphological features , differential diagnoses of : a melanocytic lesion , inconclusive for malignancy with the possibility of dysplastic nevus andbcc were offered . a melanocytic lesion , inconclusive for malignancy with the possibility of dysplastic nevus and excision with a 1-cm margin was performed . gross specimen consisted of a skin covered hyperpigmented polypoidal tissue measuring 2.5 cm 2 cm 1.5 cm . the frozen section revealed a predominantly circumscribed nodular tumor composed of glands and tubular lumina filled with some amorphous material . the loss of tumor cells and the collection of blood along the fnac needle track in the center of the lesion were clearly evident . paraffin - embedded hematoxylin and eosin ( h&e ) sections confirmed the frozen section findings . higher magnification showed small basaloid cells surrounding the lumina , which were filled with pink amorphous material . the periphery of the tumor islands showed characteristic palisading and focal areas of retraction artifacts . at places , the tumor cells showed melanin surrounded by melanophages present in the stroma . a final diagnosis of bcc - mixed histology ( mh ) ( adenoid , pigmented , and micronodular ) a 70-year - old male , a known case of chronic actinic dermatitis , presented to the dermatology outpatient department with a hyperpigmented painless plaque measuring 2.5 cm in diameter over the scalp in the right temporal region for the last 3 years . on examination , it was a firm , nontender , black colored hyperpigmented plaque - like lesion with rolled out margins and central ulceration . fna smears were highly cellular showing many syncytial , branching epithelial fragments with peripheral palisading of the nuclei in some of them [ figure 2 ] . these fragments comprised predominantly of small basaloid cells with mild pleomorphism , having scant cytoplasm , indistinct cell borders , round hyperchromatic overlapping nuclei with coarse granular chromatin , and inconspicuous nucleoli [ figure 2b ] . few fragments were embedded in the metachromatic basement membrane - like material with numerous fibroblasts and melanophages [ figure 2a ] . black pigment was seen within the tumor cells and the stromal macrophages [ figure 2d ] . ( a ) aspirate smear shows a cellular tumor comprising of epithelial fragments along with metachromatic material in the background ( mgg 100 ) . ( b ) cohesive clusters of round - to - oval basaloid cells having scant cytoplasm that show peripheral palisading of hyperchromatic nuclei ( c ) cohesive syncytial cluster comprising of basaloid cells with branching ( pap stain 200 ) ; ( d ) intracytoplasmic brown black pigment in the tumor cells and melanophages ( pap stain 200 ) microscopic examination of the excision biopsy revealed a dermal tumor composed of basaloid cells originating from the epidermis and predominantly in the form of interlacing strands . it was noted that most of the tumor islands in the biopsy had peripheral palisading , which was missing in the areas where the tumor was in the form of interlacing strands and glandular / tubular structures ) . a final diagnosis of bcc - mh ( adenoid and pigmented ) was rendered on histopathology . bcc is a common type of skin cancer localized on face , making up more than 80% of the nonmelanoma cancers . cytological diagnosis of bcc is reliable if sufficient material is aspirated and characteristic cytomorphological features are present . problem arises in situations where clear - cut diagnostic features are not evident as was seen in one of our cases . on histopathology , we found predominantly adenoid bcc with few other patterns pigmented and micronodular . the incidence of bcc - mh varies from 19 to 43% . cytological differential diagnoses in our case included tumors containing small basaloid cells , i.e. , bcc , adenoid cystic carcinoma ( acc ) , small cell neuroendocrine carcinoma , and atypical melanocytic lesion of inconclusive category . acc shows cohesive three - dimensional clusters and finger - like tissue fragments , and hyaline globules surrounded by tumor cells . the fragments show intense crowding and overlapping of small hyperchromatic irregular nuclei , some of which have conspicuous nucleoli . small cell neuroendocrine carcinoma has more dispersed atypical cells exhibiting nuclear molding with marked pleomorphism , mitoses , and necrosis . none of these lesions is pigmented . cytomorphological features that help in excluding the diagnosis of dysplastic nevus include small , uniform basaloid cells having hyperchromatic nuclei without nucleoli and lack of pleomorphism . large epithelioid cells having moderate - to - abundant cytoplasm , intracytoplasmic melanin , vesicular nuclei with conspicuous nucleoli and marked pleomorphism , and maturation into neural cells are some of the morphological hallmarks of a melanocytic lesion . classical cytomorphological features of bcc include cohesive clusters and syncytial branching fragments of basaloid tumor cells surrounded by basement membrane - like stromal matrix . cells are uniform , round - to - oval , have scant cytoplasm , coarsely granular chromatin , and inconspicuous nucleoli . smooth external contours of club - shaped epithelial fragments along with peripheral palisading of the nuclei are a striking feature of bcc . intracytoplasmic brown black pigment ( melanin ) is often seen in the tumor cells in the pigmented variant of bcc . on review of histopathology slides in case 1 , we found the aspiration site as indicated by fnac needle track in the center of the tumor , which lacked peripheral palisading . we infer that chances of getting characteristic nuclear palisading might be higher if aspiration is done from the periphery of the tumor nodule . basaloid hyperchromatic cells and nuclear palisading are important features for a definitive diagnosis of bcc on fna . evidence of glandular differentiation along with melanin production on cytology smears were suggestive of mixed ( adenoid and pigmented variants ) histology bcc . one of them could not be confidently diagnosed on fnac due to the lack of characteristic nuclear palisading , and the presence of abundant melanin and stromal matrix . if the predominant pattern is adenoid bcc , nuclear palisading may not be always evident on cytology smears . this holds particularly true if aspiration is done only from the center of the lesion as was seen in case 1 . both of our cases highlight the problems one might encounter in the diagnosis of bcc on cytology , the plausible explanation and the precautions to keep in mind to avoid misdiagnosis .
cutaneous basal cell carcinoma ( bcc ) is a slow growing locally aggressive malignant tumor . it is usually diagnosed on histopathological examination of the excised biopsy . recently , fine needle aspiration cytology ( fnac ) is emerging as a simple alternative technique for rapid diagnostic work of nodular and plaque - like skin lesions . we report the cytomorphological features of two cases of cutaneous bcc having unusual clinical presentation and mixed histology ( mh ) ; emphasizing the diagnostic difficulties encountered on cytology , the plausible explanation and the precautions to keep in mind to avoid misdiagnosis .
in recent years , the world has rapidly entered into an aging society . neglected diseases and illnesses have been continuously detected as our society is aging . like the condition that progresses very slowly in an elderly woman at an old age of over 90 , a number of problems may arise in treatment and decision - making . since the progression speed of borderline ovarian tumor ( bot ) is very slow and its prognosis and management are distinctively different from those of invasive ovarian cancer , this condition has to be accurately diagnosed.1 bots most commonly occur in young adults in 20s and 30s , and are also known to be common in nulliparous women . the authors experienced an elderly 93-year old woman with mucinous bot associated with severe abdominal pain . a 93-year old woman was suspected of ovarian mass 2 years ago under a diagnosis of huge ovarian mass at the age of 91 and was recommended for inpatient care and surgical treatment . however , the patient was discharged at the time of the first visit , since her family resisted getting any treatment due to old age . she did not undergo any treatment for 2 years , and she re - visited our emergency unit due to severe abdominal pain and vaginal bleeding and admitted to our hospital for surgical treatment after taking computed tomography ( ct ) and magnetic resonance imaging ( mri ) scans at a primary care center nearby . she had no specific family history , but had a history of hypertension . on admission , she had a blood pressure of 140/90 mmhg , a heart rate of 70 beats / min and a body temperature of 36.3. her height was 150 cm and weight was 40 kg . she was associated with distended abdomen and pain to touch . her laboratory findings revealed a low hemoglobin level of 8.3 g / dl , a hematocrit of 25.3% , and a slightly elevated white blood cell count of 15,320/mm . the results of routine chemical test , blood coagulation test and liver function evaluation were normal . compared to test results from 2 years ago , the test for serum tumor markers revealed an elevated level of cancer antigen ( ca)-125 from 27.3 u / ml to 111.6 u / ml ( normal range 0 - 35 ) , and an elevated level of ca 19 - 9 from 146.3 u / ml to 831.3 u / ml ( normal range 0 - 27 ) . the level of carcinoembryonic antigen ( cea ) , a tumor marker was slightly elevated at 5.24 ng / ml ( normal range 0 - 4.7 ) . the results of chest x - rays were normal , and the size of pelvic mass enlarged from 8 cm on the first visit 2 years ago to 15 cm on pelvic ultrasonography . abdominal and pelvic ct revealed a large volume of ascites in the abdomen , and a 15-cm firm and mobile mass was palpated above the symphysis pubis . mri scans presented a 15-cm inhomogeneous mass with a large volume of ascites , and many septa and nodules were detected within the tumor ( fig . 2 ) . considering patient 's old age , collaborative practice was carried out between cardiology and pulmonology departments before surgery . anesthesia and operation were performed carefully to avoid extended operation time and volume overload . for open abdominal surgery , the mass originated from left ovary and its size was 16.5 12.0 9.5 cm . the mass had traces of rupture , the volume of ascites was about 2,500 cc , and hemoperitoneum was seen in the cecum . the patient had atrophic uterus and right ovary , but no specific finding of abdominal adhesion was found . there were no specific findings suspected of tumor metastasis in the peritoneum , greater omentum , intestines , mesentery and others . to minimize anesthesia and operation time considering patient 's old age , frozen section biopsy was not performed with the consent of patients ' family . to remove ovarian mass , only left salpingo - oophorectomy was done . after the surgery , the patient was treated in intensive care unit for 3 days ( fig . the left ovarian mass was sized 16.5 12.0 9.5 cm and weighed 980 g. the fallopian tube was attached and the mass had the finding of rupture . the outer surface of multilocular mass was whitish gray and smooth , and the inner surface was smooth and filled with gelatinous contents . the wall thickness of septum was relatively thin , less than 0.1 cm , and the fallopian tube was 15.5 cm in length and 0.3 cm in diameter ( fig . 4 ) . the final diagnosis was confirmed as mucinous bot in the left ovary . she was treated with anemia because of a decreased hemoglobin level of 8.6 g / dl and a hematocrit of 25.8% . she is relatively healthy with no specific symptom and currently under outpatient follow - up . bots were first described by taylor in 1929 and have been termed as proliferative lesions , intermediate tumors and others . bots were defined as ovarian tumors of low malignant potential by the world health organization ( who ) in their 1973 classification of ovarian tumors , and since then , the who has called them bots.2 although bot of the ovary is characterized by the cytologic features of malignancy , they have no infiltration to surrounding tissues , very slow clinical progression and relatively favorable prognosis . even though bot may progress to carcinomatosis in the abdominal cavity , metastasized tumor nodules are mostly tissue flaps without infiltration to surrounding tissues , and invasive lesions are rarely detected . since invasive lesions generally have a poor prognosis , additional chemotherapy may be warranted.3 bots are histologically divided into serous , representing 65% of all the bots , and mucinous type , comprising 32% of all the bots , according to the clinical features of the epithelia . mucinous bots are subdivided into intestinal type ( 90% ) and mllerian ( endocervical - like ) type . unlike benign tumors , proliferative papillary projections within the cyst are present , but fewer than in malignant tumors . firm part appears in about half of the tumors , but bleeding , necrosis and other common symptoms of malignant tumors are rarely seen . mucinous epithelium proliferates into 2 and 3 layers , there is less mucus than in malignant tumor , cells appear irregular , and cell division is observed . however , there is no stroma infiltration . when diagnosing mucinous bots , poor - differentiated cells are often present around well - differentiated mucinous epithelial cells . thus , for accurate diagnosis of bots by excluding malignant tumors , it is important to perform biopsy using a large number of cross - sectional images in order to exclude malignant tumor parts.4 even though bots generally affect nulliparous young women in 20s and 30s , this case reports a rare occurrence of the tumor detected in an elderly 93-year old woman . clinical symptoms are abdominal distension and pain , palpation of mass , vaginal bleeding and others , but on occasion , this tumor could be accidentally detected asymptomatically.5 in this case report , the patient was admitted through the emergency room due to recently developed abdominal distension , severe abdominal pain and vaginal bleeding on the day of admission . bots are usually diagnosed based on the outcomes of laparotomy and histopathological examination . in case of preoperative detection of masses many papillary projections or septa were formed in bots . when diagnosis of bots is difficult based on the results of sonography , mri is useful aid for differential diagnosis . ct is a useful imaging tool in detecting the presence of lesions in the abdomen and positron emission tomography ( pet ) imaging can be also performed . massive ascites , clear borderline , multiseptated mass , and high - contrast solid components are observed in ct scans , and the clinical findings of depression may be associated in the intestines , liver , pancreas and other organs in the abdominal cavity.6 pet imaging has limitations in diagnosing low - grade mucinous lesions , but is useful in determining the presence of metastasis and recurrence.7 the levels of ca-125 , a tumor marker , may increase in more than 50% of patients with ovarian tumors and have mainly elevated in patients with serous ovarian tumors . in case of mucinous type , elevated ca 19 - 9 have been reported in about 50% of patients and cea levels may also increase , and these findings are helpful in predicting postoperative mortality rate.89 in this case report , ca 19 - 9 level was elevated to 146.3 and cea level was also raised to 5.24.1011 after surgical removal of tumors , frozen section biopsy is performed in the operating room to determine benignity or malignancy . however , frozen section has limitations in diagnostic accuracy , and frozen section findings of large masses , in particular , may not align with the final results of biopsy.12 for the patient in this case report , frozen section biopsy was not performed to minimize anesthesia and operation time considering patient 's old age . when fertility preservation is not a consideration , cytoreductive surgery and staging surgery or follow - up are carried out like ovarian cancers . standard treatment of bot is surgical removal , and histopathological characteristics , fertility preservation ( age ) , stage , prognosis factors and others need to be considered in choosing a surgical procedure . the adequate staging of bots is performing omentectomy , complete resection of suspected lesions and peritoneal biopsy after a thorough examination and irrigation of the abdominal cavity.13 bots generally occur at a younger age , progress slowly , and have relatively favorable prognosis . since bots usually affect women of reproductive age at young ages and are recurrent tumors , and patients may die due to the progression of the disease in later stages , surgical methods such as staging and postoperative management remain highly controversial . in recent years , studies on the risk of hereditary ovarian tumors have been presented based on the clinical and immunohistochemical correlates of brca1 and brca2 genes.14 the authors experienced an elderly woman with mucinous borderline tumor of the ovary , and we report the case with a brief review of literature . as our country has entered into the aging society , the occurrence of ovarian tumors has been frequently reported in older women , and as a result , surgery is anticipated to increase.1516 therefore , obstetric and gynecologic diseases that could develop at an older age should be taken into consideration and appropriate treatments are warranted to prepare for an aging population .
mucinous borderline ovarian tumors ( bots ) occur most often in women between the ages of 20 and 30 . early - stage detection of the condition has a more favorable prognosis . in this case report , the authors present an elderly 93-year old woman who visited our hospital due to severe abdominal pain after being diagnosed with a pelvic mass 2 years ago and not undergoing any treatment since the diagnosis was made . she underwent emergency left salpingo - oophorectomy and was diagnosed with mucinous bot according to biopsy results .
in general consideration of cervicofacial skeleton , the hyoid bone tends to be overlooked or is given scant attention . however , it is associated with several important functions of the human body such as deglutition , phonation , and respiration . orthodontic myofunctional therapy has the potential to affect the hyoid bone by altering the mandibular position . certain studies have been conducted pertaining to change in hyoid bone position from childhood to puberty , while others have correlated the posture of hyoid with mandibular morphology and its position in various skeletal types . effects of orthodontic and orthognathic surgical procedures on hyoid bone position have also been reported . however , very few studies have evaluated change in hyoid bone position after treatment with functional appliance . also , no single study has reported the correlation between change in hyoid bone position and pharyngeal space with functional appliance . thus , this study was designed to evaluate the association between change in hyoid bone position with twin block appliance therapy and its effect on the dimensions of pharyngeal spaces . the present study was conducted on 40 subjects ( 22 girls and 18 boys ) of angle 's class ii division 1 malocclusion treated with twin block appliance in the department of orthodontics and dentofacial orthopaedics , faculty of dental sciences , chhatrapati sahuji maharaj medical university , lucknow . the subjects included were in the age range of 1014 years ( with the mean age of 11.391.07 years for girls and 13.010.30 years for boys ) with angle 's class ii division 1 malocclusion , anb angle greater than 4 with deficient mandibular body length ( < s subjects who had any anomaly of cervical vertebra , known history or symptoms of temporomandibular joint disorder , history of any previous orthodontic treatment , or syndromic conditions were excluded from this study . lateral radiographs were taken before and after the treatment withinstrumentarum cephalometer ( rotograph plus , bologna , italy ) . all subjects were positioned in the cephalostat with the sagittal plane at a right angle to the path of the x - rays , frankfort plane parallel to the horizontal plane , teeth in centric occlusion , and the lips relaxed . during exposure of the x - ray , subjects were guided to stand still with the mandible in relaxed position to ensure that no strain or change in head posture occurred while the head was fixed in the cephalostat . kodak x - ray films ( 8 10 ) were exposed at 80 kvp , 10 ma for 0.8 s from a fixed distance of 60 inches by following the standard technique employed . the lateral head cephalograms were traced on acetate tracing sheets 0.5 m in thickness using a sharp 4h pencil on a view box using transilluminated light in a dark room . any stray light dispersion was eliminated by covering the margins of the view box with a black paper , leaving only that part which is required for radiograph visibility . each cephalogram met the following essential requirements : good definition of hard and soft tissue structuresteeth in centric occlusion . if the right and left structural outlines were lacking in superimposition on each other , then the average between the two were drawn by intersection and the cephalometric points were located in reference to the arbitrary interrupted line so obtained . the linear and angular measurements were then made to the nearest 0.5 mm and 0.5 , respectively , with the help of scale and protractor . all measurements were recorded by the same operator and were reviewed twice by other investigators for accurate landmark identification . all subjects were divided according to schudy 's facial divergence angle ( sn - mp ) [ figure 1a ] into three groups , i.e. hypodivergent , normodivergent , and hyperdivergent [ table 1 ] , as this angle is more accurate . as it was shown in previous studies that there is no sexual dimorphism in hyoid bone position , any further subgrouping into male and female was not considered in the present study . previous studies have used various methods to evaluate hyoid bone position utilizing various cranial structures to define reference planes from which hyoid bone position was measured . these cranial reference planes are relatively far from the hyoid bone , thus a small variation in the position or inclination of the reference plane would result in much greater apparent variation in hyoid bone , whether the hyoid bone position changed to that extent or not . however , in this study , a new method was used to evaluate hyoid bone position with the use of reference planes which are relatively nearer to the hyoid bone . landmarks , planes , and measurements used in the study are shown in figure 1 and table 2 . ( b ) measurements used in the study mean and standard deviation for measurements in group i , group ii , and group iii description of landmarks , planes , and measurements used in the study measurements analyzed were related to horizontal and vertical change in hyoid bone position . b , hy me , and hy cl , out of which hy b and hy me represent the movement of hyoid bone with respect to mandible . positive values of these two mean movement of mandible in forward direction was more than that of the hyoid bone . width of upper pharynx and width of lower pharynx were used to determine the changes in pharynx . the data obtained were subjected to the statistical analysis using statistical package program stata version 9.2 . descriptive statistics , including the mean and standard deviation values , were calculated for all the measurements in each group [ table 1 ] . student 's t - test was used to determine the significant differences between the pre- and post - treatment values of various measurements in the three groups . mean difference of pre- and post - treatment values of all measurements in each group was subjected to analysis of variance ( anova ) test to determine if any significant difference was present between the three groups . bonferroni post hoc test was then used to find out significant differences between the three groups [ table 3 ] . reliability of measurements was tested by doing double determinations of 12 radiographs randomly selected at 15 days interval from the collected sample by the same operator and comparison was drawn between first and second determinations by student 's t - test . the data obtained were subjected to the statistical analysis using statistical package program stata version 9.2 . descriptive statistics , including the mean and standard deviation values , were calculated for all the measurements in each group [ table 1 ] . student 's t - test was used to determine the significant differences between the pre- and post - treatment values of various measurements in the three groups . mean difference of pre- and post - treatment values of all measurements in each group was subjected to analysis of variance ( anova ) test to determine if any significant difference was present between the three groups . bonferroni post hoc test was then used to find out significant differences between the three groups [ table 3 ] . reliability of measurements was tested by doing double determinations of 12 radiographs randomly selected at 15 days interval from the collected sample by the same operator and comparison was drawn between first and second determinations by student 's t - test . the values of hy me and hy b increased significantly in group i and increase in hy the value of hy gome and hy chl decreased in all three groups , but was significant only in group i. width of upper pharynx increased in all three groups , but increase in group iii was highly significant , in group ii was moderately significant , and in group i was just significant there was no significant change in the width of the lower pharynx although it was highest in group iii and lowest in group i. value of anb decreased in all three groups after treatment , which was highly significant in all groups . the results for all cephalometric measurements are shown in tables 1 , 3 , and figure 2 . student 's t - test for each group , statistical comparisons ( anova ) of measurements among different groups , and inter - group comparison ( bonferroni post hoc test ) comparison of mean differences and standard deviation of measurements among three groups from normal position ( occupies a constant position opposite the third and fourth cervical vertebrae ) , the hyoid bone is displaced quite superiorly and posteriorly in class i and class ii malocclusions and the degree of displacement is more in the latter . today the concept of dentofacial orthopedics to stimulate the mandibular growth in skeletal class ii cases with mandibular deficiency is widely used due to the fact that the functional orthopedic treatment in such patients leads to increase in oral airway dimensions , thereby reducing the risk of respiratory problems in future . twin block given by william clark is the most common functional appliance for treatment of angle 's class ii division 1 subjects , which effectively modifies the occlusal inclined plane to induce favorably directed occlusal forces by causing functional mandibular displacement . as the hyoid bone is attached to the mandible through the muscles , change in mandible position also changes the position of hyoid bone . as there is a tendency of compromised oropharyngeal airway in angle 's class ii malocclusion , with hyoid bone being the anterior boundary of this airway , there is a need to define its position in this type of malocclusion before and after the treatment . the age group of 1014 years was considered in this study because this age group represented a period of active growth and development of craniofacial complex , which is a foremost requirement for the twin block therapy . anteroposterior movement of the hyoid bone with respect to the mandible is represented by hy me and hy b and with respect to cervical vertebrae by hy increased values of hy me and hy b measurement means the mandible is moving anteriorly from the hyoid bone . in this study , in group i , hy me and hy b were significantly increased because the relative anterior movement of mandible was more than that of the hyoid bone after functional appliance therapy , though the hyoid bone also moved anteriorly with respect to the pharyngeal airways , which was shown by increase in hy cl . this was supported by bettagel , who found hyoid became farther from point b and point me in obstructive sleep apnea patient after using mandibular protrusion appliance . cl was the highest in group iii , which signified the greatest anterior movement of hyoid bone with respect to cervical vertebrae , leading to increase in airway . but there was no significant difference between the three groups with respect to hyoid bone position alteration in horizontal dimension . yassaei and soroush did a similar study in horizontal , normal , and vertical growth patterns and found that the forward movement of hyoid bone in horizontal and normal growth directions was moderately significant and in vertical growth direction was highly significant . this may be explained by the fact that as the hyoid bone is attached to the mandible by geniohyoid , mylohyoid , and the anterior belly of digastric muscles which are responsible for downward movement of the mandible , treatment with functional appliance results in hyperactivity of these muscles . therefore , the balance between the suprahyoid and infrahyoid muscles is disturbed , resulting in upward movement of hyoid bone , while forward mandibular displacement occurs with functional appliance therapy . the decrease in these values was significant in group i and least in group iii . this may be explained by the fact that as we move from group i to iii , the hyoid bone is positioned more posteriorly and superiorly , which encroaches the airway and the pharyngeal size and has the least amount of displacement in the upward direction . similar results were reported by yassaei and soroush and bettagel et al . in their studies . in all three groups , the value of width of upper pharynx was increased , but no significant changes were found in lower pharynx . however , treatment with twin block appliance was associated with mandibular advancement and forward posturing of tongue which relieved the pressure on the soft palate , thus leading to an increase in oropharyngeal dimension and improved airway permeability . the large increment in group iii might be explained by the fact that in this group the airway was more compromised and narrower than in the other two groups . hence , more compensation takes place in the soft palate with the advancement of mandible . bonham also reported a mean increase of 2.76 mm in the superior airway space after modified functional appliance therapy . probably this reduction was because the advancement of mandible with twin block decreased the overjet and increased the value of snb . hence , functional appliances such as twin block are used in developing class ii division 1 malocclusion not only to improve facial esthetics but also to increase the pharyngeal airway space along with a favorable hyoid bone position . the following conclusions were drawn on the basis of the findings of this study : there was no significant difference between the three groups with respect to hyoid bone position alteration in horizontal dimension , but was the highest in hyperdivergent groupupward hyoid bone displacement in relation to mandibular plane was found to be highly significant in hypodivergent group as compared to the other groups , following treatment with twin block appliancewidth of upper pharynx measured from a point on the posterior outline of the soft palate ( upper half ) to the closest point on the posterior pharyngeal wall was found to be significantly increased in all three groups after treatmentthere was no significant change in the width of the lower pharynx although it was the highest in group iiianb was found to be significantly decreased in all three groups after treatment . there was no significant difference between the three groups with respect to hyoid bone position alteration in horizontal dimension , but was the highest in hyperdivergent group upward hyoid bone displacement in relation to mandibular plane was found to be highly significant in hypodivergent group as compared to the other groups , following treatment with twin block appliance width of upper pharynx measured from a point on the posterior outline of the soft palate ( upper half ) to the closest point on the posterior pharyngeal wall was found to be significantly increased in all three groups after treatment there was no significant change in the width of the lower pharynx although it was the highest in group iii anb was found to be significantly decreased in all three groups after treatment .
objective : to evaluate the position of hyoid bone in the subjects treated with twin block appliance.materials and methods : the sample consisted of 40 angle 's class ii division 1 subjects treated with twin block appliance . lateral radiographs were taken before and after treatment . according to schudy 's facial divergence angle ( sn - mp ) , the subjects were classified in to three groups : group i ( hypodivergent , sn - mp : < 31 ( 27-30 ) , n=15 ) , group ii ( normodivergent , sn - mp : 31-34 , n=15 ) , and group iii ( hyperdivergent , sn - mp : > 34 ( 3538 ) , n=10 ) . lateral cephalograms were traced and analyzed manually . after measurements of variables , student 's t - test and one - way analysis of variance ( anova ) were performed.results:post treatment with twin block therapy , hyoid bone shifted significantly ( p<0.01 ) forward in horizontal dimension in all three groups , although it was highest in group iii . however , there was no significant difference amongst the groups . in vertical dimension , hyoid bone shifted in upward direction in all three groups ; however , the shift was significant ( p<0.01 ) only in group i and there was a significant difference between group i and rest of the two groups . width of upper airway significantly ( p<0.01 ) increased and anb angle significantly ( p<0.001 ) decreased in all three groups with forward movement of mandible.conclusions:after treatment with twin block appliance , significant changes occurred in horizontal dimension ( anterior displacement ) , which resulted in significant increase in width of upper pharynx in all three groups .
cutaneous leishmaniasis ( cl ) is a major public health problem in many countries . however , there are many topical and systematic treatments for cl . at present , pentavalent antimonials are still the first drug of choice for the treatment of cl ( 1 ) . systemic administration of pentavalent antimonials has been associated with such adverse reactions as musculoskeletal pain , gastrointestinal disturbances , and mild to moderate headaches . electrocardiographic qt interval prolongation and a mild to moderate increase in liver and pancreatic enzymes are other adverse effects of pentavalent antimonials nonetheless , acute urticaria in infants has never been reported to be associated with maternal use . here we report a case of an infant presenting with acute urticaria after her mother s parenteral use of meglumine antimoniate ( glucantime ) for the first time . in november 2015 , a 34-yr - old breast - feeding woman from gonbad city of iran presented with a lesion on the anterior region of her abdomen that lasted about 60 days . the lesion first appeared as a small red papule and then progressed to an ulcer . it was a firm , non - tender , well - defined lesion , which measured 4 cm 3 cm in diameter . a slit - skin smear from the edge of the ulcer with giemsa stain showed leishman bodies within the macrophages , which confirmed the diagnosis of cutaneous leishmaniasis . the patient was treated with a weekly cryotherapy regimen and intralesional injections of glucan - time . the patient was discontented with no sign of improvement with the prescribed medications and interventions after three wk . as a result , the treatment was changed to glucantime at a dose of 20 mg / kg - body weight intramuscularly for two wk . for our patient weighing 95 kg , we prescribed 3 vials per day for 14 d ( according to the national guidelines for leishmaniasis surveillance in iran-2012 ) . a day after the start of systemic therapy , the patient brought her fifteen - month - old breast - feed infant with urticaria and malaise but without eosinophilia ( 1cells / mm ) . with an elevated liver enzyme sgot level ( 46 iu / l , normal range is up to 31 iu / l ) ; the infant s vital signs were normal . the physical examination results were normal except for urticaria , which was dominant on the abdomen , back and thighs ( fig . 1 ) . both the mother and the infant had no history of exposure to any alternative causes other than glucantime . the mother was advised to discontinue breastfeeding for two week and the infant to receive a single dose of antihistamine ( 2.5 mg cetirizine per oral ) . the symptoms resolved within 24 h , during which the urticaria disappeared and malaise was alleviated . with slow but definite improvement of the lesion , urticaria , obvious on the abdomen , back and thighs of the patient ( original ) two pentavalent antimonial drugs , sodium stibogluconate ( pentostam ) and glucantime , have been the drugs of choice for the treatment of cutaneous leishmaniasis for over 50 yr . in spite of their wide use for half a century , relatively little is known about their chemical structures and mechanism of actions ( 4 ) and , up until now , new side effects have been reported as a result of their use . in our case , the occurrence of adverse drug reaction and its successful management after discontinuing the drug points to the unwanted effects of glucantime as non - pharmacological causes were not found to have generated the reaction . we could not find any report of acute urticaria in infants associated with the mother s parenteral use of glucantime . this included a search on lactmed ( a toxnet database ) which led to no records being found ( 5 ) . hence , this is the first reported case of urticaria in infants due to the mother s parenteral use of glucantime . it is recommended that mothers discontinue breastfeeding and avoid taking glucantime in systemic doses because of adverse effects on their infants . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .
pentavalent antimonials are still the first drug of choice for the treatment of cutaneous leishmaniasis ( cl ) . like other treatments , they can cause adverse reactions including musculoskeletal pain , gastrointestinal disturbances , and mild to moderate headaches . in this paper , we report the first case of an infant who developed acute urticaria after her mother s parenteral use of meglumine antimoniate ( glucantime ) .
metaplastic breast cancer is a rare entity , with an incidence of less than 0.1 - 0.5% of all breast malignancies . neurofibromatosis type 1 ( nf1 ) is an autosomal dominant multisystem disorder affecting 1 in 3500 people . it is associated with multiple neoplasms such as optic gliomas and peripheral nerve sheath tumors , but is rarely associated with breast cancer . a study by sharif et al . , has shown that women with a history of nf1 have a fivefold increased risk of breast cancer . so far , only two cases of metaplastic carcinoma in patients with nf1 have been described in the english literature . we present a case of metaplastic breast cancer with keratinizing squamous histology in a patient with history of nf1 . the imaging findings of metaplastic breast carcinoma and the association between metaplastic breast cancer and neurofibromatosis are reviewed and discussed . a 46-year - old female with history of nf1 presented with a new self - discovered left breast mass . her cutaneous neurofibroma was diagnosed after removal of two of her skin lesions with one on her ankle and the other one on her shoulder . the patient reported that her father had neurofibromatosis , but there was no family history of breast cancer . approximately 8 cm large mass was palpated in the central left breast on physical examination . mammogram showed a large , centrally located left breast mass associated with microcalcifications measuring 10 10 9 cm [ figure 1 ] . the skin lesions ( neurofibromas ) were indicated by the circular - shaped radiopaque skin markers consistent with patient 's known neurofibromatosis . ultrasound of the subareolar left breast showed a large circumscribed mass , with central necrosis and irregular peripheral solid components [ figure 2 ] . an enlarged left axillary lymph node was also identified , measuring about 1.6 0.8 1.4 cm [ figure 3 ] . the lesion was classified as breast imaging reporting and data system ( bi - rads ) 4 . ultrasound - guided core biopsy was performed on the breast mass and axillary lymph node . pathologic examination of the breast mass showed metaplastic breast carcinoma with keratinizing squamous histology [ figure 4 ] . the neoplastic cells overexpressed human epidermal growth factor receptor 2 ( her2 ) ( 3 + ) and were negative for estrogen receptor ( er ) and progesterone receptor ( pr ) . breast magnetic resonance imaging ( mri ) was then performed , which demonstrated a large heterogeneous mass with low t1 and high t2 signals and nodular peripheral rim enhancement [ figure 5 ] . the small enhancing nodules ( neurofibromas ) on the skin were consistent with the patient 's known neurofibromatosis [ figure 5 ] . computed tomography ( ct ) of chest , abdomen and pelvis as well as bone scan studies demonstrated no distal metastasis or other disease related to nf1 except numerous cutaneous neurofibromas throughout the body . the staging method used was american joint committee on cancer ( ajcc ) 7 edition , and this showed a clinical stage iiia . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . mediolateral ( a ) oblique and ( b ) craniocaudal views of left breast mammogram demonstrate a large , relatively circumscribed mass ( arrows ) adjacent to a dot - shaped radiopaque skin marker to indicate the palpable area in the central left breast . circular - shaped radiopaque skin markers were placed to indicate the skin lesions ( neurofibromas ) which are consistent with patient 's known neurofibromatosis . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . targeted breast ultrasound on the palpable area in the central left breast demonstrates a large heterogeneous mass with central necrosis ( solid arrow ) and peripheral irregular solid components ( dashed arrow ) with doppler flow . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . ultrasound of the left axilla showed an enlarged axillary lymph node ( arrow ) with eccentric thickened cortex . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . microscopic examination of the core biopsy ( hematoxylin and eosin stain , 200 ) reveals solid sheets of neoplastic cells with squamous differentiation ( arrows ) , diagnostic of metaplastic breast carcinoma with keratinizing squamous histology . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . breast mri with ( a ) t1-weighted , ( b ) short tau inversion recovery ( stir ) , and ( c and d ) subtraction post - contrast images demonstrate a large mass ( long arrows ) in the central left breast with low t1 ( a ) , high t2 ( b ) , and rim - like enhancement ( c ) . small enhancing nodules ( neurofibromas ) ( short arrows ) are also noted at the skin of the left breast , consistent with patient 's known neurofibromatosis ( d ) . breast mri , performed after the patient completed 8 cycles of neoadjuvant chemotherapy , demonstrated significantly decreased tumor size , peripheral rim enhancement [ figure 6 ] , and axillary lymphadenopathy . pathologic analysis of the mastectomy specimen demonstrated a minute focus of residual viable metaplastic carcinoma ( 0.03 cm ) in a 6.1 cm necrotic tumor bed with near - complete response . one year later , a prophylactic right skin - sparing mastectomy was performed due to her elevated breast cancer risk with nf1 . at follow - up 12 months after the initial diagnosis , the patient is without evidence of recurrent disease or distant metastasis . 46-year - old female with history of neurofibromatosis type 1 presented with left breast mass diagnosed as metaplastic breast carcinoma . breast mri status post chemotherapy with subtraction post - contrast image shows significantly decreased size and rim enhancement of the mass ( arrow ) in the left breast . metaplastic breast carcinoma is a subtype of breast carcinoma that exhibits a non - glandular growth pattern . the non - glandular histology can be epithelial ( e.g. squamous as in our case ) or mesenchymal ( e.g. spindled , sarcomatous , chondroid , or osseous ) . metaplastic carcinoma is challenging on core biopsy for pathologists due to its non - glandular histology . the differential diagnosis often includes sarcoma , melanoma , malignant phyllodes tumor , and squamous cell carcinoma depending on the particular histology . the tumor tends to be greater than 3 cm at presentation , which is usually in stage ii or iii . lymph node involvement is less common with the rate of involvement ranging from 13% to 54% . these tumors tend to have a lower expression of er , pr , and her2 compared to invasive ductal carcinoma and more often occur in women older than 50 years . this is in contrast to our case , in which the patient was 46 years old , premenopausal , and her2 positive . on mammography , this entity tends to be more circumscribed than typical invasive ductal carcinoma , although occasionally may demonstrate ill - defined or spiculated margins . microcalcifications are overall less common than in invasive ductal carcinoma . on sonography , they may be round or lobular shaped , circumscribed to ill - defined masses . , metaplastic breast carcinoma tends to have high t2 signal , thought to be due to mucoid contents and/or necrosis . the most common pattern on post - contrast images is heterogeneous enhancement , with the second most common pattern being rim - like enhancement such as the tumor in our case . the treatment option for metaplastic breast carcinoma is determined by the stage of the tumor . as these lesions tend to be large at detection , they are usually treated with a combination of surgery , chemotherapy , and radiation , as in our case . the prognosis of metaplastic breast carcinoma is generally considered worse than that of other breast cancers . neurofibromatosis is an autosomal dominant disease , with mutations in the neurofibromin 1 gene , which is located in chromosome band 17q ii.2 and encodes the protein neurofibromin , a tumor suppressor and a negative regulator of the rat sarcoma ( ras ) signal transduction pathway . a variety of neoplasms have been reported in patients with nf1 , including cutaneous neurofibroma , plexiform fibromas , optic gliomas , astrocytomas , and pheochromocytomas . a few recent studies have suggested that there may be an increased risk of breast cancer in patients with nf1 . the breast cancer gene 1 ( brca1 ) is located on the long arm of chromosome 17 . although gran and safali have suggested a possible interaction between these two genes , the link between the two genes is not quite clear yet and more studies are needed to address it . in our case , brca testing was not performed on the patient probably due to the fact that no other family member presented with breast cancer . our case is the third case report of metaplastic breast cancer in an nf1 patient . since it is difficult to address the association of a particular subtype such as metaplastic breast cancer with nf1 from this single case , further studies on the molecular mechanisms and association of breast cancer , including metaplastic breast cancer , with neurofibromatosis are needed . in addition , awareness of the increased risk of breast cancer in patients with neurofibromatosis with close surveillance , prevention , and management is recommended . further exploration of the role of neurofibromin 1 gene in the oncogenesis of breast cancer , including metaplastic breast cancer , is needed .
metaplastic breast cancer is a rare malignancy in the breast . neurofibromatosis type 1 is an autosomal dominant multisystem disorder associated with multiple neoplasms such as optic gliomas and peripheral nerve sheath tumors . the association of breast cancer with neurofibromatosis is very rare . we present a case of a metaplastic breast cancer in a patient with type 1 neurofibromatosis . the patient presented with a palpable mass in her left breast with suspicious findings on mammogram and ultrasound . ultrasound - guided percutaneous biopsy showed metaplastic breast carcinoma with metastasis to an axillary lymph node . this is the third case report in the english literature to show metaplastic breast carcinoma in a patient with type 1 neurofibromatosis . in this report we review recent literature and discuss the association between these two entities .
the introduction of national mammographic screening programmes and the increasing use of digital mammography and mri have dramatically changed the clinical presentation of dcis . prior to this , dcis made up a small proportion of all breast malignancy and was only diagnosed in patients presenting with a palpable mass , pathological nipple discharge , or occasionally found as an incidental biopsy finding [ 1 , 2 ] . in contrast , it is now most frequently identified in asymptomatic women with screen - detected micro calcifications and makes up a larger proportion of breast malignancy . although the rates of all breast malignancy have increased with time , between 1980 and 1995 , western countries have experienced a four - fold increase in the incidence of dcis specifically , particularly in women of screening age . data from a systematic review of 374 studies reported the pooled incidence of dcis in the early 1970s as 5.8/100000 and this had risen to 32.5/100000 in 2004 . a higher proportion of the cases post screening were non comedo dcis , which is considered less aggressive . screening and cancer registry data from norway including 2.3 million women reported in 2010 showed an increase in incidence of dcis from 4/100000 before the introduction of screening to 11/100000 postintroduction . in women of screening age , the proportion of dcis within breast malignancy rose from 5% to 13% . age - standardised rates of all breast cancer including dcis increased over time in those of screening age , but a large peak at the point screening was introduced , subsequent drop in incidence ( but not to prescreening levels ) , then a steady climb over time . these studies seem to suggest that the introduction of screening is largely responsible for the apparent increased incidence of dcis in recent times , but that the stage of the disease may be much earlier and possibly less clinically relevant . the trend is likely to continue with further technological advances , including the transition from analogue to full - field digital mammography ( ffdm ) and the development of computer - aided detection ( cad ) . although the role of mri in the management of dcis is yet to be fully evaluated by randomised trials , it is being used to assess disease extent and distribution and to assess the contralateral breast [ 9 , 10 ] . it is also used for early detection of invasive and noninvasive breast cancer in high - risk women . a recent prospective observational study demonstrated mri to be significantly more sensitive than mammography for the diagnosis of dcis ( 92% versus 56% ) . a recent retrospective report looking at mri screening of high - risk women demonstrated an increased sensitivity of mri for dcis that was at least as good as the sensitivity for invasive disease . this study examined two time periods ( before 2001 ; 223 women and after 2001 ; 391 women ) in one unit which used mri and mammography to screen high - risk patients . after 2001 , the unit acquired additional breast coils , better methods of data processing , and staff with appropriate specialist training . in the first period , all of these were diagnosed by mri and just one of these was also seen on mammography . the specificity of mri was lower than mammography and significantly more patients were recalled for suspicious changes on mri in the second study period than the first , but there was no significant difference in the numbers of biopsies performed . figure 1 shows regional ductal enhancement in the uoq of the left breast anterior to a lumpectomy site in a 49-year - old female . this was recurrence picked up on screening mri . for example , it is limited by the fact that not all ducts are accessible from the nipple . currently , the preoperative diagnosis of impalpable lesions suspicious of dcis requires either stereotactic or mri guided core biopsy . vacuum - assisted core biopsy ( vacb ) has been shown to increase the diagnostic yield and upgrade atypical ductal hyperplasia ( adh ) to dcis in approximately 25% of cases and can be employed where standard core biopsy does not show dcis yet the radiological changes are suspicious . dcis is defined by two features : firstly , the malignant epithelial proliferation is limited by the ductal basement membrane and secondly , stromal invasion is absent . dcis behaves as a nonobligate precursor of invasive carcinoma and does not fully express the malignant phenotype . the progression to invasive breast cancer is not completely understood and can not be reliably predicted . classification systems aim to reproducibly categorise lesions and to provide prognostic information to aid management decisions . dcis may be classified by grade , by architecture or morphology , by the level of differentiation , or by systems which use a combination of these factors . conventional histopathological types include comedo ( tending to high grade cellular / nuclear features , often with central necrosis and calcification ) , solid , cribriform ( with small holes or open spaces ) , and micropapillary ( finger - like projections ) , however , lesions often demonstrate architectural and morphological heterogeneity [ 19 , 20 ] . it may vary between pathologists and protocols have been developed to standardise reporting of grade . figures 3 and 4 show the characteristic features of low- and high - grade dcis . the comedo subtype ( high - grade , central confluent necrosis , and solid architectural pattern in > 50% of the duct spaces ) and the presence or absence of necrosis are important features and are incorporated into classifications such as the van nuys index and the nottingham grade . all of the above classification methods as well as tumour size and the presence of absence of inflammatory changes have been found to be statistically associated with the risk of local recurrence in an independent pathological review of cases from the ukcccr / anz dcis trial . the natural history of small , noncomedo , low - grade dcis treated by biopsy alone has been evaluated in long - term followup studies . after a median of thirty - one years , 39% of patients developed invasive breast cancer , all of which occurred in the index quadrant and 45% of these patients died of metastatic disease . the overall progression to invasive breast cancer there is a wide body of evidence on the risk factors for breast cancer overall , but evidence on risk factors specific to dcis is limited . however , it does appear that the same factors are involved as for invasive disease ; high mammographic density , significant family history of breast - cancer , age , obesity , and high lifetime exposure to oestrogens . hence , it would seem that patients who receive no treatment beyond a diagnostic biopsy remain at significant risk of progression to invasive disease and that dcis represents a precursor of invasive cancer . increased risk has been demonstrated in lesions of all nuclear grade . on the other hand , a significant proportion of dcis lesions do not progress . as diagnostic frequency continues to increase , there is an impetus to accurately identify clinically relevant lesions in order to rationalise management . women with palpable dcis and those who present symptomatically exhibit higher rates of lr than mammographically detected cases [ 28 , 29 ] . some screen - detected lesions may , therefore , be less relevant than symptomatic lesions . one study identified a family history of invasive breast cancer as a significant predictor of lr in women with dcis treated with bcs and rt . previous therapy with oestrogens , either contraceptives or hormone replacement therapy , is also reported to be a significant predictor of lr . young age ( < 40 years ) has emerged as an independent risk factor for lr after bcs with or without adjuvant rt . lr has been reported to range from 1131% in this group , with the lowest rates in mammographically detected lesions . a meta - analysis of 44 trials has reported significantly increased pooled risk estimates for local recurrence after treatment for dcis if the disease is classified as comedo involved margins were associated with the highest increase in risk estimates and there was limited evidence that er- and pr - positive her2 negative disease is less likely to recur . in the meta - analysis , the pooled risk estimates for size were derived from 7097 women . lesions greater than 20 mm in size were compared with lesions less than 20 mm . accurate and reliable measurement of dcis can be challenging and several landmark studies have been criticised for their performance in this regard [ 29 , 35 , 36 ] . the large numbers in the meta - analysis will have helped to mitigate this factor . the same study reported the summary risk estimate for multifocal versus unifocal disease to be 1.95 ( 95% ci 1.592.40 ) from analysis of 3895 patients . it is possible that the total area of dcis in multifocal lesions is greater than unifocal disease and that the difference in local recurrence could be secondary to this . involved margins are associated with an increase in lr , in patients treated by bcs alone , and in those who also undergo rt [ 3739 ] . the presence of dcis at the surgical margin is associated with the identification of residual dcis in 4082% of reexcision specimens , and is correlated with margin width : 41% at < 1 mm , 31% at 1 - 2 mm and 0% with 2 mm of clearance . the french national guidelines recommend surgical margins of 3 mm , and reexcision for margins < 1 mm . a meta - analysis reporting the effect of margin status on local recurrence after bcs and rt concluded that a margin width of 2 mm was significantly superior to lesser margins ( odds ratio ( or ) = 0.53 , 95% ci 0.260.96 ) . however , there was no added value associated with clearance 2 mm compared to > 5 mm ( or = 1.51 , 95% ci 0.515.0 ) . despite this , total excision volume , independent of margin clearance , has also been correlated with lr . following bcs for dcis , the joint centre experience reported lr rates at 5 years of 9% and 0% for volumes excision volumes < 60 cm have been shown to increase the relative risk of lr in women under 45 years . margins were associated with the largest difference in the risk estimates for local recurrence in the meta - analysis by wang . the summary risk estimate for women with involved margins was 2.25 ( 95% ci 1.772.86 ) . high nuclear grade is associated with a greater risk of lr . in wang 's meta - analysis , 10,526 women were included in the analyses relating to grade , the summary risk estimate for high grade versus non - high - grade disease was 1.81 ( 95% ci 1.532.13 ) . the combination of nuclear grade and comedonecrosis is strongly associated with the risk of lr after bcs . in the same meta - analysis of 9332 women with dcis , the summary risk estimate of comedo - necrosis versus none for invasive breast - cancer recurrence was 1.71 ( 95% ci 1.362.16 ) . a recent population - based case - control study found that comedo - type dcis shares a similar profile of hormonal and reproductive risk factors to ibc , including 10 years of oral contraceptive intake and an inverse association with 3 full - term pregnancies . these findings were in contrast to those for noncomedo lesions , providing some further support for the differential management of dcis lesions . the significance of comedo - type as a risk factor for lr has resulted in its inclusion in prognostic indices [ 45 , 46 ] . high - grade dcis which is oestrogen receptor ( er ) and progesterone receptor ( pr ) negative is significantly associated with her2 and p53 positivity . overexpression represents an aggressive biological subtype of dcis , correlating with high grade , p53 expression , and hormone receptor negativity . hormone receptor positivity has been associated with low - grade dcis . in a recent case series , her2 was found to be superior to lesion size or nuclear grade in predicting concurrent invasive disease . dcis that overexpressed her2 was 6 times more likely to be associated with invasive disease ( or 6.4 , p = 0.01 ) . in the wang meta - analysis , higher rates of local recurrence were seen in er / pr negative , her2 , positive - patients but the differences were not statistically significant . various molecular markers have been studied in dcis as possible predictive or prognostic factors for progression to invasion or for the development of invasive recurrences . in invasive breast cancer , classifications based on biological profile ( derived from gene profiling and correlated with immunohistochemical profile ) rather than morphology have been developed and shown to correlate with prognosis . in order ; luminal a , luminal b , triple negative , and basal type invasive breast cancers are associated with a worsening prognosis . the same profiles have been demonstrated in dcis . more work is now needed to establish whether these profiles influence the likelihood that an area of dcis will progress . chromosome - wide comparative genomic hybridization has shown dcis to be a genetically advanced lesion with alterations corresponding to adjacent invasive disease and independent pathways of genetic evolution . a distinctive molecular portrait of each lesion can be obtained by gene expression profiling using complementary dna micro - arrays . one such study has identified a gene expression classifier of 35 genes which differ between dcis and ibc and a further 43 genes distinguishing well - from poorly differentiated dcis . protein expression profiling can similarly be undertaken using matrix - assisted laser desorption / ionization ( maldi ) or surface - enhanced laser desorption / ionization ( seldi ) . although the relevance of each parameter may not be fully understood , combinations of features may enable the biological profiling of dcis lesions into groups of similar natural history and prognosis . recently reported on a binary molecular grading scheme for dcis , based on expression at 173 oligo - nucleotide probes . two conventional parameters amenable to routine evaluation ( nuclear grade and ki67 score ) were capable of accurately assigning lesions into low or high molecular grade . proteomics analysis of dcis and normal breast tissue has also identified differential expression patterns , distinct from previous nucleic - acid - based studies . expression of syndecan-1 , e - cadherin , and c - met have recently been shown to be associated with angiogenic and lymphangiogenic factors in dcis , including endothelin a and b receptors , vascular endothelial growth factor ( vegf)-a / c , and fibroblast growth factor receptor ( fgfr)-1 . in addition to their potential use for prognostication , putative molecular targets may enable directed therapy in the future . intuitively , molecules such as matrix - metalloproteinases ( mmps ) and tissue inhibitors of matrix - metalloproteinases ( timps ) that influence the invasion of stroma and basement membrane should be important in the progression of dcis to invasive breast cancer . significantly different expression profiles of mmps and timps have been noted in dcis , admixed dcis , and invasive breast cancer . more work is needed to understand the role these molecules have in progression to invasive cancer but their expression profiles could help determine lesions that should be treated more aggressively . it is possible that not all dcis needs to be treated aggressively as not all dcis will become invasive . in particular , management strategies need to consider the breast and axilla , the need for adjuvant rt , and the role of systemic adjuvant therapy . treatment of the breast can involve bcs ( with or without rt ) or mastectomy ( mx ) . axillary surgery , even slnb , warrants particular caution in view of their low yield and potential for harm . complete excision of dcis with clear margins is the most important factor in reducing the risk of lr . mx is indicated for large tumours ( > 4 cm depending on breast size ) , multicentric lesions , inadequate margins after bcs , local recurrence after bcs ( particularly with prior rt ) , and patient preference . mx affords excellent local control , approximately 98% at 7 years , with an overall recurrence rate of 1.5% . in england and wales between 1990 and 2001 , the absolute number of mastectomies for in situ disease increased by 400% , corresponding to the introduction of national screening . the relative rate of mx for dcis has been decreasing over the last three decades and the procedure is now undertaken in approximately one third of patients . the french survey reported mx rates of 10% for lesions < 10 mm compared to 72% for > 20 mm , and 11% for low - grade compared to 54% for high - grade lesions . < 40 years by the lifetime risk of lr in those undergoing bcs despite adjuvant rt . if patients do require mx for dcis , an immediate breast reconstruction is relatively uncomplicated as postmastectomy radiotherapy and lymph node dissection will not be required . bcs combined with rt is an acceptable treatment option for smaller , unifocal areas of dcis . significant numbers of patients undergoing bcs alone develop lr , of which approximately half are invasive and up to one fifth ultimately metastatic . the literature reveals an overall lr rate of approximately 28% at 7 years , around 45% of which are invasive [ 3739 , 6468 ] . there is also evidence that mammographically detected dcis treated by bcs alone has unacceptable rates of lr ( 10-year lr rates were 27.8% , 22% , and 19% , resp . , of which approximately 35% were invasive ) [ 6870 ] . the benefit of adjuvant rt , in terms of reduced lr in those undergoing bcs , has been demonstrated by several large randomized controlled trials . however , clear margins are necessary even if rt is given to obtain acceptable rates of lr [ 37 , 38 , 71 , 72 ] . there remains a lack of level-1 evidence supporting the omission of adjuvant rt in selected low - risk cases . the national surgical breast and bowel project ( nsabp b-17 ) trail randomized 818 patients after bcs surgery for dcis , to either whole breast rt or no further treatment . after a median followup of 129-months , of the 403 women treated by wide local excision alone , there were 124 local recurrences ( 31.7% ) , 67 of which were invasive ( 54% ) . of the 410 women treated by wide local excision and rt , 61 local recurrences were observed ( 15.7% ) of which 29 were invasive ( 48% , p = 0.001 ) . despite the fact that rt was associated with a 57% reduction in lr ( both invasive and in situ ) an analysis of long - term data from the nsabp b-17 and nsabp b-24 trials showed that at 15 years the radiotherapy treated patients still had significantly fewer local recurrences and this effect had increased over time . of those that did recur , 54% were invasive , and for these patients , overall survival was lower ( hr of death = 1.75 , 95% ci = 1.45 to 2.96 , p < 0.001 ) . the european organisation for research and treatment of cancer ( eortc ) conducted a similar study recruiting 1010 patients . after a median followup of 126 months , local relapse - free rates were 85% in the rt group and 74% in the control group ( hr : 0.53 , p < 0.0001 ) . in situ lr rates were 7% and 13% , respectively , and invasive lr rates were 8% and 13% respectively . consistent with the nsabp b-17 trial findings , the absolute reduction of lr by rt increased with time from 7% at 4 years to 11% at 10.5 years . in univariate analysis , rt showed a statistically significant benefit in all subgroups of patients , but the size of this benefit varied . the authors observed a 23.5% and 42.7% lr rate for complete and incomplete / doubtful excisions , respectively , in the lumpectomy alone group , versus 14.7% and 24.7% for patients receiving adjuvant rt . indicating the importance of clear margins even with rt . the uk / anz dcis trial involved 1701 patients treated by bcs , with subsequent randomisation to rt and/or tamoxifen . there were four treatment groups : bcs alone , bcs + rt , bcs + tam , and bcs + rt + tam . after a median followup of 53 months , the respective rates of lr were 22% , 8% , 18% , and 6% . adjuvant rt was associated with a significant reduction ( hazard ratio ( hr ) = 0.38 , p < 0.0001 ) in all ipsilateral tumour recurrence ( invasive or dcis ) . rt reduced the risk of dcis by 64% ( p = 0.0004 ) and invasive cancer by 55% ( p = 0.01 ) . long - term followup data has since been reported for this trial . at a median followup of 12.7 years , the cochrane collaboration has recently published a systematic review of four adjuvant rt trials : nsabp 2001 , eortc 2006 , uk / anz dcis 2003 and the swedish dcis 2008 . with regard to lr , they report a 51% pooled risk reduction for dcis ( hr 0.61 , 95% ci 0.390.95 , p = 0.03 ) or invasive cancer ( hr 0.50 , 95% ci 0.320.76 , p = 0.001 ) . after a median followup ranging from 4.410.5 years , the lr rate for those receiving rt was 11.6% compared to 23.9% for bcs alone , resulting in a number needed to treat ( nnt ) of 9 patients to prevent one lr . although there was no attributable increase in mortality , long - term rt complications were poorly reported by the trialists . a further meta - analysis also concluded that adjuvant rt significantly reduces the risk of lr after bcs by approximately 60% , with most benefit to patients with high - grade lesions and positive margins . overall , lr rates have been reported to range from 2.7% to 18.9% , averaging 10% at 7 years , with invasive lr accounting for approximately 60% . however , the methodological quality of several trials has been criticised , particularly in terms of the treatment of unclear margins , the methodology and design of the studies , and the validity of conducting posthoc secondary retrospective analyses [ 29 , 35 ] . whilst some of these issues can be resolved by meta - analysis , others are being addressed by current studies . although it has been long been proven that radiotherapy after mastectomy for invasive breast - cancer reduces local recurrence , good evidence that this in turn leads to reduced mortality took much longer to be published [ 82 , 83 ] . dcis is associated with a better prognosis than invasive breast cancer and , therefore , proof of a survival benefit with radiotherapy may take time to establish . strategies such as a boost of rt to the tumour bed are used in ibc . a study of 75 patients treated by bcs+rt , including 20 women receiving an additional 10 gy boost to the tumour bed , identified no improvement in lr reduction after a median followup of 81 months . the efficacy of other novel strategies including partial breast rt in the context of dcis has yet to be evaluated [ 71 , 72 , 85 ] . accelerated partial breast irradiation ( apbi ) aims to provide comparable local control to whole - breast rt with reduced morbidity . in the largest study group of patients with dcis ( n = 194 ) treated with the mammosite device , the 3-year actuarial lr rate was 0% in the first 48 cases enrolled compared to 2.04% in ibc ( n = 352 ) ; median followup 37.5 months . another recent study of 126 dcis cases evaluated balloon - based brachy therapy , with either mammosite or contura catheter . after a median followup of 40 months , the lr rate for the first 50 consecutive cases was 0.02% with a 3-year actuarial rate of 2.15% . the ecog group ( eastern cooperative oncology group ) prospectively studied 565 nonrandomised patients with single areas of dcis less than 2.5 cm in size treated by breast conserving surgery alone , with margins of greater than 3 mm and split these patients into a low and intermediate group versus a high - grade group attempt to determine a sub - group of patients in whom rt could be omitted . after a median followup of 6.7 years , the local recurrence rate was 6.1% ( 95% ci : 4.18.2% ) in the low to intermediate grade group and 15.3% ( 95% ci : 8.222.5% ) in the high grade group . on the basis of this , the authors suggest that small , low - grade lesions excised with generous margins by breast - conserving surgery may not need radiotherapy . the authors did caution that longer followup and additional study would be needed to confirm this and raise the point that recurrences from low - grade lesions may present later . the radiation therapy oncology group trial ( 98 - 04 ) was a randomised trial designed to assess the need for radiotherapy for dcis in patients with a recent study attempted to account for the nonrandomisation in the ecog dcis study by comparing two groups of patients ( low and intermediate or high grade dcis ) that were treated with breast - conserving surgery and radiotherapy with the two groups in the ecog study . in these 263 patients , with similar length of followup , there was a reduction of more than 70% in the local recurrence rates with radiotherapy . more evidence is needed to confirm if there is a subgroup of patients with dcis that do not need radiotherapy after breast conservation . hormonal therapies ( mainly tamoxifen ) are the main stay of systemic adjuvant therapy in dcis . the nsabp b-24 trial was designed to assess the benefit of tamoxifen for 5 years versus placebo after bcs and rt for dcis . after 7 year median followup , the lr rates were 11.1% and 8% in the placebo and tamoxifen groups , respectively ( p = 0.02 ) . there was a significant excess of endometrial cancer and thromboembolic events in the tamoxifen group . no significant benefit was observed in the following groups : age > 50 years , in situ lr , complete local excision , and absence of necrosis . the overall mortality was not affected . a posthoc analysis of er status demonstrated that efficacy was limited to the 77% of cases which were er positive . the uk / anz dcis trial also assessed the effect of adjuvant treatment with tamoxifen after bcs and rt for dcis . at this point , there was no significant difference in the incidence of invasive breast cancer events in the tamoxifen - treated patients . however , the total number of dcis events ( ipsilateral and contralateral ) was significantly reduced by tamoxifen ( 6% versus 10% , p = 0.03 ) . after a median of 12.7 years followup , a significant difference in all new breast events in tamoxifen treated patients was seen ( hr 0.71 , 95% ci 0.580.88 ; p = 0.002 ) . tamoxifen reduced both recurrent ipsilateral dcis ( hr 0.70 , 95% ci 0.510.86 ; p = 0.03 ) and contralateral tumours ( hr 0.44 , 95% ci 0.250.77 ; p = 0.005 ) . no significant reduction in ipsilateral invasive disease has been proven ( hr 0.95 , 95% ci 0.661.38 ; p = 0.8 ) . there is , therefore , good data that tamoxifen reduces local recurrence and the risk of contra - lateral tumours in dcis treated by bcs and rt . some dcis is probably low - risk enough to omit it , but clear evidence on this is lacking . trials are ongoing to determine if aromatase inhibitors are superior to tamoxifen in the adjuvant setting after breast conserving surgery for dcis ( nsabp b-35 and ibis ii ) . recently , inhibition of cyclo - oxygenase 2 ( cox-2 ) , implicated in epithelial - stromal interactions and promoting the progression of dcis , has been evaluated using nonsteroidal anti - inflammatory drugs ( nsaids ) . results from experimental studies were encouraging [ 93 , 94 ] but were not supported by the erisac trial . pure dcis does not exhibit lymphatic or vascular invasion so surgical staging of the axilla is not necessary . however , lesions thought to be noninvasive on core biopsy are upgraded in 1033% of cases on final postoperative histology [ 96 , 97 ] and lymph node positivity has been reported in 1 - 2% of patients ( 20 ) ( which may be attributable to missed invasive foci ) . a relative indication for slnb in dcis is patients undergoing mx , as these patients are likely to have risk factors for occult invasion large or multifocal lesions , high - grade , mastectomy for recurrent disease . retrospective analyses from the nsabp b-17 and b-24 trials support the strategy of avoiding routine axillary surgery in dcis due to low yield and risk of morbidity [ 98 , 99 ] . it occurs at the site of the original lesion or within the index quadrant in 7580% . the risk decreases as the extent of primary treatment increases ( bcs , bcs + rt , mx ) . ironically , lr can be more aggressive in those who were treated more aggressively . whereas 4050% of lr is invasive after bcs this may reflect the fact that recurrence after bcs often presents as an incidental finding of in situ disease during surveillance mammography , whereas postmx ipsilateral mammographic screening is obviously not undertaken and recurrence is likely to present at a more advanced stage and relies on clinical detection . the prognostic implications of invasive lr are significantly worse than in situ recurrence . in particular , the overall risk of metastasis has been reported to be 03.6% for in situ lr , compared to 13.218% after invasive lr [ 37 , 38 , 71 , 72 , 101 ] . the rate of axillary lymph node involvement with invasive lr ranges from 1130% [ 37 , 38 , 71 , 72 ] . completion mx is indicated following lr within the breast when reexcision would be cosmetically unacceptable , or when lr is confirmed to be invasive and for those with an absolute or relative contraindication to rt ( i.e. , previous adjuvant rt ) . in the nsabp b-17 trial , the mx rate for lr was 48% in the bcs group and 62% in the bcs + rt group , consistent with similar studies reporting rates of 52.8% and 74.7% , respectively , [ 37 , 38 ] . overall , salvage mx rates range from 6484% [ 37 , 38 , 71 , 72 ] . management of the elderly dcis patient ( particularly those over 70 years ) is not strongly evidence based as this group has often been excluded from important trials and screening programs [ 35 , 45 , 46 , 71 , 72 , 90 , 91 ] . women exposed to thoracic radiation , including prior treatment for haematological malignancies , are at risk of developing secondary tumours , with breast cancer representing the most common solid lesion and dcis accounting for 1117.7% . the risk is significantly increased at adolescence and young adulthood with a median onset interval of 16 years . in one study , the majority of these patients were treated with mx , however , 29% underwent bcs rt . male dcis has been reported in approximately 300 cases , however , the incidence of dcis within ibc ranges from 0% to 17% with an average of 7% [ 103 , 104 ] . patients may present with a subareolar mass , paget 's disease , or serosanguineous nipple discharge . optimal control is achieved with simple mastectomy and lumpectomy alone has been associated with a higher rate of lr . minimally invasive interventions for breast cancer seek to redress the balance between benefit and risk and may , therefore , be of particular use in asymptomatic patients with low - risk lesions or patients deemed unfit for conventional management . image - guided radiofrequency ablation therapy ( rfa ) has been demonstrated in pilot studies to be effective with few complications and a favourable safety profile . however , complete ablation may not achievable in all patients and exhaustive histological specimen analysis is not possible . furthermore , current imaging modalities are relatively imprecise at delineating the extent of dcis and predicting / confirming complete ablation . dcis should be managed within the multidisciplinary team and management tailored to patient and tumour factors . local control depends upon adequate surgical clearance , and in order to reduce the risk of lr , surgical margins of at least 2 mm should be achieved . slnb can be considered in patients with a high - risk of occult invasive disease . there remains a lack of level-1 evidence supporting the omission of adjuvant rt in selected low - risk cases . large , multicentric , or recurrent lesions ( particularly in cases of prior rt ) should be treated by mx and immediate reconstruction should be discussed . further research is required to determine the role of contemporary rt regimes and endocrine therapies . biological profiling and molecular analysis represent an opportunity to improve our understanding of the tumour biology of this condition and rationalise its treatment . reliable identification of low - risk lesions could allow treatment to be less radical or safely omitted . articles were identified by searches of medline , pubmed , embase , and cochrane databases up to september 2011 using the terms : dcis or ductal carcinoma in situ and treatment or management or surgery or radiotherapy " or radiation or mastectomy or sentinel lymph node biopsy or natural history or tamoxifen or recurrence or invasive . the references in this review were selected to provide a balanced and representative overview of a complex subject with an extensive base of published work .
introduction . this article reviews current management strategies for dcis in the context of recent randomised trials , including the role of sentinel lymph node biopsy ( slnb ) , adjuvant radiotherapy ( rt ) and endocrine treatment . methods . literature review facilitated by medline , pubmed , embase and cochrane databases . results . dcis should be managed in the context of a multidisciplinary team . local control depends upon clear surgical margins ( at least 2 mm is generally acceptable ) . slnb is not routine , but can be considered in patients undergoing mastectomy ( mx ) with risk factors for occult invasion . rt following bcs significantly reduces local recurrence ( lr ) , particularly in those at high - risk . there remains a lack of level-1 evidence supporting omission of adjuvant rt in selected low - risk cases . large , multi - centric or recurrent lesions should be treated by mx and immediate reconstruction should be discussed . adjuvant hormonal treatment may reduce the risk of lr in selected cases with hormone sensitive disease . conclusion . further research is required to determine the role of new rt regimes and endocrine therapies . biological profiling and molecular analysis represent an opportunity to improve our understanding of tumour biology in dcis to rationalise treatment . reliable identification of low - risk lesions could allow treatment to be less radical .
many recent studies have focused on cell therapies , scaffold based and cell based , for cardiovascular diseases primarily because these pathologies still rank among the top ten leading causes of mortality and morbidity worldwide . annually , thousands of people die due to myocardial infarction , congestive heart failure , stroke , valvular heart diseases , and vascular diseases . according to the recent report of the american heart association , in 2008 , an average of one death occurred every 39 seconds accounting to more than 2200 american deaths due to cardiovascular diseases ( cvd ) each day , with greater rate among black than white americans . bearing in mind that the administration of various drugs caused a number of chemical reactions in the body and even led to autoimmune complications instead of treating the primary disease , it is therefore noteworthy that advancements on regenerative medicine and tissue engineering are highly beneficial . tissue engineering and regenerative medicine do not only offer fast recovery but also lessen the medical and economic burden among the patients suffering from cardiovascular diseases . at present , a vast of information and techniques on biofabrication and stem cell biology have been established ; however , the effectiveness based on the clinical applications of these techniques remains to be elucidated . this paper will highlight the updates of regenerative medicine and tissue engineering techniques which addressed cardiovascular diseases . in particular , this will include the evolution of scaffold and scaffold - free cell therapies for the blood vessel defects as well as the various stem cells used for engineering blood vessels . the updates on tissue engineering for heart valve and the myocardium will be reviewed subsequent to this paper . it is globally known that in the developed countries , cardiovascular diseases are the primary causes of mortality and morbidity . based on the review done by zaragosa et al . , both genetic and environmental factors are associated with the cardiac and vascular complications although prior papers emphasized that new drugs and innovative devices have improved quality of life for patients inflicted with cardiovascular diseases , they have not necessarily reduced the mortality and morbidity rate . then , organ transplantation provided a new therapeutic path . transplantation offers an immediate cure by replacing the damaged tissues or organs with normally functional substitutes . since it is the preferred treatment for organ failure , there is a growing need for transplantable human organs , either autologous or from certain donors . however , there are two major lifelong obstacles that have restricted organ transplantation , namely , the critical paucity of donors and the high risk of graft rejection . in fact , successful treatment to cardiovascular diseases has been limited due to lack of suitable autologous tissue to restore injured cardiac muscles or to serve as vascular conduits to replace or bypass diseased or occluded vessels . on the other hand , the immunosuppressive agents bridged the mortality and morbidity of the organ failure to the risk of infection , cancer , and cardiovascular diseases [ 3 , 4 ] . hence , tissue engineering has been projected as an alternative treatment to these problems by replacing the damaged tissue or organ function with constructs which are biofabricated based on the required tissue or organ features . in particular , cardiovascular tissue engineering is more valuable and relevant compared to other fields of tissue engineering mainly because it increases life expectancy , preserve , the extremities , and caters a vast number of patients . tissue engineering is an interdisciplinary field that applies the principles of engineering and life sciences towards the development of functional substitutes for damaged tissues . it is anchored on the fundamental concept of utilizing the body 's natural biological response to tissue damage in conjunction with engineering principles [ 8 , 9 ] . in addition , tissue engineering is designed to produce biomimetic constructs , which resemble normal tissues , to replace the damage tissues . moreover , the main objective of tissue engineering is the restoration of function through the delivery of living elements which become integrated in the patient . tissue engineering strategies have three basic components : firstly , the cells or source which must express the appropriate genes and maintain the appropriate phenotype in order to preserve the specific function of the tissue , secondly , the bioreactive agents or signals that induce cells to function , and thirdly , the scaffolds that house the cells and act as substitute for the damaged tissue . the source may either be embryonic stem cells ( esc ) or adult stem cells ( asc ) in origin , the scaffolds may be categorized as synthetic , biological , or composite , and the signals may include growth factors / cytokines , adhesion factors , and bioreactors . in many studies , the tissue engineering components have been considered and explored focusing on single component only ( s component only- source , scaffold , or signal only ) , or in combination ( s - s components- scaffold / signal , scaffold / source , and signal / source ) , or altogether ( s - s - s- source , scaffold , and signal ) ( figure 1 ) . currently , the evolution of bottom - up and top - down approaches ( figure 2 ) in tissue engineering has been continuously investigated by many groups as the most promising tissue engineering approaches . the bottom - up approach usually employs implantation of precultured cells and synthetic scaffold complexes into the defect area . the cells or source , generally isolated from host target tissues , are expanded in vitro and preseeded into the scaffold to provide a porous three - dimensional structure that accommodate the seeded cells and form extracellular matrix . [ 9 , 1417 ] . subsequently multiple methods such as cell aggregation , micro - fabrication , cell sheeting , and cell printing are utilized in generating modular tissues . they are then assembled through random assembly , stacking of cell sheets , or directed assembly into engineered tissues with specific microarchitectural features . therefore , this approach allow , scientists to finely transform the nanostructure of materials by balancing polymer degradation rates with the extracellular matrix ( ecm ) production and cellular infiltration which caused the increased cell binding sequences , enzymatic cleavage sites , and tethering of chemoattractant molecules [ 1720 ] . conversely , in the top - down approach , there are two ways to manufacture the engineered tissue : ( 1 ) cells and biomaterial scaffolds are combined and cultured until the cells fill the support structure to create an engineered tissue or ( 2 ) the acellular scaffolds , incorporated with biomolecules , are delivered immediately after injury . the biomolecules are released from scaffolds in a controlled manner , and they may recruit the progenitor cells in injured area and promote their proliferation and differentiation and eventually repair the injured tissues [ 9 , 1416 ] . blood vessels extend throughout the body and mediate gas exchange , nutrient and waste transport , and immune defense . the blood vessels consist of endothelial cells that are in contact with the blood , vascular smooth muscle cells that cover the endothelial cells as well as form the middle layer , and the fibroblasts and matrix that form the vessels ' outer layer . based on the earlier evaluation , cells of the blood vessels perform different functions in relation to cardiovascular physiology ( figure 3 ) [ 2129 ] . altogether , these layers of cells play a role in repairing , remodeling , and maintaining the blood vessels following an injury . all these cell types have been involved not only in cardiovascular pathology but also in therapy . in a recent review , chen et al . pointed out that human blood vessel - derived stem cells are utilized as sources for tissue repair and regeneration for various cardiac and muscular diseases . the myogenic endothelial cells are involved in muscular regeneration and cardiac repair particularly in acute myocardial infarction ; the pericytes , on the other hand , contribute to the regeneration of dystrophic skeletal muscles , while the adventitial cell participates in vascular remodeling and regeneration of the surrounding tissues [ 28 , 30 , 31 ] . blood vessel diseases such as atherosclerosis and arteritis [ 30 , 32 ] , chronic venous insufficiency ( cvi ) , and thrombosis remain as major vascular problems globally . hence , the increasing morbidity of cardiovascular diseases in the modern society has made it crucial to develop blood vessel substitutes especially for those small diameter vessels ( less than 6 mm ) for the replacement of diseased coronary and below the knee vessels . current therapies for such diseases include surgical replacement with autologous vessels or synthetic materials [ 34 , 35 ] . although autologous vessels remain the standard for small grafts , many patients have a limited vessel suitable for use because of vascular disease , amputation , or previous harvest . despite a clear clinical need for a functional arterial graft , success has been limited to arterial replacements of large - caliber vessels such as the thoracic and abdominal aorta , arch vessels , iliac , and common femoral arteries ; however , small - caliber arterial substitutes , which account for a majority of the demand , have generally proved inadequate largely because of acute thrombogenicity of the graft , anastomotic intimal hyperplasia , aneurysm formation , infection , and progression of artherosclerotic disease . from this time , tissue engineering is the promising approach to address the shortcomings of such treatment [ 36 , 37 ] . although advances in vascular tissue engineering have had limited clinical application because of the cell 's limited replicative capacity , loss of telomerase activity of adult somatic cells , and the long - term production of the biological construct [ 38 , 39 ] , many investigators have further explored techniques with the objective of fabricating biomimetic tissue - engineered blood vessels ( tebv ) . creating an engineered blood vessel substitute requires the incorporation of both smooth muscles and endothelial cells into the tubular scaffold so as to establish an architecture like that of a native blood vessel . the first production of completely biological tissue - engineered blood vessels , composed of intima , media , and an adventitia , using cultured mature smooth muscle cells and endothelial cells in bovine collagen gels was pioneered by weinberg and bell and this rapidly expanded the number of studies akin to blood vessel diseases . it is now well known that the smooth muscle layer of the blood vessel plays an important role in maintaining homeostasis of blood vessels . additionally , vascular smooth muscle cells do not only play important roles in the physiological function of the blood vessels but also in their remodeling under pathological conditions . thus , generating functional smooth muscle layer is a prerequisite for successful blood vessel construction through tissue engineering approach . smooth muscle cells and endothelial cells were the early sources broadly utilized to construct vascular implants [ 42 , 43 ] . nevertheless , due to the limited proliferation ability and loss of contractile phenotype of mature - differentiated smooth muscle cells ( smcs ) , various alternative sources of cells have been explored for the production of blood vessel replacements . their corresponding characteristics , some of these were previously described , are summarized in table 1 . to date , despite numerous scaffolds that have been manufactured through varied forms of tissue engineering techniques , the construction of an entirely biomimetic blood vessels is still underway . to achieve a successful clinical application of tissue - engineered blood vessels , the biofabrication of vascular grafts necessitates a vigorous yet time - efficient biotechnological process . several tissue engineering strategies have emerged to address biological flaws at the blood - material interface of the synthetic scaffolds , hence , paving the way to vascular cell seeding and design of bioactive polymers for in situ regeneration . moreover , advances in biomaterial design have been directed towards the generation of suitable materials that does not only mimic the native vascular tissue 's mechanical properties but also promote cell growth , inhibit thrombogenicity , and facilitate extracellular matrix production . in addition , an important characteristic of artificial scaffolds in advanced biomaterial vessel substitutes is not just the tolerance of the cells but the capacity to mimic the natural ecm in order to regulate extent and strength of cell adhesion , growth activity , cell differentiation , and maturation to the desired phenotype [ 8486 ] . the extracellular matrix proteins such as collagen , elastin , fibronectin , vitronectin , and laminins which mediate cell - material adhesion have been thoroughly assessed in an earlier review . materials for vascular replacements should be biomimetic in such a way that they should be resistant not only to thrombosis , but also to inflammation , and neointimal proliferation , and for all intents and purposes , they should resemble the native vessels [ 3 , 31 ] . for these reasons , it is necessary to investigate the physical , chemical , and biological properties and modifications of materials to further understand the molecular mechanism of the cell - material interaction . the lack of endothelial cells on the luminal surface of the artificial grafts contributes to synthetic graft thrombogenicity and promotes intimal proliferation within the graft . endothelial cell ( ec ) seeding on the synthetic grafts has been attempted to mitigate these problems . herring et al . were among the first to perform endothelial cell ( ec ) isolation and their subsequent transplantation into vascular graft . the polymer surfaces which have been formerly investigated for endothelial attachment , proliferation , and function had been listed in an earlier review . on the other hand , the synthetic polymers for reconstructing blood vessels for clinical practice which are based on polyethylene terephthalate ( pet ) or polytetrafluoroethylene ( ptfe ) had been previously reviewed . furthermore , blood vessel stem cells have been studied in combination with recent and alternative types of scaffolds / polymers . parallel to this , in scaffold - based blood vessel engineering , bioreactors and pulsatile flow systems , designed by many scientists , have been found to progress the mechanical property of the engineered blood vessels by augmenting the deposition and remodeling of extracellular matrix as well as the maturation and differentiation of self - assembled microtissues [ 38 , 39 , 67 , 68 , 76 ] . bioreactors , which were originally designed for industrial use , have high degree of reproducibility , control , and automation for specific experimental bioprocesses and these have been the reasons for their transfer to large - scale applications including vascular tissue engineering . the bioreactors allow scientists to manipulate the environment and the parameters such as ph , temperature , pressure , nutrient supply , and waste removal in order mimic the in vivo physiological condition and allow biological or biochemical processes to occur and subsequently develop the desired tissue . taken together , the formation of a microvasculature within a tissue - engineered organ or tissue will depend on multiple factors : the biochemical environment , ec type , the micro - architecture presented by the scaffold material , and mechanical signals [ 89 , 90 ] . due to the goal of developing biomimetic blood vessel scaffolds , many groups have designed such biomaterials . the polymers used in scaffold fabrication for tissue engineered blood vessels started from polyglycolic ( pga ) to varied types such as polyglycolic acid - poly - l - lactic acid ( pga - plla ) , collagen / elastin , chitosan , poly ( glycerol sebacate ) ( pgs ) , and very recently polyglycolide knitted fiber , and an l - lactide and -caprolactone copolymer sponge cross - linked to amniotic fluid . furthermore , amniotic membranes have been used as scaffolds which signify that scaffold - based tissue - engineered blood vessels can be fabricated from autologous cells at a reduced manufacturing period . the chronic inflammation , thrombosis , rejection , and poor mechanical properties of allogeneic or xenogeneic and synthetic vessels have impaired their clinical applications . in addition , due to the failure cell to cell interaction and the assembly and alignment of ecm components , and the complex host response to scaffolds , the scaffold - free techniques had recently emerged . in scaffold - free tissue engineering approach , the fabrication of the tissue construct is anchored in the crucial capability of the cells to manufacture their own extracellular matrix . in 1998 , the first scaffold - free tissue - engineered human blood vessel was established by l ' heureux and has been replicated for further preclinical evaluation using rat and mice models in 2006 [ 76 , 79 ] . years later , groups of scientists reported a fully biological self - assembly approaches by implementing rapid prototyping bioprinting method and stimulation via bioreactors for scaffold - free small diameter vascular reconstruction [ 39 , 80 ] . similar to scaffold - based technique , in tissue engineering for scaffold - free blood vessels , the bioreactors were also used to provide specific biochemical and physical signals to regulate cell differentiation , ecm production , and tissue assembly by using chemical , mechanical , or electromagnetic stimulation techniques to produce de novo tissue with properties comparable to the damaged or desired tissues [ 91 , 92 ] . there are many types of launched bioreactors however , in engineering the vascular tissues , designs of various bioreactors have been based on the expansion and recoil properties of blood vessels , and so the combinations of stress , strain , and perfusion stimulation in biomimetic bioreactors have successfully developed vascular tissues . in case of cell senescence problem , lifespan extension via telomerase expression in vascular cells ( smooth muscle cells and endothelial cells ) from elderly patients has been found as an effective strategy for engineering autologous blood vessels and eventually provides bypass conduit for atherosclerotic diseases . human telomerase , composed of an rna component and a reverse transcriptase ( htert ) , maintains the telomere length at the ends of the chromosomes . absence of htert expression in mature somatic cells induces lack of telomerase activity thus its ectopic expression has been shown to restore telomerase activity , arrest telomere shortening and senescence in some cells . while high cell population is essential in cell - based vessel biofabrication and the expansion process is lengthy , cell - based therapies are more promising in terms of efficacy despite the fact that they are more complex and costly than scaffold - based techniques . therefore , many researches have focused on this approach and the representative studies are presented in table 3 . among the well - studied scaffold - free techniques are the coculture system , sheet - based engineering , decellularization , direct cell injection , bioprinting , and biofabrication in a bioreactor system . at present , the previously established treatments for cardiovascular disorders , such as organ transplantation , surgical reconstruction , usage of mechanical and synthetic devices , or administration of metabolic products , although promising are still yet constraints and complication - free . hence , the developments in vitro and in vivo generation of biomimetic constructs for specific target organ or tissue are more suitable for regeneration of damaged cardiovascular organs . albeit the points of view of demirbag et al . on the benefits and drawbacks of the applications scaffold and scaffold - free approaches over each other are indeed noteworthy . due to the uniqueness of cells , tissues , and nature of cardiovascular defects , these approaches should be considered complementary instead of being competing components of vascular tissue engineering . the treatment for blood vessel defects ( figure 4 ) would always depend on the pathological condition of the patient . if the patient has no limitations for transplantation , then autologous blood vessels may be directly utilized for treatment . otherwise , especially in the cases congenital defects , tissue - engineered blood vessels manufactured , the current blood vessel constructs still have their corresponding limitations , therefore , further reassessment and modification have to be conducted . however , once a biomimetic blood vessel is produced , then transplantation can be the convenient treatment for blood vessel defects most especially in the infants whose transplantable large blood vessels are not yet ready for harvest . in the future , further combination of techniques may be considered in the production and design of cardiovascular - engineered tissues for the blood vessels . for instance , the high - density suspension system ( hdss ) initiated by lee et al . for constructing spherical spheroids composed of cartilage and synovium cells was found to be an effective and efficient culture system , then the spheroids were successfully implanted and able to heal the bone defects of the knee in rabbit model . such technique may be applied for expanding stem cells for the cardiovascular diseases especially if the construct has to be composed of a mixture of cells such as myofibroblast , smooth muscles , epcs , and many others for blood vessel defects . hence , this strategy may enhance the existing coculture system applied in the construction of engineered blood vessels . however , it would be better if researchers will be able to design a completely scaffold - free product since it is more beneficial in a sense that complications can be prevented and might promote greater life expectancy of the individuals affected with vascular diseases . it will remain a challenge to devise blood vessel engineered tissue until completely biomimetic construct is produced . furthermore , since angiogenesis is essential in almost all types of organ remodeling and tissue engineering , it is indeed a crucial step for the complex organ reconstruction . hence , it is also interesting to explore the importance and the interrelationships of the vascularization signaling pathways in designing biomaterials . perhaps , along the process of biofabrication , certain growth factors and other signaling molecules may be incorporated while regulating their release into the scaffold or scaffold - free construct in order to enhance blood vessel reconstruction on the injured site . the designs of the bioreactors may be further improved to hasten vascular tissue construction through their efficient and effective stimulation and by combining them with automated cell tissue culture systems to reduce time - consuming expansion period which primarily delimit the clinical application of the current vascular grafts especially in cases of emergencies .
over the years , cardiovascular diseases continue to increase and affect not only human health but also the economic stability worldwide . the advancement in tissue engineering is contributing a lot in dealing with this immediate need of alleviating human health . blood vessel diseases are considered as major cardiovascular health problems . although blood vessel transplantation is the most convenient treatment , it has been delimited due to scarcity of donors and the patient 's conditions . however , tissue - engineered blood vessels are promising alternatives as mode of treatment for blood vessel defects . the purpose of this paper is to show the importance of the advancement on biofabrication technology for treatment of soft tissue defects particularly for vascular tissues . this will also provide an overview and update on the current status of tissue reconstruction especially from autologous stem cells , scaffolds , and scaffold - free cellular transplantable constructs . the discussion of this paper will be focused on the historical view of cardiovascular tissue engineering and stem cell biology . the representative studies featured in this paper are limited within the last decade in order to trace the trend and evolution of techniques for blood vessel tissue engineering .
hereditary sensory neuropathies ( hsn ) are clinically and genetically heterogeneous disorders of autosomal dominant or autosomal recessive inheritance characterized by axonal atrophy and degeneration , predominantly affecting the sensory neurons [ 13 ] . hallmark features of the dominantly inherited variant subclassified as hsn type 1 ( hsn1 ) comprise severe distal sensory loss , painless injuries , skin ulcers and frequent bone infections that sometimes necessitate amputations of toes or feet [ 13 ] . variable distal muscle weakness and wasting and lancinating pain is also often observed . with disease progression the hands mutations in the serine - palmitoyltransferase , long chain base subunit 1 ( sptlc1 ) gene are the most frequent cause of hsn1 . sptlc1 encodes one of the three subunits of serine palmitoyltransferase ( spt ) , which catalyzes the first step in the de - novo synthesis of sphingolipids which is the condensation of l - serine and palmitoyl - coenzyme a. under certain conditions spt shows a shift from its canonical substrate l - serine to the alternative substrates l - alanine and glycine which leads to the formation of an atypical class of 1-deoxy - sphingolipids ( 1-deoxysl ) . pathologically elevated 1-deoxysls have been found in transgenic hsn1 mouse models and in hsn1 patients carrying different sptlc1 mutations but also in individuals with the metabolic syndrome and diabetes [ 68 ] . the 1-deoxysls show pronounced neurotoxic effects in vitro and may be disease causing in hsn1 but are possibly also involved in the pathology of the diabetic neuropathy . the observation that a high dose l - serine supplementation lowers plasma 1-deoxysl levels in hsn1 patients and in the transgenic mouse model has encouraged our hopes for a first treatment of this ulcero - mutilating disorder . this emphasizes the importance of an early and accurate genetic diagnosis of hsn1 patients . here we report a novel sptlc1 mutation in a female patient exhibiting an unusually severe and complicated phenotype . we show that mutations at the particular amino acid position serine 331 ( s331 ) are associated with a distinct syndromic phenotype in comparison to previously reported mutations in hsn1 . motor milestones during the first years were normal but height and weight always ranked low in percentile or they were even below the lower limit . at 4 years of age a strange gait , frequent falls and moderate hand tremor were noted . sensory disturbances were initially mild but progressed with disease . considerable pes cavus foot deformity necessitated triple arthrodesis at age 5 . subsequently , the diagnosis of hereditary motor and sensory neuropathy ( hmsn ) was made . disease progression was rapid and soon muscle weakness and wasting affected upper limbs , but also proximal limb and trunk muscles thus leading to severe scoliosis , respiratory problems and wheelchair dependence at age 14 . in addition , there was prominent growth retardation and delayed puberty whereas intellectual development was normal . at age 13 , there was general muscle hypotrophy and hypotonia with pronounced weakness in the distal muscles of the upper and lower limbs ( fig . 1 ) there were prominent sensory disturbances which were pronounced in the feet and affected all qualities except for the vibration sense which remained completely preserved . at the toes scars after burns due to reduced prominent pain and temperature sensation were evident ( fig . 1 , hypermobility of the joints , bilateral hand tremor and fasciculations , which were most prominent in the tongue , were observed ( fig . 1 ) . further evaluation included nerve conduction studies ( ncs ) , magnetic resonance imaging ( mri ) studies and molecular genetic testing which followed standard methods . whole exome sequencing was performed on a genome analyzer hiseq 2000 system ( illumina , san diego , ca . ) . nerve conduction velocities in the upper limbs were within the intermediate range ( median motor : 32 m / s , median sensory : 39 m / s , snap : 16.7 v ) and compound motor action potentials ( cmap : 2.5 mv , peak peak ) were reduced . there was no response for motor or sensory nerves in the lower limbs . based on these results the patient was initially classified as hmsn type ii . mri of the brain and spinal cord was normal at the age of 9 years . after exclusion of mutations in all common hmsn and sca ( spino - cerebellar ataxia ) genes , whole exome sequencing was carried out . thereby , a heterozygous missense change in sptlc1 ( c.992g- > t ; p.s331y ) was detected and confirmed by sanger re - sequencing . the parents were normal on neurological and on electrophysiological examination and this change was absent in both of them . also , no sequence variation at aa position s331 was found in 1969 individuals from our in - house exomes . subsequently , we measured the 1-deoxysl levels in the patients ' plasma which were found to be significantly elevated ( fig . 2a ) . increased 1-deoxysl formation was also confirmed in hek293 cells expressing the p.s331f and p.s331y mutant ( fig . to date , six disease causing mutations in sptlc1 ( p.c133w , p.c133y , p.c133r , p.v144d , p.s331f , p.a352v ) have been described . spltc1 mutations at positions p.c133 , p.c144 and p.a352 result in the typical hsn1 phenotype . in contrast , the p.s331f mutation , which was reported in two patients only , occurred de - novo and was associated with an extraordinary severe and complicated phenotype . one of these patients was initially diagnosed as early onset hmsn type ii due to muscle weakness and hypotrophy in addition to prominent sensory disturbances , bone fractures and osteomyelitis . notably , this patient also developed juvenile cataract at age of 9 years , complete retinal detachment at 10 and repetitive corneal ulceration and keratitis with poor corneal healing . an even more complex congenital phenotype with severe growth retardation , global amyotrophy , hypotonia , joint hyperlaxity , vocal cord paralysis , bilateral cataract , mild mental retardation , microcephaly and respiratory problems was described in the second patient . the pathogenicity of the p.s331f mutation was confirmed by functional studies : in vitro a reduction of spt activity was shown and in plasma samples of both patients increased levels of 1-deoxysls were detected . nevertheless , it remained uncertain whether these additional features were also related to the p.s331f mutation . the patient reported here carries a novel mutation in sptlc1 leading to a change of serine to tyrosine at aa position 331 which also results in a similar unusually severe and complicated phenotype . the core phenotype of the three patients described so far carrying an s331 sptlc1 mutation resembles early onset hmsn . the additional features highly enlarge the phenotype of hsn1 but are rather unique between the three patients ( table 1 ) thus proposing the existence of a distinct and severe syndrome associated with this particular mutation . since oral l - serine supplementation has been suggested to be a future treatment option , it will be most important to achieve a quick diagnosis by early screening of exon 11 of sptlc1 in patients exhibiting this distinct phenotype .
mutations in the serine palmitoyltransferase subunit 1 ( sptlc1 ) gene are the most common cause of hereditary sensory neuropathy type 1 ( hsn1 ) . here we report the clinical and molecular consequences of a particular mutation ( p.s331y ) in sptlc1 affecting a patient with severe , diffuse muscle wasting and hypotonia , prominent distal sensory disturbances , joint hypermobility , bilateral cataracts and considerable growth retardation . normal plasma sphingolipids were unchanged but 1-deoxy - sphingolipids were significantly elevated . in contrast to other hsn patients reported so far , our findings strongly indicate that mutations at amino acid position ser331 of the sptlc1 gene lead to a distinct syndrome .
understanding and correct analysis of the optical properties of the natural dentition such as color and translucency and the differences between the natural teeth and restorative materials are very important in accurate and consistent shade selection and the proper use of restorative materials in order to achieve clinical success [ 13 ] . there are a number of parameters affecting the translucency of composite restorations such as thickness , filler particles and opacifiers , and resin matrix composition . several investigators have evaluated the translucency of dental composite resins [ 713 ] and the influence of different other factors on the translucency such as flowability , light curing [ 14 , 15 ] , resin polymerization , and aging [ 1620 ] . the relationship between color and translucency of dental composite resins has been the focus of research in the recent decade [ 21 , 22 ] . it has been demonstrated that more chromatic shades of commercial resin composites are less translucent .yu and lee measured and classified the translucency of varied brands and shades of resin composites . the results of their study showed that the translucency was significantly influenced by the shade designation of resin composites . recently , it has been reported that the color of several esthetic composite resins significantly affected their translucency to such an extent that the boundaries between the shade categories were not distinct , and there were some overlaps between the enamel and body shades . the aim of this study was to compare the translucencies of different shades of two commercially available highly aesthetic multilayered restorative composite resins to establish whether there is a logical pattern to the translucency of multilayered composite resins which can be consistent with their color . two commercially available multilayered dental composite resin systems were tested in this study : filtek supreme ( 3 m espe , usa ) and esthet.x ( dentsply , germany ) . 3 m espe filtek supreme universal restorative material is a visible - light activated restorative nanocomposite designed for use in anterior and posterior restorations . the resin system is based on bis - gma , bis - ema , and udma with small amount of tegdma . translucent shades contain a combination of a nonagglomerated / nonaggregated , 75 nm silica nanofiller , and a loosely bound agglomerate silica nanocluster consisting of agglomerates of primary silica nanoparticles of 75 nm size fillers . all of the remaining shades contain nonagglomerated / nonaggregated , 20 nm nanosilica filler , and loosely bound agglomerated zirconia / silica nanocluster , consisting of agglomerates of primary zirconia / silica particles with size of 520 nm fillers . micro matrix restorative is an esthetic , visible - light - cured , radiopaque microhybrid composite restorative material designed specifically for use in all cavity classes in both anterior and posterior restorations . the resin matrix of esthet.x is a urethane modified bis - gma resin matrix system . it consists mainly of bis - gma adduct , ethoxylated bisphenol - a - dimethacrylate , and tegdma . the filler component of esthet.x is a blend of a proprietary inorganic bariumalumino fluoroborosilicate ( bafg ) glass with nanosized silicon dioxide particles . the bafg glass has an average filler particle size of 0.60.8 microns with narrow particles size distributions of 0.022.5 microns . 60 vol.% ; the percentage by weight is ca . 77 wt.% . in total nine shades from esthet.x and ten shades from filtek supreme esthet.x shades included a4 , b2 , c4 opaque dentine , a2 , b2 , c2 regular body , clear enamel ( ce ) , yellow enamel ( ye ) , and gray enamel ( ge ) shades . filtek supreme shades included a4d , a6d , c4d , c6d ( dentine ) , a2b , c2b , d2b ( body ) , a2e , b2e , and d2e ( enamel ) shades . three disc samples of each shade were prepared ( n = 3 ) by the following method . a mould was made by cutting 15.5 mm diameter holes in a 1.1 mm thick sheet of polycarbonate.this was done using a standing drilling machine ( weddings industries uk ltd ) . the mould was then placed on a glass plate and the dental composite was placed inside it . a second glass plate was placed on the top of the mould and firmly pressed on the mould for twenty seconds . the light intensity was measured ( 750 mw / cm ) each time before curing to make sure the intensity of the light remained the same . the thickness of each of the samples was measured by a micrometer ( wpi , usa ) at five different sites ( four corners and at the centre ) . only samples with a thickness of 1.1 0.05 mm thickness were accepted . specimens were polished on wet 400 and 600 grit silicon carbide grinding paper ( buehler - met ii , buehler , uk ) . this was followed by polishing with 61 m finish with diamond compounds ( buehler - met as , usa ) on a grinder - polisher ( buehler , coventry , uk ) at 200 rpm for 5 min using light hand pressure . after the finishing procedure the samples were washed with water and their thickness was remeasured to achieve a uniform thickness of 1.0 0.05 mm . each of the samples was then inspected on a light box to ensure that no porosity was present . finally a total of fifty - seven samples were prepared to measure the translucency of each . transmittance values were recorded for each sample using a uv / vis spectrophotometer ( perkin elmer lambda 2 ) with an integrating sphere . standard illuminant d65 corresponding to average daylight was used . for total transmittance measurement , a sample was placed in the transmission port ( entry port ) of the spectrophotometer and a white reference material was placed in the reflectance port . total transmittance then was recorded at every wavelength from 380 nm to 700 nm . a light trap can be either a black background or an open port as a light trap . the light trap absorbs the directly transmitted light ; therefore only the scattered light is measured . in this each sample was measured for diffuse transmittance between 380 nm to 700 nm . average total and diffuse transmittance of each shade of the composite resins were calculated by dividing the sum of the readings from 380 nm to 700 nm by 321 . statistical analysis of the data was carried out by one - way anova followed by tukey 's test using minitab statistical analysis software . mean total and diffused transmittance values for different shades of esthet - x dental composite resins are presented in figures 2 and 3 . statistical analysis by one - way anova followed by tukey 's test showed that the opaque dentine shades had the lowest total and diffuse transmittance values and the translucent enamel shades had the highest transmittance values in esthet - x composite resin . statistical analysis within the groups revealed that there was a significant decrease in both total and diffused transmittance from a2 to c2 of regular body shades and also from a4 to c4 of opaque dentine shades of esthet - x composite resin . within the translucent enamel group , grey enamel shade had a significantly higher diffuse translucency compared to clear and yellow enamel shades . mean total and diffuse transmittance values for different shades of filtek supreme dental composite resins are shown in figures 4 and 5 . statistical analysis by one - way anova followed by tukey 's test showed that the dentine shades had the lowest total and diffuse transmittance values and the enamel shades had the highest transmittance values in filtek supreme composite resin . statistical analysis within the groups revealed that there was a significant decrease in both total and diffuse transmittance values from a2b to d2b and also in diffuse transmittance from a4d to c6d shades of filtek supreme composite resin . however , there was no significant difference in total transmittance within the dentine shades and neither in total and diffused transmittance within the enamel shades of this composite resin . in the present study the translucency of different shades of two very commonly used universal composite resins was evaluated . these two systems were chosen because of their wide acceptance and popularity among clinicians . in selection of the shades for the study care was taken to choose the shades in a way that they present a comparable sample within any given group of each resin system and also allow us to compare their optical properties of different shades within a certain group . opaque dentine shades had the lowest total and diffused translucency values , and the translucent enamel shades had the highest translucency values in esthet - x composite resin . a similar pattern was observed with filtek supreme resin . dentine shades had the lowest total and diffused translucency values , and the enamel shades had the highest translucency values . these findings are consistent with the findings of kamishima et al . who reported that the opaque shades of the composite resins were less translucent than other shades . similarly , ikeda et al . demonstrated that opaque shade was less translucent than body shades of several restorative composite materials . translucency of these materials is influenced by the difference in the refractive indices between resin matrix and filler . as mentioned above , different shade groups of the composite resins used in this study have different compositions in terms of filler contents and nanofiller particle sizes . composite resins with lower filler size and content are more translucent . it was observed that , within the shade groups of the composite resins used in this study , total and diffuse transmittance decreased significantly from a shades towards c and d shades in several groups . the highest variations in translucency were observed within the body shades ( a to d ) of filtek supreme and also within the enamel shades of esthet - x resin . this finding is consistent with a recent study by ryan et al . who reported that the translucency of filtek supreme composite resin significantly affected the color where the boundaries between the enamel and body shade categories were not distinct , and there were some overlaps . in other words , while selecting a shade for a tooth - colored composite restoration , it is important to realize that the translucency of the resin may decrease significantly towards c and d shades and this can cause dissimilarity between the restoration and natural teeth despite the color match . the data on the translucency of two multishaded dental composites used in this study provide the clinician with useful information on these highly esthetic restorative materials . however , care must be taken in direct extrapolation of this information to all the other shades produced by the same manufacturer . since filtek supreme and esthet.x composite resins have been developed for clinical usage by multi - layering technique , the resulting restorations in this technique is determined by several factors including translucency , color , and thickness of each layer . therefore accurate knowledge regarding the translucency and color of materials is fundamental to the layering technique . thus it is important for the clinician to be aware of the optical properties of restorative dental materials such as translucency and color of each product for successful aesthetic restorations . one of the limitations of this study was that it did not take into account the combined effect of translucency , shade , and the thickness of the layers used . therefore , in order to optimize the optical properties of multilayered restorative composite restorations , further studies are required to investigate the combined effect of translucency , shade , and thickness of the layers of the restoration . from the results of this study it can be concluded that the translucency within each shade category can be severely affected by the color as observed within the body shade group of filtek supreme and the enamel shades of esthet - x composites . however , the variation in translucency within each shade group does not cross over between different shade categories . provision of information on the translucency of different shades of composite resins can be very useful for the clinicians in selecting the composites with correct shade and translucency .
the aim of the present study was to compare the translucency of different shades of two highly aesthetic multilayered restorative composite resins . in total nine shades from esthet.x and ten shades from filtek supreme composite resins were chosen . discs of each shade were prepared ( n = 3 ) and light - cured . total and diffuse transmittance values for each sample were measured . statistical analysis showed that the opaque dentine shades of both composites were the least translucent and the enamel shades had the highest translucency . there was a significant decrease in translucency from a2 to c2 of regular body shades and also from a4 to c4 of opaque dentine shades of esthet.x composite resin . grey enamel shade had a significantly higher diffuse translucency compared to clear and yellow enamel shades . there was a significant decrease in translucency from a2b to d2b and also in diffuse translucency from a4d to c6d shades of filtek supreme composite resin . it can be concluded that the color of the composite resins tested in this study had a significant effect on their translucency . information on the translucency of different shades of composite resins can be very useful for the clinicians in achieving optimal esthetic restorative outcome .
human breast cancer represents a group of highly heterogeneous lesions , consisting of about 20 morphologically distinct subtypes 1,2 . breast cancers also have highly variable molecular and immunohistochemical signatures , and could be roughly divided into 5-categories based on expression of estrogen receptor ( er ) , progesterone receptor ( er ) , human epidermal growth factor receptor-1 and 2 ( her-1 and 2 ) , and cytokeratins 5/6 3 - 5 . the clinical course and prognosis of these subtypes differ substantially . inflammatory and pregnancy - associated breast cancers have the most aggressive clinical course , in which many tumors had undergone extensive invasion or metastasis at the diagnosis 6 - 9 . in sharp contrast , small tubular and mucinous carcinomas have the most indolent clinical course , in which most pre - invasive tumors do not progress during patients ' lifetime 1,2 . despite the substantial differences in the morphology and immunohistochemistry , all breast cancer subtypes are likely to share a common pathway for invasion due to their common structural features . the epithelium of all normal and pre - invasive breast cancers is physically separated from the stroma and vascular structures by a dense fibrous capsule consisting of the basement membrane and a layer of myoepithelial cells ( except tubular carcinoma ) , which are permanent structural elements and are largely independent of hormonal regulation and biophysiological condition 10 - 12 ( fig 1 ) . thus , the disruption of the tumor capsule is a pre - requisite for all breast cancer subtype derived invasion . as the absence of the myoepithelial cell layer is one of the most distinct morphological features of invasive breast lesions , our recent studies have attempted to elucidate the early alterations of the myoepithelial cells and their impact on associated epithelial cells during tumor progression . our studies of about 1,000 cases of human breast tumors revealed that a subset of pre - invasive tumors harbored focal disruptions ( the absence of myoepithelial cells resulting in a gap larger than the combined size of at least 3-epithelial cells ) in the surrounding tumor capsules . the frequency of focal disruptions varied significantly , from none in a majority of the cases to about 1/3 of the pre - invasive tumor nests showing focal tumor capsule disruptions in about 15% of the cases 13 - 17 . focal disruptions in the tumor capsule appear to substantially impact both the morphological and biological presentations of associated epithelial cells . epithelial cells overlying these focal disruptions were generally arranged as tongue- or finger - like projections . cells within different projections from the same case or different cases were morphologically similar , but they often differed substantially in size , shape , density , and polarity from adjacent cells within the same tumor . these cell projections also displayed the following unique features : the size of these cell projections varied from a few to over 100 individual cells . some large cell projections penetrated deep into the stroma , and cells at the tip of projections were often disassociated from the tumor core ( fig 2 ) . focal tumor capsule disruptions with budding cells were seen in all breast cancer subtypes with a higher frequency in aggressive and lower frequency in indolent lesions . all or nearly all the cells within a vast majority ( over 86% ) of the budding cell projections overlying focally disrupted tumor capsules were consistently devoid of er expression , whereas all or nearly all adjacent cells within the same tumors were strongly positive for er ( fig 3 ) . a majority of these cell projections showed substantially elevated expression of her-2 and cell surface adhesion molecule e - cadherin 18,19 . the sub - cellular localization of both her-2 and e - cadherin , however , was cytoplasmic , rather than the typical membrane - association 18,19 ( fig 4 ) . in 5 selected cases , these budding cell projections overlying focally disrupted tumor capsules and adjacent counterparts within the same tumor were microdissected and assessed for loh . budding cell projections had significantly higher or different loh in 10 of the 15 markers 13 ( fig 5 ) . although tumor cell budding from focally disrupted tumor capsules was seen in all breast cancer subtypes , the frequency and size of the capsule disruptions and the cell projections varied significantly among different subtypes . large focal disruptions and large budding cell projections ( with about 100 individual cells ) were exclusively or preferentially seen in duct - derived and clinically more aggressive subtypes . clinically indolent tubular carcinoma has the lowest frequency of tumor capsule disruptions with budding tumor cells ( not shown ) . the size of these cell projections varied from a few to over 100 individual cells . some large cell projections penetrated deep into the stroma , and cells at the tip of projections were often disassociated from the tumor core ( fig 2 ) . focal tumor capsule disruptions with budding cells were seen in all breast cancer subtypes with a higher frequency in aggressive and lower frequency in indolent lesions . all or nearly all the cells within a vast majority ( over 86% ) of the budding cell projections overlying focally disrupted tumor capsules were consistently devoid of er expression , whereas all or nearly all adjacent cells within the same tumors were strongly positive for er ( fig 3 ) . a majority of these cell projections showed substantially elevated expression of her-2 and cell surface adhesion molecule e - cadherin 18,19 . the sub - cellular localization of both her-2 and e - cadherin , however , was cytoplasmic , rather than the typical membrane - association 18,19 ( fig 4 ) . in 5 selected cases , these budding cell projections overlying focally disrupted tumor capsules and adjacent counterparts within the same tumor were microdissected and assessed for loh . budding cell projections had significantly higher or different loh in 10 of the 15 markers 13 ( fig 5 ) . although tumor cell budding from focally disrupted tumor capsules was seen in all breast cancer subtypes , the frequency and size of the capsule disruptions and the cell projections varied significantly among different subtypes . large focal disruptions and large budding cell projections ( with about 100 individual cells ) were exclusively or preferentially seen in duct - derived and clinically more aggressive subtypes . clinically indolent tubular carcinoma has the lowest frequency of tumor capsule disruptions with budding tumor cells ( not shown ) . it is a commonly held belief that the disruption or degradation of the tumor capsules is triggered primarily , if not solely , by an overproduction of proteolytic enzymes produced by cancer or stromal cells 20 - 22 . first , although most pre - invasive breast cancers show high levels of proteolytic enzyme expression , only about 30% of them show the degradation of the tumor capsules and subsequent invasion 23 - 27 . second , results from worldwide human clinical trials with a wide variety of proteolytic enzyme specific inhibitors to treat or prevent tumor invasion have been very disappointing 28,29 . based on results from our recent studies 13 - 19 , we have proposed that tumor capsule degradation and tumor invasion is triggered by focal myoepithelial cell degeneration - induced autoimmunoreactions that cause focal disruptions in the tumor capsule , which selectively favor monoclonal proliferation of tumor stem cells or biologically more aggressive cell clones overlying the focal disruptions 30 . the rationale of our hypothesis is that : since the myoepithelial cell layer is the sole source of several tumor suppressors and the epithelium is normally devoid of blood vessels and lymphatic ducts , a focal disruption in the tumor capsule is likely to have several consequences : ( 1 ) a localized loss of tumor suppressors and paracrine inhibitory functions , which confers tumor cell growth advantages to escape from the programmed cell death 31,32 , ( 2 ) a localized increasing of permeability for nutrients and growth factors , and altered oxygen level , which selectively favors the proliferation of progenitor or stem cells 33,34 , ( 3 ) a localized increasing of leukocyte infiltration , which directly export growth factors to tumor cells through direct physical contact 35,36 , and ( 4 ) the direct tumor - stromal cell contact , which augments the expression of stromal mmp or represses the expression of e - cadherin and other cell surface adhesion molecules , which facilitates epithelial - mesenchymal transition 37,38 . these alterations could individually or collectively lead to increasing proliferation and motility in tumor cells overlying focally disrupted tumor capsules . together , our findings suggest that tumor cell budding from focally disrupted tumor capsules is likely to represent a common pathway shared by all breast cancer subtypes for their invasion . as the disruption of the tumor capsule is a pre - requisite for tumor invasion , budding cell projections from focally disrupted tumor capsules seen in our studies are likely to represent the direct precursors of invasive lesions . our findings and speculation are in total agreement with those of previous studies of human esophageal and colorectal cancers , which have shown that tumors with budding cells have a significantly more aggressive clinical course and worse prognosis 39 - 41 . thus , microdissecting these budding cell projections for molecular and biochemical analyses could potentially lead to the identification of the specific trigger factors for tumor invasion . the development of a quantitative immunohistochemical assay to measure the frequency and extent of tumor capsule disruptions with budding cells may significantly facilitate early detection of pending invasive tumors or patients at greater risk to develop invasive tumors . the development of therapeutic agents to specifically target these budding tumor cell projections could potentially provide the most effective regimen for early intervention and prevention of breast cancer invasion . however , it is currently very difficult , if not impossible , to fully elucidate the molecular and biochemical profiles of these very limited budding cells , due to the lack of sensitive technical approaches .
human breast cancer represents a group of highly heterogeneous lesions consisting of about 20 morphologically and immnohistochemically distinct subtypes with substantially different prognoses . our recent studies have suggested that all breast cancer subtypes , however , may share a common pathway , tumor cell budding from focally disrupted tumor capsules , for their invasion . the potential mechanisms and clinical implications of our observations are discussed .
medical errors ( mes ) and adverse drug reactions ( adr ) still persist as important factors for outpatient and in - patient treatments . additional awareness of patient safety has been established since 1999 , when the institute of medicine issued its report to err is human : building a safer health system . the statement was based on analysis of several studies by several organizations reporting the annual mortality rate of 44,000 to 98,000 people because of preventable mes . mes are critical dilemmas in all patients , and may increase the length of hospital stay , expenses , mortality and morbidity . adverse drug events ( ade ) is defined as an injury resulting from medical intervention related to a drug , and adr is considered as an effect that is noxious and unintended which occurs at doses used in an individaul for prophylaxis , diagnosis , or therapy . the medication inaccuracy problems have been of concern from more than two decades ago ; in 1995 the adverse drug event prevention study addressed prescription errors and ades in hospitalized adults . ades had a rate of 6.5 per 100 adult admissions ; and most of them were costly with severe squeals . another study reported 5 mes per 100 prescriptions , 7 in 100 were harmful , and 1 in 100 resulted in an injury . in the harvard medical practice study in 1991 , the most common ades were complications associated to medication use with 30% mortality or long - term disability among patients with drug - related injuries . for decades , pharmacists have been involved in reducing the mes . in addition to medical issues for patients , their services were also cost saving or cost avoiding . such services consisted of traditional clinical pharmacy services , responding to medical emergencies , consulting on medication topics , identifying and reducing mes , and providing medication histories at hospital admission . a review of articles published between 1980 and 2002 , reported that ades occurred among 0.7% - 6.5% of hospitalized patients , of which 56.6% were considered to be preventable . furthermore , ades accounted for 2.4% to 4.1% of admissions to inpatient services , being preventable in 69.0% of cases . this review also revealed that in up to 57.0 per 1,000 orders , ade occurred at the ordering stage . between 18.7% and 57.7% of those errors had the potential for harm , but only in about 1% were preventable . an 8.5-month prospective study in a dutch intensive care unit ( icu ) compared a baseline period with an intervention period in 1,173 patients . during the intervention period , an icu hospital pharmacist reviewed medication orders , considered prescriptions , formulated recommendations , and discussed those with the attending icu physicians . the incidence of prescribing errors during the intervention period was significantly lower than during the baseline period : 62.5 per 1,000 monitored patient - days versus 190.5 per 1,000 monitored patient - days , respectively . preventable ades were reduced from 4.0 per 1,000 monitored patient - days during the baseline period to 1.0 per 1,000 monitored . more studies are being conducted regarding ward - oriented pharmacy services . some studies on mes and ades in iran reported cases of avoidable mes . in a study conducted in a tertiary - care teaching hospital in tehran , almost 60% of ades the most probable reasons were incorrect medication doses , intervals , and choice of the prescribed drugs . another study showed that , medication - related problems in iran were responsible for 11.5% of hospital admissions and were mostly avoidable . these studies underscore the importance and benefits of contribution of ward - based clinical pharmacists and/or the computerized physician order entry ( cpoe ) in the iranian healthcare system . this issue is of special concern for those clinical settings , which are significantly dependent on accurate dose calculation such as the neonatal and pediatric wards . in the collaboration strategic plan , iran suggested expanding the use of health information technology and evidence - based decision - making in the health sector ; therefore in 2007 , a cpoe project was started in iran . several studies in adult and pediatric patients have confirmed the capability of cpoe in reducing different types of mes . a 4-month study conducted in shiraz , iran suggested that the presence of a clinical pharmacist at the nephrology ward helps in early detection of prescription errors , and therefore potential prevention of negative consequences due to drug administration . children are at higher risk of mes than adults are , this is because of weight - based dosing and small acceptance to a dosing fault in the pediatric age group . during the last three decades , several mechanistic and clinical pharmacology studies have shown the age - mediated changes of absorption , distribution , metabolism and excretion processes of medications . in turn , these changes would affect the pharmacology response and the safety in pediatric patients compared to adults . in addition to treatment modalities for children suffering from a disease , some trials might be considered for children having a disorder as obesity . the mes as medication dosage and adr should be also taken into account for such interventions in the pediatric age group . limited information exists on the epidemiology and prevention of mes and ades in pediatric in - patient and outpatient settings . the problem is to a great extent in the neonatal wards with more sensitive patients who are at higher risk to mes . the history of these topics goes back to 80s ; a 9-month pharmacy- based review in two pediatric hospitals identified 0.45 to 0.49 ordering errors per 100 medication orders . in this study , those patients with less than two years of age and those hospitalized in the pediatric icu were mainly at risk of mes . the most common type of mes was antibiotic dosing error . in another study , although the me rates were similar in pediatric and adult hospitals , the potential ades were reported to occur three times more often in newborns than in other age groups . these events mostly happened at the prescribing stage and dosage error was the most usual type of mes . a prospective multicenter cohort study on pediatric general medical wards in five european and non- european hospitals reported a total of 328 adrs in 16.7% of patients . use of five or more low - risk drugs per patient or three or more high - risk drugs was strong predictors for adrs . a study on 10778 medication orders revealed markedly high rate of potential ades in neonates and in the neonatal icu . the analysis of mes in two hospital wards in japan revealed that longer working hours of pharmacists in the ward resulted in less medication - related errors ; this was especially significant in the internal medicine ward than in the surgical ward . interventions of clinical pharmacist have several outcomes in terms of health - related quality of life , patient satisfaction , medication appropriateness , financial issues , and increase the average drug compliance rate , and decrease in ades , adrs , and the duration of hospital stay . accumulating studies suggest that pharmacist interventions have major impact on reducing mes in pediatric patients , thus improving the quality and efficiency of care provided . studying the 10-year trend of mes in toronto , canada showed that a mixture of initiatives has resulted in more than a 50% reduction of mes in the pediatric patients . total errors ( actual and potential ) decreased for nurses and physicians by half and for pharmacists by 75% . moderate and severe errors decreased by more than 70% . in a prospective cohort conducted in the pediatric , neonatal icu , and postnatal wards in new zealand , all patients admitted for more than 24 hours over a 12-week period were studied . medication - related events were identified by chart review , attendance at multidisciplinary clinical meetings , parent / career / child interviews , and voluntary or verbally solicited reports from staff . the study comprised 495 eligible patients , who had a total of 520 admissions and 3037 patient - days of admission , with 3160 written prescriptions . ades occurred at a rate of 2.1 per 100 prescriptions , 12.9 per 100 admissions , and 22.1 per 1000 patient - days . the total number of days attributed to ades was 92 ( range 1 - 26 days ) ; of these , 58 were deemed preventable days and 34 non - preventable days . in general , over half of the ades were considered to be preventable . in a two - year study on 180 pediatric beds and 138 obstetrics and gynecology beds the activities of pediatric pharmacists was analyzed . it found that pharmacists had completed an average of 0.016 interventions / patient - day . overall , 1.7% of the detected mes were potentially lethal ( 35 cases ) , while 10.2% ( 210 cases ) were clinically serious . the main reason for the interventions was the detection of a dosage between 1.5- and tenfold higher than the recommended dosage . pediatric patients had a four - fold higher risk of serious errors than the maternity population . ades represent a considerable threat for the pediatric patients and may pose large costs upon the healthcare sector . given that half of the ades are considered to be preventable , it is important to develop strategies to prevent and ameliorate ades both to improve the quality of patient care and to reduce healthcare costs clinical pharmacists can be of great help for pediatric patients . the other role of clinical pharmacists can be the decrease in some infections , as respiratory syncytial virus . moreover , recently the pediatric pharmacy advocacy group ( ppag ) highlighted a need for increased education of both student and practicing pharmacists for infants and children . ppag advocates for the involvement of pediatric pharmacists in pharmacogenomic testing and in using those results to provide safe and effective medication use in pediatric patients . the findings of a study in three pediatric units in the u.s . showed that the presence of a full - time unit - based clinical pharmacist could considerably decrease the rate of serious mes in a pediatric icu , but a part - time pharmacist was not as effective in decreasing errors in pediatric general care units . mes are critical dilemmas in all patients , and may increase the length of hospital stay , expenses , mortality and morbidity . adverse drug events ( ade ) is defined as an injury resulting from medical intervention related to a drug , and adr is considered as an effect that is noxious and unintended which occurs at doses used in an individaul for prophylaxis , diagnosis , or therapy . the medication inaccuracy problems have been of concern from more than two decades ago ; in 1995 the adverse drug event prevention study addressed prescription errors and ades in hospitalized adults . ades had a rate of 6.5 per 100 adult admissions ; and most of them were costly with severe squeals . another study reported 5 mes per 100 prescriptions , 7 in 100 were harmful , and 1 in 100 resulted in an injury . in the harvard medical practice study in 1991 , the most common ades were complications associated to medication use with 30% mortality or long - term disability among patients with drug - related injuries . for decades , pharmacists have been involved in reducing the mes . in addition to medical issues for patients , their services were also cost saving or cost avoiding . such services consisted of traditional clinical pharmacy services , responding to medical emergencies , consulting on medication topics , identifying and reducing mes , and providing medication histories at hospital admission . a review of articles published between 1980 and 2002 , reported that ades occurred among 0.7% - 6.5% of hospitalized patients , of which 56.6% were considered to be preventable . furthermore , ades accounted for 2.4% to 4.1% of admissions to inpatient services , being preventable in 69.0% of cases . this review also revealed that in up to 57.0 per 1,000 orders , ade occurred at the ordering stage . between 18.7% and 57.7% of those errors had the potential for harm , but only in about 1% were preventable . an 8.5-month prospective study in a dutch intensive care unit ( icu ) compared a baseline period with an intervention period in 1,173 patients . during the intervention period , an icu hospital pharmacist reviewed medication orders , considered prescriptions , formulated recommendations , and discussed those with the attending icu physicians . the incidence of prescribing errors during the intervention period was significantly lower than during the baseline period : 62.5 per 1,000 monitored patient - days versus 190.5 per 1,000 monitored patient - days , respectively . preventable ades were reduced from 4.0 per 1,000 monitored patient - days during the baseline period to 1.0 per 1,000 monitored . some studies on mes and ades in iran reported cases of avoidable mes . in a study conducted in a tertiary - care teaching hospital in tehran , almost 60% of ades the most probable reasons were incorrect medication doses , intervals , and choice of the prescribed drugs . another study showed that , medication - related problems in iran were responsible for 11.5% of hospital admissions and were mostly avoidable . these studies underscore the importance and benefits of contribution of ward - based clinical pharmacists and/or the computerized physician order entry ( cpoe ) in the iranian healthcare system . this issue is of special concern for those clinical settings , which are significantly dependent on accurate dose calculation such as the neonatal and pediatric wards . in the collaboration strategic plan , iran suggested expanding the use of health information technology and evidence - based decision - making in the health sector ; therefore in 2007 , a cpoe project was started in iran . several studies in adult and pediatric patients have confirmed the capability of cpoe in reducing different types of mes . a 4-month study conducted in shiraz , iran suggested that the presence of a clinical pharmacist at the nephrology ward helps in early detection of prescription errors , and therefore potential prevention of negative consequences due to drug administration . children are at higher risk of mes than adults are , this is because of weight - based dosing and small acceptance to a dosing fault in the pediatric age group . during the last three decades , several mechanistic and clinical pharmacology studies have shown the age - mediated changes of absorption , distribution , metabolism and excretion processes of medications . in turn , these changes would affect the pharmacology response and the safety in pediatric patients compared to adults . in addition to treatment modalities for children suffering from a disease , some trials might be considered for children having a disorder as obesity . the mes as medication dosage and adr should be also taken into account for such interventions in the pediatric age group . limited information exists on the epidemiology and prevention of mes and ades in pediatric in - patient and outpatient settings . the problem is to a great extent in the neonatal wards with more sensitive patients who are at higher risk to mes . the history of these topics goes back to 80s ; a 9-month pharmacy- based review in two pediatric hospitals identified 0.45 to 0.49 ordering errors per 100 medication orders . in this study , those patients with less than two years of age and those hospitalized in the pediatric icu were mainly at risk of mes . in another study , although the me rates were similar in pediatric and adult hospitals , the potential ades were reported to occur three times more often in newborns than in other age groups . these events mostly happened at the prescribing stage and dosage error was the most usual type of mes . a prospective multicenter cohort study on pediatric general medical wards in five european and non- european hospitals reported a total of 328 adrs in 16.7% of patients . use of five or more low - risk drugs per patient or three or more high - risk drugs was strong predictors for adrs . a study on 10778 medication orders revealed markedly high rate of potential ades in neonates and in the neonatal icu . the analysis of mes in two hospital wards in japan revealed that longer working hours of pharmacists in the ward resulted in less medication - related errors ; this was especially significant in the internal medicine ward than in the surgical ward . interventions of clinical pharmacist have several outcomes in terms of health - related quality of life , patient satisfaction , medication appropriateness , financial issues , and increase the average drug compliance rate , and decrease in ades , adrs , and the duration of hospital stay . accumulating studies suggest that pharmacist interventions have major impact on reducing mes in pediatric patients , thus improving the quality and efficiency of care provided . studying the 10-year trend of mes in toronto , canada showed that a mixture of initiatives has resulted in more than a 50% reduction of mes in the pediatric patients . total errors ( actual and potential ) decreased for nurses and physicians by half and for pharmacists by 75% . moderate and severe errors decreased by more than 70% . in a prospective cohort conducted in the pediatric , neonatal icu , and postnatal wards in new zealand , all patients admitted for more than 24 hours over a 12-week period were studied . medication - related events were identified by chart review , attendance at multidisciplinary clinical meetings , parent / career / child interviews , and voluntary or verbally solicited reports from staff . the study comprised 495 eligible patients , who had a total of 520 admissions and 3037 patient - days of admission , with 3160 written prescriptions . ades occurred at a rate of 2.1 per 100 prescriptions , 12.9 per 100 admissions , and 22.1 per 1000 patient - days . the total number of days attributed to ades was 92 ( range 1 - 26 days ) ; of these , 58 were deemed preventable days and 34 non - preventable days . in general , over half of the ades were considered to be preventable . in a two - year study on 180 pediatric beds and 138 it found that pharmacists had completed an average of 0.016 interventions / patient - day . overall , 1.7% of the detected mes were potentially lethal ( 35 cases ) , while 10.2% ( 210 cases ) were clinically serious . the main reason for the interventions was the detection of a dosage between 1.5- and tenfold higher than the recommended dosage . pediatric patients had a four - fold higher risk of serious errors than the maternity population . ades represent a considerable threat for the pediatric patients and may pose large costs upon the healthcare sector . given that half of the ades are considered to be preventable , it is important to develop strategies to prevent and ameliorate ades both to improve the quality of patient care and to reduce healthcare costs clinical pharmacists can be of great help for pediatric patients . the other role of clinical pharmacists can be the decrease in some infections , as respiratory syncytial virus . moreover , recently the pediatric pharmacy advocacy group ( ppag ) highlighted a need for increased education of both student and practicing pharmacists for infants and children . ppag advocates for the involvement of pediatric pharmacists in pharmacogenomic testing and in using those results to provide safe and effective medication use in pediatric patients . the findings of a study in three pediatric units in the u.s . showed that the presence of a full - time unit - based clinical pharmacist could considerably decrease the rate of serious mes in a pediatric icu , but a part - time pharmacist was not as effective in decreasing errors in pediatric general care units . clinical pharmacists have critical role in reducing mes , adr , and ade ; this is of crucial importance for the pediatric patients . this review underscores the importance of pharmacist - physician - patient collaboration for all patients notably in the pediatric age group . both authors contributed the idea of research , design of study , data analysis and manuscript preparation .
medication errors ( me ) and adverse drug reactions still continue to be the important factors for out- and in - patient treatments . mes are critical troubles in all hospitalized populations that can increase length of hospital stay , expenses , mortality and morbidity . in many countries , clinical pharmacists have been involved in reducing mes from years ago . a growing body of evidence suggests that pharmacist interventions have major impact on reducing mes in pediatric patients , thus improving the quality and efficiency of care provided . this paper presents a literature review on the role of clinical pharmacists in reducing mes , and underscores the importance of pharmacist - physician - patient collaboration for all patients notably in the pediatric age group .
the global annual incidence of primary malignant central nervous system ( cns ) tumors is around 37 per million for male and 26 per million for female [ 1 , 2 ] , with gliomas constituting the majority . in the past several years , it has been well established that quite a few clinical and histopathological parameters are helpful in predicting the clinical outcome of cancer patients . currently , well - established techniques like morphometry , stereology , static image , and flow cytometry are routinely used in diagnostic quantitative pathology . the potential significance of these techniques includes the objective distinction between benign , borderline , and malignant lesions ; the objective grading of invasive tumors ; and the prediction of prognosis and therapeutic response . computer - assisted image analysis is a new powerful tool for high - precision measurement of different facets of tumor cells to achieve similar goals [ 37 ] . to date only few studies have utilized nuclear morphometric measurements , like mean major axis ( majx ) , minor axis ( minx ) , nuclear area ( na ) , nuclear perimeter ( np ) , and roundness of nucleus ( nr ) , to determine the nuclear size and shape profiles in neoplastic tissues in cns tumors [ 612 ] . the initial four parameters , namely , majx , minx , na , and np , are related to nuclear size ( hypertrophy ) , while nr is related to nuclear shape . in the present study , mean nuclear density ( nd ) and percentage of total nuclear area ( % tna ) the main objectives of this study were to correlate morphometrically measured majx , minx , na , np , nr , nd , and % tna with who grade of diffusely infiltrating gliomas ( dig ) ; and to assess their ability to differentiate normal from neoplastic areas . the present study included biopsies from thirty cases of digs that were managed at this tertiary care institute during 20092011 . the spectrum of cases included ( a ) 14 cases of low - grade gliomas [ lgg : ten diffuse astrocytoma ( da : who grade - ii ) , four oligoastrocytoma ( oa : who grade - ii ) ] and ( b ) 16 cases of high - grade gliomas [ hgg : thirteen glioblastoma multiforme ( gbm : who grade - iv ) , three anaplastic astrocytoma ( aa : who grade - iii ) ] . brain tissue from ten autopsy cases ( three of ischemic stroke ; two of haemorrhagic stroke ; and five without any gross or microscopic brain pathology ) without cns tumours , on histology , constituted the controls . the mean age at surgery was 39.1 years ( range : 962 years ) for lgg and 54.6 years ( range : 2779 years ) for hgg . there was only one case in the pediatric age ( < 18 years ) group ( low grade astrocytoma ) . morphometric analysis was performed on hematoxylin and eosin ( h&e)-stained histological sections of 5-micron thickness of formalin fixed paraffin - embedded cns tissue , having optimal histological detail . a computerized digital photomicrograph system ( dewinter optical inc . with digi eye 330 digital photomicrography camera and biowizard 4.2 image analysis software ) was used for image analysis . the measuring scale of the image analysis software was properly calibrated . for each sample , five high power fields ( 400x ) , having maximum cellularity , were recorded for the study . for each case , 100 nuclei , clearly separated from others and relatively larger in size , were chosen to evaluate nuclear shape and size . the nuclei were outlined using a mouse attached to the computer and then separated from others prior to the determination of their nuclear parameters using the software ( figure 1 ) . after measurement , the data has been transferred to an ms - excel sheet for further analysis . nuclei were analyzed for major axis ( majx ) , minor axis ( minx ) , nuclear area ( na ) , nuclear perimeter ( np ) , and nuclear roundness ( nr ) . the nuclear roundness is expressed as [ ( 4nuclear area)/(nuclear perimeter ) ] 100 in percentage . thus , for a perfectly round nucleus its value is maximum , that is , equal to 100 . a nucleus having irregular shape had smaller value of nr . counting of nucleus was done in the five recorded high power fields from which the mean nuclear density ( nd ) was calculated . the percentage of total nuclear area ( % tna ) was determined for the five high power fields for each sample using the software , and their mean was calculated . the various parameters used to analyze were majx , minx , na , np , and nr for each nucleus of every sample of the three groups . the mean values of these parameters with standard deviation ( sd ) and range were calculated for the three groups : cg , lgg , and hgg . student 's t - test was performed to evaluate the difference in majx , minx , na , np , nr , nd , and % tna for each pair of the groups , and the p values were determined . data was reported as mean , standard deviation of mean , and range of mean for these parameters . the statistical correlations of the analyzed morphometric parameters with tumor grades of all samples were investigated ; correlations of nd with na and np were also studied . pearson correlation coefficient ( r ) and p value were calculated , and regression line was drawn in correlation studies . the distribution of the measured area of nucleus for five samples of each group is also shown along with the calculated gaussian distribution of nuclear area using mean and sd of the respective group . figures 2(a)2(g ) represent the correlation of the mean values of majx , minx , na , np , nr , nd , and % tna of each sample with who grade ( 2007 classification ) , respectively . in case of controls , the parameters : majx , minx , na , np , nd , and % tna , showed strong positive correlation with tumour grade ( r > 0.70 ) , whereas nr demonstrated mild negative correlation with grade ( r = 0.42 ) . the mean values of nuclear parameters and age at the time of surgery with standard deviation ( sd ) and range for controls , lgg , and hgg are presented in table 1 . the p values to predict the difference of each pair of these three groups for all the parameters are also presented in this table . the mean values of majx , minx , na , np , nr , nd , and % tna of the three groups were represented in figures 3(a)3(g ) respectively ; the range of the parameters for each group was presented as error bar in the figures . it was noted that the nuclear parameters : mean majx , minx , na , np , nd , and % tna , of the two tumor groups , lgg and hgg were significantly greater than the controls ( p < 0.0004 ) and that nr in hgg was significantly smaller than the controls ( p = 0.0125 ) . again , between two tumor groups , age , majx , minx , na , np , nd , and % tna in hgg were significantly greater than lgg ( p < 0.05 ) , unlike nr ( p = 0.4011 ) . the mean age of the cg was 46.3 years ( range : 4053 years ) . nuclei , in the control tissues , were evenly distributed , with mean majx : 6.96 m ( range : 6.23 m8.07 m ) , mean minx : 4.62 m ( range : 4.18 m5.30 m ) , mean na : 23.44 m ( range : 19.42 m30.33 m ) , mean np : 21.54 m ( range : 18.84 m25.33 m ) , and mean nr : 65.55 ( range : 59.8573.48 ) . nd was 1107 mm ( range : 849 mm1282 mm ) , while mean % tna was 2.32 ( range : 1.653.33 ) . in lgg , the following was noted mean majx was 9.41 m ( range : 7.51 m10.30 m ) ; mean minx was 6.34 m ( range : 4.98 m7.56 m ) ; and mean na was 42.62 m ( range : 27.15 m55.23 m ) ; mean np was 29.79 m ( range : 23.34 m32.74 m ) ; and mean nr was 61.53 ( range : 48.9970.43 ) . nd was 3232 mm ( range : 1456 mm5633 mm ) , and mean % tna was 9.98 ( range : 3.6317.35 ) . majx , minx , na , np , nd , and % tna in lgg were significantly larger than controls ( p < 0.0004 ) but significantly smaller than the hgg ( p < 0.05 ) . age of patients was also found significantly lower in lgg as compared to hgg ( p = 0.0116 ) . the mean age of the hgg was 54.6 years ( range : 2779 years ) . in this group the following was noted : mean majx was 10.73 m ( range : 8.90 m12.87 m ) ; mean minx was 7.11 m ( range : 4.66 m8.70 m ) ; mean na was 55.22 m ( range : 30.26 m76.90 m ) ; mean np was 34.24 m ( range : 28.92 m41.91 m ) ; and mean nr was 59.78 ( range : 48.9470.40 ) . nd was 4350 mm ( range : 1941 mm6360 mm ) and mean % tna was 15.88 ( range : 6.6435.33 ) . majx , minx , na , np , nd , and % tna in lgg were significantly larger than controls ( p < 0.0001 ) , and lgg ( p < 0.02 ) . in hgg , the mean age was also found significantly higher than lgg ( p = 0.0116 ) , and mean nr was significantly lower than controls ( p = 0.0125 ) . figures 4(a ) , 4(b ) , and 4(c ) represent the measured distribution of nuclear area of cg , lgg , and hgg for five samples of each group . it was observed that the distributions for the normal samples were nearly gaussian with smaller range , but in tumors , the distributions deviated from gaussian pattern and displayed larger range and smaller height than the controls . figure 4(d ) shows the predicted gaussian distribution of nuclear area for cg , lgg , and hgg , using mean na and mean sd of na of respective group . figures 5(a ) and 5(b ) represent scatter plots of nd versus na and np for all study and control samples with linear regressions . both na and np showed strong positive correlation with nd , but np exhibited better correlation ( r = 0.72 ) than na ( 0.70 ) . nuclear morphometric features have a potential role in differentiating between the different grades of gliomas and predicting patient survival [ 68 ] . niedermayer et al . studied nuclear area percentage , nuclear size , and pleomorphism in gliomas . using the regression analysis of survival data , they observed that the best predictors for patient outcome were grading , as observed on histology , and nuclear area percentage , as evaluated by image analysis . reported that the shape factor in conjunction with nuclear pleomorphism and mitotic activity might possess a better ability to distinguish atypical and malignant meningiomas . in a recent study on meningiomas , noy et al . described that tumors with less nuclear orientation , more nuclear density , higher fractal dimension , and less regular chromatin textures had a tendency to recur faster . in the present study , we observed that in cases of cns lesions , a panel of nuclear parameters evaluated by image morphometry was not only able to reliably distinguish normal from neoplastic areas , but also to indicate consistently the grade of tumour . nuclei of astrocytic cells in the control groups had the smallest value of majx , minx , na , np , and nd and % tna , while neoplastic astrocytes of hgg measured the largest . in cases of parameters related to size of the nucleus , namely , majx , minx , na , and np , a strong positive correlation with tumour grades ( r > 0.78 ) could be observed , which is translated as follows : the bigger the size of the nucleus , the higher is its probability of being a glioma of higher grade . of these , np and majx displayed the best correlation ( r = 0.83 ) . nd and % tna , parameters related to the rate of growth of a tumor , showed strong positive correlation with tumour grade ( r > 0.74 ) , thus confirming that higher grade tumors are indeed more susceptible to a rapid rate of growth . the faster growth rate in higher - grade tumor leads to an increase in the number density of nucleus , which is histologically seen as closely packed tumor cells with higher percentage of tumour area occupied by dysplastic nuclei . in the current study , na and np exhibited strong positive correlation with nd , with np being better . it is accepted that in high - grade tumors the nutritional and oxygen demands per unit volume of tissue are higher , which it tries to compensate by stimulating various proangiogenic factors like hypoxia inducible factor ( hif-1 ) that enhances the microvascular networks in the tumour . however , the increased nutritional and oxygen requirements per unit volume of tissue in hgg may not always be fulfilled by the increased microvascular network . therefore , it can be hypothesized that the nuclei of the tumour cells enlarge in an effort to increase their surface area so as to enhance the diffusion rate to maintain their required metabolic function . in support of this , it was observed that np directly related to the surface area of a nucleus in three - dimensional cases , showed the best correlation with the tumour grade and nuclear density . the nuclear roundness , which was related to shape of the nuclei , showed a mild negative correlation with tumour grade ( r = 0.42 ) . hence , the nuclear size and parameters related to tumor growth have more importance in comparison to the parameters related to nuclear shape , for assessment of tumour grade by a quantitative morphometric method . owing to its high nuclear density , all the nuclei of a closely packed high - grade tumour may not receive sufficient nutrients . in an effort to compensate there is enhancement in the rate of diffusion , which the tumour cell performs by escalating its surface area per unit nuclear mass , a feature that is seen histologically by the severe pleomorphism in shape of the cells ( i.e. , deformity in its shape from ideal spherical one ) . owing to this the nuclear area distributions were nearly gaussian pattern for the control group , while they deviated from the gaussian pattern in case of tumours , a feature that can be potentially applied to reliably differentiate neoplastic from normal areas in cytology and in evaluation of stereotactic biopsies . it was noted that there was a decrease in the height of the distribution and an increase in the range of the distribution with an increase in tumour grade ( figures 4(a)4(c ) ) , as expected from their hypothetical gaussian distribution ( figure 4(d ) ) . the nuclear area distribution pattern may be useful for the classification of tumor grade in diffusely infiltrating gliomas . in conclusion , our study showed a definitive correlation between various nuclear morphometric parameters with tumor grade in diffusely infiltrating gliomas . the nuclear morphometric study can be gainfully utilized not only to distinguish normal from neoplastic tissue , but also to differentiate between the various grades of gliomas . it also serves as an excellent model to comprehend various facets of tumour and tumour cell physiology . the present study also revealed that the tumor grade had a better correlation with nuclear enlargement than with nuclear roundness , where majx and np showed the best correlation with grades ( r = 0.83 ) . the nuclear area distribution pattern may also be gainfully utilized for identification of different grades of gliomas . these features have potentially immense utility in diagnostically challenging scenarios , like intraoperative cytological specimen , and in the analysis of tiny specimen as in stereotactic biopsies .
introduction . the ability to reliably differentiate neoplastic from nonneoplastic specimen and ascertain the tumour grade of diffusely infiltrating gliomas ( digs ) is often challenging . aims and objective . to evaluate utility of image morphometry in identifying dig areas and to predict tumour grade . materials and methods . image morphometry was used to analyze the following nuclear features of 30 digs and 10 controls ( cg ) : major axis of nucleus ( majx ) , minor axis of nucleus ( minx ) , nuclear area ( na ) , nuclear perimeter ( np ) , nuclear roundness ( nr ) , nuclear density ( nd ) , and percentage of total nuclear area ( % tna ) . results . statistically significant differences in all parameters , except nr , were observed between all groups , with strong positive correlation with tumour grade ( r > 0.7 ) . the mean values were maximum for hgg and minimum for cg . for nr , the difference between cg / hgg was statistically significant , unlike cg / lgg and lgg / hgg . it was observed that na distributions for cg were nearly gaussian type with smaller range , while gliomas displayed erratic pattern with larger range . na and np exhibited strong positive correlation with nd . conclusion . image morphometry has immense potential in being a powerful tool to distinguish normal from neoplastic tissue and also to differentiate lgg from hgg cases , especially in tiny stereotactic biopsies .
bariatric surgery is the most effective treatment for severe obesity often resulting in excess weight loss of 5080% [ 1 , 2 ] and improved psychological wellbeing and health - related quality of life ( hrqol ) [ 35 ] . in addition , particularly , roux en - y gastric bypass ( rygb ) has been shown to lead to remission of type 2 diabetes and consequently many severely obese individuals with type 2 diabetes seek out this surgical procedure . however , results vary and 7%50% of patients undergoing bariatric surgery do not achieve a successful weight loss ( % ewl < 50 ) or regain weight when the surgical effects begin to abate [ 79 ] . a growing body of research has suggested that emotional and psychological impairments after surgery influence or may even be the cause of the suboptimal weight loss and weight regain in some bariatric patients [ 10 , 11 ] . before surgery , bariatric patients report elevated levels of mental distress and reduced hrqol compared with the general and nonsurgical obese population . also , in bariatric populations , the prevalence of current psychiatric disorders has been found to be as high as 56% and up to 73% report to have had at least one psychiatric disorder at some point in their life . in defining a successful treatment outcome after bariatric surgery , unfortunately , the importance of postoperative psychological factors has often been overlooked in the bariatric literature and further research is highly needed . type 2 diabetes and lack of physical activity in bariatric patients have previously been associated with decreased weight loss after surgery [ 1416 ] . however , the predictive value of preoperative medical comorbidities and behavioural factors including type 2 diabetes and physical activity , for mental health and hrqol , is currently unclear . it is well established that medical comorbidities such as type 2 diabetes are associated with impaired mental health and hrqol both in the general and in the nonsurgical obese population [ 1820 ] . for instance , a large meta - analysis of 42 studies with a combined total of 20.218 subjects concluded that individuals with diabetes have twice the risk of depression compared with nondiabetic individuals . however , in a recent study , we investigated mental health and hrqol in 129 rygb candidates and found indications that the relation between type 2 diabetes and mental health may differ in the bariatric population . more specifically , results from this study showed that bariatric patients with type 2 diabetes presented for rygb surgery with better mental health and hrqol compared with nondiabetic patients , especially with regard to physical aspects of hrqol . these results suggest that , in our study , patients with type 2 diabetes sought out the surgical option at an earlier stage than the nondiabetic patients , primarily to target their diabetes . in contrast , the nondiabetic patients may have experienced severe mental and physical impairments before considering surgical obesity treatment . despite the observed psychological differences between patients with and without type 2 diabetes , no studies have investigated the predictive value of baseline type 2 diabetes for the mental health and hrqol after bariatric surgery . in addition , lack of physical activity has been associated with poor mental health and reduced hrqol in the bariatric population . in a large cohort of severely obese adults , king et al . found an inverse association between physical activity and mental health prior to undergoing bariatric surgery . furthermore , a study with 131 bariatric patients reported that both frequency and intensity of physical activity one year after rygb were independently associated with better mental hrqol and fewer depressive symptoms . these results suggest that the lack of physical activity may negatively predict mental health and hrqol after bariatric surgery . however , to our knowledge , no studies have prospectively investigated the effect of physical activity on mental health among bariatric patients . furthermore , while these studies provide some evidence of an association between physical activity and psychological wellbeing among bariatric patients , the majority of the research relies on self - reported physical activity [ 2325 ] and no studies have investigated the relation using an objective measure of the patients ' actual physical fitness level . to address these shortcomings in the literature , the aim of this study was to prospectively investigate the effect of objectively measured baseline type 2 diabetes and physical fitness level on mental health , hrqol , and weight - related body image after rygb . the current study is part of the larger gasmito study ( the national committee on health research ethics , study protocol number hc-2009 - 050 ) that prospectively investigates psychological and physiological factors in severely obese rygb patients with and without type 2 diabetes from the time before weight loss is started until weight stability is achieved 1.5 years after rygb . all patients were tested at four follow - ups : ( a ) at baseline , prior to weight loss , ( b ) about two months later after a diet induced weight loss , ( c ) 4 months after rygb , and , finally , ( d ) 18 months after rygb . each test session consisted of three test days which included a number of physiological tests including oral and intravenous glucose tolerance tests , 2-hour hyperinsulinemic euglycemic clamp , dual x - ray absorptiometry scan , and incremental bicycle vo2max test . furthermore , the psychological profile of the patients was assessed using a battery of standardized questionnaires including measures of mental symptoms , hrqol , body image , and lifestyle , which were administered at each of the four follow - ups . in total , 40 gasmito participants completed the psychological and physiological tests at baseline , 32 participants at follow - up ( b ) , 31 participants at follow - up ( c ) , and finally 23 participants at follow - up ( d ) . the main reason for dropout was the time associated with the multiple tests days and some tests were furthermore associated with some pain or discomfort . participants were sampled consecutively at the bariatric clinic at hamlet hospital or at kge hospital , two hospitals located in copenhagen and suburban copenhagen area , respectively . participants were contacted at their first presurgical consultation at the hospital or contacted over the phone after their initial consultation and invited to an information meeting before inclusion . all gasmito participants were informed verbally and in writing about the procedures and were asked to sign a consent form before being included in the study . inclusion criteria were in agreement with the danish guidelines for gastric bypass surgery prior to january 2011 , which allowed individuals between 18 and 60 years of age with a bmi > 40 kg / m or bmi > 35 kg / m and obesity - related comorbidities ( e.g. , type 2 diabetes ) to be considered for surgery . exclusion criteria for the current study comprised heart disease , renal disease , or hyper- or hypothyreosis . to assess mental symptoms , a short version of the danish this 90-item checklist assesses the severity of a wide range of mental symptoms and is scored on a scale ranging from 0 to 4 with 4 reflecting the highest level of symptom load . only the three subscales ( 35 items ) measuring somatization , depression , and anxiety were used , as these symptoms are expected to be prevalent among the patients . furthermore , the general severity index ( gsi ) , which reflects both number and severity of symptoms , was calculated as the mean score of all 35 items . to assess quality of life and general health status of the patients ( sf-36 ) , which consists of 36 items evaluating eight aspects of hrqol including physical function , physical role , physical pain , general health , vitality , social function , mental role , and mental wellbeing . raw scores from the sf-36 were transformed to scores ranging from 0 to 100 with 100 indicating the highest level of hrqol . information about the patients ' background , lifestyle , and medical status was obtained using a short version of the questionnaire that was developed as part of the copenhagen aging and midlife biobank ( camb ) . this questionnaire comprises 76 questions providing information on social background , social situation , lifestyle , and physical health status . the body image questionnaire ( biq ) was used to assess the patients ' body image and comprises 50 items scored on a scale from 1 to 5 , with 5 indicating a more positive body image . a mean item score for weight - related items only was calculated as the sum of items 3 , 15 , 19 , 24 , 27 , 30 , 31 , 34 , 40 , 45 , 48 , and 50 divided by 12 . this score was expected to be especially sensitive to weight - related changes in body image . the plasma samples were cooled and centrifuged at 2000 g for 10 minutes before the plasma was stored at 80c until analysis was conducted . remission of type 2 diabetes was defined as hba1c < 42.1 mmol mol , fasting glucose < 5.6 mmol l , and no medication . the vo2max ( ml / min / kg ) is an objective measure of physical fitness level and a direct indicator of the extent of physical activity . a test was considered valid when leveling off was achieved , which was defined as unchanged oxygen uptake despite increasing work load , and when a respiratory exchange ratio greater than 1.15 was observed . maximal oxygen uptake was calculated as the highest average uptake during 20 seconds of exercise . finally , a dual x - ray absorptiometry scan ( dxa scan ) was performed to examine the body composition and body fat distribution of the patients . descriptive statistics were used to investigate patient characteristics at baseline . to avoid losing information due to missing follow - up data points , we analysed the repeated data using a random intercept multilevel model , allowing intercepts to vary between subjects , with within - subjects level 1 ( follow - up time ) and between - subjects level 2 with the subjects gasmito i d as grouping variable for the measures . all analyses of the repeated data were performed using the genlinmixed procedure in spss 20.0 with the robust standard error option to accommodate nonnormality in some of the outcome variables . to investigate the effect of baseline diabetes and physical fitness level on the psychological outcome variables , the multilevel model included follow - up time , sex , age , baseline bmi , baseline vo2max , baseline diabetes , and their interaction with follow - up time as fixed effects covariates . age , bmi , and vo2max at baseline were included as continuous variables in the interaction analyses with follow - up time . in total , 40 bariatric patients were included in the gasmito study , 30% ( n = 12 ) men and 70% ( n = 28 ) women . the participants ' mean age at baseline was 39.5 ( 8.9 ) years , their mean bmi was 42.5 ( 4.5 ) kg / m , and their mean vo2max was 21.2 ( 4.7 ) ml / kg / min , reflecting a very poor to poor level of physical fitness . finally , 35% ( n = 14 ) of the participants had type 2 diabetes at baseline and 65% ( n = 26 ) were classified as nondiabetic . patients with and without diabetes had similar age , weight , bmi , and vo2max prior to surgery . however , body fat % was lower in the diabetic than in the nondiabetic patients ( 45.1% ( 5.9 ) versus 49.6% ( 5.5 ) , p = 0.024 ) . table 1 shows the baseline results for weight , bmi , vo2max , mental symptoms ( scl-90 ) , hrqol ( sf-36 ) , and weight - related body image ( biq ) and the difference in each subscale score from one follow - up to another . these weight - related improvements were highly significant from baseline to follow - up ( b ) immediately before surgery and continued to be highly significant throughout the surgical course . at follow - up ( d ) , 18 months after rygb , the mean percent excess weight loss ( % ewl ) from baseline reached 65% ( 12 ) and percent weight loss ( % wl ) was 30% ( 6 ) , indicating a successful surgical weight loss outcome . patients with and without type 2 diabetes at baseline did not differ significantly with regard to % ewl . at 18-month follow - up furthermore , of the 14 patients with baseline type 2 diabetes , 50% ( n = 7 ) experienced total remission after surgery and only 21% ( n = 3 ) clearly met the criteria for diabetes ( hba1c > 48 ) postoperatively . also , vo2max increased significantly after surgery possibly explained by the decreased body mass of the patients . at 18-month follow - up , the bariatric patients reported a significant reduction of mental symptoms and a significant increase in hrqol and weight - related body image compared with baseline values , indicated by lower scores on the somatization , depression , anxiety , and gsi subscale of the scl-90 and higher scores on the eight sf-36 subscales and the weight - related biq subscale ( p < 0.05 for all subscales ) . as table 1 shows , the improvements were evident in most of the scl-90 and sf-36 subscales from the time immediately before surgery ( follow - up ( b ) ) to four months after surgery ( follow - up ( c ) ) with the most pronounced improvements observed on the physical hrqol subscales . of the scl-90 and sf-36 subscales , only somatization and social function did not improve during the first four postoperative months . furthermore , the somatization , depression , gsi , physical function , vitality , and social function subscales improved postoperatively until 18 months after surgery . finally , the weight - related body image score increased significantly throughout the surgical course and was , together with physical function , the only subscale demonstrating significant changes at each follow - up . in the applied multilevel model , the interaction between follow - up time and type 2 diabetes at baseline was found to be significant for six of the thirteen investigated subscales after adjusting for main effects of sex , age , baseline bmi , baseline vo2max , and their interaction with follow - up time . figure 1 shows the effect of baseline diabetes across follow - ups for the six subscales where this interaction was found to be significant . the only significant main effect of baseline diabetes was observed for the emotional role subscale of the sf-36 ( p = 0.011 ) . however , the interaction between follow - up time and diabetes was significant for the somatization ( p = 0.005 ) , the depression ( p = 0.004 ) , the anxiety ( p = 0.036 ) , and the gsi ( p = 0.001 ) subscales of the scl-90 . in addition , the interaction between follow - up time and diabetes was significant for the physical function ( p = 0.002 ) and the physical role ( p = 0.016 ) subscales of the sf-36 . as illustrated by figure 1 , these results indicate that differences in mental distress and physical aspects of hrqol between patients with and without baseline diabetes were only substantial at baseline assessment , but not at the later follow - ups . no significant main or interaction effects of diabetes were observed for the weight - related body image subscale . physical fitness ( vo2max ) made modest contributions to variations in mental symptoms and hrqol but not weight - related body image . main effects of vo2max were observed for the physical function ( p = 0.031 ) , the physical role ( p = 0.015 ) , and the vitality ( p = 0.018 ) subscales of the sf-36 with higher baseline vo2max associated with higher scores on these subscales . also , the interaction between follow - up time and baseline vo2max was significant for the somatization ( p = 0.000 ) subscale of the scl-90 and the physical role ( p = 0.016 ) and general health ( p = 0.024 ) subscales of the sf-36 suggesting that the effect of baseline physical fitness level on these subscales declines after surgery . to illustrate this , baseline vo2max was recoded into a binary low - high variable using the median ( vo2max = 21.7 ml / min / kg ) to distinguish the two groups . figure 2 shows the effect of baseline physical fitness level on the three subscales , somatization , physical role , and general health , across the four follow - ups . more specifically , the main effect of sex was significant for physical function ( p = 0.030 ) and weight - related body image ( p = 0.004 ) with women demonstrating lower scores than men on these subscales . the interaction between follow - up time and sex was significant for the depression ( p = 0.005 ) score of the scl-90 and the physical function ( p = 0.015 ) , the general health ( p = 0.024 ) , the vitality ( p = 0.032 ) , and the mental health ( p = 0.010 ) scores of the sf-36 . in general , these interactions reflected that sex differences tended to become smaller across follow - ups . however , for the vitality and the mental health subscale of the sf-36 , the direction of the association between sex and these subscale scores changed after surgery and sex differences remained at 18-month follow - up with women reporting higher scores than men . furthermore , a main effect of age was observed for the somatization ( p = 0.028 ) , the depression ( p = 0.007 ) , and the gsi ( p = 0.010 ) subscales with younger patients showing more mental distress than their older counterparts . the interaction between follow - up time and age was significant for the somatization ( p = 0.007 ) , the depression ( p = 0.002 ) , the gsi ( p = 0.015 ) , the vitality ( p = 0.001 ) , the mental health ( p = 0.016 ) , and the weight - related body image ( p = 0.048 ) scores indicating that in general the effect of age on these subscales declines across follow - ups . baseline bmi was of limited predictive value and only showed significant main effects for weight - related body image ( p = 0.040 ) where a lower bmi at baseline was associated with higher body image scores . finally , the interaction between follow - up time and baseline bmi was significant for the vitality ( p = 0.000 ) and the mental health ( p = 0.000 ) subscales suggesting that the effect of baseline bmi on these two subscales decreases from follow - up ( a ) to follow - up ( d ) . to our knowledge , this study was the first study to prospectively investigate the importance of type 2 diabetes and physical fitness at baseline for mental health , hrqol , and weight - related body image among bariatric patients undergoing rygb . in line with consistent findings from prior research [ 4 , 10 ] , mental health , hrqol , and weight - related body image improved significantly from preoperative levels . improvements were most pronounced four months after rygb particularly in physical aspects of hrqol and weight - related body image . the interaction between follow - up time and baseline diabetes was significant for mental health and physical hrqol outcomes indicating that the difference in mental symptoms and physical hrqol between diabetic and nondiabetic patients declines across follow - ups . diabetic patients endorsed fewer mental symptoms and had a higher hrqol and better weight - related body image preoperatively compared with nondiabetic patients . this indicates that diabetic patients seeking rygb may be motivated by their diabetes in contrast to nondiabetic patients that may seek out the surgical option due to substantial obesity - related distress . however , interestingly , the differences in mental symptoms and hrqol between patients with and without diabetes at baseline resolved around the time of surgery . this also suggests that the psychological impairments in the nondiabetic patients may be related to the obese state and therefore immediately influenced by weight loss . it could be speculated that positive expectations to the operation outcome generate an experience of optimism that positively affects the level of mental symptoms and hrqol in the nondiabetic patients around the time of surgery . in fact , improvements in mental health and hrqol were more pronounced initially after surgery in patients that did not have preoperative diabetes compared with patients with diabetes at baseline in spite of the fact that diabetes resolved in 50% of these patients after surgery . one possible explanation is that the differences in psychological wellbeing between patients with and without diabetes reflect preoperative differences in weight - related mental health and hrqol . prior research has suggested that type 2 diabetes is not associated with major impairments of mental and physical functioning among bariatric candidates . in contrast , nondiabetic patients report marked impairments in psychological and physical wellbeing prior to surgery indicating that nondiabetic patients seek out bariatric surgery at a more debilitating stage of the obese state . thus , as suggested , it is possible that bariatric candidates with diabetes primarily seek out surgery to target their diabetes , whereas some bariatric patients without diabetes at baseline seek surgery because of impaired mental health and hrqol related to obesity . it could therefore be speculated that nondiabetic patients experience a major relief when undergoing weight loss and surgery and this might intensify the improvements in mental health and hrqol among these patients initially after surgery . this explanation is supported by a study that investigated motivational factors among 208 gastric banding patients . interestingly , this study found that patients who sought bariatric surgery due to medical comorbidities , primarily hypertension and type 2 diabetes , had fewer depressive symptoms and higher hrqol scores compared with patients who sought surgery to improve other factors including appearance , physical fitness , and physical limitations . however , research investigating the influence of preoperative diabetes on mental health and hrqol after bariatric surgery is currently lacking and should therefore be investigated further . significant increases in physical activity have consistently been reported in prior research [ 23 , 25 ] . these studies have mainly used self - reported physical activity with the risk for patients to overreport their physical activity due to misperceptions or reporting bias . among the bariatric patients in our study , however , preoperative level of physical fitness did not contribute to the differences between diabetic and nondiabetic patients and vo2max was only a main predictor of improvements in the physical function , the physical role , and the vitality subscale of the sf-36 with higher vo2max associated with better physical hrqol . furthermore , the interaction between follow - up time and vo2max was only significant for the somatization subscale of the scl-90 and the physical role and general health subscales of the sf-36 . this may seem surprising since prior research has found that physical activity strongly predicts weight loss outcome [ 14 , 25 ] , fewer depressive symptoms , and higher mental hrqol one year after rygb . however , in contrast to the majority of this research , we used an objective measure as indicator of physical activity . vo2max depends on body mass that is why the observed increase in physical fitness level of our patients may reflect weight loss rather than increased physical activity . thus , with regard to the predictive value of physical activity , the use of different assessment methods may therefore explain the inconsistency between our results and prior findings . finally , numerous attempts have been made to identify demographic predictors of weight loss after bariatric surgery with conflicting results [ 33 , 34 ] . furthermore , the effect of demographic factors including sex and age on psychological outcome after bariatric surgery is understudied and currently unclear . in line with preoperative studies [ 3537 ] , our results showed that women presented for surgery with more mental distress , reduced hrqol , and poorer weight - related body image compared with men . also , younger patients tended to report worse psychological wellbeing compared with their older counterparts . a more positive weight - related body image was observed among patients with lower baseline bmi compared with the patients with a higher bmi . this effect of sex , age , and baseline bmi on mental distress , hrqol , and weight - related body image declined throughout the surgical course for most of the subscales . however , sex differences were observed on two aspects of hrqol 18 months after surgery with women reporting higher scores on the vitality and the mental health subscales of the sf-36 . thus , in terms of hrqol , it may seem that women benefit the most from surgery . in contrast , also using the sf-36 , masheb et al . investigated postoperative hrqol among 137 patients undergoing gastric bypass surgery and found that male sex predicted better mental hrqol 12 months after surgery . also , due to the relatively modest number of men participating in the current study , it is difficult to draw sound conclusions about the effect of sex on postoperative hrqol and further research is therefore highly needed . the current study is an important contribution to the very limited literature investigating type 2 diabetes and psychological outcome after bariatric surgery . the prospective study design and the use of objective methods to assess weight , bmi , type 2 diabetes , and physical fitness are important strengths of the study . in addition , the assessment of four psychological factors contributes to a fairly detailed psychological profile of the bariatric patients . the relatively small sample size , questioning the power of the study , and the lack of comparison with a nonsurgical obese control group are both limitations of the study . thus , significant findings may have been missed and , furthermore , it remains unclear whether the results are specific to the bariatric population or whether they also apply to the severely obese individuals in traditional weight loss programs . thus , it is not possible to infer causality and therefore not possible to examine whether baseline type 2 diabetes or baseline fitness level has causal effects on psychological outcome after rygb surgery . finally , patients were followed up to 18 months to two years after their operation . however , the american society for bariatric surgeons has recommended research to conduct at least 5-year follow - ups and the results of the current study should therefore be considered preliminary . we do acknowledge the importance of longer - term follow - ups and intend to pursue the possibility of extending the follow - up period . this study found significant improvements in bmi , mental health , hrqol , weight - related body image , and physical fitness among the gasmito patients undergoing rygb . the diabetic group had better mental health and hrqol on all psychological measures before surgery . however , these differences resolved around the time of surgery and no significant differences between the two groups were observed postoperatively . thus , this study found no evidence that baseline diabetes should be considered either a positive or a negative predictor of long - term mental health and hrqol after rygb surgery . furthermore , level of physical fitness ( vo2max ) as an indicator of physical activity was not a main predictor of mental health or hrqol outcome . future studies should prospectively investigate the long - term ( > 5-year follow - up ) effects of type 2 diabetes and physical activity on mental health and hrqol in a larger bariatric sample using objective methods to obtain information about weight , bmi , diabetes status , and physical activity . specifically , physical activity is of importance as this factor is clinically meaningful and can potentially be modified . research should therefore seek to clarify the most optimal type and intensity of physical activity that result in successful outcome with regard to both weight loss and psychological wellbeing after bariatric surgery .
objective . to investigate the predictive value of type 2 diabetes and lack of physical activity for mental health and health - related quality of life after roux - en - y gastric bypass . method . forty severely obese patients undergoing roux - en - y gastric bypass were included in the gasmito study . information about physiological and psychological factors was prospectively assessed at four time points , two times prior to surgery and two times after surgery . measures included oral and intravenous glucose tolerance tests , vo2max test , symptoms checklist ( scl-90 ) , short form health survey 36 ( sf-36 ) , body image questionnaire , and a questionnaire assessing sociodemographic factors and medical status . results . mean % excess weight loss was 65% ( 12 ) at 18-month follow - up and 50% of the participants with diabetes experienced total remission . also , significant improvements were observed with regard to physical fitness , mental distress , health - related quality of life , and weight - related body image ( p < 0.05 ) . the interaction between follow - up time and type 2 diabetes at baseline significantly predicted six of the thirteen psychological subscales ( p < 0.05 ) and , across the follow - ups , physical fitness level made modest contributions to variations in mental symptoms and hrqol but not weight - related body image . conclusion . the results suggest that baseline difference in mental symptoms and physical hrqol between diabetic and nondiabetic patients declines across follow - ups and resolves around the time of surgery .
wegener 's granulomatosis is an uncommon systemic disease characterized by necrotizing vasculitis of small blood vessels with granuloma formation . central nervous system manifestations of wg include cranial neuritis , mononeuritis multiplex , cerebral vasculitis , and meningeal involvement . subdural hematoma as a manifestation of wg is extremely rare and till date , only one such case has been reported . here a 42-year - old male presented with complaints of low - grade fever , diffuse headache , and joint pains for 8 weeks . patient gave history of pain and swelling of knees , ankle , wrist and elbow joints , not associated with morning stiffness . laboratory investigations revealed hemoglobin-14 g / dl , total leukocyte count- 13,200/cmm , and platelet count 4,53,000/cmm . brain mri revealed subdural hematoma ( subacute stage ) in left fronto - parietal region [ figures 1 and 2 ] . the neurosurgeon advised surgical evacuation of hematoma , but the patient did not give consent . non - contrast ct scan of head revealed subacute subdural hematoma in the left fronto - parietal region . on 50 day of his illness , patient developed right hemiparesis , and repeat ct scan of head showed infarct of left basal ganglia , which extended up to the parietal region . mri brain t1-weighted image showing left fronto - parietal subdural hematoma with effacement of left side gyri and sulci mri brain t2-weighted image showing left fronto - parietal subdural hematoma the patient presented to the emergency room of our hospital with weakness of right half of body for 7 days . in addition , he gave history of fever , headache , and joint pains for 3 months . there was no history suggestive of chronic upper respiratory symptoms , except for 4 - 5 episodes of epistaxis about 6 months back , which subsided without any treatment . patient was conscious and oriented , and power of right upper and lower limbs was grade 3 - 4/5 with hyper - reflexia . ultrasound abdomen revealed mild hepatomegaly with fatty liver and multiple hypoechoic lesions in the substance of spleen . contrast - enhanced ct scan of abdomen showed irregular wedge - shaped hypodense lesions having attenuation value of 6 35 hu in spleen . patient was empirically put on anti - tubercular treatment ; however , he did not respond . five weeks later , contrast - enhanced ct scan of chest revealed thin - walled cavitary lesions in both upper lobes with parenchymal mass [ figure 3 ] . cytoplasmic anti - neutrophil cytoplasmic antibody ( canca ) levels were found to be raised . blood urea was 52 mg / dl , and serum creatinine was 2.1 mg / dl . ct scan showing cavities in both upper lobes associated with parenchymal lesion a diagnosis of wg was made , and the patient was treated with 3 doses of intravenous methylprednisolone followed by oral prednisolone and oral cyclophosphamide . fever subsided within 10 days of initiation of immunosuppressants , and renal functions improved to normal level within 2 weeks . cyclophosphamide was replaced by mycophenolate mofetil after 6 months , and dose of prednisolone was tapered to 10 mg per day . mri brain repeated after 8 months of follow - up did not show any subdural hematoma . the patient is on regular follow - up and for last 1 year ; he is largely asymptomatic , except for mild residual right hemiparesis . this patient initially presented with fever , headache , and joint pains and had fronto - parietal subdural hematoma on imaging . organ systems commonly involved in wg such as paranasal sinuses , lungs , kidneys , and skin were not involved . we could find only one case report of wg presenting as subdural hematoma . in this case , mri scan was suggestive of subdural hematoma or empyema , hence subdural drainage was done , which revealed pus - like fluid . shiotani et al . reported a case that presented with fever and severe headache , and ct and mri of head revealed subdural masses . the diagnosis in this case was established by needle biopsy of nasal polyps and positive canca . it has been reported that meningeal involvement usually develops in patients with localized disease who are more likely to have destructive lesions of upper airways . in our case , the diagnosis was made after detection of characteristic finding on ct scan of chest and test for canca . in our patient , the development of cerebral infarct and subdural hematoma appear to be a manifestation of cns vasculitis due to wg . wg is a devastating disease ; hence , high index of suspicion and timely treatment is warranted . in patients with subdural hematoma without history of head injury , cns vasculitis due to wg , though very rare , may be considered as one of the possibilities .
wegener 's granulomatosis ( wg ) is a systemic vasculitis , which can involve any organ system in the body ; however , involvement of central nervous system at presentation is very uncommon . dural involvement in wg has been infrequently reported ; however , presentation with subdural hematoma as the initial manifestation is extremely rare . we present a case of wg presenting as subdural hematoma , which resolved on cytotoxic therapy without surgical evacuation .
the clinical efficacy of many existing antibiotics is being threatened by the emergence of multidrug resistant pathogens . many infectious diseases have been known to be treated with herbal remedies throughout the history of mankind . there is a continuous and urgent need to discover new antimicrobial compounds with diverse chemical structures and novel mechanisms of action for new and reemerging infectious diseases . medicinal plants are gifts of nature to cure limitless number of diseases of human beings . the abundance of plants on the earth 's surface has led to an increasing interest in the investigation of different extracts obtained from traditional medicinal plants , as potential source of new antimicrobial agents . hence , researchers are increasingly turning their attention to folk medicine , looking for new leads to develop better drug against microbial infections . increasing failure of chemotherapeutics and antibiotic resistance exhibited by pathogenic microbial infectious agents has led to screening of several medicinal plants for their potential antimicrobial activity . in recent years , secondary plant metabolites ( phytochemicals ) , previously with unknown pharmacological activities , have been extensively investigated as a source of medicinal agents . euphorbia hirta belonging to family euphorbiaceae is a medicinal , rhizomatous herb distributed in southern western ghats of india and northern east coast of tamil nadu . in east and west africa , it is also used for coughs , chronic bronchitis , and other pulmonary disorders in malagasy . the plant is also widely used in angola against diarrhea and dysentery , especially amebic dysentery . in nigeria , extracts or exudates of the plant are used as ear drops and in the treatment of boils , sore , and promoting wound healing . in the current investigation e. hirta showed its antimicrobial potential against test pathogens , which are being involved in a number of human diseases . e. hirta has previously been studied for antibacterial and antifungal activities , but still the literature available is meager . antibacterial activity and toxicological potentials of crude ethanolic extracts of e. hirta against s. aureus , e. coli , p. aeruginosa , salmonella typhi , and bacillus subtilis . aqueous , methanol , hexane , and amoxicillin extracts of e. hirta have been found to be active against e. coli , p. mirabilis , shigella dysentriae , salmonella typhi , and klebsiella pneumoniae . methanolic extract of leaf inhibited the growth of s. aureus , e. coli , and b. subtilis . screening of the plant under investigation ( e. hirta ) so far has not been worked out for flavonoids . mostly the crude extracts have been screened , that too without minimum inhibitory concentration ( mic ) , minimum bactericidal / fungicidal concentration ( mbc / mfc ) , and total activity ( ta ) determination . such studies could only indicate their antimicrobial potential , but are not helpful in establishing them as an antibiotic . the aim of the study was to investigate the antimicrobial activity of extracts of e. hirta in order to explore possibility for new antimicrobial substances against some human pathogens . the present investigation evaluates the antibacterial and antifungal effects of free and bound flavonoids of e. hirta ( root , stem , leaf , and fruits ) . the study was carried out along with standard drugs ( terbinafine and itraconazol for fungus and streptomycin for bacteria ) . different parts ( root , stem , leaf , and fruits ) of e. hirta were collected from jaipur ( india ) , and the specimen of the plant was identified at the department of botany , university of rajasthan . the sample specimen with no . rubl20666 was submitted in the herbarium of department pf botany , university of rajasthan . free and bound flavonoids from root , stem leaf , and fruits of e. hirta was extracted following the well - established method . hundred grams of each finely powered sample was soxhlet extracted with 80% hot methanol ( 500 ml ) on a water bath for 24 h and filtered . each filtrate was reextracted successively with petroleum ether ( fraction i ) , ethyl ether ( fraction ii ) , and ethyl acetate ( fraction iii ) using separating funnel . petroleum ether fractions were discarded as being rich in fatty substances , whereas ethyl ether and ethyl acetate fractions were analyzed for free and bound flavonoids , respectively . ethyl acetate fraction of each of the samples was hydrolyzed by refluxing with 7% h2so4 for 2 h ( for removal of bound sugars from the flavonoids ) and filtered . ethyl ether ( free flavonoid ) and ethyl acetate fractions ( bound flavonoids ) thus obtained were dried in vaccuo and weighed . the extracts were stored at 4c and were resuspended in their respective solvents to get 10 mg / ml for antimicrobial assay . selected extract ( bound flavonoid of stem ) which showed activity against all microorganisms tested was dissolved in ethyl acetate and applied on silica gel coated ( 0.2 - 0.3 mm ) and activated glass plates ( 20 20 cm ) in an oven at 100c for 30 min along with the standard reference compound of apigenin and quercetin 1 cm above the edge of the plates . these plates were developed in an organic solvent mixture of benzene , acetic acid , and water ( 125:72:3 ) , air dried and visualized under ultraviolet ( uv ) light . three spots ( retention factor ( rf ) 0.86 , 0.78 , 0.10 ) were observed which were further confirmed by spraying the plates with 5% ethanolic ferric chloride solution [ table 1 and figure 1 ] . a few other solvent system ( n - butanol : acetic acid : water , 4:1:5 ; n - butanol : water 1:1 ; n - butanol : acetic acid : water , 6:1:2 ) were used , but in the present investigation the solvent system of benzene , acetic acid , and water ( 125:72:3 ) gave excellent results . rf value 0.86 , 0.78 obtained indicate the presence of kaempferol and quercetin in the bound flavonoids of stem extract subjected to thin layer chromatography ( tlc ) . rf values of spots of flavonoid extract obtained in tlc ( solvent system benzene : acetic acid : water 125:72:3 ) thin layer chromatography . e : extract ; k : kaempferol ; q : quercetin preparative tlc of the bound flavonoids from stem of e. hirta was carried out on silica gel coated and activated ( 0.4 - 0.5 mm thick ) glass plates in the selected solvent ( benzene , acetic acid , and water ) . spot of rf value 0.86 and 0.78 were marked on each plate and were collected and eluted with ethyl acetate . elutes were pooled , completely dried , and rechromatographed to test the purity of the isolated compound . the isolated compounds were crystallized , weighed , and subjected to melting point ( m.p . ) and infrared spectral studies on perkins elmer model 555 spectrophotometer in kbr pellets . quercetin ( rf 0.78 ; uv fluorescent - dull yellow , ammonia - yellow brown , fecl3-blue - grey , m.p . 309 - 311c ) and kaempferol ( rf 0.86 ; uv fluorescent - bright yellowish blue , ammonia - deep yellow , fecl3 - brown ; m.p . 270 - 273c ) were identified in bound flavonoids stem of e. hirta [ figure 2 ] . infrared of quercetin and kaempferol eight pathogenic microorganisms in total , including four bacteria , viz . 46 ) , p. aeruginosa ( mtcc 1934 ) , p. mirabilis ( mtcc 3310 ) , and s. aureus ( mtcc 3160 ) ; and four fungal strains , viz . , c. albicans ( mtcc 183 ) , a flavus ( mtcc 277 ) , a. niger ( mtcc 282 ) , and trichophyton mentagrophytes ( mtcc no . bacterial strains were grown and maintained on mueller - hinton agar ( mha ) medium , while fungi were maintained on sabouraud dextrose agar medium ( sda ) . mha and sda base plates were seeded with the bacterial and fungal inoculum , respectively with inoculum size 1 10 cfu / ml for bacteria and 1 10 cell / ml for yeast . sterile filters paper discs ( whatman no . 1 , 6 mm in diameter ) were impregnated with 100 l of each of the extract ( 10 mg / ml ) to give a final concentration of 1 mg / disc and left to dry in vaccuo so as to remove residual solvent , which might interfere with the determination . each extract was tested in triplicate with streptomycin ( 1 mg / disc ) and candid - v6 ( 1 mg / ml ) as standard for bacteria and fungi , respectively . the plates were kept at 4c for 1 h for diffusion of extract , thereafter were incubated at 37c for bacteria ( 24 h ) and 27c for fungi antibacterial activity of flavonoids of euphorbia hirta by disc diffusion assay where iz = inhibition zone . plant extracts were resuspended in acetone ( which has no activity against test pathogens ) to make 10 mg / ml final concentration and then was two - fold serially diluted . thereafter 100 l inoculum ( for bacteria 1 10 cfu / ml and for yeast and fungi 1 10 cfu / ml ) was added to each well . bacterial and fungal suspensions were used as negative control , while broth containing standard drug was used as positive control . the microtiter plates were incubated at 37c for 24 h for bacteria and 28c for 48 h for yeast . each extract was assayed in duplicate and each time two sets of microplates were prepared , one was kept for incubation while another set was kept at 4c for comparing the turbidity in the wells of microplate . the mic values were taken as the lowest concentration of the extracts in the well of the microtiter plate that showed no turbidity after incubation . the turbidity of the wells in the microtiter plate was interpreted as visible growth of microorganisms . least concentration of extract showing no visible growth on subculturing was taken as mbc / mfc . ta is the volume at which the test extract can be diluted with the ability to kill the microorganisms . it is calculated by dividing the amount of extract from 1 g plant material by the mic of the same extract or compound isolated and is expressed in ml / g . different parts ( root , stem , leaf , and fruits ) of e. hirta were collected from jaipur ( india ) , and the specimen of the plant was identified at the department of botany , university of rajasthan . the sample specimen with no . rubl20666 was submitted in the herbarium of department pf botany , university of rajasthan . free and bound flavonoids from root , stem leaf , and fruits of e. hirta was extracted following the well - established method . hundred grams of each finely powered sample was soxhlet extracted with 80% hot methanol ( 500 ml ) on a water bath for 24 h and filtered . each filtrate was reextracted successively with petroleum ether ( fraction i ) , ethyl ether ( fraction ii ) , and ethyl acetate ( fraction iii ) using separating funnel . petroleum ether fractions were discarded as being rich in fatty substances , whereas ethyl ether and ethyl acetate fractions were analyzed for free and bound flavonoids , respectively . ethyl acetate fraction of each of the samples was hydrolyzed by refluxing with 7% h2so4 for 2 h ( for removal of bound sugars from the flavonoids ) and filtered . ethyl ether ( free flavonoid ) and ethyl acetate fractions ( bound flavonoids ) thus obtained were dried in vaccuo and weighed . the extracts were stored at 4c and were resuspended in their respective solvents to get 10 mg / ml for antimicrobial assay . selected extract ( bound flavonoid of stem ) which showed activity against all microorganisms tested was dissolved in ethyl acetate and applied on silica gel coated ( 0.2 - 0.3 mm ) and activated glass plates ( 20 20 cm ) in an oven at 100c for 30 min along with the standard reference compound of apigenin and quercetin 1 cm above the edge of the plates . these plates were developed in an organic solvent mixture of benzene , acetic acid , and water ( 125:72:3 ) , air dried and visualized under ultraviolet ( uv ) light . three spots ( retention factor ( rf ) 0.86 , 0.78 , 0.10 ) were observed which were further confirmed by spraying the plates with 5% ethanolic ferric chloride solution [ table 1 and figure 1 ] . a few other solvent system ( n - butanol : acetic acid : water , 4:1:5 ; n - butanol : water 1:1 ; n - butanol : acetic acid : water , 6:1:2 ) were used , but in the present investigation the solvent system of benzene , acetic acid , and water ( 125:72:3 ) gave excellent results . 0.78 obtained indicate the presence of kaempferol and quercetin in the bound flavonoids of stem extract subjected to thin layer chromatography ( tlc ) . rf values of spots of flavonoid extract obtained in tlc ( solvent system benzene : acetic acid : water 125:72:3 ) thin layer chromatography . e : extract ; k : kaempferol ; q : quercetin preparative tlc of the bound flavonoids from stem of e. hirta was carried out on silica gel coated and activated ( 0.4 - 0.5 mm thick ) glass plates in the selected solvent ( benzene , acetic acid , and water ) . spot of rf value 0.86 and 0.78 were marked on each plate and were collected and eluted with ethyl acetate . elutes were pooled , completely dried , and rechromatographed to test the purity of the isolated compound . the isolated compounds were crystallized , weighed , and subjected to melting point ( m.p . ) and infrared spectral studies on perkins elmer model 555 spectrophotometer in kbr pellets . quercetin ( rf 0.78 ; uv fluorescent - dull yellow , ammonia - yellow brown , fecl3-blue - grey , m.p . 309 - 311c ) and kaempferol ( rf 0.86 ; uv fluorescent - bright yellowish blue , ammonia - deep yellow , fecl3 - brown ; m.p . 270 - 273c ) were identified in bound flavonoids stem of e. hirta [ figure 2 ] . eight pathogenic microorganisms in total , including four bacteria , viz . , e. coli ( mtcc no . 46 ) , p. aeruginosa ( mtcc 1934 ) , p. mirabilis ( mtcc 3310 ) , and s. aureus ( mtcc 3160 ) ; and four fungal strains , viz . , c. albicans ( mtcc 183 ) , a flavus ( mtcc 277 ) , a. niger ( mtcc 282 ) , and trichophyton mentagrophytes ( mtcc no . bacterial strains were grown and maintained on mueller - hinton agar ( mha ) medium , while fungi were maintained on sabouraud dextrose agar medium ( sda ) . were seeded with the bacterial and fungal inoculum , respectively with inoculum size 1 10 cfu / ml for bacteria and 1 10 cell / ml for yeast . sterile filters paper discs ( whatman no . 1 , 6 mm in diameter ) were impregnated with 100 l of each of the extract ( 10 mg / ml ) to give a final concentration of 1 mg / disc and left to dry in vaccuo so as to remove residual solvent , which might interfere with the determination . each extract was tested in triplicate with streptomycin ( 1 mg / disc ) and candid - v6 ( 1 mg / ml ) as standard for bacteria and fungi , respectively . the plates were kept at 4c for 1 h for diffusion of extract , thereafter were incubated at 37c for bacteria ( 24 h ) and 27c for fungi antibacterial activity of flavonoids of euphorbia hirta by disc diffusion assay where iz = inhibition zone . plant extracts were resuspended in acetone ( which has no activity against test pathogens ) to make 10 mg / ml final concentration and then was two - fold serially diluted . thereafter 100 l inoculum ( for bacteria 1 10 cfu / ml and for yeast and fungi 1 10 cfu / ml ) was added to each well . bacterial and fungal suspensions were used as negative control , while broth containing standard drug was used as positive control . the microtiter plates were incubated at 37c for 24 h for bacteria and 28c for 48 h for yeast . each extract was assayed in duplicate and each time two sets of microplates were prepared , one was kept for incubation while another set was kept at 4c for comparing the turbidity in the wells of microplate . the mic values were taken as the lowest concentration of the extracts in the well of the microtiter plate that showed no turbidity after incubation . the turbidity of the wells in the microtiter plate was interpreted as visible growth of microorganisms . least concentration of extract showing no visible growth on subculturing was taken as mbc / mfc . ta is the volume at which the test extract can be diluted with the ability to kill the microorganisms . it is calculated by dividing the amount of extract from 1 g plant material by the mic of the same extract or compound isolated and is expressed in ml / g . antimicrobial potency of flavonoids ( free and bound ) of e. hirta was assessed by iz and ai [ tables 2 and 3 ] . free and bound flavonoid extract exhibited good inhibitory activity against most of the pathogens . in the present study , all eight extracts showed significant antimicrobial activity against test microbes . in all test microbes most susceptible organism in the investigation was c. albicans against which all the plant extracts showed iz . antifungal activity of flavonoids of euphorbia hirta by disc diffusion assay in some cases , even more than the standard and the best activity were observed for bound flavonoids of root with iz 27.66 mm , ai 1.976 0.104 , mic 0.039 out of the four bacteria tested , s. aureus was found to be the most sensitive whereas e. coli was found to be the most resistant microbe against which only one extract ( bound flavonoid extract of stem ) showed activity ( iz 17.66 mm , ai 0.679 0.130 , mic best antibacterial activity was observed against p. aeruginosa ( iz 16.33 mm , ai 0.817 0.060 , mic 0.156 mg / ml , mfc 0.156 ) , p. mirabilis ( iz 17.33 mm , ai 0.693 0.058 , mic 0.039 mg / ml , mfc 0.078 ) , and s. aureus ( iz 18.33 mm , ai 0.872 0.111 , mic 0.039 , mfc 0.078 ) for free flavonoids of root ; whereas , bound flavonoids of fruits showed best activity against p. mirabilis ( iz 17 mm , ai 0.680 0.106 , mic 0.039 free flavonoids of stem showed bioactivity against p. mirabilis ( iz 11.16 mm , ai 0.447 0.024 , mic 0.156 mg / ml , mfc 0.312 ) ; whereas , bound flavonoids showed activity against c. albicans ( iz 18.5 mm , ai 1.321 0.021 , mic the growth of fungi ( a. flavus , a. niger , and t. mentagrophytes ) was not influenced by any of the test extracts . mic and mbc / mfc values [ tables 4 and 5 ] were evaluated for those plant extracts , which showed activity . the range of mic and mbc / mfc of extracts recorded was 0.039 - 0.625 mg / ml and 0.039 - 1.25 mg / ml , respectively . in the present investigation lowest mic value ( 0.039 mg / ml ) was recorded against p. mirabilis , s. aureus , and c. albicans ; whereas , it was 0.078 mg / ml against e. coli and 0.156 mg / ml against p. aeruginosa . mic and mbc / mfc values of euphorbia hirta against bacterial pathogens mic and mbc / mfc values of euphorbia hirta against fungal pathogens ta and quantity of extracts from plant parts was calculated and recorded [ table 6 ] . ta indicates the volume at which extracts can be diluted without losing the ability to kill microorganisms . full ta calculated against e. coli , p. aeruginosa , p. mirabilis , s. aureus , and c. albicans , were 70.51 , 48.07 , 192.30 , 192.30 , and 141.02 ml , respectively . most of the extracts showed high values of ta against p. mirabilis , s. aureus , and c. albicans ; which proves potential of the extracts to inhibit growth of the test microorganisms , even at low concentration . quantity and total activity of free and bound flavonoids of euphorbia hirta the potential for developing antimicrobials from higher plants appears rewarding as it will lead to the development of phytomedicine to act against microbes . plant - based antimicrobials have enormous therapeutic potential as they can serve the purpose of synthetic antimicrobials . continued further exploration of plant - derived antimicrobials is need of the day . results of the present study reveals that all the eight tested plant extracts inhibit the growth of selected bacteria and fungi ; indicating broad spectrum bioactive nature of selected plant . most of the extracts of e. hirta were found to be potent inhibitor of tested organisms except e. coli , against which only one extract of the plant showed activity . excellent activity was shown by free and bound flavonoids of roots of e. hirta as low values of mic and mbc / mfc were observed . higher values of mbc / mfc than that of the mic indicated the bacteriostatic / fungistatic nature of the extracts , which were observed for rest of the active extracts . same values of mic and mbc / mfc was observed for free flavonoids of root ( 0.156 ) against p. aeruginosa which shows their bactericidal nature , bound flavonoids of stem ( 0.078 ) against e. coli and p. mirabilis , and bound flavonoids of fruits ( 0.078 ) against s. aureus . mic and mbc / mfc values were observed to be good enough for eight extracts of e. hirta which is a desirable character as far as the exploitation of compound for future plant based - drug is concerned . gram positive bacteria ( s. aureus ) was the second most susceptible organism after fungi c. albicans , which supported the finding that plant extracts are usually more active against gram positive bacteria than gram negative . susceptibility difference between gram positive and gram negative bacteria might be due to differences in cell wall structures .
objective : this study aims to phytochemical and antimicrobial study of euphorbia hirta euphorbiaceae).materials and methods : antimicrobial activity of flavonoids ( free and bound ) of euphorbia hirta l. was determined by disc diffusion assay against four bacteria ( escherichia coli , pseudomonas aeruginosa , proteus mirabilis , and staphylococcus aureus ) and four fungi ( aspergillus flavus , aspergillus niger , trichophyton mentagrophytes , and candida albicans ) . minimum inhibitory concentration ( mic ) of the extract was evaluated through micro broth dilution method , while minimum bactericidal / fungicidal concentration was determined by subculturing the relevant samples . total activity ( ta ) of extracts against each sensitive pathogen was also evaluated.results:out of fungi ; a. flavus , a. niger , and t. mentagrophytes were found to be resistant , against which none of the tested extracts showed activity . bound flavonoids extract of root showed best activity against c. albicans ( inhibition zone ( iz ) 27.66 , mic 0.039 , minimum fungicidal concentration ( mfc ) 0.039 ) . ta of free flavonoid extract of root was found to be the same for p. mirabilis and s. aureus ( 192.30 ml / g ) . two flavonoids quercetin and kaempferol were identified in the bound flavonoids of stem extract which showed activity against all the microorganisms.conclusion:results of the present investigation indicate that e. hirta has good antimicrobial activity with low range of mic , hence can be exploited for future plant - based antimicrobial drugs .
many different types of alloys are available in the dental market , which can be used for prosthetic applications . the most important factors affecting the choice of these alloys are mechanical properties , workability , biocompatibility and resistance to corrosion.1 some metallic elements are completely safe in the elemental state , but on the other hand , they can form harmful , toxic ions or compounds to the body . therefore , in developed countries noble metals and all ceramic materials are mostly used to keep away from detrimental effects of non precious metals . because noble metals possess good resistance to corrosion due to low reactivity and compatible biological properties , in developing countries non - precious alloys such as cobalt chromium ( co - cr ) , chromium nickel ( cr - ni ) have been preferred because of their cheap costs.2 cobalt - based alloys provide strength , hardness and resistance to corrosion . chromium provides corrosion resistance when its concentration is between 16 and 20 wt%.3 nickel increased modulus elasticity of the casting alloys and also thermal expansion coefficient of nickel based alloys and it is consistent for conventional porcelains , which prevents cracking of the veneer during firing.4 nickel is allergenic material so nickel sensitivity is thought to be potential clinical effect for these alloys . for this reason , nickel ion released during corrosion is much more important than other metals for this reason . porcelain veneer fired onto the metal alloys for aesthetic purposes referred to as porcelain - fused to metal ( pfm ) . sometimes only facial aspect of the metal veneered while the occlusal and lingual aspects are left intact . alternatively , only the lingual aspect close proximity to the gingiva are left as half moon shape for gingival accordance since metal release through corrosion process may cause adverse reactions.5,6 heat treatments for metal alloys and pfm firing process effects alloy surface oxides , microstructures and physical properties.7 - 9 therefore it is important to evaluate the effects of porcelain firing process on the corrosion of dental metal alloys . there are some studies about the porcelain firing process on the corrosion and surface properties of the dental alloys8,10 and some studies carried out about their corrosion behavior in artificial saliva.3,11 on the other hand , there is no study about the effect of the number of firing on dental alloys ' corrosion resistance . the purpose of this study was to evaluate the effects of repeated porcelain firing process on the corrosion rates of the dental alloys . the research hypothesis was that corrosion resistance would occur relative to the firing times and among alloys . cr - co ( wirobond c ; bego dental , bremen , germany ) , cr - ni ( shera ; gmbh&co . kg , germany ) and pd - ag ( begopal 300 ; bego , gmbh&co . each metal supported porcelain consisted of 30 specimens of 10 for 7 , 9 and 11 times firing each . totally 90 specimens fabricated for this study . the castings were prepared in accordance with the manufacturers ' recommendations in the dental laboratory . 10 mm diameter and 3 mm thickness disc - shaped specimens were formed by melting alloys with a propane - oxygen flame and cast with a centrifuge casting machine ( motorcast , degussa , germany ) . the cast specimens were wet - polished using silicon carbide abrasive sandpaper up to 1500 grit to simulate clinical procedures,6 then ultrasonically cleaned for 5 minutes each in acetone , ethanol , and de - ionized water to eliminate surface contaminants . porcelain veneer was applied on the metal alloys , then heat was applied on the specimens under vacuum in a dental porcelain furnace ( ivoclar vivadent p-300 leciester , uk ) . the specimens were degassed at 1,010 under vacuum for 5 minutes , opaque fired at 980 under vacuum and air cooled , body fired at 970 under vacuum and air cooled , a moon shape metal was leaved on the specimens to simulate porcelain crowns in the mouth and finally glaze fired at 980 and air cooled.9 moon shape metal parts were polished with rubbers . specimens were fired 7 , 9 and 11 times respectively and corrosion resistance was recorded . corrosion measurements were performed using an electrochemical potentiostat / galvanostat ( parstat 2273 ; princeton applied research , oak ridge , tn , usa ) via a test cell with the mounted specimen as the working electrode , a high - purity platinum wire as the counter electrode , and saturated calomel electrode ( sce ) as the reference electrode ( fig . corrosion tests were performed in quintuplicate for each alloy ( after porcelain firing ) in fusayama artificial saliva solution ( 0.4 g l nacl , 0.4 g l kcl , 0.795 g l cacl22h2o , 0.690 g l nah2po4h2o , 0.005 g l na2s9h2o , 1.0 g l urea , ph 5.0 ) in a pyrex glass cell . samples were polished with successively finer grade of emery papers ( up to 800 grit ) and then degreased with toluene . the corrosion behaviors of the samples were investigated by both tafel and open circuit potential ( ocp ) methods . the breakdown potential ( ebr ) , at which the corrosion current increases abruptly , was also estimated from the polarization curves . icorr and rp represent the corrosion rate and corrosion resistance , respectively ( table 2 ) . because the breakdown of passive oxide film , marked by a large and generally increasing current , is caused by localized or pitting - type corrosion , the corrosion resistance of the alloys can also be evaluated using the breakdown potential , which means that a greater ebr value indicates a better corrosion resistance.12 statistical analysis data from three different metal alloys for corrosion testing were analyzed statistically with spss v11.5 software ( spss , chicago , il , usa ) . tamhane and sheffe test was used to compare corrosion differences in results after repeated firings and among 7 , 9 and 11 firing for each alloys . the probability level for statistical significance ( i ) 7 , ( ii ) 9 , and ( iii ) 11 , exposed to artificial saliva solution . open circuit potentials are one measure used to determine the potential at which the anodic and cathodic corrosion reactions cancel one another out . these values indicate a metal 's tendency to corrode in the given electrolyte . upon exposure of these samples in artificial saliva , it was observed that all materials except 11 times firing showed a shift in the potential toward noble direction . the ecorr shift was maximum ( 30 mv ) in case of 7 times firing ( commercial ) while minimum ecorr shift was observed in case of 11 times firing ( 5 mv ) . this is possibly due to better passive film formation in 7 times firing . finally , the order of ecorr after stabilization was 7 > 9 > 11 ( p<.05 ) . the high temperatures reached during porcelain firing may cause change in the form or structure of the composition of the surface oxides , and alter the corrosion properties of the alloy . 2b shows the corrosion property of electrodeposited cr - co series alloy in a fusayama solution . the corrosion potential ( ecorr ) of the samples are -0.33 vsce for the 11 times firing and -0.24 vsce 7 times firing . compared with 11 firing sample , it is found that the corrosion potential of the deposited at 7 firing sample is 37% nobler . it is thus further concluded that the firing times of the cr - co series alloys up to firing time 7 possesses superior anti - corrosion behaviors than that of firing times 11 ( p<.05 ) . that corrosion rate of fired cr - co was at minimum possibly because of better spontaneous passive film formation due to chromium oxide formation on the film surface or possible phase transformation of cast alloy . 2c shows the corrosion property of cr - ni series alloy in a fusayama solution . the corrosion potential ( ecorr ) of the smallest corrosive resistive at 11 firing and the biggest corrosion resistive 7 firing are -0.48 vsce and -0.13 vsce , respectively ( p<.05 ) . compared with 11 firing sample , it is found that the corrosion potential of the deposited at 7 firing sample is 269% nobler . it is thus further concluded that the firing times of the cr - ni series alloys up to firing time 7 possesses superior anti - corrosion behaviors than 11 times firing . 2d shows the corrosion property of electrodeposited pd - au series alloy in a fusayama solution . the corrosion potential ( ecorr ) of the smallest corrosive resistive at 11 firing and the biggest corrosion resistive pd - ag 7 firings are -0.35 vsce and 0.14 vsce , respectively ( p<.05 ) . compared with 11 firing sample , it was found that the corrosion potential of the deposited at 7 firing sample is 350% nobler . it is thus further concluded that the firing times of the pd - ag series alloys up to firing time 7 possesses superior anti - corrosion behaviors than that of firing times 11 . it was evident from the fig . that the tafel behavior of all these alloys is not highly distinct . 3 , 4 and 5 show the scanning electron microscopy images ( sem ) of cr - co , pd - ag and cr - ni series before and after corrosion tests , respectively . in the sem images , alloys show obvious changes on their surface morphology after polarized in the solution . especially at 11 times fired sample this in vitro study measured the corrosion resistance of the alloys according to firing numbers . the results of this study supports the hypothesis that corrosion resistance would change relative to the firing numbers and the corrosion resistance of the alloy were affected by the firing numbers differently . corrosion of dental alloys are affected by multi - factorial conditions such as alloy 's composition , recurrent castings,1 environmental conditions , and composition of the surrounding electrolyte selected for study5,13 so the same ph ( 5 ) and electrolyte medium were used for this study . noble alloys are defined as having a noble metal ( gold , platinum , palladium ) content greater than or equal to 25% by weight14 and have more resistance to corrosion than base metal alloys because of low reactivity , resulting from the noble nature of the atoms . this idea was supported by manaranche and hornberger 's study15 but these are very expensive and can not be used routinely in dentistry . base metals , such as molybdenum , chromium , and nickel , have a great affinity for oxygen and thus form a thin passivating oxide film that acts as a protective layer from corrosion.16 therefore they can be used for fixed prosthesis instead of noble alloys . as a result of this study , cr amounts are the same and this can be explained by its higher percentage of mo of cr - ni alloy . mo as molybdenum oxide ( mo2o3 ) and as cr as chromium oxide ( cr2o3 ) provide the initial stability to prevent dissolution of metal ions and thus provide resistance to corrosion and lesser corrosive rate.17 molybdenum , chromium and nickel alloys can be added to promote resistance to corrosion ; in contrast , small variations in their compositions affect this corrosion resistance.1 in dental alloys , the ratio of cr and mo ranges from 11 to 25 and 0 to 10 wt% respectively . under this ratio it was reported that alloys were more susceptible to corrosion.18 porcelain firing to metal process affects the alloy 's resistance to corrosion . this may be due to increased levels of the released metal ions from the samples . according to studies by wylie et al.19 and lin hy et al.,10 despite the small changes in the alloy microstructures and increased ion release after porcelain firing on the other hand , roach et al.8 reported that porcelain firing had a detrimental effect on the corrosion properties of alloys , which is in consistence with this study . surface analysis of the alloys was not done in this study ; only the corrosion resistance were measured . unlike other studies , porcelain was fired at an increasing and different numbers ( 7 , 9 and 11 ) in this study and proportionally ones increased porcelain firing number , alloy 's corrosion resistance was decreased . this may be because the fixed prosthesis requires high temperature firing cycles which results in changes in the surface structure during the porcelain firing processes8,20,21 and when firing process is repeated , a negative effect of high temperature increased on the alloys . the limitation of this study was that fusayama artificial saliva solution provides only the inorganic components , and does not consist of organic components ; however , this electrolyte has a response close to natural saliva.22 the actual conditions of the oral environment is very complex . therefore , it was difficult to simulate the same composition of oral environment.23 thus alloys such as cr - ni can be corrosive with regard to in vitro study.19 on the other hand , it can be reported that there is good corrosion resistance for cr - ni casting alloys in the oral cavity.24 porcelain firing should be considered important when evaluating the corrosion behavior of dental alloys . therefore , the nature of dental alloys plays a major role in the corrosion resistance rate . on comparing corrosion resistance of the materials after repeated firings , the results were pd - ag > cr - ni > cr - co respectively . repeated firings decreased corrosion resistance of pd - ag , cr - co and cr - ni alloys . therefore , dentists should keep away from repeated firings if possible while fabricating the fixed prosthesis .
purposethe aim of this study was to evaluate the effects of repeated porcelain firing process on the corrosion rates of the dental alloys.materials and methodscr - co , cr - ni and pd - ag alloys were used for this study . each metal supported porcelain consisted of 30 specimens of 10 for 7 , 9 and 11 firing each . disc - shaped specimens 10 mm diameter and 3 mm thickness were formed by melting alloys with a propane - oxygen flame and casted with a centrifuge casting machine and then with the porcelain veneer fired onto the metal alloys . corrosion tests were performed in quintuplicate for each alloy ( after repeated porcelain firing ) in fusayama artificial saliva solution ( ph = 5 ) in a low thermal - expansion borosilicate glass cell . tamhane and sheffe test was used to compare corrosion differences in the results after repeated firings and among 7 , 9 and 11 firing for each alloy . the probability level for statistical significance was set at =0.05.resultsthe corrosion resistance was higher ( 30 mv ) , in case of 7 times firing ( commercial ) . on the other hand , it was lower in case of 11 times firing ( 5 mv ) ( p<.05).conclusionrepeated firings decreased corrosion resistance of pd - ag , cr - co and cr - ni alloys . the pd - ag alloy exhibited little corrosion in in vitro tests . the cr - ni alloy exhibited higher corrosion resistance than cr - co alloys in in vitro tests .
during april 2008december 2009 in shandong province , 613 blood samples were obtained from hybrid wild boars that had not been vaccinated against prrsv ( table ) . the herd check prrs commercial elisa kit ( idexx laboratories , norcross , ga , usa ) was used for serologic analysis ; 167 ( 27.2% ) of 613 samples were seropositive for prrsv , and 2 prrsv isolates ( tayz and zcyz ) were obtained . the viruses were plaque - purified once in marc-145 cells and amplified for sequencing and infection of other pigs . because open reading frame 5 ( orf5 ) and the nonstructural protein 2 ( nsp2 ) gene are 2 of the most variable genes in prrsv ( 13 ) , these genes were sequenced to identify genetic variation in the 2 isolates . tayz and zcyz had higher nucleotide homologies in orf5 with highly pathogenic prrsv ( prototype virus jxa1 ) than north american - type prrsv ( prototype virus vr2332 ) , and european - type prrsv ( prototype virus lv ) . for nsp2 of tayz , 2 deletions were identified : a 1-aa deletion at position 482 , and a 29-aa deletion at positions 533561 . these deletions were similar to those in jxa1 , hub1 , and sd - jn isolates associated with porcine high fever disease reported in china ( 47 ) . for nsp2 of zcyz , 2 deletions were identified : a novel 25-aa deletion at positions 476500 , and a 29-aa deletion at positions 533561 ( figure 1 ) . amino acid sequence alignments of partial nonstructural protein 2 genes of porcine reproductive and respiratory syndrome virus isolates , china . to determine the virulence and pathogenesis of the prrsv isolated , we performed experimental infection with the zcyz isolate in ten 6-week - old domestic duroc crossbred pigs and ten 6-week - old hybrid wild boars . the animal infection protocol was reviewed and approved by the shandong province animal ethics committee . domestic pigs and hybrid wild boars were randomly divided into 2 groups , each consisting of 5 pigs . these pigs were shown by serologic analysis to be negative for antibodies against prrsv , swine influenza virus , and mycoplasmas . in hybrid wild boars injected intramuscularly with 1 ml of zcyz isolate ( 10 50% tissue culture infectious doses / ml ) , high fever > 40.8c and respiratory disorders were observed at 56 days postinfection ( dpi ) . pulmonary hyperplasia and consolidation ( figure 2 , panel e ) and cardiac hemorrhage and edema ( figure 2 , panel h ) were observed in the dead hybrid wild boars . prrsv - specific antibodies were detectable by 7 dpi , had increased by 14 dpi , and remained high until autopsy at 21 dpi . for the infected domestic duroc crossbred pigs , high fever > 41c and respiratory problems were observed at 45 dpi , and red discoloration was observed in the ears ( figure 2 , panel c ) . two pigs in this group died at 6 dpi ; the other 3 pigs in this group died at 7 dpi . the dead pigs all had multiple lesions in various organs , such as edema and hemorrhage in the lung ( figure 2 , panel f ) and hemorrhagic spots in the heart ( figure 2 , panel i ) . duroc crossbred pigs and hybrid wild boars in the control group injected with dulbecco minimal essential medium had a normal appearance ( figure 2 , panels a , b ) , appetite , and rectal temperature during the experiment , and no obvious pathologic changes were observed in the lungs ( figure 2 , panel d ) and heart ( figure 2 , panel g ) . experimental infection of domestic duroc crossbred pigs and hybrid wild boars with porcine reproductive and respiratory syndrome virus isolate zcyz . a ) domestic duroc crossbred pig ( control ) injected with dulbecco minimal essential medium ( dmem ) , showing normal skin color . b ) hybrid wild boar ( control ) injected with dmem , showing normal skin color . c ) red discoloration in ears of a domestic duroc crossbred pig infected with zcyz ) . f ) edema and hemorrhage in the lungs of domestic duroc crossbred pig infected with zcyz ) . prevalence of antibodies against prrsv was similar for different types of farm environments ( table ) . two prrsv isolates were obtained from hybrid wild boars ; 1 of the isolates ( zycz ) has a novel genetic marker in the nsp2 gene . the zcyz isolate showed high virulence in domestic duroc crossbred pigs and hybrid wild boars . shandong province is one of the major pig - producing areas in china ; annual production is 60 million domestic pigs and 500,000 hybrid wild boars . it has been reported that 793 ( 59.5% ) of 1,332 serum samples from domestic pigs were seropositive for prrsv , and seropositivity was > 80% in some large - scale commercial production farms in the shandong area ( 8) . as a transitional group between domestic pigs and wild boars , hybrid wild boars were sensitive to highly pathogenic prrsv . however , 167 ( only 27.2% ) of 613 samples from hybrid wild boars were positive for prrsv , indicating that the prevalence of prrsv differed between domestic pigs and hybrid wild boars in this area . hybrid wild boars are usually raised on hills or slopes or in forests , characterized by a relatively low - density pig population and separation from commercial domestic pigs . these features may have helped to limit transmission of prrsv to hybrid wild boar herds . when prrsv enters the wild pig population , its subsequent spread has been found to be limited , probably because the virus is not easily transmitted within a low - density or medium - density population ( 9 ) . some genetic traits in local wild boars prrsv is currently divided into 2 distinct genotypes , european and north american , which show 60% nt sequence similarity ( 10 ) . in this study , the 2 prrsv isolates from hybrid wild boars belonged to the north american genotype on the basis of sequence analysis and were similar to highly pathogenic prrsv isolated during 20062009 in china . this finding suggests that infection of hybrid wild boars with prrsv may be caused by the spread of highly pathogenic prrsv in domestic pigs in recent years . experimental infection of pigs showed that the zcyz isolate was highly pathogenic in domestic pigs and hybrid wild boars , indicating that hybrid wild boars likely play a role in the epidemiology of prrsv and may be an alternative model that can be used to study transmission of prrsv among the wild boar population . however , how prrsv has evolved and varies in hybrid wild boars is not clear , and further studies , including extensive genomic sequence analyses , should be conducted .
we conducted a serologic investigation of porcine reproductive and respiratory syndrome virus ( prrsv ) in hybrid wild boar herds in china during 20082009 . prrsv isolates with novel genetic markers were recovered . experimental infection of pigs indicated that hybrid wild boars are involved in the epidemiology of prrsv .
there are various types of bags such as shoulder bags and backpacks , and various styles of carrying a bag . people use these different types of bags to carry the things they require in their daily lives . while carrying a bag and walking , the body is subjected to physical stress owing to the weight of the bag , and the body is either mechanically or physiologically influenced , which affects dynamic balance and changes the posture of the body2 , 3 . carrying a backpack in an incorrect manner can cause various biomechanical , physiological and neuromuscular disorders that may reduce physical performance4 , 5 . an ideal bag weight and space between the shoulder straps have been recommended6 , 7 . asymmetry of weight distribution in both shoulder straps may cause a spinal deformity with gait abnormalities and scoliosis1 , 2 . carrying weight on one shoulder increases energy consumption and leads to alteration in the electromyogram of both arms and legs muscles8 , 9 . if carrying weight on one side continues , the body involuntarily compensates by deviating the trunk in the opposite direction to correct the imbalance caused by an external force creating abnormal posture9 . excessive weight will increase the load on the spine and shoulders and it may cause changes in the spine curvature4 . scapular position1 and electromyogram activities of the trunk and lower extremities muscle3 , 8 may be affected by a change in the space between the backpack shoulder straps . lengthening or weakening of the upper trapezius can also lead to scapular depression syndrome and pain in the upper trapezius muscle6 . researchers have studied various backpack types and designs with the aim of preventing injuries associated with prolonged load carrying10 . few studies investigated the effect of the spacing of backpack shoulder straps on cervical muscle activity , acromion angle , scapular distance and upper trapezius pain threshold after walking with a backpack . there is a lack of literature on proper length and level of backpack shoulder straps . therefore , the purpose of this study was to investigate the effect of the length of backpack shoulder straps on upper trapezius pain threshold and cervical posture as measured by the craniovertebral angle . twenty - five males were assigned to one group and gave signed informed consent to participate in the study . their mean age , height and weight were ( 19 3 ) years , ( 78.8 6 ) kg and ( 173 8) cm , respectively . the subjects had no musculoskeletal disorder or pain in the upper extremities in the prior 6 months . this study was approved by the local research ethical committee with number : p.t.rec/012/0014 . upper trapezius pain threshold and craniovertebral angle were measured for all subjects without the backpack ( delsey , france ) then re - measured after walking on a treadmill for 15 min under 2 conditions : 1 ) wearing a backpack with short straps and 2 ) wearing a backpack with long straps . pain threshold of the bilateral upper trapezius was measured before the experiment by using a pressure algometer dynamometer ( fab148 ; fabrication enterprises , white plains , ny , usa ) at the upper trapezius trigger point area located at the measured midpoint between the acromion process and the spinous process of t1 . the craniovertebral angle is formed by the intersection of a horizontal line through the spinous process of c7 and a line from the tragus of the ear . clothing was rearranged so that shoulders were exposed . with the subjects in standing posture , adhesive markers were placed on 2 anatomical landmarks ( tragus of the ear and spinous process of the 7th cervical vertebra ) . subjects were asked to stand comfortably with their arms by their sides with normal posture . the lateral malleoli were placed between parallel lines , perpendicular to the frontal planes . sony 8 mega pixels digital camera ( sony corporation , tokyo , japan ) was attached to an adjustable tripod stand and the camera height adjusted to the shoulder level of participants , the camera was placed 50 cm from the subject s right side and positioned perpendicular to the ground11 . photographs were analyzed with digital software ( kinovea organization , paris , france , 2 d software version 0.7.10 ) . the space between the shoulder straps in the backpack was adjusted to be 20 cm1 . the bottom end of the backpack was at the level of t12 with short shoulder straps and at s1 with long shoulder straps . each individual was asked to walk on the treadmill for 15 min at a speed of 2 km / h1 . on the first day , the individual randomly used one of the 2 load - carrying styles ; after 24 h the same individual used the other style . pain sensitivity and craniovertebral angle were measured after 15 min walking in both conditions . the selection of shoulder straps length was randomized using sealed envelopes to avoid a learning effect . the sample size ( 25 participants ) was calculated to yield an 80% power and =0.05 . prior to final analysis , data were screened for normality assumption , and presence of extreme scores . this exploration was done as a pre - requisite for parametric calculation of the analysis of differences and of relationship measures . repeated measure multivariate analysis of variance ( manova ) was used to statistically compare the upper trapezius pressure pain threshold and craniovertebral angle obtained during 3 backpack conditions . there was a statistically significant difference in upper trapezius pain threshold among the 3 different conditions ( without backpack , backpack with short straps , and backpack with long straps ) ( f=134.005 , p<0.05 ) . a multiple pairwise comparison test ( post hoc test ) revealed that there was a statistically significant reduction in the upper trapezius pain threshold in the backpack with long straps condition compared with the without backpack and backpack with short straps conditions ( p<0.05 ) . in addition , there was a statistically significant reduction in the upper trapezius pain threshold in the backpack with short straps compared with the without backpack condition ( p<0.05 ) . there was also a statistically significant difference in the craniovertebral angle among the 3 different conditions ( f=31.442 , p<0.05 ) . a multiple pairwise comparison test ( post hoc test ) revealed that there was a statistically significant reduction in the craniovertebral angle in the backpack with long straps condition compared with the without backpack and backpack with short straps conditions ( p<0.05 ) . in addition , there was a statistically significant reduction in the craniovertebral angle in the backpack with short straps compared with the without backpack condition ( p<0.05 ) ( table 1table 1.dependent variables in participants while wearing a backpack with short straps ; or a backpack with long straps and without a backpackwithout backpackbackpack with short strapsbackpack with long strapsupper trapezius pain threshold ( kg / cm)3.7 1.04.3 1.2 * 5.8 1.2craniovertebral angle ( degrees)39.4 2.344 1.7 * 47 2*significant ( p<0.05 ) difference between without backpack and backpack with short straps , significant ( p<0.05 ) difference between backpack with short straps and backpack with long straps , significant ( p<0.05 ) difference between without backpack and backpack with long straps . ) . * significant ( p<0.05 ) difference between without backpack and backpack with short straps , significant ( p<0.05 ) difference between backpack with short straps and backpack with long straps , significant ( p<0.05 ) difference between without backpack and backpack with long straps . this study revealed that subjects assume a forward head posture ( indicated by a decrease in craniovertebral angle ) when carrying a backpack with long straps more than when using short straps . there was a significant difference in upper trapezius pain threshold and craniovertebral angle value with different backpack shoulder strap lengths . thus it can be concluded that carrying a backpack with long straps would alter the compensatory head position and may result in pain and other anomalies associated with altered posture . mackie et al.12 showed that manipulation of backpack weight , and shoulder strap length had a strong effect on shoulder strap tension and shoulder pressure . backpack weight had the greatest effect on shoulder strap tension and shoulder pressure while shoulder strap adjustment had the next greatest influence . therefore , this study investigated the effect of backpack shoulder strap length on upper trapezius pain threshold and craniovertebral angle . while using long shoulder straps , the area of contact between the backpack and the back is small with the backpack load concentrated on both shoulders . conversely , with short shoulder straps the area of contact between the backpack and back is large so that an increase in the surface area will lead to a decrease in the stress on the shoulders . moreover , the back will dissipate some of the forces , which leads to reduction in the load on the shoulders . from a biomechanical point of view , the torque produced while the shoulder straps are long is greater than the torque produced while the shoulder straps are short , due to an increase in the angle of pull and in the backpack weight moment arm . the upper trapezius pressure pain threshold was also significantly decreased with the long shoulder straps compared to that for the short shoulder straps . it was surmised that the pain sensitivity in the upper trapezius might be increased by scapular depression and downward rotation , causing overstretching of the upper trapezius12 . scapular depression syndrome is associated with lengthening or weakening and a lower pressure pain threshold in the ut muscle12 . a prolonged time in the depressed scapular position , in particular , may lead to chronic upper trapezius pain12 . a backpack with long shoulder straps places a lower muscular requirement on the cervical muscles , but may cause an increase in the compressive component of backpack weight , in addition to scapular depression backpack weight had the greatest influence on shoulder straps tension and shoulder pressure as the weight of the backpack increased the strap tension and shoulder pressure also increased . when the shoulder straps were loose , the tension and pressure under the shoulder straps decreased13 . as the torque produced while the shoulder straps are long is greater than the torque produced while the shoulder straps are short , shoulder strap tension and shoulder pressure increase . rule - of - thumb _ for load carrying , backpacks should be positioned high on the trunk at t12 not l3 . the findings in the current study were supported by those of kim et al.14 , who believed that carrying a backpack in the upper position may lead to safer use , and may help prevent musculoskeletal discomfort in those who regularly use a backpack . the study findings suggested that adjusting the backpack position , by fastening the shoulder strap , is a useful strategy for the prevention of musculoskeletal problems in school - age children . lower load placement produces more forward body lean , adding weight to the front half of the feet . moreover , previous studies have reported that forward leaning of the upper trunk increases to a greater extent , when subjects carry a backpack in a lower position , using a longer shoulder strap15 , 16 . shoulder straps should be adjusted so that the pack fits close to the upper part of the back . the further the backpack load is from the upper back , the more it pulls the body backward and strains muscles between the shoulders17 . placement of a backpack is a factor that can also potentially alter the design of a backpack . based on the results of 4 studies , low backpack placement leads to less postural deviation and postural sway5 , 18,19,20 . one of these 4 studies was conducted on adults and the other 3 on adolescents . three of the studies showed that load placement does not have any influence on gait and posture . one study recommended that for carrying more than 15% of body weight , low load placement should be avoided21 . other studies investigated the effect of load positioning on energy and oxygen consumption , pain , contact pressure and pulmonary function ; however , due to limited evidence no conclusions can be drawn22 . a study by brackley et al.5 evaluated changes in trunk forward lean , craniovertebral angle , and spinal lordosis angle that occurred with high , medium and low load placement during standing and walking in children . the study concluded that low load placement in the backpack produced a fewer changes in craniovertebral angle and spinal lordosis angle . in addition , joseph and sengupta23 , investigated the effect of the position of a backpack on physiological cost and perceptual responses of university students . each participant carried books weighing 15% of their body weight in a backpack with upper back vs. lower back placement and no load conditions . for the high backpack position , the top of the bag was leveled at the shoulder line , and for the low backpack position the bottom of the backpack was leveled at the l5 lumbar vertebra . the results indicated that wearing the backpack on the upper back might impose additional physical stress on male university student . moreover , low load placement ( at the spinal level of l3 ) was recommended by grimmer et al21 . when considering horizontal displacements of various anatomical landmarks with only a rested standing posture and 10% body weight loads , backpacks positioned at t7 produced a larger forward ( horizontal ) displacement of all the anatomical points than when positioned at ( t12 and l3 ) . in contrast to those in children , adult backpack studies have found that high load placement minimizes postural adaptations , indicating that adult findings can not be directly transferred to children . additionally , frank et al.24 found that the forces on the shoulder and back were minimized with low load placement ; however , postural analysis found less changes with high placement . mackie et al.12 found that load weight , use of a waist belt and longer strap lengths resulted in less shoulder pressure , thus advocating lower load placement . other researchers have advocated higher load placements , as forward lean is less than with low placements . the results of this study indicate that short straps are better than long straps . for - optimal use and ergonomic design , the backpack must be carried with a load equal 1015% of body weight , the space between the shoulder straps must be narrow and the length of the straps must be short at the level of t11t12 .
[ purpose ] this study was performed to investigate the effect of the length of backpack shoulder straps on upper trapezius muscle pain threshold and craniovertebral angle . [ subjects and methods ] there were 25 participants , with ages from 15 to 23 years old . upper trapezius pain threshold and craniovertebral angle were measured for all subjects without the backpack then re - measured after walking on a treadmill for 15 min under 2 conditions : 1 ) wearing a backpack with short straps ; and 2 ) wearing a backpack with long straps . [ results ] there was a significant reduction in upper trapezius pain threshold and craniovertebral angle while carrying a backpack with long shoulder straps , compared to use of a backpack with short shoulder straps or no backpack . [ conclusion ] a backpack with short straps is less harmful than a backpack with long straps . this result should be considered in ergonomic design of backpacks to reduce the incidence of various physiological and biomechanical disorders .
prior studies reported an association between ambient air concentrations of total suspended particles and so2 during pregnancy and adverse pregnancy outcomes . we examined the possible impact of particulate matter up to 10 microm ( pm10 ) and up to 2.5 microm ( pm2 . 5 ) in size on intrauterine growth retardation ( iugr ) risk in a highly polluted area of northern bohemia ( teplice district ) . the study group includes all singleton full - term births of european origin over a 2-year period in the teplice district . information on reproductive history , health , and lifestyle was obtained from maternal questionnaires . the mean concentrations of pollutants for each month of gestation were calculated using continuous monitoring data . three intervals ( low , medium , and high ) were constructed for each pollutant ( tertiles ) . odds ratios ( ors ) for iugr for pm10 and pm2.5 levels were generated using logistic regression for each month of gestation after adjustment for potential confounding factors . adjusted ors for iugr related to ambient pm10 levels in the first gestational month increased along the concentration intervals : medium 1.62 [ 95% confidence interval ( ci ) , 1.07 - 2.46 ] , high 2.64 ( ci , 1.48 - 4.71 ) . ors for pm2.5 were 1.26 ( ci , 0.81 - 1.95 ) and 2.11 ( ci , 1 . 20 - 3.70 ) , respectively . no other associations of iugr risk with particulate matter were found . influence of particles or other associated air pollutants on fetal growth in early gestation is one of several possible explanations of these results . timing of this effect is compatible with a current hypothesis of iugr pathogenesis . seasonal factors , one of the other possible explanations , is less probable . more investigation is required to examine these findings and alternative explanations.imagesfigure 1
radiation retinopathy is a chronic and progressive retinal microangiopathy that can occur even years after radiation treatment for cancer . radiation retinopathy has been reported secondary to treatment of intraocular tumors , such as uveal melanoma , retinoblastoma , as well as cephalic , nasopharyngeal , orbital , and paranasal tumors [ 1 , 2 , 3 ] . pathological vascular changes include a pattern of capillary occlusion , dilatation , and leakage , often within the macula which may progress to microaneurysms , telangiectatic - like vessels exudation and subsequent cystoid macular edema ( cme ) . capillary nonperfusion may also result in vasoproliferative sequelae , including retinal neovascularization , secondary vitreous hemorrhage , and neovascular glaucoma . current treatment of radiation retinopathy includes thermal laser photocoagulation , intravitreal antivascular endothelial growth factor ( anti - vegf ) injections , intravitreal steroid injections , and hyperbaric oxygen . however , despite treatment patients often may have progressive visual loss due to the significant amount of ischemic damage . conventional thermal laser photocoagulation for cme may result in macular scarring and eventually vision loss due to progressive atrophy from direct laser scars . subthreshold micropulse laser has been increasingly recognized as an effective and safe treatment for cme secondary to other retinal vascular diseases , including diabetic macular edema , retinal vein occlusion , and central serous retinopathy . unlike conventional thermal laser , micropulse laser delivers short bursts of laser energy in microsecond pulses micropulses rather than a continuous wave , resulting in less thermal damage and minimal or no scarring . also , yellow ( 577 nm ) wavelength laser light may be theoretically safer than conventional green ( 532 nm ) wavelength laser light when treating the macular area due to less thermal absorption by the xanthophyll pigments . here , we report a case of cme secondary to radiation retinopathy which was treated successfully with yellow pattern 577-nm micropulse laser . a 60-year - old asian man presented with a 2-month history of reduced vision and metamorphopsia in the left eye . he had mild controlled hypertension and hypercholesterolemia . he also had a history of nasopharyngeal carcinoma which was treated with local radiation and chemotherapy 23 years and 9 years previously . best - corrected visual acuity ( bcva ) was 20/16 in the right eye and 20/40 in the left eye . fundoscopy showed some intraretinal hemorrhages in the left temporal macula with telangiectatic vessels and scattered microaneurysms ( fig . 1 ) . fluorescein angiography revealed patchy capillaries , nonperfusion , and left late macular leak consistent with cme ( fig . optical coherence tomography ( oct ; heidelberg engineering , heidelberg , germany ) showed left cme ( fig . following informed consent , a solid - state subthreshold yellow 577-nm wavelength pattern micropulse laser ( supra scan 577 ; quantel medical , cournon d'auvergne , france ) with an adapter attached to a haag - streit type slit - lamp microscope was used to treat the left eye . using fluorescein angiography guidance to treat the leaking areas , single - spot and 9-spot square patterns of 100-m diameter were used with a duration of 0.02 s and a duty cycle of 15% ( the laser stayed on for 15% of the time ) . two months following treatment , subjectively the patient noted improved symptoms , bcva had improved to 20/20 in the left eye and the oct examination demonstrated reduced intraretinal edema ( fig . ten months after the micropulse laser , bcva had stabilized to 20/20 in the left eye and the oct examination revealed absence of the previously found intraretinal edema ( fig . subthreshold micropulse laser is an innovative therapy for retinal disorders which has been shown to be safe and effective in the treatment of macular edema [ 6 , 7 ] . the yellow pattern 577-nm micropulse laser in this case converts each laser shot into a pulse envelope consisting of a sequence of extremely short pulses of laser ( 1020 ms ) with intervening periods of zero laser energy to the treatment site . when the multi - spot pattern mode is used , the pulses are not produced simultaneously ; however , they formed in rapid succession with low - energy pulses during each laser shot . previous studies have shown that subthreshold laser performed in this way was sufficient to show a consistent retinal pigment epithelium - confined photothermal effect , and also to allow the inner retinal temperature to remain below the threshold of coagulative damage , sparing the transparency of the retina and lowering the risk of hemorrhage . because the micropulse laser treatment has no or minimal damage to the retina or choroid , and is less likely to produce chorioretinal scars , retreatment of the same area is feasible . as a result , it is possible to safely treat macular edema in a transfoveal location using subthreshold micropulse laser . however , the possibility of undertreatment is always a concern due to the difficulty in titrating treatment without a visible end point . in our case , we utilized fluorescein angiography guidance to treat the leaking areas ( overlay of the treatment map provided in fig . 2 ) . a previous study demonstrated that indocyanine green dye - guided micropulse diode laser was effective in the treatment of central serous chorioretinopathy . the pathogenesis of radiation retinopathy still remains elusive . in 1994 , in a review , archer et al . proposed that initial radiation caused the immediate death of retinal endovascular cells which created microscopic foci of epithelial damage . a vicious cycle of retinal vascular endothelial cell death , migration , division , and further death thus ensues , outstretching the ability of endothelial cells to maintain an unbroken endothelial lining and triggering inflammation and clotting cascades [ 4 , 5 ] . as a result , occlusion of discrete retinal capillary beds creates hemodynamic stress on neighboring capillaries which dilate to accommodate . however , many such capillary collaterals are compromised by radiation damage , leading to vascular leakage or further occlusion . occurring within the macular area , such vascular leakage results in cme . our patient presented with retinopathy and macular edema 23 years after initial radiotherapy . the onset of pathological changes may possibly be delayed due to the slow turnover of retinal vascular endothelial cells . our patient with macular edema secondary to radiation retinopathy was successfully treated with 1 session of subthreshold yellow pattern 577-nm micropulse laser with no detectable complications or retinal scarring . postulated processes include modification of inflammatory cytokines or induction of heat shock proteins in retinal pigment epithelium cells . in this case report , we presented a 60-year - old asian man with radiation retinopathy who was treated successfully with 1 session of yellow pattern 577-nm micropulse laser photocoagulation , resulting in improving symptoms and fluid resolution . further studies are needed to elucidate possible mechanisms of subthreshold laser and to develop better therapeutic as well as preventive treatment strategies for radiation retinopathy . the patient was informed that imaging related to his case would not be able to identify him personally and may be published and he consented for the publication . the authors declare that no conflicts of interest are involved in the present case report .
we report a case of a 60-year - old asian male who developed radiation retinopathy 23 years after initial radiotherapy for nasopharyngeal carcinoma and was successfully treated with yellow pattern 577-nm micropulse laser . secondary macular edema and visual acuity improved following a single treatment session with minimal scarring . yellow pattern micropulse laser is a safe and effective treatment for macular edema secondary to radiation retinopathy .
the utilization of multiple pharmacologic agents is an essential component of modern day anesthetic practice . while there have been numerous advancements in recent years in both analgesic and amnestic medications available for an anesthesiologist to use in clinical practice , the cadre of neuromuscular blocking agents available in the united states has been stagnant . the ideal neuromuscular blocking agent is one that is rapidly acting , has minimal to no adverse effects , is independent of end organ metabolism , and allows for rapid and complete reversal of neuromuscular blockade . first , the deleterious effects of residual neuromuscular blockade in the postanesthetic care unit have been well studied and are clinically relevant . emphasis on operative efficiency and patient discharge has also been widely identified as an area for potential cost saving measures in modern healthcare settings . novel drug development has been proven to be a difficult and timely process as it has been over 20 years since a new nondepolarizing muscle relaxant has been introduced for clinical use . this paper will highlight some of the latest pharmacological advancements in the area of neuromuscular blockade . the enantiomers gantacurium and cw002 are two of the most recent neuromuscular blocking agents that have shown potential for clinical application . the appeal of these molecules is the ultra - rapid reversal of neuromuscular blockade via cysteine adduction and minimal systemic hemodynamic alterations with administration . gantacurium is an asymmetric alpha - chlorofumarate and is classified as an ultra - short acting nondepolarizing neuromuscular blocker . its pharmacologic properties have been established using both animal and human models with its ed95 found to be 0.19 mg / kg . maximum neuromuscular blockade using gantacurium was found to be within 90 s following administration of 1.5 ed95 with even faster onset at higher doses . this pharmacologic profile is comparable to that of succylincholine and could eventually serve as a replacement for a rapid depolarizing muscle relaxant . gantacurium chemical structure cw002 differs in structure from gantacurium by being symmetrical and lacking a chlorine at the fumarate double bond . these properties give cw002 a greater potency than gantacurium and an intermediate duration of action of approximately 30 min . using both animal and human models , , cw002 has minimal to no hemodynamic effects at administered doses well above its documented ed95 . the first is a slow ph - sensitive hydrolysis at the ester linkages of the molecules . this results in a t of 56 min and 495 min for gantacurium and cw002 , respectively . the second pathway for inactivation is much more rapid and has the greatest clinical implications . l - cysteine adduction results in a byproduct of extremely low potency that also subsequently undergoes hydrolysis to form inactive molecules . furthermore , of importance is that unlike conventional neuromuscular blockers , this pathway allows for complete reversal at any time after bolus administration of neuromuscular blockers . l - cysteine adduction terminates the relaxants action via inactivation and not by overcoming competitive inhibition . advancements in neuromuscular blocking agents have the potential to have significant impact on anesthetic care in the united states . the ability to rapidly and reliably induce and reverse favorable conditions for tracheal intubation and surgery can profoundly impact anesthetic care in ambulatory , inpatient , and emergent settings . all anesthesia providers will need to consider some of the advantages and potentially disadvantages of these new drugs in their practice in the future . this paper details some of the promising medications on the horizon for clinical use . continued research is needed in the most important area of neuromuscular modulation in clinical practice .
pharmacological advances in anesthesia in recent decades have resulted in safer practice and better outcomes . these advances include improvement in anesthesia drugs with regard to efficacy and safety profiles . although neuromuscular blockers were first introduced over a half century ago , few new neuromuscular blockers and reversal agents have come to market and even fewer have remained as common clinically employed medications . in recent years , newer agents have been studied and are presented in this review . with regard to nondepolarizer neuromuscular blocker agents , the enantiomers gantacurium and cw002 , which are olefinic isoquinolinium diester fumarates , have shown potential for clinical application . advantages include ultra rapid reversal of neuromuscular blockade via cysteine adduction and minimal systemic hemodynamic effects with administration .
gastrointestinal ischemia arises due to a sudden reduction in intestinal blood flow , and it most commonly occurs due to mesenteric thrombosis , vasculitis and torsion of the intestine . in occlusive conditions , the collateral circuit of the intestine is occluded , which can be seen due to traumas , surgery on aorta or pelvic arteries , or can be caused by thrombosis / embolus in the mesenteric arteries . non - occlusive conditions are characterized by reduced flow , often due to hypotension such as septic or hypovolemic shock . ischemic colitis accounts for 5060% of cases of gastrointestinal ischemia and is associated with a high morbidity and mortality . in contrary , the rectum is only affected in 25% , a result of rich collateral blood supply of the rectum . symptoms include abdominal pain , gastrointestinal bleeding , diarrhea ( 68% ) , abdominal distention ( 63% ) and nausea / vomiting ( 38% ) . the disease can even be transient due to non - occlusive disorders , which makes it difficult to find the exact etiology of the ischemia and diagnosis may be delayed while exploring more common etiologies of the symptoms . risk factors for development of intestinal ischemia include age > 65 years , hypertension , renal failure , diabetes , history of irritable bowel disease , chronic obstructive pulmonary disease , constipation and atherosclerosis [ 68 ] . in this case report , we describe a rare case of ischemic proctosigmoiditis due to retroperitoneal hematomas in a patient with a pelvic fracture . an 87-year - old woman was admitted to the emergency unit due to abdominal pain and diarrhea . her previous medical history included prior to admission , the patient had fallen at home and was complaining about dizziness , lower abdominal pain , watery stool for the past 24 h and right - sided pelvic pain . initial assessment revealed following vital parameters : blood pressure 122/50 mmhg , pulse 63/min , respiratory rate 20/min , saturation 90% on room air and temperature 35.5c . during physical examination , the patient complained of tenderness over the pubic bone and lower abdomen , while no peritoneal reaction was found . biochemical measures revealed : hemoglobin 6.5 mmol / l ( 7.39.6 ) , white blood cell count 10.6 10/l ( 3.58.8 ) , platelets 102 10/l ( 145390 ) , creatinine 196 mol / l ( 5090 ) and c - reactive protein 29 mg / l ( < 8) . x - ray of the pelvic region revealed a right - sided nondisplaced pubic ramus fracture . after 9 h , the arterial blood gas was repeated and showed ph 7.42 and lactate 2.7 . due to near normalization of blood gas parameters upon i.v . fluid administration , the pelvic fracture was believed to be caused by a fall due to severe dehydration and diarrhea . twenty - one hours after admission , the patient s condition worsened and she was complaining of severe abdominal pain . a suspicion of intestinal ischemia arose , and without further radiologic examination , the patient was taken to the operating room for exploratory laparotomy . intra - operatively , necrosis of the sigmoid colon and proximal part of rectum were detected . additionally , another 10 cm area of non - vital ileum was detected 20 cm from the ileocecal region , which were adherent to the rectosigmoid junction . retroperitoneal hematomas were detected in the pelvic region , while no hematoma was identified in proximity to the inferior mesenteric artery . all non - vital intestinal segments were resected , and ileostomy and sigmoideostomy were performed . only minor bleeding was encountered during the procedure . postoperatively , the patient had severe sepsis and was kept at the intensive care unit . however , she recovered and was discharged 10 days after admission . histopathology of the resected tissue showed necrosis due to ischemia without any sign of vasculitis or thrombosis ( fig . 1 ) . we report a rare case of acute ischemic proctosigmoiditis where the origin of ischemia is difficult to establish . previously , only a few cases of ischemic proctitis have been reported in patients with pelvic fractures due to high - energy traumas , but no previous reports on ischemic proctosigmoiditis have been reported . the blood supply to the sigmoid colon arises from the inferior mesenteric artery through the sigmoid artery and its end branch , the superior rectal artery . the rectum has a rich blood supply which originates from the superior rectal artery and the middle and distal rectal artery , branches of the paired internal iliac artery . in addition , there is abundant collateral blood supply to the distal colon and rectum from the marginal artery of drummond that links the superior and inferior mesenteric arteries . in this case , we report ischemia of the distal part of sigmoid colon and proximal part of rectum . however , this patient had increased age , known hypertension and cardiovascular disease that could explain the increased susceptibility to ischemia . we assume that the origin of ischemia in this case was a pelvic fracture that caused retroperitoneal hematomas resulting in a local increase in retroperitoneal pressure and obstruction of the blood supply to the affected part of rectum and colon sigmoideum . possibly , early computed tomography imaging could have identified an expanding retroperitoneal hematoma and thus allowed for embolization by interventional radiologists . ischemia of colon and rectum are serious conditions associated with high morbidity and a mortality of 40% in patients with transmural necrosis of the rectum . our case illustrates that ischemia of the intestinal wall can arise due to pelvic fractures in patients with risk factors for vessel disease , and clearly states the difficulty in placing the correct diagnose of gastrointestinal ischemia .
gastrointestinal ischemia is caused by ischemic colitis in 5060% of cases and is associated with high morbidity and mortality among patients . ischemic proctosigmoiditis is a very rare disorder with only few cases reported . due to collateral blood supply the rectum is only affected in 25% of all cases of ischemic colitis . we report a rare case of ischemic proctosigmoiditis caused by a retroperitoneal hematoma due to a pelvic fracture .
recent research suggests that there is a symbiotic relationship between the non - self ' microbiota and self ' immune system , and both should be considered as one in the superorganism theory . the microbiota has been shown to have profound effects in the development of gut - associated lymphoid tissue , the differentiation of gut immune cells , and production of immune mediators such as igs ( iga ) and antimicrobial peptides ( defensins ) , as reviewed by sommers and bckhed . importantly , the microbiota has modulatory effects on important regulatory immune cells , including invariant natural killer t ( inkt ) cells and regulatory t cells ( tregs ) . the findings from these studies highlighted the tight and proper control of the interaction between the host immune system and microbiota provide mutual benefit and regulation . indeed , cells of the gut and the immune system have continual interactions to sample and distinguish between non - pathogenic commensal microflora , harmless foodstuff and pathogenic microorganisms . an appropriate balance between inflammatory and anti - inflammatory state a key tool in gaining insights into the importance of the microbiota in regulating the immune response is through studies of germ - free ( gf ) mice . unlike specific pathogen - free ( spf ) counterparts , gf mice are born and reared without exposure to any live microbes , thus they are devoid of microbiota . although different to the skewing of microbiota seen with a change in hygiene or diet , the use of gf mice in an experimental research setting has many benefits . it can be used to examine the extent to which a lack of microbiota influences the immune system , among other systems of the organism . inoculating gf mice with single strains of bacteria also provides a valuable tool in studying specific microbial species and its effect on the immune response . there are inherent deficiencies of t cells in the lamina propria of the intestine , with gf mice having fewer numbers of cd3 + t cells . such deficiency in t cells has been shown to result in increased bacterial translocation , such as escherichia coli . in addition , other studies have demonstrated that the t cell deficiencies and a th1/th2 imbalance is rescued by the addition of commensal bacteria bacteroides fragilis , bacterial molecule polysaccharide a , or lipopolysaccharide produced by gram - negative bacteria . the expression of angiogenin-4 , a selective yet potent antimicrobial peptide , is diminished in gf mice , and that inoculation of a single strain of bacteroides thetaiotaomicron can induce its expression . furthermore , bacterial colonisation of the commensal morganella morganii in the gut of gf mice also stimulates iga production that in turn prevents bacterial translocation . this may represent further mechanisms whereby the microbiota promotes the development of host immune responses , and also the capacity of the host immune system to prevent excessive bacterial translocation and inflammation . together , these point towards an important role of the microbiota in shaping different facets of the immune system . in mice lacking microbiota , studies have shown a defective treg population with lowered numbers and reduced capacity to function . not only were there less cd4+cd25 + t cells , gf mice also had reduced expression of treg transcription factor forkhead box p3 ( foxp3 ) , il-10 and il-13 . interestingly , tregs with increased suppressive capacity can be generated in vitro by co - incubation with bacterial antigens and antigen presenting cells ( apc ) , and in vivo by administration of clostridium - related segmented filamentous bacterium . a separate study suggests that microbiota - induced generation of treg in the periphery have a unique set of t - cell receptor repertoire , different to those of thymic origin . these results demonstrate an important role of the microbiota in the control of regulatory immune cells . in gf non - obese diabetic mice , the expression of foxp3 was only reduced in the gut , suggesting a restricted effect of the microbiota on treg biology . interestingly , the addition of scfas acetate , butyrate or propionate reversed the deficiencies of colonic treg numbers and function in gf mice . this supports a pathway whereby the generation of scfas through fermentation of fibre by the gut microbiota have direct effects on tregs , and highlights the anti - inflammatory functions of fibre and its metabolites . despite this , there is also evidence suggesting that dna of commensal microbiota limits treg and promotes t cell differentiation through tlr9 . these studies clearly further indicate the interaction between microbiota and the host immune system can result in a multitude of consequences . in addition , it advances the idea that the interplay and balance between gut microbiota and the immune system is crucial for intestinal homeostasis , and that dysbiosis may cause excessive inflammation that contributes to disease pathology . the second part of the review will highlight recent findings on the influence of microbiota changes in the development of inflammatory diseases , and the potential of harnessing the gut microbiota to provide opportunities for translation from research to clinical management . intriguingly , recent studies into the gf mice demonstrated an upregulation of genes involved in cell growth and signalling , signal transduction and metabolism with oncogenic implications , whereas a downregulation of immune - related genes , reflecting an underdeveloped immune system . this finding indicates that the impact of the microbiota is not limited to the local immune function and inflammation , but also influence the host metabolic homeostatic state . therefore , in addition to our primary focus on the localised effects of dysbiotic microbiota on the development of ibd , we will explore recent findings from clinical and animal studies that demonstrate the systemic effects of the dysbiotic microbiota on asthma , obesity and diabetes , and some of the emerging uses of microbiota modification as a target for therapeutic intervention . expectedly , changes in the gut microbiota has associations with inflammation and inflammatory diseases in the gut . ibd patients have increased enterobacteriaceae ( such as e. coli ) and bacteroidetes ( such as b. fragilis ) and reduced firmicutes ( clostridia - related clusters ) , and also consistently elevated bacterial load in the colon . patients with uc also have reduced faecalibacterium prausnitzii , a bacterium that has anti - inflammatory properties . , f. prausnitzii has been shown to protect against murine model of colitis , through induction of regulatory cytokine il-10 , and not th1 cytokines il-12 or ifn-. in addition , purified polysaccharide a , a product from b. fragilis , can prevent gut pathology through the modulation of il-10-producing t cells in mice . despite the fact that a change in microbiota composition is associated with ibd development , changes in specific bacterial species have not been identified across patients . it is likely that a combination of elevated bacterial load and a shift away from bacteria with anti - inflammatory properties that have an accumulative effect in initiating or aggravating the pathology of disease . however , the current research does not elucidate a causal effect . in a mouse model , despite commensal enterobacteriaceae ( primarily e. coli ) are enriched in mice with colitis , transfer of these microorganisms did not induce disease in antibiotic - pre - treated mice , whereas transfer of commensal bacteroides did . this suggests a clear distinction between microorganisms that induce disease and those that change as a result of disease . it will be a difficult feat to identify any specific microorganisms that promotes the pathogenesis of ibd given the retrospective nature of human studies , and the fact that not all animal studies successfully translate to humans . nevertheless , associations in human studies , and temporal studies in animals will allow greater insight into the immunopathogenesis of ibd . gf mice have been an invaluable tool used to study the function of microbiota in animal models of inflammatory diseases . there are increased relative and absolute numbers of inkt cells that forms a stable population in the lamina propria , although their activation markers remain unaltered . gf mice are more susceptible to inkt - dependent oxazolone - induced colitis , and have increased expression of il-13 and il-1 , whereby this disease phenotype can be reversed with cd1d blockade . this clearly indicates that antigen presentation and subsequent activation of inkt cells is critical to maintain gut homeostasis . in a 2% dextran sulphate sodium ( dss)-induced colitis model , gf mice showed increase mortality compared with spf mice . however , disease severity was lessened in gf mice with the addition of b. fragilis , with improved survival rates , disease activity scoring , histopathological scoring , reduced tnf- and increased il-10 production . the results of this study revealed the immunomodulatory role of b. fragilis and the effects this bacterium could have on disease progression . therefore , the appropriate modulation of gut microbiota may be a therapeutic target for localised inflammatory conditions . one method of altering the gut microbiota is to restrict bacterial growth in the patients ' gut microbiome by the use of antibiotics . studies have shown that in certain subgroups , and indeed during certain stages of disease , treatment with antibiotics was successful in inducing remission and preventing relapse . in a multicentre trial , oral administration of amoxicillin , tetracycline and metronidazole reduced clinical score , increased clinical remission and also promoted corticosteroid discontinuation in patients with uc who were dependent on it . interestingly , it seems that as the more time progresses , the less significance there was between treatment and control groups . this could be , at least partially , explained by the resilient nature of the gut microbiota in a study with ciprofloxacin for 5 days . the use of antibiotics was shown to result in an altered , yet stable , microbiota and the persistence of antibiotic - resistant genes . the propagation of antibiotic resistance and the distribution of bacteria beneficial or detrimental for ibd are potentially important determinants of the level of response to antibiotic therapies . since ibd has microbial complications , if not infectious origins , the use of antibiotics seem more than appropriate . the effects of antibiotics are not restricted to killing bacteria , with rifaximin shown to have effects on epithelial cells and immunological transcription factors such as nuclear factor-b ( nf-b ) . the findings of this study demonstrated the potential actions of certain antibiotics to act beyond an antibacterial agent , which could have synergistic roles in dampening inflammation , though the mechanisms behind the beneficial effects of antibiotics in ibd is still unclear . on the other hand , the tipping of microbiota composition may not always favour commensals . the reduction in gut microbiota diversity may promote the growth of bacteria that may not benefit , if not worsen , the ibd phenotype . therefore , there is great potential for antibiotic therapy in ibd , with possible benefits beyond that of modulating the microbiota , but details of the mechanisms of action need to be elucidated . animal models provides us with a controlled environment for the study of specific aspects of disease . studies suggest that antibiotics therapy with the combined dose of ampicillin , metronidazole , neomycin and vancomycin , or bacitracin and neomycin , increases bacterial translocation , induces mild inflammation and the risk of developing dss - induced colitis . however , different studies using cin-102 , a natural cinnamon oil composition - like mixture with broad - spectrum antibacterial activity , and cathelicidin from bungarus fasciatus decreased intestinal bacterial load , and improved symptoms of dss - induced colitis . ciprofloxacin and metronidazole have also been shown to reduce ileitis in genetically modified mice through the downregulation of pro - inflammatory cytokines ifn- and tnf , and t - cell activation . although some antibiotics such as ampicillin and ciprofloxacin have broad - spectrum activities , others have specific activities , with vancomycin targeting gram - positive bacteria , and metronidazole targeting anaerobes . these highlight the importance in choosing the right antibacterial compounds and combinations of antibiotics are crucial to the control of disease . furthermore , with the natural antibacterial therapy having shown no resistance in the study , it may have advantages over conventional antibiotics in its spectrum of control of the gut microbiota . the use of antibiotics during pregnancy also decreases bacterial richness and increases the risk of colitis for the offspring . therefore , much considerations are needed in choosing a specific antibacterial compound , and its timing of use , especially with the increases in antibiotic - resistant strains in humans . nonetheless , these animal studies have outlined important microbiota - modulating roles of antibiotics in controlled and less genetically diverse animal models , and successful therapies could lead to future human research and development into clinical trials . to investigate further into the association of specific bacteria and the progression of ibd , addition of bacteria to the patients ' gut microbiome can be achieved in the form of probiotics . probiotics are live microorganisms that are beneficial to gastrointestinal and general health . in most cases , patients with ibd have increased bacteroides , enterobacteriaceae ( mainly e. coli ) and decreased lactobacillus and bifidobacterium . in a systematic review of clinical trials , lactic acid bacteria and bifidobacteria , and even bifidobacteria - fermented milk , had the potential to treat patients with ibd , with greater efficacy in patients with uc than cd . a mixture named vsl#3 containing lactobacillus , in addition , a non - pathogenic strain of e. coli was effective in maintaining remission in patients with uc . the greater benefit observed in patients with uc could be the restricted nature of uc pathology to the mucosal layer of the colon , whereas cd can affect any layer of any part of the gastrointestinal tract , and thus have more variance in its pathology . nevertheless , these evidence suggest a therapeutic role of probiotic lactobacillus and bifidobacteria in patients with ibd that should be further pursued . a study found that a probiotic mixture can improve disease scoring of dss - induced colitis . bifidobacterium longum can also reduce colitis severity by preserving tight junction proteins and improving intestinal epithelial integrity . however , this protective effect was observed in a specific strain ( ccm7952 ) and not in others , suggesting the different genetic make up and specific bacteria - host interactions even between different strains are important to confer protection . another animal study showed that the combined effects of clostridium butyricum and bifidobacterium infantis protected against colitis , by restoring the gut microbiota . lactobacillus casei can also modulate the microbiota and protect against colitis , but it requires the dairy delivery matrix of milk for this effect . f. prausnitzii and the extracellular polymeric matrix isolated from its biofilm both had anti - inflammatory effects through tlr-2 signalling and modulation of il-10 and il-12 , ameliorating dss - induced colitis . a recent study suggests that live bifidobacteria can also protect against dss - induced colitis , although it only stably colonises the gut in gf but not spf mice . this is likely due to the fact that there is no competing colonising strains in gf mice , and raises an interesting question of how well bacteria given as a probiotic can colonise the gut . human studies have shown that although the probiotics have minimal effects on the composition of the gut microbiota , and is usually undetectable after 2 weeks post - ingestion , they do promote bacterial gene expressions related to plant - polysaccharide and other carbohydrate metabolism pathways . there could also be immunomodulatory effects during the period of probiotic consumption that polarise dcs . in vitro studies suggest probiotics promote a regulatory dc phenotype , either by direct interactions or through epithelial expression of tgf- and thymic stromal lymphopoietin . therefore , it is possible that given sufficient dosage and length of probiotic therapy , there can be bias towards a less inflammatory gut environment that benefit patients with ibd . another concept is to replace an unhealthy ' gut microbiota with a healthy ' one , in what is termed faecal microbiota transplant ( fmt ) . fmt has been successful in treatment of clostridium difficile infections , and given the dysbiotic nature of ibd , fmt seems suitable as a treatment option . indeed , in a recent systematic review of fmt therapy in adults and children with ibd ( along with other gastrointestinal infection and inflammatory diseases ) , active uc or refractory cd , the results were positive without adverse effects . notably , fmt was more successful for treating patients with uc rather than cd , again likely due to the heterogeneity of cd . however , fmt for ibd is much less effective than for c. difficile infections , which may be because of a collection of different risk factors in disease development , and in the differences of donor microbiota . the primary reason might be the difference between one causative bacteria ( c. difficile ) compared with an unknown cause and contributing microorganisms for ibd . for example , the amount of processing time may affect the populations of anaerobic and aerobic bacteria , changing the composition and affecting the outcome of transplantation . the microbiota following fmt varies significantly , and patients whose microbiota shifted towards that of the donors ' had better outcomes . the richness of donor microbiota , and the enrichment of butyrate - producing bacteria also correlated with successes in fmt . interestingly , the latter enrichment suggests that an increased utilisation of butyrate may be a pathway benefiting patients with ibd , possibly through restoration of epithelial cell function and colonic integrity . although fmt are generally well - tolerated by patients , both children and the elderly , there are limited studies that involve long - term follow - up . given the increasing research outlining roles of the microbiota in many aspects of host physiology , long - term safety of fmt is an important aspect that should be included in future studies . one method of modelling fmt and studying the effects of microbiota transfers experimentally is the use of co - housed animals . a study found that a genetic knockout strain harboured altered microbiota containing higher populations of firmicutes and probiotic bacteria . interestingly , this altered microbiota was transferred to wild - type mice when co - housed , and subsequently transferred protection to dss - induced colitis . this indicated that a transferred microbiota , if well tolerated , can transfer protection , giving support to the use of fmt . similarly , when the genetic knockout mice were inherently protected from dss - induced colitis , co - housing with wild - type mice increased their sensitivity to disease , while the vice versa was also true ; when the genetic knockout mice were susceptible to colitis , co - housing conferred protection . in addition , when using the same helicobacter - induced model of colitis on mice in two different facilities , researchers showed that differing compositions of gut microbiota had significant and opposing effects on the outcomes of disease . this hints at the possibility that modulating the microbiota may override genetic susceptibilities , adding further support to the capacity of microbiota transfers as a therapeutic strategy . however , the same environmental variations presents obstacles in the translation of microbiota research to human studies , where there are vastly more variations to be considered . taken together , it is evident that microbiota transfers have the potential to modulate disease outcomes , and supports the notion that fmt is beneficial to patients with ibd . the important difference between animal models and clinical ibd is the known cause of disease in animal models . indeed , the unknown cause of ibd in humans and how to increase the compatibility of donor recipient gut microbiota are immediate hurdles for research into the clinical effectiveness of fmt in ibd . last but not least , prebiotics are types of fibre that promote the growth of beneficial microorganisms which contribute to the health of the host , and is therefore an option for therapeutic intervention . different prebiotics have different effects , with inulin and fructo - oligosaccharides promoting the growths of bifidobacteria and lactobacilli , respectively . a few studies on the effects of prebiotics in patients with ibd showed it lowered inflammation and clinical activity score , and maintained remission in patients with uc . interestingly , it was found that patients with active cd had a lower intake of inulin - type fructans and oligofructose than patients with inactive cd and healthy controls . therefore , the findings from these clinical studies suggest that improvements in disease activity may be due to the anti - inflammatory properties of fermented products of prebiotics , such as scfas , they are produced by bacteria such as f. prausnitzii , bifidobacteria and lactobacilli . when assessed for the capacity of the colonic mucosa to utilise butyrate , glucose and glutamate , it was found that patients with uc were less effective at metabolising butyrate , while there were increased utilisation of glucose and glutamate , possibly as a compensatory mechanism . in animal studies , prebiotics alter the gut microbiota and have anti - inflammatory effects . soluble dextrin from different sources ( corn or tapioca ) differentially alters the gut microbiota , thus it is safe to assume the complexity of prebiotic fermentation and the effects of prebiotics on the gut microbiota colonies . when fed a high - fibre diet or scfa acetate , mice had a reduced risk of developing colitis . this could be due to the actions of butyrate on the colonic epithelium , but also the capacity of scfas in promoting the numbers and functions of colonic tregs , thus enabling a state that is more resistant to inflammation . however , when given during dss - induced colitis as a model of treatment , both fibre ( with or without the addition of b. longum ) and acetate failed to alter disease progression , indicating a role of prebiotics in prevention rather than treatment of disease . this further supports the association between consumption of a western diet and increase in risk for the later development of inflammatory diseases . it also suggests the importance in timing of prebiotic treatments , and that such therapies are more effective during remission and inactive inflammatory responses . one method of altering the gut microbiota is to restrict bacterial growth in the patients ' gut microbiome by the use of antibiotics . studies have shown that in certain subgroups , and indeed during certain stages of disease , treatment with antibiotics was successful in inducing remission and preventing relapse . in a multicentre trial , oral administration of amoxicillin , tetracycline and metronidazole reduced clinical score , increased clinical remission and also promoted corticosteroid discontinuation in patients with uc who were dependent on it . interestingly , it seems that as the more time progresses , the less significance there was between treatment and control groups . this could be , at least partially , explained by the resilient nature of the gut microbiota in a study with ciprofloxacin for 5 days . the use of antibiotics was shown to result in an altered , yet stable , microbiota and the persistence of antibiotic - resistant genes . the propagation of antibiotic resistance and the distribution of bacteria beneficial or detrimental for ibd are potentially important determinants of the level of response to antibiotic therapies . since ibd has microbial complications , if not infectious origins , the use of antibiotics seem more than appropriate . the effects of antibiotics are not restricted to killing bacteria , with rifaximin shown to have effects on epithelial cells and immunological transcription factors such as nuclear factor-b ( nf-b ) . the findings of this study demonstrated the potential actions of certain antibiotics to act beyond an antibacterial agent , which could have synergistic roles in dampening inflammation , though the mechanisms behind the beneficial effects of antibiotics in ibd is still unclear . on the other hand , the reduction in gut microbiota diversity may promote the growth of bacteria that may not benefit , if not worsen , the ibd phenotype . therefore , there is great potential for antibiotic therapy in ibd , with possible benefits beyond that of modulating the microbiota , but details of the mechanisms of action need to be elucidated . animal models provides us with a controlled environment for the study of specific aspects of disease . studies suggest that antibiotics therapy with the combined dose of ampicillin , metronidazole , neomycin and vancomycin , or bacitracin and neomycin , increases bacterial translocation , induces mild inflammation and the risk of developing dss - induced colitis . however , different studies using cin-102 , a natural cinnamon oil composition - like mixture with broad - spectrum antibacterial activity , and cathelicidin from bungarus fasciatus decreased intestinal bacterial load , and improved symptoms of dss - induced colitis . ciprofloxacin and metronidazole have also been shown to reduce ileitis in genetically modified mice through the downregulation of pro - inflammatory cytokines ifn- and tnf , and t - cell activation . although some antibiotics such as ampicillin and ciprofloxacin have broad - spectrum activities , others have specific activities , with vancomycin targeting gram - positive bacteria , and metronidazole targeting anaerobes . these highlight the importance in choosing the right antibacterial compounds and combinations of antibiotics are crucial to the control of disease . furthermore , with the natural antibacterial therapy having shown no resistance in the study , it may have advantages over conventional antibiotics in its spectrum of control of the gut microbiota . the use of antibiotics during pregnancy also decreases bacterial richness and increases the risk of colitis for the offspring . therefore , much considerations are needed in choosing a specific antibacterial compound , and its timing of use , especially with the increases in antibiotic - resistant strains in humans . nonetheless , these animal studies have outlined important microbiota - modulating roles of antibiotics in controlled and less genetically diverse animal models , and successful therapies could lead to future human research and development into clinical trials . to investigate further into the association of specific bacteria and the progression of ibd , addition of bacteria to the patients ' gut microbiome can be achieved in the form of probiotics . probiotics are live microorganisms that are beneficial to gastrointestinal and general health . in most cases , patients with ibd have increased bacteroides , enterobacteriaceae ( mainly e. coli ) and decreased lactobacillus and bifidobacterium . in a systematic review of clinical trials , lactic acid bacteria and bifidobacteria , and even bifidobacteria - fermented milk , had the potential to treat patients with ibd , with greater efficacy in patients with uc than cd . a mixture named vsl#3 containing lactobacillus , bifidobacteria and streptococcus was also successful in inducing and maintaining remission of paediatric uc . in addition , a non - pathogenic strain of e. coli was effective in maintaining remission in patients with uc . the greater benefit observed in patients with uc could be the restricted nature of uc pathology to the mucosal layer of the colon , whereas cd can affect any layer of any part of the gastrointestinal tract , and thus have more variance in its pathology . nevertheless , these evidence suggest a therapeutic role of probiotic lactobacillus and bifidobacteria in patients with ibd that should be further pursued . a study found that a probiotic mixture can improve disease scoring of dss - induced colitis . bifidobacterium longum can also reduce colitis severity by preserving tight junction proteins and improving intestinal epithelial integrity . however , this protective effect was observed in a specific strain ( ccm7952 ) and not in others , suggesting the different genetic make up and specific bacteria - host interactions even between different strains are important to confer protection . another animal study showed that the combined effects of clostridium butyricum and bifidobacterium infantis protected against colitis , by restoring the gut microbiota . lactobacillus casei can also modulate the microbiota and protect against colitis , but it requires the dairy delivery matrix of milk for this effect . f. prausnitzii and the extracellular polymeric matrix isolated from its biofilm both had anti - inflammatory effects through tlr-2 signalling and modulation of il-10 and il-12 , ameliorating dss - induced colitis . a recent study suggests that live bifidobacteria can also protect against dss - induced colitis , although it only stably colonises the gut in gf but not spf mice . this is likely due to the fact that there is no competing colonising strains in gf mice , and raises an interesting question of how well bacteria given as a probiotic can colonise the gut . human studies have shown that although the probiotics have minimal effects on the composition of the gut microbiota , and is usually undetectable after 2 weeks post - ingestion , they do promote bacterial gene expressions related to plant - polysaccharide and other carbohydrate metabolism pathways . there could also be immunomodulatory effects during the period of probiotic consumption that polarise dcs . in vitro studies suggest probiotics promote a regulatory dc phenotype , either by direct interactions or through epithelial expression of tgf- and thymic stromal lymphopoietin . therefore , it is possible that given sufficient dosage and length of probiotic therapy , there can be bias towards a less inflammatory gut environment that benefit patients with ibd . another concept is to replace an unhealthy ' gut microbiota with a healthy ' one , in what is termed faecal microbiota transplant ( fmt ) . fmt has been successful in treatment of clostridium difficile infections , and given the dysbiotic nature of ibd , fmt seems suitable as a treatment option . indeed , in a recent systematic review of fmt therapy in adults and children with ibd ( along with other gastrointestinal infection and inflammatory diseases ) , active uc or refractory cd , the results were positive without adverse effects . notably , fmt was more successful for treating patients with uc rather than cd , again likely due to the heterogeneity of cd . however , fmt for ibd is much less effective than for c. difficile infections , which may be because of a collection of different risk factors in disease development , and in the differences of donor microbiota . the primary reason might be the difference between one causative bacteria ( c. difficile ) compared with an unknown cause and contributing microorganisms for ibd . for example , the amount of processing time may affect the populations of anaerobic and aerobic bacteria , changing the composition and affecting the outcome of transplantation . the microbiota following fmt varies significantly , and patients whose microbiota shifted towards that of the donors ' had better outcomes . the richness of donor microbiota , and the enrichment of butyrate - producing bacteria also correlated with successes in fmt . interestingly , the latter enrichment suggests that an increased utilisation of butyrate may be a pathway benefiting patients with ibd , possibly through restoration of epithelial cell function and colonic integrity . although fmt are generally well - tolerated by patients , both children and the elderly , there are limited studies that involve long - term follow - up . given the increasing research outlining roles of the microbiota in many aspects of host physiology , long - term safety of fmt is an important aspect that should be included in future studies . one method of modelling fmt and studying the effects of microbiota transfers experimentally is the use of co - housed animals . a study found that a genetic knockout strain harboured altered microbiota containing higher populations of firmicutes and probiotic bacteria . interestingly , this altered microbiota was transferred to wild - type mice when co - housed , and subsequently transferred protection to dss - induced colitis . this indicated that a transferred microbiota , if well tolerated , can transfer protection , giving support to the use of fmt . similarly , when the genetic knockout mice were inherently protected from dss - induced colitis , co - housing with wild - type mice increased their sensitivity to disease , while the vice versa was also true ; when the genetic knockout mice were susceptible to colitis , co - housing conferred protection . in addition , when using the same helicobacter - induced model of colitis on mice in two different facilities , researchers showed that differing compositions of gut microbiota had significant and opposing effects on the outcomes of disease . this hints at the possibility that modulating the microbiota may override genetic susceptibilities , adding further support to the capacity of microbiota transfers as a therapeutic strategy . however , the same environmental variations presents obstacles in the translation of microbiota research to human studies , where there are vastly more variations to be considered . taken together , it is evident that microbiota transfers have the potential to modulate disease outcomes , and supports the notion that fmt is beneficial to patients with ibd . the important difference between animal models and clinical ibd is the known cause of disease in animal models . indeed , the unknown cause of ibd in humans and how to increase the compatibility of donor recipient gut microbiota are immediate hurdles for research into the clinical effectiveness of fmt in ibd . last but not least , prebiotics are types of fibre that promote the growth of beneficial microorganisms which contribute to the health of the host , and is therefore an option for therapeutic intervention . different prebiotics have different effects , with inulin and fructo - oligosaccharides promoting the growths of bifidobacteria and lactobacilli , respectively . a few studies on the effects of prebiotics in patients with ibd showed it lowered inflammation and clinical activity score , and maintained remission in patients with uc . interestingly , it was found that patients with active cd had a lower intake of inulin - type fructans and oligofructose than patients with inactive cd and healthy controls . therefore , the findings from these clinical studies suggest that improvements in disease activity may be due to the anti - inflammatory properties of fermented products of prebiotics , such as scfas , they are produced by bacteria such as f. prausnitzii , bifidobacteria and lactobacilli . when assessed for the capacity of the colonic mucosa to utilise butyrate , glucose and glutamate , it was found that patients with uc were less effective at metabolising butyrate , while there were increased utilisation of glucose and glutamate , possibly as a compensatory mechanism . in animal studies , prebiotics alter the gut microbiota and have anti - inflammatory effects . soluble dextrin from different sources ( corn or tapioca ) differentially alters the gut microbiota , thus it is safe to assume the complexity of prebiotic fermentation and the effects of prebiotics on the gut microbiota colonies . when fed a high - fibre diet or scfa acetate , mice had a reduced risk of developing colitis . this could be due to the actions of butyrate on the colonic epithelium , but also the capacity of scfas in promoting the numbers and functions of colonic tregs , thus enabling a state that is more resistant to inflammation . however , when given during dss - induced colitis as a model of treatment , both fibre ( with or without the addition of b. longum ) and acetate failed to alter disease progression , indicating a role of prebiotics in prevention rather than treatment of disease . this further supports the association between consumption of a western diet and increase in risk for the later development of inflammatory diseases . it also suggests the importance in timing of prebiotic treatments , and that such therapies are more effective during remission and inactive inflammatory responses . dysbiotic microbiota also exerts systemic effects , and is implicated in extra - gastrointestinal diseases such as asthma and diabetes . microbiota research in asthma has centred more on the hygiene hypothesis , whereby early - life exposure to microorganisms has been a large part of the focus . studies suggest that babies born through vaginal delivery when compared with those born via caesarean section , and also infants fed with breast milk when compared with those fed formula , have increased bifidobacteria and decreased bacteroides , among other differences in gut microbiota . in addition , having older siblings also increased bacterial diversity and bacterial richness in 18-month - old individuals . these findings indicate that interactions between the offspring and parents or siblings are associated with beneficial outcomes , possibly through having similar composition of the gut microbiota . children living in rural areas were exposed to an increased variety of microorganisms ( in bacteria and fungi ) and this microbial diversity rendered them less likely to develop asthma , though the study was unable to identify the specific species involved . these findings support the hypothesis that there is a window of opportunity for microbial modulation during early childhood , and when there are reductions in gut microbial diversity and altered airway microbiota during this time , it may present as a risk factor for chronic wheeze and asthma , though there have also been studies that failed to find any associations . unlike the gut , increased bacterial load and diversity in the lung were correlated with bronchial hyperresponsiveness and disease activity in patients with asthma . this may be due to inappropriate colonisations of potentially pathogenic bacteria , such as by sphingomonadaceae , which elicit an inkt cell - driven production of il-4 and il-13 , and induction of airway hyperresponsiveness . these results from the animal study showed that even though an increase in bacterial load increases recruitment of immune cells , there needs to be in depth clarification of bacterial strains to understand how bacterial diversity affects the host immune response and subsequent development of inflammation . another aspect of microbiota research in asthma has been the use of antibiotics . in a study using ovalbumin ( ova)-induced allergic airways disease ( aad ) , a murine model of asthma , vancomycin treatment in early - life stages exacerbated disease . here , the researchers showed that vancomycin during early - life stages , but not streptomycin , reduced microbial diversity and percentages of tregs in the colon , but not in the lung . in addition , actinobacteria and bacteroidetes were almost completely depleted , while there is an overgrowth of lactobacillus . another study found that components of streptococcus pneumoniae increased the number of tregs in the lung , which were required for the suppression of inkt cells and aad . taken together , these results advocate for the hygiene hypothesis in the development of asthma . more specifically , reduced antibiotic use and increased gut microbial diversity and richness ( especially during early life ) can induce the number and function of regulatory immune cells to protect against asthma . the gut microbiota also has crucial functions in harvesting energy , and its alterations have profound effects on host systemic physiology and metabolic homeostasis . previous studies suggest that firmicutes have a greater capacity for energy harvest when compared with bacteroidetes . in fact , the positive association between increased ratio of firmicutes : bacteroidetes and obesity was found in ob / ob mice . similar result was observed in humans , and as such , this firmicutes - predominant microbiota composition has been colloquially termed an obese microbiota ' . however , this is not always true , and even the inverse relationship has been found in other studies . the confounding factor could be diet , with differential use of fat - restricted or carbohydrate - restricted diet , or no dietary restrictions at all in the different studies . another possibility may be the lack of dependency of obesity on the ratio of bacterial phyla , but rather specific species and their capacity to produce scfas . acetate , the most abundant scfas in the gut , was found to be increased in patients on the carbohydrate - restricted diet and in lean individuals . furthermore , there are studies that suggest an obese individual can be distinguished from a lean individual by analysing the difference in the number of microbiota genes . a reduction of faecal bifidobacteria in children may predict overweight , with bifidobacteria being associated with breast feeding and reduced risk of obesity . a potential pathway for the beneficial effects of bifidobacteria is the fermentation of breast milk and prebiotic fibre to produce scfas . in studies using rats fed on a high - fat diet , those prone to obesity had increased tlr4 expression , decreased epithelial integrity and increased serum lipopolysaccharide levels . furthermore , when compared with rats fed a low - fat diet , consumption of a high - fat diet decreased total bacterial load , but increased the relative abundance of bacteroides , and , to a greater extent , clostridia and enterobacteriaceae in the composition of the gut microbiota . these animal studies provided evidence that different phyla of bacteria have differential effects on energy harvest and fibre fermentation , though there are still discrepancies between studies . more importantly , it highlights varying effects of different species of bacteria on host physiology . indeed , it may be these differences that contribute to the contrasting results from phyla analysis . together , the findings from these studies reveal a change in microbiota composition and encoded genes that promotes energy harvest and inflammation play a more prominent role in obesity , and shed light on the potential of scfas and scfa - producing bacteria as a therapeutic . the microbiota of diabetic patients and mouse models also hints at how changes in microbiota affects metabolic diseases . in patients with pre - type ii diabetes ( t2d ) , there were reduced butyrate - producing bacteria ( such as f. prausnitzii ) and decreased bacteroides . however , in a different study , an increase in bacteroidetes and decrease in firmicutes were observed in patients with t2d . as with obesity , a confounding factor could be diet , as the studies were conducted in china and denmark , with inherently different diets and lifestyle factors . sample handling may also contribute to alterations of microbial compositions , with the chinese study freezing samples at 80 c within 2 h of collection , a shorter time than the 24 h in the danish study . animal studies have provided insights into the positive association between lipopolysaccharide , a product of gram - negative bacteria such as bacteroidetes , and the induction of t2d . the mechanism for this is likely to be mediated through toll - like receptor ( tlr ) sensing , as tlr9-deficient mice in a type i diabetes ( t1d ) model had increased actinobacteria ( bifidobacteria ) and firmicutes , and decreased bacteroidetes . although changes in the firmicutes : bacteroidetes population in animal studies contrast that of the aforementioned human studies , it may be due to differences between mice and humans , or the different nature of disease . mice deficient in tlr3 or myeloid differentiation primary response gene 88 ( myd88 ) ( dependent signalling molecule of other tlrs ) were protected from t1d , suggesting differential but important roles of tlrs , and consequently , the microbiota , in the initiation and development of diabetes . interestingly , studies in gf and spf non - obese diabetic mice found no difference in the incidence of t1d , though the addition of bacillus cereus resulted in a delayed and lowered incidence . although a very good model of human t1d , non - obese diabetic mouse models are still not perfect in translating murine studies to humans . furthermore , a study into gf mice that was fed a western - like ' diet was shown to be protected from developing obesity , and this was found to be mediated through increased expression of phosphorylated amp - activated protein kinase in muscle and liver , which promotes fatty acid oxidation . however , in gf mice deficient in fasting - induced adipocyte factor , there were reductions in enzymes involved in fatty acid oxidation and increased weight gain , even though muscle and liver phosphorylated amp - activated protein kinase remained similar . this study showed that the microbiota may directly impact on fatty acid metabolism , or indirectly , through the regulation of genes that modulate metabolism . taken together , the use of various strains of mice and types of disease models under normal spf or gf conditions reveal important roles of the microbiota in modulating inflammatory conditions and metabolic diseases . there is a growing body of research on the use of probiotics for the treatment of respiratory diseases , including asthma and other airway hypersensitivity conditions . a randomised , double - blinded and placebo - controlled trial of oral lactobacillus gasseri capsule in asthmatic children found the treatment group had lower bronchial hyper - reactivity , better pulmonary function , and greater improvements in day time asthmatic symptoms . this treatment also reduced in vitro production of tnf , il-12 , il-13 and ifn- in peripheral blood mononuclear cells . similar results were observed with oral inoculation of lactobacillus rhamnosus in mice being protective of the ova model of aad . the group of mice treated with probiotics had decreased clinical score , airway hyperresponsiveness and ova - specific t cells in the spleen , and increased proportions of tregs in the spleen . this could be in part mediated through the modulation of macrophages , with l. rhamnosus strains previously shown to have an effect outside of the gut in mice . similarly , administration of a probiotics mixture was found to exert effects on regulatory dcs and tregs in the respiratory tract and protect against asthma . interestingly , although intragastric administration of lactobacillus paracasei reduced symptoms of ova - induced aad in mice , it was significantly more effective when introduced intranasally ( direct to the lungs ) . this finding indicates that different routes of entry for probiotics can elicit different extent of responses . however , it is noteworthy that with current technology , it is implausible to perform routine intranasal administrations on human patients . in addition , a randomised , double - blinded and placebo - controlled trial concluded that lactobacillus gg is protective of upper respiratory tract infections in children , with infections lasting a significantly shorter amount of time . these studies showed that orally taken probiotics have the capacity to induce both local and systemic effects on regulatory cells and cytokines , and consequently modulate respiratory tract conditions . the modulation of microbiota also has the capacity to affect diseases such as diabetes that involve tissues other than the mucosa . the effects of prebiotics , probiotics , symbiotics ( the combination of pre- and probiotics ) , antibiotics and fmt on obesity and t2d have been comprehensively reviewed by kootte and vrieze . this group also showed the effectiveness of transferring lean donor microbiota to obese subjects with metabolic syndrome in a double - blinded randomised controlled study . it is important to note that in research on obesity , diabetes and other extra - gastrointestinal diseases , there are currently limited human studies , and trials have been small - scale . recent research has shown that places previously thought to be sterile , such as the urinary tract and the placental environment , are in fact colonised by microbiota but not necessarily infectious . in addition , it is intriguing to examine whether or not the placenta microbiota may mediate inheritance ' of the maternal gut microbiota and risks of diseases , or impact on the microflora of other sites , such as the offspring 's skin and in the mouth , ultimately influencing their immune responses . this may then be able to explain the benefits of closer parent - offspring or sibling interactions . although current research are lacking in this area , recent evidence suggests an epigenetic effects of the maternal gut microbiota in regulating the development of asthma in the offspring . further research in this area will provide significant insight on the important role of the gut microbiota in the regulation of immune responses and the development of inflammatory diseases in not only the host , but perhaps also their offspring . there is a growing body of research on the use of probiotics for the treatment of respiratory diseases , including asthma and other airway hypersensitivity conditions . a randomised , double - blinded and placebo - controlled trial of oral lactobacillus gasseri capsule in asthmatic children found the treatment group had lower bronchial hyper - reactivity , better pulmonary function , and greater improvements in day time asthmatic symptoms . this treatment also reduced in vitro production of tnf , il-12 , il-13 and ifn- in peripheral blood mononuclear cells . similar results were observed with oral inoculation of lactobacillus rhamnosus in mice being protective of the ova model of aad . the group of mice treated with probiotics had decreased clinical score , airway hyperresponsiveness and ova - specific t cells in the spleen , and increased proportions of tregs in the spleen . this could be in part mediated through the modulation of macrophages , with l. rhamnosus strains previously shown to have an effect outside of the gut in mice . similarly , administration of a probiotics mixture was found to exert effects on regulatory dcs and tregs in the respiratory tract and protect against asthma . interestingly , although intragastric administration of lactobacillus paracasei reduced symptoms of ova - induced aad in mice , it was significantly more effective when introduced intranasally ( direct to the lungs ) . this finding indicates that different routes of entry for probiotics can elicit different extent of responses . however , it is noteworthy that with current technology , it is implausible to perform routine intranasal administrations on human patients . in addition , a randomised , double - blinded and placebo - controlled trial concluded that lactobacillus gg is protective of upper respiratory tract infections in children , with infections lasting a significantly shorter amount of time . these studies showed that orally taken probiotics have the capacity to induce both local and systemic effects on regulatory cells and cytokines , and consequently modulate respiratory tract conditions . the modulation of microbiota also has the capacity to affect diseases such as diabetes that involve tissues other than the mucosa . the effects of prebiotics , probiotics , symbiotics ( the combination of pre- and probiotics ) , antibiotics and fmt on obesity and t2d have been comprehensively reviewed by kootte and vrieze . this group also showed the effectiveness of transferring lean donor microbiota to obese subjects with metabolic syndrome in a double - blinded randomised controlled study . it is important to note that in research on obesity , diabetes and other extra - gastrointestinal diseases , there are currently limited human studies , and trials have been small - scale . recent research has shown that places previously thought to be sterile , such as the urinary tract and the placental environment , are in fact colonised by microbiota but not necessarily infectious . in addition , it is intriguing to examine whether or not the placenta microbiota may mediate inheritance ' of the maternal gut microbiota and risks of diseases , or impact on the microflora of other sites , such as the offspring 's skin and in the mouth , ultimately influencing their immune responses . this may then be able to explain the benefits of closer parent - offspring or sibling interactions . although current research are lacking in this area , recent evidence suggests an epigenetic effects of the maternal gut microbiota in regulating the development of asthma in the offspring . further research in this area will provide significant insight on the important role of the gut microbiota in the regulation of immune responses and the development of inflammatory diseases in not only the host , but perhaps also their offspring . proposals of how early childhood hygiene , widespread antibiotic use and the increase in processed food and lack of fibre consumption culminates in what was an under - appreciated part of us : our microbiota . extensive studies in gf mice have elucidated important interactions between bacteria and immune cells that enables proper development and function of our immune system . this has profound impact as the relative abundance of bacteroidetes and firmicutes , and the proportions of bifidobacteria and lactobacilli are all important determinants in gut homeostasis and whole - body health . a summary figure of the complex interplay of how therapeutics affect the gut microbiota , immune response and inflammatory conditions is shown in figure 3 . although we still do not know the exact cause of a number of inflammatory diseases such as ibd , and whether or not the gut microbiota changes or dysbiosis are the cause or effect , we are starting to understand the protective and pathological effects of some of these changes . furthermore , by modulating the total population of the gut microbiota using antibiotics or fmt , or by specifically targeting one or more bacterial species using prebiotics and/or probiotics , we are gaining significant insights into the effects of specific bacteria on disease pathology . the combined use of antibiotics and fmt , of prebiotics and probiotics , or even all four of these therapies may 1 day provide effective treatment for many inflammatory diseases . there is emerging data to suggest that the gut microbiota affects not only the inflammatory state of mucosal surfaces , but also metabolic disorders such as diabetes . therefore , harnessing and manipulating the gut microbiota will provide widespread therapeutic opportunities not restricted to simply a single - organ system .
the advent of vaccination and improved hygiene have eliminated many of the deadly infectious pathogens in developed nations . however , the incidences of inflammatory diseases , such as inflammatory bowel disease , asthma , obesity and diabetes are increasing dramatically . research in the recent decades revealed that it is indeed the lack of early childhood microbial exposure , increase use of antibiotics , as well as increase consumption of processed foods high in carbohydrates and fats , and lacking fibre , which wreak havoc on the proper development of immunity and predispose the host to elevated inflammatory conditions . although largely unexplored and under - appreciated until recent years , these factors impact significantly on the composition of the gut microbiota ( a collection of microorganisms that live within the host mucosal tissue ) and inadvertently play intricate and pivotal roles in modulating an appropriate host immune response . the suggestion that shifts in the composition of host microbiota is a risk factor for inflammatory disease raises an exciting opportunity whereby the microbiota may also present as a potential modifiable component or therapeutic target for inflammatory diseases . this review provides insights into the interactions between the microbiota and the immune system , how these affect disease phenotypes , and explore current and emerging therapies that target the gut microbiota as potential treatment for inflammatory diseases .
adenomatoidodontogenic tumor ( aot ) is a slow growing lesion , constituting only 2.2% to 7.1% of all odontogenic tumors and 0.1% of jaw tumors , with a predilection for the anterior maxilla of young females in the second decade of life [ 14 ] . patients are usually referred to dentists with complaints of impacted teeth within the lesion , usually a canine . the lesion may be associated with the coronal portion of the tooth or extend to the root [ 14 ] . aot is composed of odontogenic epithelium in a variety of histoarchitectural patterns , embedded in a mature connective tissue stroma and characterized by slow but progressive growth . some authors describe it as a true benign , non - aggressive , non - invasive neoplasm , while others conceptualize it as a developmental hamartomatous odontogenic growth [ 16 ] . however , large tumors that involve serious loss of bone and thin the bone dangerously are often treated by insertion of a drain or by marsupialization . marsupialization decreases intracystic pressure and promotes shrinkage of the cyst as well as bone fill [ 79 ] . the author report a case using surgical and orthodontic approaches to preserve the impacted canine due to extensive aot . an 11-year - old boy presented with a swelling of the right side of his face for one month . physical examination showed a painless and circumscribed swelling of the right maxillary , but skin color was normal . panoramic radiograph demonstrated a well - defined unilocular radiolucent lesion at the apices of the roots of the right maxillary from the lateral incisor to the first molar . due to the expansive growth there was deviation of the roots of right maxillary lateralis , first and second premolar ( fig . 1a ) , and of the roots of right mandibular canine and first premolar ( fig therefore , we planned marsupialization of the lesion through the extracted socket of deciduous canine to create a window allowing continuous drainage of the tumor content . we treated the patient by marsupialization under local anesthesia , extracting the deciduous canine affected by the tumor . finally , we inserted a vaseline gauze into the cyst cavity to keep it open and to achieve hemostasis . panoramic radiographs were taken at three month intervals until the tumor - associated teeth erupted . after six months , there was further occlusal movement of the developing tooth with reduced radiolucency . the root formation of maxillary canine had continued , and bone formation was evident in the tumor ( fig . 2 ) . follow - up examination revealed occlusal movement of the developing tooth bud , but no apparent reduction in the radiolucency . so we performed enucleation and curettage , exempting the impacted canine , 12 months after marsupialization and decompression ( fig . six months after marsupialization , a multibracket appliance was placed in the maxillary arches , and to reinforce anchorage , a nance appliance was placed . a small orthodontic button , threaded with soft twisted ligature wire of 0.012-inch gauge , was bonded during the partial enucleation and curettage . after 20 months of traction , the canine erupted and orthodontic treatment was finished after 37 months . although we did orthodontic treatment only at the maxillary arch , class i occlusion was achieved with an acceptable interincisal relationship . we continued to observe the patient , and the tumor did not recur as of one year postoperatively ( fig . microscopic examination revealed an extremely vascular encapsulated lesion showing multivariate patterns of cellular arrangements ranging from sheets of polygonal cells arranged in ductal patterns , rosettes to solid sheets of cells . in the center of these ducts , the solid lobular masses showed numerous spindle to columnar hyperchromatic cells with interspersed deposits of eosinophilic hyaline - like material . , the most striking pattern is that of various sizes of solid nodules of columnar or cuboidal epithelial cells forming nests or rosette - like structures with minimal stromal connective tissue ( fig . we took a preventive approach to preserve the developing canine . therefore , we planned marsupialization of the lesion through the extracted socket of deciduous canine to create a window allowing continuous drainage of the tumor content . we treated the patient by marsupialization under local anesthesia , extracting the deciduous canine affected by the tumor . finally , we inserted a vaseline gauze into the cyst cavity to keep it open and to achieve hemostasis . panoramic radiographs were taken at three month intervals until the tumor - associated teeth erupted . after six months , there was further occlusal movement of the developing tooth with reduced radiolucency . the root formation of maxillary canine had continued , and bone formation was evident in the tumor ( fig . 2 ) . follow - up examination revealed occlusal movement of the developing tooth bud , but no apparent reduction in the radiolucency . so we performed enucleation and curettage , exempting the impacted canine , 12 months after marsupialization and decompression ( fig . six months after marsupialization , a multibracket appliance was placed in the maxillary arches , and to reinforce anchorage , a nance appliance was placed . a small orthodontic button , threaded with soft twisted ligature wire of 0.012-inch gauge , was bonded during the partial enucleation and curettage . after 20 months of traction , the canine erupted and orthodontic treatment was finished after 37 months . although we did orthodontic treatment only at the maxillary arch , class i occlusion was achieved with an acceptable interincisal relationship . 4 ) . we continued to observe the patient , and the tumor did not recur as of one year postoperatively ( fig . microscopic examination revealed an extremely vascular encapsulated lesion showing multivariate patterns of cellular arrangements ranging from sheets of polygonal cells arranged in ductal patterns , rosettes to solid sheets of cells . in the center of these ducts , the solid lobular masses showed numerous spindle to columnar hyperchromatic cells with interspersed deposits of eosinophilic hyaline - like material . , the most striking pattern is that of various sizes of solid nodules of columnar or cuboidal epithelial cells forming nests or rosette - like structures with minimal stromal connective tissue ( fig . current convention classifies aots into three main types : follicular ( or pericoronal ) , extrafollicular ( or extracoronal ) , and peripheral ( or extraosseous / gingival ) . in a recent retrospective study , radiographically , this lesion usually surrounds an unerupted tooth and is seen as a corticate radio - lucency with small radiopacities , but there are cases where the lesion has no radiopaque component , as in our case , and in such a case , a dentigerous cyst is the preferred differential diagnosis . however , an aot often appears to envelop the crown as well as the root as shown in the picture of this case [ 16 ] . when deciding treatment methods , the age of patient , anatomical structures , the region of lesion and the size of cyst should be considered . surgical enucleation or curettage is the usual treatment modality for aot associated with impacted teeth and/or complete removal of the tooth buds . marsupialization , decompression , and the partsch operation is a treatment in which a pouch - like surgical window on the wall of the cyst is incised , the contents of the cyst evacuated , and the continuity between the cyst and oral cavity , maxillary sinus , or nasal cavity is maintained . after marsupialization , the reduction of tumor size should be carefully monitored , and if needed , immediate surgical removal should be performed [ 711 ] . usually , the tumors do not exceed 1 to 3 cm in greatest diameter , and while usually asymptomatic , may be associated with cortical expansion as in the present case . to the best of our knowledge , this case of large aot with the sequential surgical approaches and the preservation of impacted tooth is rare in the published literature [ 112 ] . we performed the orthodontic treatment to bring the involved tooth into the arch for eruption . traction on an impacted tooth with an immature root often causes root resorption , root deformation , and pulpitis . in the present case , the root length of the impacted canine was less than three - fifth that of a normal root , and the root apex was open . observation of the impacted tooth is necessary after creating a space for tooth spontaneous eruption . we applied the orthodontic button bonding and orthodontic traction after tooth did not erupt further . therefore , careful observation and orthodontic treatment during the optimal period is necessary in a growing patient with an impacted tooth and tumor . it should be emphasized that careful diagnostic procedures and adequate interpretation of clinical and radiographic findings will lead to a correct diagnosis . to preserve the involved tooth , the tumor size and the position of tooth further validation of recurrence of aot and prognosis of saved tooth needs large clinical studies .
the present report describe the surgical therapy , clinical course , orthodontic treatment and morphological characteristics of an adenomatoid odontogenic tumor in the maxilla of an 11-year - old patient . the cystic tumor filled the maxillary sinus and involved a tooth . marsupialization was accompanied by partial enucleation and applied traction to the affected tooth by a fixed orthodontic appliance . healing was uneventful and no local recurrence was observed during a 1-year period of follow - up control .
a total of 23 neuropathic diabetic foot patients participated ( 17 men , 6 women ) . mean age was 59.1 ( sd 12.6 ) years , and mean bmi was 33.0 ( 8.7 ) kg / m . mean duration of diabetes was 13.8 ( 10.1 ) years , and mean hba1c level was 7.3 ( 1.1 ) percent . a total of 18 patients had a history of plantar foot ulceration , which included nontraumatic neuropathic foot ulcers located at the hallux ( n = 3 ) , toes ( n = 1 ) , metatarsal heads ( n = 11 ) , or midfoot ( n = 3 ) . all patients had at least one foot deformity ( claw / hammer toes , hallux valgus , midfoot charcot deformity , limited joint mobility , pes planus , or pes cavus ) . peripheral neuropathy was confirmed by the inability to feel the pressure of a 10-g semmes - weinstein monofilament at one or more of six plantar foot sites . two clinics provided four participating patients , one clinic six patients , and one clinic nine patients . all participants were consecutive referrals for footwear evaluation because of previous ulcer healing , the presence of severe deformity , or presigns of ulceration and a measured in - shoe plantar pressure > 200 kpa . for this reason , the local ethics committee waived the requirement for ethical approval of the study . the prescribed therapeutic footwear consisted of fully customized footwear ( n = 22 ) or custom molded insoles in an extra - depth shoe ( n = 1 ) . the footwear was generally manufactured on a last that was created from a negative or positive cast or foam impression of the patient s foot . blueprints and/or glass - plate images of the feet were used to identify foot shape and specific at - risk locations to target footwear design and manufacturing . shoes were mostly ankle high and made from leather with a stiffened rubber outsole and roller configuration . custom molded insoles were made from multidensity - layered materials , with a moldable base and an open or closed - cell material top cover . the footwear in each clinic was prescribed and manufactured by a rehabilitation specialist and an orthopedic shoe technician ( qualification similar to a certified pedorthist ) who had a minimum of 4 years experience with treating the diabetic foot . in - shoe plantar pressures were measured using the pedar - x system ( novel , munich , germany ) . this system comprises 2-mm - thick flexible pressure - sensing insoles including 99 sensors each measuring the vertical ( normal ) pressure at the shoe - sock interface at a sample frequency of 50 hz . pedar - wide insoles were available in five different length sizes to accommodate different foot sizes . before the pressure measurements , each of the 99 individual sensors per insole was calibrated according to the manufacturer s guidelines . patients repeatedly walked at a self - selected speed along a 12-m walkway while in - shoe plantar pressures were measured . with each pressure measurement , a minimum of 15 midgait steps walking speed was measured between two fixed points using a stopwatch and kept constant between trials ( maximum 5% deviation ) . shoe plantar pressures were first measured in the nonmodified footwear ( baseline assessment ) . from the peak pressure distribution diagrams shown on - screen in the novel step analysis program , these rois corresponded with locations of previous ulceration , severe foot deformity ( charcot osteoarthropathy ) , or preulcerative signs , all in which the measured peak pressure was > 200 kpa . the shoe technician modified the footwear with the goal to reduce peak pressure at the roi . the choice of modification was made by the shoe technician and/or physician and consisted of the local removal or softening of material in the insole ; replacement of the insole top cover ; the addition of a metatarsal pad , hallux pad , or metatarsal bar in the insole ; or the adjustment of the rocker or roller in the shoe outsole or insole ( i.e. , earlier or more significant ) . modifications that would require significant extra time or special machinery such as the application of a new rocker outsole or the replacement of midsole materials were not applied . walking speed was kept consistent with the speed measured during baseline assessment ( maximum 5% deviation ) . change in peak pressure at the roi compared with baseline was calculated from the on - screen display of the peak pressure diagrams . the footwear was classified as successfully optimized when , compared with the baseline assessment , a minimum 25% reduction in mean peak pressure at the roi was achieved ( criterion a ) or mean peak pressure was reduced below an absolute level of 200 kpa ( criterion b ) . both criteria were chosen to represent a significant , probably clinically relevant , reduction in plantar pressure . criterion b was based on previous results showing an average in - shoe peak pressure of 200 kpa using similar equipment in patients who had remained healed in their prescribed footwear after an episode of ulceration ( 15 ) . if the optimization criteria were not met after the first round of one or more modifications , additional in - shoe pressure evaluations and modifications were allowed , up to a maximum of three rounds . this number of modification rounds was maximized for feasibility reasons considering the ( potential ) use of this approach in clinical practice . if the optimization criteria were not met within three rounds , optimization was considered a failure . the time required to complete the session , including all pressure measurements and footwear modifications , was recorded . using novel multimask software , masks were drawn for each roi and , in the same foot , for each of 10 anatomical foot regions : medial and lateral heel , medial and lateral midfoot , metatarsal 1 , metatarsals 2/3 , metatarsals 4/5 , hallux , toes 2/3 , and toes 4/5 . for each mask , mean peak pressure and pressure - time integral over all collected steps per foot were calculated . specific analyses were performed for each roi , for each major foot location where the roi were present ( hallux , metatarsals , and midfoot ) , for each shoe technician , for new and already worn footwear , and for each type of modification applied . when more than one modification was made in the same round of footwear modifications , the effect of these modifications on peak pressure peak pressure effects in neighboring ( anatomical ) regions of each roi after modifying the footwear were calculated and considered excessive if increased > 25 kpa and > 25% compared with baseline . where data were compared statistically , paired a total of 23 neuropathic diabetic foot patients participated ( 17 men , 6 women ) . mean age was 59.1 ( sd 12.6 ) years , and mean bmi was 33.0 ( 8.7 ) kg / m . mean duration of diabetes was 13.8 ( 10.1 ) years , and mean hba1c level was 7.3 ( 1.1 ) percent . a total of 18 patients had a history of plantar foot ulceration , which included nontraumatic neuropathic foot ulcers located at the hallux ( n = 3 ) , toes ( n = 1 ) , metatarsal heads ( n = 11 ) , or midfoot ( n = 3 ) . all patients had at least one foot deformity ( claw / hammer toes , hallux valgus , midfoot charcot deformity , limited joint mobility , pes planus , or pes cavus ) . peripheral neuropathy was confirmed by the inability to feel the pressure of a 10-g semmes - weinstein monofilament at one or more of six plantar foot sites . two clinics provided four participating patients , one clinic six patients , and one clinic nine patients . all participants were consecutive referrals for footwear evaluation because of previous ulcer healing , the presence of severe deformity , or presigns of ulceration and a measured in - shoe plantar pressure > 200 kpa . for this reason , the local ethics committee waived the requirement for ethical approval of the study . the prescribed therapeutic footwear consisted of fully customized footwear ( n = 22 ) or custom molded insoles in an extra - depth shoe ( n = 1 ) . the footwear was generally manufactured on a last that was created from a negative or positive cast or foam impression of the patient s foot . blueprints and/or glass - plate images of the feet were used to identify foot shape and specific at - risk locations to target footwear design and manufacturing . shoes were mostly ankle high and made from leather with a stiffened rubber outsole and roller configuration . custom molded insoles were made from multidensity - layered materials , with a moldable base and an open or closed - cell material top cover . the footwear in each clinic was prescribed and manufactured by a rehabilitation specialist and an orthopedic shoe technician ( qualification similar to a certified pedorthist ) who had a minimum of 4 years experience with treating the diabetic foot . in - shoe plantar pressures were measured using the pedar - x system ( novel , munich , germany ) . this system comprises 2-mm - thick flexible pressure - sensing insoles including 99 sensors each measuring the vertical ( normal ) pressure at the shoe - sock interface at a sample frequency of 50 hz . pedar - wide insoles were available in five different length sizes to accommodate different foot sizes . before the pressure measurements , each of the 99 individual sensors per insole was calibrated according to the manufacturer s guidelines . patients repeatedly walked at a self - selected speed along a 12-m walkway while in - shoe plantar pressures were measured . with each pressure measurement , a minimum of 15 midgait steps walking speed was measured between two fixed points using a stopwatch and kept constant between trials ( maximum 5% deviation ) . the footwear optimization algorithm is shown in fig . shoe plantar pressures were first measured in the nonmodified footwear ( baseline assessment ) . from the peak pressure distribution diagrams shown on - screen in the novel step analysis program , these rois corresponded with locations of previous ulceration , severe foot deformity ( charcot osteoarthropathy ) , or preulcerative signs , all in which the measured peak pressure was > 200 kpa . the shoe technician modified the footwear with the goal to reduce peak pressure at the roi . the choice of modification was made by the shoe technician and/or physician and consisted of the local removal or softening of material in the insole ; replacement of the insole top cover ; the addition of a metatarsal pad , hallux pad , or metatarsal bar in the insole ; or the adjustment of the rocker or roller in the shoe outsole or insole ( i.e. , earlier or more significant ) . modifications that would require significant extra time or special machinery such as the application of a new rocker outsole or the replacement of midsole materials were not applied . walking speed was kept consistent with the speed measured during baseline assessment ( maximum 5% deviation ) . change in peak pressure at the roi compared with baseline was calculated from the on - screen display of the peak pressure diagrams . the footwear was classified as successfully optimized when , compared with the baseline assessment , a minimum 25% reduction in mean peak pressure at the roi was achieved ( criterion a ) or mean peak pressure was reduced below an absolute level of 200 kpa ( criterion b ) . both criteria were chosen to represent a significant , probably clinically relevant , reduction in plantar pressure . criterion b was based on previous results showing an average in - shoe peak pressure of 200 kpa using similar equipment in patients who had remained healed in their prescribed footwear after an episode of ulceration ( 15 ) . if the optimization criteria were not met after the first round of one or more modifications , additional in - shoe pressure evaluations and modifications were allowed , up to a maximum of three rounds . this number of modification rounds was maximized for feasibility reasons considering the ( potential ) use of this approach in clinical practice . if the optimization criteria were not met within three rounds , optimization was considered a failure . the time required to complete the session , including all pressure measurements and footwear modifications , was recorded . using novel multimask software , masks were drawn for each roi and , in the same foot , for each of 10 anatomical foot regions : medial and lateral heel , medial and lateral midfoot , metatarsal 1 , metatarsals 2/3 , metatarsals 4/5 , hallux , toes 2/3 , and toes 4/5 . for each mask , mean peak pressure and pressure - time integral over all collected steps per foot were calculated . specific analyses were performed for each roi , for each major foot location where the roi were present ( hallux , metatarsals , and midfoot ) , for each shoe technician , for new and already worn footwear , and for each type of modification applied . when more than one modification was made in the same round of footwear modifications , the effect of these modifications on peak pressure peak pressure effects in neighboring ( anatomical ) regions of each roi after modifying the footwear were calculated and considered excessive if increased > 25 kpa and > 25% compared with baseline . where data were compared statistically , paired a total of 17 were located at the metatarsal heads ( first , n = 6 ; second or third , n = 9 ; fifth , n = 2 ) , 13 at the hallux , and 5 at the midfoot . in 9 of the 18 patients who had a previous foot ulcer , the roi corresponded with the previous ulcer location . all 35 rois could be optimized according to the defined criteria : 16 on the basis of a minimum 25% peak pressure relief compared with baseline , 7 on the basis of a peak pressure reduction below a level of 200 kpa , and 12 on the basis of both criteria . the mean peak pressure measured at baseline in all rois was 303 ( sd 77 ) kpa . peak pressure significantly reduced with 95 kpa ( 30.2% , p < 0.001 ) to a mean 208 ( sd 46 ) kpa after all necessary rounds of footwear modification . mean relief in pressure - time integral across all rois after modifying the footwear was 24.3% ( p < 0.001 ) . the mean time required to complete the testing session was 53 min ( sd 13 , range 3478 ) . an average 1.6 rounds of footwear modifications were needed to satisfy the optimization criteria . in the 21 rois requiring one round , mean peak pressure relief compared with baseline was 30.3% . in the seven rois requiring two rounds , mean peak pressure relief was 9.2% after the first round and 23.0% after the second round . in the seven rois requiring three rounds , mean peak pressure relief was 10.6% after the first , 1.7% after the second , and 18.5% after the third round . figure 2 shows the peak pressure changes per follow - up in - shoe pressure measurement together with the applied modifications in each round of footwear modification for all 35 individual rois . peak pressure diagrams for a patient who had his footwear successfully optimized are also shown in fig . c : line graphs showing , for each roi per foot location , the change in peak pressure from baseline to follow - up in - shoe pressure measurement as a result of each round of footwear modification . also shown for each roi , as cross outs of the line graphs , are the modifications applied , where 1 ) denotes the local removal of material in the insole , 2 ) the local softening of material in the insole , 3 ) the replacement of the top cover of the insole , 4 ) the addition of a metatarsal or hallux pad or bar in the insole , and 5 ) an earlier or more significant rocker or roller in the shoe outsole or the insole . d : peak pressure isobar diagrams showing the mean peak pressure measured over multiple steps in the right foot in a tested patient at baseline ( 1 ) and after three rounds of footwear modifications ( 24 ) . this patient had limited mobility at the first metatarsal phalangeal joint and a history of ulceration at the plantar hallux . footwear modifications used ( and their effect on mean peak pressure in kpa ) were as follows : round 1 : addition of a hallux bar just distal to the first metatarsal head in the insole ( 50 kpa ) ; round 2 : application of an earlier roller in the shoe outsole ( 28 kpa ) ; and round 3 : replacement of the top layer of the insole with 3-mm - thick 2 silicone foam ( 70 kpa ) . the diagrams show a typical pattern for the study finding that footwear modification did not lead to excessive buildup of peak pressure in neighboring regions , but rather to a peak pressure decrease across foot regions . there were no significant differences in mean peak pressure relief achieved between the roi optimized by the four shoe technicians ( range 26.732.8% , p = 0.37 ) . there were also no significant differences in mean peak pressure relief achieved between the roi located at different major foot locations : 33.4% ( range 17.651.8 ) for the hallux ( n = 13 roi ) , 27.9% ( 17.238.2 ) for the metatarsal regions ( n = 17 ) , and 29.7% ( 17.140.0 ) for the midfoot ( n = 5 ) ( p = 0.23 ) . analysis of the 10 anatomical foot locations showed significant mean peak pressure reductions after modifying the footwear in all but three locations ( lateral midfoot , toes 2/3 , and toes 2/5 ) ( p < 0.05 ) . excessive buildup of pressure in a neighboring region was present with three of the 35 rois . differences in effects between the types of modification were small and nonsignificant ( p = 0.64 ) . additionally , there was no clear difference in the type of modifications used and the optimization success between newly delivered and already worn shoes ( mean peak pressure relief 28.5 and 31.3% , respectively ) . type and number of footwear modifications and their mean effect on in - shoe peak pressure for all rois and for the rois per foot location data are n or mean effect ( range ) , with the effect on peak pressure expressed as percentage reduction compared with the previous in - shoe pressure measurement in the session ( negative values denote an increase in peak pressure ) . the results of this study showed a substantial relief in peak pressure of 30% at selected high - pressure rois after modifying the custom - made footwear of neuropathic diabetic foot patients using in - shoe plantar pressure analysis as a guidance tool to the modifications made . all selected rois were optimized according to the defined optimization criteria , within an average of 53 min . this result demonstrates in our view the success and feasibility of the approach . because an increase in plantar foot pressure increases the risk for diabetic foot ulceration , such optimization results should reduce the risk of foot ulceration the study results substantiate earlier case reports showing that significant pressure relief is achievable when using in - shoe pressure analysis as a guidance tool for footwear modification ( 14 ) . furthermore , the results support earlier suggestions that in - shoe plantar pressure analysis should be an integral part of footwear evaluation in high - risk neuropathic diabetic patients ( 6,10,11,13,16 ) . the approach offers an individual - based solution to instantly achieve more optimal footwear on the assumption that different footwear design principles or modifications may work for different patients . this result is supported by the finding that not all rois were optimized within one round or with one type of footwear modification , but required subsequent rounds and/or different modifications to achieve the desired outcome ( fig . this provides the clinical team with a valuable approach to achieve better quality footwear for the individual patient . at baseline , the patients footwear was not yet optimal in relieving pressure , although half of the previous ulcer locations were not selected as an roi , apparently showing already good pressure relief at these locations . the suboptimal footwear is probably due to the lack of available ( evidence - based ) guidelines for footwear prescription and lack of predictable effects of footwear design principles . this scenario currently makes the provision and evaluation of footwear largely a trial - and - error process , where the skills and experience of the clinical team determine the outcome . however , the lack of differences found in outcome between the four teams of physicians / shoe technicians suggest that positive results can be achieved by any experienced team . only recently , quantitative approaches such as the use of dynamic barefoot pressure recordings and three - dimensional foot shape measurements have been introduced in the provision of footwear for diabetic patients . the application of such methods can result in footwear providing also an 30% pressure relief compared with footwear made using conventional methods ( 17 ) . combining these methods with the current optimization approach may potentially further optimize the pressure - relieving capacity of prescribed therapeutic footwear . the effect of these modifications on peak pressure was quite variable from roi to roi ( table 1 , fig . this result supports the use of the optimization approach , in particular , because of its flexibility to allow multiple ( rounds of ) modifications to increase the chance for a significant positive result . average effects at the roi were quite similar between different types of modification ( 1015% pressure relief ) , showing that all had relevance in optimizing the footwear . in the feet of only 3 of the 35 rois optimized , a neighboring region showed excessive pressure buildup . additionally , in 7 of 10 anatomical locations of the foot , peak pressure was significantly reduced after modifying the footwear . these results suggest that footwear modification did not put neighboring regions at risk and generally resulted in a more optimal solution for the whole foot . the use of in - shoe plantar pressure analysis for evaluation and optimization of diabetic footwear requires ( extra ) investments in machinery , measurement equipment , personnel , and training . these investments may not be possible at every treatment location , but specialized centers should consider adopting such an approach . in germany , requirements for demonstrated efficacy of footwear prescriptions in reducing plantar pressures have recently been introduced , although it is unclear which guidelines or evidence supports these requirements . a proven cost - effective prevention of foot ulceration and other complications , using this approach will stimulate its implementation in clinical practice and help establish evidence - based guidelines . nonetheless , the approach should be considered relative to other foot ulcer prevention strategies ( e.g. , diabetes control , podiatry , vascular control , early recognition of preulcerative signs ) . also , other factors may be important in determining clinical outcome such as shear , duration of pressure , and treatment adherence , although their role has not been studied to date . we are currently investigating the ( cost ) effectiveness of the current optimization approach and several of these additional factors in preventing secondary ulceration in a multicenter randomized controlled trial . first , the outcomes reflect to a certain extent the skills and experiences of the physicians and shoe technicians in modifying the footwear , which may affect the reproducibility of the results . modifications were not determined objectively and systematically on the basis of a certain pressure distribution profile because guidelines on how to reduce these pressures do not exist . we followed the dominant current practice in footwear evaluation in which a trial - and - error approach is used . nevertheless , logical choices were made in modifying the footwear using a limited set of generally effective modifications , which resulted , after one or more rounds , in optimized footwear . they were based on what we considered a clinically relevant pressure reduction , partly on the basis of previous recommendations ( 15 ) , which could be achieved in a reasonable time . nevertheless , future research will have to show whether these chosen criteria are clinically meaningful . third , the number of tested patients could be considered quite small given the variability in pressure distribution profiles and footwear modifications applied . however , all 35 selected roi were optimized , and percentage peak pressure reductions in the rois were significantly skewed toward the positive side ( 1752% ) . on the basis of these consistent results , we believe that relevant conclusions can be drawn from this small study sample . finally , the majority of footwear tested ( 14 of 23 ) was previously worn for some period . this concerned mostly footwear in which patients had developed an ulcer and which was modified after the healing of the ulcer in another device . wear and tear of this footwear may have increased the chance for successful optimization , although the results show no clear differences in types of modifications used and pressure relief achieved between the new and already - worn footwear . the results show that evaluation and optimization is worthwhile in footwear of any age , but the most appropriate moment is probably close to delivery . future studies will have to demonstrate the optimization success in a larger sample of newly prescribed footwear and the optimal frequency for in - shoe pressure evaluation . in conclusion , the results of this study show that custom - made therapeutic footwear of at - risk neuropathic diabetic foot patients can be effectively and efficiently optimized for its pressure - relieving capacity when using in - shoe plantar pressure analysis as a tool to guide modifications to the footwear . this provides the clinical team with a valuable , objective , and efficient method to assess and improve therapeutic footwear quality for individual patients . such optimization should reduce the risk of plantar foot ulceration in this patient group , although this result will have to be confirmed in future prospective clinical trials .
objectivetherapeutic footwear for diabetic foot patients aims to reduce the risk of ulceration by relieving mechanical pressure on the foot . however , footwear efficacy is generally not assessed in clinical practice . the purpose of this study was to assess the value of in - shoe plantar pressure analysis to evaluate and optimize the pressure - reducing effects of diabetic therapeutic footwear.research design and methodsdynamic in - shoe plantar pressure distribution was measured in 23 neuropathic diabetic foot patients wearing fully customized footwear . regions of interest ( with peak pressure > 200 kpa ) were selected and targeted for pressure optimization by modifying the shoe or insole . after each of a maximum of three rounds of modifications , the effect on in - shoe plantar pressure was measured . successful optimization was achieved with a peak pressure reduction of > 25% ( criterion a ) or below an absolute level of 200 kpa ( criterion b).resultsin 35 defined regions , mean peak pressure was significantly reduced from 303 ( sd 77 ) to 208 ( 46 ) kpa after an average 1.6 rounds of footwear modifications ( p < 0.001 ) . this result constitutes a 30.2% pressure relief ( range 1850% across regions ) . all regions were successfully optimized : 16 according to criterion a , 7 to criterion b , and 12 to criterion a and b. footwear optimization lasted on average 53 min.conclusionsthese findings suggest that in - shoe plantar pressure analysis is an effective and efficient tool to evaluate and guide footwear modifications that significantly reduce pressure in the neuropathic diabetic foot . this result provides an objective approach to instantly improve footwear quality , which should reduce the risk for pressure - related plantar foot ulcers .
mycoplasma hominis usually colonizes the lower urogenital tract and can cause pyelonephritis , pelvic inflammatory disease , chorioamnionitis , rupture of fetal membranes , preterm labor , postpartum fever , postabortal fever , and neonatal infection.19 this organism is a marker for sexual activity , as demonstrated by its higher prevalence in cervicovaginal cultures of sexually active women than in those before sexual debut . m. hominis , m. genitalis , ureaplasma urealyticum , and u. parvum may invade and infect placental and fetal tissues , leading to adverse pregnancy outcomes.1 in particular , m. hominis and u. urealyticum have been documented to cause genital tract infectious diseases for several decades . m. hominis occasionally causes nongenitourinary infection of the blood , wounds , central nervous system , joints , or respiratory tract.10,11 to our knowledge , there are four published articles regarding the isolation of this pathogen from postcesarean incisional infections.5,1214 we present a case of m. hominis infection after cesarean section . this case report and the literature provide the features of postoperative infection with this organism , of which physicians should remain mindful . a 27-year - old woman , para 0 , underwent emergency cesarean section because of labor arrest and cephalopelvic disproportion at 39 weeks of gestation . a transverse skin incision was made at the lower abdomen , and the patient was delivered of an infant with meconium - stained amniotic fluid . the first dose was infused at the start of the operation , followed by the other doses 12 , 24 , and 36 hours later . on postoperative day 5 , the patient developed a fever of 39.0c and erythema with swelling and tenderness around the abdominal wound . blood examination revealed a white blood cell count of 18,400/mm and a c - reactive protein ( crp ) level of 15.4 mg / dl ( figure 1 ) . a lower abdominal computed tomography ( ct ) scan revealed subcutaneous hematoma and rectus abdominis muscle abscess ( figure 2 ) . these findings prompted us to open the central portion of her abdominal wound ( approximately 2 cm width ) under local anesthesia , for the purpose of drainage . a bloody purulent exudate was obtained from the incision , which was subjected to bacteriological culture . the gram stain indicated numerous altered polymorphonuclear leukocytes without any pathogens ( figure 3 ) . we irrigated the incision with 100 ml of saline daily and intravenously administered 1 g flomoxef sodium twice daily . on day 8 , an abdominal ct scan suggested that the subcutaneous hematoma and rectus abdominis muscle abscess had subsided ( figure 2 ) , indicating that our drainage was effective . nevertheless , her fever persisted , and the white blood cell count and crp level remained high . on day 7 , we began an intravenous infusion of imipenemcilastatin sodium ( 1:1 ; 500 mg ) twice daily , instead of flomoxef sodium . on day 10 , the abdominal incisional exudative fluid specimen obtained on day 5 revealed the growth of tiny colonies on a sheep blood agar culture plate under anaerobic conditions . the colonies were pinpoint sized , translucent , measuring 50300 m in diameter , and grew on blood agar in an anaerobic or 5% carbon dioxide atmosphere in 23 days but showed no growth in an aerobic environment in subculture . on gram stain of the colonies , the cells were so small that their cellular morphology was invisible under a routine light microscope ( figure 4 ) . the isolate was identified as m. hominis based on morphology of colonies , size of cells , and culture condition , being compatible with unsuccessful chemotherapy using a -lactam agent . therapy with a quinolone , ciprofloxacin ( 300 mg twice daily ) , was started intravenously , and imipenemcilastatin sodium therapy was discontinued . this antibacterial treatment , during which breastfeeding was avoided , was continued until day 14 when her fever was resolved . the white blood cell count and crp level diminished to their normal ranges , and the patient was discharged home 21 days after the cesarean section they appear as an amorphous mass on gram staining and are therefore unidentifiable by this method.9,13 in addition , m. hominis is a slow - growing bacterium , and its identification and antimicrobial sensitivity testing with routine culture methods are difficult . therefore , incubation in an anaerobic environment may enhance the growth of this pathogen,9 although 4896 hours are usually required for its growth on nonselective routine bacteriological media . furthermore , this organism is cultured most successfully on designed media , such as shepard s 10b urea broth and a8 solid medium , after 2448 hours of incubation.15 media designed for detection of mycoplasma are commercially available ( remel inc . , lenexa , ks , usa ) . m. hominis colonies are pinpoint sized , flat , measuring 20300 m in diameter , and have a characteristic fried - egg appearance when observed under 10 magnification . mycoplasma species do not have a cell wall , which is the target of -lactam antimicrobials that are commonly used as prophylactic agents for postsurgical infections . erythromycins are also less effective against m. hominis,10,13 whereas m. pneumoniae is susceptible to these drugs . tetracycline has historically been considered the antibiotic of choice for treating m. hominis infections,9,16 and clindamycin and lincomycin chloride are often used to treat infection with tetracycline - resistant strains.9,10,17 quinolones , including ciprofloxacin , ofloxacin , temafloxacin , sparfloxacin , trovafloxacin , gemifloxacin , gatifloxacin , moxifloxacin , and garenoxacin , are equally active against tetracycline - susceptible as well as tetracycline - resistant strains of m. hominis.1824 because m. hominis is typically resistant to macrolides , -lactams , aminoglycosides , vancomycin , trimethoprim , and sulfonamides,9,10,13,17,23,25 administration of effective antimicrobial agents is often initiated late . due to the aforementioned reasons , high fever and inflammation persist for a long time in many cases of m. hominis infection . polymerase chain reaction ( pcr ) is a simpler , more rapid , and more sensitive method than culturing for the identification of this organism ; therefore , a pcr assay should be performed if m. hominis infection is suspected.26 in our patient , abdominal wound hematoma and abscess due to m. hominis were formed following cesarean section , and drainage and the administration of a quinolone , ciprofloxacin , improved the infection . to our knowledge , there are four published articles on the isolation of this organism from postcesarean incisions in which the patients developed hematomas.5,1214 in one patient with m. hominis wound infection after cesarean section and in three patients with m. hominis and u. urealyticum infection , aspiration of the incision yielded a cloudy serosanguinous fluid.12,13 the serosanguinous exudates suggest the presence of abdominal incisional purulent hematoma . in a case of hematoma and abscess formation due to m. hominis infection at the site of a uterine incision after cesarean section , drainage and administration of a quinolone , pazufloxacin mesilate , promptly resolved the patient s fever.14 a perihepatic hematoma with m. hominis was observed after a liver transplant,27 and a perinephric hematoma was infected with this pathogen after a renal transplant.28 moreover , hematoma infection with this bacterium developed following transplant nephrectomy.29 these indicate that m. hominis infections after surgery may cause hematoma formation in immunosuppressed patients . when a hematoma with bacterial infection or an abscess presents , drainage , aspiration , and debridement are promising treatments . physicians may need to subject the specimens to bacteriological culture in an anaerobic environment , on designed media , or with pcr assay , to initiate appropriate antibacterial therapy as soon as possible if the causative organism is mycoplasma . one possible speculation is that the pathogen invaded and infected fetal membranes and amniotic fluid from the vagina or uterine cervix during pregnancy , resulting in postcesarean infection . we present a case of abdominal wound infection by m. hominis following cesarean section . based on our observation , this pathogen may cause hematoma formation with or without abscess after cesarean section or in immunosuppressed postoperative patients . in such cases , physicians may need to suspect mycoplasma infection and start effective antimicrobial treatment as soon as possible in order to avoid persistent fever .
mycoplasma species can not be identified by routine bacteriological culture methods and are resistant to common antimicrobial agents . mycoplasma hominis usually colonizes the lower urogenital tract and causes pyelonephritis , pelvic inflammatory disease , chorioamnionitis , rupture of fetal membranes , preterm labor , postpartum fever , postabortal fever , and neonatal infection . this organism is highly prevalent in cervicovaginal cultures of sexually active women . m. hominis , m. genitalis , ureaplasma urealyticum , and u. parvum may invade and infect placental and fetal tissues , leading to adverse pregnancy outcomes . m. hominis occasionally causes nongenitourinary infection of the blood , wounds , central nervous system , joints , or respiratory tract . we present a case of a 27-year - old woman who developed abdominal wound hematoma and abscess after cesarean section . the wound was drained , but her high fever persisted , in spite of antibiotic treatment using flomoxef sodium and imipenemcilastatin sodium . because the exudate exhibited m. hominis growth in an anaerobic environment , we administered the quinolone ciprofloxacin . this therapy resolved her fever , and her white blood cell count and c - reactive protein level diminished to the normal ranges . to our knowledge , there are four published articles regarding the isolation of m. hominis from postcesarean incisions . based on the current study and the literature , infection by this pathogen may cause hematoma formation with or without abscess after cesarean section or in immunosuppressed postoperative patients . in such cases , physicians may need to suspect mycoplasma infection and initiate appropriate antibacterial treatment as soon as possible in order to avoid persistent fever .
the traditional approach to disorders consequent to brain injury centers on the description of concrete symptoms that be shown to correlate significantly with injuries to particular brain regions . this approach began with the pioneering works of broca and wernicke , and has continued in much contemporary work in neuropsychology [ 35 ] . luria tried to go beyond merely listing the particular symptoms observed , introducing the idea of the basic defect , i.e. a single underlying disorder that is presumably causing the manifold observable difficulties the patient manifests in performing the tasks involved in a neuropsychological examination . thus a basic defect in phonemic hearing would affect performance in all tasks involved with that function , such as verbal memory , word repetition , reading , writing , etc . , while performance should be unimpaired in tasks that do not require phonemic hearing . only in this way would it be possible , in luria s view , to describe a syndrome characterized by a particular set of disorders following a specific brain lesion . luria s approach was certainly a step forward , both in the better understanding of the nature of the symptoms observed in a particular patient and in conducting more effective therapy . yet luria s approach was only able to explain some of the symptom changes observed in a patient during the process of recovery . it does not provide an explanation for the appearance of clinically distinct syndromes over the course of progressive deterioration , as observed in many post - tbi patients . one such patient will be described in the present report , with particular emphasis on some unusual disorders of personal identity in a former physician who sustained a serious brain injury due to a car accident in 1998 . the injury resulted in focal injuries in the frontal and right temporal areas and coma lasting 63 days . the real purpose of this paper , however , is to explore the mind of a patient whose identity has been disrupted , and who has experienced the loss of his self image and relations with his immediate surroundings . this case study follows patient pa from the age of 43 at the time of injury until his current age of 54 years . the patient is a board - certified gynecologist and obstetrician . prior to the accident , he was the head of the ob - gyn department in a provincial hospital in southern poland . he was married with three children , currently ranging in age from 13 to 26 years . the oldest daughter finished the academy of fine arts in 2009 and is making a career as a painter . there were some problems with the marriage after his wife discovered that he had had a lover , who , as reported by his family and the lover herself , he had claimed to regard as the love of his life . in november 1998 , the car pa was driving struck a tree when he swerved to avoid a head - on collision . he remained conscious for a short period of time immediately after the accident , however , and his memory concerning the event itself seems to be intact as of this writing . an intracranial hematoma developed immediately after admission to hospital , and the patient lost consciousness . his glasgow coma scale score 24 hours after the accident was 3 , the lowest possible . he remained in a coma for 63 days , but was not operated ; his post - injury amnesia lasted 98 days . neuroimaging ( figure 1 ) shows damage mainly in the right hemisphere , most significantly affecting : the frontal lobe , especially the precentral orbital gyrus ; the lower frontal gyrus ; the lower , central and upper temporal gyrus . when first examined by the authors in january 1999 , the patient was found to be suffering from : sleeping problems , including narcolepsy , occasional parasomnia and nightmares ; mild post - traumatic aphasia , with naming problems ; executive dysfunction ; inability to perform activities of daily living ( adl ) ; bouts of aggressiveness ; visuospatial disorientation ; identity disturbance ( does not recognize himself , does not remember his name ) ; autobiographical memory disturbance ; prosopagnosia ( confuses close relatives , does not recognize his children or extended family members ) . these included : inaccurate spatial orientation with confabulation , e.g. the clinic was identified as a garage and he was a mechanic ; loss of the feeling of personal identity ( the patient complained that he did not know who he was , despite the absence of objective symptoms of global amnesia ) ; abrupt changes in personal habits and routines ( including smoking and drinking ) ; loss of personal history , social roles , and lifestyle . at that time he was able to recognize ( i.e. name ) some personal items ( e.g. keys , comb , toothbrush ) , but denied that they belonged to him . later in his recovery , he was able to name objects relevant to his past , e.g. cigarettes , a bottle of cognac , but did not recognize these items as being connected with his previous experience . we learned from an interview with his wife that on the day of the accident a major marital crisis had occurred , resulting from the patient s infidelity . his wife had discovered that pa intended to go to a party with his lover . after a fierce quarrel he eventually backed down , and went with his wife instead ; however , during the trip there was a sudden change in the situation on the road , and pa drove into a tree while passing a delivery truck . his wife did not suffer any serious injuries , because pa at the very last moment before the collision steered the car in such a way so as to take on himself the full force of the impact . the patient s mother is of the opinion , and has often repeated it , that the cause of the accident was the hysterical behavior of her daughter - in - law . the truth is that her son had always driven much too fast and recklessly ; pa has loved sports cars since childhood , and dreamed of taking part in car rallies . very significant changes in his habits and behavior were noted in the 6 months following his arousal from coma . prior to his accident he had been a vegetarian , a smoker , a moderate drinker , a known wit , who enjoyed social intercourse and parties . following the injury , he had no recall of this lifestyle and personal history . at the same time pa exhibited symptoms of mirror sign , and a few months later of capgras syndrome , which included suspicion and confabulations regarding his wife and children ( whom he called imposters ) , denial that he even knew his erstwhile lover , and even denial of his dog ( who seemed not to recognize him when he returned home , and barked at him ) . however , facial recognition of public figures was preserved . below are some examples of the patient s problems : a physiotherapist named jacek was helping pa stand in front of a full - length mirror : therapist ( th ) : who is that , peter ? pa : i do nt know , but maybe jacek , i think you said so , is nt that right ? although he was not able to recognize himself in the mirror , he recognized and gave the name of the therapist . ten minutes after this incident , however , he did not remember that he had been standing before a mirror or what the therapist s name was . here is an extract from an interview with the patient in the presence of his parents , his wife and his oldest daughter , who was 19 at the time : th : you are pleased that you ve been visited by your family , are nt you ? they are body doubles doubles of my entire family or i do nt know [ shouting ] ! this seems a very clear case of capgras syndrome . neuropsychologists and psychiatrists have known for nearly 100 years that a small number of psychiatric patients become profoundly suspicious of their closest relationships , often cutting themselves off from those who love them and care for them . they may insist that their spouse is an impostor , that their grown children are body doubles ; that a caregiver , a close friend , even the entire family is fake , a duplicate version . another symptom we observed during this period was denial of the extra - marital relationship ( supposedly the love of his life ) . upon being visited by his former girlfriend in the hospital , he displayed complete non - recognition . [ attempts to kiss him ] pa : do nt kiss me [ shouting]!. i do nt know you ! after one hour the therapist asked him about the visit ( which had been arranged by pa s mother ) . th : she s a beautiful woman , is nt she ? pa : perhaps i could consider that woman beautiful , yes i would regard her as beautiful , she is about 40 , is nt she ? although pa did not recognize his lover , a few minutes later in conversation he suddenly stated that it was not permissible for a physician to enter into such a close relationship with a patient even though no one had yet said to him that the woman who was claiming to be his lover had previously been his patient , and in fact the subject of conversation had already changed . this might suggest that he recognized her as a former patient ( which in point of fact is true ) , but not as his lover . on the other hand , his wife is also a doctor , so his pangs of conscience might be related to his marriage , though that seems rather far - fetched . it is nearly impossible to establish , in his cognitive state , to what extent his failure to acknowledge his lover is repressed guilt , and to what extent it should be called amnesia , or confusion . about half an hour after his lover had left the room , the patient asked the therapist , are nt you hmm my fiance or something she must be somewhere , but i do nt know where she is and nobody can find her . it is possible that he was remembering the unpleasant conversation with his fiance and was somehow looking for her to make things right . some traces may have been maintained in his memory , then , of his feelings for this woman , and these memories were activated , with a marked delay , by the visit of his girlfriend . in his state of cognitive confusion he misidentified his therapist as his lover , but the emotional memory indicating that the lover had been lost was essentially correct . one of the most interesting aspects of pa s problems with autobiographical memory is his complete denial of having ever had a dog , when before the accident he and the dog had been extremely close . [ in the presence of his pet , a dachshund , who is barking at him . apparently , the dog does not exhibit positive feelings towards the patient here and now ] . pa was able to recognize public figures , but during this period he was watching an excessive amount of television , and had become interested in politics only after the accident . it is quite possible , however , that these faces of public figures constitute islands of episodic or autobiographical memory , which excludes any assumption that his disturbances might be linked to difficulties in facial recognition per se . after being shown pictures of two important polish politicians he stated : here is the president and the prime minister it s them who changed the calendar and everyone thinks that i m 40 when i m really 20 . this last utterance showed another important characteristic of pa s mental state , namely , the problems with identity . not only was he unable to state his age , but he reacted with anger to an attempt by the therapist to specify his true identity , which is illustrated by the following conversation : pa : who am i ? it was eventually established that he possessed some murky recollections of childhood up to the age of eight . at that time he had dreamed of becoming a car mechanic , and now he sometimes claimed to be one . he also vaguely remembered his first year at school , but from the age of eight . this can be noted in his commentary accompanying his drawing of a ladybug ( figure 2 ) : my inner self reminds me of a ladybug . it s obviously looking for something because she feels foggy and empty like me everything has to be searched for . the loss of identity was accompanied by delusions , which is illustrated by the following utterance : the government has not only changed the money and i ca nt recognize it , but also the calendar to avoid paying the life annuity they added 30 years to the established calendar and as a result i am supposed to be 45 years old , but really , i m 25 . he would often change his stated age depending on the person with whom he found himself in contact . over time his lack of a personal sense of identity made him borrow the identity of others . below are presented examples of some of the more interesting identities assumed by pa : when he was on the ward with a patient named andrzej , who had global amnesia and maintained that he was a six- year - old clone , pa began shouting that the doctors had cloned him , too , and that now he was a six - year - old monster . when he was on the ward with a 19-year - old patient named jurek , who had had a knee operation , he shouted that he could nt walk because he had had a knee operation and would have to use a wheelchair ; he also maintained that his name was jurek . when pa met zbyszek , a 29-year - old art therapist , he took the brushes from him and refused to give them back . he shouted that he had to paint a picture in the open because he had to earn a living . when a 20-year - old hairdresser was cutting his hair , he took her scissors from her and refused to give them back . when the young chaplain of the physiotherapy department , whom the patient had taken a liking to , was distributing communion on the ward , pa took his bible , which had been left for a moment on the table , and refused to give it back . he shouted that they wanted to steal the bible from him and that he would have nothing to pray from . all these temporary acquired identities were based on situational stimuli : the identities borrowed by this patient are content - specific . it is also important to state that these identities have a temporal frame : for acquired identities , approximately 12 hours , which seems to be a factor of the maximum duration of his episodic memory . he would momentarily associate himself with an object or person which in some way attracted his attention , though what motivation there was for this particular object or person remains unknown , when other opportunities were ignored . the individuals selected were never older than their late 20s , and not infrequently they were children . of importance is the fact that after an hour ( or sometimes two ) pa would forget about his newly adopted identity , and again did not really know who he was . however , in general he would protest , and present himself as a car mechanic . he continues to ascribe to himself the identity of those with whom he comes into contact . he believes that his family all died in an accident , but does not show any emotional reaction to this . he is totally alone , but he has no clear recognition of his situation . after reading about cotard s delusion , a rare psychiatric syndrome in which people consider themselves to be dead , he consequently claimed that he was just such a case and was in fact dead , or perhaps reincarnated . it came as a surprise , however , to discover , 3 years after the accident , that his medical knowledge was very well preserved . after meeting a tbi patient who had been pregnant and had lost her child , he advised her in a very professional way , and told her what drugs she could take for the depression that had developed following the loss of the child . in a thematic picture completed half an hour later concerning his most important memories from childhood , he drew four pregnant women ( figure 3 ) and entitled the picture maternity ; he later stated : when i think about it i see a black hole , such a void . he was also able to recognize and describe the ultra sonogram of a baby shown to him by his daughter , commenting : . it s a baby in ultrasound 3d it could be in the 29 or 30 week of pregnancy . yet he protested with anger when his daughter said that this was his grandson , crying : moreover , he was able to give details of gynecological operations , but was extremely surprised to find that he could do so . he did not remember studying medicine , but was able to recognize the university building . this reflects a discrepancy between well - preserved medical knowledge and the lack of autobiographical memory . he had no recollection of having obtained a medical diploma even when it was shown to him , claiming that what he was seeing must have been counterfeit . at the same time he proved to have preserved semantic memory , while autobiographical memory appeared to be lost . thus he stated that people had children : to develop a so - called procreative family , to maintain the human species , to pass on their genes . yet he denied having children of his own , even when he was presented with their pictures : pa has been under neuropsychiatric and neuropsychological observation for 10 years , from january 1999 to june 2009 . we found the following symptoms : traces of aphasia with minor naming difficulties ; minor problems with the production of syntactically correct sentences ; working memory problems and severe learning problems ( pa does not remember anything longer than a few minutes at the most ) , especially with delayed memory tasks ; severe problems with autobiographical memory ( the patient remembers very little about his life before the accident ) ; persistent disturbances of actuators , e.g. the patient soaps himself in the shower and then leaves the bathroom , entering the living room naked in the presence of his children ; features of frontal lobe syndrome ; persistent identity impairment ( pa does not recognize himself in the mirror or in photographs , though he knows his name ) . a steady decline in his iq , as measured by the polish version of the wechsler adult intelligence scale revised ; features of temporal syndrome ( altered consciousness ) ; a high level of anxiety ; inability to perform activities of daily living ; bizarre behavior , with an apparent inability to conform to social norms ( especially laughing or shouting at inappropriate moments , e.g. during church services ) . in this context it is perhaps significant that the metabolic changes in pa s brain , measured by hmrs , are at present close to the spectrum seen in fronto - temporal dementia ( ftd ) . figure 4 shows a statistically significant drop in naa concentration , and also in the relative naa / cr concentration . at the same time there is a statistically significant growth in the concentration of mi , as well as the relative mi / cr concentration . another important indicator is the relative relation of the naa / mi concentrations ; this value shows a statistically significant drop when compared to age- and gender - matched norms . it should be added here that the localization of pathological changes in the case of the spectrum obtained from patient pa is similar to that of patients with ftd . in pa s case , however , these changes are localized chiefly in the right frontal lobe , and not bilaterally , as in the typical ftd patient . prior to the accident , pa s family had relatively normal family ties , though the bond between the patient and his wife was strained by the fact that he had a lover . now the patient does not remember that he has loved anyone , and his family feels baffled by his strange behavior . his wife , his children , and his parents say he is quite a different man than he used to be . they say it is difficult to have warm feelings towards a man who is so quarrelsome , rude , and irresponsible . moreover , the bonds that united and bound the remaining members of the family to each other have also collapsed , or have been seriously shaken . it is also plausible that the dissociation of pa s identity may be caused , at least to some extent , by his premorbid personality traits . interviews with his family have revealed that his mother was a dominant person who used to made all her sons to act in accordance with her will despite their own wishes . we learn that pa dreamed of being a car mechanic but he became a doctor as his mother had wished . it is of interest to note that being a car mechanic is one of his adopted personalities now . it was also noted that the patient s attitude towards his mother underwent considerable changes . he is disobedient and shouts at her , though she shows no emotional reaction to this kind of behavior . it may be concluded , then , that she was always a self - disciplined cold mother , and this as we know may lead to a number of emotional disorders in the child . in fact , childhood trauma is believed to be one of the causes of dissociative identity disorder . first of all he had a number of love - affairs , which meant he had to make various stories to hide this from his wife and family . moreover , his wife reports that he tended to tell small lies to his friends just to make life more interesting , to use his own words . naturally , this does not explain the nature of pa s disorders , but they can not be explained solely by memory disturbances as well , though memory , especially autobiographical memory , certainly plays an important role in integrating one s concept of self . at the same time , both linguistic functions and acquired knowledge ( including medical skills ) have remained intact to a considerable degree . it is worth noting here that these are functions that do not concern pa personally . in other words , he has lost mainly the emotionally loaded information , which may explain at least to some extent his emotional reactions to suggestions concerning his true personal relations . pa s memory disorders include not only autobiographical memory , but also short - term memory . some deficits were apparent on standardized memory tests , based on recall after 2030 minutes of filled delay , but we observed clinically that he seemed unable to recall anything at all 2 hours after the event occurred . in order to measure this , we designed a simple experiment , which consisted in choosing a particular event that occurred during the ordinary hospital day ( e.g. a visitor , a meal , a physiotherapy session or the like ) , and then asking pa what he remembered immediately after the event , and then again at four time points : 30 minutes , 60 minutes , 90 minutes , and 120 minutes . this experiment was repeated 6 times during pa s hospitalization at the cracow rehabilitation centre in summer of 2003 , and again in the summer of 2004 . the amount of information recalled immediately after the event was treated as 100% for baseline , and the amount of recall at subsequent time points was calculated in terms of information units . as shown in figure 5 , the intensity of the effect achieved when pa records a given event in memory diminishes rapidly over time , in comparison to the effect that accompanied the event itself . the magnitude of the negative effect exceeds the dimensions of the positive effect . considering the automatic scaling on the graph , the differences at a time of storage of 1.5 hours appear to be slight , but these differences like the others are statistically significant . on one occasion , according to hospital schedule , pa was sent to kinesitherapy for 2 hours . when he returned to the ward , we asked pa what had happened , and he gave a reasonably full account of the exercises he had been through , which coincided in all essentials with the physiotherapist s report . when asked for the same information 30 minutes later , some details were missing , but the essentials were in place . at one hour , however , he remember only the last half - hour of exercises , and insisted that he had been there only half an hour . his account at 90 minutes was extremely sketchy , and there were some confabulations . at two hours he did remember that he had already been asked several times for that information , but became agitated that we were pestering him about something that never happened . he began to express indignation that no one had remembered to take him to kinesitherapy , and all attempts to convince him that he had actually been there met with an increasingly aggressive reaction . on another occasion , nearly a year later , he was visited one day by his wife , who spent an hour with him on a day when she usually was unable to come see him . immediately after she left , he gave a reasonably full account of the event , which his wife later verified as substantially accurate . within half an hour , he remembered only that his wife had probably been there , though he expressed uncertainty as to whether this had not happened the day before . at 90 minutes he remembered that someone had been there , but not who . at two hours thus memory traces of emotionally laden material , both positive and negative , tend to diminish and disappear completely after a period of two hours . this would not be especially surprising , if the material forgotten consisted of a list of random numbers or words , or even a story read aloud by an examiner , as in most standard memory tests . in fact , however , pa forgets everything that happens to him , no matter how much it matters to him . moreover , he does not remember that he has forgotten something , a state which occurs only in medium - to - late stages of dementia . this means that both long - term and short - term memory are severely disturbed . a physiotherapist named jacek was helping pa stand in front of a full - length mirror : therapist ( th ) : who is that , peter ? pa : i do nt know , but maybe jacek , i think you said so , is nt that right ? although he was not able to recognize himself in the mirror , he recognized and gave the name of the therapist . ten minutes after this incident , however , he did not remember that he had been standing before a mirror or what the therapist s name was . another feature of the disorder was denial of the family . here is an extract from an interview with the patient in the presence of his parents , his wife and his oldest daughter , who was 19 at the time : th : you are pleased that you ve been visited by your family , are nt you ? they are body doubles doubles of my entire family or i do nt know [ shouting ] ! this seems a very clear case of capgras syndrome . neuropsychologists and psychiatrists have known for nearly 100 years that a small number of psychiatric patients become profoundly suspicious of their closest relationships , often cutting themselves off from those who love them and care for them . they may insist that their spouse is an impostor , that their grown children are body doubles ; that a caregiver , a close friend , even the entire family is fake , a duplicate version . another symptom we observed during this period was denial of the extra - marital relationship ( supposedly the love of his life ) . upon being visited by his former girlfriend in the hospital l : how are you feeling , darling ? [ attempts to kiss him ] pa : do nt kiss me [ shouting]!. i do nt know you ! after one hour the therapist asked him about the visit ( which had been arranged by pa s mother ) . i would regard her as beautiful , she is about 40 , is nt she ? although pa did not recognize his lover , a few minutes later in conversation he suddenly stated that it was not permissible for a physician to enter into such a close relationship with a patient even though no one had yet said to him that the woman who was claiming to be his lover had previously been his patient , and in fact the subject of conversation had already changed . this might suggest that he recognized her as a former patient ( which in point of fact is true ) , but not as his lover . on the other hand , his wife is also a doctor , so his pangs of conscience might be related to his marriage , though that seems rather far - fetched . it is nearly impossible to establish , in his cognitive state , to what extent his failure to acknowledge his lover is repressed guilt , and to what extent it should be called amnesia , or confusion . about half an hour after his lover had left the room , the patient asked the therapist , are nt you hmm my fiance or something she must be somewhere , but i do nt know where she is and nobody can find her . it is possible that he was remembering the unpleasant conversation with his fiance and was somehow looking for her to make things right . some traces may have been maintained in his memory , then , of his feelings for this woman , and these memories were activated , with a marked delay , by the visit of his girlfriend . in his state of cognitive confusion he misidentified his therapist as his lover , but the emotional memory indicating that the lover had been lost was essentially correct . one of the most interesting aspects of pa s problems with autobiographical memory is his complete denial of having ever had a dog , when before the accident he and the dog had been extremely close . t : is this your dog ? [ in the presence of his pet , a dachshund , who is barking at him . apparently , the dog does not exhibit positive feelings towards the patient here and now ] . pa was able to recognize public figures , but during this period he was watching an excessive amount of television , and had become interested in politics only after the accident . it is quite possible , however , that these faces of public figures constitute islands of episodic or autobiographical memory , which excludes any assumption that his disturbances might be linked to difficulties in facial recognition per se . after being shown pictures of two important polish politicians he stated : here is the president and the prime minister it s them who changed the calendar and everyone thinks that i m 40 when i m really 20 . this last utterance showed another important characteristic of pa s mental state , namely , the problems with identity . not only was he unable to state his age , but he reacted with anger to an attempt by the therapist to specify his true identity , which is illustrated by the following conversation : pa : who am i ? it was eventually established that he possessed some murky recollections of childhood up to the age of eight . at that time he had dreamed of becoming a car mechanic , and now he sometimes claimed to be one . he also vaguely remembered his first year at school , but from the age of eight . this can be noted in his commentary accompanying his drawing of a ladybug ( figure 2 ) : my inner self reminds me of a ladybug . it s obviously looking for something because she feels foggy and empty like me everything has to be searched for . the loss of identity was accompanied by delusions , which is illustrated by the following utterance : the government has not only changed the money and i ca nt recognize it , but also the calendar to avoid paying the life annuity they added 30 years to the established calendar and as a result i am supposed to be 45 years old , but really , i m 25 . . he would often change his stated age depending on the person with whom he found himself in contact . over time his lack of a personal sense of identity made him borrow the identity of others . below are presented examples of some of the more interesting identities assumed by pa : when he was on the ward with a patient named andrzej , who had global amnesia and maintained that he was a six- year - old clone , pa began shouting that the doctors had cloned him , too , and that now he was a six - year - old monster . when he was on the ward with a 19-year - old patient named jurek , who had had a knee operation , he shouted that he could nt walk because he had had a knee operation and would have to use a wheelchair ; he also maintained that his name was jurek . when pa met zbyszek , a 29-year - old art therapist , he took the brushes from him and refused to give them back . he shouted that he had to paint a picture in the open because he had to earn a living . when a 20-year - old hairdresser was cutting his hair , he took her scissors from her and refused to give them back . when the young chaplain of the physiotherapy department , whom the patient had taken a liking to , was distributing communion on the ward , pa took his bible , which had been left for a moment on the table , and refused to give it back . he shouted that they wanted to steal the bible from him and that he would have nothing to pray from . all these temporary acquired identities were based on situational stimuli : the identities borrowed by this patient are content - specific . it is also important to state that these identities have a temporal frame : for acquired identities , approximately 12 hours , which seems to be a factor of the maximum duration of his episodic memory . he would momentarily associate himself with an object or person which in some way attracted his attention , though what motivation there was for this particular object or person remains unknown , when other opportunities were ignored . the individuals selected were never older than their late 20s , and not infrequently they were children . of importance is the fact that after an hour ( or sometimes two ) pa would forget about his newly adopted identity , and again did not really know who he was . however , in general he would protest , and present himself as a car mechanic . he continues to ascribe to himself the identity of those with whom he comes into contact . he believes that his family all died in an accident , but does not show any emotional reaction to this . he is totally alone , but he has no clear recognition of his situation . after reading about cotard s delusion , a rare psychiatric syndrome in which people consider themselves to be dead , he consequently claimed that he was just such a case and was in fact dead , or perhaps reincarnated . it came as a surprise , however , to discover , 3 years after the accident , that his medical knowledge was very well preserved . after meeting a tbi patient who had been pregnant and had lost her child , he advised her in a very professional way , and told her what drugs she could take for the depression that had developed following the loss of the child . in a thematic picture completed half an hour later concerning his most important memories from childhood , he drew four pregnant women ( figure 3 ) and entitled the picture maternity ; he later stated : they could have been my patients . when i think about it i see a black hole , such a void . he was also able to recognize and describe the ultra sonogram of a baby shown to him by his daughter , commenting : . it s a baby in ultrasound 3d it could be in the 29 or 30 week of pregnancy . yet he protested with anger when his daughter said that this was his grandson , crying : moreover , he was able to give details of gynecological operations , but was extremely surprised to find that he could do so . he did not remember studying medicine , but was able to recognize the university building . this reflects a discrepancy between well - preserved medical knowledge and the lack of autobiographical memory . he had no recollection of having obtained a medical diploma even when it was shown to him , claiming that what he was seeing must have been counterfeit . at the same time he proved to have preserved semantic memory , while autobiographical memory appeared to be lost . thus he stated that people had children : to develop a so - called procreative family , to maintain the human species , to pass on their genes . yet he denied having children of his own , even when he was presented with their pictures : these are children , but not mine . pa has been under neuropsychiatric and neuropsychological observation for 10 years , from january 1999 to june 2009 . we found the following symptoms : traces of aphasia with minor naming difficulties ; minor problems with the production of syntactically correct sentences ; working memory problems and severe learning problems ( pa does not remember anything longer than a few minutes at the most ) , especially with delayed memory tasks ; severe problems with autobiographical memory ( the patient remembers very little about his life before the accident ) ; persistent disturbances of actuators , e.g. the patient soaps himself in the shower and then leaves the bathroom , entering the living room naked in the presence of his children ; features of frontal lobe syndrome ; persistent identity impairment ( pa does not recognize himself in the mirror or in photographs , though he knows his name ) . a steady decline in his iq , as measured by the polish version of the wechsler adult intelligence scale revised ; features of temporal syndrome ( altered consciousness ) ; a high level of anxiety ; inability to perform activities of daily living ; bizarre behavior , with an apparent inability to conform to social norms ( especially laughing or shouting at inappropriate moments , e.g. during church services ) . in this context it is perhaps significant that the metabolic changes in pa s brain , measured by hmrs , are at present close to the spectrum seen in fronto - temporal dementia ( ftd ) . figure 4 shows a statistically significant drop in naa concentration , and also in the relative naa / cr concentration . at the same time there is a statistically significant growth in the concentration of mi , as well as the relative mi / cr concentration . another important indicator is the relative relation of the naa / mi concentrations ; this value shows a statistically significant drop when compared to age- and gender - matched norms . it should be added here that the localization of pathological changes in the case of the spectrum obtained from patient pa is similar to that of patients with ftd . in pa s case , however , these changes are localized chiefly in the right frontal lobe , and not bilaterally , as in the typical ftd patient . prior to the accident , pa s family had relatively normal family ties , though the bond between the patient and his wife was strained by the fact that he had a lover . now the patient does not remember that he has loved anyone , and his family feels baffled by his strange behavior . his wife , his children , and his parents say he is quite a different man than he used to be . they say it is difficult to have warm feelings towards a man who is so quarrelsome , rude , and irresponsible . moreover , the bonds that united and bound the remaining members of the family to each other have also collapsed , or have been seriously shaken . it is also plausible that the dissociation of pa s identity may be caused , at least to some extent , by his premorbid personality traits . interviews with his family have revealed that his mother was a dominant person who used to made all her sons to act in accordance with her will despite their own wishes . we learn that pa dreamed of being a car mechanic but he became a doctor as his mother had wished . it is of interest to note that being a car mechanic is one of his adopted personalities now . it was also noted that the patient s attitude towards his mother underwent considerable changes . he is disobedient and shouts at her , though she shows no emotional reaction to this kind of behavior . it may be concluded , then , that she was always a self - disciplined cold mother , and this as we know may lead to a number of emotional disorders in the child . in fact , childhood trauma is believed to be one of the causes of dissociative identity disorder . first of all he had a number of love - affairs , which meant he had to make various stories to hide this from his wife and family . moreover , his wife reports that he tended to tell small lies to his friends just to make life more interesting , to use his own words . naturally , this does not explain the nature of pa s disorders , but they can not be explained solely by memory disturbances as well , though memory , especially autobiographical memory , certainly plays an important role in integrating one s concept of self . at the same time , both linguistic functions and acquired knowledge ( including medical skills ) have remained intact to a considerable degree . it is worth noting here that these are functions that do not concern pa personally . in other words , he has lost mainly the emotionally loaded information , which may explain at least to some extent his emotional reactions to suggestions concerning his true personal relations . pa s memory disorders include not only autobiographical memory , but also short - term memory . some deficits were apparent on standardized memory tests , based on recall after 2030 minutes of filled delay , but we observed clinically that he seemed unable to recall anything at all 2 hours after the event occurred . in order to measure this , we designed a simple experiment , which consisted in choosing a particular event that occurred during the ordinary hospital day ( e.g. a visitor , a meal , a physiotherapy session or the like ) , and then asking pa what he remembered immediately after the event , and then again at four time points : 30 minutes , 60 minutes , 90 minutes , and 120 minutes . this experiment was repeated 6 times during pa s hospitalization at the cracow rehabilitation centre in summer of 2003 , and again in the summer of 2004 . the amount of information recalled immediately after the event was treated as 100% for baseline , and the amount of recall at subsequent time points was calculated in terms of information units . as shown in figure 5 , the intensity of the effect achieved when pa records a given event in memory diminishes rapidly over time , in comparison to the effect that accompanied the event itself . the magnitude of the negative effect exceeds the dimensions of the positive effect . considering the automatic scaling on the graph , the differences at a time of storage of 1.5 hours appear to be slight , but these differences like the others are statistically significant . on one occasion , according to hospital schedule , pa was sent to kinesitherapy for 2 hours . when he returned to the ward , we asked pa what had happened , and he gave a reasonably full account of the exercises he had been through , which coincided in all essentials with the physiotherapist s report . when asked for the same information 30 minutes later , some details were missing , but the essentials were in place . at one hour , however , he remember only the last half - hour of exercises , and insisted that he had been there only half an hour . his account at 90 minutes was extremely sketchy , and there were some confabulations . at two hours he did remember that he had already been asked several times for that information , but became agitated that we were pestering him about something that never happened . he began to express indignation that no one had remembered to take him to kinesitherapy , and all attempts to convince him that he had actually been there met with an increasingly aggressive reaction . on another occasion , nearly a year later , he was visited one day by his wife , who spent an hour with him on a day when she usually was unable to come see him . immediately after she left , he gave a reasonably full account of the event , which his wife later verified as substantially accurate . within half an hour , he remembered only that his wife had probably been there , though he expressed uncertainty as to whether this had not happened the day before . at 90 minutes he remembered that someone had been there , but not who . at two hours thus memory traces of emotionally laden material , both positive and negative , tend to diminish and disappear completely after a period of two hours . this would not be especially surprising , if the material forgotten consisted of a list of random numbers or words , or even a story read aloud by an examiner , as in most standard memory tests . in fact , however , pa forgets everything that happens to him , no matter how much it matters to him . moreover , he does not remember that he has forgotten something , a state which occurs only in medium - to - late stages of dementia . this means that both long - term and short - term memory are severely disturbed . what makes the case described above nearly unique is the progression of symptoms , which seem to cover an entire spectrum of memory disturbances . at any given moment , the mosaic of pa s memory deficits and retained capacities could be accounted for in the familiar terms of classical neuropsychology , as a set of disturbances resulting from damage to a particular module or memory system ( short - term , long - term , episodic , semantic , and so forth ) . if pa were to be included in a large group study of severe tbi patients , his scores at any given moment would enable him to be assigned to a sub - group without any particular difficulty . the problem is that if the same tests were administered only a few months ( or even weeks ) later , he would just as easily be assigned to another , quite different group , at a moment when he seems to have regained some aspects of memory , while losing his grip on something he had previously had under control . yet it does not suffice merely to superimpose a typical neurodegenerative process on a typical though it is not impossible that ftd is developing in pa s brain independently of the tbi , this would be a most remarkable coincidence , and in any event the course of both diseases would certainly be profoundly affected by the presence of the other . in order to understand pa s case properly , it is essential to look at what has happened to him , not as status post , i.e. a particular event ( cause , i.e. the accident ) with its various sequelae ( effect , i.e. the symptoms ) , and not even as a disease , where the onset of illness ( the cause ) is assumed to set in train a cascade of events ( the symptoms ) , but rather as a process ( the patient s life as a whole ) , whose course has been radically altered by an event . for the present purposes , let segment a - b represent the course of pa s life , where a represents the starting point and b the goal to which pa aspires . the appearance of a strong external force ( c , here representing the accident ) pushes the vector in a different direction , to his current status , represented as d. what is most important here is that the vector c - d is not simply the result of the direction and strength of c , but rather the effect of c on the original vector a - b . the syndrome described here results from the unfolding of the lower layers of the process of becoming , from core ( self ) to perception ( world ) , which frames the mind / brain state . consciousness is the relation of early to late or depth to surface in this process . visual and verbal imagery , including conceptual or intentional feeling , the arrow in figure 7 represents sensation acting on the phase of imagery to externalize and adapt the state to the physical world . the mind / brain state and immediate present develop in a fraction of a second , replaced by overlapping states . as mentioned in the introduction by brown and pachalska , a traditional approach to symptoms observed after brain lesions does not provide an explanation for the change observed in clinical syndromes in the course of recovery or deterioration . this case raises the question of the origin of : stability , whenever the world and mind are in constant change ; the nature of identity : is it continuous ? according to marcia there are four phases in the process of forming an identity : in diffuse identity the self is vaguely defined and ill - formed . the first person singular does not exist , either as a grammatical function or as a psychological category , only a kind of primordial chaos of undifferentiated being . in mirror recognition , the individual recognizes her / himself only in others , especially parents . there is no chance for making independent choices that would not be consistent with the choices made by the significant other , whose reflection is one s own self . in deferred identity , the maturing self becomes aware of its otherness , and at the same time of its incompleteness , which it strives to fill with selected contents . there is an attempt to distance oneself from the previous points of identification , replacing them with new ones , as teenagers rebel against their parents and begin to identify themselves with other kinds of groups . in mature identity there is a delicate balance maintained between a sense of belonging and a sense of one s own uniqueness , between continuity and change . these phases are typically presented as phases in human development over one s lifespan , but in the case of our patients it is possible to see each of them emerging after coma through all four phases . in akinetic mutism and the phases that follow , the patient shows no willful behavior in spite of possessing a working nervous system , central and peripheral , primarily because there is no consciousness that action as such exists or is possible . our case shows that a self is not a persistent object but a recurrent state . hume ( 1740/1967 : book i , part iv , section vi ) questioned the existence of identity , which he believed to be an illusion , and so he could not account for the sense of identity over time . james as well as whitehead were of the opinion that identity was due to an overlap of mental states . self has to be created in each moment , and this creative process leads to a more dynamic way of thinking about the mind and brain . microgenetic theory provides an account of the process of creating the self [ 2634 ] . it emphasizes the span of neural time ( in microseconds in the case of a healthy adult ) that on the one hand enables continuity of the self , and on the other buffers it from falling apart [ 3537 ] . there is a minimal self , the irreducible core , whose existence is necessary in order for the organism to be an organism , and not merely a collection or colony of cells . we feel this minimal self in our most fundamental biological / mental state , the awareness of being a longitudinal self arises when memory allows the discrete moments of minimal self time to be bundled in larger units , making it possible not only to feel one s existence in the present moment , but also to conceive of that existence in the past and imagine it continuing into the future . the case of pa demonstrates that the minimal self can persist , stranded in the moment , without the privilege of mental time travel that episodic memory affords . an integrated longitudinal self , however , requires alignment of one s current mental state and enduring semantic knowledge of personal traits , goals , beliefs , and values . it requires seamless access to the episodic memory of past and present selves that ground semantic self knowledge and infuse it with emotional meaning . in other words , a person whose identity is stable needs to be : aware of past , present , and future ; able to perceive her surroundings ; able to access her memories ; able to operate with reasons , i.e. conceive several options , select one of them as better than the others , and realize it ; capable of making decisions ; responsible for at least some of her own behavior . unfortunately , all those conditions are not present in the patient described here , which resulted in the gradual loss of the sense of personal identity . his case , however , allows one to draw a hypothesis on the way the self has to be buffered in order to protect it from disintegration . the process of insulating the self is secured due to the expansion from the core self into the subjective i , then the formation of an object world distinct from the i , which thus preserves its integrity and identity through time or at least for some segment of time . there is a paradox in all this , which is that the subjective self , having created an objective world and separated itself from it , at the same time becomes conscious of itself as an object . i can conceive of , evaluate , look at , analyze , interpret the me , the self seen by the subject as an object among other objects . i and the me makes possible not only introspection , but also social thinking , the ability to conceive of oneself as a human object among other human objects , without losing the i or at least without the necessity to lose it , though the risk is certainly there . i and me is more on the order of actual and potential than knower and known . i at the threshold of consciousness - knows that which develops out of it . the subliminal me that remains beneath as the potential for the i is implicit , unconscious and inaccessible . it represents , or is part of , the tacit knowledge of the individual , what the person knows or has the capacity ( competence ) to know , and it gives rise to the conscious self , to thought and action . the known self is not actually known , it is felt , intuited , sought after . the changes that have occurred in the clinical picture of pa s mental status are perplexing . he has passed through a mosaic of disturbances , which resulted in a continuous deterioration of his identity : misidentification ( person and place ) ; capgras syndrome for person(s ) ; capgras for environment ; capgras for the arm ( asomatognosia ) ; frgoli syndrome for person(s ) ; frgoli for environment ; delusional reduplication ( without misidentification ) of self or other persons ; loss of identity ( cotard s syndrome , the delusion of being dead ) . as illustrated in figure 9 , time has played an important role in the process of pa s continuous deterioration . in fact , he has completely lost orientation in his surroundings , and his attempts to discover his true identity have ceased . in a recent publication , the first author of the present study has described these changes in self - identity , which include many , if not most , of the syndromes of impaired recognition of self and others described in the literature . the problem of personality and the self - concept can be approached , from the standpoint of pathology , in terms of patterns of transition from one symptom - complex to another in the same individual , and not as isolated defects in particular individuals within a population . disorders of the self can not be localized to separate brain areas , but constitute a spectrum in the process through which personality is preserved and sustained . the case described here provides convincing evidence that the stability and identity of the self depends , not on the association of discrete components , but on a recurrent process that maintains the self - concept over time , in aging , through sleep , and in the course of changing life events . as noted elsewhere by the first author of the present study the basic components of identity , those that can be weakened or destroyed by brain damage , are the following : coherence , that is , the idea that being oneself makes some kind of sense , that the parts which make up the whole fit together , at least in a general way ; unity , that is , the requirement that fundamentally there is one self in one body , despite the complexity of its structure ; continuity , that is , the requirement that the coherence and unity of identity last as long as life itself lasts , from birth to death , despite the natural tendency to break life down into periods ( epochs , eras ) . it turns out that one of pa s problems is the loss of the feeling of time , due mainly to the disturbances of autobiographic memory . macqueen has suggested that when speaking of that type of memory we concentrate on auto- , and forget about the original meaning of biography . the ancient greek word bios meant life , and grapho meant to write . our autobiography is therefore essentially a story , composed of the events of our own life , and is therefore narrative in its very nature . it is not , however , an orderly and exhaustive story that includes literally all the events of our life , but rather a kind of sketch made up of only those events which are of importance to us . as a rule these are emotionally loaded events , as well as those which proved to be of vital consequence for our future . in this respect autobiographic memory is more like a play or a film , in which significant events ( episodes , scenes , moments ) are combined in a way to form a comprehensive and continuous story . the story gains its coherence due to the logical sequence of events , where the viewer is left to assume or infer a logical sequence from one event to the next . in the case of the autobiography ( understood here as a mental construct , not a literary genre ) even if the sequence of symptoms presented by pa seems unique , the complaint that one is a different person after the injury is not . this means that both long - term and short - term memory are severely disturbed . in consequence , he lives only in the present , since both past and future have ceased to exist for him . as pointed out by brown , the past is an essential component of the feeling of the present , which develops out of the immediate state revived in the present moment , while the future does not exist other than as an idea , or a feeling of the surge forward to the present . no wonder pa has lost his sense of self , as he has no elements to refer to . to make matters worse , he also encounters difficulties in evaluating the surrounding world , which is blurred and difficult to comprehend . it is worthy to remind here that we create our picture of current reality on the basis of our previous knowledge and experience , and pa has lost an access to them . according to microgenetic theory the primary activity of mind is to chunk experience into private and public objects or events [ 2729 ] . in other words , we are able to perceive ( or recognize ) only those objects and events that correspond to models created in our mind by experience . the models sculpt a complex reality into meaningful and comprehensible wholes . as brown puts it : the inner connectedness of the world is not its ostensible relatedness in the world , but its formative trajectory in the mind / brain . the changes that have occurred in the clinical picture of pa s mental status are perplexing . he has passed through a mosaic of disturbances , which resulted in a continuous deterioration of his identity : misidentification ( person and place ) ; capgras syndrome for person(s ) ; capgras for environment ; capgras for the arm ( asomatognosia ) ; frgoli syndrome for person(s ) ; frgoli for environment ; delusional reduplication ( without misidentification ) of self or other persons ; loss of identity ( cotard s syndrome , the delusion of being dead ) . as illustrated in figure 9 , time has played an important role in the process of pa s continuous deterioration . in fact , he has completely lost orientation in his surroundings , and his attempts to discover his true identity have ceased . in a recent publication , the first author of the present study has described these changes in self - identity , which include many , if not most , of the syndromes of impaired recognition of self and others described in the literature . the problem of personality and the self - concept can be approached , from the standpoint of pathology , in terms of patterns of transition from one symptom - complex to another in the same individual , and not as isolated defects in particular individuals within a population . disorders of the self can not be localized to separate brain areas , but constitute a spectrum in the process through which personality is preserved and sustained . the case described here provides convincing evidence that the stability and identity of the self depends , not on the association of discrete components , but on a recurrent process that maintains the self - concept over time , in aging , through sleep , and in the course of changing life events . as noted elsewhere by the first author of the present study the basic components of identity , those that can be weakened or destroyed by brain damage , are the following : coherence , that is , the idea that being oneself makes some kind of sense , that the parts which make up the whole fit together , at least in a general way ; unity , that is , the requirement that fundamentally there is one self in one body , despite the complexity of its structure ; continuity , that is , the requirement that the coherence and unity of identity last as long as life itself lasts , from birth to death , despite the natural tendency to break life down into periods ( epochs , eras ) . it turns out that one of pa s problems is the loss of the feeling of time , due mainly to the disturbances of autobiographic memory . macqueen has suggested that when speaking of that type of memory we concentrate on auto- , and forget about the original meaning of biography . the ancient greek word bios meant life , and grapho meant to write . our autobiography is therefore essentially a story , composed of the events of our own life , and is therefore narrative in its very nature . it is not , however , an orderly and exhaustive story that includes literally all the events of our life , but rather a kind of sketch made up of only those events which are of importance to us . as a rule these are emotionally loaded events , as well as those which proved to be of vital consequence for our future . in this respect autobiographic memory is more like a play or a film , in which significant events ( episodes , scenes , moments ) are combined in a way to form a comprehensive and continuous story . the story gains its coherence due to the logical sequence of events , where the viewer is left to assume or infer a logical sequence from one event to the next . in the case of the autobiography ( understood here as a mental construct , not a literary genre ) thus identity problems in tbi patients should hardly be surprising . even if the sequence of symptoms presented by pa seems unique , the complaint that one is a different person after the injury is not . this means that both long - term and short - term memory are severely disturbed . in consequence , he lives only in the present , since both past and future have ceased to exist for him . as pointed out by brown , the past is an essential component of the feeling of the present , which develops out of the immediate state revived in the present moment , while the future does not exist other than as an idea , or a feeling of the surge forward to the present . no wonder pa has lost his sense of self , as he has no elements to refer to . to make matters worse , he also encounters difficulties in evaluating the surrounding world , which is blurred and difficult to comprehend . it is worthy to remind here that we create our picture of current reality on the basis of our previous knowledge and experience , and pa has lost an access to them . according to microgenetic theory the primary activity of mind is to chunk experience into private and public objects or events [ 2729 ] . in other words , we are able to perceive ( or recognize ) only those objects and events that correspond to models created in our mind by experience . the models sculpt a complex reality into meaningful and comprehensible wholes . as brown puts it : the inner connectedness of the world is not its ostensible relatedness in the world , but its formative trajectory in the mind / brain . pa is not able to chunk his experience , to create meaningful units out of the continuous flow of stimuli he is confronted with . hence , the world around him is chaotic and incomprehensible , and he is an observer , whose only function is to react to situations he does not understand . in consequence he has no means to form his self - awareness . this is reflected in his emotional reactions to any attempt to make him realize who he really was , as well as reactions to music he formerly liked . in a way , there is a regression to a former state of consciousness , which may also explain why he has stopped smoking and drinking : after all , these are not the activities of the boy he believes himself to be . acting on the limbic level explains also his inability to control his emotions and his inappropriate social behaviors . but most disastrous is the fact that he has lost his identity , since he has no elements to rely upon . hence , he tends to cling to the self of others , borrowing their identities at least for the period he is able to remember . additional problems are created by frontal lobe dysfunction , which makes it difficult if not impossible for pa to assemble the disparate pieces of his foggy world .
summarybackgroundit is well known that traumatic brain injury often changes the way the patient perceives reality , which often means a distortion of the perception of self and the world . the purpose of this article is to understand the processes of identity change after traumatic brain injury.case reportwe describe progressive deterioration in personal identity in a former physician who had sustained a serious head injury ( 1998 ) , resulting in focal injuries to the right frontal and temporal areas . he regained consciousness after 63 days in coma and 98 days of post - traumatic amnesia , but has since displayed a persistent loss of autobiographical memory , self - image , and emotional bonds to family and significant others . qualitative life - story interviewing was undertaken to explore the mental state of a patient whose subjective , first person identity has been disengaged , despite the retention of significant amounts of objective , third person information about himself and his personal history ( though this was also lost at a later stage in the patient s deterioration).identity change in our patient was characterized by a dynamic and convoluted process of contraction , expansion and tentative balance . our patient tends to cling to the self of others , borrowing their identities at least for the period he is able to remember . identity is closely connected with the processes of memory.conclusionsthe results will be examined in relation to the microgenetic theory of brain function . the brain mechanisms that may account for these impairments are discussed . findings from this study have important implications for the delivery of person - focused rehabilitation .
although applying the pesticides in rice has increased grain production , their use has raised serious concern . beside the high cost of the pesticides , the use of pesticides may contaminate the products , as well as posing a serious danger to human health ( 1 ) . carbamates , or urethanes , are a group of organic compounds sharing a common functional group with the general structure r1-o-(co)-nr2-r3 . carbamates are esters of carbamic acid , which are unstable compounds because of the liability of the h - groups , leading upon exposure to water to rearrangements that lead to the decomposition to ammonium bicarbonate . a group of insecticides also contains the carbamate functional group , including aldicarb , carbofuran , pirimicarb , propoxur , carbaryl ( sevin ) , ethienocarb , and fenobucarb . these insecticides can cause cholinesterase inhibition poisoning by reversibly inactivating the enzyme acetyl cholinesterase and cause a cholinergic poisoning ( 2 ) . the presence of harmful pesticide residues in food has caused a great concern among the consumers . therefore , it is important to develop some pragmatic procedures to increase the food safety along with the reduction in consumption of pesticide residue ( 3 ) . food processing treatments include baking , bread making , dairy product manufacture , drying , thermal processing , fermentation , freezing , infusion , juicing , malting , milling , parboiling , peeling , peeling and cooking , storage , storage and milling , washing , washing and cooking , washing and drying , washing and peeling , washing peeling and juicing , and wine making ( 4 ) . literature demonstrates that in most cases processing leads to large reductions in residue levels of pesticides in the prepared food , particularly through washing , peeling and cooking operations ( 5- 9 ) . the effect of food processing on pesticide residues in rice has been the focus of a few recently published articles . a report by lee et al . , it showed that washing the rice grains with water , removes approximately 60% of the chlorpyrifos residues from fortified rice samples ( 10 ) . in another study , fukuhara et al . showed that an initial level of 19 ppm permethrin in rice was removed completely by washing with water ( 11 ) . the elimination of pesticide residues from the boiled extract could be due to decomposition by the effect of heat , the stronger adsorption of pesticide onto plant tissues and/or the poor solubility of pesticides in water ( 12 ) . the persistence of trifluralin , chlorpyrifos , decamethrin , cypermethrin and dichlorvos in rice and beans after cooking in a commercial microwave oven was evaluated by castro et al . the results showed that 92% to 99% of the pesticides were eliminated ( 13 ) . the effect of boiling and cooking on reducting some organophosphorus pesticides in rice was evaluated by holand p t , at et al . the fate of malathion and chlorpyrifos after boiling in rice has been the focus by cogburn et al . in 1990 ( 15 ) . investigating about the effect of cooking process on the pesticides residue has also been the subject of studies by satoh and saka ( 16 , 17 ) . the effect of processing on pesticide residues in food is an area where the available information should be consolidated and the missing information needs to be obtained through further research . more than 90% of the world s rice is cultured and consumed in asia ( 1 ) . rice is a staple food for more than 60% of the world s population . in iranian food basket , the consumption of rice in tehran is 110 g per capita / day ( personal communication ) . in this study , we evaluated the effect of cooking on reducing the amount of three carbamates residue i.e. carbaryl , pirimicarb and propoxur pesticides residues in white rice ( figure 1 ) . the iranian traditional method for rice cooking was used , in which a mixture of 15 g of white rice and 45 ml of boiling water was placed in a 100 ml pyrex container . in order to evaluate the percentage of pesticide s reduction , this processing was applied on spiked rice samples . chemical sctructures of carbaryl , pirimicarb and propoxur the percentage of reduction in pesticides concentration after cooking were determined by gas chromatography mass - spectrometry ( gc / ms ) using interpolation of the relative peak areas for each pesticide to internal standard peak area in the sample on the spiked calibration curve . the list of selected pesticides along with some of their physico - chemical properties are presented in table 1 . all organic solvents , intended for extraction , were at least lc grade and purchased from merck ( darmstadt , germany ) . bulk quantities of anhydrous na2so4 and nacl , were obtained from merck ( darmstadt , germany ) . anhydrous mgso4 , was obtained from sigma - aldich co. ( sigma - aldich , japan ) , the mgso4 was baked for 5 h at 500c in a furnace to remove phthalates and residual water . primary secondary amine ( psa ) was purchased from supelco ( supelco , usa ) . an agilent technologies 6890n network gc system chromatographs ( wilmington , usa ) with a sq detector and equipped with an agilent 7683b autosampler ( agilent technologies , usa ) was used . a hp-5 capillary column ( film thickness : 30 m 0.25 mm i.d . calibration standards individual stock standard solutions ( 1 mg / ml ) were prepared in ethyl acetate and stored in the dark at -20c . a mixed stock standard solution of pesticides was prepared in 15 g / ml ethyl acetate . spiked calibration standards at 6 levels of 25 , 50 , 100 , 250 , 500 and 1000 ng / ml were prepared by adding 25 l , 50 l , 100 l , 250 l , 500 l and 1000 l of mixed standard stock solution respectively to 15 g of cooked blank rice samples in each case . a stock solution of triphenylmethane ( tpm ) in ethyl acetate at concentration of 1 mg / ml was used as internal standard . an aliquot of 10 l of tpm solution in ethyl acetate ( 1000 mg / l ) was added to the spiked rice sample as internal standard . the iranian traditional method for rice cooking ( kateh ) was used , in which a mixture of 15 g of white rice and 45 ml of distilled water was placed in a 100 ml pyrex container . the mixture was heated for 20 min with hotplate and kept warm for another 45 min in order to complete the cooking process . the whole process was divided into three stages : 1 ) five min from the start of heating to the start of boiling of the mixture ; 2 ) fifteen min from the start of boiling to the start of steam coming out of the rice cooker ; 3 ) forty five min from the start of steam coming out of the rice cooker to the end of cooking . a thermo - meter was applied for measuring the variation in temperature ( 100 - 105c ) at the sampling locations during the rice cooking process . two sets of samples were considered to evaluate the effect of cooking on pesticides residues . for the first set , both pesticides and internal standard were added to the rice after cooking . the second set was spiked with the pesticides prior to the cooking process and the internal standard was added after cooking . the second set was used to evaluate the effect of cooking process on pesticides residues . in all cases , pesticides and/or internal standard solutions were added after cooling the cooked rice at room temperature ( 25c ) in order to avoid any possible decomposition of pesticides and internal standard . the spiked samples were left at ambient temperature in dark for 1.5 h. a volume of 120 ml acetonitrile was added to the mixture and then the mixture was blended . six grams of nacl was added to the mixture , and blending was continued for another 60 sec . the supernatant was filtered through 25 g of na2so4 in a 250 ml container and the filtrate was evaporated by the rotary evaporator to 10 ml . the extract was transferred to a 50 ml falcon tube including 6 g mgso4 and 300 mg psa , and the residue in container was rinsed with 15 ml acetonitrile and added to the centrifuge tube . after shaking for 1 min and centrifugation for 7 min at 3000 rpm , the filtrate evaporated to 5 ml . the extract was transferred to a 15 ml falcon tube containing 2 g mgso4 and 200 mg psa ( primary secondary amine ( psa ) whichis one of the most powerful solid- phase extraction adsorbent for clean - up of food matrices and multi pesticide residue analysis . after shaking for 1 min and centrifugation for 7 min at 503 g , the filtrate was evaporated to 0.3 ml . the residue was reconstituted by toluene to obtain 1 ml solution and 2 l of the solution was injected into gas chromatograph . for recovery determination , spiked cooked blank rice samples at concentration levels of 25 , 50 and 500 ng / g were prepared in triplicates and then treated according to the procedure described in sample preparation . evaluation of pesticide s reduction the percentage of reduction after cooking was determined based on determination of recovery from triplicate spiked rice raw samples at levels 25 , 100 and 500 ng / g of each pesticides before cooking and then after cooking according to rice cooking and treatment according to the procedure described in sample preparation . the gc - sq - ms was employed with helium as the carrier gas at a constant flow rate of 1 ml / min . the oven temperature started at 75c and remained at this temperature for 3 min increasing to 120c in a ramp rate of 25c / min and then increased to 300c at 5 c / min ramp , holding at 300c for 11 min . the injection port was adjusted at 250c and the splitless mode was used . after acquisition of the total ion chromatogram for the mixed stock standard solutions in scan mode , the identification was confirmed by comparing the relative abundances for three ions ( one quantifier and two qualifiers ) of the experimental standards to the known relative abundances of the pest library reference spectra . the most abundant ion that showed no evidence of chromatographic interference and had the highest signal - to - noise ratio was taken for quantification purposes . the concentrations of pesticides were determined by interpolation of the relative peak areas for each pesticide to internal standard peak area in the sample on the spiked calibration curve . in order to compensate for losses during sample processing and instrumental analysis , internal standard ( tpm ) was used . gas chromatographic determination analysis was performed in the sim mode based on the use of one target and two qualifier ions . the quantitation was based on the peak area ratio of the targets to that of internal standard . table 2 summarizes pesticides studied with their target and qualifier ions used in the sim mode in this study . the retention times , diagnostic ions and the selected quantification ion for the target pesticides and the internal standard calibration curves were constructed for each compound using six different concentration levels . for identification of pesticides , the retention time and three ions ( one for quantitation and two for identification ) were used . a gc sq ms chromatogram of 3 pesticides and internal standard ( tpm ) analyzed in cooked spiked rice is shown in figure 2 . a representative chromatogram obtained for the three pesticides ( propoxur , rt = 10.91 , 21.14 ; carbaryl , rt = 18.72 ; pirimicab , rt = 26.45 ) and internal standard ( tpm , rt = 29.85 ) . linearity of the standards in spiked calibration curves the three pesticides showed linearity in the sim mode . linear spiked calibration curves for all the carbamate pesticides were obtained with correlation factors > 0.999 . the spiked calibration curve for pirimicarb in rice sample is shown in figure 3 as a representative . spiked calibration curve for pirimicarb in cooked rice limitation of quantification limits of quantification ( loqs ) of the proposed method were calculated by considering a value 10 times more than that of background noise . the loqs for all the three pesticides in this method were calculated as 25 ppb . the recovery of pesticides at these three levels was in the range of 89.47 - 100.24% . in terms of repeatability , the vast majority of pesticides gave rsd < 10% with n = 3 at each spiking level . the recoveries and repeatabilities are in accordance with the criteria set by sanco guideline ( commission of the european communities , 2006 ) . average recoveries ( % ) and range of relative standard deviations ( % ) obtained by gc - ms analysis of rice at 3 spiking levels ( n = 3 ) in rice samples the reduction of pesticides after cooking the results of percentage of reduction for each carbamate after the boiling process is presented in table 4 . average reduction ( % ) and range of relative standard deviations ( % ) obtained by gc - ms analysis of spiked rice at 3 spiking levels ( n = 3 ) after cooking figure 4 shows an overlaid chromatogram of carbaryl in spiked rice samples before ( a ) and after ( b ) cooking . the overlaid chromatogram ; ( a ) blank rice which is spiked with carbaryl ( 100 ppb ) after the cooking ; ( b ) blank rice which is spiked with carbaryl ( 100ppb ) before the cooking the carbamates are a family of compounds whose general structures are shown in figure 5 . the great success of carbamates in agricultural applications has led to a continued increase in the use of these pesticides , but their acute toxicity is of great concern and calls for their accurate determination in food stuff ( 18 ) . food is the basic necessity of life and food contaminated with toxic pesticides is associated with severe effects on the human health . it is therefore of significance to develop simple , cost effective methods to enhance food safety and prevent the possible harms caused by pesticides . the disappearance of pesticide residues from boiling extract could be due to the decomposition by the effect of heat , the stronger adsorption of pesticide onto plant tissues and/or the poor solubility of pesticides in water ( 12 ) . processes involving heating , can increase volatilization , hydrolysis or the other chemical degradation and thus reduce the residue levels ( 14 ) . in this study , we evaluated the effect of boiling on the reduction of three carbamate pesticide residues in rice . the selected pesticides , including those for which mrl is issued by the institute of standards of iran ( 19 ) , include carbaryl and pirimicarb . the results of this study show that the cooking process decreases the amount of the three mentioned carbamates . carbaryl showed the highest reduction after cooking ( 78.47% in average ) while pirimicarb showed the lowest reduction ( 34.5% in average ) . no strong correlation was found between a single physico - chemical property of each of the three pesticides and the percentage of their reduction after the cooking . since several parameters including rate of hydrolysis , volatility ( vapor pressure ) , water solubility and molecular weight could affect the amount of reduction after cooking , no decisive conclusion could be drawn about the extent that each parameter contributes to the total loss of pesticides residue after cooking . investigating the effect of cooking process on the amount of reduction for a larger group of carbamates could help to find out more about mechanisms involved in this process . an accurate method was developed to determine residues of the three carbamate insecticide in cooked rice , a main food in the iranian food basket . the method which consists of a simple sample preparation and gc sq - ms - sim analysis showed a high sensitivity and confirmatory power necessary for the determination of pesticide residues at mrl levels in rice set by the institute of standards and industrial research of iran ( isiri ) . the results of present study proves that the traditional iranian rice cooking which involves long boiling time , significantly reduces the amount of carbamate residues . from the safety and toxicological point of view , this could be considered as an advantage for this type of food processing .
a gas chromatography mass spectrometry with spike calibration curve method was used to quantify three carbamate pesticides residue in cooked white rice and to estimate the reduction percentage of the cooking process duration.the selected pesticides are three carbamate pesticides including carbaryl and pirimicarb that their mrl is issued by the institute of standards of iran and propoxur which is used as a widely consumed pesticide in rice.the analytical method entailed the following steps : 1- blending 15 g cooked sample with 120 ml acetonitrile for 1 min in solvent proof blender , 2- adding 6 g nacl and blending for 1 min , 3- filtering upper layer through 25 g anhydrous na2so4 , 4- cleaning up with psa and mgso4 , 5- centrifuging for 7 min , 6- evaporating about 0.3 ml and reconstituting in toluene till 1 ml , 7- injecting 2 l extract into gc / ms and analyzing by single quadruple selected ion monitoring gc / ms - sq - sim . the concentration of pesticides and the percentage of pesticides amounts after the cooking were determined by gas chromatography mass - spectrometry ( gc / ms ) using with interpolation of the relative peak areas for each pesticide to internal standard peak area in the sample on the spiked calibration curve . calibration curve was linear over the range of 25 to 1000 ng / g , and loq was 25 ng / g for all three pesticides . the percent of loss for the three pesticides were 78% , 55% and 35% for carbaryl , propoxur and pirimicarb respectively . different parameters such as vapor pressure , boiling point , and suspect ability of the compound to hydrolysis , could be responsible for the losing of pesticides during the cooking process .
,-unsaturated carboxylic acids undergo rh(iii)-catalyzed decarboxylative coupling with ,-unsaturated o - pivaloyl oximes to provide substituted pyridines in good yield . the carboxylic acid , which is removed by decarboxylation , serves as a traceless activating group , giving 5-substituted pyridines with very high levels of regioselectivity . mechanistic studies rule out a picolinic acid intermediate , and an isolable rhodium complex sheds further light on the reaction mechanism .
bone is one of the most common sites of metastasis in advanced cancer , present in approximately 5075% of patients . bone metastases are especially prevalent in patients with prostate , breast , or lung primaries [ 24 ] and are of great concern to both physicians and patients as they can result in complications such as pathologic fractures , hypercalcemia , and spinal cord compression [ 2,57 ] . one of the most common symptoms of bone metastases is pain , occurring in an estimated 70% of patients . often , patients initially present with multiple bone metastases and often , multiple sites of pain . pain may be localized or diffuse , and may worsen upon weight bearing . as a consequence of bone pain , patients often have increased difficulty with activities of daily living and decreased quality of life ( qol ) . radiation therapy ( rt ) is considered to be the standard treatment for cancer patients with symptomatic bone metastases . various studies have shown that approximately 6070% of patients experience at least some degree of pain relief following rt , regardless of radiotherapy regime . moreover , about 25% of patients experience complete pain relief , otherwise known as a complete response . although pain relief is a proven benefit of radiation therapy , this is not necessarily indicative of improved qol . qol is a multidimensional model that attempts to capture the physical , social , and psychological well - being of the patient . many components influence qol , including physical symptoms of the disease , side effects of treatment , social and family support . treatment in the advanced cancer population is palliative rather than curative in intent , meaning that the goal is managing symptoms as opposed to prolonging life . with this goal in mind , it is important for health care providers to consider treatment in terms of not only managing symptoms , but also stabilizing or improving other factors that affect qol . as qol is a subjective concept , it can be difficult to capture in an accurate and meaningful fashion . currently , various tools are employed to assess pain and qol in advanced cancer patients and in those specifically with bone metastases . the european organisation for research and treatment of cancer ( eortc ) has developed one of the most commonly used measurements for this purpose : the qlq - c30 . associated with this measurement is the qlq - c15-pal , a reduced version of the parent qlq - c30 designed to capture qol outcomes in a brief internationally recognized and validated tool . the eortc qlq - bm22 is a sub - module of the qlq - c30 and is an internationally recognized and validated scale used to measure qol in bone metastases patients . another widely used tool is the brief pain inventory ( bpi ) , developed by cleeland and ryan . the bpi is a questionnaire used to determine overall pain intensity and functional interference as a result of pain . specifically , it examines functional interference in terms of general activity , normal work , walking ability , mood , sleep , relations with others , and enjoyment of life . in addition , it captures three aspects of pain : worst , average , and current intensity . finally , the edmonton symptom assessment system ( esas ) examines symptoms on a scale of 0 , representing absence of symptom to 10 , representing worst possible symptom . symptoms captured in this questionnaire are pain , tiredness , nausea , depression , anxiety , drowsiness , appetite , feeling of well - being , and shortness of breath . in general , symptoms given a rating of 13 are considered mild , 47 are considered moderate , and 810 are considered severe . the objective of this review was to investigate changes in qol following rt for painful bone metastases . specifically , we wanted to determine whether or not those who experienced pain relief post - treatment also experienced a positive response in qol compared to non responders . a literature search was conducted using ovidsp medline ( 1946week 4 2014 ) , embase ( 1947week 5 2014 ) , and the cochrane central register of controlled trials ( dec 2013 ) databases . palliative radiation , cancer palliative therapy , bone metastases , quality of life , and pain. any publication which reported change in qol using a validated scale following rt was included in this review . exclusion criteria were literature reviews and articles that discussed qol solely before radiation treatment , as well as those which only discussed pain . titles and abstracts of articles generated in the initial search were independently screened by rm and gb and potential articles were identified . eighteen of these articles , published between 1977 and 2013 , met the eligibility criteria [ 1,3,4,7,8,1122 ] . all studies collected data prospectively , except for that by gilbert et al . who determined qol through chart review . only 3 of the studies were randomized control trials , while the rest employed no other intervention than the questionnaire . the most commonly used tool was the bpi , used in a total of six papers . the next most commonly used assessment tools were eortc measures and the esas , which were employed in five and three studies , respectively . other assessment tools included the patient - generated subjective global assessment , net pain relief , the mcgill melzalk score , the spitzer scale , and others [ 3,2022 ] . in total , eight articles directly compared qol in responders and non - responders , as defined by the international bone metastases consensus guidelines , while the remaining ten [ 3,8,11,13,14,17,1922 ] made no differentiation between the two patient groups . all of the six articles that utilized the bpi reported at least some improvement in functional interference at one month following radiotherapy for painful bone metastases ( table 1 ) . however , the specific functional items , the degree to which they improved , and whether the improvement was observed in only responders were inconsistently reported among the publications . wu et al . published their study in 2006 , which investigated pain relief and qol following rt for patients with bone metastases . these authors reported that there was an improvement in all seven functional items of the bpi one month following treatment ; however they did not differentiate between responders and non responders . it was reported by nguyen et al . that only mood was significantly related to responders , whereas hadi et al . concluded that all items except mood , relations with others , and sleep , were significantly related to pain response . . found a significant reduction in interference with general activity , normal work , enjoyment of life , and average functional interference in responders . no significant reduction was found for any functional interference scores in patients classified as non responders . zeng et al . observed that improvement in all functional interference scores was significantly related to responders , except for sleeping problems at month two and four post treatment . in contrast , khan et al . reported an improvement in sleep at two and three months post rt in responders . in non responders , sleep was reported to have improved at month one and two , but then worsened at month three . the esas was used in three of the 17 included studies , none of which differentiated between responders and non responders . both pituskin et al . and fairchild et al . concluded similar pain response post - treatment , with pain scores decreasing from 6.1/10 and 6.08/10 at baseline , to 2.6/10 and 2.96/10 post - treatment , respectively . in terms of symptoms , pituskin et al . reported that shortness of breath , nausea , and appetite were the only symptoms that did not show significant improvement at a four week follow - up . contrastingly , fairchild et al . found improvement in all symptom severities at weeks one and four post treatment , although improvement was reported as the percentage of patients who experienced symptom relief , with no mention of the statistical significance when compared to baseline . also utilized the esas with a large population of 518 patients . these authors assessed pain and qol at 1 , 2 , 4 , 8 , and 12 weeks post rt and observed an improvement in global pain , index pain , anxiety , and sense of well - being for all patients throughout the follow - up . all articles that employed the esas to measure qol can be found in table 2 . a total of five studies used eortc developed questionnaires ; three used the qlq - c30 , one used the qlq - c15-pal , and one used both the qlq - bm22 as well as the qlq - c30 ( table 3 ) . used the qlq - c30 when evaluating patients who were treated with half - body irradiation for symptomatic bone metastases . not only did pain decrease from 6.1 at baseline to 3.1 two weeks post - treatment , but all five functional scales ( physical functioning , role functioning , emotional functioning , cognitive functioning , and social functioning ) also demonstrated improvement over time . the same held true for global qol , and all symptom scales except for diarrhea and financial difficulties . another study , conducted by lee et al . investigated pain relief and qol in patients with metastatic renal cell carcinoma . although this study did not focus solely on bone metastases in these patients , 25 of a total of 31 patients were radiated for painful bone metastases . improvement in qol was reported by 33% of patients , no significant change by 21% , and decline in qol by 46% . physical functioning was reported as improved in 48% of patients and symptom improvement in 22% of patients . a study conducted by lam et al . used the qlq - c30 and reported improvement in physical and emotional functioning , global health score , pain , insomnia , constipation , and financial problems following rt . the qlq - bm22 , in conjunction with the qlq - c30 , was used in a study conducted by zeng et al . . fifty - nine patients had complete follow - up data of which 22 , 8 , and 29 experienced a partial response , pain progression , and an indeterminate response , respectively . lower scores for painful sites , painful characteristics , and pain were seen at follow - up for responders when compared to non - responders . responders also experienced improved physical and role functioning , as well as functional interference and constipation . improvement , although not significant , was seen in psychosocial aspects and global health status in responders compared to non responders . caissie et al . used the qlq - c15-pal in their study of 178 patients with symptomatic bone metastases . overall radiotherapy response was seen in 45% of patients at week 1 , 62% at week two and month 1 , and 65% at month 2 . in responders , overall qol furthermore , improvement was also seen in emotional functioning , fatigue , insomnia , constipation , and pain . contrastingly , no improvement was seen in overall qol , functioning , or symptoms in non responders . a variety of other pain assessments were used in studies published between 1977 and 2001 ( table 4 ) . used karnofsky performance status ( kps ) , which measures functional impairment , to assess qol . patients who spent most of their life being able to care for most of their own needs were considered to have good qol , defined as level 1 . qol post - treatment , although the prevalence of such was not reported before treatment . . investigated symptoms and qol using eastern hospital anxiety and depression ( had ) scale and spitzers qol index . spitzers qol index is a five item questionnaire about activity , daily living , health , support , and outlook . using these tools , reported a decreased prevalence of anxiety and depression and improved qol in responders for both fractionation schedules . nielsen et al . assessed pain relief and qol through a 5 point visual analog scale that included pain , global qol , and analgesic consumption . similarly to gaze et al . , they reported an increase in qol regardless of fractionation schedule , with a total of 7% of patients experiencing a complete feeling of well - being . a randomized trial was conducted by salazar et al in 2001 in which patients were randomized to receive 15 gy in 5 fractions in 5 days , 8 gy in 2 fractions in 1 day , or 12 gy in 4 fractions in 2 days . the authors found an improvement in qol in patients with the first and third radiation schedule , but significantly worse qol in patients randomized to the second schedule . this was consistent for all primaries except prostate , in which the first protracted schedule ( 15 gy in 5 fractions in 5 days ) was favoured . all of the six articles that utilized the bpi reported at least some improvement in functional interference at one month following radiotherapy for painful bone metastases ( table 1 ) . however , the specific functional items , the degree to which they improved , and whether the improvement was observed in only responders were inconsistently reported among the publications . wu et al . published their study in 2006 , which investigated pain relief and qol following rt for patients with bone metastases . these authors reported that there was an improvement in all seven functional items of the bpi one month following treatment ; however they did not differentiate between responders and non responders . it was reported by nguyen et al . that only mood was significantly related to responders , whereas hadi et al . concluded that all items except mood , relations with others , and sleep , were significantly related to pain response . . found a significant reduction in interference with general activity , normal work , enjoyment of life , and average functional interference in responders . no significant reduction was found for any functional interference scores in patients classified as non responders . zeng et al . observed that improvement in all functional interference scores was significantly related to responders , except for sleeping problems at month two and four post treatment . in contrast , khan et al . reported an improvement in sleep at two and three months post rt in responders . in non responders , sleep was reported to have improved at month one and two , but then worsened at month three . the esas was used in three of the 17 included studies , none of which differentiated between responders and non responders . both pituskin et al . and fairchild et al . concluded similar pain response post - treatment , with pain scores decreasing from 6.1/10 and 6.08/10 at baseline , to 2.6/10 and 2.96/10 post - treatment , respectively . in terms of symptoms , pituskin et al . reported that shortness of breath , nausea , and appetite were the only symptoms that did not show significant improvement at a four week follow - up . contrastingly , fairchild et al . found improvement in all symptom severities at weeks one and four post treatment , although improvement was reported as the percentage of patients who experienced symptom relief , with no mention of the statistical significance when compared to baseline . also utilized the esas with a large population of 518 patients . these authors assessed pain and qol at 1 , 2 , 4 , 8 , and 12 weeks post rt and observed an improvement in global pain , index pain , anxiety , and sense of well - being for all patients throughout the follow - up . all articles that employed the esas to measure qol can be found in table 2 . a total of five studies used eortc developed questionnaires ; three used the qlq - c30 , one used the qlq - c15-pal , and one used both the qlq - bm22 as well as the qlq - c30 ( table 3 ) . used the qlq - c30 when evaluating patients who were treated with half - body irradiation for symptomatic bone metastases . not only did pain decrease from 6.1 at baseline to 3.1 two weeks post - treatment , but all five functional scales ( physical functioning , role functioning , emotional functioning , cognitive functioning , and social functioning ) also demonstrated improvement over time . the same held true for global qol , and all symptom scales except for diarrhea and financial difficulties . another study , conducted by lee et al . investigated pain relief and qol in patients with metastatic renal cell carcinoma . although this study did not focus solely on bone metastases in these patients , 25 of a total of 31 patients were radiated for painful bone metastases . improvement in qol was reported by 33% of patients , no significant change by 21% , and decline in qol by 46% . physical functioning was reported as improved in 48% of patients and symptom improvement in 22% of patients . a study conducted by lam et al . used the qlq - c30 and reported improvement in physical and emotional functioning , global health score , pain , insomnia , constipation , and financial problems following rt . no differentiation between responders and non responders the qlq - bm22 , in conjunction with the qlq - c30 , was used in a study conducted by zeng et al . . fifty - nine patients had complete follow - up data of which 22 , 8 , and 29 experienced a partial response , pain progression , and an indeterminate response , respectively . lower scores for painful sites , painful characteristics , and pain were seen at follow - up for responders when compared to non - responders . responders also experienced improved physical and role functioning , as well as functional interference and constipation . improvement , although not significant , was seen in psychosocial aspects and global health status in responders compared to non responders . caissie et al . used the qlq - c15-pal in their study of 178 patients with symptomatic bone metastases . overall radiotherapy response was seen in 45% of patients at week 1 , 62% at week two and month 1 , and 65% at month 2 . in responders , furthermore , improvement was also seen in emotional functioning , fatigue , insomnia , constipation , and pain . contrastingly , no improvement was seen in overall qol , functioning , or symptoms in non responders . a variety of other pain assessments were used in studies published between 1977 and 2001 ( table 4 ) . used karnofsky performance status ( kps ) , which measures functional impairment , to assess qol . patients who spent most of their life being able to care for most of their own needs were considered to have good qol , defined as level 1 . good qol post - treatment , although the prevalence of such was not reported before treatment . . investigated symptoms and qol using eastern hospital anxiety and depression ( had ) scale and spitzers qol index . spitzers qol index is a five item questionnaire about activity , daily living , health , support , and outlook . using these tools , gaze et al . reported a decreased prevalence of anxiety and depression and improved qol in responders for both fractionation schedules . nielsen et al . assessed pain relief and qol through a 5 point visual analog scale that included pain , global qol , and analgesic consumption . similarly to gaze et al . , they reported an increase in qol regardless of fractionation schedule , with a total of 7% of patients experiencing a complete feeling of well - being . a randomized trial was conducted by salazar et al in 2001 in which patients were randomized to receive 15 gy in 5 fractions in 5 days , 8 gy in 2 fractions in 1 day , or 12 gy in 4 fractions in 2 days . the authors found an improvement in qol in patients with the first and third radiation schedule , but significantly worse qol in patients randomized to the second schedule . this was consistent for all primaries except prostate , in which the first protracted schedule ( 15 gy in 5 fractions in 5 days ) was favoured . as a multidimensional concept that encompasses the well - being of the whole person , qol is both difficult to define and measure . often , bone metastases cause pain which decreases mobility and interferes with physical functioning . in turn , this may lead to an inability to seek support from friends and family , causing emotional and psychological distress . in an article written by carlson et al . normal feelings of vulnerability , sadness , and fears , to problems that can become disabling such as depression , anxiety , panic , social isolation , and spiritual crisis . these authors stated that distress is associated with reduced survival and qol , and that both pain and fatigue are highly validated components of distress . this was further confirmed in a study conducted by kaasa et al . , who showed that psychological distress is related to pain and reduced performance status . currently , treatment response is defined by the international bone metastases consensus guidelines in terms of pain score and analgesic consumption . it is hypothesized that , if psychological distress is related to pain and reduced performance status , an improvement in pain will lead to an improvement in psychological aspects of ones health and qol . our literature review confirmed that the majority of patients experience an improvement in qol following rt ; however , it is unknown which aspects of qol improve , and the degree to which this improvement is related to pain response . part of the difficulty in determining which aspects of qol improve is due to the wide range of questionnaires used . although there has been an effort to standardize assessment tools in recent years , for example with the development of the qlq c15-pal and the bm22 , there still remains an inconsistent approach to assessing qol . this makes it difficult to compare the individual functional interference items and symptom scales between questionnaires . this questionnaire should then be employed in a large prospective study investigating the possible existence of a positive correlation between pain relief and improvement in qol following palliative radiotherapy for painful bone metastases . only three of the 18 studies were randomized control trials , all of which were exploring the use of fractionation schedule and radiation technique . numerous other randomized control trials have investigated similar questions ; however their primary endpoints are often pain score , survival , and toxicity . it is important for the endpoints of these randomized control trials to be reconsidered to include qol because its maintenance or improvement is such a vital goal of palliative treatment . in studies investigating variables in a palliative cancer population , this is a limitation in all studies included in this review , as all studies involved post - radiation follow - up at which point patients could either have died or become no longer contactable . in addition , only patients who were well enough to complete follow - up questionnaires were included in follow - up data . as such , those who have a poorer qol and physical functioning may not be able to provide data . these studies are also limited in that they do not exclude those who are on other cancer treatments , including hormone therapy and chemotherapy . finally , it is noted that a variety of follow - up schedules were used across the studies included in this review . future studies would be useful in determining an appropriate period of follow - up , in order to ensure that trial endpoints can be reached without placing too much burden on patients . in studies investigating variables in a palliative cancer population , patient attrition is always one of the main limitations . this is a limitation in all studies included in this review , as all studies involved post - radiation follow - up at which point patients could either have died or become no longer contactable . in addition , only patients who were well enough to complete follow - up questionnaires were included in follow - up data . as such , those who have a poorer qol and physical functioning may not be able to provide data . these studies are also limited in that they do not exclude those who are on other cancer treatments , including hormone therapy and chemotherapy . finally , it is noted that a variety of follow - up schedules were used across the studies included in this review . future studies would be useful in determining an appropriate period of follow - up , in order to ensure that trial endpoints can be reached without placing too much burden on patients . overall , despite somewhat contradicting results and limited literature , it seems that there may be at least some improvement or stabilization in qol in patients who respond to radiation therapy . this , combined with the knowledge that 6070% of patients experience pain relief post - treatment , satisfies the goals of palliative treatment : to manage symptoms and improve or stabilize qol . future studies using a validated questionnaire that look at a correlation between responders to rt and improvement in qol would be useful in determining the degree to which qol can be expected to improve following treatment . this would be useful to allow informed decision making for both patients and physicians , especially when offering treatment to patients with lower performance status and poorer prognosis .
objectiveto investigate the quality of life ( qol ) following palliative radiotherapy for painful bone metastases.methodsa literature search was conducted in ovidsp medline ( 1946jan week 4 2014 ) , embase ( 1947week 5 2014 ) , and the cochrane central register of controlled trials ( dec 2013 ) databases . the search was limited to english . subject headings and keywords included palliative radiation , cancer palliative therapy , bone metastases , quality of life , and pain. all studies ( prospective or retrospective ) reporting change in qol before and after palliative radiotherapy for painful bone metastases were included.resultseighteen articles were selected from a total of 1730 . the most commonly used tool to evaluate qol was the brief pain inventory . seventeen studies collected data prospectively . an improvement in symptoms and functional interference scores following radiotherapy was observed in all studies . the difference in changes in qol between responders and non responders was inconsistently reported.conclusionqol improves in patients who respond to palliative radiotherapy for painful bone metastases .
oxaliplatin , a platinum - based chemotherapeutic agent , is effective for the treatment of advanced colorectal cancer.15 unlike other platinum derivatives , oxaliplatin does not cause significant renal impairment or ototoxicity . the dose - limiting toxicity of oxaliplatin is related to peripheral nerve function and the potential development of peripheral neuropathy.6 chemotherapy for metastatic colorectal cancer has remarkably advanced with the introduction of folinic acid , fluorouracil , and irinotecan ( folfiri ) and folinic acid , fluorouracil , and oxaliplatin ( folfox ) regimens . however , both these regimens require the implantation of a central venous ( cv ) access port and treatment is occasionally interrupted by complications associated with the cv port , such as infection , thrombosis , and pinch - off syndrome.7 with the recent development of capecitabine plus oxaliplatin ( xelox ) therapy , the implantation of a cv port can now be avoided . however , phlebitis caused by peripheral intravenous infusion of antineoplastic agents can limit the completion or continuation of chemotherapy . factors that contribute to the development of phlebitis include the ph and osmotic pressure of the solution , the size of the vein used , the size and material of the catheter , and infusion periods.8 a number of methods for reducing the risk of phlebitis have been reported , but none are completely effective.9,10 in one study , the addition of steroids to the oxaliplatin drip infusion was useful in controlling vascular pain.11 however , the addition of steroids can increase the ph of the solution and affect the stability of oxaliplatin . furthermore , the prescribing information states that oxaliplatin is incompatible in solution with alkaline medications or media ; therefore , it is not mixed with these solutions or simultaneously administered through the same infusion line . because intravenous dexamethasone ( dex ) is alkaline , it is routinely administered to patients before chemotherapy . to date however , we have previously reported that the ph of a solution of dex and oxaliplatin was less than 7.4 . in that retrospective study , we found that hypersensitivity reactions ( hsrs ) to oxaliplatin could have been prevented by the coinfusion of dex.12 little information is available about the risk factors of oxaliplatin - induced hsr.13 to our knowledge , only four investigations have previously attempted to identify potential predictive factors by multivariate analysis.1417 kim et al reported the possible association between oxaliplatin - induced hsr and clinical characteristics and found that females , younger patients , and patients receiving oxaliplatin in salvage regimens were more likely to experience oxaliplatin - induced hsr.16,17 on the basis of multivariate analysis , mori et al15 analyzed that being young and having an oxaliplatin - free interval were independent risk factors , whereas shao et al14 found higher oxaliplatin dose per infusion as an independent risk factor . moreover , a recent study reported that a lower dose of dex ( < 20 mg ) could be a positive risk factor.16 to our knowledge , there have been no reports about prospective trials of preventing oxaliplatin - induced hsrs by the coinfusion of dex . the present prospective study was undertaken to evaluate the effectiveness of dex to prevent hsrs caused by the administration of oxaliplatin . the avoid trial was a prospective , multicenter , open - label , single - arm phase ii trial in japan . the institutional review board at fukuoka university approved the protocol and the study is registered with the university hospital medical information network clinical trials registry ( i d : umin000009742 ) . this study evaluated the effectiveness of coinfusion of dex and oxaliplatin to prevent oxaliplatin - induced hsrs . the target sample size was 70 patients , assuming that the expected hsrs and threshold hsrs were 4% and 12% , respectively , with a one - sided alpha - level of 5% and a power of 80% . patients were recruited from fukuoka university hospital , fukuoka sanno hospital , fujita health university hospital , kansai medical university hirakata hospital , sano hospital , and kanazawa medical university hospital . eligible patients were 20 years of age , with histologically confirmed colorectal cancer without prior chemotherapy for metastatic disease , and with at least 6 months elapsed from completion of any adjuvant therapy . they also met the following criteria : eastern cooperative oncology group performance status 02 , life expectancy 12 weeks , neutrophil count 1,000/mm , platelet count 75,000/mm , hemoglobin 8.0 g / dl , total bilirubin 2.0 mg / dl , and serum creatinine 1.5 times the upper limit of normal . patients with any of the following conditions were excluded : severe peripheral sensory neuropathy ( psn ) , a history of serious hypersensitivity to drugs , active infection , paralytic or mechanical bowel obstruction , uncontrolled hypertension , uncontrolled diabetes , cirrhosis , clinically significant cardiovascular disease , history of myocardial infarction within the previous 3 months , uncontrolled angina pectoris or arrhythmia , multiple primary cancers within the past 5 years , pleural effusion requiring drainage ascites or pericardial effusion , uncontrolled diarrhea , clinically significant mental or psychological disease , and any other condition making a patient unsuitable for this study . the 73 study patients received either xelox or xelox plus bevacizumab therapy ( oxaliplatin 130 mg / m bevacizumab 7.5 mg / kg on day 1 , plus capecitabine 1,000 mg / m twice daily on days 114 , every 3 weeks ) for advanced or recurrent colorectal cancer . all patients received intravenous dex ( 6.6 mg ) and a selective 5-hydroxytryptamine-3 receptor antagonist before oxaliplatin infusion . in addition , dex ( 6.6 mg ) was administered in combination with oxaliplatin ( figure 1).1820 dose reductions were required for all grade 3 or 4 toxicities attributed to the study medications . study treatment was delayed if any of the following criteria were applicable on the day when administration was scheduled or the previous day : a neutrophil count of < 1,000/mm , a platelet count of < 75,000/mm , active infection with fever 38.0c , grade 2 or worse diarrhea , grade 3 or worse psn , and other grade 2 or worse nonhematological toxicities . the oxaliplatin dose was reduced to 100 mg / m if grade 34 neutropenia or thrombocytopenia , persistent grade 2 or reversible grade 3 psn , or any grade 34 nonhematological toxicities occurred . the study was terminated if grade 3 toxicity persisted after a 21-day washout period or if grade 4 psn or a grade 24 allergic reaction occurred . the study was also terminated if the patient required longer than 3 weeks to recover from an adverse event . all patients underwent physical examination , chest radiography , and computed tomographic scans of the abdomen , pelvis , and chest before starting the treatment . the severity of adverse events was evaluated according to the national cancer institute common toxicity criteria ( nci - ctc ) , version 4.0 . tumors were measured at 6- to 8-week intervals , and response was evaluated according to the response evaluation criteria for solid tumors ( recist ) version 1.1 . complete ( cr ) and partial response ( pr ) required subsequent confirmation after an interval of at least 4 weeks . the disease control rate ( dcr ) was calculated from the number of patients who achieved a cr , pr , or stable disease ( sd ) with treatment , while the overall response rate was based on the number of patients who had cr or pr . drug hsrs are the adverse effects of pharmaceutical formulations ( including active drugs and excipients ) that clinically resemble allergy.21 for general communication , when an allergic drug reaction is suspected , hsr is the preferred term , because true drug allergy and nonallergic hsr may be difficult to differentiate based on the clinical presentation alone , especially in cases of acute severe hsr.22 in this study , oxaliplatin - induced hypersensitivity was defined as the occurrence of cutaneous symptoms ( such as urticaria , rash , and angioedema ) , respiratory symptoms ( such as dyspnea , bronchospasm , and laryngeal edema ) , gastrointestinal symptoms , neurological symptoms , or anaphylaxis subsequent to oxaliplatin administration . if hsr occurred during the administration of oxaliplatin or prior to administration of the next drug in the regimen s sequence , then oxaliplatin was identified as the causative agent . if hsr occurred after administration of subsequent drugs , then oxaliplatin hypersensitivity was confirmed if there was a recurrence of symptoms , despite eliminating other suspected drugs . the avoid trial was a prospective , multicenter , open - label , single - arm phase ii trial in japan . the institutional review board at fukuoka university approved the protocol and the study is registered with the university hospital medical information network clinical trials registry ( i d : umin000009742 ) . this study evaluated the effectiveness of coinfusion of dex and oxaliplatin to prevent oxaliplatin - induced hsrs . the target sample size was 70 patients , assuming that the expected hsrs and threshold hsrs were 4% and 12% , respectively , with a one - sided alpha - level of 5% and a power of 80% . patients were recruited from fukuoka university hospital , fukuoka sanno hospital , fujita health university hospital , kansai medical university hirakata hospital , sano hospital , and kanazawa medical university hospital . eligible patients were 20 years of age , with histologically confirmed colorectal cancer without prior chemotherapy for metastatic disease , and with at least 6 months elapsed from completion of any adjuvant therapy . they also met the following criteria : eastern cooperative oncology group performance status 02 , life expectancy 12 weeks , neutrophil count 1,000/mm , platelet count 75,000/mm , hemoglobin 8.0 g / dl , total bilirubin 2.0 mg / dl , and serum creatinine 1.5 times the upper limit of normal . patients with any of the following conditions were excluded : severe peripheral sensory neuropathy ( psn ) , a history of serious hypersensitivity to drugs , active infection , paralytic or mechanical bowel obstruction , uncontrolled hypertension , uncontrolled diabetes , cirrhosis , clinically significant cardiovascular disease , history of myocardial infarction within the previous 3 months , uncontrolled angina pectoris or arrhythmia , multiple primary cancers within the past 5 years , pleural effusion requiring drainage ascites or pericardial effusion , uncontrolled diarrhea , clinically significant mental or psychological disease , and any other condition making a patient unsuitable for this study . the 73 study patients received either xelox or xelox plus bevacizumab therapy ( oxaliplatin 130 mg / m bevacizumab 7.5 mg / kg on day 1 , plus capecitabine 1,000 mg / m twice daily on days 114 , every 3 weeks ) for advanced or recurrent colorectal cancer . all patients received intravenous dex ( 6.6 mg ) and a selective 5-hydroxytryptamine-3 receptor antagonist before oxaliplatin infusion . in addition , dex ( 6.6 mg ) was administered in combination with oxaliplatin ( figure 1).1820 dose reductions were required for all grade 3 or 4 toxicities attributed to the study medications . study treatment was delayed if any of the following criteria were applicable on the day when administration was scheduled or the previous day : a neutrophil count of < 1,000/mm , a platelet count of < 75,000/mm , active infection with fever 38.0c , grade 2 or worse diarrhea , grade 3 or worse psn , and other grade 2 or worse nonhematological toxicities . the oxaliplatin dose was reduced to 100 mg / m if grade 34 neutropenia or thrombocytopenia , persistent grade 2 or reversible grade 3 psn , or any grade 34 nonhematological toxicities occurred . the study was terminated if grade 3 toxicity persisted after a 21-day washout period or if grade 4 psn or a grade 24 allergic reaction occurred . the study was also terminated if the patient required longer than 3 weeks to recover from an adverse event . all patients underwent physical examination , chest radiography , and computed tomographic scans of the abdomen , pelvis , and chest before starting the treatment . the severity of adverse events was evaluated according to the national cancer institute common toxicity criteria ( nci - ctc ) , version 4.0 . tumors were measured at 6- to 8-week intervals , and response was evaluated according to the response evaluation criteria for solid tumors ( recist ) version 1.1 . complete ( cr ) and partial response ( pr ) required subsequent confirmation after an interval of at least 4 weeks . the disease control rate ( dcr ) was calculated from the number of patients who achieved a cr , pr , or stable disease ( sd ) with treatment , while the overall response rate was based on the number of patients who had cr or pr . drug hsrs are the adverse effects of pharmaceutical formulations ( including active drugs and excipients ) that clinically resemble allergy.21 for general communication , when an allergic drug reaction is suspected , hsr is the preferred term , because true drug allergy and nonallergic hsr may be difficult to differentiate based on the clinical presentation alone , especially in cases of acute severe hsr.22 in this study , oxaliplatin - induced hypersensitivity was defined as the occurrence of cutaneous symptoms ( such as urticaria , rash , and angioedema ) , respiratory symptoms ( such as dyspnea , bronchospasm , and laryngeal edema ) , gastrointestinal symptoms , neurological symptoms , or anaphylaxis subsequent to oxaliplatin administration . if hsr occurred during the administration of oxaliplatin or prior to administration of the next drug in the regimen s sequence , then oxaliplatin was identified as the causative agent . if hsr occurred after administration of subsequent drugs , then oxaliplatin hypersensitivity was confirmed if there was a recurrence of symptoms , despite eliminating other suspected drugs . characteristics of the study patients are shown in table 1 . of the 73 patients , the median age was 64 years ( range : 3184 ) and 52.1% were female . eastern cooperative oncology group performance status scores were 0 , 1 , and 2 in 83.6% , 13.7% , and 2.7% of the patients , respectively . fifty - three patients ( 72.6% ) continued treatment until eight cycles , while the other reasons for discontinuing treatment were adverse events in four patients , operation in four patients , cr in one patient , progression disease in two patients , and refusal or personal reasons in nine patients . treatment was delayed in 22 patients ( 30.1% ) with the delay being due to neutropenia in four patients ( 5.5% ) , thrombocytopenia in five , fatigue in three , diarrhea in two , psn in one , pneumonia in one , cholangitis in one , ileus in one , and personal reasons in two patients . twenty - three patients ( 31.5% ) required dose reduction at least once within eight cycles , with the reason being neutropenia in four and thrombocytopenia in five . three patients ( 4.1% ) developed hsr at five cycles , six cycles , and ten cycles . in all three cases , the reaction was cutaneous ( grade 1 erythema ) and it resolved within minutes or hours . the tumor response was assessed in 45 of the 73 patients because 28 patients received chemotherapy as part of adjuvant chemotherapy . the confirmed response rate was 64.4% ( 95% confidence interval [ ci ] 48.878.1 ; cr , 8.9% ; pr , 55.6% ; sd , 31.1% ; progressive disease [ pd ] , 4.4% ) , and disease control rate was achieved in 95.6% ( 95% ci 84.999.5 ) . grade 3 or higher hemotoxicity occurred in ten patients ( 13.7% ) , and ten patients ( 13.7% ) developed grade 3 or higher nonhematological toxicity . there were no other severe treatment - related adverse events and no deaths during treatment . characteristics of the study patients are shown in table 1 . of the 73 patients , the median age was 64 years ( range : 3184 ) and 52.1% were female . eastern cooperative oncology group performance status scores were 0 , 1 , and 2 in 83.6% , 13.7% , and 2.7% of the patients , respectively . fifty - three patients ( 72.6% ) continued treatment until eight cycles , while the other reasons for discontinuing treatment were adverse events in four patients , operation in four patients , cr in one patient , progression disease in two patients , and refusal or personal reasons in nine patients . treatment was delayed in 22 patients ( 30.1% ) with the delay being due to neutropenia in four patients ( 5.5% ) , thrombocytopenia in five , fatigue in three , diarrhea in two , psn in one , pneumonia in one , cholangitis in one , ileus in one , and personal reasons in two patients . twenty - three patients ( 31.5% ) required dose reduction at least once within eight cycles , with the reason being neutropenia in four and thrombocytopenia in five . three patients ( 4.1% ) developed hsr at five cycles , six cycles , and ten cycles . in all three cases , the reaction was cutaneous ( grade 1 erythema ) and it resolved within minutes or hours . the tumor response was assessed in 45 of the 73 patients because 28 patients received chemotherapy as part of adjuvant chemotherapy . the confirmed response rate was 64.4% ( 95% confidence interval [ ci ] 48.878.1 ; cr , 8.9% ; pr , 55.6% ; sd , 31.1% ; progressive disease [ pd ] , 4.4% ) , and disease control rate was achieved in 95.6% ( 95% ci 84.999.5 ) . grade 3 or higher hemotoxicity occurred in ten patients ( 13.7% ) , and ten patients ( 13.7% ) developed grade 3 or higher nonhematological toxicity . there were no other severe treatment - related adverse events and no deaths during treatment . the incidence of hsrs to oxaliplatin is varying from 10% to 23.8%.3,5,1417,2328 identifying patients at increased risk of oxaliplatin - induced hsrs is important and several studies have assessed risk factors , although with variable results.14,15,17,24,28 the mechanisms responsible for hyper sensitivity to oxaliplatin remain unclear.2932 however , it is likely that reactions to oxaliplatin are a type i , ige - mediated hypersensitivity , while hemolysis and thrombocytopenia represent type ii reactions and chronic urticaria , joint pain , and proteinuria are type iii reactions.14,15,17,24,28 a review of the literature found that hsrs usually develop after multiple infusions of oxaliplatin , which clearly show that repeated exposure to the drug is a prerequisite to the induction of an allergic immune response.33 in addition to the review , there have been several case reports describing hsrs to oxaliplatin.3436 kim et al17 reported that the antivascular epithelial growth factor monoclonal antibody bevacizumab was not associated with hsrs when administered with combination chemotherapy regimens . consistent with their results , we found no difference in the frequency of hsrs according to the presence or absence of bevacizumab . there have been various approaches used to avoid hsrs to platinum - based agents , including premedication with high - dose corticosteroid3739 desensitization procedures,40,41 and a slower infusion rate.40,42 at present , there is no standardized method for premedication to reduce the risk of oxaliplatin hypersensitivity . one study reported that premedication with a high - dose steroid ( dex 20 mg ) significantly lowered the occurrence of oxaliplatin hypersensitivity and the rate of withdrawal from chemotherapy compared with premedication with the standard dose of steroid ( dex 8 mg).37 therefore , an appropriate premedication steroid dose should be established for effective management of oxaliplatin hypersensitivity . as shown in table 3 , the findings of the avoid trial indicate that hsrs to oxaliplatin were low compared with other studies . the 95% ci is 0.9%11.5% and the expected hsrs and threshold hsrs were 4% and 12% , respectively . this has proven significantly that the hsrs incidence is less than 12% . this may be simply because of the higher dosage of dex , not because of the mixture ; however , a recent study reported that a lower dose of dex ( < 20 mg ) could be a positive risk factor.16 the change in ph caused by coinfusion of dex may be one of the reasons . histamine release was greatly influenced by ph;4346 however , in investigating this effect it is necessary to avoid extreme changes in ph because such changes also cause a direct release of histamine . the curve for histamine release in response to an antigen has a minimum at ph 6.26.5 . ph 7.4 , a small fraction ( maximally 0.7% ) of oxaliplatin will exist as the monodentate intermediate . however , it could rapidly react with endogenous compounds , resulting in a continuous conversion of oxaliplatin via the monodentate form.47 we have previously reported changes in ph at 0 , 1 , 2 , and 3 hours after adding dex ( 3.3 or 6.6 mg ) to 250 ml of infusion solution containing 135 mg / m oxaliplatin . the ph without dex was 4.78 , but increased to 6.90 and to 7.33 when dex 3.3 and 6.6 mg , respectively , was added to oxaliplatin.12 the ph did not exceed 7.4 even when dex was added to oxaliplatin . most of oxaliplatin does not appear to be degraded when administered in combination with dex.47 therefore , the ph change caused by the coinfusion of dex may reduce oxaliplatin - related hsrs . the xelox regimen with dex appears to be beneficial in the treatment of colorectal cancer , reducing the incidence of hsrs while maintaining an acceptable response rate . we performed a premedication with steroids and palonosetron before the coinfusion of dex and oxaliplatin . this trial is a single arm , but is the important trial that can lead to the next phase iii trial . this findings of the avoid trial suggest that the coinfusion of dex and oxaliplatin can reduce oxaliplatin - induced hsrs . this approach should be considered for all patients who receive oxaliplatin , allowing treatment to be completed as planned , in addition , we recommend our modified premedication regimen to reduce hsrs in clinical practice . however , phase iii prospective studies are warranted to confirm the safety and efficacy of this method .
backgroundpatients with colorectal cancer treated with oxaliplatin are at risk of hypersensitivity reactions , with the incidence estimated to be 12%20% . coinfusion of dexamethasone and oxaliplatin could potentially reduce the incidence of these reactions , but oxaliplatin is reported to be incompatible with alkaline compounds in solution . however , in a previous retrospective study we found that the ph of a solution of dexamethasone and oxaliplatin was less than 7.4 , and that hypersensitivity to oxaliplatin could have been prevented by coinfusion of dexamethasone . we aimed to evaluate the effectiveness of coinfusion of dexamethasone and oxaliplatin to prevent oxaliplatin - induced hypersensitivity reactions.patients and methodsthe avoid trial was a prospective , multicenter , open - label , single - arm phase ii trial conducted from january to september 2013 . the study included 73 patients who received capecitabine plus oxaliplatin ( xelox ) or xelox plus bevacizumab therapy for colorectal cancer . in all patients , oxaliplatin was administered in combination with dexamethasone . the primary outcome measure was the presence of hypersensitivity reactions.resultshypersensitivity reactions occurred in three patients ( 4.1% ) ; all three experienced a cutaneous reaction ( grade 1 erythema ) . none of the 73 patients developed respiratory symptoms , ocular symptoms , or anaphylaxis . grade 3 or higher hemotoxicity occurred in 13.7% of the patients and grade 3 or higher nonhematological toxicity occurred in 13.7% . the response rate to treatment was 64.4%.conclusionthe coinfusion of dexamethasone and oxaliplatin effectively reduced oxaliplatin - induced hypersensitivity reactions in patients with colorectal cancer . this approach should be considered for all patients treated with oxaliplatin , allowing treatment to be completed as planned .
in living organisms , communication between individual cells and between cells and the environment plays essential roles in various cellular processes including growth , differentiation , migration , and apoptosis.1 these cellular processes are mediated in large part by signaling pathways triggered by interactions between receptor tyrosine kinases ( rtks ) and their ligands.1 upon ligand binding , rtks on the cell surface activate downstream signaling cascades and regulate target gene expression in a paracrine or autocrine manner.1 these signaling pathways mediated by rtks and their ligands are critical for both regulation of diverse cellular processes and development and progression of cancers.24 rtk - mediated signaling pathways are tightly regulated according to the physiological status of normal cells . in contrast , rtk signaling pathways are dysregulated or hyperactivated in a wide range of cancers via gain - of - function mutations , gene rearrangements , gene amplifications , and overexpression or abnormal stimulation of receptors / ligands.14 furthermore , it has been suggested that loss - of - function by deletion or mutation of rtks , including fibroblast growth factor receptor 1 , epha , and c - met , is associated with several diseases , including cancers.57 thus , rtk - mediated signaling pathways have become promising therapeutic targets for treating cancer.24 individual rtk - mediated signaling cascades can be targeted at several levels to develop anti - cancer therapeutic agents that inhibit the signaling pathways via disruption of interactions between rtks and their ligands , dimerization and phosphorylation of rtks , and activation of downstream elements.2,4 for monoclonal antibody - based therapeutics , rtk - mediated signaling pathways are mainly inhibited by disrupting interactions between rtks and their ligands.4 compared with small - molecule compounds that inhibit the kinase activity and autophosphorylation of a broad spectrum of rtks , antibody inhibitors have greater target specificity for particular rtks and/or ligands . several antibody - based therapeutic agents that inhibit rtk - mediated signaling pathways have already been approved for the treatment of human cancers.4 trastuzumab ( herceptin , genentech / roche , south san francisco , ca , usa ; approved by the us food and drug administration [ fda ] in 1998 ) binds to human epidermal growth factor receptor 2 ( her2)/neu receptor and is used to treat breast cancer.8 bevacizumab ( avastin , genentech / roche ; approved by the fda in 2004 ) binds to vascular endothelial growth factor ( vegf ) and is used to treat colorectal cancer , metastatic renal cell carcinoma , recurrent glioblastoma , and non - small cell lung cancer ( nsclc).912 both cetuximab ( erbitux ; developed by bristol - myers squibb , new york , ny , usa / eli lilly , indianapolis , in , usa and merck kgaa , darmstadt , germany and approved in 2004 ) and panitumumab ( vectibix , developed by amgen ( thousand oaks , ca , usa ) and approved in 2006 ) bind to epidermal growth factor receptor ( egfr ) and are used to treat colorectal and head / neck cancers.13,14 ramucirumab ( cyramza , developed by eli lilly and approved in 2014 ) binds to vegf receptor 2 and is used to treat gastric cancer.15 although these fda - approved therapeutic antibodies have contributed to improving clinical outcomes , there are still unmet needs for difficult - to - treat cancers . identification of additional rtk / ligand targets may enable more effective treatment of these cancers.24 currently , a variety of novel antibody - based inhibitors targeting rtks such as c - met , fibroblast growth factor receptor , her1 , her3 , insulin - like growth factor-1 receptor , platelet - derived growth factor receptor , and ron ( recepteur dorigine nantais ) are in preclinical and clinical development.4 c - met , the rtk oncogene , was first cloned in 1984.16 the ligand of c - met , hepatocyte growth factor ( hgf ; also known as scatter factor ) was identified in 1991 as a potent mitogen / morphogen.17,18 the hgf / c - met signaling pathway has been demonstrated to play important roles in the development and progression of various cancers.1921 dysregulation and hyperactivation of hgf or c - met have been reported in human cancers and linked to poor prognosis.22,23 it has been suggested that the hgf / c - met signaling pathway may be a promising target for drugs designed to overcome development of resistance to inhibition of other ligand / rtk signaling pathways.1921 a large number of inhibitors of the hgf / c - met signaling pathway are under development to treat human cancers.1921 similar to other inhibitors of rtk - mediated signaling pathways , agents targeting hgf or c - met are categorized into two groups , ie , small - molecule drugs and biologics such as monoclonal antibodies.1921 currently , multiple therapeutic antibodies targeting the hgf / c - met signaling pathway are in preclinical or clinical development.24 in this review , we summarize the role of hgf and c - met in normal tissues and cancers . we then discuss the development of hgf / c - met signaling pathway inhibitors for cancer treatment , including critical issues in clinical development and future perspectives focusing on monoclonal antibody - based therapeutics . the hgf / c - met signaling pathway influences a variety of cellular functions to control diverse biological processes such as embryonic development , epithelial branching morphogenesis , postnatal organ regeneration , and wound healing ( figure 1).1921 hgf is a paracrine signaling molecule produced and secreted from mesenchymal cells to affect neighboring epithelial cells expressing c - met . protective roles of hgf have been reported in tissue fibrosis , liver cirrhosis , endothelial injury , and lung fibrosis.2529 hgf is produced as an inactive single - chain precursor that is processed to yield an active heterodimer of one alpha and one beta chain linked by a disulfide bond.30,31 c - met is also produced as a single - chain precursor and processed to yield a mature receptor composed of a glycosylated , extracellular alpha subunit disulfide - bonded to a transmembrane beta subunit.32 the extracellular portion of c - met is composed of a sema domain ( homologous to semaphorins ) , a cysteine - rich , met - related - sequence domain , and four immunoglobulin ( ig)-like modules ( igg domains ) responsible for binding hgf.32 the intracellular portion of c - met is composed of a juxtamembrane domain , a tyrosine kinase domain , and a c - terminal regulatory tail responsible for signal transduction.33 tyrosine residues tyr 1234 and tyr 1235 in the tyrosine kinase domain regulate the kinase activity of c - met , and tyrosine residues tyr 1349 and tyr 1356 in the c - terminal regulatory tail ( the multisubstrate docking site ) are important for recruitment of downstream adapters , including growth factor receptor - bound protein 2 ( grb2 ) protein and grb2-associated binding protein 1 ( gab1 ) ( figure 1).34,35 hgf / c - met signaling through these downstream effectors stimulates diverse cellular processes such as cell proliferation , differentiation , migration , invasion , and survival ( figure 1).1921 mice lacking either hgf or c - met exhibit embryonic lethality due to incomplete liver development.36,37 in addition , loss of hgf signaling in mice decreases proliferation of gastric mucosal cells and delays recovery from mucosal injury.38 depletion of c - met in cancer cells results in the inhibition of cell proliferation , invasion , and survival , suggesting an essential role of c - met in the development , progression , and invasion of cancers.3942 in addition to the developmental roles described above , the hgf / c - met signaling pathway is highly activated in human cancers via overexpression , amplification , or mutation , and promotes development , progression , invasive growth , and metastasis of cancers.43 abnormal expression of hgf and c - met has been reported in various solid tumors , including breast , colon , lung , ovary , kidney , and liver cancers ( table 1).44,45 hgf secretion from tumor stromal cells has been correlated with overexpression of c - met . overexpression of hgf / c - met has been reported in breast , colon , lung , ovarian , and renal cancer.44,45 hgf / c - met over - expression has also been correlated with metastasis and poor survival in hepatocellular carcinoma , renal cell carcinoma , and breast cancer.4650 both germline and somatic mutations in c - met have been reported in various cancers . these mutations increase tumorigenic potential via constitutive activation of the c - met receptor.51 the mutations are found in the tyrosine kinase domain , juxtamembrane domain , and extracellular domain of c - met . the activating mutations in the tyrosine kinase domain of c - met induce different downstream cascades and biological processes . d1228h / n and m1250 t mutations increase c - met phosphorylation and ras activation , while l1195v and y1230c mutations activate phosphatidylinositol-4 , 5-bisphosphate 3-kinase to promote invasive and anchorage - independent growth.52 amplification of c - met receptor and overexpression of hgf are associated with resistance to inhibitors targeting other rtks . amplification of c - met activates erbb3 ( her3)-dependent phosphatidylinositol-4,5-bisphosphate 3-kinase signaling , leading to resistance to gefitinib ( a small - molecule inhibitor of egfr ) in lung cancer.53 in addition , hgf is involved in decreased susceptibility to irreversible egfr tyrosine kinase inhibition in lung cancer with the egfr t790 m mutation.54 similarly , amplification of c - met is involved in resistance to the anti - egfr monoclonal antibodies , cetuximab and panitumumab , in metastatic colorectal cancer.55 recent studies have demonstrated that the copy number of hgf and met genes correlates with sensitivity to treatment with trastuzumab in her2-positive metastatic breast cancer . an increased copy number for the met gene has been linked to a higher failure rate of trastuzumab treatment and to a shorter time to progression , which means the length of time from the date of diagnosis or the start of treatment for a breast cancer patient until the breast cancer starts to get worse or spreads to other parts of the body . increased copy number for the hgf gene is also linked to a higher failure rate of trastuzumab treatment.56 these studies on mutation and amplification of hgf and met genes provide important information for the development of therapeutic agents targeting the hgf / c - met signaling pathway.57,58 these results indicate that the c - met receptor , together with other rtk signaling pathways such as erbb3 ( her3 ) , egfr , and erbb2 ( her2 ) , has a synergic role in tumor progression in certain types of cancers . therefore , combination therapy targeting both c - met and other rtks may be more effective for cancer treatment compared with monotherapy . inhibitors of the hgf / c - met signaling pathway are divided into two groups : while small - molecule compounds block the signaling pathway by inhibiting tyrosine kinase activity and autophosphorylation of c - met , biologics including truncated hgf , n - terminal sema domain of hgf , soluble extracellular domain of c - met ( decoy met ) , and antibodies against hgf and c - met suppress the signaling pathway by inhibiting interactions between hgf and c - met . compared with small - molecule compounds that often target multiple rtks multiple therapeutic antibodies targeting the hgf / c - met signaling pathway are currently in preclinical and clinical development ( table 2 ) . rilotumumab ( amg102 , amgen ) is a human monoclonal antibody against hgf that blocks interactions between hgf and its receptor c - met , thereby inhibiting cellular processes driven by the hgf / c - met signaling pathway.59 in a phase ii clinical trial in gastric and esophagogastric junction cancers , rilotumumab in combination with epirubicin , cisplatin , and capecitabine ( ecx ) has been shown to improve both progression - free survival and overall survival in patients with tumors expressing high levels of c - met.60,61 in this study , patients were given placebo or rilotumumab at 15 mg / kg or 7.5 mg / kg on day 1 in addition to ecx ( 50 mg / m epirubicin and 60 mg / m cisplatin on day 1 , and 625 mg / m capecitabine twice a day on days 121 ) every 3 weeks . median progression - free survival was 5.1 months for patients treated with rilotumumab 15 mg / kg and 6.8 months for patients treated with rilotumumab 7.5 mg / kg , compared with 4.2 months for the placebo group . objective response rates reported for patients treated with rilotumumab 15 mg / kg , rilotumumab 7.5 mg / kg and placebo were 31% , 48% , and 21% , respectively . median overall survival times for patients treated with rilotumumab 15 mg / kg , rilotumumab 7.5 mg / kg , and placebo were 9.7 , 11.1 , and 8.9 months , respectively . adverse events , including hematologic adverse events , peripheral edema , and venous thromboembolism , were reported for both the placebo and rilotumumab groups , but were more common in the rilotumumab group . based on the safety profile and results indicating better efficacy of rilotumumab in combination with ecx , a phase iii study is ongoing in c - met - positive gastric and gastroesophageal junction cancers ( rilomet-1).61 the efficacy of rilotumumab has also been demonstrated in metastatic colorectal cancer with wild - type kras . in a phase ii clinical trial of rilotumumab in combination with panitumumab ( a fully human anti - egfr monoclonal antibody ) , the median progression - free survival was 5.2 months for the combination treatment and 3.7 months for treatment with panitumumab alone.62 ficlatuzumab ( av-299 ; sch 900105 , aveo pharmaceuticals , cambridge , ma , usa ) is a humanized monoclonal antibody against hgf that inhibits the hgf - induced c - met signaling pathway by neutralizing hgf / c - met binding.63 preclinical studies carried out in the h596 nsclc xenograft model have demonstrated increased anti - cancer activity of ficlatuzumab in combination with an egfr inhibitor ( erlotinib or cetuximab ) compared with single agents.64 in a phase i study of advanced solid tumors including sarcoma , ovarian cancer , mesothelioma , and glioblastoma multiforme , ficlatuzumab was intravenously administered at 2 , 5 , 10 , or 20 mg / kg once every 2 weeks . at the recommended phase ii dose , ficlatuzumab was administered in combination with erlotinib ( 150 mg / day ) . adverse events including fatigue , peripheral edema , headache , hematologic problems , and pruritus have been reported in the monotherapy group , and common adverse events of rash and diarrhea have been reported in the combination therapy group . from the phase i study , it has been demonstrated that the selected dose of ficlatuzumab is safe and well tolerated when used in combination with erlotinib at the standard dose.65,66 this was followed by a randomized phase ii study with gefitinib alone or in combination with ficlatuzumab to treat nsclc patients.67 tak-701 ( galaxy biotech ) is a humanized monoclonal antibody that binds to hgf with high affinity.68 combination treatment with tak-701 and gefitinib ( a small - molecule inhibitor of egfr ) inhibits the phosphorylation of both c - met and egfr and downstream signaling cascades in hcc827-hgf tumor cells ( engineered human nsclc cells that contain an activating egfr mutation and stably express hgf).68 combination treatment with tak-701 and gefitinib also markedly inhibits tumor growth in hcc827-hgf xenograft models.68 these results suggest that combination treatment with tak-701 and gefitinib may provide a means of overcoming resistance to egfr - tyrosine kinase inhibitor therapy in hgf - induced nsclc . phase i studies are ongoing for tak-701 as a single - agent treatment for advanced solid tumors . onartuzumab ( metmab , genentech ) is a humanized , monovalent monoclonal antibody against c - met . onartuzumab was developed with the knob - into - hole technology , which allows one - to - one interaction between the antibody and the receptor.69 onartuzumab potently inhibits binding of hgf , phosphorylation of c - met , and downstream signaling in the hgf / c - met pathway with antibody - like pharmacokinetics . strong anticancer activity has been reported for onartuzumab in preclinical xenograft studies.69 activated hgf / c - met signaling has been associated with a poor prognosis and with resistance to egfr inhibitors in nsclc . in a phase ii study , prolonged progression - free survival ( 2.9 months versus 1.5 months ) and overall survival ( 12.6 months versus 3.8 months ) have been reported in c - met - positive patients treated with erlotinib and onartuzumab compared with patients treated with erlotinib alone.70 however , in a randomized phase iii trial , combination therapy with onartuzumab and erlotinib failed to confirm the efficacy demonstrated in the phase ii study , as no improvement in overall survival ( 6.8 months versus 9.1 months ) or progression - free survival ( 2.7 months versus 2.6 months ) was observed in c - met - positive patients.71 despite the failure of the phase iii trial , genentech has continued to develop onartuzumab in two additional phase iii trials in different subgroups of nsclc , ie , c - met - positive stage iiib or iv nsclc with activating egfr mutation . subgroup analyses may provide a means of targeting patients more selectively.72 another phase iii clinical trial is ongoing in gastric cancer for evaluation of the efficacy and safety of onartuzumab . in this study , onartuzumab is administered in combination with 5-fluorouracil , folinic acid , and oxaliplatin ( mfolfox6 ) to treat metastatic her2-negative and c - met - positive gastroesophageal cancer.72 emibetuzumab ( ly-2875358 , eli lilly ) is a humanized , bivalent anti - c - met antibody that inhibits both ligand - dependent and ligand - independent activation of c - met.73 in the case of hgf - dependent c - met activation , emibetuzumab inhibits hgf binding to c - met , c - met phosphorylation , and tumor growth both in vitro and in vivo , similar to a humanized , one - armed 5d5 anti - c - met antibody ( precursor of onartuzumab ) . in the case of hgf - independent c - met activation by met gene amplification in tumors decreases in phosphorylated and total c - met after treatment with emibetuzumab induces inhibition of cell proliferation and tumor growth in the gastric cancer cell lines , mkn-45 and snu-5 , and in the nsclc cell lines , ebc-1 and h1993 . however , the one - armed 5d5 antibody has exhibited no anti - tumor activity in the case of hgf - independent c - met activation.73 in a phase i study , treatment with emibetuzumab alone or in combination with erlotinib resulted in a durable partial response in nsclc and was also shown to be safe and well tolerated . based on the pharmacokinetic / pharmacodynamic data , the recommended phase ii dose of emibetuzumab for intravenous administration is 750 mg once every 2 weeks as a single agent or in combination with erlotinib.74 argx-111 ( argen - x ) is a defucosylated antagonistic anti - c - met antibody with potent anti - cancer activity based on enhanced antibody - dependent cellular cytotoxicity . a phase ib study was initiated in january 2014 to evaluate argx-111 in advanced cancers with c - met overexpression.75 em1-mab ( genmab , janssen research and development , san diego , ca , usa ) is a bispecific anti - egfr / c - met antibody that inhibits both egfr and c - met signaling pathways . em1-mab has exhibited more potent inhibition of downstream signaling cascades compared with the combination of monospecific antibodies.76 rilotumumab ( amg102 , amgen ) is a human monoclonal antibody against hgf that blocks interactions between hgf and its receptor c - met , thereby inhibiting cellular processes driven by the hgf / c - met signaling pathway.59 in a phase ii clinical trial in gastric and esophagogastric junction cancers , rilotumumab in combination with epirubicin , cisplatin , and capecitabine ( ecx ) has been shown to improve both progression - free survival and overall survival in patients with tumors expressing high levels of c - met.60,61 in this study , patients were given placebo or rilotumumab at 15 mg / kg or 7.5 mg / kg on day 1 in addition to ecx ( 50 mg / m epirubicin and 60 mg / m cisplatin on day 1 , and 625 mg / m capecitabine twice a day on days 121 ) every 3 weeks . median progression - free survival was 5.1 months for patients treated with rilotumumab 15 mg / kg and 6.8 months for patients treated with rilotumumab 7.5 mg / kg , compared with 4.2 months for the placebo group . objective response rates reported for patients treated with rilotumumab 15 mg / kg , rilotumumab 7.5 mg / kg and placebo were 31% , 48% , and 21% , respectively . median overall survival times for patients treated with rilotumumab 15 mg / kg , rilotumumab 7.5 mg / kg , and placebo were 9.7 , 11.1 , and 8.9 months , respectively . adverse events , including hematologic adverse events , peripheral edema , and venous thromboembolism , were reported for both the placebo and rilotumumab groups , but were more common in the rilotumumab group . based on the safety profile and results indicating better efficacy of rilotumumab in combination with ecx , a phase iii study is ongoing in c - met - positive gastric and gastroesophageal junction cancers ( rilomet-1).61 the efficacy of rilotumumab has also been demonstrated in metastatic colorectal cancer with wild - type kras . in a phase ii clinical trial of rilotumumab in combination with panitumumab ( a fully human anti - egfr monoclonal antibody ) , the median progression - free survival was 5.2 months for the combination treatment and 3.7 months for treatment with panitumumab alone.62 ficlatuzumab ( av-299 ; sch 900105 , aveo pharmaceuticals , cambridge , ma , usa ) is a humanized monoclonal antibody against hgf that inhibits the hgf - induced c - met signaling pathway by neutralizing hgf / c - met binding.63 preclinical studies carried out in the h596 nsclc xenograft model have demonstrated increased anti - cancer activity of ficlatuzumab in combination with an egfr inhibitor ( erlotinib or cetuximab ) compared with single agents.64 in a phase i study of advanced solid tumors including sarcoma , ovarian cancer , mesothelioma , and glioblastoma multiforme , ficlatuzumab was intravenously administered at 2 , 5 , 10 , or 20 mg / kg once every 2 weeks . at the recommended phase ii dose , ficlatuzumab was administered in combination with erlotinib ( 150 mg / day ) . adverse events including fatigue , peripheral edema , headache , hematologic problems , and pruritus have been reported in the monotherapy group , and common adverse events of rash and diarrhea have been reported in the combination therapy group . from the phase i study , it has been demonstrated that the selected dose of ficlatuzumab is safe and well tolerated when used in combination with erlotinib at the standard dose.65,66 this was followed by a randomized phase ii study with gefitinib alone or in combination with ficlatuzumab to treat nsclc patients.67 tak-701 ( galaxy biotech ) is a humanized monoclonal antibody that binds to hgf with high affinity.68 combination treatment with tak-701 and gefitinib ( a small - molecule inhibitor of egfr ) inhibits the phosphorylation of both c - met and egfr and downstream signaling cascades in hcc827-hgf tumor cells ( engineered human nsclc cells that contain an activating egfr mutation and stably express hgf).68 combination treatment with tak-701 and gefitinib also markedly inhibits tumor growth in hcc827-hgf xenograft models.68 these results suggest that combination treatment with tak-701 and gefitinib may provide a means of overcoming resistance to egfr - tyrosine kinase inhibitor therapy in hgf - induced nsclc . phase i studies are ongoing for tak-701 as a single - agent treatment for advanced solid tumors . onartuzumab ( metmab , genentech ) is a humanized , monovalent monoclonal antibody against c - met . onartuzumab was developed with the knob - into - hole technology , which allows one - to - one interaction between the antibody and the receptor.69 onartuzumab potently inhibits binding of hgf , phosphorylation of c - met , and downstream signaling in the hgf / c - met pathway with antibody - like pharmacokinetics . strong anticancer activity has been reported for onartuzumab in preclinical xenograft studies.69 activated hgf / c - met signaling has been associated with a poor prognosis and with resistance to egfr inhibitors in nsclc . in a phase ii study , prolonged progression - free survival ( 2.9 months versus 1.5 months ) and overall survival ( 12.6 months versus 3.8 months ) have been reported in c - met - positive patients treated with erlotinib and onartuzumab compared with patients treated with erlotinib alone.70 however , in a randomized phase iii trial , combination therapy with onartuzumab and erlotinib failed to confirm the efficacy demonstrated in the phase ii study , as no improvement in overall survival ( 6.8 months versus 9.1 months ) or progression - free survival ( 2.7 months versus 2.6 months ) was observed in c - met - positive patients.71 despite the failure of the phase iii trial , genentech has continued to develop onartuzumab in two additional phase iii trials in different subgroups of nsclc , ie , c - met - positive stage iiib or iv nsclc with activating egfr mutation . subgroup analyses may provide a means of targeting patients more selectively.72 another phase iii clinical trial is ongoing in gastric cancer for evaluation of the efficacy and safety of onartuzumab . in this study , onartuzumab is administered in combination with 5-fluorouracil , folinic acid , and oxaliplatin ( mfolfox6 ) to treat metastatic her2-negative and c - met - positive gastroesophageal cancer.72 emibetuzumab ( ly-2875358 , eli lilly ) is a humanized , bivalent anti - c - met antibody that inhibits both ligand - dependent and ligand - independent activation of c - met.73 in the case of hgf - dependent c - met activation , emibetuzumab inhibits hgf binding to c - met , c - met phosphorylation , and tumor growth both in vitro and in vivo , similar to a humanized , one - armed 5d5 anti - c - met antibody ( precursor of onartuzumab ) . in the case of hgf - independent c - met activation by met gene amplification in tumors decreases in phosphorylated and total c - met after treatment with emibetuzumab induces inhibition of cell proliferation and tumor growth in the gastric cancer cell lines , mkn-45 and snu-5 , and in the nsclc cell lines , ebc-1 and h1993 . however , the one - armed 5d5 antibody has exhibited no anti - tumor activity in the case of hgf - independent c - met activation.73 in a phase i study , treatment with emibetuzumab alone or in combination with erlotinib resulted in a durable partial response in nsclc and was also shown to be safe and well tolerated . based on the pharmacokinetic / pharmacodynamic data , the recommended phase ii dose of emibetuzumab for intravenous administration is 750 mg once every 2 weeks as a single agent or in combination with erlotinib.74 argx-111 ( argen - x ) is a defucosylated antagonistic anti - c - met antibody with potent anti - cancer activity based on enhanced antibody - dependent cellular cytotoxicity . a phase ib study was initiated in january 2014 to evaluate argx-111 in advanced cancers with c - met overexpression.75 em1-mab ( genmab , janssen research and development , san diego , ca , usa ) is a bispecific anti - egfr / c - met antibody that inhibits both egfr and c - met signaling pathways . em1-mab has exhibited more potent inhibition of downstream signaling cascades compared with the combination of monospecific antibodies.76 several antibody - based inhibitors of the hgf / c - met signaling pathway are under active preclinical / clinical development as novel therapeutic agents to treat cancers . there are important aspects of hgf / c - met biology that need to be carefully addressed for successful development of these therapeutic antibodies targeting the hgf / c - met signaling pathway . these include unwanted activation of c - met by bivalent anti - c - met antibodies and the recent failure of the phase iii study of onartuzumab in combination with erlotinib in nsclc . a monovalent antibody , onartuzumab ( metmab ) , was designed to address issues reported for several bivalent anti - c - met reagents that induce unwanted stimulation of the c - met signaling by mimicking c - met dimerization.69,77 onartuzumab , the one - armed humanized antibody against c - met , blocks the interaction between the hgf- chain and the sema domain ( homologous to semaphorins ) of the c - met receptor , demonstrated by crystallographic , structural , and biochemical analysis.69 however , despite concerns regarding c - met activation by bivalent anti - c - met antibodies and the development of the one - armed antibody , onartuzumab , clinical trials are still ongoing for two bivalent antibodies against c - met ( emibetuzumab and argx-111).74,75 more important aspects to consider for the development of hgf / c - met inhibitors include patient stratification and identification of effective combinations of inhibitors targeting the hgf / c - met pathway along with other interacting signaling pathways such as the egfr pathway . since alterations in hgf / c - met signaling are closely related to tumorigenesis , tumor progression , and metastasis , it is critical to more accurately detect c - met expression levels and alterations . in the phase ii study of onartuzumab in nsclc , it has been demonstrated that the intensity of c - met labeling detected via immunohistochemistry can successfully identify target patient groups for treatment.70 immunohistochemistry - based detection of c - met expression levels was also important for patient stratification in the phase i and ii trials of rilotumumab.61,62 however , the same strategy has failed to meet the initial goal in the phase iii study of onartuzumab in combination with erlotinib in nsclc , possibly resulting from the recruitment of nonspecific patient groups rather than from ineffectiveness of the antibodies.71,72 in addition to immunohistochemistry , different detection methods and other specific targets have also been examined . elevated c - met expression levels have been detected via western blotting of serum proteins from patients with hepatocellular carcinoma and tissues from patients with colorectal cancer and metastasis to the liver.78,79 phosphorylated c - met ( the active form of c - met ) has been intensively examined in preclinical and clinical studies and via in silico modeling . antibodies that specifically recognize phosphorylated c - met can be used to detect this pharmacodynamic biomarker.8082 in addition to the development of better detection methods and detecting antibodies , well defined scoring systems and minimization of interobserver differences are all required for effective patient diagnosis and stratification . although no significant correlation between a high met gene copy number and patient response to onartuzumab has been reported from clinical trials , results from both preclinical and clinical studies with small - molecule inhibitors have demonstrated a correlation between a high copy number or specific mutation of met gene and increased clinical response.8385 due to the association between met gene amplification / mutation and poor clinical outcomes , various technologies including next - generation sequencing are under development.86 as reported from studies in nsclc , inhibitors of the hgf / c - met pathway may become more potent when combined with antagonists of other signaling pathways . most clinical trials with anti - c - met monoclonal antibodies were designed in combination with chemical inhibitors of other signaling pathways . clinical trials of onartuzumab were conducted in combination with erlotinib , an egfr inhibitor , to overcome egfr - mediated resistance.70,71 synergistic effects of dual inhibition of the hgf / c - met and vegf signaling pathways have been reported in preclinical studies , suggesting that combination of hgf / c - met and vegf / vegfr inhibition may allow more effective treatment of human cancers.8789 the efficacy of onartuzumab and rilotumumab are being evaluated in combination with bevacizumab or panitumumab in the clinical settings of glioblastoma multiforme and metastatic colorectal cancer.86 successful clinical development of candidates requires a better understanding of the interactions between signaling pathways . the use of two or more therapeutic agents in combination should be carefully designed because this combination treatment may elevate the risk of adverse effects and increase the treatment cost . results from clinical studies reflect the highly complex nature of hgf / c - met signaling in human cancers and suggest that successful development of antibody - based therapeutics targeting the hgf / c - met signaling pathway requires a better understanding of the pathways involved in the diseases , along with more careful analyses of the clinical data . studies carried out over the past two decades have demonstrated that the hgf / c - met signaling pathway is a promising therapeutic target for treating cancers . therapeutic agents designed to target hgf / c - met - mediated signaling cascades have been developed and evaluated in preclinical and clinical studies . in clinical trials in lung , gastric , prostate and renal cancers , inhibitors of the hgf / c - met signaling pathway have yielded promising results . like inhibitors of other rtk signaling pathways , inhibitors of the hgf / c - met signaling pathway are divided into two groups , ie , small - molecule compounds suppressing the tyrosine kinase activity of c - met and biologics such as monoclonal antibodies that specifically bind to hgf or c - met . among the therapeutic agents targeting hgf or c - met , a small - molecule inhibitor , cabozantinib ( xl184 , exelixis , south san francisco , ca , usa ) became the first agent approved by the fda for the clinical treatment of progressive metastatic medullary thyroid cancer ( in november 2012 ) . in addition , several small - molecule inhibitors of c - met , including tivantinib ( arq 197 , arqule , woburn , ma , usa ) , golvatinib ( e7050 , eisai , tokyo , japan ) , and foretinib ( gsk 1363089 , glaxosmithkline , brentford , uk ) are currently being evaluated in clinical studies for treatment of hepatocellular carcinoma.90 in contrast with the success of cabozantinib , an antibody - based inhibitor of c - met , onartuzumab failed to improve the clinical benefit in a recent phase iii study in nsclc . however , the failure in this phase iii trial suggests several key issues to consider for successful clinical development of antibody - based hgf or c - met inhibitors . challenges to face for effective clinical application of hgf / c - met - targeted therapeutics include advances in analytical methods to identify specific patient groups , more careful selection of target populations , development of biomarkers for hgf / c - met signaling , and identification of effective combination therapies with other rtk inhibitors .
signaling pathways mediated by receptor tyrosine kinases ( rtks ) and their ligands play important roles in the development and progression of human cancers , which makes rtk - mediated signaling pathways promising therapeutic targets in the treatment of cancer . compared with small - molecule compounds , antibody - based therapeutics can more specifically recognize and bind to ligands and rtks . several antibody inhibitors of rtk - mediated signaling pathways , such as human epidermal growth factor receptor 2 , vascular endothelial growth factor , epidermal growth factor receptor or vascular endothelial growth factor receptor 2 , have been developed and are widely used to treat cancer patients . however , since the therapeutic options are still limited in terms of therapeutic efficacy and types of cancers that can be treated , efforts are being made to identify and evaluate novel rtk - mediated signaling pathways as targets for more efficacious cancer treatment . the hepatocyte growth factor / c - met signaling pathway has come into the spotlight as a promising target for development of potent cancer therapeutic agents . multiple antibody - based therapeutics targeting hepatocyte growth factor or c - met are currently in preclinical or clinical development . this review focuses on the development of inhibitors of the hepatocyte growth factor / c - met signaling pathway for cancer treatment , including critical issues in clinical development and future perspectives for antibody - based therapeutics .
interpreting the clinical significance of genomic information depends on broad access to dna sequence variants and clinical information about those tested . some proprietary genetic test providers have developed privately controlled databases containing information essential to interpreting the results of their tests . this is exemplified by brca1/2 testing by myriad genetics ( salt lake city , ut , usa ) in the united states . as the provider of bracanalysis , the sole brca1/2 diagnostic test commercially available in the united states and one of the most commercially successful genetic tests worldwide , myriad genetics serves as an excellent case study of the importance of collecting clinical data and the implications of keeping those data private . myriad notes that nearly one million patients have had brca testing , and it has payment agreements with 2500 insurers or payers . its status as the sole commercial provider of brca testing in the united states is a consequence of its exclusive us patent rights . in 1994 , scientists , some of whom were affiliated with myriad , discovered brca1 , which when mutated results in pronounced predisposition to breast , ovarian and certain other cancers . it became the sole commercial testing service for brca1/2 in the united states by asserting its patents and clearing the market of us competitors , generating over $ 105 million from its bracanalysis test in the second quarter for calendar year 2012 . it runs a highly efficient laboratory , has developed a network of health professionals who use its services , has secured agreements with hundreds of payers , has brand recognition based in part on direct - to - consumer advertising , and has a trained sales force . although those advantages should abide any change in patent status or data access policies , myriad 's entry into europe , projected for later this year , presents an opportunity to implement policies on access to brca mutation data that can set a salutary precedent not only for brca but for genetic testing in general , including whole - genome analysis . most patients who get brca testing have results that can be interpreted in a relatively straightforward manner either no variations from wild type ' , harmless sequence variations or a clearly deleterious mutation . such results are valuable to those tested and to their providers , influencing decisions about treatment options , including prophylactic surgery or close monitoring and medical management . mutations that clearly disrupt protein function ( e.g. , through a small insertion or deletion that results in a frame shift ) are generally obvious upon inspection . in a significant minority of tests , however , sequence differences from wild type are difficult to interpret missense mutations that substitute one amino acid for another or changes near intron exon boundaries can be particularly difficult to interpret . myriad claims that the fraction of cases resulting in a vus is 3% in its hands , and 20% for most european brca - testing services . this discrepancy is at least in part due to myriad having sole possession of the information needed to interpret vus results . myriad has obtained this exclusivity by using its status as the sole brca1/2 test provider to develop , at its own cost , an extensive database that relates variants of uncertain significance to phenotype , details their frequency in various populations and includes genetic studies on patient families . thus , myriad 's proprietary database that contains information about variants , which is not found in public databases , is probably the major factor in explaining the company 's ability to interpret vus results more successfully than others . to its credit and the benefit of patients , myriad has used its database to reduce the frequency with which it reports a vus . when myriad finds a new vus or one previously identified but whose clinical significance is not yet understood it offers free testing to the patient 's family members ( something that not all genetic testing laboratories do ) in an effort to help determine the variant 's significance . myriad encourages the person with the vus to contact others in their family , providing a model letter that patients can send their relatives . myriad collects data regarding the clinical outcome associated with that vus , and a vus may ultimately be reclassified as deleterious or neutral as more is learned ; conversely , deleterious or neutral mutations are occasionally reclassified as vuss . myriad has access to public databases in interpreting mutations , but outsiders do not have access to myriad 's database . this asymmetry has clinical impact : a woman might be able to receive brca testing from another laboratory in malawi or malta , where myriad 's brca patent rights are not in force and testing is perfectly legal , but that laboratory will have no access to myriad 's data and will thus be unable to interpret many vus results . but the fact that the inequity is based on the availability of basic scientific and medical information , rather than of a drug or product , changes the policy context , prompting a debate about keeping clinically relevant data proprietary when that secrecy makes independent verification of its medical significance impossible . in an environment in which new technologies , including whole - genome and whole - exome sequencing , are already beginning to change clinical practices in genetic testing , a proprietary database gives myriad indefinite exclusivity independent of patent protection . even if myriad 's patents are invalidated ( for a summary of the ongoing court challenge , see supplementary materials ) , or new alternative testing technologies do not infringe them , until the data and interpretive algorithms are re - created in publicly accessible form , competing services will be able to manage vus results in only two ways : by having samples analyzed at myriad , where it is interpreted in light of myriad 's proprietary database , or by rendering inadequate interpretations based upon incomplete public data and algorithms . the former perpetuates myriad 's exclusivity even after the expiration of its patent rights , while the latter is unacceptable from a clinical perspective . in either case , myriad contributed data to public databases until late 2004 , but since then its contributions have essentially stopped . its last major deposit of data to the breast cancer information core ( bic , the largest database for brca mutations , maintained by the national human genome research institute ) was in november 2004 . myriad officials explained to one of us ( rc - d ) that the decision not to share data was initially because of difficulties in matching data formats , but that after 2005 , the company adopted a deliberate policy of retaining data as a trade secret . myriad has published some articles on vus data since november 2004 when its public data - sharing stopped . investigators with access to the myriad database through 2006 , did the most extensive analysis of vus , reporting 18 deleterious and 100 neutral variants out of 1433 variants they studied . those 118 sequence variants of known significance are now in the public literature . more than 1200 variants are mentioned in that publication , but the sequences are not listed , and the interpretive algorithms are not specified in detail or deposited where others can use them to interpret the data . thus , myriad 's general approach to calling ' vus results is described , but neither analytic algorithms nor underlying sequence data are available . this contrasts with recommendations of the national academies in two reports that call for depositing data and methods sufficient for replication and interpretation . myriad 's exclusive us testing rights and its pursuit of cases of vus have enabled it to accumulate data that confer a proprietary advantage in brca test interpretation worldwide . some will surely point to this as a legitimate benefit bestowed by the patent system , part of myriad 's just reward for innovating . patents gave myriad exclusive access to those seeking genetic testing , which enabled myriad , in turn , to produce a valuable database . others , however , are likely to consider the withholding of unpatented patient data to hinder rather than to promote the progress of science and useful arts , ' the constitutional mandate upon which the us patent system is founded . arguments that focus on rewarding innovation , moreover , must also take into account that much of the work that led to the isolation of brca1/2 was done with public or nonprofit funding . the practical effect of retaining such data as a trade secret is to extend myriad 's testing monopoly beyond the life of the patents on which it was founded . whole genome analysis stands poised to have a major impact on medical care if it can be harnessed appropriately . but the biggest challenge to its implementation is properly interpreting the variants found upon analyzing any individual 's genome . as whole - genome and whole - exome sequencing become commonplace , the rate of truly novel mutations will eventually decline . for the foreseeable future , however , each individual whose genome is sequenced will have vast numbers of variants of uncertain clinical significance . comprehensive databases such as the human gene mutation database in cardiff , mutadatabase , the human variome project database , the leiden open variation database , and other public databases will be essential resources for tracking and interpreting vus data . those databases depend , however , on sharing sufficient information to make genotype phenotype correlations . myriad , prevention genetics and medical neurogenetics are the only three laboratories not agreeing to contribute data on human genetic variants to mutadatabase , in contrast to over 100 services that have agreed to contribute mutation data ( including genedx , quest / athena , labcorp and other large commercial testing services ) . the evidence - based network for the interpretation of mutant germline alleles ( enigma ) was funded as a us national institutes of health challenge grant in 2009 to focus on interpreting vus results from brca genes in the public domain . it draws from databases and colleagues around the world to apply bioinformatic and laboratory biological methods to improve vus interpretation . enigma has access to data in myriad 's database through 2006 , but not from the past 5 years . the objective of these databases and research consortia is to accumulate data and to refine interpretive methods to create a publicly available foundation for improving clinical interpretation of genetic testing . as these public resources accumulate data , the value of proprietary databases will eventually erode , but in the meantime clinicians will be ordering and health plans will be paying for many genetic results that can not be accurately interpreted based on publicly available information . to deal with this conundrum , one set of policy options involves leveraging the influence of scientific journals and organizations by applying existing disclosure standards . medical journals and scholars have legitimate claims on data and methods for clinical interpretation of mutations . the 2003 national academies report on publication of genomic data recommended that authors should include in their publications the data , algorithms or other information that is central or integral to the publication that is , whatever is necessary to support the major claims of the paper and would enable one skilled in the art to verify or replicate the claims ' . the uniform requirements for submission of manuscripts to medical journals mandates that authors identify the methods and procedures in sufficient detail to allow others to reproduce the results ' . the importance of replicability and objective , independent access to data and algorithms was reiterated in the march 2012 report from the institute of medicine ( iom ) , which recommended that data and metadata used for development of the candidate omics - based test should be made available in an independently managed database ' . iom also recommended that computer code and computational methods be fully shared , either through a public database , publication or in the process of regulatory review . these criteria imply a norm of access to data and analytical methods sufficient to make clinical inferences about vus results . leveraging publication standards some journals already require public deposit of data sufficient to independently interpret reported mutations . but as noted above , myriad 's publications gave the sequences of only 118 of more than 1400 mutations studied , and did not include the interpretive algorithms . publication guidelines , moreover , apply only when the benefits of publication are sought ; they obviously do not apply to unpublished vus data . as a related option , databases listing mutations or availability of genetic tests ( e.g. , the nih 's nascent genetic testing registry ) could mandate test providers share sequence data and interpretive algorithms as a condition of listing their tests . in addition , physicians receiving results , or the organizations that collectively represent them , could also demand access to underlying data and algorithms . for example , standards for reporting such results could be established by the european society for human genetics or international scientific and medical organizations . payers currently reimburse bundled genetic tests and interpretive services . in cases when interpretation can not be independently verified , payers would be on firm ground to request or demand the evidence underlying the clinical determinations . national health systems , insurers and regulators have several policy tools at their disposal to ensure independent validation of clinical inferences about genomic variants . first , they could ask testing firms to voluntarily adopt policies to share mutation data publicly . second , payers could refuse payment unless clinically relevant data are shared and subject to independent verification for both accuracy and validity of interpretation . this option further bifurcates into ( 1 ) disclosure only to payers or providers , or ( 2 ) full public disclosure . that is , if payers mandated data access , disclosure could be limited to regulatory authorities or to those making coverage and payment decisions . alternatively , payers could require as a condition of payment deposit of data and interpretive algorithms into public databases to enable open and independent evaluation , building on the iom recommendations . similarly , national authorities that regulate genomic tests could mandate public disclosure as a condition of pre - market approval . third , national and international institutions could fund research to re - create the data in proprietary databases by ensuring that results of genetic analysis get incorporated into large databases . such an option , although redundant and thus expensive , might be accomplished through electronic health records that include genomic as well as clinical data , or by building out from consortia such as enigma that have been established for just this purpose to collect data and develop analytical methods as a public research and clinical resource . fourth , national health systems could craft payment policies to create incentives for disclosure of data needed to interpret genetic tests for example , establishing payment codes for public deposit and interpretation of genomic data , in addition to performing the test itself thus rewarding firms that disclose valuable data . current practices of proprietary databases may hinder interpretation of genomic data and impede the advance of personalized medicine . policies to reward or require data sharing can prevent some foreseeable problems caused by limited access to proprietary data about the clinical significance of genetic variations . myriad genetics , for example , has leveraged its brca patents to become the dominant brca testing service and , in turn , to create a valuable database . myriad clearly sees its proprietary database as a source of competitive advantage , one that will persist after its underlying patents expire or are invalidated in court . because of its public profile and explicit , data - based business plan , myriad 's entry into europe will force policy choices into stark relief , just as the reduced cost of full - genome analysis brings a worldwide deluge of genomic data . payers in the united states did not foresee the problems of incomplete access to data , and did not put in place policies to ensure independent verification of clinical predictions . hundreds of agreements have been signed between genetic testing firms and us payers that have apparently not required disclosure of the underlying data , which is ultimately derived from and would benefit patients seeking optimal treatment . payers and regulators in europe , south america , asia and other markets need not be so passive . with the entry of myriad into europe in 2012 , those making policy decisions about regulation , coverage and reimbursement of genetic tests in europe can ensure that the data necessary to interpret the clinical significance of genetic variations are made public , where they can be subjected to scientific scrutiny and be available to benefit patients and health professionals around the world .
sole - source business models for genetic testing can create private databases containing information vital to interpreting the clinical significance of human genetic variations . but incomplete access to those databases threatens to impede the clinical interpretation of genomic medicine . national health systems and insurers , regulators , researchers , providers and patients all have a strong interest in ensuring broad access to information about the clinical significance of variants discovered through genetic testing . they can create incentives for sharing data and interpretive algorithms in several ways , including : promoting voluntary sharing ; requiring laboratories to share as a condition of payment for or regulatory approval of laboratory services ; establishing and compelling participation in resources that capture the information needed to interpret the data independent of company policies ; and paying for sharing and interpretation in addition to paying for the test itself . us policies have failed to address the data - sharing issue . the entry of new and established firms into the european genetic testing market presents an opportunity to correct this failure .
diabetic foot syndrome is one of the most common complications of diabetes . alongside neuropathy and ischemia this syndrome includes infections within the soft tissues and bony structures of the foot ( as a consequence of neurogenic and vascular abnormalities ) and a less frequent complication neuropathic osteoarthropathy known as charcot arthropathy . in the differential diagnosis of charcot arthropathy clinical data , laboratory results and radiological images should be taken into account . patients who present a swollen foot or ankle may be referred for an ultrasound scan as an initial imaging method and in these cases an inquisitive sonographer has a chance to play a vital role in providing a quick diagnosis , resulting in appropriate treatment . forty - one - year - old man with 10 years history of type 2 diabetes ( hba1c 8.2% ) visited a rheumatologist with pronounced swelling of his left foot , associated with moderate erythema and mild pain . there was no history of a foot ulcer and the skin was intact ( fig . 1 ) . photograph of the patient 's feet at the time of the ultrasound scan the patient associated the onset of these symptoms with a minor left foot injury which occurred nearly a year before . the radiograph performed at that time was reported normal and an orthopedic surgeon diagnosed an ankle distortion . over the course of one year there was a significant regression of foot edema and erythema , and the skin temperature , which had initially been increased , returned to normal . in january 2011 the patient decided to repeat the radiograph of his left foot . the radiological report described significant bony changes , suggested gout as their cause and the patient was referred for further rheumatological consultation . the consulting rheumatologist requested an ultrasound scan which showed irregularity and dislocation of the midfoot bones . joint effusion and features of moderately increased vascularity in the pd option were observed , but no other abnormalities were noted ( figs . 2 , 3 ) . as the patient did not provide any earlier radiographs of his foot nor any other diagnostic imaging results , the sonographer decided that further diagnostic procedures were necessary and referred the patient for a plain radiograph of the foot ( fig . 4 ) . the radiograph revealed fragmentation of the midfoot bones , subluxations and luxations in the tarsal and tarsometatarsal joints . these findings combined with the clinical data were consistent with the diagnosis of charcot arthropathy . ultrasound scan reveals irregularity of the midfoot bones panoramic imaging option ultrasound scan reveals effusion and moderately increased synovial vascularity in pd option frontal radiograph of the feet depicts bony debris within the left foot structures : fragmentation , subluxations and luxations within the tarsal and tarsometatarsal joints . right foot appears to be normal the patient was referred to the diabetic foot clinic , where the diagnosis of neuropathic arthropathy was confirmed . he underwent a subsequent mri of his left foot , which revealed severe destruction in the bony structures and joints of his left foot , dislocations in the midfoot joints and bone marrow edema ( figs . 5 a , b ) . mri of the left foot : sagittal t1-weighted ( a ) and t2-weighted fat saturated images ( b ) depict destructive changes : fragmentation , subluxations and luxations within the tarsal and tarsometatarsal joints , bone marrow edema of midfoot bones accompanied by soft tissue edema two months after the diagnosis of charcot arthropathy of the left foot was confirmed the patient contacted the diabetic foot clinic due to increasing edema of his contralateral foot and the subsequent appearance of an extensive but superficial ulceration on its plantar aspect ( fig . 6 ) . in laboratory results mildly increased inflammatory markers were noted ( crp at 10.4 mg / l and esr 34 mm / h non - fasting results ) . the right foot was significantly warmer and the difference of the temperature between both his feet was 4.5c . photograph of the patient 's feet 2 months later depicts deformity of both feet and ulceration on the plantar aspect of the right foot the radiograph of the patient 's right foot revealed dislocations and fragmentation of the midfoot bones consistent with charcot arthropathy ( fig . the diagnosis was confirmed by an mri , which showed similar changes to those , previously observed in his left foot destruction in the bony structures of the foot , dislocations in the midfoot joints , and bone marrow edema . the images confirmed the diagnosis of bilateral charcot arthropathy , but combined with the clinical data ( slightly increased inflammatory markers and presence of an ulcer ) did not allow for the exclusion of a secondary soft tissue and/or bony infection within the right foot . frontal radiograph of the right foot 2 months later destructive changes within the right foot bony structures : fragmentation , subluxations and luxations within the tarsal and tarsometatarsal joints acute charcot arthropathy is a frequently overlooked complication of diabetes and according to the literature reports up to 25% of cases are misdiagnosed . it clinically presents as a red , hot , swollen foot or ankle with usually mild or absent pain ( due to sensory neuropathy ) . the differential diagnosis includes mainly cellulitis and osteomyelitis , post - traumatic changes , deep vein thrombosis , gout , tendovaginitis and joint inflammation . in the initial stage plain radiographs , which , in spite of the recent progress in diagnostic imaging techniques , still remain a mainstay in bony structures imaging , early changes can be seen in bone scintigraphy as areas of increased radiopharmaceutical uptake and in mri , which reveals features of bone marrow edema , soft tissue swelling and joint effusion . if at this point proper treatment is not administered , a dynamic , progressive ( from day to day as per literature descriptions ) destruction of bony structures may occur subluxations , luxations , fractures , cartilage and bone fragmentation , leading to the appearance of bony debris , which happened in our patient 's case . in cases with an unfortunate outcome , mainly affecting those who do not avoid weight bearing , irreversible deformity takes place , including convexity on the medial aspect of the foot ( medial convexity ) or rocker bottom deformity . mr imaging in the acute phase reveals enhancement after cm administration , however the enhancement is nonspecific . therefore cm administration is not considered to be necessary although it allows for a better soft tissue evaluation for the presence of an abscess or sinus tract in case of infection . ultrasound evaluation enables soft tissue assessment in terms of joint , tendon sheath and bursa effusion or abscesses . it is also possible to visualize increased vascularity typical of the active phase of charcot arthropathy . ultrasound evaluation of bony structures is limited to visualization of their external contours and possible dislocations . an essential part of the treatment is immobilization of the affected foot , preferably in a total contact cast and avoiding weight bearing . a total contact cast is applied on average for 812 weeks until the process stabilizes ( clinically stabilization of the process is defined by the difference of skin temperature between the feet being less than 2c ) . at this stage the radiopharmaceutical uptake in bone scintigraphy decreases and the signal intensity in mri scans gradually becomes normal or decreased in all the sequences which correlates with osteosclerosis seen on radiographs . however , if in the acute phase of the disease ( due to weight - bearing and lack of casting ) deformity and dislocations of bony structures occur , the image of the bones and joints of the foot will be irreversibly changed . thus it is vital to make both diabetic patients and healthcare professionals , including radiologists/ sonographers , aware of the possibility of this complication , in order to diagnose all cases of charcot arthropathy as early as possible and to minimize the risk of irreversible deformity . although the process is usually unilateral , some cases of bilateral foot involvement have been described . it happens more frequently in those cases of charcot arthropathy , when no weight is borne on the affected foot as per doctor 's advice and the contralateral foot becomes overloaded , as in our patient 's case . diabetes is the most common cause of charcot 's arthropathy and the disease is most likely to affect the foot . changes characteristic of neuropathic osteoarthropathy may also be caused by other diseases , both congenital and acquired , injuries of the central and peripheral nervous system and they may involve joints of upper and lower extremities and the spine . quick diagnosis is essential to prevent irreversible deformities within the musculoskeletal system . diagnostic procedures include plain radiographs , bone scintigraphy and/or mri and in some cases an ultrasound scan may be of benefit . the most recent data suggest that elastography may be useful in evaluation of plantar fascia , which alters in the course of charcot arthropathy . however , the knowledge of possible clinical complications of diabetes and their radiological symptomatology enables the sonographer , when taking into account the patient 's medical history , to suspect charcot arthropathy and make an urgent referral for further investigations , contributing to quick diagnosis and initiating appropriate treatment in order to minimize the risk of significant deformity and amputation .
the paper presents a case of charcot foot in a patient with long standing type 2 diabetes and complicated by peripheral neuropathy . it was initially diagnosed by an ultrasound examination and subsequently confirmed by an x - ray and an magnetic resonance imaging . diabetic neuropathy is nowadays the most frequent cause of charcot arthropathy , although it can be also a result of other diseases of the nervous system . in the acute phase the patient usually presents with edema , redness and increased temperature of the foot , which can suggest many other diagnoses including bacterial infection , gout , venous thrombosis or trauma . because of its non specific clinical presentation and unsufficient awareness of the specificity of the diabetic foot syndrome among health professionals and the patients the diagnosis of this process is in many cases delayed . in the acute phase appropriate treatment needs to be initiated ( mainly off loading and immobilization of the foot in a total contact cast ) , otherwise a rapidly progressing destruction of the bones and joints will usually begin , leading to fractures , dislocations and a severe foot deformity . increased awareness among doctors taking care of the diabetic patients and appropriate use of the imaging methods can definitely improve efficacy of the diagnostic process and help to optimize the treatment of charcot arthropathy . the standard approach usually includes use of radiography , magnetic resonance imaging and scintigraphy . in some cases a sonographer may be the first one to notice typical signs of bony destruction in a patient with charcot arthropathy and suggest immediate further imaging in order to confirm the diagnosis and to minimize the risk of mutilating complications .
abdominal aortic aneurysm ( aaa ) is a life - threatening disease when rupture occurs . elective open surgical repair ( osr ) has been the optimal therapy to prevent aaa rupture . however , after the first introduction by parodi et al . ( 1 ) , endovascular aneurysm repair ( evar ) has increased dramatically and is the most popular therapy nowadays ( 2 ) . a number of studies reported that evar has significant benefit over osr in terms of rapid postoperative recovery , fewer intensive care unit administration and reduction in hospital stay ( 3 , 4 ) . however , this initial advantage in cost is gradually disappearing in the long - term after evar due to more frequent life - long follow - up imaging and higher reintervention rates . some recent studies have reported even similar or higher hospital costs for evar ( 4 , 6 - 10 ) . the cost - effectiveness of a new medical therapy can vary according to the medical insurance system in each nation . although some studies from western countries have dealt with cost - effectiveness of evar in the management of aaa , these results can not be applied directly to korea . to justify the routine use of evar for aaa treatment in korea , it is needed to prove the cost - effectiveness under the current situation of reimbursement and patient payment of the national health insurance ( nhi ) corporation . health care costs can affect clinical decision making but also the policy of the national health insurance program . until recently , however , no studies regarding cost - effectiveness of evar is conducted in korea . therefore the aim of this study was to compare the hospital - related cost of elective aaa treatment including peri- and post - operative costs and to study cost structure between those selected for open or endovascular repair . between january 2005 and december 2009 , 120 infrarenal aaa repairs were performed in seoul national university hospital . among them , 15 operations were excluded from the study due to various reasons , including 9 ruptured aneurysms , 2 stent graft migrations , 1 foreign patient , and 3 complicated aaas such as infected aneurysm . the remaining 105 primary elective aaa repairs ( 79 osrs and 26 evars ) were included in this study . patients were generally admitted 3 or 4 days before osr or evar . the decision to choose the repair method was based on the anatomic configuration of the aneurysm , patient comorbidities , and patient preference with surgeon 's recommendation . osr was performed through midline ( n = 70 ) or retroperitoneal ( n = 9 ) approach and a dacron ( dupont , wilmington , de , uas ) graft was implanted . zenith ( cook , bloomington , in , usa ; n = 22 ) or excluder ( w.l . gore & associates , flagstaff , az , usa ; n = 4 ) were placed . for follow - up , patients treated with evar were routinely checked with computed tomography ( ct ) angiography at 1 , 6 , and 12 months after surgery and annually thereafter with clinical examination at each hospital visit . the standard follow - up program of osr patients consisted of clinical examination at 1 , 6 , and 12 months after surgery and annually thereafter medical records were reviewed to obtain patients characteristics , preoperative investigations , operative details , early and late complications , the need for additional procedures , the length of stay in the intensive care unit ( icu ) and hospital , and outcome parameters as defined by the ad hoc committee for standardized reporting practices in vascular surgery ( 11 ) . additional data on survival for patients with loss to follow - up were obtained from the electronic data for resident registration of the ministry of public administration and security , korean government and by telephone survey . all hospital - related costs linked to aaa treatment were included in the cost analysis . the cost for each patient was determined by accessing the hospital cost accounting system which includes detailed data on operations , anesthesia , pre- and postoperative investigations , intensive care , and postoperative hospitalization . the total hospital cost for the index admission was divided into preoperative costs , operative costs , and postoperative costs including costs for icu stay and hospital stay . follow - up costs linked to aaa treatment were obtained from discharge until july 2010 . preoperative cost was determined as costs incurred by all investigations and hospitalization performed preoperatively after the decision for aneurysm repair was made . therefore , preoperative costs included cost of ct angiography , cardiorespiratory investigations , consultations , medications , clinical laboratory costs , bed costs and interventions performed during hospital admission . operative costs included graft costs , operation charges , anesthesia charges , medications , and additional costs for guidewires , catheters , sheath , and contrast used during evar . postoperative cost was defined as the sum of costs incurred by postoperative icu stay and all cost after returning to the general ward until discharge such as bed and nursing costs , medical imaging , consultations , medications , clinical laboratory costs , and additional interventions . follow - up costs included all aaa treatment - related costs after discharge such as routine follow - up costs , ct angiography , additional interventions required to treat endoleaks and rehospitalization . statistical outliers ( osr , n = 2 ; evar , n = 1 ) of more than 3 standard deviations from the mean for total hospital costs during the main admission were excluded from the cost analysis ( 12 ) . in korea , total hospital costs are divided into benefit - service charges of which 80% are reimbursed by the nhi corporation , and nonbenefit - service charges . thus , total hospital cost , reimbursement by nhi corporation and patient payment were calculated for each patient and compared between osr and evar patients . the data were expressed as means standard deviation values or as frequencies ( percentages ) , according to the data type . for data which did not fit normal distribution , patient survival rates were determined by kaplan - meier analysis and log - rank method . this study was performed after obtaining approval from the institutional review board of seoul national university hospital ( irb no . this study was performed after obtaining approval from the institutional review board of seoul national university hospital ( irb no . during the study period , 79 patients underwent osr and 26 patients underwent evar as primary elective treatment for aaa . the baseline clinical characteristics of the patients in the two groups are shown in table 1 . the mean age of the patients in the evar group was higher than the osr group ( 75.0 8.1 vs 70.3 8.0 , p = 0.004 ) , and combined malignant disease was more frequent in the evar group compared to the osr group ( 30.8% vs 11.4% , p = 0.031 ) . there was no significant difference between the groups with regard to other clinical characteristics examined . the mean diameter of the aneurysms were 58.5 10.6 mm in the osr group and 57.2 8.6 mm in the evar group ( p = 0.563 ) . there was no difference in the length of proximal neck ( 26.8 14.9 mm in the osr group vs 27.9 9.8 mm in the evar group , p = 0.727 ) between the two groups and more than two third of the patients showed aneurysmal involvement of common iliac artery in both groups ( p = 0.607 ) . evar resulted in a tendency for a reduced length of hospital stay as well as length of icu stay . the median length of postoperative hospital stay was 8 days in the evar group ( range , 7 - 14.5 days ) and was 10 days in the osr group ( range , 8 - 14 days ; p = 0.078 ) . all patients except one in the evar group went to the icu postoperatively but there appeared to be a shorter length of icu stay in the evar group , with a median icu stay of 1 day ( range , 1 - 2 days ) in the evar group compared with 2 days ( range , 1 - 2 days ) in the osr group ( p = 0.110 ) . there was no significant difference in 30-day mortality between the groups ( 2.5% for osr vs 4.0% for evar , p = 0.566 ) . causes of 3 inhospital mortalities were sepsis in 2 patients and subdural hemorrhage in an other patient . although 5-yr patient survival was significantly inferior in the evar group compared to osr group ( 54.5% vs 91.9% , p < 0.001 ) , there was no aaa - related mortality in both groups . the causes of patient death were malignant disease , sepsis , acute myocardiac infarction , fall down accident , and intracranial hemorrhage ( fig . four patients ( 5.1% ) in the osr group and 3 patients ( 11.5% ) in the evar group required reoperation ( p = 0.361 ) . one patient from the evar group underwent osr because of persistent type i endoleak at 7 days after evar . the evar group showed significantly higher rate of type ii endoleak ( 34.6% ) and need for intervention of type ii endoleak ( 15.4% , p < 0.001 ) , with a mean follow up duration of 888 548 days in the osr group and 576 473 days in the evar group . figs . 2 and 3 display the cost structure of both treatment groups . operative cost was significantly higher in the evar group compared to the osr group , which was mainly attributed by the high cost of endografts and disposables such as sheaths and guidewires ( fig . 0.001 ) were significantly higher in evar patients compared to the osr group . because of the reimbursement of the endo - graft by the nhi corporation , patient payment was comparable between two groups ( krw6,156,612.5 3,931,410.6 for osr vs krw5,786,037.8 1,684,082.5 for evar , p = 0.380 ) while the reimbursement by nhi corporation was significantly higher in evar group ( krw 6,238,895.1 3,393,210.0 for osr vs krw14,071,081.4 4,856,932.5 for evar , p < 0.001 ) ( fig . when the total hospital costs incurred during the index admission were divided into three stages , the preoperative and postoperative costs were similar in both groups . the mean preoperative costs ( fig . 2a ) including consultation , cardiorespiratory investigations , imaging studies , clinical laboratory costs and bed costs ( krw2,532,484 1,652,591 for osr vs krw2,037,121 1,876,712 for evar , p = 0.255 ) were similar . 2b ) including icu care and postoperative ward admission ( krw4,823,165.8 2,813,945.4 vs krw4,850,649.2 2,807,148.9 , respectively for evar and osr group , p = 0.968 ) were similar . the length of postoperative icu and hospital stay tended to be shorter in the evar group , however it could not induce economic advantage nor offset the cost of endo - graft ( fig . , patients in the evar group were routinely checked with ct angiogram at 1 , 6 , and 12 months after surgery . four ( 15.4% ) out of 9 ( 34.6% ) patients with type ii endoleak were treated with additional intervention . no patient required conversion to osr . at 1 yr follow - up , the evar group required significantly higher cost than the osr group ( krw648,538.1 926,975.6 vs krw180,844.8 189,659.1 , p < 0.001 ) and the discrepancy in the cumulative cost increased further till 2 yr follow - up ( krw1,612,226 1,319,305.8 vs krw 393,203.8 356,785.8 respectively , p < 0.001 ) . during the study period , 79 patients underwent osr and 26 patients underwent evar as primary elective treatment for aaa . the baseline clinical characteristics of the patients in the two groups are shown in table 1 . the mean age of the patients in the evar group was higher than the osr group ( 75.0 8.1 vs 70.3 8.0 , p = 0.004 ) , and combined malignant disease was more frequent in the evar group compared to the osr group ( 30.8% vs 11.4% , p = 0.031 ) . there was no significant difference between the groups with regard to other clinical characteristics examined . the mean diameter of the aneurysms were 58.5 10.6 mm in the osr group and 57.2 8.6 mm in the evar group ( p = 0.563 ) . there was no difference in the length of proximal neck ( 26.8 14.9 mm in the osr group vs 27.9 9.8 mm in the evar group , p = 0.727 ) between the two groups and more than two third of the patients showed aneurysmal involvement of common iliac artery in both groups ( p = 0.607 ) . both osr and evar groups had a low morbidity . the perioperative and postoperative complications are listed in table 2 . evar resulted in a tendency for a reduced length of hospital stay as well as length of icu stay . the median length of postoperative hospital stay was 8 days in the evar group ( range , 7 - 14.5 days ) and was 10 days in the osr group ( range , 8 - 14 days ; p = 0.078 ) . all patients except one in the evar group went to the icu postoperatively but there appeared to be a shorter length of icu stay in the evar group , with a median icu stay of 1 day ( range , 1 - 2 days ) in the evar group compared with 2 days ( range , 1 - 2 days ) in the osr group ( p = 0.110 ) . there was no significant difference in 30-day mortality between the groups ( 2.5% for osr vs 4.0% for evar , p = 0.566 ) . causes of 3 inhospital mortalities were sepsis in 2 patients and subdural hemorrhage in an other patient . although 5-yr patient survival was significantly inferior in the evar group compared to osr group ( 54.5% vs 91.9% , p < 0.001 ) , there was no aaa - related mortality in both groups . the causes of patient death were malignant disease , sepsis , acute myocardiac infarction , fall down accident , and intracranial hemorrhage ( fig . four patients ( 5.1% ) in the osr group and 3 patients ( 11.5% ) in the evar group required reoperation ( p = 0.361 ) . one patient from the evar group underwent osr because of persistent type i endoleak at 7 days after evar . the evar group showed significantly higher rate of type ii endoleak ( 34.6% ) and need for intervention of type ii endoleak ( 15.4% , p < 0.001 ) , with a mean follow up duration of 888 548 days in the osr group and 576 473 days in the evar group . operative cost was significantly higher in the evar group compared to the osr group , which was mainly attributed by the high cost of endografts and disposables such as sheaths and guidewires ( fig . 0.001 ) were significantly higher in evar patients compared to the osr group . because of the reimbursement of the endo - graft by the nhi corporation , patient payment was comparable between two groups ( krw6,156,612.5 3,931,410.6 for osr vs krw5,786,037.8 1,684,082.5 for evar , p = 0.380 ) while the reimbursement by nhi corporation was significantly higher in evar group ( krw 6,238,895.1 3,393,210.0 for osr vs krw14,071,081.4 4,856,932.5 for evar , p when the total hospital costs incurred during the index admission were divided into three stages , the preoperative and postoperative costs were similar in both groups . 2a ) including consultation , cardiorespiratory investigations , imaging studies , clinical laboratory costs and bed costs ( krw2,532,484 1,652,591 for osr vs krw2,037,121 1,876,712 for evar , p = 0.255 ) were similar . 2b ) including icu care and postoperative ward admission ( krw4,823,165.8 2,813,945.4 vs krw4,850,649.2 2,807,148.9 , respectively for evar and osr group , p = 0.968 ) were similar . the length of postoperative icu and hospital stay tended to be shorter in the evar group , however it could not induce economic advantage nor offset the cost of endo - graft ( fig . , patients in the evar group were routinely checked with ct angiogram at 1 , 6 , and 12 months after surgery . four ( 15.4% ) out of 9 ( 34.6% ) patients with type ii endoleak were treated with additional intervention . no patient required conversion to osr . at 1 yr follow - up , the evar group required significantly higher cost than the osr group ( krw648,538.1 926,975.6 vs krw180,844.8 189,659.1 , p < 0.001 ) and the discrepancy in the cumulative cost increased further till 2 yr follow - up ( krw1,612,226 1,319,305.8 vs krw 393,203.8 356,785.8 respectively , p < 0.001 ) . the number of patients with aaa is rapidly increasing in korea and , after the inception of reimbursement for endo - grafts by the health insurance reimbursement association ( hira ) , evar has become the preferred method for aaa treatment , replacing osr ( 13 ) . health economic evaluation for a new treatment strategy should be mandatory before it is reimbursed within the health service system and a number of reports on cost - effectiveness of evar have been published in western countries ( 5 - 10 , 14 - 23 ) . however , this issue of cost - effectiveness of evar has never been evaluated in the korean health care system . the principal finding of this study is that the total in - hospital costs for evar ( krw19,857,119.2 ) were significantly higher than those for osr ( krw12,395,507.6 ) , which contrasted with several reports from western countries that showed evar was less costly or equal in cost to osr ( 10 , 19 ) . the most important cause for the difference in total in - hospital costs between evar and osr was the cost of the procedures themselves . although there were reductions in anesthesia and operation fee in the evar group , this could not recoup the high costs of the endovascular graft ( krw9,021,037.3 ) and disposables ( krw1,296,660.4 ) such as guidewires , sheaths and radiocontrast materials ( fig . this is mainly due to the lower costs of operation - related fees in korea , while higher operation fees in western countries recoup the endograft costs . in addition , almost every patient in the evar group in this study was admitted to the icu and the length of hospital stay was also comparable between the two study groups . this might be caused by the treatment policy of the vascular surgery team in the study hospital . however , this reduction in hospital and icu stay can not offset the costs of the endovascular grafts , because the mean cost of the endografts accounted for 45.4% of the total in - hospital cost in the evar group and the mean cost of postoperative icu and hospital stay accounted for only 24.3% . furthermore , this study showed that 2-yr cumulative follow - up costs were also higher for evar than osr ( fig . 4 ) , which is similar to the western studies . because ct was regularly checked to identify endoleaks , graft migration , graft kinking or other complications related to evar and secondary intervention was additionally required in some cases , follow - up costs increase cost disparity after evar ( 4 , 8 , 17 ) . another interesting finding in this study was that patient payments were not different between evar ( krw5,786,037.8 ) and osr ( krw6,156,612.5 ) patients . this was caused by the reimbursement off higher cost materials including endovascular grafts and disposables by the hira which accounted for the largest portion of the costs in evar , the amount of reimbursement by nhi corporation reaching krw14,071,081.4 . therefore , as the number of patients undergoing evar increases , the financial burden of the nhi corporation is becoming more considerable . three randomized trials comparing evar and osr have all shown a markedly reduced 30-day operative mortality for evar and this benefit has made evar a more prevalent treatment option ( 3 , 4 , 24 ) . ( 8) , longer - term follow - up analysis showed increased rates of endograft - related complications including type ii endoleaks and additional interventions in the evar group . in contrast to evar , osr has strong evidence regarding durability ( 25 , 26 ) and no graft - related complications occurred in this study population . overall , current evidence including this study show that evar has early advantage in terms of operation - related mortality and morbidity but is associated with significantly higher graft cost which is not offset by short stay in icu or hospital , higher graft - related complications and reintervention resulting in higher follow - up costs . it is noteworthy that new graft - related complications can develop and the need for reintervention persists even at 8 yr after evar ( 8) . considering the continued evaluation with ct for graft - related complications , evar may prove to be cost - effective only in very elderly patients . it is clear that , although evar showed lower operative mortality , careful follow - up after evar is also mandatory in addition , evar patients are potentially exposed to a significant cumulative amount of iatrogenic radiation from pre - operative assessment to death by life - long follow - up of ct angiography , with the associated carcinogenic risks ( 27 ) . in this regard it is doubtful whether evar routinely offered even to relatively young patients with low operative risks . the eventual impact of the radiation dose by evar and life - long check up of ct is more pertinent in younger patients requiring aneurysm repair , potentially exposing these patients to carcinogenic risk with a latency period of between 10 and 20 yr . therefore , the decision of which method to be used in aaa treatment should be individualized ( 28 ) . medical practitioners should balance the patient 's operative risks and disadvantages of evar . summarizing , the total in - hospital costs for evar are significantly higher than those for osr . a lower number of days of hospital admission and icu care can not offset higher procedural costs for evar . this study suggests " evar only " policy can not be accepted in perspective of cost - effectiveness in korea and which strategy to choose , open or endovascular , in aaa treatment should be individualized . further research is required to determine the ideal indication of evar in terms of patient 's age , expected follow - up period after evar , costs for evar per se and follow - up with reintervention .
this study was designed to compare the hospital - related costs of elective abdominal aortic aneurysm ( aaa ) treatment and cost structure between endovascular aneurysm repair ( evar ) and open surgical repair ( osr ) in korean health care system . one hundred five primary elective aaa repairs ( 79 osrs and 26 evars ) performed in the seoul national university hospital from 2005 to 2009 were included . patient characteristics were similar between two groups except for older age ( p = 0.004 ) and more frequent history of malignancy ( p = 0.031 ) in evar group . thirty - day mortality rate was similar between two groups and there was no aaa - related mortality in both groups for 5 yr after repair . the total in - hospital costs for the index admission were significantly higher in evar patients ( mean , krw19,857,119 ) than osr patients ( mean krw12,395,507 ) ( p < 0.001 ) . the reimbursement was also significantly higher in evar patients than osr patients ( mean , krw14,071,081 vs krw6,238,895 , p < 0.001 ) while patients payments was comparable between two groups . evar patients showed higher follow - up cost up to 2 yr due to more frequent imaging studies and reinterventions for type ii endoleaks ( 15.4% ) . in the perspective of cost - effectiveness , this study suggests that the determination of which method to be used in aaa treatment be more finely trimmed and be individualized .
mite demodex is an ectoparasite infesting the areas of face rich in pilo - sebaceous units and less commonly other seborrheic sites like upper and medial region of chest and back are also involved . majority of the patients are immune - compromised though immunocompetent are not spared , nevertheless atypical presention in immunocompetent individuals is a rarity . we report a case with atypical presentation which posed diagnostic dilemma due to confusing clinical picture . a 32-year - old male presented with gradual onset swelling and redness on right side of face associated with minimal itching for past six months . it started as a pea - sized red raised flat lesion , which increased in size to involve 1/3 rd of right cheek , adjoining nasolabial fold and lower eye - lid . there was modest increase in redness and pruritus of the lesions on sunexposure , however hot spicy meals , alcohol or emotional stress did not aggravate his symptoms . there was no history of cough , chest pain , fever , weight loss or any constitutional or systemic symptoms . patient reported to a dermatologist about a month back , where he was diagnosed as hansen s disease in view of equivocal hypoaesthesia and solitary indurated plaque on face . he was empirically started on multi drug treatment ( mdt ) multi bacillary for hansens disease . after about four weeks of mdt , patient reported to our hospital with no clinical improvement and persistence of symptoms . dermatological examination revealed involvement of right malar region , nasolabial fold and adjacent parts of nasal bridge and lower eyelid in the form of edema , erythema and follicular dilatation ( figure 1 ) . laboratory investigations revealed complete blood count , erythrocyte sedimentation rate ( esr ) , liver and renal function tests , serum ace levels , were normal . screening for hepatitis b , hepatitis c and human immunodeficiency virus , as well as serology for antinuclear antibodies ( ana ) were negative . chest x - ray showed no abnormality and koh mount of scrapings did not reveal any pathology . repeat skin biopsy from medial end of the swelling along nasolabial fold showed mild epidermal orthohyperkeratosis . the dermis showed intense follicular and perifollicular lymphocytic inflammatory infiltrate along with dense lichenoid lymphomononuclear infiltrate . there was follicular dilatation with presence of demodex sp.mite with surrounding homogenous eosinophilic material ( figure 2 ) . patient was managed with oral ivermectin 12 mg stat and topical metronidazole gel locally twice a day . the eryhthema and swelling started regressing within few days and after 03 weeks had near complete resolution of symptoms ( figure 3 ) . demodex are parasitic mites that live in hair follicles and pilosebaceous units , accordingly maximum density is found in seborrheic sites . besides humans they also cause significant infestation in canines and felines . human infestation is very common and varies between 23 - 100% as per different authors . this infestation is usually asymptomatic , but when and how it becomes pathogenic is poorly understood . primary or secondary suppression in immunity plays a major role in demodex proliferation and resultant dermatoses . cutaneous disorders attributed to this mite include , rosacea , pustular folliculitis , perioral dermatitis , lupus miliaris disseminatus faciei , madarosis , non - specific facial dermatitis etc . our patient presented with non - specific facial dermatitis affecting only right side of the face . unilateral , indurated , erythematous plaque on face with equivocal hypoaesthesia resulted in initial misdiagnoses . earlier it has also been reported to present with facial sclera - oedema and blepharoedema which mimicked cutaneous lymphoma . further demodicidosis should also be considered in patients presenting even with unilateral lesions in seborrheic areas .
demodicosis is a common parasitic infection of the hair follicles and the pilosebaceous unit by the demodex mites viz . demodex folliculorum and demodex brevis . infection by this parasite is common among immunocompromised and elderly . we report a case of facial demodicosis which presented like atypical rosacea with a gradually progressing swelling and redness on right side of face which was initially diagnosed as a case of hansen s disease . skin biopsy revealed follicular dilatation with presence of demodex mite along with intense perifollicular lymphomononuclear infiltrate . patient was treated with oral tab ivermectin 12 mg stat along with topical gel metronidazole twice daily to which he responded favourably .
pyrethrums are organic , environment - friendly insecticides having a knock down effect on a variety of insects . pyrethrin and pyrethroids have quick action against insects , low toxicity , repellent properties , and virtually no insect immunity . the very low potential for toxicity in human being is due to its rapid metabolism into non - toxic metabolites following ingestion or exposure . fewer than 10 deaths have been reported from the ingestion or occupational exposure of pyrethroids . we describe a case of deliberate poisoning of pyrethroid ( prallethrin ) presenting as status epilepticus . a 35-year - old male was admitted to our emergency department with giddiness as the major complaint following ingestion of an unknown quantity of an unknown poison . patient was conscious , oriented with stable cardio - respiratory parameters at the time of arrival . after sometime , despite being well oxygenated via face mask , patient started having generalized tonic - clonic seizures . initial attention to airway , breathing and circulation ( abc ) was given , followed by a bolus dose of diazepam . seizures subsided for a brief period only to recur repeatedly . on repeated enquiry , the patient 's relative brought empty bottles of all out , a commercial composition of pyrethroid used as insecticides providing a circumstantial evidence of the nature of the poisoning . patient was given a bolus dose of thiopentone sodium , and soon his trachea was intubated . this was followed by a loading dose of the anti - convulsant phenytoin to control seizures . patient was shifted to the intensive care unit for further management . on examination , he was deeply comatose . hemogram , liver and kidney function tests , x - ray chest , ecg , and arterial blood gases were normal . thereafter , thiopentone sodium and midazolam infusions were administered and titrated clinically as no bedside eeg monitoring was available . gradually , thiopentone sodium and midazolam infusions were tapered off , and patient was weaned off the ventilator to be extubated after 72 hours . the patient was discharged from the hospital on the 7 day after a psychiatry consultation . the pyrethrin insecticides were discovered in the last decade of the 19 century as pyrethrum , pyrethrin , and pyrethroid . pyrethrum is an extract from the dried flowers of the compositae family such as chrysanthemums or daisies . they are widely - used organic , environment - friendly , and multipurpose insecticides with a long safety record for both acute and chronic intoxication in human beings . they are not stored in the body fat , nor penetrate the intact skin , and are very rapidly metabolized in the body into non - toxic metabolites . pyrethrins have been established to be an allergen and are responsible for dermatitis , conjunctivitis , rhinitis - like symptoms . all - out , the commercial brand of pyrethroid insecticide , contain a chemical prallethrin . as per who norms , prallethrin is a racemic mixture of 8 isomers used as household insecticides and pesticides with very low mammalian toxicity and no carcinogenicity or mutagenicity . on the basis of their chemical structure , type -1 , which produce hyperexcitability with fine tremors , and type 11 , which produce more severe symptoms and seizures on intoxication . the poisoning syndrome includes nausea , vomiting , headache , fine tremors , hyperexitability , and paresthesia in milder cases . however , severe toxicity is characterized by dizziness , gross tremors , hypersalivation , sympathetic stimulation leading to hypotension , tachycardia , profuse sweating , and dilated pupils . patient needs to be treated symptomatically i.e. , atropine for excessive salivation and diazepam for control of seizures . paresthesias lasting for short periods do occur and are treated successfully with vitamin e. gastric lavage was deferred due to continuous convulsions but was performed later . as seizures could not be controlled with diazepam and anti - convulsants , therapeutic coma was induced with thiopentone sodium and midazolam infusions , but for a brief period , due to lack of bedside eeg monitoring . the exact mechanism of poisoning is a change at the voltage - gated sodium channels i.e. leading to repetitive discharges and synaptic disturbances . severe toxicity is believed to be due to decrease in chloride through voltage - dependent chloride channels . pyrethroids in high concentration act on gaba - activated chloride channels , leading to seizures . with ever increasing demand for more powerful insecticidal agents for agriculture and household use , the chances of intoxication after long - term exposure presents a real risk to human beings and animals . very few cases of pyrethroid poisoning have been reported with status epilepticus . in india , only 2 children of allethrin poisoning and 1 adult of pyrethroid poisoning had presented with convulsions . a similar case presenting as status epilepticus after the consumption of a large amount of pyrethroid was reported earlier . pyrethroid poisoning should be considered among the differential diagnoses for a patient of suspected poisoning presenting with seizures .
this report describes a 35 year old male who presented with seizures after consuming 4 - 5 bottles of all - out a commercial composition of pyrethroid used as insecticides . our case report supports authors reporting an association of pyrethroid poisoning with status epilepticus .
przyjcie na oddzia intensywnej opieki ( oit ) bywa poprzedzone wydarzeniami , ktre mog prowadzi do trwaych ubytkw neurologicznych . ocena stenia biaka s100 w osoczu moe by klinicznie uyteczna w przewidywaniu , jaki bdzie stan neurologiczny pacjenta po nagym zatrzymaniu krenia ( nzk ) . nie wiadomo , czy wyniki te mona odnie do szerszej grupy chorych przyjmowanych na oit . ocena przydatnoci stenia biaka s100 w osoczu w predykcji zgonu , trwaego uszkodzenia neurologicznego lub niekorzystnego efektu leczenia przy przyjciu na oit . stenie biaka s100 w osoczu zbadano u 102 chorych przy przyjciu na oit , niezalenie od ich stanu neurologicznego i przyczyny przyjcia . wikszo chorych bya przyjta na oit ze schorzeniami kardiologicznymi , z wyczeniem chorych po urazach . pacjentw przypisano do trzech grup , w ktrych moliwe byy nastpujce wyniki leczenia : trwae uszkodzenie neurologiczne lub powrt wiadomoci , niekorzystny wynik leczenia ( definiowany jako zgon lub przeycie z trwaym uszkodzeniem neurologicznym ) lub korzystny wynik leczenia oraz zgon lub przeycie . stenie biaka s100 w osoczu w momencie przyjcia na oit uatwiao identyfikacj pacjentw , u ktrych pniej wystpio trwae uszkodzenie neurologiczne lub ktrzy odzyskali wiadomo ( p < 0,0001 ) . u wszystkich pacjentw ze steniem biaka s100 przewyszajcym 0,532 g / l przy przyjciu na oit wystpiy trwae uszkodzenie neurologiczne albo niekorzystny wynik leczenia . czuo oznaczenia stenia biaka s100 , przy przyjciu wartoci 0,532 g / l jako punktu odcicia , bya niska i wynosia odpowiednio 48% i 40% . stenia biaka s100 w osoczu przekraczajce 0,532 g / l oceniane przy przyjciu na oit wykazuj si wysok specyficznoci , ale niewielk czuoci w przewidywaniu zarwno trwaego uszkodzenia neurologicznego , jak i niekorzystnego wyniku leczenia w heterogennej grupie pacjentw przyjmowanych na oit . . this may be due to a previous in - hospital or out - of - hospital cardiac arrest , or many other , sometimes unclear , reasons . despite the fact that outreach and early warning systems are becoming an integral part of hospital practice aiming at improving early identification and management of deteriorating patients on general hospital wards , hence , icu admission may be preceded by profound hypoxia , hypoperfusion or metabolic abnormalities . the administration of sedatives or even muscle relaxants ( urgent intubation ) , and delayed transfer to the icu , increase the length of hospital stay and the mortality rate . the risk of permanent anoxaemic neurological injury is very high in the period preceding admission to the intensive care area . the icu staff may not always have the complete data regarding these events , particularly if the patient is admitted from another hospital . patients with neurological injury initially remain in a coma due to ischaemic encephalopathy , after which their condition begins to evolve in different directions . the final effect of treatment could be extremely disappointing ( brain death or persistent vegetative state ) or satisfactory ( restoration of consciousness ) , with a large spectrum of varying degrees of damage to the central nervous system located between these two extremes [ 3 , 4 ] . early identification of patients who have no chance to regain consciousness is of great importance . ideally , this kind of information should be obtained at the time of icu admission . the proposed tests to assess the likelihood of an adverse neurological outcome must have a false positive rate close to zero , otherwise there could be a risk of reducing treatment in patients who in fact have a chance of survival . the usefulness of individual components of neurological examination , neuroimaging and other radiological techniques is being evaluated . the most interesting area of science , however , is the use of biomarkers , chemical substances released to the blood after each episode of neuronal injury . they could facilitate the identification of complications at a very early stage , when no clinical data indicating the occurrence of such complications are yet available . protein neuron - specific enolase ( nse ) and protein s100 are currently considered the most promising candidates for neurological predictors . an extensive review of recent literature shows that the assessment of protein s100 levels at admission to the icu could be clinically more useful in predicting neurological outcome following cardiac arrest than nse levels . the predictive value of protein s100 has already been tested with regard to patients survival of the event [ 3 , 5 ] , restoration of consciousness [ 710 ] and favourable outcomes [ 3 , 5 , 11 , 12 ] . its main role is to participate in the processes of proliferation of astrocytes and glia - neuron interactions . the release of protein s100 into the blood occurs as a result of a breach of the blood - brain barrier . advantages of s100 protein include high specificity for nerve tissue and a relatively short half - life , which make it an optimal marker for early detection and monitoring of neurological injury . from a practical point of view , it is important that s100 protein may be assessed in various body fluids ( serum , cerebrospinal fluid , whole blood ) , and that this blood test is minimally invasive and very simple to implement [ 4 , 6 ] . although there are numerous studies evaluating the usefulness of biomarkers , they vary significantly with regard to the definitions applied , time points at which samples are taken , as well as the cut - off points differentiating positive and negative outcomes . consequently , there are no firm standards as to the use of biomarkers , and their clinical significance is uncertain . the purpose of this study was to assess plasma s100b protein in predicting death , permanent neurological damage , or in this prospective study , 102 consecutive patients admitted to the medical intensive care unit were included regardless of their neurological status and the reason for admission to the intensive care area . the concentration of protein s100 in plasma was established in all patients at admission , as a routine entry investigation . the result obtained had no impact on the clinical management and the process of treatment . accordingly , in compliance with the decision of the local ethics committee , the informed consent was waived . protein s100 was evaluated by means of the elisa method , with the cobas e411 analyser ( hitachi , japan ) and reagents by boehringer - manheim ( germany ) . the presence of sedation and its type were noted . at discharge from hospital , each patient was assigned a score according to the glasgow outcome scale . after hospital discharge , patients were grouped according to the following final binary outcomes : permanent neurological deficit or restoration of consciousness , unfavourable outcome or favourable outcome , patients status was classified as permanent neurological deficit if they did not regain full consciousness and died in a coma , or developed a minimally conscious state or persistent vegetative state according to the criteria given by giacino et al . . restoration of consciousness if they regained full consciousness during the icu stay either before discharge or before death . this is important , as the two above - mentioned groups of binary outcomes are totally independent of each other ( the same patient could be classified under survival and persistent neurological deficit , or as death and restoration of consciousness ) . patients were classified as having an unfavourable outcome if they either died ( with or without restoration of consciousness during the icu stay ) or survived with a permanent neurological deficit ( glasgow outcome scale score 2 or 3 ) . only survival with a complete restoration of consciousness ( glasgow outcome scale 4 or 5 ) was classified as a death was recorded only if the patient died either during the icu stay or in the general ward of the same hospital . patients were not followed up after their transfer to long - term facilities or other departments outside the hospital . if a patient was discharged outside the hospital in a stable condition , this was recorded as survival . forty - nine ( 48.0% ) patients were admitted to the icu following cardiac arrest . cardiac arrest occurred out of hospital in 19 ( 18.6% ) patients and in hospital ( in the other ward prior to admission ) in the remaining 30 ( 29.4% ) patients . overall , 80 ( 78.4% ) patients were unconscious and 42 ( 41.2% ) patients were in cardiogenic shock at admission to the icu . among patients who were unconscious at admission , the event most likely to cause neurological injury most commonly took place 2 days before admission ( from 1 to 7 days ) . patients were admitted to the icu in a course of various diseases and for various reasons the largest groups were complicated acute coronary syndromes ( n = 39 ) , complications pre- or post - cardiac surgery ( n = 23 ) , acute heart failure or decompensation of chronic heart failure ( n = 18 ) and exacerbation of copd ( n = 9 ) . other , less frequent reasons included such diverse medical conditions as : medical complications of pandemic influenza virus infection , medical complications in the course of cancer , suicide attempts , acute alcohol intoxication , complications following invasive cardiology procedures and various neurological disorders . mean age of patients was 62 14 years ( from 18 to 82 years ) . the predictive sensitivity and specificity of admission values of protein s100 were assessed for the occurrence of permanent neurological damage , unfavourable outcome and death . sensitivity , specificity , positive predictive values ( ppv ) and negative predictive values ( npv ) were calculated for each outcome separately . sensitivity of the test was interpreted as the percentage of true positive results to the sum of true positive and false negative results . specificity of the test was interpreted as the percentage of true negative results to the sum of true negative and false positive results . positive predictive value of the test was interpreted as the percentage of patients with a worse outcome among patients with a positive result . negative predictive value of the test was interpreted as the percentage of patients without a worse outcome among patients with a negative result . the receiver operating characteristic ( roc ) curves enabled us to determine the optimal cut - off point for the prediction of these outcomes . for the purpose of all calculations , sensitivity , specificity , positive predictive values ( ppv ) and negative predictive values ( npv ) were calculated for each outcome separately . sensitivity of the test was interpreted as the percentage of true positive results to the sum of true positive and false negative results . specificity of the test was interpreted as the percentage of true negative results to the sum of true negative and false positive results . positive predictive value of the test was interpreted as the percentage of patients with a worse outcome among patients with a positive result . negative predictive value of the test was interpreted as the percentage of patients without a worse outcome among patients with a negative result . the receiver operating characteristic ( roc ) curves enabled us to determine the optimal cut - off point for the prediction of these outcomes . for the purpose of all calculations , the level of statistical significance was assumed as p < 0.05 . overall , out of the 102 studied patients , 40 ( 39.2% ) died . among patients who died , five patients were certified brain dead . out of the 62 ( 60.8% ) patients who survived , only 42 had a favourable outcome and 20 patients were discharged with a permanent neurological deficit ( glasgow outcome scale 2 or 3 ) . the numbers of patients in each category are given in table i. number of patients assigned to various categories of outcome favourable outcome is shown in grey . mean value of plasma s100 protein level at admission was 0.59 g / l , and 24 ( 23.5% ) patients had their admission s100 levels higher than 0.532 mean admission values of protein s100 were significantly higher in patients with a permanent neurological deficit , unfavourable outcome or death , in comparison to the remaining patients ( fig . 1 ) . mean admission values of protein s100b in study subgroups plasma s100 protein levels at admission facilitated the identification of patients who later developed a permanent neurological deficit or regained consciousness ( p < 0.0001 ) . the area under the roc curve ( auc ) was 0.82 . with the optimal cut - off point of 0.27 g / l , the sensitivity was 68% , specificity 89% , ppv 85% and npv 74% . the cut - off point of 0.532 g / l was 100% specific , but only 48% sensitive . protein s100 levels at admission also facilitated the identification of patients who later had favourable outcomes ( p < 0.0001 ) . g / l , the sensitivity was 57% , specificity 86% , ppv 85% and npv 58% . the cut - off point of 0.532 g / l was 100% specific , but only 40% sensitive . protein s100 levels at admission also facilitated the identification of patients who later died or survived ( p = 0.0001 ) . g / l , the sensitivity was 45% , specificity 97% , ppv 90% and npv 73% . the cut - off point of 0.532 g / l was 90% specific , but only 48% sensitive . admission plasma s100 protein levels of patients assigned to various categories of outcome roc curves for various binary outcomes the results of our study indicate that protein s100 b assessed at admission to the medical intensive care unit may be useful in predicting neurological outcome . although this idea is not new , most studies originating from the intensive care area to date focus on patients following cardiac arrest [ 3 , 5 , 12 , 15 , 16 ] . in a comprehensive meta - analysis of the use of biomarkers after cardiac arrest , shinozaki et al . presented numerous studies confirming that protein s100 was useful in neurological prediction . our target group , however , was more diverse , as we aimed to answer a practical question , whether protein s100 may be used as a universal biomarker at icu admission . in our study , approximately half of the patients suffered a cardiac arrest before admission ; nevertheless , as many as 78% were unconscious at admission to the icu due to various , frequently unknown reasons ( sedation , prolonged periods of hypoperfusion , the need for urgent intubation in a general ward , etc ) . the period between the event with the potential to cause unconsciousness or brain damage and the icu admission was variable ( 17 days ) . patients were admitted with a limited spectrum of diseases ( mainly cardiac patients , excluding trauma ) but in varying state . our general icu is not entirely typical , as it is located in a hospital with a very active cardiology and cardiac surgery department , with no emergency surgical or trauma admissions . it is therefore not surprising that as many as 39 patients were admitted to the icu with various complications of myocardial infarction , most commonly following in - hospital or out - of - hospital cardiac arrests or due to cardiogenic shock . another 23 admissions were linked to cardiac surgical procedures 3 patients were admitted due to acute haemodynamic instability before surgery , whilst 20 patients were admitted postoperatively , mainly due to neurological complications . to our knowledge , protein s100 has never been tested in such a heterogeneous population . however , it has been confirmed that this biomarker may be potentially useful in the assessment of patients admitted with head injury , subarachnoid haemorrhage , severe sepsis , co intoxication , and in patients on extracorporeal life support . we are well aware of the fact that the inclusion of a variety of neurologic pathologies that included acute myocardial infarction , complications after cardiac surgery , encephalitis , hepatic carcinoma , alcohol intoxication , focal ischaemic stroke , and others into one group may be considered an important limitation of our study . on the other hand , each patient admitted to the icu in a critical condition may already have a brain injury , such a population would always be heterogeneous , and the time period between the event ( likely to cause brain damage ) and icu admission would always be variable ( and often unknown ) . for the icu use , it is extremely important to know which factors can affect plasma levels of protein s100 in critically ill patients . it has already been confirmed that the prognostic potential of protein s100 is not affected by the type of sedation and hypothermia , but the blood levels were higher in the presence of low systemic pressure , ph and haemoglobin in this population . increased plasma levels of this biomarker our main aim was to investigate whether protein s100 may serve as a prognostic tool in a heterogeneous population of patients admitted to the medical intensive care department . we hypothesized that since the mechanism of potential neurological injury in the period prior to icu admission is usually due to global cerebral hypoperfusion , protein s100 may prove useful in this setting . thus , the results of many studies on the use of protein s100 following cardiac arrest may potentially be extrapolated to our population . we assessed the prognostic power of protein s100 in three different aspects , as previously proposed by shinozaki et al . , creating a dichotomous outcome of permanent neurological deficit or restoration of consciousness , unfavourable or favourable outcome , and death or survival . in many previous studies , blood samples were taken many times , usually at regular time intervals . as a result , conclusions were based not only on the absolute values of protein s100 but also on the fluctuations of plasma levels over time . in addition , the studied groups of patients were usually more homogeneous . there is a frequent need to admit patients whose deterioration was overlooked in general wards , and whose admission to the icu was preceded by a dramatic and unclear event . patients may sometimes be sedated or even paralysed ( due to recent emergency intubation ) . our aim was to assess whether a single result taken at admission could identify such neurological damage . this simplistic approach was based on the fact that most of the valuable tests for the presence or absence of a condition or a disease are usually performed only once ( obviously best at admission ) . in our study protein s100b was able to reliably predict permanent neurological deficit or restoration of consciousness as well as unfavourable or favourable outcome , and even but to a lesser extent death or survival ( although it was obviously not intended for this purpose ) . regarding the first dichotomous outcome , we were able to confirm that in a heterogeneous population of patients admitted to the icu , plasma s100 protein levels at admission facilitated the identification of patients who later developed a permanent neurological deficit or regained consciousness , with the optimal cut - off point of 0.27 g / l . the specificity corresponding to this cut - off value , however , was only 89% . in a study by zingler et al . , specificity was fixed at 100% , creating a cut - off value as high as 5.2 g / l rarely seen in clinical practice . such a radical approach is not necessary , as protein s100 should only suggest the prognosis , and we believe nobody would ever withdraw life - sustaining treatments on the basis of s100 results alone [ 4 , 9 ] . slightly more comparable results ( cut - off value 0.7 g / l , specificity 85% ) were obtained by hachimi - idrissi et al . . in this study , however , a very significant difference in mean values was found between patients who regained consciousness ( 0.8 g / l ) and those who remained comatose ( 4.7 g / l ) in our study the corresponding values were 0.2 g / l and 1.0 plasma s100 protein levels at admission facilitated the identification of patients who later had favourable outcomes , defined as both survival and restoration of consciousness . this is extremely important , as out of 45 patients who were unconscious at admission and survived in the icu , 19 ( 42% ) were discharged to long - term facilities being either minimally conscious or in a persistent vegetative state ( unfavourable outcomes ) . again , we were able to demonstrate that admission protein s100 was useful in predicting such outcomes with an optimal cut - off value of 0.27 a similar design was found in three studies [ 3 , 5 , 11 ] , although the authors worked with a homogeneous post - cardiac arrest population and only two of them presented their cut - off values ( 0.76 g / l and 0.4 g / l ) . lastly , in our study plasma s100 protein levels at admission enabled the identification of patients who later died or those who survived , although the predictive power was not as high as in the case of the previous two outcomes . this was to be expected , as 10 patients who later died in the icu were fully conscious at admission and there were 20 patients with permanent neurological injury in the survival group . g / l , with 45% sensitivity and 97% specificity . a similar design and results are presented in a study published by bttiger et al . in 2001 the cut - off point was 0.2 this is not surprising , as protein s100 is specific to the central nervous system and brain injury is not necessarily associated with death ( and vice versa : lack of brain injury obviously does not guarantee survival ) . it seems to be obvious that the mortality of patients admitted to the icu is mainly determined by their neurological outcome at least in patients after cardiac arrest . in the reality of intensive care , however , survival and favourable outcome do not always go hand in hand , we were able to prove that plasma protein s100b could predict neurological outcome in a heterogeneous population of patients admitted to the medical icu . admission plasma s100b protein levels over 0.532 g / l were 100% specific , but not sensitive for both permanent neurological deficit and unfavourable outcome .
introductionadmission to the intensive care unit ( icu ) may be preceded by dramatic events leading to permanent neurological injury . plasma s100 protein levels are proved to be clinically useful in predicting neurological outcome following cardiac arrest . it is unclear , however , whether this may be extrapolated to a broader population of icu patients.aimto assess the utility of plasma s100 protein in predicting death , permanent neurological damage , or unfavourable outcome at admission to the intensive care unit.material and methodsthe concentration of plasma s100 protein was established in 102 patients on admission to the icu , regardless of their neurological status and the reason for admission . the majority of patients were admitted with various cardiac diseases , excluding trauma patients . the patients were classified into three groups with the following binary outcomes : permanent neurological deficit or restoration of consciousness ; unfavourable outcome ( death or survival with permanent neurological deficit ) or favourable outcome ; and death or survival.resultsplasma s100 protein levels at admission facilitated the identification of patients who later developed a permanent neurological deficit or regained consciousness ( p < 0.0001 ) . all patients with plasma s100 protein over 0.532 g / l at icu admission either developed a permanent neurological deficit or had an unfavourable outcome ( death or survival with permanent neurological deficit ) . however , sensitivity for this cut - off value was only 48% and 40% , respectively.conclusionsplasma s100 protein levels over 0.532 g / l are specific but not sensitive for both permanent neurological deficit and unfavourable outcome when assessed in a heterogeneous population at admission to the icu .
given the ongoing incidence of human immunodeficiency virus ( hiv ) infection , thanks to the effectiveness of antiretroviral therapy ( art ) , especially its well - known subclass of protease inhibitors ( pis ) that are coming up every day , hiv - infected patients are going to live longer than ever before . in addition to the special healthcare that is essential in this population at an older age , metabolic alterations and organ function deterioration may neccesitate another concern in this regard . with the advent of the highly active antiretroviral therapy ( haart ) , the history of hiv - related complications has been splitted in terms of hematological parameters and biochemistry , as these parameters have been shown to be affected in relation to the long - term administration of this class of drugs.[36 ] in addition , hematological alterations , including diminished white blood cells , thrombocytopenia , and decreased red blood cells ( anemia ) have been already reported in patients diagnosed with the acquired immunodeficiency syndrome ( aids ) regardless of the antiretroviral therapy . this is besides the abnormal pattern of lipid profile already demonstrated in hiv - infected subjects.[347 ] bone marrow failure occurs apparently in association with type-1 hiv infection and by impacting on hematopoiesis , cytopenia is commonly seen in this population . with the increasing number of hiv - infected patients who have access to haart hence , it is of absolute importance to pay attention to this subject not only due to the alteration of parameters , but for the sake of its impacts on hiv - related mortality and progression of the viral infection to the more advanced stages of the disease . although there are a large number of studies around the subject of hematological alterations in patients with hiv infection , such reports does not exist in iran . also , it seems that different studies with their small size have only assessed one aspect of these evolutions and not all the hematological changes have been brought into the circle . besides , the increasing incidences of hiv infections that are occurring in our population necessitate more attention in this regard , before such issues become prevalent in the country just like they did , some years ago , in the rest of the world . the aim of our case - control study was to determine the hematological alterations , lipid profile patterns , and some of the other biochemical elements ( micronutrients ) in the hiv - infected population , by referring to an academic referral hospital in tehran , the capital of iran . our case - control study was carried out prospectively at imam complex , a major referral hospital in tehran , the capital of iran , affiliated to the tehran university of medical sciences ( tums ) . a group of 114 patients already diagnosed as hiv - positive cases referring to the center of high - risk behaviors from january 2011 to june 2011 were included in the study . the diagnosis was made based on western blotting , the enzyme - linked immunosorbent assay ( elisa ) , and the polymerase chain reaction ( pcr ) . the control group comprised of 114 cases with negative results for complete hiv testing performed at the imam complex in tums , tehran , iran . patients with a history of serious medical diseases including autoimmune disease , corticosteroid administration , previous diagnosis of viral infections , malignancy , pregnancy , gastrointestinal tract ( gi ) disorders , including malabsorption , children ( age < 18 years old ) , patients who were receiving antibiotics in the prior two weeks , and patients who could not to be evaluated by western blot were excluded from the study . five milliliters of clotted blood and 3 ml of anticoagulated blood by ethylenediaminetetraacetic acid ( edta ) were obtained by needle aspiration from a circumferentially and superficially sterilized vein , and were sent to the laboratory of the hospital later . as the collection of serum samples reached the desired number , the hematological parameters , lipid profiles , and biochemical elements were measured at room temperature for each patient . anticoagulated blood was also tested in terms of cd4 + and cd8 + lymphocyte counts by the flow cytometry device ( fcm ) ( partec , japan ) . by employing the colorimetric enzymatic method and the precipitation techniques , the serum level of tg , hdl , and ldl were determined explicitly . data were analyzed using spss for windows ( version 19.0 , chicago , il ) . the pearson correlation was calculated to compare the relationship of parameters between the hiv - positive and hiv - negative groups . the t - test was also employed to analyze the relationship between the hematological parameters and other biochemical profiles with cd4 + cell count , cd8 + cell count , and wbc count . analysis of variances ( anova ) was the test of choice in assessing the relationships between cd4 + , cd8 + , and wbc categories ( sub - divided into more categories by defining the cell count levels ) and other hematological and biochemical parameters . values were deemed significant at p < 0.005 and correlations received their own level of significance at values less than 0.01 or 0.05 . the study was approved by the research ethics committee of the tehran university of medical sciences ( tums ) and informed consent was obtained from each patient before entering the study . a total of 228 consecutive patients were enrolled in our study , 114 in the case group and 114 in the control group . the mean sd of all the variables are summerized in tables 1 and 2 . as mentioned earlier , two groups were similar in terms of sex , age , and other sociodemographic features . pattern of hematological parameters , lipid profiles , and micronutrient elements based on hiv status association between cd4 + categories and mean sd of hematological variables in hiv - positive patients the hematological parameters and biochemistry elements were measured in each patient and were compared between the groups [ tables 1 and 2 ] . among the hematological parameters ( mean sd : hiv negative vs. hiv positive ) , cd4 + cell count ( cd4 + : 981.37 261.21 vs. 292.59 189.57 ) , cd8 + cell count ( cd8 + : 964.08 267.61 vs. 772.71 380.48 ) , white blood cell count ( wbc : 6881.02 1293.76 vs. 5444.28 1999.25 ) , red blood cell count ( rbc : 4.89 0.51 vs. 4.34 0.86 ) , hematocrit ( hct : 44.34 2.72 vs. 40.38 5.14 ) , mean corposcular volume ( mcv : 92.47 4.26 vs. 94.77 12.93 ) , mean corposcular hemoglobin ( mch : 29.09 1.71 vs. 33.17 5.37 ) , mean corposcular hemoglobine concentration ( mchc : 32.90 1.86 vs. 34.89 1.52 ) , platelet count ( plt : 275.39 81.17 vs. 200.57 79.34 ) , eosinophil count ( eos : 1.71 0.83 vs. 184.03 152.78 ) , and basophile count ( baso : 1.35 .716 vs. 25.43 15.52 ) obtained significnat differences between groups ( p < 0.05 ) . considering the biochemistry parameters ( mean sd : hiv negative vs. hiv positive ) [ table 2 ] , trigelicerides ( tg : 184.99 21.37 vs. 141.71 85.52 ) , total cholesterol ( ch : 190.19 30.94 vs. 199.02 125.42 ) , high density lipoprotein ( hdl : 63.50 21.12 vs. 44.97 28.43 ) , low density lipoprotein ( ldl : 120.53 23.55 vs. 88.12 24.43 ) , magnesium ( mg : 2.20 0.34 vs. 2.74 0.95 ) , zinc ( zn : 97.42 11.08 vs. 149.32 48.27 ) , phosphorus ( p : 3.29 0.52 vs. 3.63 1.14 ) , and adenosin deaminase ( ada : 27.39 16.92 vs. 8.99 4.492 ) were significantly different in hiv - positive patients compared to the controls ( p < 0.05 ) . hiv - positive patients were divided into five categories based on the level of the cd4 cell count per milimeter : less than 50 as category 1 , 50 100 as category 2 , 100 200 as category 3 , 200 500 as category 4 , and more than 500 cell count as category 5 . a similar division was done for hiv - positive patients based on the cd8 + count ( less than 100 , 100 200 , 200 500 , and more than 500 ) , and wbc count ( less than 1200 , 1200 3500 , and more than 3500 ) with four and three groups , respectively . according to the five categories of cd4 + , statistically significant differences were observed in cd8 + , white blood cells ( wbc ) , eosinophils ( eos ) , and alkaline phosphatase ( alkp ) in relation to the cd4 + numbers ( p < 0.05 ) [ table 3 ] . considering the four categories for cd8 + as a level of division , the hematological variables were compared between the groups ; the same was done for three categories of wbc with different levels . the former showed statistically significant differences in cd4 + , wbc , platelets ( plt ) , and basophils ( baso ) , in relation to the cd8 + numbers , and the latter revealed similar significant differences in cd4 + , cd8 + , wbc , rbc , hematocrit ( hct ) , mean cell hemoglobin ( mch ) , mean cell hemoglobin concentration ( mchc ) , and eos ( p < 0.05 ) in relation to wbc count [ tables 4 and 5 ] . association between cd8 + categories and mean sd of hematological variables in hiv - positive patients association between wbc categories and mean sd of hematological variables in hiv positive patients correlation between hematological parameters , biochemical profiles , and micronutrient elements with cd4 + cell , cd8 + cell , wbc , and rbc count in hiv infected patients pearson correlation was also calculated for detecting the association between constant values of cd4 + , cd8 + , wbc , and rbc , with other constant variables , and were deemed significant at the related levels of < 0.01 or < 0.05 . the tables show a positive and significant correlation between cd4 + , cd8 + , and wbc ; rbc and hct ; cd8 + and plt ; eos , wbc , and rbc ; baso and wbc ; alkp and wbc ; and a negative and significant correlation between rbc , mcv , mch , and mchc ; wbc and mchc ; ldl and rbc ; and alkp and cd4 + . many of blood parameters were assessed in this study to find the impact of hiv infection and the progress of the diseases due to these parameters ; with a larger sample size of study population compared to the previous ones ; this study could be unique in its type . the hematological parameters as well as lipid profiles and micronutrient elements were assessed in our analysis , with special attention to adenosine deaminase ( ada ) . there are sufficient evidences regarding the hematopoietic alterations in hiv - infected patients and its advanced stages of aids diseases.[6891113 ] anemia , leukopenia , lymphocytopenia , granulocytopenia , and thrombocytopenia are common findings among this population . bone marrow changes also add to these alterations and show the effect of hiv infection to be more fundamental than a peripheral interference ; in fact , pancytopenia is always persistent in advanced stages of hiv infection . however , this is not always that simple , as it has been reported that anemia and other hematological changes occur more severely in some of the endemic regions like southern africa , rather than regions in the united states , suggesting that more precaution to be applied in interpreting the results . dislipidemia , including alterations in the metabolic profiles of blood biochemistry , has also been discussed in the literature ; this includes lower triglycerides ( tg ) , hdl , and ldl . similar to hematological alterations , the lipid profile also has a complexity of an inter - region pattern of change , as mondy et al . have reported a diminished level of hdl and an elevated level of tg among us hiv - positive population , while buchacz et al . have shown that hiv - positive patients in uganda have uncommon elevations in their serum levels of tg , ldl , and cholesterol ( ch ) ; all these point to a very important lesson , and that is , that the wide spectrum of variation between hiv - related changes around the world , neccessitate close attention in treating hiv - infected patients at each seperated setting . riddler et al . have shown that lipid changes could be divided into two different patterns ; one before the initiation of antiretroviral therapy ( decreased serum levels of ch , ldl , and hdl ) and another pattern of changes would occur afterward ( starting to increase the levels of ch , ldl , and hdl , to reach the pre - infection levels after a minmum of three years ) ; thus , a lot more studies are needed to reveal the underlying mechanism of all these inconsistencies , to reach a consensus around this issue . in addition , it would be beneficial to assess the serum levels of antiretrovial medications and metabolites , in association with patterns of lipid profile . in our study , cd4 + , cd8 + , wbc , rbc , hct , and plt were lower in hiv - positive patients , while mcv , mchc , eos , and baso were significantly higher , compared to the control group . as described earlier , the hematopoiesis change in hiv - infected patients and the bone marrow of these cases have apparently shown significant myelodysplasia and subsequent supression ; so it is not far from the mind that the hematopoietic parameters have been diminished in their levels and rbc morphology has been changed similar to the megaloblastic alterations . thrombocytopenia is one of the greatest manifestations of hematopoiesis impairments in association with hiv;[1821 ] however , many underlying mechanisms have been explained with uncertainty in this regard . anemia has been documented to occur in association with hiv infection by one of the following mechanisms : dysfunction of myloid progenitor cells in the bone marrow , antibody secretion against erythroid antigens , and impairment of the precursors metabolisms . this explains the lower number of rbc counts among hiv - positive patients and an increased mcv in them , as well as , raised mch and mchc . involvment of progenitors in their early stages of division is also suggested by other studies.[2224 ] leukopenia is another hematological manifestation in hiv - positive patients which can be in direct association or inversly related to neutropenia . however , as our population was selected from among the uncomplicated patients referring to the clinic for behavioral disorders , with no serious concerns of infectious disease ( i.e. , is related to hiv - associated neutropenia ) , we did not intend to measure the absolute netrophile count ( anc ) . basophile and eosinophil counts were also correlated with hiv infection and cd4 + counts , as this may be due to the increased risk of opportunistic and parasitic infections and dysregulation of the immune system in hiv - infected subjects . in case of lipid profiles , triglycerides ( tg ) , high density lipoprotein ( hdl ) , and low density lipoprotein ( ldl ) were lower and total cholestrol was significantly higher in the hiv - positive group ; a varying spectrum has been defined for patterns of lipid profile in association with hiv infection . these reports are even more complexed with initiation of antiretriviral regimens , as this medication shows certain dyslipidemic impacts . in our study , the complex pattern of lipid profile alterations can be explained by the uncertain pattern of antiretroviral therapies each patient has recieved . has also concluded that such patterns can be unique to any different compound that hiv - infected patients are recieving as daily therapies . our results also showed that magnesium ( mg ) , zinc ( zn ) , and phosphorus ( p ) were higher in hiv - infected persons . this was in contrast to the previous reports , which revealed with confidence that hiv infection was a cause of micronutrient deficiency , and such supplements should accompany the antiretroviral therapies that the indicated patients were taking.[2729 ] although there were evidences about the toxic and adverse effects of high levels of mineral supplements in hiv - infected individuals , it was of great importance that the deficiency of such elemnts should be wisely approached . the higher levels of some of these minerals in the serum of hiv - infected patients in our study may be due to the effect of the highly consumed nutritional supplements that are becoming prevalent in developing countries , as the people might domestically have an idea of enriching the sick people by adding nutritional supplements in their diet . however , this is one of the hypotheses that should be examined by documenting studies . also it is wise to pay special attention to the higher levels of serum calcium , due to the hyperparathyroidism in hiv - infected heroin addicts ; this by a similar mechanism may interfere with the metabolism of body minerals and develop higher levels of blood micronutrients . however , we must notice that this level of abnormality does not evoke an intervention , and it has still remained as a normal range of our referal laboratory . in addition , it has been expressed that haart is capable of repleting the reservoir of micronutrients within the bodies of hiv - infected patients , especially when observational studies with a large sample size and rational period of follow - up are established . the higher levels of serum micronutrient elements in our study may also be associated with the uncontrolled administration of supplements in the theraputic diets of patients . before intending to recommend nutritional supplements to the patients suffering from hiv infection , there must be more evidence regarding the benefits of such an approach , including lowering the mortality and transmission rates of hiv infection . adenosin deaminase wassignificantlylower in association with hiv infection ; previous studies have well described the increased level of ada in patients suffering from inflammatory processes , infections , immunodeficiency syndromes , and aids . such an inverse correlation has been also detected in association with cd4 + cell count . alkaline phosphatase ( another variable among our results ) showed an increased level in its serum concentration , but did not recieve statistically significant differences . activation of lymphocytes was seen to increase the production of alkp in hiv infection , which was similar to and in line with our results . as limitations of our study , we should point to the small sample size compared to the larger and multinational studies and the unicentral nature of our investigation ; besides , the percise serological measurments along with more attention to the serum levels of more blood elements should be included . attention should also be paid to the antiretroviral therapies , as these medications are responsible for many of the remaining questions . as mentioned earlier in this manuscript , further studies should target the exact investigation of viral load and viral activity , the regimen of antiretroviral therapies , and their associations with blood parameters from hematological to metabolic , lipid , and micronutrient profiles , with a larger sample size and in a multicenter setting . our study showed that like similar studies from the hiv - endemic regions , hiv infection affects hematopoiesis by diminishing the hematological productivity parameters and increasing rbc - related morphology ; in addition , we showed a different pattern of lipid profile ( decreased tg , ldl , and hdl , and increased ch ) and serum micronutrients ( elevated concentration of serum trace elements ) in our hiv - positive population .
background : there is strong evidence regarding the patterns of alteration in the blood parameters in human immunodeficiency virus ( hiv)-positive patients . however , no consensus has been reached in this regard and the results vary from different regions and studies . our study aims to report these patterns in a population of hiv - infected patients in iran.materials and methods : we studied two groups of hiv - infected and hiv - negative patients . one hundred and fourteen subjects were enrolled in each group ; blood parameters were compared in these two.results:variables of hiv - negative patients changed as follows compared to hiv - positive patients : with regard to the hematological variables , cd4+ ; cd8+ ; wbc ; rbc ; hct ; mcv ; mch ; mchc ; plt ; eos ; and baso ; and among the metabloic parameters , tg ; ch ; hdl ; ldl , mg ; zn ; p ; and ada , which showed significnat differences between groups ( p < 0.05).conclusion : we conclude that hiv infection affects hematopoiesis by diminishing the hematological productivity parameters and increasing red blood cell related morphology , along with a different pattern of lipid profile ( decreased tg , ldl , hdl , and increased ch ) and serum micronutrients ( elevated concentration of serum trace elements ) in our population of study .
clostridium perfringens ( c. perfringens ) is a ubiquitous bacterium broadly distributed in environment . it also presents as a normal intestinal flora of humans and domestic animals . c. perfringens is an arsenal producing a wide range of bacterial toxins , of which genes encoding 17 distinct toxins have been identified in the chromosome or plasmids in this bacterial species . according to its capacity to produce four major types of alpha , beta , epsilon , and iota toxins , bacteria of this species historically , this species of bacteria was first found as a cause of food poisoning by mcclung in mid-1940s , and it thus has been linked to gastrointestinal ( gi ) diseases in human . c. perfringens beta toxin ( cpb , also known as cpb1 ) is a lethal toxin produced by c. perfringens type c and type b , which is a 35 kda protein able to form pores on membranes of susceptible cells , leading to cell distension and lysis . the 50% lethal dose of cpb was determined at 310 ng / kg when it was administered intravenously ( i.v . ) . in addition to cpb1 , c. perfringens was found to produce another beta toxin , the beta2 toxin ( cpb2 ) with a molecular weight ( mw ) of ~28 kda , which was first identified from a c. perfringens strain isolated from a piglet that died of necrotizing enterocolitis . intriguingly , the cpb2 has no significant homologies with other clostridium toxins , and the mode of its action has not been elucidated yet . despite its encoding gene , cpb2 was found on plasmids of c. perfringens isolates [ 5 , 6 ] . pathologically , both cpb1 and cpb2 are thought to be important virulent factors of the necrotic enteritis in humans and animals , particularly in piglets [ 4 , 7 , 8 ] , and a presence of cpb2-positive c. perfringens strains in the intestine has been associated with intestinal diseases in humans , ruminants , horses , and piglets [ 11 , 12 ] . it has been reported that over 97% of c. perfringens isolates from pig diarrhea could produce cpb2 , in addition to c. perfringens strains producing alpha toxin ( cpa ) . both cpa and cpb2 were found in horses suffering from typhlocolitis and other intestinal disorders , particularly those treated with the aminoglycoside antibiotic gentamicin . equally noteworthy , the presence of cpb2 gene was also reported in c. perfringens isolated from humans [ 9 , 13 ] . in a study conducted by carman et al . , c. perfringens isolates carrying a cpb2 gene were found to colonize in 8 of 43 ( 23% ) healthy subjects . in another study , fisher et al . reported that the cpb2 gene was detected in 75% of c. perfringens isolates from cases of antibiotic - associated diarrhea ( aad ) and sporadic diarrhea , among which 97% of these isolates could produce cpb2 in vitro . these results provide conflicting evidence as to whether cpb2 is associated with human enteric diseases in clinical settings , although c. perfringens isolates bearing genes of cpb2 and c. perfringens enterotoxin ( cpe ) , cpe , have been linked to human antibiotic - associated / sporadic diarrhea ( aad / sd ) . in these clinical isolates , the production of cpb2 as an accessory toxin in human cpe - positive c. perfringens type a bacteria needs to be further confirmed [ 9 , 14 ] . similarly , ronco et al . recently compared genomes of c. perfringens isolates from healthy and diseased poultry and pigs , and they found that all isolates from healthy ( n = 4 ) and diseased ( n = 6 ) chickens , healthy ( n = 4 ) and diseased ( n = 5 ) turkeys , and diseased pigs ( n = 5 ) harbored the cpb2 gene . these studies clearly imply that cpb2 may be a virulent factor in enteric diseases [ 4 , 11 ] . however , unlike c. perfringens alpha toxin ( cpa ) , the pathogenic role of cpb2 in the pig enteric disease caused by an infection of c. perfringens type c isolates has not been characterized yet [ 4 , 7 , 8 ] , and its cytopathological functions and mechanisms of cytotoxicity are also currently unknown , largely owing to a difficulty in the purification of cpb2 toxin and a lack of antibodies specifically against the toxin . on a view of above studies , it is a necessity to have a purified cpb2 toxin and antibody to this toxin for further investigation of its biological functions and pathological mechanisms . in the present study , we reported characterizations of purified recombinant cpb2 toxin ( rcpb2 ) and monoclonal antibodies ( mcabs ) against cpb2 , by determining the integrity and cytotoxicity of rcpb2 and immunological reactions of mcabs employed in immunoblotting , immunofluorescent , elisa , and neutralizing assays . the results suggest that the rcpb2 toxin expressed by e. coli has biological functions , and the characterized mcabs can be used for studies of cytotoxic mechanism and determination of cpb2 in clinical settings . these reagents thus will be useful tools for investigation of biological functionality and pathogenic mechanism of cpb2 in future . pmd18-t vector , dna restriction enzymes , taq dna polymerase , and t4 dna ligase were the products of neb ( new england biolabs inc . escherichia coli bl21(de3 ) cells were purchased from emd millipore ( billerica , ma , usa ) . clostridium perfringens china isolates c58 - 1 ( type b ) and c59 - 44 ( type c ) were purchased from the china institute of veterinary drug control ( beijing , china ) . the intestinal epithelial cell line ncm460 was procured from the national centre for cell science ( shanghai , china ) . bacterial genomic dna from the c. perfringens type c strain china isolate c59 - 44 was isolated using a bacterial genomic dna isolation kit ( tianqen biological inc . , china ) . based on the cpb2 dna sequence deposited in genbank ( genbank : ay609177.1 ) , the following primer sets were designed and used for amplifying the encoding regions of the cpb2 gene : cpb2-f : 5cggaattctaatgaaagaaatcgacgcttat3 and cpb2-r : 5gaatgcggccgctgcacaatacccttcacc3 , and restriction sites of ecori and not i were included in the 3-ends of the primers , respectively . the sequenced confirmed cpb2 gene dna was further in - frame subcloned into the upstream of his - tag of ptig - trx bacterial expression vector using appropriate restriction sites ( ecori and noti ) . the resultant plasmid was designated as ptig - trx - cpb2 ( figure 1(a ) ) and transformed into e. coli bl21(de3 ) cells for induction of the expression of his - tagged cpb2 protein . the above ptig - trx - cpb2 plasmid was transformed into e. coli bl21 ( de3 ) competent cells and selected with ampicillin ( amp ) antibiotics . single bacterial colonies were isolated and cultured in the lb medium containing 50 g / ml of ampicillin in a 37c incubator with shaking overnight . 1.0% ( v / v ) of the seed culture was inoculated into lb broth medium containing 50 g / ml of ampicillin with a 37c incubation to log phase ( determined by optical density 600 nm [ od600 = 0.6 ] ) . iptg ( isopropyl -d-1-thiogalactopyranoside ) was added at a final concentration of 1 mm and the mixture was cultured for an additional 4 h. following the iptg induction , the bacterial cells were harvested by centrifugation and the bacterial pellet was resuspended in 10 pellet volumes of lysis buffer ( 20 mm tris - cl buffer , 50 mm nacl , ph 8.5 ) . the supernatants were analyzed for expression of the recombinant protein on 12% sodium dodecyl sulphate polyacrylamide gel electrophoresis ( sds - page ) . since the rcpb2 expressed in ptig - trx vector system was his - tagged , it could be purified using nickel - nitrilotriacetic acid ( ni - nta ) columns . briefly , the iptg - induced bacterial cells harboring ptig - trx - cpb2 plasmid were harvested by centrifugation at 10,000 g for 20 min at 4c . the pellet was resuspended in 10 volumes of pellet of lysis buffer ( 20 mm tris - hcl , 100 mm nacl , ph 8.0 ) containing 10 mg / ml of lysozyme and incubated on ice for 2 hr . after incubation , the cell suspension was sonicated for 10 cycles ( 30 s each with cooling for 30 s between the cycles ) ( sonics , usa ) prior to the cell extraction , followed by centrifugation at 12000 g for 20 min at 4c . the supernatant ( 10 ml ) was purified using a ni - nta column ( ge healthcare , usa ) by a gradient hplc ( akta purifier ph / c10 ) . following the binding to column , the column was washed with lysis buffer containing 10 mm imidazole . elution was performed by the use of buffer containing increasing concentrations of imidazole ( 10 , 75 , and 100 mm ) . endotoxin of the purified rcpb2 proteins was removed using a toxin eraser tm endotoxin removal kit ( genscript , usa ) before use . ten potential epitopes of cpb2 protein were selected for the generation of murine hybridoma cell lines producing monoclonal antibodies ( mcabs ) . these epitopes were predicted based on an in - house software developed by abmart inc . peptides of 12 amino acids ( aas ) of each epitope were synthesized and consequently integrated into an abmart antigen system to generate mixture of antigens for further immunization of mice and screening mcabs . immunized mice were used for generation of hybridoma cell lines producing mcabs as described elsewhere . hybridoma cell lines were injected into balb / c mice to produce ascites containing mcabs . the expression and purity of protein of interest were ascertained by resolving the protein on a 12% sodium dodecyl sulphate polyacrylamide gel ( sds page ) , followed by coomassie g250 blue silver staining . the specificity and integrity of proteins were determined by an immunoblotting assay using mouse antibodies specifically against cpb2 toxin ( self - generated by abmart as mentioned in section 2.5 ) , followed by a secondary irdye 800cw goat anti - mouse or irdye 680cw goat anti - rabbit ( li - cor ) . antibodies against human beta - actin , caspase-3 , and bax were products of proteintech ( rosemont , il , usa ) . the activity of the rcpb2 proteins was evaluated using ncm460 cells essentially as previously described . the rcpb2 toxin was diluted in rpmi-1640 medium modified supplemented with 10% fetal calf serum ( fcs ) and added to the cells followed by incubation at 37c for 12 h. the control wells were treated with an equal volume of the medium only . the toxicity of rcpb2 was accessed by determining the cell viability of the ncm460 cells by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assay as described everywhere . the dose of rcpb2 that causes 50% cell death ( cytotoxicity 50 , ct50 ) was defined as the toxin concentration that resulted in 50% reduction of the absorbance observed with untreated control . since cpb2 is a secreted protein , culture supernatants of the c. perfringens c58 - 1 and c59 - 44 isolates were collected and used for examining the presence of cpb2 protein . for this purpose , c. perfringens was grown anaerobically overnight at 37c in schaedler anaerobe broth ( oxoid limited , uk ) and for cpb2 production . the culture supernatant was collected by centrifugation at 12,100 g for 20 min at 4c . the supernatant was then filtered using a 0.22 m nalgene bottletop filter ( merck millipore company , germany ) . samples were used for sds - page and western blot analysis of secreted proteins and stored at 20c for future use . the rcpb2 toxin protein or the culture supernatant and cell lysis of c. perfringens c58 - 1 ( type b ) and c59 - 44 ( type c ) strains the resolved proteins were transferred to a pvdf membrane using a bio - rad mini - transfer apparatus ( bio - rad , hercules , usa ) . after blocking with 5% bsa in tbs ( 20 mm tris - hcl , 137 mm nacl , ph 7.6 ) for 1 h at room temperature , the membrane was first incubated with each of mcabs derived from distinct hybridoma cell lines . the ascites containing mcabs were diluted in tbst ( 20 mm tris - hcl , 137 mm nacl , 0.1%tween-20 , ph 7.6 ) . after extensive washing , the membrane was incubated with secondary irdye 800cw goat anti - mouse ( li - cor ) . the ncm460 cells cultured in collagen - coated cover slides were treated with rcpb2 toxin for different times ( 5 min , 30 min , 2 h , 4 h , 6 h , and 12 h ) for evaluating the binding of rcpb2 to cell membranes . the rcpb2-treated cells were fixed with 4% paraformaldehyde in pbs at room temperature for 15 min , washed in pbs for 3 5 min , and permeabilized with 0.3% triton x-100 for 10 min at room temperature . nonspecific antibody binding was blocked using 5% normal donkey serum in pbs for 1 h at room temperature , after which primary antibodies against cpb2 toxin were applied at a 1 : 100 dilution in pbs and incubated at 4c overnight . primary antibody binding was detected using the fitc - labeled donkey - anti - mouse igg secondary antibody ( 1 : 500 ) ( thermo , rockford , usa ) . after extensive washing , cell membranes were mounted by annexin a2 polyclonal antibody ( 1 : 200 ) ( sanying biotechnology , china ) as primary antibody , and rhodamine- ( tritc- ) conjugated goat anti - rabbit igg as secondary antibody ( 1 : 250 ) ( sanying biotechnology , china ) . after extensively washing , the slides were mounted for fluorescence in vectashield mounting medium with dapi ( thermo , rockford , usa ) . images were acquired using a leica tcs sp2 a0bs confocal system and processed on leica confocal software v.2.6.1 ( leica , germany ) . 96-well plates were coated with recombinant cpb2 ( 3 g / ml ) protein in 0.1 mol / l sodium carbonate buffer overnight at 4c . the plates were then blocked with 5% bsa in pbs for 2 h at room temperature to prevent nonspecific binding . after plates were washed with 0.05% tween in pbs , 2-fold series of dilution of mcab ascites to cpb2 were added to wells , and the plates were incubated at 37c for 2 h. followed by being washed with 0.05% tween in pbs , the diluted goat anti - mouse igg conjugated with horseradish peroxidase ( from zhongshan biological inc . , beijing , china ) was added to the immunoplates and incubated for 1 h at room temperature . absorbance was read at 450 nm after quenching the wells with 50 l of 2 mol / l h2so4 . the capacity of monoclonal antibodies to neutralize the cytotoxicity of rcpb2 toxin was determined by an in vitro neutralization assay . briefly , 2x ct50 ( 30 g / ml ) of rcpb2 toxin was mixed with 200 l of 50x diluted ascites of monoclonal antibodies . the mixtures of mcab and rcpb2 toxin proteins were then applied into the cells and incubated at 37c for additional 12 h. the control wells were treated with an equal volume of rpmi-1640 supplemented with 10% fcs . all data collected in this study were obtained from at least three independent experiments for each condition . statistical evaluation of the data was performed by a t - test for comparison of differences between two groups . a difference was considered to be a statistical difference at a p value of < 0.05 . by employing general dna cloning protocols and a pcr strategy , the cpb2-toxin encoding gene ( cpb2 ) was in - frame cloned into the ptig - trx bacterial backbone plasmid to generate a vector expressing cpb2-his tag fusion gene ( figure 1(a ) ) . e. coli bl21 ( de3 ) cells harboring ptig - trx - cpb2 plasmid were induced for transgenic expression in the presence of iptg . sds - page analysis showed an expression of recombinant his - tagged cpb2 protein with expected mw of ~28 kda in the soluble fraction of bacterial cells , which was able to bind to ni - nta column and be purified by hplc akta purifier ph / c10 system with a gradient imidazole ( lanes 57 in figure 1(b ) ) . the peak of purified protein of interest was observed in the imidazole - eluted fraction at concentration of 75 mm ( figure 1(b ) ) . immunoblotting analysis further revealed that the purified proteins were specifically reacted with 1e23 antibody ( 1 : 800 ) against cpb2 ( figure 1(c ) ) . notably , detectable native cpb2 protein was observed in the culture supernatant of c59 - 44 isolate ( lane 9 in figure 1(c ) ) but not in the cell lysate ( lane 8 in figure 1(c ) ) , as determined by the immunoblotting assay ( figure 1(c ) ) . these results suggested that the purity and integrity of rcpb2 generated by this approach could be used for investigation of biological functions of cpb . the cytotoxic activity of purified rcpb2 toxin was assessed in terms of its effects on ncm460 cells by an mtt assay . morphological changes were observed in cells exposed to 20 g / ml of rcpb2 toxin ( figure 2(b ) ) , including rounding up of cells and ultimately leading to cell death , as compared with the untreated control cells ( figure 2(a ) ) . of interest , the degree of 20 g / ml of rcpb - induced cytotoxicity was comparable to the culture supernatant of c. perfringens c59 - 44 strain , as determined by morphological observation . this result indicates that the rcpb2 toxin has a biological activity of cytotoxicity in vitro . mtt assay further revealed a dose - dependent cytotoxicity of rcpb2 on ncm460 cells , but a time - dependent cytotoxicity of this recombinant toxin on cells was only observed at a dosage less than 15 g / ml ( figure 2(d ) ) . the cytotoxic activity was observed at a concentration as low as 5.0 g / ml , and the concentration causing 50% cell death ( ct50 ) was determined at 15 g / ml ( figure 2(d ) ) . flow cytometric analysis showed more frequency of apoptotic cells when they were exposed to rcpb2 , in comparison with untreated cells ( figure 3(a ) ) in addition , the rcpb2-induced cell apoptosis was dose - dependent ( figure 3(b ) ) . intriguingly , rcpb2 exhibited potential to induce an apoptotic cell death rather than a necrotic cell death , as determined by the cytotoxicity assay ( figure 2 ) . in this regard , rcpb2 induced up to 20% cells with apoptotic cell death relative to about 5% of cells with necrotic death when ncm460 cells were cultured in the presence of a dose of ct50 ( figure 3(b ) ) . mechanistically , immunoblotting analysis showed more abundant proapoptotic proteins , including caspase-3 and bax in cells treated with rcpb2 ( figure 3(c ) ) . this data implies an involvement of caspase - dependent apoptotic pathway in cpb2-mediated cell apoptosis . however , the precise mechanism by which cpb2 toxin induced cytotoxicity needs further investigation . in order to further explore biological roles of cpb2 as well as provide a useful tool for detection of cpb2 toxin in clinical settings and investigation of functional mechanisms of this bacterial toxin , mcabs to cpb2 were produced by hybridoma cell lines generated from mice immunized with a mixture of 10 antigenic epitopes that integrated abmart antigen system ( figures 4(a ) and 4(b ) ) . a total of 21 hybridoma cell lines were generated ; among them , clones 1e23 , 2g7 , and 2h7 were identified to cross - react with both native cpb2 and rcpb2 by several immunological assays ( figures 57 ) . mcab 1e23 was derived from cpb2 epitope number 5 which spans aa region of 98109 ( nkeifnvktefl ) , while mcabs 2g7 and 2h7 were generated from mice immunized with epitope number 10 which encompasses aa sequence of 252263 ( tpasirvfgegy ) ( figure 4 ) . of note , these mcabs could detect both rcpb2 and native cpb2 by an immunoblotting assay using purified rcpb2 and supernatants of c. perfringens c59 - 44 isolate ( figure 5 ) . all three selected mcabs showed ability to cross - react with rcpb2 in the immunoblotting assay ; among them , mcab 1e23 exhibited the best immunological reactivity in this assay ( figure 5(a ) ) , which could detect 10 ng ( 0.01 g ) of rcpb2 ( figure 5(b ) ) and thus was used for further analysis in this report . the 1e23 antibody was also capable of detecting native cpb2 in the supernatant of c. perfringens c59 - 44 strain but not c58 - 1 strain by immunoblotting assay ( figure 5(c ) ) . consistently , the cpb2 gene was only amplified in c. perfringens c59 - 44 strain but not in c58 - 1 strain by pcr ( figure 5(d ) ) , suggesting that the undetectable cpb2 in c. perfringens c58 - 1 strain was due to the lack of cpb2 gene . similarly , these antibodies were also able to cross - react with rcpb2 in an elisa , in which mcabs 1e23 and 2h7 displayed a greater affinity with a titration of ascites up to 4000 , relative to mcab 2g7 by this assay ( figure 6(a ) ) . more importantly , all the three tested mcabs exhibited potential to neutralize the cytotoxicity of rcpb2 on ncm460 cells ( figure 6(b ) ) . for in vitro neutralization assay , 2x ct50 of rcpb2 toxin protein ( 30 g / ml ) was preincubated with 50x diluted mcab ascites at 37c for 2 h , and then the mixture was applied on ncm460 cells . results from the mtt assay demonstrated a different extent of protection of cells from cytotoxicity of rcpb2 among these three antibodies ; among them 1e23 was the most powerful in neutralizing rcpb2 cytotoxicity in vitro , which could result in an up to 90% ncm460 cell viability against toxicity of 2x ct50 of rcpb2 as compared with the untreated control cells . viabilities of cells exposed to rcbp2/2g7 , rcpb2/2h7 , and rcpb2 alone were 44% , 61% , and 19% in comparison with the untreated cells , respectively ( figure 6(b ) ) . in an attempt to understand the underlying mechanism of cytotoxicity of cpb2 in vitro , the capacity of rcpb2 to bind to and translocate into cells was determined by an immunofluorescent ( if ) assay using mcabs 1e23 , 2g7 , and 2h7 . the if staining revealed a specific fluorescent staining of rcpb2 in cells probed with mcab 1e23 but not with mcabs 2g7 and 2h7 ( figure 7 and data not shown ) . interestingly , a dynamic translocation of rcpb2 toxin protein into the ncm460 cells was observed with the lapse of time from 5 min to 12 h , as determined by the if assay using antibody 1e23 ( figures 7(a)7(f ) ) . at 5 min of incubation , the rcpb2 protein was only observed in the outer membrane of cells ( figure 7(a ) ) . at 30 min of incubation , the recombinant toxin could be determined in both membrane and cytoplasm of cells ( figure 7(b ) ) and more abundant rcpb2 protein was transported into cytoplasm at 2 h after the incubation ( figure 7(c ) ) , which led to an increased intensity of staining for cell membrane marker annexin a1 but a diminished rcpb2 staining over the time . of note , the majority of rcpb2 protein was found in the cytoplasm but few proteins were still bound to cell membrane at 4 h after incubation ( figure 7(d ) ) . however , rcpb2 toxin only was observed in cytoplasm at incubations of 6 h ( figure 7(e ) ) and 12 h ( figure 7(f ) ) . these observations clearly suggested that the rcpb2 toxin protein could bind to the cell membrane and dynamically translocate into cytoplasm with time . this result further indicated a biological activity of purified rcpb2 and implied the usefulness of mcab 1e23 in studying the functional mechanism of cytotoxicity of cpb2 . necrotic enteritis ( ne ) is a worldwide disease caused by infection of c. perfringens , a ubiquitous anaerobic bacterium that is readily found in soil , dust , feces , feed , poultry litter , and intestinal contents [ 2123 ] . pathologically , varied toxins produced by c. perfringens are main virulent factors of this species of pathogen ; therefore , a better understanding of biological activities and underlying mechanisms of their cytotoxicity will provide an insight into the pathogenesis of c. perfringens infection . however , these studies have been significantly hampered , partially owing to the difficulty in purification of c. perfringens toxins and the lack of their specific antibodies . in the present report , we generated and characterized a recombinant his - tagged c. perfringens beta2 ( rcpb2 ) toxin and mcabs against cpb2 in vitro . our results showed that rcpb2 purified from e. coli had limited extent of cytotoxicity on ncm460 human intestinal epithelial cells ( figures 1 and 2 ) , on which rcpb2 induced more frequency of apoptotic cell death than the necrotic main cell death , at least in part through an apoptotic pathway involved in caspase-3 signaling ( figure 3 ) . in addition , three mcabs produced by hybridoma cells 1e23 , 2g7 , and 2h7 were characterized to be able to cross - react with both rcpb2 and native cpb2 by assays of immunoblotting , elisa , and immunofluorescence ( figures 4 and 5 ) . importantly , these antibodies exhibited a capacity to neutralize the cytotoxicity of rcpb2 on ncm460 cells ( figure 6 ) . more notably , the immunofluorescent staining further revealed an ability of rcpb2 to bind to cell membrane prior to being dynamically transported into cytoplasm ( figure 7 ) . mounting evidence has revealed that a purified bacterial toxin can elicit characteristic symptoms of the diseases caused by infection of the bacteria producing this toxin in experimental animals , a direct implication of the toxin in pathogenesis . despite the fact that native toxin(s ) can be produced by most bacteria in culture , it is difficult to be purified ; production of toxins through recombinant dna technology is thus an advantage as it bypasses the need to culture the pathogen for purification using conventional methods . furthermore , for development of an effective vaccine , it is important for a recombinant protein to retain all properties of its native toxin . in this regard , the purified his - tagged rcpb2 toxin protein generated from an e. coli expressing system in this report retains integrity , cytotoxicity , and capacity to bind to cell membrane of a native cpb2 . these biological activities of rcpb2 were in line with those found in purified native cpb2 derived from a porcine c. perfringens strain and human c. perfringens strain , in which cpb2 showed a cytotoxic activity on human intestinal cells ( i407 ) and human caco-2 cells , respectively . however , a minimal concentration of cytotoxicity for native cpb2 has been reported in great variations , with a range from 0.1 g / ml to 20.0 g / ml . such a variation in doses required for cytotoxicity was due to the instability , and/or it might be a cell context - dependent manner of cytotoxic mechanism of this type of toxin . in a previous work by gibert et al . , the authors found that the native of cpb2 failed to significantly disrupt the cytoskeleton of human intestinal ( i407 ) cells , which was unlikely for other toxins produced by c. perfringens species . this notion was supported by a recent study on the cytotoxicity of cpb2 toxin of human and porcine cpb2-harbouring c. perfringens . in this report , the authors demonstrated that there was no significant role for cpb2 in the cytotoxicity of human caco-2 cells and porcine ipi-21 cells induced by human and porcine cpb2-harbouring c. perfringens . such a discrepancy in cytotoxicity of cpb2 was also previously reported in a study on the association of cpb2 and c. perfringens type a isolates carrying a plasmid enterotoxin gene in human gastrointestinal disease . in this study , fisher et al . demonstrated that cpb2 could be an accessory toxin in c. perfringens enterotoxin- ( cpe- ) associated aad / sd . molecularly , two different cpb2 variants ( named cpb2h1 and cpb2h2 ) could be produced by aad / sd isolates , which were dependent on whether is1470-like or is1151 sequences were present downstream of their cpe gene . cytotoxically , cpb2h1 showed approximately 10-fold more cytotoxicity for caco-2 cells relative to cpb2h2 , despite the fact that both purified cpb2h1 and cpb2h2 could induce caco-2 cell damage after the confluent monolayer cell cultures were exposed to the purified toxins at a concentration of 10 g / ml for 5.5 h . in line with these findings , we also showed that the purified rcpb2 only exhibited a low cytotoxicity with an up to 15 g / ml of ct50 on ncm460 cells in this study ( figure 2 ) . with respect to antibodies against cpb2 generated in this study , a mixture of peptides of 10 optimized potential epitopes that were predicted by a software developed by abmart were integrated into abmart in - house antigen system which was used for immunization of mice for generation of hybridoma cells producing mcabs ( figure 4 ) . three hybridoma cell lines that produce respective mcabs 1e23 , 2g7 , and 2h7 were screened to be able to immunologically react with both rcpb2 and native cpb2 as determined by immunoblotting assay , elisa , and immunofluorescent staining ( figures 57 ) . in particular , mcab 1e23 displayed the broadest and most specific immunological reaction to rcpb2 and native cpb2 among these three mcabs in all tested assays ( figures 57 ) . these antibodies will provide useful tools for investigating pathogenic mechanisms of cpb2 and developing assays for detection as well as neutralizing this toxin in clinical settings . indeed , all three screened mcabs showed a varied extent capacity to neutralize the cytotoxicity on ncm460 cells , and mcab 1e23 was the most powerful in neutralizing cytotoxicity ( figure 6 ) . mechanistically , immunofluorescent analysis clearly demonstrated that rcpb2 was first bound to cell membrane and then translocated into cytoplasm dynamically in vitro ( figure 7 ) . flow cytometric analysis showed that the majority of cell death induced by rcpb2 was cell apoptosis rather than a necrotic death on ncm460 cells ( figure 3 ) . molecular analysis further revealed that a caspase-3 signaling was involved in the rcpb2-induced cell apoptosis ( figure 3 ) . these findings provide important information on mechanisms of biological functions of cpb2 for the first time , an indicative of usefulness of the rcpb2 toxin protein and antibodies . collectively , in the present report , we first generated and purified a his - tagged recombinant beta2 toxin of c. perfringens ( rcpb2 ) and produced monoclonal antibodies ( mcabs ) against cpb2 . the purified rcpb2 toxin expressed in e. coli retained the integrity and some extent of cytotoxicity of cpb2 . three screened mcabs to cpb2 could immunologically react with both rcpb2 and native cpb2 by immunoblotting assay , elisa , immunofluorescent staining , and neutralization analysis . mechanistically , rcpb2 was able to first bind to cell membrane and dynamically translocate into cytoplasm for its cytotoxic activity . flow cytometric analysis further revealed that rcpb2 could induce apoptotic cell death rather than necrotic death in ncm460 cells and caspase-3 signaling was involved in this apoptotic process . however , the precise mechanisms of the cytotoxicity and pathogenesis need to be further investigated by using the rcpb2 toxin protein and antibodies produced in this study .
introduction . clostridium perfringens ( c. perfringens ) beta2 toxin ( cpb2 ) is an important virulent factor of necrotic enteritis in both animals and humans . however , studies of its pathogenic roles and functional mechanisms have been hampered due to the difficulty of purification and lack of specific antibodies against this toxin . methods . a recombinant his - tagged c. perfringens beta2 ( rcpb2 ) toxin and monoclonal antibodies ( mcabs ) against cpb2 were generated and characterized by assays of cytotoxicity , immunoblotting , elisa , neutralization , and immunofluorescence . results . a his - tagged rcpb2 with integrity and cytotoxicity of native cpb2 was purified from e. coli expressing system , which exhibited a moderate cytotoxicity on ncm460 human intestinal epithelial cells . the rcpb2 could induce apoptotic cell death rather than necrotic death in part through a pathway involved in caspase-3 signaling . mechanistically , rcpb2 was able to first bind to cell membrane and dynamically translocate into cytoplasm for its cytotoxic activity . three mcabs 1e23 , 2g7 and 2h7 were characterized to be able to immunologically react with cpb2 and neutralize rcpb2 cytotoxicity on ncm460 cells . conclusion . these results indicated the rcpb2 and antibodies generated in this study are useful tools for studies of biological functions and pathogenic mechanisms of cpb2 in future , which warrants for further investigations .
we report the unique case of a patient with brachiocephalic deep venous thrombosis ( dvt ) and persistent foramen ovale ( pfo ) who developed ischemic stroke in the absence of other risk factors for stroke . this may suggest the need for more detailed search for the embolic source in selected cases . a large percentage of ischemic strokes have no known cause ( up to 40% ) [ 1 , 2 ] . pfo prevalence amongst cases of cryptogenic stroke ( cs ) is twice as high as that of the normal population , making a causal relationship possible . stroke mechanism in this setting is thought to be a paradoxical embolism arising from a venous or right atrial source . the embolic source is , however , only seldom found , possibly because the search for thrombotic episodes is often restricted to the lower extremities , which makes up for only approximately one third of the embolic sources in clinically plausible cases of paradoxical embolism and stroke . in our patient , the thrombus was detected using brachiocephalic venography done during pfo closure . a 40-year - old mildly overweight female caucasian without a history of seizures or risk factors for atherosclerosis and dvt was referred to us for further evaluation 4 weeks after an acute - onset right - sided sensorimotor hemiparesis , dizziness and mild mnestic dysfunction . she had a similar , but much shorter and milder episode affecting the left extremities several weeks earlier , which had been attributed to a migraine , but may also have been a transient ischemic attack ( tia ) . on examination , blood pressure and blood glucose on admission were 125/65 mm hg and 105 mg / dl , respectively . magnetic resonance imaging revealed a left - sided , wedge - shaped lesion in the inferotemporal cortex ( fig . 1a ) , clearly suggesting recent ischemia due to occlusion of a temporal branch of the posterior cerebral artery . laboratory tests including cholesterol and coagulation parameters ( proteins c and s , antithrombin iii , prothrombin mutation and antiphospholipid antibodies ) revealed no pathological findings . interestingly , transesophageal contrast - enhanced echocardiography ( tee + contrast ) revealed a significant pfo ( fig . 1b ) with spontaneous right - to - left shunt and a hypermobile interatrial septum with a maximum deviation of 8 mm towards the right atrium , but no evidence of intracardiac thrombus or aortic plaques . the guidelines recommend acetylsalicylic acid 100 - 300 mg for first time cs in the setting of pfo and warfarin after a recurrence . the possible episode of tia several weeks earlier made the current case , affecting a different territory as the former , a recurrence which made us initiate therapy with a vitamin k antagonist ( phenprocoumon ) to reach an inr between 2.0 and 3.0 as a bridge to pfo closure since the patient could not be convinced to stay on this therapy for 2 or more years as suggested in the guidelines . twelve weeks later , an interventional fluoroscopic and tee - guided pfo closure using an amplatzer 25-mm device was carried out , which necessitated a dual antiplatelet therapy for 6 months . during this procedure an angiography of the brachiocephalic vein revealed residue of a venous wall adherent thrombus ( fig . a detailed history and physical examination followed by a plain chest x - ray in 2 plains , an abdominal ultrasound and a gynecological examination including mammography revealed no findings in support of malignancy as a possible cause of the unusually located dvt . pfo as a conduit for paradoxical embolism causing stroke is debated , despite the existence of extensive epidemiological evidence suggesting a causal relationship between pfo and cs [ 3 , 6 , 7 , 8 ] . the prevalence of pfo among young ischemic stroke patients is twice as high as that of the normal population ( 25% ) . however , pfo alone can not represent the direct etiology of a stroke , as it always requires the presence of a thrombotic source . here , we hypothesized paradoxical embolism as a plausible cause of the ischemic event . paradoxical embolism is easily demonstrable on contrast echocardiography in the presence of pfo and there have been cases of transit thrombus literally caught in the act of crossing the interatrial septum via a pfo . nevertheless , large trials ( including the more recent closure i trial ) have not proven pfo closure to be superior to other forms of therapy , such as aspirin and warfarin , in preventing recurrent cs . these studies have , however , enrolled a heterogeneous group of patients ( those in which the pfo is possibly just an epiphenomenon and those with a strong evidence of paradoxical embolism ) coupled with the development of multiple possible causes ( left atrial clot , atrial fibrillation , etc . ) of recurrent stroke in the course of a trial , undermining the conclusiveness of the data interpretation . this latter reason , coupled with the fact that nearly 30,000 young patients yearly have a cs and pfo , may suggest to rethink future trial strategies , for example pfo closure plus best medical therapy versus best medical therapy alone . however , the uniqueness in our case is the occurrence of an inferotemporal cortex stroke following a possible tia several weeks earlier in association with pfo in the presence of an extremely rare dvt location . this strongly suggests paradoxical embolism as the cause of the ischemic insult , especially in the absence of a cardioembolic source and atherosclerotic risk factors . stroke is a potentially debilitating disease with a high propensity to recur , especially in the absence of adequate therapy . therefore , patients with dvt and a higher probability of paradoxical embolism as in the case of coexisting pfo with right - to - left shunt and stroke should , even in the absence of inherited coagulation disorders , be treated with vitamin k antagonist for an average period of 6 months ( in keeping with dvt guidelines ) , followed by pfo closure . critics rightly propose that underlying dvt is only seldom found in patients with ischemic stroke and pfo . however , this may also be due to the dissolution of the source of embolism at the time of the diagnostic investigation , the heterogeneous expertise of the sonographers or the search for such culprit dvt being limited to the lower extremities . in addition , studies on pulmonary embolism ( pe ) have shown a dvt prevalence of only 18% and of 36 - 45% in patients with suspected and with confirmed pe , respectively , suggesting that dvt is a frequent cause of embolism , and that the presence of pfo in these patients may be a risk factor for stroke . furthermore , otten et al . demonstrated the existence of dvt in unusual locations in patients admitted to hospital for other reasons , suggesting that other venous sources of emboli are often overlooked . brachiocephalic dvt is a rare entity ( < 0.06% of hospitalized patients ) , associated with central venous catheters , crohn 's disease and occult malignancy ( trousseau 's syndrome ) [ 13 , 14 , 15 ] . a search beyond the lower limbs may become , however , necessary in case of recurrent cryptogenic stroke , especially when an embolic pattern and one or the other risk factor ( e.g. central venous line , inflammatory bowel disease , malignancy , etc . ) for upper limb dvt are evident . to our knowledge , this is the first reported case of brachiocephalic dvt associated with ischemic stroke and pfo . this suggests that in selected cases such as in young patients with stroke of embolic pattern , prior central venous catheter and history of crohn 's disease or malignancy , further examination of the venous system beyond the lower extremities may be warranted . with the exclusion of cases where the thrombus has already dissolved at the time of examination , this would further strengthen the evidence for paradoxical embolism .
up to 40% of ischemic strokes have no known cause ( cryptogenic ) . the prevalence of persistent foramen ovale ( pfo ) amongst patients with cryptogenic stroke ( cs ) is twice as high as that of the normal population , therefore suggesting a causal relationship between the two entities . however , pfo by itself is not sufficient to cause stroke , as an embolic source is needed . this source is often unknown , making the causal relationship between cs and pfo hard to demonstrate . the most frequent , although still seldom , identifiable cause of embolism in an otherwise cryptogenic stroke associated with pfo is a deep venous thrombosis ( dvt ) of the lower extremities . here , we present a unique case of brachiocephalic venous dvt associated with pfo and ischemic stroke in a young patient . as the search for dvt in patients with pfo and stroke is often limited to the lower extremities , this case may suggest that an unspecified number of dvts are overlooked . our report lends support to paradoxical embolism as a mechanism of stroke in patients with pfo and does , at least in selected cases , suggest a more detailed search for dvt beyond the lower extremities .
recently , several cases of splenic cyst with high serum levels of carbohydrate antigen 19 - 9 ( ca 19 - 9 ) , cancer antigen 125 ( ca 125 ) and carcinoembryonic antigen ( cea ) have been reported . it has been suggested that the cysts are produced by the inner epithelium of the cyst . splenic cysts are mostly asymptomatic but become symptomatic as a consequence of enlargement , infection , or rupture , which are very rare complications . we herein report a patient with a spontaneously ruptured splenic cyst with high serum levels of ca 19 - 9 , ca 125 and cea who was successfully treated by emergency operation . a 20-year - old female patient suffered from severe abdominal and left shoulder pain and was admitted to our hospital the next day . at the time of admission , her body temperature was 38.5c . her other vital signs ( heart rate , blood pressure , respiratory rate and consciousness level ) were stable , and her abdomen was hard and tender the touch . the patient 's past medical history was unremarkable , and she did not report any abdominal trauma . laboratory data showed inflammatory findings ( white blood cell count 9,300/l and c - reactive protein 7.80 mg / dl ) . serum concentrations of tumor markers were high , as follows : cea , 135 ng / ml ( normal < 5.0 ng / ml ) , ca 19 - 9 , 43,000 u / ml ( normal < 37 u / ml ) , and ca 125 , 1,470 u / ml ( normal < 35 u / ml ) . since the patient was hemodynamically stable , further studies with ultrasonography and computed tomography of the abdomen to the pelvis were performed . ultrasonography and computed tomography showed an 11-cm multilocular cystic lesion in the spleen and the presence of free intraperitoneal fluid ( fig . 1 ) . peritoneal hypertrophy and a relatively high density of the connective tissue around the spleen were also observed . the patient was diagnosed with peritonitis and a ruptured splenic cyst , and she underwent emergency laparotomy via a midline incision . a giant cyst was present in the spleen and adhered to the abdominal surface of the left diaphragm . the gastrointestinal tract , liver , gallbladder , pancreas , kidney , and genital organs were intact . 2 ) . one part of the cystic wall that adhered to the diaphragm was burned with an argon beam coagulant . the patient 's white blood cell count was elevated to 15,500/l with a moderate fever on day 2 following the operation . she was discharged on day 9 after surgery , and she remains healthy without episodes of recurrence . the histological findings revealed that the lesion was a benign epidermoid cyst that was completely lined by inner stratified squamous epithelium and surround by a capsule of connective tissue ( fig . in the immunostaining analyses , the squamous epithelium was found to be positive for cea ( fig . the level of cea in the ascites at the time of the operation was extremely high ( 7,700 ng / ml ) . the ascites cytological analyses revealed no malignant cells . on the 9th day after the operation , the serum concentrations of tumor markers were drastically decreased in comparison to the levels measured at the time of admission , as follows : cea , 17.8 ng / ml , and ca 19 - 9 , 4,630 u / ml . splenic cysts are a relatively rare event , with an incidence of 0.07% as reported in a review of 42,327 autopsies . recent advances in medical imaging have contributed to an increase in the detection of occult splenic cysts . splenic cysts are classified as primary or secondary cysts , depending on the presence or absence of an epithelial lining of the lumen . the optimal treatment of splenic cysts remains controversial , and standard guidelines have not yet been established . if the cyst is smaller than 5 cm in diameter and asymptomatic , no treatment is necessary . . however , the reasoning for a 5-cm diameter cutoff appears to be unclear . in the present case , infection by taenia echinococcus was not found , and the cyst was therefore suspected to be of nonparasitic origin . although some treatments ( aspiration , injection , fenestration , and splenectomy ) are sometimes performed for splenic cysts , total or partial splenectomy is generally chosen by the physician . since the spleen is essential for the control of blood volume and the immune system , partial splenectomy is recommended if possible . , an emergency surgical procedure was performed due to the large cyst size ( 11 cm in diameter ) and because the patient had complained of severe abdominal pain with a high fever , suggesting peritonitis . as the splenic cyst had already ruptured , emergency total splenectomy was able to successfully treat the patient 's critical condition . ruptured splenic cysts are an extremely rare complication in splenic cysts . only 13 cases of ruptured splenic cysts have been reported ( table 1 ) . in those studies , the mean age of the patients was 20.0 years ( range 936 years ) , and the mean diameter of the cysts was 8.6 cm ( range 414 cm ) in diameter . in most cases , the patients complained of abdominal pain , sometimes accompanied by left shoulder pain or vomiting . the free peritoneal fluid that tended to accompany a ruptured splenic cyst was useful for the diagnoses . the splenic cyst ruptures required emergency operative therapy , and the postoperative courses were mostly uneventful . trauma , infection , or an increase in the cystic component may trigger such rupture . free peritoneal fluid and purulence were observed in one previous case and in the present patient . it is known that splenic abscess follows sepsis ( bacterial endocarditis , malaria , and urinary tract infections , among other causes ) , but the infectious route resulting in splenic cysts is unknown . serum concentrations of tumor markers ( for example , cea , ca 19 - 9 , and ca 125 ) were elevated in several patients with splenic cysts . in spite of high levels of tumor markers , tumor markers are hypothesized to be secreted into the intracystic fluid by the inner epithelial cells originating from the cysts . in the immunohistochemical staining , several mechanisms that are not yet characterized may induce the transport of intracystic tumor markers into dynamic circulation . intracystic tumor markers that are distributed in the free peritoneal cavity are absorbed through the peritoneum , and the serous levels of tumor markers are thereby increased . only one patient with a ruptured splenic cyst and elevated serous tumor markers has been previously reported ; the present case is the second patient described in the literature . in general , the serous levels of tumor markers in patients with splenic cysts are rapidly reduced after resection , and our patient showed a similar course . splenic cysts are a relatively rare event ; moreover , complications due to rupture are extremely rare . a ruptured splenic cyst causes sudden onset of severe peritonitis with elevated serous tumor markers . an emergency operation is the recommended treatment for patients with a ruptured splenic cyst and peritonitis , and this surgical treatment was very effective in the present patient .
splenic cyst is a relatively rare disease ; however , the occurrence of complications associated with its rupture is even more rare . a 20-year - old female patient who had severe abdominal and left shoulder pain was admitted to our hospital . the patient 's abdomen was hard and tender to the touch and she presented with a high fever . the patient 's serum levels of the tumor markers carbohydrate antigen 19 - 9 , cancer antigen 125 and carcinoembryonic antigen were high . ultrasonography and computed tomography of the abdomen showed an 11-cm multilocular cystic lesion in the spleen and the presence of free intraperitoneal fluid . peritonitis with ruptured splenic cyst was diagnosed , and the patient underwent an emergency laparotomy . the abdominal cavity was filled with purulent fluid . the cyst was localized to the spleen and had already ruptured . total splenectomy and cyst resection were performed . the postoperative course was uneventful . the patient was discharged on day 9 following surgery . the histological findings showed the lesion to be a benign epidermoid cyst completely lined with inner stratified squamous epithelium with a capsule of connective tissue . in the immunostaining analyses , the squamous epithelium was positive for carcinoembryonic antigen . a ruptured splenic cyst causes sudden onset of severe peritonitis and elevation of serous tumor markers . an emergency operation is indicated as the treatment for a ruptured splenic cyst with peritonitis , after which a favorable outcome can be expected .
since guinto , et al . reported a case of spontaneous regression of a herniated lumbar disc in 1984 , this phenomenon in lumbar discs has been well documented and discussed [ 2 - 4 ] . however , there have been fewer reports of spontaneous regression of cervical disc herniation ( cdh ) [ 5 - 7 ] , especially ones confirmed by magnetic resonance imaging ( mri ) [ 8 - 10 ] . recently , a patient with cdh who was treated at our hospital experienced this exceptional condition after 12 months of conservative treatment . in the following report , we will present this case and discuss the condition . a 59-year - old female patient who was unable to conduct her normal activities or sleep due to intense neck pain and severe radiating pain in the right c7 dermatomal distribution was admitted to our institute a day after her symptoms developed . , she could not maintain a supine position owing to insufferable pain from the day of admission . mri at 15 days after the admission ( fig 1 ) revealed multiple degenerative changes of the cervical vertebra , as well as a disc that was significantly herniated to the right at the c6-c7 level . on physical examination , her motor power ( esp . wrist flexion ) was assessed as grade 4 + ; the spurling test was positive on the right side . details of the treatment are reported in ( table1 ) based on the standards for reporting interventions in clinical trials of acupuncture(stricta ) . the most frequently targeted local points were gv16 , bl11 , te10 , gb20 , bl10 , and gb21 , bl12 and the most frequently treated distant points were si3 , te3 , and li4 . she received analgesics , non - steroidal antiinflammatory drugs and a muscle relaxant for only four weeks . the patient 's visual analog scale ( vas ) score improved from 10 points at the time of admission to 3 points after 2 weeks of treatment ( fig . , the patient 's symptoms were completely alleviated , and no abnormal sensory , motor or spurling test findings were observed . in addition , follow - up mri conducted after 12 months revealed that the protruded disc had disappeared completely and that no root compression was present ( fig . since the first report of spontaneous regression of a herniated cervical disc by krieger and maniker in 1992 , several other authors have also reported this rare phenomenon [ 6 - 10 ] . according to the guidelines of the u.s . department of health & human services , anterior surgical nerve root decompression via anterior cervical discectomy with or without fusion in patients with cervical radiculopathy is recommended for rapid relief ( within 3 - 4 months ) of arm and neck pain , weakness , and/or sensory loss compared to physical therapy or immobilization with a cervical collar . in the absence of knowledge about the natural history of a herniated disc , doctors are apt to choose surgical treatment . published a retrospective review of complications associated with an anterior cervical discectomy and fusion in 1,015 patients . the results of their studies revealed a mortality rate of 0.1% and a morbidity rate of 19.3% , with the most common complication being development of isolated postoperative dysphasia , which was observed in 9.5% of the patients . other complications observed included postoperative hematoma ( 5.6% ) , recurrent laryngeal nerve palsy ( 3.1% ) , dural penetration ( 0.5% ) and esophageal perforation ( 0.3% ) . the possibility of such complications makes non - surgical treatment for cervical disc herniation desirable . spontaneous regression of cdh with acupuncture treatment can be regarded as a benign natural course that occurs in some patients with herniated cervical disc . the result of his study revealed 30% excellent , 35% good , and 35% fair . kim et al . used mri to confirm that spontaneous regression of a herniated cervical disc had occurred in 9 patients after traditional korean medical treatment , including acupuncture , bee venom pharmacopuncture , manipulation , and herb medicine . shin et al . reported clinical improvement made by bee venom therapy at cervical hyeopcheokhyeol in the case of upper limb disability caused by cervical herniations . many factors related to the regression process have been recognized , including the age of the patient , dehydration of the expanded nucleus pulposus , resorption of a hematoma , revascularization , penetration of herniated cervical disc fragments through the posterior longitudinal ligament ( pll ) , the size of disc herniation , and the existence of cartilage and annulus fibrosus tissue in the herniated material . resorption of a herniated nucleus pulposus is thought to occur via an inflammatory reaction in the outermost layer of the herniation , with macrophages as the major cellular population . although we report only one case of cdh , it might give clinical doctors a chance to reconsider surgery , and choose conservative treatment . here , we report a case in which a cervical disc herniation patient improved in response to acupuncture . mri conducted to evaluate the patient 12 months after treatment revealed that spontaneous regression of the herniated disc had occurred .
the spontaneous regression of herniated cervical discs is not a well - established phenomenon . however , we encountered a case of a spontaneous regression of a severe radiculopathic herniated cervical disc that was treated with acupuncture , pharmacopuncture , and herb medicine . the symptoms were improved within 12 months of treatment . magnetic resonance imaging ( mri ) conducted at that time revealed marked regression of the herniated disc . this case provides an additional example of spontaneous regression of a herniated cervical disc documented by mri following non - surgical treatment .
because coronary heart diseases often manifest as abnormalities of the ventricular geometry and wall kinematics , noninvasive cine medical imaging techniques are of significant clinical value , such as magnetic resonance imaging ( mri ) , to provide shape and motion information of the myocardium ( ) . in the past three decades , there has been a large increase in the number of cardiac image analysis methods to assess the shape and motion parameters from image sequences that describe the functionality of the heart . however , several challenges remain . as the first step for motion tracking , registration , and many other cardiac imaging analyses , segmentation is often needed to isolate the myocardium from the background information throughout the cardiac cycle before further processing . the difficulties of this process arise from the presence of noise , lack of edge information for the epicardium , and intensity inhomogeneities . accordingly , many approaches have been developed for myocardial contour delineation to overcome these issues , including the use of dynamic programming ( ) , probability atlas ( ) , active shape model ( asm ) ( , ) , active appearance model ( aam ) ( , ) , combination of asm and aam ( ) , constr - ained pattern matching strategy ( ) , proactive deformable model ( ) , and motion - guided segmentation frame - work ( , ) . in addition to the continuing progress in cardiac image segmentation , considerable efforts have also been focused on motion and deformation recovery from image sequences . imaging - derived kinematic constraints , such as salient point correspondence and eulerian velocity , provide the initial estimates of the myocardium . various regularization strategies , including mathematical smoothness ( ) , continuum mechanics models ( ) , and electromechanical models ( , ) , are adopted to constrain the ill - posed problem for recovering the dense field motion and deformation parameters of the heart . in addition , several attempts have been made to track the motion over the entire cardiac cycle by using the explicit temporal modeling of cyclic heart dynamics , from forward and backward kalman filters ( , ) to fourier harmonics tracking ( ) . thus far , most existing efforts have not attempted to tackle segmentation and motion problems in a joint or simultaneous fashion ; rather , these have been treated as two sequential processes . obviously , cardiac segmentation and motion tracking problems are closely related , and the robustness and effectiveness of these methods can be enhanced significantly by coupling them . in other applications , it has been shown that treating the spatial boundary finding and spatiotemporal motion tracking problems as a coherent and unified process can achieve more consistent and probably more approximate results ( ) . in this manner , we can use the total available information provided by the image sequence in a more complete manner , and reduce the possibility of error propagation from one step to another to achieve potentially more robust analysis results . in this paper , a unified framework is presented that simultaneously recovers the boundary shape and motion information of the heart over the entire image sequence . our effort adopts the energy minimization formulation of deformable models through the integration of various data - driven image constraints and intrinsic model constraints that guide the spatiotemporal model evolution process . specifically , gradient measures and gradient vector fields ( ) provide edginess information ; image - derived geometrical tokens , i.e. , the isointensity curvature , are used to establish the likelihood measure for shape - based correspondence matching ; frame - to - frame eulerian velocity fields , i.e. , mr phase contrast images and optical flow maps , bias the direction and magnitude of the model movement ; and the physical model regularizes the behavior between neighboring points . furthermore , a temporally cyclical model of the cardiac boundary motion is incorporated to reduce the feasible space of the moving contour . to achieve segmentation and motion recovery simultaneously , we use iterative procedures to evolve the heart tissue under the external image derived and prior model based driving forces . the work reported here provides a detailed description of our earlier effort ( ) with careful validation based on synthetic data , animal models , and human mr image sequences . an incompressible - model - based registration method for cardiac deformation recovery from cine mri has been proposed ( ) . a generalized robust point matching strategy with a boundary element method was used for the recursive recovery of shape and motion through a cardiac image sequence . our work is different in that it is constrained by biomechanically motivated system dynamics , and it is implemented in a mesh - free framework to overcome finite element method ( fem ) limitations . our strategy is based on a physically motivated active region model in which each node spatiotemporally evolves under the influences of the node - dependent imaging data , temporal consistency models of the tissue geometry and kinematics , and statistical priors of the myocardium spatial distributions . first the approach is formulated as an energy minimization problem for each image frame , then we use the mesh - free representation and iterative procedures to solve it . under the influence of the image data and prior model constraints , the heart behaves as an elastic object , which has three integral components : ( 1 ) a topological and geometric representation of the object , which is presented in section ii - b ; ( 2 ) a material constitutive law that defines the intrinsic dynamic behavior of the object , which is discussed in detail in section ii - c ; and ( 3 ) the external driving forces that move and deform the object toward equilibrium , which is discussed in section ii - d . the unified segmentation and motion analysis framework is posed as an energy minimization problem:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \hat { u}= \arg \min _ { u } \int _ { \omega } \ , ( e_{internal}(u ) + e_{external}(u ) ) \ , d{\omega } \end{equation*}\end{document } where : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u$ \end{document } is the displacement field defined over the region of interest \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \omega $ \end{document};the internal energy function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{internal}$ \end{document } imposes regularity constraints on the solution , and it is solely defined by the object s deformation and intrinsic material properties ; andthe external energy \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{external}$ \end{document } includes both segmentation cues and motion tracking terms needed to deform the current object configuration towards the new equilibrium state . \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u$ \end{document } is the displacement field defined over the region of interest \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \omega $ \end{document } ; the internal energy function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{internal}$ \end{document } imposes regularity constraints on the solution , and it is solely defined by the object s deformation and intrinsic material properties ; and the external energy \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{external}$ \end{document } includes both segmentation cues and motion tracking terms needed to deform the current object configuration towards the new equilibrium state . using galerkin s principles , energy functionals are formulated in terms of the nodal displacements \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { u}$ \end{document } , and we can express the resulting set of differential governing equations in matrix form as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } k \mathbf { u } = f \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } is the assembled global stiffness matrix which describes the material elasticity of the object , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } is the external driving force that tries to deform the object to adhere to the image data and prior information . we can interpret this equation as the model spatiotemporally evolving toward the equilibrium state under the internal spatial constraints of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } , which provides the relationship between nodes and the space - time dependent external forces \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document}. by taking finite differences in the time domain , with time step \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \tau $ \end{document } , we use an explicit euler time integration procedure to integrate equation ( 2 ) through time . specifically , the lagrangian evolution can be presented as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } ( i + \tau k)\mathbf { u } ^{t } = ( \mathbf { u } ^{t-1 } + \tau f^{t-1 } ) \end{equation*}\end{document } therefore , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { u } ^{t } = ( i + \tau k)^{-1 } ( \mathbf { u } ^{t-1 } + \tau f^{t-1 } ) \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document } is an identity matrix , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { u } ^{t}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { u } ^{t-1}$ \end{document } are the displacement at step \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t-1 $ \end{document } , respectively , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f^{t-1}$ \end{document } is the force vector at step \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t-1 $ \end{document}. the evolution is stopped when the external force \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } diminishes and/or when the displacement difference between iterations \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \|\mathbf { u } ^{t}-\mathbf { u } ^{t-1 } \|$ \end{document } is below a certain threshold . how to represent the heart structures in a computational environment is an important issue , because this affects the numerical accuracy , computational feasibility , and implementation difficulty . fem has been widely used in computational cardiology , but for cardiac image analysis , it s probably not the best choice . we adopt mesh - free methods in our framework . by using the mesh - free methods , the heart is represented by a set of nodes bounded by surfaces which represents the heart boundaries . as no meshing is involved , the distribution of nodes is more flexible , thus facilitating adaptive refinements to improve the regional numerical accuracy . furthermore , the intrinsic h - p ( spatial refinements and orders of polynomial ) adaptivity of the mesh - free methods facilitates the incorporation of high - order polynomials , and thus , the number of nodes required is smaller than that of linear fem for the same accuracy . to obtain a continuous cardiac motion field from a sparse set of data efficiently and accurately , a proper representation and computation strategy for the myocardium is necessary . for the last few decades , fem has been widely used for motion field approximations in cardiac analysis because of its effectiveness and general applicability . with fem , the complicated continuous solution domain is discretized into much simpler sub - domains ( elements ) with known polynomials , such as triangles in 2d and tetrahedra in 3d , to provide relationships with the sampling nodes . with such discretizations , the complicated physical and mathematical models can be approximated and solved by sets of governing algebraic equations . first , the fem result is highly related to the number of finite element meshes . in practice , because of the heart s motion nature , some elements of the mesh will become compressed or even skewed . this problem could be solved by mesh refinements and remeshing ; however , the procedures are very computationally expensive , especially in 3d cases . more crucially , it is difficult to handle fiber orientation discontinuities in the fem representation . the mesh - free representation has the potential to overcome these drawbacks , in which the geometry of the heart is represented by unstructured , adaptively sampled nodes that are bounded by the boundaries of the object . as no mesh is required , the density of the nodes can be refined adaptively by simply adding or removing nodes in the problem domain , depending on the available computational resources and required preciseness . furthermore , it has been shown that the mesh - free method better handles the fiber orientations and kinematics / material discontinuities , and it also has better h - p adaptivity . in this paper , the mesh - free representation of the myocardium is used . typically , ecg - gated mri image sequences are acquired over the heart cycle , which are in 1620 frames consisting of 1016 slices each . the endocardial and epicardial boundaries of the cardiac image in the first frame are segmented using the existing level set framework ( ) . the endocardial and epicardial surfaces are then reconstructed using delaunay triangulation and are smoothed using the non - shrinking algorithm . the myocardial sample points together with the endocardial and epicardial surfaces or boundaries of a selected mid - ventricular slice in 2d form the mesh - less representation of the heart . specifically , we can attach the local fiber orientation to each sampling node depending on its location , thus the fiber structure can be represented efficiently . in the mesh - free representation of the heart , the nodes can have adaptive and non - uniform distributions over time and space , and are more densely distributed in areas with large shape variation and large displacement gradient , and the initial distribution quality should not be mainly concerned . by using the finite element formulation , we use an isoparametric formulation defined in a natural coordinate system , in which the same basis functions are used in the interpolations of the element coordinates and the element displacements . for the mesh - free particle representation , shape functions need to be created to approximate the field function by using their values at sampling nodes in the analysis domain . in particular , the shape functions are constructed by using the moving least squares ( mls ) approximation . let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u(\mathbf { x})$ \end{document } be the displacement field defined in the myocardial domain \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \omega $ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u^{h}(\mathbf { x})$ \end{document } be the approximation of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u(\mathbf { x})$ \end{document } at point \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } as given by the mls approximation:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } u^{h}(\mathbf { x } ) = \sum _ { j=1}^{m } p_{j}(\mathbf { x } ) a_{j}(\mathbf { x } ) \equiv \mathbf { p}^{t}(\mathbf { x } ) \mathbf { a}(\mathbf { x } ) \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { p}(\mathbf { x})$ \end{document } is the polynomial basis function , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } is the number of terms of monomials ( polynomial basis ) , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}(\mathbf { x})$ \end{document } is a vector of unknown location - dependent coefficients . given a set of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } nodal values at nodes \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x_{1 } , x_{2 } , \ldots , x_{n}$ \end{document } that are in the influence domain , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}(\mathbf { x})$ \end{document } can be obtained at any point \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } by minimizing a weighted , discrete \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ l_{2}$ \end{document } norm:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } j = \sum _ { i=1}^{n } w(\mathbf { x}-\mathbf { x}_{i } ) [ \mathbf { p}^{t}(\mathbf { x}_{i } ) \mathbf { a}(\mathbf { x } ) - u_{i}]^{2 } \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } is the number of node points \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}_{i}$ \end{document } in the neighborhood of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } ( influence domain ) for which the weight function is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ w(\mathbf { x}-\mathbf { x}_{i } ) \neq 0 $ \end{document } , and the nodal value is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u_{i } = u(\mathbf { x}_{i})$ \end{document}. the shape of the influence domain of x can be square or circular . the stationarity of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } in equation ( 6 ) with respect to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}(\mathbf { x})$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \frac { \partial j}{\partial \mathbf { a } } = 0 $ \end{document } , leads to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { a(x ) } = \mathbf { a}^{-1}(\mathbf { x } ) \mathbf { b(x ) } \mathbf { u } \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } \mathbf { a(x)}=&\sum _ { i=1}^{n } w(\mathbf { x}-\mathbf { x}_{i } ) \mathbf { p}(\mathbf { x}_{i})\mathbf { p}^{t } ( \mathbf { x}_{i } ) \\ \mathbf { b(x)}=&[\mathbf { b_{1 } } , \mathbf { b_{2 } } , \ldots , \mathbf { b_{n } } ] \end{align } \end{document } with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { b}_{i } = w(\mathbf { x}-\mathbf { x}_{i})\mathbf { p}(\mathbf { x}_{i})$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { u}^{t } = \{u_{1 } , u_{2 } , \ldots , u_{n}\}$ \end{document}. note that we require \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n\gg m$ \end{document } , which prevents the singularity of the matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}(\mathbf { x})$ \end{document } and ensures the existence of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}^{-1}(\mathbf { x})$ \end{document } , and this condition can be guaranteed by the size of the adaptively controlled influence domain . substituting the results into equation ( 5 ) gives \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } u^{h}(\mathbf { x } ) = \sum _ { i=1}^{n } \sum _ { j=1}^{m } p_{j}(\mathbf { x } ) ( \mathbf { a}^{-1}(\mathbf { x } ) \mathbf { b}(\mathbf { x}))_{ji}u_{i } \end{equation*}\end{document } the above equation can also be written in matrix form:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } u^{h}(\mathbf { x } ) = \mathbf { n}(\mathbf { x } ) \mathbf { u } \end{equation*}\end{document } where the mls - derived shape function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { n}(\mathbf { x})$ \end{document } is defined by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { n}(\mathbf { x } ) = \mathbf { p}^{t}(\mathbf { x } ) \mathbf { a}^{-1}(\mathbf { x } ) \mathbf { b}(\mathbf { x } ) \end{equation*}\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \mathbf { n}(\mathbf { x } ) } = [ n_{1}(\mathbf { x } ) , n_{2}(\mathbf { x } ) , \ldots , n_{n}(\mathbf { x } ) ] $ \end{document } corresponding to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } nodes in the domain . to determine the spatial derivatives of the field variable s function , obtaining the derivatives of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ mls$ \end{document } shape functions is necessary . for convenience , we set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } r(\mathbf { x})= \mathbf { a(x)^{-1}}\mathbf { p}(\mathbf { x } ) \end{equation*}\end{document } then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { n}(\mathbf { x } ) = r^{t}(\mathbf { x})\mathbf { b}(\mathbf { x } ) \end{equation*}\end{document } thus , we can obtain the partial derivatives of the shape function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { n}$ \end{document } from the partial derivatives of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r(\mathbf { x})$ \end{document } as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } \mathbf { n}_{,i_{x}}(\mathbf { x})=&r_{,i_{x}}(\mathbf { x})\mathbf { b}(\mathbf { x})+ r(\mathbf { x})\mathbf { b}_{,i_{x}}(\mathbf { x } ) \\ \mathbf { n}_{,i_{x } i_{y}}=&r_{,i_{x } i_{y}}\mathbf { b}+ r_{,i_{x}}\mathbf { b}_{,i_{y}}+r_{,i_{y}}\mathbf { b}_{,i_{x}}+r\mathbf { b}_{,i_{x } i_{y } } \\ \mathbf { n}_{,i_{x } i_{y } i_{z}}=&r_{,i_{x } i_{y } i_{z}}\mathbf { b}+ r_{,i_{x } i_{y}}\mathbf { b}_{,i_{z } } + r_{,i_{x } i_{z}}\mathbf { b}_{,i_{y}}\notag \\&+\ : r_{,i_{y } i_{z}}\mathbf { b}_{,i_{x } } + r_{,i_{x}}\mathbf { b}_{,i_{y } i_{z } } + r_{,i_{y}}\mathbf { b}_{,i_{x } i_{z}}\notag \\&+\ : r_{,i_{z}}\mathbf { b}_{,i_{x } i_{y } } + r\mathbf { b}_{,i_{x } i_{y } i_{z } } \end{align } \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{x}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{y}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{z}$ \end{document } denote the coordinates . a comma designates a partial derivative with respect to the indicated spatial variable . from the above equations , we can see that the weighting function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ w(\mathbf { x}-\mathbf { x}_{i})$ \end{document } is important in determining \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}(\mathbf { x})$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { b}(\mathbf { x})$ \end{document}. this weighting function should be positive ( ensure a meaningful presentation of the physical phenomena ) and compact ( smooth and continuous over the entire domain ) . the continuous approximation of the shape function can be achieved by choosing appropriate weighting functions instead of using a high - order basis \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { p}(\mathbf { x})$ \end{document } , which is an attractive property of the mls approximation . in 2d space:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } { \mathbf { p}^{t}(\mathbf { x})}=\{1 , x , y , xy , x^{2 } , y^{2 } , \ldots , x^{m } , y^{m}\ } \end{equation*}\end{document } in 3d space:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } { \mathbf { p}^{t}(\mathbf { x})}=\{1 , x , y , z , xy , yz , zx , x^{2 } , y^{2 } , z^{2},\ldots , x^{m } , y^{m } , z^{m}\}\notag \\ { } \end{align } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } has the same meaning as in equation ( 5 ) . let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { r } = |\mathbf { x } - \mathbf { x}_{i}|/d_{mi}$ \end{document}. then , the weight function is given by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } w(\mathbf { x}-\mathbf { x}_{i})=&w(\bar { r } ) \notag \\=&\begin{cases } \dfrac { 2}{3 } - 4\bar { r}^{2 } + 4 \bar { r}^{3 } & \text { for $ \bar { r } \leq \dfrac { 1}{2}$}\\[0.6pc ] \dfrac { 4}{3 } - 4\bar { r } + 4\bar { r}^{2 } - \dfrac { 4}{3 } \bar { r}^{3 } & \text { for $ \dfrac { 1}{2 } < \bar { r } \leq 1 $ } \\ 0 & \text { for $ \bar { r } > 1 $ } \end{cases}\notag \\ { } \end{align } \end{document } the support size \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ d_{mi}$ \end{document } of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i^{th}$ \end{document } node is determined by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ d_{mi } = d_{max}c_{i}$ \end{document } , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ d_{max}$ \end{document } is a scaling parameter , and the distance \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{i}$ \end{document } is determined by searching for enough neighbor nodes to ensure the singularity of the matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { a}$ \end{document } in equation ( 8) . to regularize our region model s intrinsic behavior , physically more meaningful continuum mechanics models are adopted . although models of different complexities are available , as our goal is to study the subject - specific cardiac physiology through medical images , the models chosen should be detailed enough to include macroscopic cardiac properties such as fiber orientations and anisotropic material properties ; however , they should not be too complicated such that many parameters can not be determined using the available knowledge or measurements . the mechanical model can be defined in terms of an internal energy function that describes the state of the material . in our 2d implementation , we can model the myocardium as an isotropic linear elastic material , which provides a reasonable framework to aid the recovery of shape and motion . under two dimensional cartesian coordinate system , this is defined in terms of the linear isotropic constitutive law:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \sigma = c \varepsilon \tag{21}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma $ \end{document } is the stress vector and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } is the stress - strain or material matrix . assuming the displacement along the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x-$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y-$ \end{document}axis to be \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ u(x , y)$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ v(x , y)$ \end{document } respectively , the infinitesimal strain tensor \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \varepsilon $ \end{document } is defined as:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } \varepsilon=&\left [ { \begin{array}{c}\displaystyle \frac { \partial u}{\partial x } \\[0.3pc ] \displaystyle \frac { \partial v}{\partial y } \\ \displaystyle \frac { \partial u}{\partial y } + \frac { \partial v}{\partial x } \end{array } } \right ] = \left [ { \begin{array}{cc } \partial / \partial x & 0 \\ 0 & \partial / \partial y \\ \partial / \partial y & \quad \partial / \partial x \end{array } } \right ] \left [ { \begin{array}{c } u \\ \end{array } } \right ] \\=&\mathbf { l u } \tag{22}\end{align * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { l}$ \end{document } is a differential operator matrix which depends on the strain types ( infinitesimal or finite ) . under plane strain situations , the material matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } is:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } c = \frac { e_{y}}{(1+\nu ) ( 1 - 2\nu ) } \left [ { \begin{array}{clcr } 1-\nu & \nu & 0 \\ \nu & 1-\nu & 0 \\ 0 & 0 & \displaystyle \frac { 1 - 2\nu } { 2 } \end{array } } \right ] \qquad \tag{23}\end{equation * } \end{document } here , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{y}$ \end{document } is the young s modulus that is measure of the stiffness of the material and the poisson s ratio \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \nu $ \end{document } is the measure of incompressibility . biomechanics studies have demonstrated that myocytes , which connect to each other by collagen to form fibers , occupy 70% of the ventricular wall volume ( , ) . it means that cardiac tissues have different properties along and across fibers ( ) . thus in three dimensional cases , it is more suitable to use a transversely elastic model to describe the intrinsic behavior of the myocardium . this is an extension of the isotropic linear elastic model which allows for one of the three material axes to have a different stiffness from the other two . for such a material , the stress ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma $ \end{document } ) and strain ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \epsilon $ \end{document } ) constitutive laws still obey hooke s law in a particular orientation ( along or across the myofiber ) . let us define \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{0}$ \end{document } as the material matrix with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 0^{o}$ \end{document } ( along \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document}-axis ) fiber orientation of a point in the myocardium:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } c_{0 } = \left [ { \begin{matrix } \displaystyle \dfrac { 1}{e_{f } } & -\dfrac { \upsilon _ { f}}{e_{cf } } & -\dfrac { \upsilon _ { f}}{e_{cf } } & 0 & 0 & 0\\ -\displaystyle \dfrac { \upsilon _ { f}}{e_{cf } } & \dfrac { 1}{e_{cf } } & -\dfrac { \upsilon _ { cf}}{e_{cf } } & 0 & 0 & 0\\ -\displaystyle \dfrac { \upsilon _ { f}}{e_{cf } } & -\dfrac { \upsilon _ { cf}}{e_{cf } } & \dfrac { 1}{e_{cf } } & 0 & 0 & 0\\ 0 & 0 & 0 & \displaystyle \dfrac { 1}{g } & 0 & 0\\ 0 & 0 & 0 & 0 & \displaystyle \dfrac { 1}{g } & 0\\ 0 & 0 & 0 & 0 & 0 & \displaystyle \dfrac { 2(1+\upsilon _ { cf})}{e_{cf } } \end{matrix } } \right ] ^{-1}\!\!\!\!\ ! \\ { } \tag{24}\end{align * } \end{document } here , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{f}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{cf}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \upsilon _ { f}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \upsilon _ { cf}$ \end{document } are the young s moduli and poisson s ratios along and cross the fiber , respectively . \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ g = e_{f}/(2(1+\upsilon _ { f}))$ \end{document } describes the shearing property . for isotropic materials , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{0}$ \end{document } reduces to the matrix if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e_{f}=e_{cf}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ v_{f}=v_{cf}$ \end{document}. since the fiber orientation varies in different regions of the left ventricle ( ) , assuming that the local coordinate system has \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \theta _ { h}$ \end{document } degrees horizontal angle and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \phi _ { v}$ \end{document } degrees vertical angle apart from the global coordinate system , the corresponding material matrix at any point can be obtained using the tensor transformation:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } c = t^{-1 } c_{0 } r t r^{-1 } \tag{25}\end{equation * } \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } is a combination transformation matrix of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t_{vert}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t_{hori}$ \end{document}:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } t = t_{vert } t_{hori } \tag{26}\end{equation * } \end{document } with ( 27 ) , ( 28 ) as shown at the bottom of this page : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } t_{vert}=&\left [ { \begin{matrix } & cos^{2}\phi _ { v } & 0 & sin^{2}\phi _ { v } & 0 & 2sin\phi _ { v } cos\phi _ { v } & 0 \\ & 0 & 1 & 0 & 0 & 0 & 0\\ & sin^{2}\phi _ { v } & 0 & cos^{2}\phi _ { v } & 0 & -2sin\phi _ { v } cos\phi _ { v } & 0\\ & 0 & 0 & 0 & cos\phi _ { v } & 0 & sin\phi _ { v}\\ & -sin\phi _ { v } cos\phi _ { v } & 0 & sin\phi _ { v } cos\phi _ { v } & 0 & cos^{2}\phi -sin^{2}\phi _ { v } & 0\\ & 0 & 0 & 0 & -sin\phi _ { v } & 0 & cos\phi _ { v } \end{matrix}}\right ] \tag{27}\\ t_{hori}=&\left [ { \begin{matrix } & cos^{2}\theta _ { h } & sin^{2}\theta _ { h } & 0 & 2sin\theta _ { h } cos\theta _ { h } & 0 & 0\\ & sin^{2}\theta _ { h } & cos^{2}\theta _ { h } & 0 & -2sin\theta _ { h } cos\theta _ { h } & 0 & 0\\ & 0 & 0 & 1 & 0 & 0 & 0\\ & -sin\theta _ { h } cos\theta _ { h } & sin\theta _ { h } cos\theta _ { h } & 0 & cos^{2}\theta _ { h}-sin^{2}\theta _ { h } & 0 & 0\\ & 0 & 0 & 0 & 0 & cos\theta _ { h } & sin\theta _ { h}\\ & 0 & 0 & 0 & 0 & -sin\theta _ { h } & cos\theta _ { h } \end{matrix}}\right ] \tag{28}\end{align * } \end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } t_{vert}=&\left [ { \begin{matrix } & cos^{2}\phi _ { v } & 0 & sin^{2}\phi _ { v } & 0 & 2sin\phi _ { v } cos\phi _ { v } & 0 \\ & 0 & 1 & 0 & 0 & 0 & 0\\ & sin^{2}\phi _ { v } & 0 & cos^{2}\phi _ { v } & 0 & -2sin\phi _ { v } cos\phi _ { v } & 0\\ & 0 & 0 & 0 & cos\phi _ { v } & 0 & sin\phi _ { v}\\ & -sin\phi _ { v } cos\phi _ { v } & 0 & sin\phi _ { v } cos\phi _ { v } & 0 & cos^{2}\phi -sin^{2}\phi _ { v } & 0\\ & 0 & 0 & 0 & -sin\phi _ { v } & 0 & cos\phi _ { v } \end{matrix}}\right ] \tag{27}\\ t_{hori}=&\left [ { \begin{matrix } & cos^{2}\theta _ { h } & sin^{2}\theta _ { h } & 0 & 2sin\theta _ { h } cos\theta _ { h } & 0 & 0\\ & sin^{2}\theta _ { h } & cos^{2}\theta _ { h } & 0 & -2sin\theta _ { h } cos\theta _ { h } & 0 & 0\\ & 0 & 0 & 1 & 0 & 0 & 0\\ & -sin\theta _ { h } cos\theta _ { h } & sin\theta _ { h } cos\theta _ { h } & 0 & cos^{2}\theta _ { h}-sin^{2}\theta _ { h } & 0 & 0\\ & 0 & 0 & 0 & 0 & cos\theta _ { h } & sin\theta _ { h}\\ & 0 & 0 & 0 & 0 & -sin\theta _ { h } & cos\theta _ { h } \end{matrix}}\right ] \tag{28}\end{align * } \end{document } matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r$ \end{document } represents the transformation between strain and engineering strain:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } r = \begin{bmatrix } & 1 & 0 & 0 & 0 & 0 & 0\\ & 0 & 1 & 0 & 0 & 0 & 0\\ & 0 & 0 & 1 & 0 & 0 & 0\\ & 0 & 0 & 0 & 2 & 0 & 0\\ & 0 & 0 & 0 & 0 & 2 & 0\\ & 0 & 0 & 0 & 0 & 0 & 2 \end{bmatrix } \tag{29}\end{equation * } \end{document } specifically , under the assumption of hooke s law , the total potential energy functional \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ e$ \end{document } of the system can be reached:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } e = \frac { 1}{2 } \int _ \omega \ , \sigma ^{t } \epsilon d{\omega } - \int _ \omega \ , f^{t } u d{\omega } \tag{30}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } is the external force , which has detailed description in the following section . by using the strain - displacement equation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \boldsymbol{\varepsilon } } = \mathbf { l u}$ \end{document } and minimizing the equation ( 30 ) with respect to displacement , we can derive that the stiffness matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } and force matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } have the following form:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } k_{i , j}=&\int _ \omega { s_{i } } \omega \mathbf { n}_{i}^{t } f d{\omega } \tag{32}\end{align * } \end{document } in the 2d case , with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { n}_{i } = \left [ { \begin{array}{cc } n_{i } & 0 \\ 0 & n_{i } \end{array } } \right ] \ ! , \quad \mathbf { s}_{i } = \mathbf { l n_{i } } = \left [ { \begin{array}{cc } n_{i , x } & 0 \\ 0 & n_{i , y } \\ n_{i , y } & n_{i , x } \end{array } } \right ] \qquad \tag{33}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i , x}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i , y}$ \end{document } represent the derivatives of the mls shape functions with respect to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , respectively . with regard to the 3d case , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } \mathbf { n}_{i}=&\begin{bmatrix } & n_{i } & 0 & 0\\ & 0 & n_{i } & 0\\ & 0 & 0 & n_{i } \end{bmatrix}\tag{34}\\ { s_{i}}=&\mathbf { l n}_{i } = \begin{bmatrix } & n_{i , x } & 0 & 0\\ & 0 & n_{i , y } & 0\\ & 0 & 0 & n_{i , z}\\ & n_{i , y } & n_{i , x } & 0\\ & 0 & n_{i , z } & n_{i , y}\\ & n_{i , z } & 0 & n_{i , x } \end{bmatrix } \tag{35}\end{align * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i , x}$ \end{document},\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i , y}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i , z}$ \end{document } are the derivatives of the shape function with respect to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } , respectively . to evaluate the entries of the system matrices , integrations over the problem domain and both the natural and the essential boundaries need to be be performed through numerical techniques such as the gauss quadrature . a mesh of non - overlapping cells , called the background mesh , is required for the quadrature integration . in contrast to the fem mesh needed for field variable interpolation , the background mesh , which needs to be properly designed to obtain an appropriate solution of desired accuracy , is used merely for the integration of the system matrices ( ) . furthermore , the background cells are usually totally independent of the arrangement of nodes ; in this paper , a regular - grid background mesh is used . in the regular - grid cell structure , there may exist cells that do not entirely belong to the analysis domain . a simple visibility scheme that automatically separates the portion of the cell that lies outside the physical domain is employed ( ) . in the 2d case , we have used \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{c } \times m_{c}$ \end{document } cells in the integration , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{c } = \sqrt { n_{t}}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{t}$ \end{document } is the total number of nodes in the domain . the number of quadrature points depends on the number of nodes in a cell , and we have used \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{q } \times n_{q}$ \end{document } gauss quadrature , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{q } = \sqrt { n_{node } } + 2 $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{node}$ \end{document } is the number of nodes in a cell . in the 3d case , we have used \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{c } \times m_{c } \times m_{c}$ \end{document } cells , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{c}=\sqrt { n_{t}}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{t}$ \end{document } is the number of the nodal points ( ) . in each cell , we use \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{c}\times n_{c } \times n_{c}$ \end{document } gauss quadrature . both imaging data information and prior modeling constraints , needed for the simultaneous recovery of the heart shape and motion , are incorporated in the external driving force term \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } , which has four primary components : ( 1 ) the data - driven edginess measures \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{edginess}(\mathbf { x})$ \end{document } of the myocardial boundary and tagging points , ( 2 ) the statistical prior distributions of the myocardial tissue locations \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{prior}(\mathbf { x})$ \end{document } , ( 3 ) the temporal shape coherence measures on the image - derived salient features \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{shape}(\mathbf { x})$ \end{document } , and ( 4 ) the motion constraints on the myocardial behavior \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{temporal}(\mathbf { x})$ \end{document } , including the prior cyclic heart dynamics and the data - derived eulerian velocity information . for boundary and tagging line nodes , all four components contributes to the overall force field:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } f_{boundary}(\mathbf { x})=&f_{edginess}(\mathbf { x } ) \ , [ \alpha ( \mathbf { x } ) f_{prior}(\mathbf { x } ) \\&+\ , \beta ( \mathbf { x } ) f_{shape}(\mathbf { x } ) + \gamma ( \mathbf { x } ) f_{temporal}(\mathbf { x})]\qquad \tag{36}\end{align * } \end{document } here , the algorithm favors locations that are likely edge points while maintaining the balance among the prior positional information , temporal filtering / prediction results , and salient shape coherence measures between frames . for all non - boundary / non - tag nodes , there are no constraints on them being edge points or preserving shape coherence between image frames . therefore , the force term is simplified to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{other}(\mathbf { x } ) = \alpha ( \mathbf { x } ) f_{prior}(\mathbf { x } ) + \gamma ( \mathbf { x } ) f_{temporal}(\mathbf { x } ) \tag{37}\end{equation * } \end{document } all these four types of force components , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{edginess}(\mathbf { x})$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{prior}(\mathbf { x})$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{shape}(\mathbf { x})$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{temporal}(\mathbf { x})$ \end{document } , are normalized to the range of [ 0 ; 1 ] , and the weighting constants \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \alpha ( \mathbf { x})$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \beta ( \mathbf { x})$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \gamma ( \mathbf { x})$ \end{document } are selected to reflect the varying data and model conditions in different parts of the heart at different time frames . to achieve geometry recovery , the resulting boundary nodes ( and some internal nodes for mri tagging data ) earlier works have shown that portions of the heart boundary may have confusing gradient information caused by the partial volume effect and intensity homogeneity , thus achieving good segmentation results solely from gradient information is difficult . furthermore , as suggested by ( ) , the diffusion of the gradient magnitude field generates a more robust gradient vector flow ( gvf ) with low gvf magnitude near the object boundary . therefore , we construct our edginess measure to enforce high gradient values and low gvf values:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{edginess}(\mathbf { x } ) = \frac { |gvf(\mathbf { x})|}{1+|\bigtriangledown i(\mathbf { x})| } \tag{38}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bigtriangledown i$ \end{document } is image gradient and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ |gv f |$ \end{document}is the gvf magnitude . to achieve more robust estimation results against imaging noises and defects , while these constraints are currently only enforced on the starting boundary and tag - line nodes for each frame , there is little difference if we are considering the other nodes in the same fashion . the spatial prior ranges of the nodes are constructed as a 2d gaussian distribution \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { n}(\mathbf { x}(k-1 ) , \sigma ) $ \end{document } , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma $ \end{document } is the variance , and the mean \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}(k-1)$ \end{document } is the nodal point at the starting position of the current frame ( result of the last frame ) . therefore , the derived prior force component becomes \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{prior}(\mathbf { x } ) = 1 - \bar { n}(\mathbf { x}(k-1 ) , \sigma ) \tag{39}\end{equation * } \end{document } in 3d , we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{prior}(\mathbf { x } ) = 1 - \bar { n}(\mathbf { x}(k-1),\sigma _ { 1},\sigma _ { 2},\sigma _ { 3 } ) \tag{40}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { n}(\mathbf { x}(k-1),\sigma _ { 1},\sigma _ { 2},\sigma _ { 3})$ \end{document } is the 3d gaussian distribution as the spatial prior range . obviously , we assume that every node moves away from its starting position during a cardiac cycle . while this has produced reasonable results in our experiments , other types of biases can be used as long as they are meaningful to the specific cases . earlier efforts have demonstrated and validated the effectiveness of tracking the heart boundary motion by using geometrical shape cues ( , ) . following this strategy , we propose to use the shape coherence of the myocardial salient landmarks , such as boundary nodes and tag - tag / tag - boundary crossings , between image frames as an additional guideline for constructing the force field . based on the theorem of implicit iso - intensity curve representation ( ) , the differential curvature values of the nodes from the images can be directly computed in the two - dimensional case:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \kappa ( \mathbf { x } ) = \frac { i_{yy}(\mathbf { x } ) i_{x}^{2}(\mathbf { x } ) - 2 i_{xy}(\mathbf { x } ) i_{x}(\mathbf { x } ) i_{y}(\mathbf { x } ) + i_{xx}(\mathbf { x } ) i_{y}^{2}(\mathbf { x } ) } { { ( i_{x}^{2}(\mathbf { x } ) + i_{y}^{2}(\mathbf { x}))}^{3/2 } } \end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{x}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{y}$ \end{document } are the first derivatives of the image intensity , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{xx}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{yy}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{xy}$ \end{document } are the second derivatives . in the 3d case , the hessian matrix can be derived as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { h } = \begin{bmatrix } i_{xx } & i_{xy } & i_{xz}\\ i_{xy } & i_{yy } & i_{yz}\\ i_{xz } & i_{yz } & i_{zz } \end{bmatrix } \tag{41}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{xx}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{xy}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{xz}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{yy}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{yz}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{zz}$ \end{document } are the second derivatives of the 3d image intensity . after rotating the hessian to align the first axis with the gradient \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ g=(i_{x},\,\,\,i_{y},\,\,\,i_{z})$ \end{document } , the resulting matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { h}^{r}$ \end{document } can be written as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { h}^{r } = \left [ \begin{array } { ccc } i_{gg } & & \\ \hdashline & i_{uu } & i_{uv } \\ & i_{uv } & i_{vv } \end{array}\right ] = \left [ \begin{array } { cc } i_{gg } & \\ \hdashline & \mathbf { h_{t}}^{r } \end{array } \right ] \tag{42}\end{equation * } \end{document } assuming that the eigenvalues of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { h_{t}}^{r}$ \end{document } are \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \lambda _ { 1}$ \end{document } ( maximum ) and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \lambda _ { 2}$ \end{document } ( minimum ) , the corresponding principle curvatures can be obtained:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align * } \kappa _ { 1}=&\frac { -\lambda _ { 1}}{\|g\|}\tag{43}\\ \kappa _ { 2}=&\frac { -\lambda _ { 2}}{\|g\| } \tag{44}\end{align * } \end{document } therefore , the mean curvature can be computed as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \kappa ( \mathbf { x } ) = \frac { 1}{2 } ( \kappa _ { 1}+\kappa _ { 2 } ) \tag{45}\end{equation * } \end{document } then , the basic idea is to use the minimum bending energy criterion to guide the boundary and tag nodes moving toward the final pixel positions , which have as close geometric properties as these nodes at the previous frame ( starting nodal positions for the current frame ) . therefore , the shape force term is defined as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{shape}(\mathbf { x } ) = |\kappa ( ( \mathbf { x}+\delta \mathbf { x})(k+1))- \kappa ( ( \mathbf { x}(k))| \tag{46}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \kappa ( ( \mathbf { x}+\delta \mathbf { x})(k+1))$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \kappa ( ( \mathbf { x}(k))$ \end{document } are the iso - intensity curvatures at frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k+1 $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } , respectively , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \delta \mathbf { x}$ \end{document } indicates that the search is conducted at a local window near the original boundary / tag point \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document}. as with most other cardiac applications , we assume that the motion of the heart is periodic . we can expand the trajectory of each node into sine functions ( ) . owing to the limited temporal resolution available , the first two terms of the expansion are retained and a continuous model of the trajectory of any mesh node is approximated by a closed ellipse in a short time interval in a piecewise sense:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \mathbf { x}(t ) = \bar { \mathbf { x } } + a \sin ( 2 \pi \omega t + \varphi ) \tag{47}\end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } is the continuous time index , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } is the node position , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { \mathbf { x}}$ \end{document } is the mean position over the cardiac period , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a$ \end{document } is the amplitude of the motion . the frequency of the oscillator is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 2 \pi \omega = 2 \pi /t$ \end{document } , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } is the period of the cardiac cycle , which is known from the imaging data . an estimation of the node \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } at frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k+1 $ \end{document } can be provided by the past positions of a given node \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}$ \end{document } up to the current image frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } and the available imaging / image - derived eulerian motion information . typical eulerian kinematic data include the optical flow field calculated from image frames \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k+1 $ \end{document } , the instantaneous velocity provided by mr phase contrast images , the partial velocity information from doppler echocardiography , etc . a standard kalman filter / predictor can be used to estimate the state variables ( position , displacement , and velocity ) at frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k+1 $ \end{document } as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \hat { z } ( k+1 \mid k ) = \bar { c } \hat { z } ( k \mid k ) \tag{48}\end{equation * } \end{document } with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \bar { c } = \left [ { \begin{array}{ccc } \lambda & \mu & 0 \\ 1-\cos ( \omega \triangle t ) & \cos ( \omega \triangle t ) & \dfrac { 1}{\omega } \sin ( \omega \triangle t ) \\ \omega \sin ( \omega \triangle t ) & -\omega \sin ( \omega \triangle t ) & \cos ( \omega \triangle t)\\ \end{array } } \right ] \end{equation * } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z = [ \bar { \mathbf { x } } , \mathbf { x } , \dot { \mathbf { x } } ] $ \end{document } is the state vector , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \hat { z } ( k+1 \mid k)$ \end{document } is the kalman filter estimated state for image frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k+1 $ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \hat { z } ( k \mid k)$ \end{document } is the estimated state vector up to frame \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \lambda = ( n-1)/n$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu = 1/n$ \end{document } are constants , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } is the number of image frames over the heart cycle . in our experiments , the velocity term in equation ( 48 ) adopts the available eulerian motion fields from the mr phase contrast velocity images or the spatiotemporal intensity flow between mr image frames . for phase velocity data , the regularization of the vector field may be needed to remove noise . the temporally predicted possible node position \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \hat { \mathbf { x}}$ \end{document } is used to construct a rotated 2d gaussian distribution \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { n}(\hat { \mathbf { x } } , \sigma _ { i } , \sigma _ { j } , \theta ( \hat { \mathbf { x}}))$ \end{document } , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { j}$ \end{document } are the variances in the rotated major directions , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \theta $ \end{document } is the angle of the line formed by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}(k-1)$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \hat { \mathbf { x}}(k)$ \end{document } with respect to the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x-$ \end{document}axis , with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k-1 $ \end{document } indicating image frame numbers . we can construct the temporal filtering / prediction force as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{temporal}(\mathbf { x } ) = 1 - \bar { n}(\hat { \mathbf { x } } , \sigma _ { i } , \sigma _ { j } , \theta ( \hat { \mathbf { x } } ) ) \tag{49}\end{equation * } \end{document } in the 3d case , the temporal force could be constructed as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } f_{temporal}(\mathbf { x } ) = 1-\bar { n}(\hat { \mathbf { x}},\sigma _ { i},\sigma _ { j},\sigma _ { k},\theta ( \hat { \mathbf { x}}),\phi ( \hat { \mathbf { x } } ) ) \tag{50}\end{equation * } \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \bar { n}(\hat { \mathbf { x}},\sigma _ { i},\sigma _ { j},\sigma _ { k},\theta ( \hat { \mathbf { x}}),\phi ( \hat { \mathbf { x}}))$ \end{document } is a rotated 3d gaussian distribution , where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { j}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { k}$ \end{document } are the variances in the rotated major directions , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \theta $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \phi $ \end{document } are the angles of the line formed by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mathbf { x}(k-1)$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \hat { \mathbf { x}}(k)$ \end{document } with respect to the cartesian coordinate . with the mesh - free particle framework for the simultaneous recovery of the heart shape and motion , we have performed experiments on synthetic data , mr phase contrast images including instantaneous velocity information sequences , mr tagging sequences , and gradient echo cine mr image sequences . the proposed framework can employ the measured data extracted from images , which are either intensity or / and velocity depending on the imaging protocol used . the first step of the algorithm is initialization which includes extraction of the useful features ( such as endo- and epi- boundaries and tag - tag points ) of the first frame and allocation of the sampling nodes bounded by the initial boundaries . a local analysis domain centered at each node then based on the mls approximations , the shape interpolation functions are constructed and the stiffness matrix \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ k$ \end{document } and external force terms are formulated . finally , we estimate the dense displacement field by tracking for minimizing the total energy between successive frames . the canine heart model of the university of auckland , which provides both the cardiac geometry and the fiber architecture obtained through anatomical experiments ( ) , young s moduli along and across the fiber were 75 and 25 kpa , respectively . the physiome model was applied to the heart model to provide the ground truth , and 50 frames of one cardiac cycle were obtained , which were then converted into a grayscale structural image sequence of 50 frames with image size of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 75\times 75 \times 16 $ \end{document } and spatial resolution of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1.27 \times 1.27 \times 4.86 mm^{3}$ \end{document}. noise with 5db snr was added to the derived images data to provide noisy measurements . the epicardial and endocardial surfaces of the whole heart segmented from the synthetic images in the first frame as well as 1274 myocardial sample points formed the mesh - free representation of the heart . for the purpose of comparisons the shape and kinematic parameters of the synthetic heart were recovered by the proposed approach with mesh - free ( linear bases , without refinement ) and fem ( linear tetrahedral elements , without refinement ) representations under the same external forces . further , the fiber orientations were obtained by invasive procedures of dead canine hearts ( ) . the data are in 3d and are obtained at the most relaxed state of the heart . in the next canine experiment , 2d mid - ventricle slice data were extracted for our initial fiber orientations . the 2d fiber orientation data are mapped to our myocardium geometry by using principal warps . apart from the normal case , a validation with a pathological case was also performed . in the pathological case , part of the heart 1 ) , where young s modulus was set to be three times that in the normal case . then , procedures similar to those described above were used . finally , the shape and kinematic parameters of the synthetic heart were recovered by the proposed approach with mesh - free representation under the same biomechanical model as in the normal case . figure 1.left : pathological case ; part of the heart was assumed to be infarcted ( red region ) . right : ttc - stained post - mortem left - ventricular myocardium in which infarcted zone are highlighted . left : pathological case ; part of the heart was assumed to be infarcted ( red region ) . right : ttc - stained post - mortem left - ventricular myocardium in which infarcted zone are highlighted . in the third experiment , the joint method and the traditional separated strategy ( ) were compared using the pathological simulation results . a set of canine mr phase contrast image sequences has been used in this experiment . during the animal experiment , a proximal segment of the left anterior descending ( lad ) coronary artery of an adult mongrel dog is dissected free to enable the production of a controlled , graded coronary stenosis . sixteen canine mr phase contrast velocity and magnitude images are acquired over the heart cycle , with the following imaging parameters : flip angle = 30 , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ te = 11 ms$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ tr = 34 ms$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ fov = 28 cm$ \end{document } , matrix 256\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \times $ \end{document}128 , and venc \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = 15 cm / s$ \end{document}. the image resolution is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1.09 mm / pixel$ \end{document } , and the velocity intensity ranges from \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ -150 mm / s$ \end{document } to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 150 mm / s$ \end{document } , with the signs indicating the directions . the histological staining of the post - mortem myocardial tissues is shown in right of fig . 1 , and the infarct regions is highlighted . sixteen mr tagging images of a healthy mongrel dog over the heart cycle are used in the second experiment , where the tagging magnetic void grid is applied at the end diastole ( frame # 1 ) , shown in fig . figure 2.1st row : tagging images at frames # 1 , # 5 , # 9 , and # 13 ; 2nd row : segmentation results at frames # 1 , # 5 , # 9 , and # 13 ; 3rd row : estimated frame - to - frame displacement fields : between frames # 1 - 2 , # 5 - 6 , # 9 - 10 , and # 13 - 14 ; 4th row : strain estimates for tagging data between end - diastole and end - systole : radial , circumferential , shear strain , and scale map ( from left to right ) . 1st row : tagging images at frames # 1 , # 5 , # 9 , and # 13 ; 2nd row : segmentation results at frames # 1 , # 5 , # 9 , and # 13 ; 3rd row : estimated frame - to - frame displacement fields : between frames # 1 - 2 , # 5 - 6 , # 9 - 10 , and # 13 - 14 ; 4th row : strain estimates for tagging data between end - diastole and end - systole : radial , circumferential , shear strain , and scale map ( from left to right ) . we also implemented our approach on gradient echo cine mr image sequence , including animals and humans : 1 normal dog , 2 mini - porcine , and 22 human volunteers . 1.table 1the imaging parameters used for experimentsdataresolution ( mm)image sizeslicesframescanine1.56 * 1.56 * 5.064 * 641616mini - porcine 11.25 * 1.25 * 8.064 * 641220mini - porcine 21.25 * 1.25 * 8.064 * 641620patient1.27 * 1.27 * 8.0128 * 1281820 the myocardium is modeled as a transversely linear elastic solid , as described in section 2.3 . 3 shows the results under the linear fem framework and those under the mesh - free framework . table 2 shows the quantitative assessments of the average positional errors ( error is defined as the distance between the estimated boundary point and its corresponding true one . overall , the results obtained with the mesh - free representation agree with the ground truth . it can be seen that the segmented shape of the whole heart with the mesh - free representation is closer to the boundary defined in the image . in fig . 4 , for frame # 25 as an example , it can be seen that the strains estimated using the mesh - free representation are better ; the strain is smoother , and its distribution is similar to the ground truth . this is mainly because the mesh - free representation can handle fiber discontinuities and avoid the problem caused by tetra skewing . in the reported experiments on a 2.33 ghz 4-core computer with 8 gb memory and under the matlab environment , each iteration loop took 491 s for the mesh - free method and 478 s for the fem method . please note that especially for complex geometries like the heart , the time required for constructing the mesh in fem may even be longer than that required for the analysis itself.table 2average positional errors over time . each data cell represents the mean and standard deviational errorsframeaverage errors ( mean standard deviation ) ( pixel)femmesh - free21.17 0.621.17 0.5881.19 0.731.17 0.62141.20 0.881.19 0.77201.74 0.941.21 0.78261.98 1.01.23 0.86322.57 0.991.25 0.87383.14 1.11.30 0.98444.61 1.21.31 0.98505.64 1.31.33 0.99 figure 3.1st and 2nd rows : joint segmentation and motion tracking results with linear fem framework . 3rd and 4th rows : joint segmentation and motion tracking results with mesh - free framework . the 1st and 3rd rows show a selected segmented volume representation of the left and right ventricles . the 2nd row shows contours generated by a linear fem - based method overlaid on the corresponding intensity image slice . the 4th row shows contours generated by the mesh - free method overlaid on the corresponding intensity image slice . the 2nd and 4th rows show how much the output of the algorithm matches the boundary in the image . figure 4.a long - axis cut - away view of the heart showing strains at frame # 25 with respect to the # 1 frame . top to bottom : radial strain maps , circumferential strain , and longitudinal strain . left to right : ground truth , fem results , mesh - free results , and scale map . 1st and 2nd rows : joint segmentation and motion tracking results with linear fem framework . 3rd and 4th rows : joint segmentation and motion tracking results with mesh - free framework . the 1st and 3rd rows show a selected segmented volume representation of the left and right ventricles . the 2nd row shows contours generated by a linear fem - based method overlaid on the corresponding intensity image slice . the 4th row shows contours generated by the mesh - free method overlaid on the corresponding intensity image slice . the 2nd and 4th rows show how much the output of the algorithm matches the boundary in the image . a long - axis cut - away view of the heart showing strains at frame # 25 with respect to the # 1 frame . top to bottom : radial strain maps , circumferential strain , and longitudinal strain . left to right : ground truth , fem results , mesh - free results , and scale map . the strain plots in fig . 5 show a comparison of the mean strains between the normal and the pathological cases by using the proposed method ; this figure shows that all strain changes in the pathological case are smaller than those in the normal case because of the infarction . figure 5.the mean strains between the normal and the pathological cases by using the proposed method : radial strain ( top ) , circumferential strain ( middle ) , and longitudinal strain ( bottom ) . the mean strains between the normal and the pathological cases by using the proposed method : radial strain ( top ) , circumferential strain ( middle ) , and longitudinal strain ( bottom ) . in the third experiment , to perform a quantitative comparison , we computed the mean strains in different segments and sorted them in ascending order ( table 3 ) . first , almost all infarcted segments ( 1 , 5 , 6 , 7 , and 12 ) are located at the beginning of the queue . second , the segments directly neighboring the infarcted ones are at the front of the queue . this is because shape / kinematics recovery is constrained in a unified framework , which gives a more consistent result . more importantly , the traditional strategy requires isolation of the myocardium from the background information throughout the cardiac cycle before processing . this segmentation step is difficult and can not be done automatically , and thus , the time required for segmenting and establishing a sparse set of corresponding feature points between boundaries may even be longer than that required for the motion tracking itself . table 3mean strains in different segments . the 16 segments are sorted by the mean of the largest principal strains in ascending order . infarcted regions are ( 1 , 5 , 6 , 7 , 12)our methodtraditional strategy ( ) ( 1 ) 0.079(5 ) 0.091(5 ) 0.084(11 ) 0.120(6 ) 0.092(1 ) 0.130(11 ) 0.116(6 ) 0.135(12 ) 0.120(12 ) 0.136(7 ) 0.125(8 ) 0.138(2 ) 0.131(2 ) 0.144(8 ) 0.134(7 ) 0.147(16 ) 0.142(13 ) 0.149(13 ) 0.147(16 ) 0.152(4 ) 0.157(4 ) 0.161(3 ) 0.159(3 ) 0.166(9 ) 0.163(14 ) 0.199(10 ) 0.170(10 ) 0.207(14 ) 0.201(9 ) 0.231(15 ) 0.243(15 ) 0.267 the 1st row of fig . 6 shows volumetric segmentation results from the phase contrast data which are visually robust and sensible . the detected boundary contours have consistent spatial and temporal characteristics , which are much desired for image sequence segmentation and for motion analysis . further , the recovered motion measures from the image sequence are presented for displacement vector fields in the 2nd row of fig . 6 and for cardiac - specific radial strain maps ( 1st row of fig . 7 , indicator for myocardial contraction ) , circumferential strain maps ( 2nd row of fig . 7 , indicator for myocardial twisting ) , and shear strain maps ( 3rd row of fig . 7 ) , all with respective to the end - diastolic image frame . from the displacement vectors , it can be observed that during the contraction phase of the cardiac cycle ( i.e. , frames # 1 to # 8) , there is little contracting motion at the infarct zone ( lower right part ) until frame # 6 . at the beginning of the cardiac expansion phase ( frames # 9 to # 10 ) , however , the contracting motion of the infarcted tissues continues while the expanding motion of the normal tissues just starts . the expansion at the infarct zone does not occur until frame # 14 . from the strain maps , it is quite obvious that the infarct region has vastly different characteristics from the normal zones : little deformation in the radial and circumferential directions , and opposite changes in the shear strain maps . these signs of dyskinesias ( impairment of voluntary movements resulting in fragmented or jerky motions ) and motion reductions at the lower - right part of the lv are clear indications of myocardial injury , and they agree with the histochemical result very well . figure 6.1st row : selected segmentation results for mr phase contrast image at frames # 1 , # 3 , # 6 , # 9 , # 12 , and # 15 . 2nd row : estimation of the displacement vector maps with respect to frame # 1 for the mr phase contrast images at frames # 3 , # 6 , # 9 , and # 12 . figure 7.1st row : estimation results of the radial strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . 2nd row : joint estimation results of the circumferential strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . 3rd row : joint estimation results of the radial - circumferential shear strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . 1st row : selected segmentation results for mr phase contrast image at frames # 1 , # 3 , # 6 , # 9 , # 12 , and # 15 . 2nd row : estimation of the displacement vector maps with respect to frame # 1 for the mr phase contrast images at frames # 3 , # 6 , # 9 , and # 12 . 1st row : estimation results of the radial strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . 2nd row : joint estimation results of the circumferential strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . 3rd row : joint estimation results of the radial - circumferential shear strain maps for the mr phase contrast images ( w.r.t . frame # 1 , the end - diastolic phase ) at frames # 1 , # 6 , # 8 , # 9 , # 10 , # 14 , and # 16 . the cardiac - specific strain maps are also given in fig . 2 between the end- diastole ( ed ) and end - systole ( es ) frames . because the tagging grid decays over time , the tag lines in the images become very weak late in the image sequence . further efforts on constructing appropriate external forces are needed and in progress , including the modeling of the temporal intensity changes of the tag line and the use of directional band - pass filters to enhance tag line contrast . the volumetric segmentation results , namely , the estimated displacement vector map with respect to end - diastole are shown in the fig . 812 . as expected , we see substantially more movement by the endocardial tissue than the epicardial tissue . to the end , we have calculated the strain tensors for each point to depict the non - rigid deformation . 4th to 6th row : a long - axis cut - away view of the lv showing radial ( 4th row ) , circumferential ( 5th row ) and longitudinal strain ( 6th row ) at frames # 3 , # 6 , # 11 , and # 13 with the same scale as shown in fig . figure 9.mini- porcine1 experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 using meshfree framework . 3rd to 5th row : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) and longitudinal strain ( 5th row ) at corresponding 5 time points with the same scale as shown in fig . figure 10.mini- porcine2 experimental results at frames # 3 , # 6 , # 9 , and # 12 using meshfree framework . 3rd to 5th row : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) and longitudinal strain ( 5th row ) with the same scale as shown in fig . 4 . figure 11.patient 1 s experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 by using mesh - free framework . 3rd to 5th rows : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) , and longitudinal ( 5th row ) strains with the same scale as that used in the 1st row of fig . 4 . figure 12.patient 2 s experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 by using mesh - free framework . 3rd to 5th rows : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) , and longitudinal ( 5th row ) strains with the same scale as that used in the 1st row of fig . 4th to 6th row : a long - axis cut - away view of the lv showing radial ( 4th row ) , circumferential ( 5th row ) and longitudinal strain ( 6th row ) at frames # 3 , # 6 , # 11 , and # 13 with the same scale as shown in fig . 4 . mini- porcine1 experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 using meshfree framework . 3rd to 5th row : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) and longitudinal strain ( 5th row ) at corresponding 5 time points with the same scale as shown in fig . 4 . mini- porcine2 experimental results at frames # 3 , # 6 , # 9 , and # 12 using meshfree framework . 3rd to 5th row : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) and longitudinal strain ( 5th row ) with the same scale as shown in fig . 4 . patient 1 s experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 by using mesh - free framework . 3rd to 5th rows : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) , and longitudinal ( 5th row ) strains with the same scale as that used in the 1st row of fig . 4 . patient 2 s experimental results at frames # 3 , # 6 , # 9 , # 12 , and # 16 by using mesh - free framework . 3rd to 5th rows : a long - axis cut - away view of the lv showing radial ( 3rd row ) , circumferential ( 4th row ) , and longitudinal ( 5th row ) strains with the same scale as that used in the 1st row of fig . , we can see that the endocardial tissue deforms more than the epicardial tissue in the radial and circumferential directions . further , it is quite obvious that during the cardiac deformation from ed to es , the magnitudes of the radial , circumferential , and longitudinal strains increase , in which the longitudinal strains are relatively small . this indicates that the myocardium is primarily thickened in the radial direction and shortened in the circumferential direction . for the human experiments , most of the trajectories obtained using the mesh - free method are converged . from the segmentation result and the trajectory of the boundary points , we can see that the mesh - free framework is more suitable for segmentation than the fem representation . this is because it needs no remeshing , and a more accurate result can be obtained only by changing the weighting function . the strain distribution of the model recovered by the mesh - free method agrees with the observations available from biomechanics and cardiology literatures , and this distribution is continuous . these promising results demonstrate that the proposed algorithm can be used to perform 3d segmentation and motion tracking simultaneously . to validate the success of the proposed segmentation procedure , we compared the results of the human experiments with manual segmentation from cardiac mri images of 22 patients . table 4 summarizes the means and standard deviations of the position differences between the results of the proposed algorithm and manual contours . these numbers show that , globally , the automatic segmentations are very close to the manual ones . table 4average and maximum distances between automatic and manual contours ( pixel)averageendo1.01 0.53epi0.92 0.32maximumendo3.31epi2.86 we have proposed spatiotemporal strategies for the joint segmentation and motion tracking of the heart . this unified approach is based on the use of image analysis strategies and mechanical modeling of the myocardium , and it is implemented in a mesh - free framework for the integration of complementary image sources . this joint segmentation and motion analysis framework estimates the optimal shape , motion , and deformation parameters from noisy image data . the application of a continuum mechanical model of the myocardium provides physically meaningful constraints on the dynamic behaviors of the heart tissue . we should note that there are several parameters ( weighting parameters ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \alpha $ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \beta $ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \gamma $ \end{document } ) , variance parameters ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { 1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { 2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { 3}$ \end{document } ) ) in the proposed method . the incorrect selection of these parameters will result in large estimation errors or even divergence . a general rule on the choice of these parameters is related to the confidence measures on the available imaging / imaging - derived measurement data . for example , if we trust \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{shape}$ \end{document } more than the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{prior}$ \end{document } , we should make \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \alpha $ \end{document } smaller than \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \beta $ \end{document}. this will deemphasize the importance of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{prior}$ \end{document } relative to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{shape}$ \end{document}. an automatic procedure to determine the algorithm parameters obtained from the local phase coherence ( ) of images is under investigation . the algorithms in this paper only provide the quantitative estimation of the possible locations and extents of the infarcted area , but not the material properties , such as young s moduli of the diseased areas , that have great clinical value . further research could extend to joint segmentation , motion , and a material parameters estimation framework . moreover , from the viewpoint of biomechanical constraints , although we have adopted anisotropic material models , these remain different from the extremely complex physical properties of an actual heart . first , while most works thus far have used linear material models of the heart muscles under infinitesimal stain theory , we believe that the adopted constrained biological model of the heart with large deformation will provide more accurate estimation results . furthermore , integrating electrical activation into the biomechanical model would be very useful to help estimate the shape and motion parameters from cardiac image sequences ( ) .
although accurate and robust estimations of the deforming cardiac geometry and kinematics from cine tomographic medical image sequences remain a technical challenge , they have significant clinical value . traditionally , boundary or volumetric segmentation and motion estimation problems are considered as two sequential steps , even though the order of these processes can be different . in this paper , we present an integrated , spatiotemporal strategy for the simultaneous joint recovery of these two ill - posed problems . we use a mesh - free galerkin formulation as the representation and computation platform , and adopt iterative procedures to solve the governing equations . specifically , for each nodal point , the external driving forces are individually constructed through the integration of data - driven edginess measures , prior spatial distributions of myocardial tissues , temporal coherence of image - derived salient features , imaging / image - derived eulerian velocity information , and cyclic motion model of myocardial behavior . the proposed strategy is accurate and very promising application results are shown from synthetic data , magnetic resonance ( mr ) phase contrast , tagging image sequences , and gradient echo cine mr image sequences .
accidents can take place in a wide variety of environments and settings ; however , the home , which people regard as the safest place , is the most likely location . home accidents comprise 35% of all unintentional injuries in childhood , and the majority of victims are toddlers and pre - school children . televisions ( tv ) have become ubiquitous in households all around the world [ 35 ] . over the past several years , tvs have grown larger in size and shape , which has made them unstable and susceptible to toppling [ 6 , 7 ] . falling tvs have created a potential risk for significant injury to children in households . however , despite the danger , only a few studies have been reported in the literature regarding this source of risk [ 1 , 311 ] . furthermore , several home safety guidelines for parents do not include how to prevent tv - related injuries [ 12 , 13 ] . the purpose of this study was to quantify injuries in children that result from toppled televisions and to highlight the significance of this mechanism of injury . this is a retrospective chart review study for which we collected data from our emergency department s digital patient database for the september 2008september 2009 period . all children under 15 years of age who presented to the ed with injuries casued by a falling television were included in this study . patients were identified and selected from the digital database using the chief complaint upon arrival . demographic information , injured body region and diagnosis , surgical intervention , admission to the intensive care unit ( icu ) , glasgow coma scale ( gcs ) score , length of hospital stay ( los ) , in - hospital mortality , and disposition at hospital discharge were analysed . a descriptive analysis of the continuous and categorical data was performed using proportions , frequency distributions , means , and standard deviations . during the 12-month period under investigation , 3,856 children were admitted to our ed with injuries sustained at home . of these 3,856 admissions , 71 ( 1.8% ) were becasue of tv - related injuries , and thus these patients were included in this analysis . the mean age was 39.79 20.14 months ( sd ) , with more than half ( 53.5% ) of the children aged 12 to 36 months . table 1age and gender of the patientsage ( months)girlsboystotal<120121224491325365202537484374960491361721567384326>84011total215071 age and gender of the patients almost three - quarters of the children ( 49/71 ) sustained various head and facial injuries . the most common site for a scalp hematoma was the occipital region ( 55% ) , followed by the temporal , frontal , and parietal regions . the most common site for a scalp laceration was the frontal region ( 57% ) , followed by the temporal , occipital , and parietal regions . there were 18 skull fractures ( 8 occipital bone , 4 temporal bone , 3 frontal bone , and 3 parietal bone ) . traumatic brain injury occurred in 14 patients ( 4 subarachnoid bleeding , 1 epidural hematoma , 1 subdural hematoma , and 8 cerebral contusions ) . the average gcs score was 13.3 ( range , 315 ) in head trauma patients . one patient had a skin laceration over the midfoot that was sutured in the ed . there were seven patients with fractures , which were all treated with casting and/or closed reduction . two of them had superficial skin lacerations over the abdominal wall that did not reach the intra - abdominal cavity . one patient had a minor liver laceration , and two patients had free fluid in the abdomen detected with ultrasonography . the mean length of stay was 15.6 h ( 124 h ) in these patients . sixteen patients were hospitalised , and 14 of them required follow - up in the icu . two patients ( one with an epidural hematoma and one with a subdural hematoma ) underwent surgical intervention . four patients with subarachnoid bleeding died ( mean age , 30.25 months , range 2731 ) . one of them died immediately upon arrival , and the other three died in the icu . the mean los was 71.25 h ( range , 48168 h ) in the hospitalised patients . the number of injuries may add up to more than the number of cases because of multiple injuriesinjured body regionnumber of casesdescription of the injurieshead and facial injuries49*scalp and facial injuries31 patients , scalp hematoma 14 patients , scalp laceration6 patients , nasal contusion2 patients , forehead laceration1 patient , lip laceration*skull fractures8 patients , nondisplaced linear skull fracture10 patients , basilar skull fracture*traumatic brain injury4 patients , subarachnoid bleeding1 patient , epidural hematoma1 patient , subdural hematoma8 patients , cerebral contusionchest injuries132 patients , rib fracture11 patients , chest wall contusionabdominal injuries101 patient , grade 1 liver laceration 2 patients , abdominal wall laceration7 patients abdominal wall contusionextremity injuries30*upper extremity17 patients , soft tissue injuries1 patient , clavicular fracture1 patient , radius distal torus fracture*lower extremity5 patients , soft tissue injuries1 patient , skin laceration over midfoot2 patients , closed tibia fracture2 patients , closed metatarsal fracture1 patient , closed femur fracture distribution and description of injured body regions . the number of injuries may add up to more than the number of cases because of multiple injuries most accidents take place in the home environment , especially in toddlers and pre - schoolers as they spend most of their time there [ 1 , 2 , 11 ] . this study showed that children aged 12 to 36 months of both genders had the highest overall injury rate resulting from tv - related injuries . children s relative lack of coordination at this stage of development and their still undeveloped cognitive hazard awareness and avoidance skills are the major reasons for the accumulation of injuries at this age . previous studies on tv - related injuries have had comparable results to those of our study [ 1 , 6 , 8 ] . reported that more than half ( 57.4% ) of the children were boys , and more than three quarters ( 76.0% ) were 1 to 4 years of age . similarly , yahya et al . reported that 7 out of 18 children with tv - related head injuries were younger than 36 months of age , and more severe injuries occurred in this age group in their series . although home accidents can occur in all children , current evidence indicates that this specific mechanism of injury particularly affects boys younger than 36 months of age . previous retrospective descriptions and a prospective study have confirmed that a tv tip - over usually occurs when a curious toddler attempts to climb onto furniture , typically a dresser , on which the tv sits , causing the furniture and the tv to fall onto the child [ 1 , 5 ] . cathode ray tube tvs are not stable due to the imbalance of the intrinsic weight distribution of their design [ 6 , 7 ] . constructed a static model of a climbing child to simulate a tv tip - over and investigated how much weight was enough to topple a tv . suprisingly , they found that 90% of the accessible televisions could be tipped by a child 4 years of age with weight in the 90th percentile . sikron et al . reported that nearly three - quarters of the children ( 73.3% ) sustained head / neck injuries , with almost half of these having a definite traumatic brain injury . our results and the other relevant studies supported this evidence [ 5 , 11 ] . there may be two reasons ; either the tv falls onto the child s head , or the child hits his head on the ground during the fall we further analysed our data and found that occipital and frontal lesions , involving scalp haematomas , lacerations , and cranial fractures , were more common than lesions in other head regions . the presence of frontal lacerations , nasal contusions , and forehead and lip lacerations are indications of the first scenario , while the presence of occipital hematomas and fractures point to the second . mortality and substantial long - term sequelae in tv - related injuries can be attributed to traumatic brain injuries [ 9 , 10 ] . other injuries , including those of the abdomen , chest , and extremities , were mild to moderate in this study . reported the highest mortality rate ( 38.3% ) among studies concerning tv - related injuries . however , crush type injuries were also responsible for half of the mortality in their study . therefore , victims of tv - related injury should be carefully examined for possible fatal abdominal and thoracic injuries . we could not obtain a detailed history from the parents at the time of admission . we do not know the tv screen sizes , what the tvs were placed on , and the circumstances surrounding the injury scene . furthermore , data were extracted from our digital patient database , and some cases may have been missed , which may have affected the results . prospective studies are necessary to have a more realistic understanding of the mechanism of injury . in conclusion , falling tvs may cause significant morbidity and mortality in children , particularly those younger than 3 years old . head and facial injuries are the most commonly encountered , followed by injuries to the extremities . preventive measures taken in the home and , more importantly , increased awareness of this potential risk of injury by the parents are the key solutions to this problem .
backgroundfemoral artery pseudoaneurysm following cardiac catheterization is a serious groin complication requiring careful assessment and prompt intervention.aimsthe risk of femoral artery pseudoaneurysm is estimated at 0.6 to 17% following diagnostic and interventional procedures.methodsthe clinical use of bedside ultrasonography as part of the physical examination by attending emergency physicians has increased significantly over recent years.resultsbedside emergency department ultrasonography provides the clinician with critical information noninvasively , rapidly determining various anatomical structures.conclusionswe present the case of a patient with femoral artery pseudoaneurysm detected by bedside emergency department ultrasonography secondary to angiographic catheterization .
antireflection ( ar ) technology plays an important role in the fabrication of high - efficiency solar cells by increasing light coupling into the active region of devices . generally , a relatively low - light reflectivity can be obtained for crystalline silicon solar cells by combining surface texturization with sixny - thin - film deposition . however , in order to further reduce the light reflectivity for the improvement of solar cell efficiency , a variety of nanostructures with size comparable to the wavelength of m : most of the utilized solar spectrum have been proposed , such as photonic crystals , porous structures , plasm : monics [ 5 - 8 ] , etc . the subwavelength structures can be nanowires , nanocones , frustum nanorods , biomimetic nanostructures [ 13 - 16 ] , dielectric nanoparticles etc . all these nanostructures should be based on the wide bandgap materials which , themselves , can not absorb sunlight . the zno material has a wide bandgap , which has been popularly used in the fields of photocatalysis and optoelectronic nanodevices . for photovoltaic application , the zno nanostructures as antireflective layers could be fabricated by various approaches like pulsed laser deposition , chemical vapor deposition , vapor liquid - solid growth , hydrothermal method , and electrochemical deposition technique . am : mong them , a seeding and growth two - step process in zinc salt and amide mixed solutions seems quite acceptable for photovoltaics due to its low cost and good potential for scale - up . experiments have shown that zno nanorod arrays can exhibit better antireflective properties than other oxide compounds . a weighted global reflectance of 6.6% has been achieved in the broadband range from 400 to 1,200 nm . however , m : most work on zno nanorod arrays as antireflective layers is performed on the naked silicon wafer by now . the application of zno nanostructures in the practical silicon solar cells is seldom reported . in this work , we have grown zno nanowhiskers ( nws ) with different lengths by the seeding and growth two - step process , and meanwhile have integrated the zno nw technique into the fabrication of czochralski ( cz ) silicon solar cells based on the current standard celling technology . the density and the length of zno nws have been optimized for the improvement of solar cell performances by controlling the time of growth . the result shows that the efficiency of cz silicon solar cell can be improved by a value of 3% relatively using the zno nws as the ar layer in practice . the starting samples are p - type cz silicon solar cells fabricated by a standard process including surface texturization , phosphorus diffusion , sixny film deposition , screen printing , and metallization . the seed layer of zno was first deposited on the front surface of solar cells by a magnetron sputtering system . the deposition temperature is 150c , and the seed layer thickness is about 10 nm . after protecting the parts without the zno seed film with waterproof tapes , the samples were immersed in the solution of zinc nitrate hexahydrate ( zn(no3)26h2o ) and ( ch2)6 n4 mixture for 30 to 60 min for the growth of zno nw . the zno nw growth temperature is 90c . for characterization , a scanning electron microscope ( sem ; hitachi s-4800 , hitachi , ltd . , chiyoda , tokyo , japan ) was used to observe the zno nws on the solar cells . the reflection spectra of the samples were measured by a uv vis spectrophotometer ( hitachi u-4100 ) in the wavelength range of 300 to 1,100 nm . the external quantum efficiencies ( eqes ) of the final solar cells were obtained from the spectral responses . the current voltage characteristics of the cells under the dark and illumination circumstances were measured . for illumination , one sun ( 100 mw / cm ) with am 1.5 global spectrum was used . figure 1 shows the sem micrographs of a silicon solar cell with the zno nws after a two - step growth process . it can be seen that the zno nws are uniformly fabricated on the surface of silicon solar cell . generally , the fabrication of zno nws based on aqueous solution consists of nucleation and growth . the main chemical reactions through the whole process can be described as follows : ( 1)znno326h2ozn2++ 2no3+6h2o ( 2)ch26n4 + 6h2o6hcho+4nh3 sem images of top ( a ) and cross - sectional ( b ) views of zno nw - coated solar cell surface . the decomposition of hexamethylenetetramine produces amm : monia that can supply the oh needed for the zno nw formation reaction and acts as a ph buffer to regulate the ph value of the solution . the ph value of the solution should be 6 or 7 for the whole reaction process . during the process , the zno nanocrystals existing in the seed layer serve as the nucleation centers where the growth of zno nws takes place . due to its growth habit , c - axis is the m : most preferred growth orientation , which leads to the formation of zno nws . figure 2 shows the sem micrographs of zno nws on the solar cells after growing at different times . figure 2a , d shows the plan view and its cross - sections of zno nws after growing 30 min , respectively . one can see that the tapered zno nws with the length of approximately 100 nm are obtained on the pyramid - like textured surface of solar cell via this method . with the growth time increasing , the density of zno nws increases ( see figure 2b , c , e , f ) . meanwhile , the length of zno nws becomes larger , e.g. , approximately 200 nm after 45 min and approximately 300 nm after 60 min . sem images of zno nws grown under different times and their cross - section view . ( a ) and ( d ) 30 min , ( b ) and ( e ) 45 min , and ( c ) and ( f ) 60 min . figure 3 shows the reflectance spectra of the solar cells without or with the zno nw coating . it can be seen that , compared with the solar cell without zno nw coating ( reference ) , all the solar cells with zno nw coating exhibit lower reflectance than in the whole wavelength range . the reflectivity of zno nw - coated solar cells decreases with an increase of zno nw growth time . the solar cell with zno nws grown for 45 min has the lowest reflectivity . however , when the zno nw growth time reaches to 60 min , the reflectivity of coated solar cell becomes higher in the wavelength range of 500 to 1,100 nm . since the density and length of zno nws increase with an increase of growing time , it is suspected that the zno nws grown for 60 min could have formed something like this finally results in a higher reflection of zno nw grown for 60 min . nevertheless , these results clarify that the zno nw - coated solar cells have better antireflection effect than the reference without zno nw coating . the decrease of reflectivity in the long wavelength range mainly results from the effect of zno nw trapping light by the multiple scattering of the incident light . meanwhile , their gradually and continuously changing refractive index profile from the air to the substrate is also beneficial for its antireflection property . the drastic decrease of reflectance in the low - wavelength range should be mainly attributed to the absorption of light by zno nws , themselves , which hardly makes any contribution to the improvement of the solar cell performance . after a prolonged growing time , e.g. , 60 min , the light absorption of long zno nws becomes even stronger , and therefore , their contribution to the solar cell efficiency is further smaller . the reflectance ( r ) spectra for the solar cell with zno nw grown under different times . figure 4 shows the eqes of the solar cells with zno nws grown for different times . it can be seen that the solar cells with zno nws grown for 30 and 45 min generally have higher eqes than the referenced one in the whole spectral region . it signifies that zno nws on cz silicon solar cells can effectively improve the response of light spectrum . for the solar cell with zno nws grown for 60 min , the eqes in the short - wavelength range are smaller than that of the referenced due to the stronger light absorption of long zno nws . table 1 lists the detailed parameters of the solar cells coated with zno nws grown for different times . it can be seen that even though the open - circuit voltages for all the solar cells keep the same , the short - circuit current density of the solar cells coated by zno nws are higher . this finally results in that the efficiency of the solar cells coated by zno nws grown for 30 and 45 min are improved by a value of 0.1% and 3.0% , respectively , in comparison with the referenced cell . figure 5 examples the current density as a function of bias voltage for the solar cells with zno nws grown for 45 min . it reveals that zno nw - coated solar cells have higher short - circuit current density than the referenced one , while the open - circuit voltages keep constant . the improvement of short - circuit current density is obviously a result of zno nws suppressing the light reflectivity . in the case of zno nws grown for 60 min , the fill factor of the cell has a low fill factor and , therefore , a low efficiency . this deterioration of the cell performance should be related to the long - time immersion of the solar cell in the 90c aqueous solution during the zno nw growth process . the external quantum efficiencies ( eqes ) of the solar cells with zno nws grown for different times . performance parameters of c - si solar cells with and without zno nws ff fill factor , jsc short - circuit current density , voc , open - circuit voltage . the current density - voltage curves of the solar cells with 45-min grown zno nws . under a standard am 1.5 illumination . in summary , around 100 to 300 nm zno nws are grown on the surface of czochralski si solar cells based on a low cost aqueous solution method . zno nws grown for different times , such as 30 , 45 , and 60 min , can reduce the reflectivity of the solar cells effectively ( r < 3% ) in a large spectral region and improve the external quantum efficiency in the corresponding range . furtherm : more , zno nws with 45-min growth time can improve the efficiency of the solar cells by 3% , corresponding to their increment of short - circuit current density and fill factor . finally , long - time immersion of solar cells in aqueous solution during the zno nw growth process can deteriorate the solar cell performance drastically . deren yang and xuegong yu are both professors and doctorate degree holders in the state key laboratory of silicon materials , department of materials science & engineering , zhejiang university . dong wang , dong lei , and genhu li are masters degree holder candidates of the same university . this work is supported by the national natural science foundation of china ( grant nos . 60906002 and 50832006 ) , national key technology r&d program ( 2011bae03b13 ) , key laboratory of optoelectronic materials chemistry and physics , cas ( 2008dp173016 ) , and innovation team project of zhejiang province ( 2009r50005 ) .
an efficient antireflection coating is critical for the improvement of silicon solar cell performance via increased light coupling . here , we have grown well - aligned zno nanowhisker ( nw ) arrays on czochralski silicon solar cells by a seeding - growth two - step process . it is found that the zno nws have a great effect on the macroscopic antireflection effect and , therefore , improves the solar cell performance . the zno nw array - coated solar cells display a broadband reflection suppression from 500 to 1,100 nm , and the minimum reflectance smaller than 3% can easily be achieved . by optimizing the time of zno nw growth , it has been confirmed that an increase of 3% relatively in the solar cell efficiency can be obtained . these results are quite interesting for the application of zno nanostructure in the fabrication of high - efficiency silicon solar cells .
scientific collaboration often necessitates sharing data with researchers outside the organization that collects and maintains the data . sharing microdata records of individual information on a relatively small number of subjects carries a risk of disclosure ( determining the identity of one or more individuals ) and , if such disclosure occurs , subjects may be harmed through access to sensitive information contained in the data [ 14 ] . subjects who supply data are understandably concerned about the possibility of their private data being disclosed . also , despite contracts and technical implementations to ensure that data remain confidential , researchers themselves may feel uneasy about releasing private data to outside laboratories . therefore , it makes sense to take additional steps to ease such concerns . in the united states , one approach is the federal certificate of confidentiality ; however , national laws may be of little use when data are shared in international collaborations . confidentiality of research data remains an issue despite routine application of methods for protecting privacy ; indeed , it has recently been shown that an individual can be identified as contributing or not to publicly available summary data if one has access to certain components of the individual 's data . institutions have legal and ethical responsibilities to ensure that research subjects ' privacy is protected [ 6 , 7 ] . direct identifiers ( names , addresses , birth dates , etc . that have virtually one - to - one correspondence with individuals ) are routinely removed and the microdata are anonymized by deleting numbers used to link to identifying information in the source database . this alone , however , does not ensure protection of privacy ; the data values themselves may possess some degree of subject specificity or uniqueness that could in principle be used to identify individual subjects [ 810 ] . risk of identification via the data values can be reduced by masking , one of several techniques useful for statistical disclosure limitation or statistical disclosure control [ 1113 ] , the goal of which is to render data safe against attackers / intruders / snoopers while retaining as much information as possible to allow effective statistical analysis . a great deal of work has been done in this area , resulting in methods that allow data managers to consider the balance between disclosure risk ( security ) and analytical integrity ( utility ) , but the ideal of a data set safe against intrusion yet retaining its full richness for statistical analysis is elusive . nevertheless , there are few documented instances of successful attacks breaching the confidentiality of research subjects . much of the data disclosure literature speaks specifically of information organizations ( or data stewardship organizations ) , data managers , and clients . in such settings however , we are concerned with data to be shared among public health and epidemiologic research collaborators as opposed to data considered a commodity to be made public . in the collaborative setting where collaborators have a right to expect to be able to obtain essentially the same analytical results that would be obtained using the original data within the institution that maintains those data the trade - off between security and utility renders it inevitable that the disseminating institution receives reasonable assurances in writing as to use of the data rather than relying solely on data masking ; this indeed has been demonstrated to be useful . even without such assurances , identification of research subjects via data values is unlikely , but there may be a perceived risk of identification by research subjects , who are concerned about psychosocial and financial risks resulting from disclosure of personal health or genetic information . some degree of masking and assessment of identifiability risk is therefore necessary : not so much as a defense against attack , but as a means of providing reasonable assurances that satisfy stakeholders . there seems to be little discussion of data disclosure control in the epidemiologic literature and a dearth of practical methods for dealing with it that are accessible to epidemiologic researchers . existing methods of disclosure control may be difficult for epidemiologic investigators to use and , unlike public release of data , the effort may not be justified by the limited amount of data or restricted sphere of dissemination ( not to mention the inherently smaller risk ) involved in collaborative data sharing . we therefore investigated simple steps to address disclosure concerns , with a view towards the impact on analytic utility of the masked data . we also illustrate a graphical approach to characterizing the trade - off between disclosure risk and analysis potential , which is analogous to the risk - utility ( r - u ) plot ( also referred to as a map ) known in the data disclosure literature [ 12 , 18 ] , except that it may be generated using quantities easily derived from standard methods of risk analysis and is transformed to mimic measures familiar to epidemiologists . the approach is illustrated using a small set of microdata constructed from the japanese atomic - bomb survivor population . developing a data - masking strategy involves sequentially answering three questions : ( 1 ) is there a risk of identifying individuals , and if so , how great is it ? ( 2 ) if the risk of identification is unacceptable , can it be reduced by masking the data ? ( 3 ) if data are masked , what impact does the masking have on the results of analyses ? if the impact of masking on analysis is unacceptable , it may be necessary to reevaluate the acceptable degree of identification risk , resulting in the need to seek a compromise between disclosure risk and informativeness ( utility ) of the data . although deletion of identifying keys is referred to as anonymization , we use the term anonymity loosely to imply that confidentiality is maintained . also , the term keys can mean either the elements used to link records in a relational database or the variables that are shared in common between any two datasets . identification could be absolute , based on linkage to identifying keys ( names , etc . ) in the institutional database , or predictive ( presumed ) , based only on data values in the distributed dataset ( using keys available to the potential intruder , such as gender , and region ) . with appropriate access control the institutional database should be secure from outside intrusion , and in - house researchers should not generally need to access identifying information for purposes of analysis . source data may be separated into resource data , to which linkage and access are highly restricted , and research data , which are anonymized by removing identifying information prior to use in - house . absolute identification is therefore not considered a plausible scenario . in the case of distributed data , linkage to outside sources of information might in principle facilitate identification of individuals in a predictive sense ( with some degree of uncertainty ) based on the values in the dataset . coarsely stratified pieces of information that are not in themselves linkable can , when combined , increase the possibility of identification . although the ability of researchers to perform such linkage may be overestimated , research subjects who perceive possible harm to themselves through the threat of lost anonymity may be unwilling to participate [ 1 , 4 ] . risk of identification in an anonymized dataset may be defined as the probability that an individual 's identity is correctly inferred conditional on the masked data and other prior information available to the intruder . because it is difficult to speculate what information might be used by an intruder to learn the identities of subjects ( the disclosure attack scenario ) , we used as a proxy to this scenario matching records in the distribution dataset to records in the source data , which depends on uniqueness of an individual 's data ; a perfect link would be the epitome of disclosure , as it would reveal absolutely the identity of an individual in the microdata . we compared data values in the distribution dataset to the source database to determine whether an individual was theoretically identifiable via his or her data ( per - record measure of risk ) . this is purely an academic exercise that represents a worst - case scenario unlikely to be realized with typical access - control safeguards . an aggregate measure of risk for the entire dataset can be derived by considering uniqueness of records . if only one record in the source database matches that of an individual in the distribution dataset , that individual is theoretically identifiable with probability one . let n1 be the number of such persons in the distribution data . if two records in the source database exactly match that of an individual in the distribution data , then the probability of correctly identifying that individual is 0.5 ( 1 out of 2 ) ; let n2 be the number of such individuals . continuing in this way , define an identifiability risk score as ( 1)identifiability risk score = n11+n2(1/2)+n3(1/3)+n4(1/4)+total number of individuals in the distributed dataset ( n)=i=1kni / in . this is similar to a measure of identification risk described elsewhere , except that it is an aggregate measure for the entire microdataset obtained as a weighted average of individual uniqueness measures ( the uniqueness measure being the probability 1/i and the weight being the number of individuals ni having uniqueness 1/i , i = 1 , , k ) . the value k is simply the largest value of i that occurs in a given application . the goal is to reduce the overall identifiability risk by reducing , through data masking , the numbers of distributed data records that have nearly unique matches in the source data , that is , reduce the magnitudes of the ni at small values of i , which have a high probability ( 1/i ) of identification . we define an anonymity score as ( 2)anonymity score=1identifiability risk score , where 0 anonymity score 1 , with 0 representing unambiguous identification of all individuals and 1 representing the case that no individuals are identified . the aforementioned definition of overall risk is slightly different from a method that counts number of individuals in the microdata who have the same values of certain variables ( thereby reducing their uniqueness ) . however , that perspective stems from the scenario where a potential intruder has a particular individual in mind and desires to know if that individual is present in the microdata ; our perspective is that of identifying any individual in the microdata , equivalent to what has been described as someone attempting to show that the system can be breached . our aggregate score is a weighted measure , which reflects varying degrees of risk , unlike the so - called rule of three that treats occurrences of i = 1 or 2 ( i < 3 ) as unsafe but weights them equally . numerous approaches to data masking are available . we consider two broad classes that do not involve deletion or subsampling of subjects : ( 1 ) grouping and ( 2 ) randomization ( adding random noise to data values ) . although both classes are perturbative , we distinguish them because they pose different statistical challenges in terms of the random error induced . grouping ( or coarsening ) , which includes stratification , rounding , and truncation , is deterministic and results in errors of the so - called berkson type that do not generally induce bias . furthermore , even though random noise may have mean zero , it does not preserve variances or correlation coefficients . stratified microdata would contain individual records having stratum indicators rather than actual values of covariates . individual outcome indicators could be grouped into broad disease or cause - of - death categories . rounding to relative precision involves using a fixed number of significant digits . rounding to absolute precision involves rounding all data to the same decimal place and results in greater loss of information with values closer to zero . if exposure values range over several orders of magnitude or display a skewed distribution , relative precision rounding might be a more natural way of masking because it preserves approximately the same amount of statistical precision regardless of the level of exposure . birth date and age could be rounded to the nearest tenth of a year ( approximately the same as year plus month ) or to the nearest integer year . dates can be truncated by removing the day value ( sometimes day is replaced by 15 ) . truncating exposure data could pose serious repercussions for dose - response analyses because it introduces systematic bias . analysis potential refers to how faithfully masked data can replicate results that would be obtained using the source data . a collaborator would have little interest in data that do not produce essentially the same results as an analysis of the original data . an estimated parameter ( ) can be evaluated in terms of its precision and bias . bias can result from , for example , covariate error ; precision plays a role in the statistical significance and variability ( width of confidence intervals ) of risk estimates . we examine two types of masking : ( 1 ) grouping , rounding , or randomizing a continuous exposure variable and ( 2 ) deleting or combining multiple categorical variables . for a continuous exposure , we assess analysis potential ( utility ) via the bias and/or loss of precision in the risk estimate from a simple dose - response analysis with various degrees of masking . a statistical measure that incorporates both bias and variance is the mean squared error ( mse = variance + bias ) ; further aspects of analysis , such as the dose - response shape or effect modification , are not easily incorporated into a general approach to quantifying analysis potential and so are not considered here . another measure of utility is the degree of overlap between confidence intervals obtained with original and masked data . we have not pursued use of that measure because we find it difficult to interpret quantitatively . we define an analysis - potential score as ( 3)analysis - potential score = 1mse(m)mse()mse(m)=mse()mse(m ) , where m is the risk estimate obtained using masked data and is the correct risk estimate obtained using nonmasked data . this score generally takes values between 0 and 1 , with 1 representing no adverse impact on analysis potential . it could conceivably take on values greater than 1 because estimates obtained using biased regression methods ( such as ridge regression ) can have reduced variance . we summarize the trade - off between anonymity and analysis potential by plotting security ( anonymity score ; ( 2 ) ) versus utility ( analysis - potential score ; ( 3 ) ) , as shown in figure 1 . this plot is similar to a risk - utility plot ( e.g. , karr et al . ) , except that we plot security on the ordinate rather than risk , and the scales range from 0 to 1 , providing some indication of where the security and utility lie relative to the ideal case of no risk and no loss of utility ( analogous to an roc curve ) . we used data from the adult health study ( ahs ) , a subset of about 23,000 persons who have participated in clinical examinations and are selected from the larger follow - up study of 120,321 japanese atomic - bomb survivors and controls ( the life span study cohort ) [ 2628 ] . we created microdata on 64 cases of stomach cancer with radiation dose to the stomach ( gray ) , city , gender , age at exposure ( known precisely from birth date and date of bombing ) , and age at diagnosis ( known precisely from birth date and date of diagnosis ) . radiation doses ranged from 0 to 2.74 gray , with mean 0.61 ( sd 0.74 ) , median 0.31 , and interquartile range 0.00.88 . these doses were compared to three subsets of the larger cohort exposure database : ( 1 ) all radiation doses without regard to organ ( there are multiple dose entries in a relational table , each corresponding to a different organ of the body ; if the organ specifier is ignored , there are a total of 1 , 830 , 479 dose values ) , ( 2 ) stomach doses only ( 96 , 341 values ) , and ( 3 ) stomach doses among the subset of persons who are members of the ahs ( 16 , 153 values ) . we estimated radiation risk using logistic regression with adjustment for uncertainties ( random error ) in radiation dose estimates . analyses were performed using the epicure statistical package ( hirosoft international corporation , seattle , wa ) . identifiability risk scores ( 1 ) using unmasked stomach doses are shown in table 1(a ) . with more information about the source of the data , larger proportions of individuals were linkable via unique dose values . none of the cases was correctly matched ( table 1(b ) ) , but some of the rounded dose values matched values belonging to other individuals in the source data . the proportion of such erroneous matches decreased with decreasing size of the comparison source database ; the perceived identification risk based on these chance matching proportions is also shown in table 1(b ) . with rounded data it would not be possible to determine whether a match was correct or erroneous , adding additional ambiguity to any presumed identification . figure 2(a ) shows the probability of matching an individual to the clinical subset of the cohort database when data were grouped by five - year intervals of age at exposure and age at diagnosis and further broken down by dose strata , city , and gender ( the strata used in analyses of the full cohort ) . a large proportion ( 23% ) of subjects in the microdataset were uniquely matched ( p = 1 ) , being the only individual occupying the corresponding stratum in the source data . thus , grouping the variables into categories did not afford substantial protection against matching to a unique record in the database . as the number of variables or the number of categories per variable increases , the number of persons per stratum decreases , and identifiability risk increases ( recall , however , that these identifiability estimates presume access to the source data ) . without knowledge of clinical cohort membership ( i.e. , comparing the distributed data to the entire cohort database ) , thus , knowledge of a specific subcohort from which microdata were prepared may be an important factor in identification via stratified data . using ten - year age intervals resulted in reduction by more than one - half in the numbers of cases with identification probabilities of 1.0 or 0.5 ( figure 2(b ) ) , with an overall identification risk score of 0.23 . removing the two age variables altogether produced a large reduction in identifiability risk ( figure 2(c ) ) . ignoring ages , the maximum ratio of number of microdata cases to number of source - data subjects in any stratum was 0.077 and the overall identifiability risk score was 0.013 . this is an overestimate of individual identifiability risk because some of the strata in the microdataset had more than one case . table 2 shows results of binary regression of the risk of stomach cancer for radiation dose , employing various forms of dose masking and using all cancer - free subjects for comparison . we include in table 2 the results of adding random perturbations to the doses by generating random uniform deviates in the range 0.001 gray , 0.01 gray , or 0.1 gray . because the results of analysis based on randomized doses are random , the results for this masking scheme are presented as the means and ranges ( extreme values ) from 500 repetitions . the bias with rounding was small and there was virtually no difference between absolute and relative precision rounding , but there was a small increase in bias and standard error with stratification . with randomization , bias increased only slightly on average , but with any particular randomization the bias could be quite large , as seen by the ranges in table 2 . randomization using 0.1 gray ( slightly greater than 10% of the standard deviation or interquartile range ) resulted in average bias of 1.6% , similar to that with stratification , but the maximum bias was as high as 6.5% . with randomization using 0.001 gray the bias was less than 0.1% , while using 0.01 gray it ranged to a little more than 0.5% . the various masking methods led to varying degrees of reduction in identifiability risk , but most had little impact on analysis potential . we have adapted the risk - utility ( r - u ) plot ( or r - u map ) [ 12 , 18 ] to utilize easily derived measures and to illustrate the trade - off between confidentiality and utility in a way that is familiar to epidemiologists . one could undertake a formal mathematical analysis that minimizes information loss in a masked dataset under the constraint that disclosure risk is below some allowable threshold ( minimum safety principle ) , although in practice it can be difficult to define information loss ( predict the analytical needs of the collaborator ) and quantify the risk ( which depends in part on the particular attack scenario assumed ) . although masked data can be analyzed appropriately given knowledge of masking mechanisms , treating the masked values as truth ( ignoring the process of masking ) may be the only realistic method of analysis because disclosing the masking mechanism may increase the likelihood of successful attack . it would be useful to further evaluate the method using other databases with different exposure classifications and distributions to assess its generalizability . we found that there was little chance of identifying individuals if ages were truncated to integer values and doses in gray were rounded to at most one decimal place of accuracy . because the source database is highly protected and even sources of information outside the institution are subject to privacy protection laws and regulations however , in terms of analytical potential , relative - precision rounding would be preferable to absolute rounding given the wide range of magnitudes of doses . it is prudent to consider the distributions of the variables when contemplating a masking strategy . unique values might not be successfully masked if the magnitude of rounding is small relative to the variability in the data , particularly in sparse regions of the distribution . one could use a variable - precision rounding scheme , whereby values in sparse regions of the distribution are rounded to less precision than values in dense regions of the distribution . in the example presented here , the exposure distribution is positively skewed , so relative - precision rounding achieves the same purpose . masking by grouping results in berkson - type random error , which does not introduce covariate - error bias in simple linear models but can lead to problems with more complex models , including nonlinear models and analyses of interaction with other variables . covariate - error bias in the case of classical error , such as arises with randomization of data values , leads to attenuated effect estimates ( underestimation ) , but berkson error can lead to overestimation of effects . thus , grouping should not be employed needlessly , and its impact on the planned analysis should be carefully considered . first of all , it is difficult to assess the performance of data masking without considering the specific data situation . we examined masking both continuous and categorical information and assessed identifiability for a reasonably small distribution dataset , so we think that our results should be generally applicable to most practical , small - data situations . however , the performance of any data - masking scheme should be evaluated in its own setting . secondly , we used an aggregate measure of identifiability and applied the same masking scheme to all individuals in the microdata . in practice , some individuals will be at higher risk of identification due to more unique values of their data ( e.g. , those with extreme values in a skewed distribution ) . using per - record measures of disclosure risk may yield greater analysis potential if some records do not require the same degree of masking . however , to achieve the same overall anonymity score may require that records with greater identifiability risk be masked to a greater extent . thirdly , we did not evaluate the propensity score , a means of summarizing confounder information . the propensity score combines information from multiple variables into a single value , which should result in substantial masking . however , this would only be useful with variables not individually needed in analysis , such as confounders . the propensity score could not be used to replace exposures or effect modifiers of interest . obviously , if the full analysis to be conducted by the collaborating investigator is applied to ascertain analysis potential of the masked data , there would be no need for the collaboration . analysis potential must therefore be evaluated using simplified analyses that are expected to provide an indication of data quality without replicating the entire collaborative effort . a post hoc analysis , such as fitting the collaborators ' final model to the source data , might be considered . finally , we have dealt with perceived ( predictive ) identification rather than true identification , although the latter is generally considered more relevant for purposes of disclosure control . because we assumed that identifiability is tantamount to having access to the source data , which are generally secure , we might have overestimated the true identifiability risk . however , we did not address situations where alternative , publicly available sources of data could be used in identification . as there is no way of generally characterizing all potential attack scenarios , it is best to evaluate each individual application separately , taking into account security of the source data , availability of relevant public databases , and existence of related microdatasets previously sent outside the institution . the situation discussed here focuses on sharing microdata with a small number of investigators for research purposes , whereas medical informatics requires making data more widely available . individual data are required for purposes of developing tailor - made prognostic clinical models , and seriously perturbed data may suffer from unacceptable loss of utility . although we have not addressed security issues in other fields , it would be useful to establish links between collaborative and public - access scenarios . this is beyond the scope of the present paper , but would provide a useful bridge between the fields of epidemiology and medical informatics . ( does the research contribute to generalizable knowledge ) , what constitutes identifiable information , and what constitutes minimal risk [ 17 , 34 ] . for example , researchers might need unmasked dose estimates to investigate uncertainties in exposure assessment . another situation is when subjects have a rare disease , which is not easily masked because the full population is small to begin with . thus , in addition to masking , appropriate assurances should be obtained from the collaborators regarding privacy protection and use of the distributed data . a recent text on molecular epidemiology notes the need for multidisciplinary collaborative research but appears to mention subject confidentiality only once in the first chapter . although actual identification of research subjects from shared data is extremely unlikely given the secure nature of research databases , it is important to consider the perceived possibility of identification . research subjects may withhold consent if they perceive a threat to their privacy , or researchers may be concerned that such perception might impact the quality of the data provided by subjects . furthermore , laws require researchers involved in data sharing to understand and apply appropriate safeguards to protect the privacy of subjects ' data . article 23 of the declaration of helsinki of the world medical association states , every precaution must be taken to minimize the impact of the study on their physical , mental and social integrity . this would include stigmatization caused by perceived potential for identification and its implications for the subject 's health care , employment , and so forth . the best masking schemes are those for which anonymity ( security ) and analysis potential ( utility ) are mutually as high as possible . standard approaches to statistical disclosure control are developed for large - scale data releases by organizations specializing in data management but may be difficult to implement by epidemiologic researchers in small - scale data - sharing collaborations . we recommend that confidentiality be assessed by examining uniqueness of data records and attempting linkage with the source data . for disseminating microdata the trade - off between security and utility should be numerically evaluated in each individual data - sharing situation to assure outside researchers and study participants of the utility and security of the data . an approach to evaluating the trade - off between security and utility may be based simply on quantities easily derived by epidemiologic researchers and examined graphically as illustrated herein .
objective . ensuring privacy of research subjects when epidemiologic data are shared with outside collaborators involves masking ( modifying ) the data , but overmasking can compromise utility ( analysis potential ) . methods of statistical disclosure control for protecting privacy may be impractical for individual researchers involved in small - scale collaborations . methods . we investigated a simple approach based on measures of disclosure risk and analytical utility that are straightforward for epidemiologic researchers to derive . the method is illustrated using data from the japanese atomic - bomb survivor population . results . masking by modest rounding did not adequately enhance security but rounding to remove several digits of relative accuracy effectively reduced the risk of identification without substantially reducing utility . grouping or adding random noise led to noticeable bias . conclusions . when sharing epidemiologic data , it is recommended that masking be performed using rounding . specific treatment should be determined separately in individual situations after consideration of the disclosure risks and analysis needs .
we report a case of a healthy 22-year - old man who underwent an arthroscopic right acl reconstruction with hamstring grafts in january 2010 , 6 months after his initial injury . the graft was fixed with an endobutton ( smith & nephew , andover , ma , usa ) for the femoral side , and a biosure bioabsorbable screw ( smith & nephew ) and metal staples ( smith & nephew ) for the tibial side . after an initial uneventful postoperative recovery , he presented 7 weeks after surgery with right knee swelling associated with fever and chills . on examination the range of motion of the right knee was 5 to 100 and was limited by pain . the c - reactive protein , erythrocyte sedimentation rate , and total white cell count were 139 , 71 , and 7.3 , respectively . the right knee aspiration performed revealed turbid fluid , and bacterial cultures yielded no bacterial growth . he was offered , but refused , arthroscopic debridement of the right knee , and was given oral antibiotics with instructions to follow - up at the outpatient clinic . there was no resolution of his wound discharge , and the patient subsequently consented to an arthroscopic washout of his right knee , synovectomy , and debridement of the right tibial wound 3 months after his initial acl reconstruction . intraoperatively , there was florid synovitis but the acl graft was noted to be intact and healthy . there was no frank pus noted from the right tibial wound and the wound was debrided . the knee fluid was incubated at 35 , 5% carbon dioxide levels on blood agar for five days . the mycobacterium detection dna accuprobe identification was positive and the organism was confirmed to be m. abscessus . susceptibility testing using a broth microdilution method confirmed that the organism was sensitive to amikacin , clarithromycin , and linezolid . postoperatively , the patient was given 2 weeks of intravenous ( iv ) amikacin and concurrently started on one week of iv cefoxitin and clarithromycin . there was a gradual decline in the laboratory markers of infection ( creactive protein and erythrocyte sedimentation rate ) . postoperatively , the wound showed progressive healing , with no further discharge noted during subsequent outpatient consultations . he was lost to follow - up 6 months after the arthroscopic washout and 9 months after his initial acl reconstruction . two years later , he presented to our outpatient clinic with right knee pain associated with discharge from the knee wound for the past six months . there was a chronic sinus located over the anteromedial aspect of the right knee with seropurulent discharge , giving the appearance of a chronic granuloma . there was otherwise no collections seen and the acl graft appeared intact ( figs . 1 and 2 ) . the patient subsequently underwent arthroscopic washout and removal of the screws and staples of the right tibia . intraoperatively , he was noted to have a chronic sinus tract over the staples and tibial tunnel site . he received 14 days of iv amikacin , iv cefoxitin , and oral clarithromycin for the duration of his hospitalization . he was discharged on postoperative day 17 with 6 weeks of oral clarithromycin and 2 weeks of oral cloxacillin . the patient was successfully contacted for a clinical review 14 months after the second arthroscopic washout and implant removal from his right knee . he reported no further symptoms of infection in his right knee since the second arthroscopic washout and had regained full premorbid function of his right knee . on examination , the wounds had since healed , the knee was not warm , effused , or tender and there was full range of motion of the right knee . after its separation from the m. chelonae group in 1992 , m. abscessus was recognized as the culprit pathogen for many human infections , including skin and soft tissue infections , surgical site infections , respiratory infections , and disseminated infections in immunocompromised individuals . infections caused by m. abscessus are notoriously difficult to treat because the bacteria is intrinsically resistant to most conventional anti - tuberculous drugs . reasons for this resistance include the slow growth of the bacteria , the presence of a waxy impermeable cell wall , which serves as both a physical ( by size exclusion ) and a chemical ( hydrophobic ) barrier , various drug export systems , and genetic polymorphism of targeted genes.4 ) m. abscessus possesses the ability to form smooth biofilms . hence , retention of the implants can possibly lead to a failure to achieve a microbiological cure and re - infection , especially since m. abscessus is notoriously resistant to most antibiotic regimes . there are published case reports of m. abscessus bacteremia associated with infected indwelling vascular catheters . a case series by chang et al.5 ) involving 12 patients with rgm bacteremia demonstrated that the rate of relapsing bacteremia was significantly higher in patients with delayed catheter removal compared to patients with timely catheter removal . in our case report , the patient 's implants were initially left in situ , as it was deemed too premature to remove the implants because the graft had not yet integrated . however , leaving the implants in place may result in the persistence of infection , as shown in the vascular catheter case series . thus , the first learning point is the need for full removal of implants in m. abscessus infections for source control in persistent , recurrent infections . the literature demonstrates a lack of consensus for the treatment of septic arthritis following acl reconstruction . generally , the treatment involves either arthroscopic or open debridement with or without acl graft retention followed by antibiotic treatment . mcallister et al.6 ) reported an average of 2.75 procedures ( range , 2 to 4 procedures ) required after the diagnosis to eradicate the infection and restore knee motion . the scar formation resulting from repeated invasive procedures to the involved knee joint can lead to capsular contraction , thus significantly limiting joint motion and affecting the patient 's functional outcome . a recent case report describing a m. wolinskyi infection post - total knee arthroplasty emphasizes the lack of a standardized treatment protocol in infections caused by rgm . in the case report , the authors described the successful eradication of the infection after prolonged targeted antibiotic therapy and surgical debridement without removal of the prosthesis.7 ) this suggests that the decision as to retain or remove the implant should be taken on a case - by - case basis . there is limited literature on the incidence and management of culture - negative septic arthritis following acl reconstruction . however , there are publications delineating the incidence of culture - negative prosthetic joint infections . berbari et al.8 ) described 60 cases ( 7% ) of culture - negative prosthetic joint infections out of 897 patients with prosthetic joint infections over a 9-year period . these 60 patients were noted to have a sinus tract or purulence communicating with the prosthesis and/or features of acute inflammation on histology . the possible reasons for culture - negative infections are prior antimicrobial therapy , infection with fastidious organisms or unusual organisms such as fungi or mycobacterium , and biofilm formation . our patient had a similar presentation and his initial cultures did not yield any bacterial growth . hence , the second important learning point is that in patients presenting with chronic discharging sinuses over the previous surgical site with negative cultures , infection with rgms such as m. abscessus should be considered . there have been case reports of coinfections as well as secondary infections of prosthetic joints . the implicated organisms include listeria monocytogenes with s. aureus9 ) and candida albicans with methicillin - resistant s. aureus.10 ) hence , a third learning point is the need to consider the possibility of a coinfection or superinfection whenever there is an atypical organism involved , such as m. abscessus . the presence of a secondary or coinfection in post - acl reconstruction septic arthritis is clinically relevant , as it significantly affects the choice of antimicrobial therapy . it should also be considered in cases of infection which do not respond to the antimicrobial regime tailored to the initially identified organism . in our case , the chronicity of the discharge and low grade nature of the infection suggested an atypical infection . however , the presence of a purulent component to the discharge suggested an element of coinfection with a staphyloccal species . in our patient , the biosure bioabsorbable screw used was made of poly - l - lactic acid and hydroxyapatite . polylactic acid implants are thought to be less likely to cause local inflammatory and foreign body reactions as compared to similar implants manufactured using polyglycolic acid , due to the long degradation time of polylactic acid.3 ) despite this , abscess cavities in conjunction with the l tunnel have been reported , with negative gram stains and cultures.3 ) during the second debridement of our patient , the screw in the tibial tunnel was noted to be loose and fragmented , suggesting that the local inflammatory response from osteolysis associated with the use of a polylactic implant may provide a suitable environment for infection to occur . our case report has demonstrated that atypical organisms , such as m. abscessus , should be considered whenever bacterial cultures are negative in chronic lowgrade infections . the case also suggests that removal of orthopedic implants may be necessary for the complete eradication of this pathogen .
infections following anterior cruciate ligament reconstruction are rare , with no previous reports citing mycobacterium abscessus as the culprit pathogen . a 22-year - old man presented twice over three years with a painful discharging sinus over his right tibia tunnel site necessitating repeated arthroscopy and washout , months of antibiotic therapy , and ultimately culminating in the removal of the implants . in both instances , m. abscessus was present in the wound cultures , along with a coinfection of staphyloccocus aureus during the second presentation . though rare , m. abscessus is an important pathogen to consider in postoperative wounds presenting with chronic discharging sinuses , even in healthy non - immunocompromised patients . this case illustrates how the organism can cause an indolent infection , and how the removal of implants can be necessary to prevent the persistence of infection . coinfection with a second organism is not uncommon and necessitates a timely change in treatment regime as well .
they have poor communication with the normal lymph systems and therefore collect lymph.[15 ] the most common location in the mouth is the dorsum of tongue , followed by lips , buccal mucosa , soft palate , and floor of the mouth . these tumors typically present in children younger than 2 years and in a significant number of cases are present at birth.[19 ] this article describes a case of lymphangioma of the tongue and its management . a 5-year - old girl reported to the opd of kothiwal dental college , moradabad with chief complaint of growth on the right lateral border of tongue , associated with biting of the tongue on mastication . her parents noticed it increasing in size along with the growth of the child . on inspection , there was a marked soft tissue growth with numerous papillary and vesicle - like projections which made it appear irregular and granular [ figure 1 ] . the mouth opening was normal and there was no restriction of functions of the tongue . on the basis of history and clinical features a provisional diagnosis of lymphangioma was made and an excisional biopsy under general anaesthesia was planned . right lateral border of tongue showing the soft tissue growth under general anesthesia , a deep suture was placed on the tip of the tongue [ figure 2 ] for retraction . single linear incision was outlined on the base of the elevated mass on the lateral surface of the tongue with methylene blue . initially , the incision was mucosal all around the elevated mass and subsequently it was deepened to excise it completely [ figure 3 ] . retraction of tongue and localization of lesion tongue after excision of the lesion following excision , the tongue was approximated in two layers [ figure 4 ] . on histopathological examination it was confirmed to be a lymphangiomatous lesion [ figure 6 ] . there was no evidence of recurrence of the lesion on follow - up of 4 years . they are believed to arise from lymph sac sequestration and enlarge due to inadequate drainage , from lack of communication with the central lymphatic channels or excessive secretion of lining cells . goetsch in 1938 noted that this sequestered lymphatic tissue forms cysts which enlarge from accumulation of lymph caused by projection of endothelial sprouts from cystic walls . the sprouts further destroy tissue and force the lesion into areas of least resistance , between muscles and vessels , invading tissue planes and causing atrophy , fibrosis and hyalinization of the engulfed tissue . lymphangiomas can be classified histopathologically as : lymphangioma simplex ( composed of small thin - walled lymphatics).cavernous lymphangioma ( comprised of dilated lymphatic vessels with surrounding adventitia).cystic lymphangioma ( consisting of huge , macroscopic lymphatic spaces surrounded by fibrovascular tissues and smooth muscles).benign lymphangioendothelioma ( lymphatic channels appear to be dissecting through dense collagenic bundles ) . cystic lymphangioma ( consisting of huge , macroscopic lymphatic spaces surrounded by fibrovascular tissues and smooth muscles ) . lymphangiomas are classified according to their clinical presentation into macrocystic ( cavities larger than about 2 cm ) , microcystic ( cavities smaller than about 2 cm ) , and mixed ( combining these two types ) . they are always present at birth , but they may go unnoticed until after dentition erupts or even after puberty . however , there have been reports of its occurrence in adults . the frequent site is the anterior two - thirds of the tongue and may enlarge to a great extent that results in macroglossia , which may impair speech and eating and may become life - threatening due to their size or secondary infection . their limited extent usually permits complete surgical excision with various techniques of tongue reduction described by a number of authors . the treatment of lymphangioma depends upon their type , size , involvement of anatomical structures and infiltration to the surrounding tissues . microcystic lesions do not respect tissue planes , are diffuse and difficult to eradicate , whereas macrocystic lesions are localized and easily excised . partial surgical excision , injection of sclerosing solutions ( ok432 ) , electrocoagulation , cryotherapy , embolization , steroid administration , radiation and laser surgery may be the other modalities of treatment of diffuse lymphangioma of the tongue.[179 ] since they do not respond to sclerosing agents , pressure therapy , radiotherapy or any known chemotherapy , they are either tolerated by the patient or treated surgically .
lymphangiomas are developmental malformations and have a marked predilection for the head and neck region . they are benign proliferation of lymphatic vessels and represents hamartomas of malformed lymphatics . the most common location in the mouth is the dorsum of tongue , followed by lips , buccal mucosa , soft palate , and floor of the mouth . in the tongue , they may present as a localized or a diffused growth which may enlarge to cause macroglossia , impaired speech and difficulty in mastication . these tumors are typically present at birth , but may go unnoticed until after dentition erupts or even after puberty . presenting here is a case of localized lymphangioma of the tongue in a five year old child and its surgical management .
the rate of endometriosis is estimated to be approximately 1015% in women of reproductive age and 2550% in infertile women . several mechanisms for the association of endometriosis with infertility have been proposed , including altered pelvic anatomy , impaired ovarian function , distorted microenvironment , altered endometrial receptivity , and reduced oocyte / embryo quality . improvements in controlled ovarian hyperstimulation ( coh ) using gonadotropin - releasing hormone agonist ( gnrh - a ) may suppress some of the negative effects of endometriosis on pregnancy . however , there is no consensus concerning the impact of endometriosis on the outcomes of in vitro fertilization ( ivf)/intra - cytoplasmic sperm injection ( icsi ) . patients with stage iii / iv endometriosis have lower ivf / icsi implantation rates , cumulative pregnancy rates , and lower live - birth rates compared with women with mild endometriosis or tubal factor infertility . however , several studies have shown that patients with endometriosis who underwent ivf / icsi achieved outcomes similar to those of patients with tubal infertility . during ivf fresh embryo transfer cycles , the endometrium and embryo are exposed to supra - physiological concentrations of estradiol and progesterone for ovarian stimulation , which could affect endometrium receptivity and pregnancy outcomes of patients with endometriosis . frozen - thawed embryo transfer ( fet ) not only achieves higher pregnancy rates but , most importantly , also generates lower maternal and infant morbidity and mortality than fresh embryo transfer does . few studies have been conducted on endometrial preparation protocols following fet cycles in patients with advanced endometriosis . no compelling advantage for one protocol over another has been established , and the optimal protocol for fet with endometriosis is still under debate [ 4,810 ] . at present , endometrial preparation protocols following fet cycles in patients with endometriosis mainly include pituitary down - regulation with long - term gnrh - a administration . gnrh - a downregulation for endometrial preparation can completely and effectively suppress the pituitary gland and improve the embryo quality and endometrium receptivity in women with endometriosis . indeed , simon et al . investigated whether low levels of exogenous estrogen can hold the window of receptivity for an extended period of time since high doses of estrogen can rapidly induce a refractory state . in addition , some patients may have adverse reactions to large doses of exogenous estrogen . there are few studies about natural cycle ( nc ) endometrial preparation protocols following fet cycles in patients with advanced endometriosis . nc - fet does not require the administration of exogenous hormones and , thus , maintains natural physiological conditions , which minimally affects the endometrium and is easily accepted by patients . however , the pregnancy outcomes following nc - fet and the transfer of high - quality embryos are still unknown for patients with severe endometriosis , as well as the rates of pregnancy complications and birth defects . therefore , the aim of the present study was to analyze the influence of fet cycles on pregnancy outcomes in patients with advanced endometriosis undergoing nc endometrial preparation , and to investigate whether severe endometriosis influences pregnancy outcomes and whether fet without pituitary down - regulation with gnrh - a has benefits in patients with severe endometriosis . this was a retrospective study of the use of nc for endometrial preparation following fet cycles in patients with endometriosis at a tertiary reproductive medical center . patients with endometriosis were diagnosed by laparoscopy or laparotomy , and all were treated surgically . endometriosis was staged according to the revised american society for reproductive medicine ( asrm ) classification . all patients enrolled in the present study met the following inclusion criteria : 1 ) normal uterine cavity as assessed by ultrasonography , hysterosalpingography , or hysteroscopy ; 2 ) high - quality frozen embryos were transplanted ; and 3 ) the number of ovulation periods antral follicle ranged from 5 to 15 . the exclusion criteria were : 1 ) presence of hydrosalpinges ; 2 ) presence of adenomyosis or endometrioma at the start of the fertility treatment ; and 3 ) polycystic ovary syndrome ( pcos ) . the control group included 258 patients with tubal factor infertility who underwent 300 fet cycles . this study was approved by the ethics committee of the hospital and conformed to the declaration of helsinki ( as revised in tokyo in 2004 ) . the need for individual consent embryos were examined for the number and regularity of blastomeres and the degree of embryonic fragmentation , and were graded according to cummins s criteria . all top - quality embryos ( including grades i and ii 8-cell blastomere embryos ) were vitrified on the third day after oocyte retrieval . the procedure for freezing and thawing cleavage - stage embryos and blastocysts has been described previously . the ovarian stimulation regimen included a short gnrh - a protocol and luteal - phase ovarian stimulation , as described previously . frozen embryos with at least 50% of the blastomeres being intact were selected for intrauterine transfer . a modified nc involves administration of hcg to trigger ovulation . the method for embryo and endometrium synchronization for fet was as follows . follicular growth was monitored by measuring the levels of serum hormones and performing ultrasound from cycle day 10 . when the diameter of the dominant follicle was > 16 mm and the endometrial thickness was > 8 mm , with estrogen > 150 pg / ml and progesterone < 1.0 ng / ml , one of two procedures was performed , depending upon the patient s luteinizing hormone ( lh ) value . if lh was < 20 iu / l , 5000 iu of hcg was administered at night ( 21:00 ) to trigger ovulation , and the transfer of 3-day - old embryos was performed 5 days later . the quality of the transferred embryos was monitored and was good ( grade i and ii 8-cell blastomere embryos ) , as this is vital for a successful outcome . if the lh value was > 20 iu / l , 5000 iu hcg was injected the same afternoon , and the embryo transfer was conducted 4 days later . beginning on the third day after hcg injection , 40 mg of dydrogesterone ( duphaston , abbott laboratories , abbott park , il , usa ) was given every day for luteal support . when pregnancy was achieved , the progesterone supplement was continued until 8 weeks of gestation . patients characteristics including age , duration of infertility , body mass index , number of embryos transferred , average endometrial thickness of endometrium ( mm ) , basal fsh , serum estrogen and progesterone on the transplantation day , number of previous failed embryo transfer cycles , and rates of basal fsh > 10 miu / ml were recorded . the main outcomes were the rates of implantation , clinical pregnancy , and live birth . pregnancy was defined as the presence of a gestational sac with fetal heart activity during the ultrasound examination 7 weeks after fet . implantation rate was defined as the number of gestational sacs divided by the number of embryos transferred . an ongoing pregnancy was defined as an intact intrauterine pregnancy confirmed by ultrasound at 12 weeks of gestation . endometrial cyst recurrence referred to recurrence of an endometrial cyst on the ovary confirmed through vaginal ultrasound after the laparoscopy or laparotomy . the recurrent cyst was 2 cm . statistical analyses were carried out using spss 11.0 ( spss inc . , continuous data with normal distribution are presented as means standard deviation ( sd ) and were analyzed using anova followed by the student s post hoc test . categorical data are presented as frequencies and were analyzed using the chi - square test or the fisher s exact test , as appropriate . this was a retrospective study of the use of nc for endometrial preparation following fet cycles in patients with endometriosis at a tertiary reproductive medical center . patients with endometriosis were diagnosed by laparoscopy or laparotomy , and all were treated surgically . endometriosis was staged according to the revised american society for reproductive medicine ( asrm ) classification . all patients enrolled in the present study met the following inclusion criteria : 1 ) normal uterine cavity as assessed by ultrasonography , hysterosalpingography , or hysteroscopy ; 2 ) high - quality frozen embryos were transplanted ; and 3 ) the number of ovulation periods antral follicle ranged from 5 to 15 . the exclusion criteria were : 1 ) presence of hydrosalpinges ; 2 ) presence of adenomyosis or endometrioma at the start of the fertility treatment ; and 3 ) polycystic ovary syndrome ( pcos ) . the control group included 258 patients with tubal factor infertility who underwent 300 fet cycles . this study was approved by the ethics committee of the hospital and conformed to the declaration of helsinki ( as revised in tokyo in 2004 ) . the need for individual consent embryos were examined for the number and regularity of blastomeres and the degree of embryonic fragmentation , and were graded according to cummins s criteria . all top - quality embryos ( including grades i and ii 8-cell blastomere embryos ) were vitrified on the third day after oocyte retrieval . the procedure for freezing and thawing cleavage - stage embryos and blastocysts has been described previously . the ovarian stimulation regimen included a short gnrh - a protocol and luteal - phase ovarian stimulation , as described previously . frozen embryos with at least 50% of the blastomeres being intact were selected for intrauterine transfer . a modified nc involves administration of hcg to trigger ovulation . the method for embryo and endometrium synchronization for fet was as follows . follicular growth was monitored by measuring the levels of serum hormones and performing ultrasound from cycle day 10 . when the diameter of the dominant follicle was > 16 mm and the endometrial thickness was > 8 mm , with estrogen > 150 pg / ml and progesterone < 1.0 ng / ml , one of two procedures was performed , depending upon the patient s luteinizing hormone ( lh ) value . if lh was < 20 iu / l , 5000 iu of hcg was administered at night ( 21:00 ) to trigger ovulation , and the transfer of 3-day - old embryos was performed 5 days later . the quality of the transferred embryos was monitored and was good ( grade i and ii 8-cell blastomere embryos ) , as this is vital for a successful outcome . if the lh value was > 20 iu / l , 5000 iu hcg was injected the same afternoon , and the embryo transfer was conducted 4 days later . beginning on the third day after hcg injection , 40 mg of dydrogesterone ( duphaston , abbott laboratories , abbott park , il , usa ) was given every day for luteal support . when pregnancy was achieved , the progesterone supplement was continued until 8 weeks of gestation . patients characteristics including age , duration of infertility , body mass index , number of embryos transferred , average endometrial thickness of endometrium ( mm ) , basal fsh , serum estrogen and progesterone on the transplantation day , number of previous failed embryo transfer cycles , and rates of basal fsh > 10 miu / ml were recorded . the main outcomes were the rates of implantation , clinical pregnancy , and live birth . pregnancy was defined as the presence of a gestational sac with fetal heart activity during the ultrasound examination 7 weeks after fet . implantation rate was defined as the number of gestational sacs divided by the number of embryos transferred . an ongoing pregnancy was defined as an intact intrauterine pregnancy confirmed by ultrasound at 12 weeks of gestation . endometrial cyst recurrence referred to recurrence of an endometrial cyst on the ovary confirmed through vaginal ultrasound after the laparoscopy or laparotomy . statistical analyses were carried out using spss 11.0 ( spss inc . , chicago , il , usa ) . continuous data with normal distribution are presented as means standard deviation ( sd ) and were analyzed using anova followed by the student s post hoc test . categorical data are presented as frequencies and were analyzed using the chi - square test or the fisher s exact test , as appropriate . no significant differences were found in age , duration of infertility , body mass index , number of embryos transferred , average endometrial thickness of et ( mm ) , basal fsh , rate of fsh > 10 miu / ml , serum estrogen or progesterone levels on the transplantation day , or number of previous failed embryo transfer cycles between the two groups ( all p>0.05 ) . patients with tubal factor infertility group were more likely to have secondary infertility compared to patients with stage iii iv endometriosis ( p<0.001 ) . in patients with stage iii iv endometriosis , 40 received 47 fet cycles and had endometrial cyst recurrence after laparoscopic or laparotomy treatment . rates of implantation , clinical pregnancy , and live birth were comparable between the two groups . no differences were found between the two groups in terms of rates of ongoing pregnancy , miscarriage , ectopic pregnancy , or complications . iv endometriosis had smaller babies than patients with tubal factor infertility ( median , 2850 vs. 3100 g , p=0.001 ) and delivered earlier ( median , 37.0 vs. 38.3 weeks , p<0.001 ) . multivariate analysis revealed that age ( or=0.898 , 95%ci : 0.8510.948 , p<0.001 ) , average number of embryos transfer cycles ( or=0.248 , 95%ci : 0.1870.328 , p<0.001 ) , and number of embryos transferred ( or=1.892 , 95%ci : 1.0623.369 , p=0.030 ) were independently associated with the pregnancy rate ( table 4 ) . in addition , the 42 patients with cyst recurrence had 47 fet cycles , leading to a cyst recurrence rate of 23.3% . as shown in table 5 , there were no significant differences in clinical pregnancy ( 42.55% vs. 45.33% ) and live birth rates ( 36.20% vs. 39.00% ) between stage iii iv endometriosis patients with recurrence of ovarian cyst after laparoscopic treatment and patients with tubal factor infertility . rates of miscarriage , ectopic pregnancy , and implantation were comparable between the two groups ( all p>0.05 ) . no significant differences were found in age , duration of infertility , body mass index , number of embryos transferred , average endometrial thickness of et ( mm ) , basal fsh , rate of fsh > 10 miu / ml , serum estrogen or progesterone levels on the transplantation day , or number of previous failed embryo transfer cycles between the two groups ( all p>0.05 ) . patients with tubal factor infertility group were more likely to have secondary infertility compared to patients with stage iii iv endometriosis ( p<0.001 ) . in patients with stage iii iv endometriosis , 40 received 47 fet cycles and had endometrial cyst recurrence after laparoscopic or laparotomy treatment . rates of implantation , clinical pregnancy , and live birth were comparable between the two groups . no differences were found between the two groups in terms of rates of ongoing pregnancy , miscarriage , ectopic pregnancy , or complications . iv endometriosis had smaller babies than patients with tubal factor infertility ( median , 2850 vs. 3100 g , p=0.001 ) and delivered earlier ( median , 37.0 vs. 38.3 weeks , p<0.001 ) . multivariate analysis revealed that age ( or=0.898 , 95%ci : 0.8510.948 , p<0.001 ) , average number of embryos transfer cycles ( or=0.248 , 95%ci : 0.1870.328 , p<0.001 ) , and number of embryos transferred ( or=1.892 , 95%ci : 1.0623.369 , p=0.030 ) were independently associated with the pregnancy rate ( table 4 ) . in addition , the 42 patients with cyst recurrence had 47 fet cycles , leading to a cyst recurrence rate of 23.3% . as shown in table 5 , there were no significant differences in clinical pregnancy ( 42.55% vs. 45.33% ) and live birth rates ( 36.20% vs. 39.00% ) between stage iii iv endometriosis patients with recurrence of ovarian cyst after laparoscopic treatment and patients with tubal factor infertility . rates of miscarriage , ectopic pregnancy , and implantation were comparable between the two groups ( all p>0.05 ) . while it has been established that many factors are likely to influence the outcome of ivf , such as the adverse roles of nicotine and the methods of preservation of frozen embryos , the effects of endometriosis on the results of ivf are currently controversial . therefore , the aim of the present study was to retrospectively assess the efficacy of nc endometrial preparation for fet in women with severe endometriosis . results showed that the rates of implantation , pregnancy , and live birth were similar between the two groups . in addition , no differences were observed in the rates of ongoing pregnancy , miscarriage , or pregnancy complications . although severe endometriosis did not affect birth rate , higher frequencies of premature delivery and low birth weight were observed . this effect of severe endometriosis on delivery age and birth weight is supported by a previous study , but other studies showed no difference in delivery age or birth weight . because this result could have been affected by the small sample size , additional studies are necessary to address this point . some studies reported that infertility of patients with endometriosis was mainly attributed to a reduced ovarian reserve and ovarian response , lower anti - mllerian hormone levels , higher fsh levels , and abnormal expression of some proteins . in addition , patients with endometriosis showed increased il-6 secretion , inducing changes in endocrine , paracrine , and autocrine pathways of patients with endometriosis , which probably play a role in the lower implantation rate . the changes observed in women with endometriosis may result in oocytes of low quality and lower ability to implant serum from patients with endometriosis is embryotoxic for mouse embryos , but this effect can be reversed by glucocorticoid treatment . furthermore , altered endometrial receptivity in patients with endometriosis may also contribute to endometriosis - associated infertility . a recent meta - analysis revealed that women with endometriosis have a reduced pregnancy rate compared with women with tubal factor infertility . in addition , fertilization and implantation rates have been shown to be different between women with endometriosis - associated infertility and women with tubal factor infertility . furthermore , a previous study reported that patients with stage iii or iv endometriosis have poorer outcomes after assisted reproductive procedures than women with stage i or ii endometriosis , indicating that the severity of endometriosis affects the outcome of assisted reproduction . in contrast , opoien et al . reported that ivf / icsi carried out in patients with severe endometriosis but without endometrioma achieved outcomes comparable to those with tubal factor infertility . in the present study , patients with endometrioma were not included . . also found that patients with endometriosis had a reduced response to ovarian stimulation , a lower number of oocytes , and a reduced fertilization rate , but not a reduced pregnancy rate compared with patients with tubal factor infertility . in the patients with severe endometriosis , there were 294 oocyte retrieval cycles in 271 patients , and 929 top - quality embryos ( d3 frozen ) , and 940 valid embryos ( including top - quality embryos and frozen blastocysts ) were collected . there were 305 oocyte retrieval cycles among 276 patients with tubal factor infertility , and 1047 top - quality embryos ( d3 frozen ) , and 1054 valid embryos ( including top - quality embryos and frozen blastocysts ) were collected . there were 300 transfer cycles in 258 patients with tubal factor infertility . in this study , there were no significant differences in the maturation rate of oocytes , fertilized oocytes , oocyte cleavage rate , top - quality embryos , valid embryos , and cycle cancellation rate . to the best of our knowledge , few studies have evaluated the pregnancy outcomes after nc - fet in patients with endometriosis . previous studies have mostly focused on the relationship between fresh embryo transfer and endometriosis and pregnancy outcomes . a previous study reported good outcomes with nc - fet , but it was designed to assess the effect of uterine peristalsis , and no comparisons were made with other approaches . therefore , the main question of the present study was to determine whether it is feasible to perform fet without pituitary downregulation with a prolonged gnrh - a in patients with endometriosis . iv endometriosis and patients with tubal factor infertility . in addition , the rates of implantation and ongoing pregnancy were comparable , but it was lower in patients with endometriosis according to a study by van der houwen . in this previous study , long - term pituitary downregulation achieved improved ongoing pregnancy rates in ivf - fresh et , including cryopreserved embryo transfers , compared with nc - fet . in the fet protocols used in our center , only the highest - quality embryos are frozen and transferred , which may have positively affected the outcomes of the study . the present study showed that there was no difference in the miscarriage rate , which is different from a previous meta - analysis . in the present study , a woman with stage iii iv endometriosis underwent labor induction due to general dropsy of the fetus at week 15 . in a twin - pregnant woman , one fetus was found with a single umbilical artery , thickening of the neck stratum lucidum , and early embryonic death . however , the lack of a significant difference could be caused by labor induction due to abnormal results during antenatal examinations , which should be further investigated using larger sample sizes . results showed that there was no birth defect in the two groups , although fetal abnormalities and abortions were observed during the second trimester . lack of birth defect could be the result of high - quality embryo transfer , proactive abortion of abnormal fetus through thorough antenatal examinations , or simply because of the limited number of cases in this study . although severe endometriosis did not affect birth rate , higher frequencies of premature delivery and low birth weight were found , which is supported by previous studies . to further investigate the differential effects of fet outcomes by stages of endometriosis , the present study looked at women with severe ( stage iii or iv ) endometriosis and recurrence of ovarian cysts after surgery . results showed no significant associations between severe endometriosis with recurrence of ovarian cysts and patients with tubal factor infertility after nc - fet . the recurrence of an ovarian cyst represents active endometrial lesions , but the rates of clinical pregnancy and implantation were not significantly affected . first , high - quality embryos were used , which excluded the effect of embryo quality on the implantation rate and pregnancy outcomes in women with severe endometriosis . since patients with endometriosis often have low - quality oocytes , particular care must be taken when selecting the embryos . second , the effects of down - regulated gnrh - a and high doses of estrogen and progesterone on endometrial receptivity were further excluded . the nc used in the present study was similar to the psychological status , and the effects on endometriosis were slighter . third , recurrence of endometrial cyst suggests active endometriosis , but the implantation rate was not affected , which means that the endometrial receptivity and the potential of high - quality embryos were not affected . these findings strongly suggest that the effects of endometriosis on fertility could be caused by the environment in the pelvic and abdominal cavities on the quality of the oocytes , which further affected the quality of the embryos , and finally affected the implantation rate and pregnancy outcomes . a well - designed , prospective , randomized study in severe patients with endometriosis undergoing fet with and without long - term pituitary downregulation should be performed . another probable bias was that , in the endometriosis group , laparoscopy was not always performed in our hospital , and the severity of the disease had to be determined based on the reports from other hospitals , probably introducing an observer bias . there was no difference in pregnancy outcomes between patients with endometriosis and those with tubal infertility .
backgroundthe aim of this study was to investigate the effect of natural cycle ( nc ) endometrial preparation for frozen - thawed embryo transfer ( fet ) in women with advanced endometriosis.material/methodsthis retrospective study included 179 patients with stage iii iv endometriosis who underwent 233 fet cycles at a tertiary care academic reproductive medical center between march 2011 and august 2013 ( group a ) . the control group included 258 patients with tubal factor infertility who underwent 300 fet cycles ( group b ) . both groups were prepared for fet using a nc protocol . rates of implantation , clinical pregnancy , live birth , ongoing pregnancy , miscarriage , and pregnancy complication were recorded.resultsthe implantation rate ( a : 36.0% , b : 30.4% , p=0.06 ) , the pregnancy rate ( a : 50.2% , b : 45.3% , p=0.263 ) , and the live birth rate ( a : 39.91% , b : 39.0% , p=0.428 ) were similar between the stage iii iv endometriosis and tubal factor infertility groups . no differences were observed in ongoing rates of pregnancy , miscarriage , and pregnancy complications , independent of endometriosis severity . no congenital birth defects were found . when high - quality embryos are transferred , pregnancy results were not affected by active endometriosis . although severe endometriosis did not affect birth rate , higher frequencies of premature delivery ( mean gestational age a : 37 weeks , b : 38.3 weeks , p=0.044 ) and low birth weight were observed ( < 2500 g a : 26.4% , b : 16.6% , p=0.047).conclusionsthere was no difference in pregnancy outcomes between patients with endometriosis and those with tubal infertility . pregnancy outcomes in patients with endometriosis were not affected by endometriosis severity . pregnancy outcomes were not affected by active endometrial cyst .
in the early 1970s , this picture of thymic selection was still being colored in . immunologists were unaware that the antigens recognized by t cells were peptides bound to mhc molecules . and tcrs themselves peter doherty laid out the nobel prize winning rules of what is now known as self - mhc restriction in 1973 . they showed that antiviral t cells from an immunized mouse only recognized infected cells from other mice that shared the same type of mhc genes ( 1 ) . one for a self - mhc molecule , and the other for the viral antigen ( 2 ) . but zinkernagel and doherty preferred their own altered - self hypothesis , which proposed that the t cells bore a single receptor that recognized an mhc molecule that had been somehow altered by the viral infection . michael bevan , then a postdoctoral fellow at the salk institute ( san diego , ca ) , was intrigued by the altered - self theory . he had been studying differences in the genes encoding minor histocompatibility antigens ( mhas ) that cause graft rejection even when donors and recipients are mhc matched . he found that recognition of target cells by t cells specific for mha also followed the rules of mhc restriction . he proposed that the t cells recognized self - mhc molecules that were associated with these mhas and called it the antigen interaction hypothesis . the nature of this altering the binding of peptides to self - mhc would not be known for a few more years . bevan was able to boost confidence in the altered - self theory by disproving the two - receptor hypothesis . he found that in the progeny of mhc - a and mhc - b mice , individual t cells recognized antigen on either mhc - a or mhc - b cells but not both . in the dual recognition theory , each t cell would have had receptors for both mhc molecules and thus would have recognized both targets . as a further test of his theory , bevan designed an assay in which cells that had either the correct mhc but the wrong mha or vice versa competed with cells that had both the correct mhc and mha as targets for killing by mha - specific t cells . he found that both the correct mhc and mha had to be on the same target cells to be recognized by the t cells . an enticing explanation for these data was that the self - mhc and the antigen were somehow interacting . bevan published these results in the journal of experimental medicine in 1975 ( 3 ) . a previous hypothesis suggested that t cells were selected in the thymus ( 4 ) . bevan tested this theory by injecting t cell precursors from the progeny of mhc - a and mhc - b parents into lymphocyte - deficient mhc - a recipients . newly generated t cells from these mice recognized antigen - presenting target cells from mhc - a but not mhc - b mice . furthermore , when the thymus of the progeny mouse was replaced with an mhc - a only thymus , most of its t cells only recognized antigen bound to mhc - a cells ( 5 ) . bevan concluded that the mhc molecules in the thymus determine what mhc molecules will be recognized by the t cells . the definition of the tcr structure finally vindicated the single receptor hypothesis ( 6 ) . tcrs were later shown to recognize peptide fragments bound to mhc molecules on antigen - presenting cells ( 7 ) .
in the 1970s , michael bevan showed that t cells only recognize antigens in cells that have the same type of major histocompatibility complex ( mhc ) molecule present in the thymus where the t cells mature . his work provided the first clues to how thymic self - mhc molecules select the cells that make up the mature t cell repertoire .
coomb 's positive hemolytic anemia is a very rare cause of anemia associated with tb and only few case reports have been published . the case presented here had tuberculosis lymphadenitis associated coomb 's positive hemolytic anemia which resolved on treatment with anti tuberculous treatment . a 19-year - old girl presented with swelling in the left side of the neck of 1 year duration . laboratory findings on admission were as follows : hemoglobin 3.5 g / dl , total wbc count 4800/mm(52% neutrophils and 48% lymphocytes ) , platelet count 225,000/ mm , mcv 97 , mch 30.5 fl , and reticulocyte 12% . biochemical tests were as follows : total bilirubin 3.7 mg / dl , direct bilirubin 2.0 mg / dl , indirect bilirubin 1.7 mg / dl , ldh 720 u / l and haptoglobulin 20 mg / dl . coomb 's test done prior to transfusion was positive ( table 1 for hematological parameters before starting anti - tuberculosis therapy ) . serum levels of urea , creatinine were within normal limits and glucose 6 phosphate dehydrogenase activity was normal . serologic tests for antinuclear antibodies , human immunodeficiency virus , mycoplasma , hepatitis b and c virus were negative . left cervical lymph node biopsy showed caseating granulomatous lymphadenitis [ figure 1 ] mantoux test was positive ( 18 mm induration ) . laboratory parameters of the patient during hospital stay langerhan 's giant cells seen in tuberculosis lymphadenitis patient was started on antituberculosis treatment with isoniazid ( 300 mg qday ) , rifampicin ( 450 mg qday ) , ethambutol ( 800 mg qday ) , and pyrazinamide ( 750 mg bid ) . hemoglobin improved to 5 gm / dl after 2 weeks of treatment and coomb 's test became negative after 2 months [ table 2 ] . autoimmune hemolytic anemia ( aiha ) represents a spectrum of disorders in which antibodies against self - antigens on the erythrocyte membrane cause a shortened red blood cell ( rbc ) life span . aiha can occur as an idiopathic ( primary ) disorder or can coexist with another disease ( secondary ) . anemia in tuberculosis is most often due to nutritional deficiency , malabsorption syndromes , failure of iron utilization , and bone marrow suppression . siribaddane et al . , first reported association of autoimmune hemolytic anemia in tuberculous lymphadenitis in 1997 . a detailed search revealed only 7 cases of aiha in tuberculosis in the english literature ; 3 of them responded to anti - tuberculous treatment ( att ) alone without need for blood transfusion or steroids . mehmet turgut et al.,from turkey , reported a case of pulmonary tuberculosis with aiha responding to att alone without the need for blood transfusion . ping - hung kuo et al . from taiwan , reported an episode of coomb 's positive aiha in a patient with miliary tuberculosis resulting in a hemoglobin of 5g / dl . the hematological parameters in their case improved without the use of steroids or blood transfusion . , from india , reported a case of aiha in childhood tuberculosis ( mediastinal tuberculous lymphadenitis ) , which responded to steroids and antituberculous therapy . abdullah abba et al . , from saudi arabia , reported aiha in an indonesian housemaid suffering from intestinal tuberculosis . in their case , from india , reported about a child with abdominal tuberculosis and aiha , which responded to steroids and att . apart from autoimmune hemolytic anemia , reported a case series of 5 patients with tuberculosis and thrombocytopenia who were treated with att and other drugs like danazol , vincristine , iv immunoglobulin , and steroids . this case highlights the need for detailed evaluation of anemia in tuberculosis patients and to consider aiha in the differential diagnosis of anemia in these patients . one of the main treatments of aiha is the administration of steroids ; however , this may be potentially harmful in tuberculosis patients . this case report is to emphasize the effectiveness of att alone to correct aiha in tuberculosis patients .
anemia in tuberculosis is usually anemia of chronic disease . severe hemolytic anemia is exceedingly rare in tuberculosis patients . we report a patient diagnosed with tubercular lymphadenitis complicated by coomb 's positive hemolytic anemia . patient responded well to antituberculous treatment . hematological parameters improved after initiation of antituberculosis treatment . to the best of our knowledge , this is the first case from india of an adult patient with tuberculous lymphadenitis presenting with coomb 's positive hemolytic anemia .
the incidence rate ranges from 4.5 to 20% after pneumonectomy and is 0.5% after lobectomy . the risk of developing a bronchopleural fistula is greater when surgery is performed for a malignancy and even more when radiation or chemotherapy is given [ 1 , 2 , 3 ] . until now there are no established guidelines , nor is there a consensus on how to approach the problem . besides attempts to close the fistula , preventive measures , early treatment with antibiotics , drainage of the empyema and aggressive nutritional and rehabilitative support are of major importance . yet , when a patient is inoperable , only endoscopic procedures with the application of sealants can be used to close the fistula . unfortunately , large ( > 8 mm ) or central bronchopleural fistulas are usually not eligible for such endoscopic treatment . recently , fruchter et al . and kramer et al . have described several successful cases where a novel technique has been used to close bronchopleural fistulas . they used an amplatzer septal occluder device , which has originally been developed for the endovascular closure of cardiac septal defects [ 5 , 6 , 7 ] . we present an inoperable patient with a large bronchopleural fistula , arisen after lobectomy for a stage i squamous cell carcinoma . in the absence of other therapeutic options , we decided to apply the novel endoscopic technique , using the amplatzer septal occluder device , in an attempt to close the fistula . we report on a 68-year - old woman with a history of a diffuse , large , b - cell , non - hodgkin lymphoma of the thyroid and stomach ( stage iv b ) . she underwent surgery ( resection of a thyroidal mass ) and was treated with chemotherapy after which complete remission was achieved . at that time , she also underwent tracheal stenting because of recurring aspiration related to a fistula ( postoperative ) between the oesophagus and the trachea . five years later , she was diagnosed with a squamous lung carcinoma in the right lower lobe stage ia . a lobectomy was performed and the initial postoperative course was favourable . however , 5 days later , she started suffering from marked dyspnoea . during clinical examination developing respiratory insufficiency with extensive bilateral infiltrates visible on chest x - ray prompted intubation and mechanical ventilation . bronchoscopy revealed a large ( approximately 10 mm in diameter ) bronchopleural fistula in the middle of the right bronchial stump . since the patient had a high oxygen need , she was considered inoperable . due to the size and central location of the fistula unfortunately , the patient remained septic and repeated bronchoscopy was needed to remove extensive , sticky , endobronchial secretions . since no other therapeutic option was available , this device , originally developed for the endovascular closure of cardiac septal defects , consists of two expandable disks , made of nitinol wire mesh , connected by a central waist . the device can be compressed inside a catheter . by placing the catheter inside the defect and then releasing the device from the delivering sheath , the disks can anchor the device on either side of the defect . in our case , the distal disk was first extruded and pulled back against the distal side of the defect . the procedure was successful with almost complete closure of the fistula , but because of a small persistent air leak , bioglue surgical adhesive was applied after a couple of days to obtain a complete seal of the bronchopleural fistula ( fig . bronchoscopic reassessment showed granulation tissue developing progressively around the device which caused further closure of the fistula . the patient was eventually discharged from the hospital to a rehabilitation facility several weeks after the insertion of the device . there were no remaining symptoms and ct thorax showed a good position of the device and full expansion of the lung tissue without any remaining pleural cavity ( fig . bronchopleural fistulas can occur after lobectomy or pneumonectomy . although rare , this complication is associated with high morbidity and mortality rates . its management remains a difficult matter because no scientific evidence for optimal treatment is available . reported interventions are all based on small ( often retrospective ) series or individual cases . our patient suffered from a large bronchopleural fistula , following right lower lobectomy and was considered inoperable . in the absence of any other options , a novel endoscopic technique , using an amplatzer septal occluder device , the family of the patient was informed of the fact that an off - label use of the device was being performed . up until now , endoscopic techniques have been considered to be only useful for the treatment of small , peripheral , bronchopleural fistulas , most often as a bridge to surgery in high - risk surgical patients . in this case report we illustrate that the use of an amplatzer septal occluder device can expand the importance of endoscopic techniques in the treatment of bronchopleural fistulas . in this particular case , the endobronchial application of an amplatzer septal occluder device an experimental procedure which was the only possible option in this very weak , inoperable , ventilated patient led to the closure of a very large , central , bronchopleural fistula and furthermore provided a definite cure of the fistula . studies exploring the use of this technique as an alternative to surgery even in operable patients might be of interest . this case furthermore illustrates the potential use of devices designed for other purposes in other disciplines and highlights the advantages of close collaboration between different specialities , e.g. interventional pulmonologists and cardiologists as in our patient . none of the authors has any conflicts of interest regarding the content of this article .
bronchopleural fistulas can occur as a rare but severe complication after pulmonary resection . established guidelines for the proper treatment of patients with bronchopleural fistulas do not exist . apart from attempts to close the fistula , emphasis is placed on preventive measures , early treatment with antibiotics , drainage of the empyema and aggressive nutritional and rehabilitative support . for inoperable patients , endoscopic procedures are the only therapeutic option . unfortunately , large ( > 8 mm ) or central bronchopleural fistulas are usually not suitable for such endoscopic management . recently , some groups have published a few case reports about a novel technique for the endobronchial closure of bronchopleural fistulas , using an amplatzer device , originally designed for transcatheter closure of cardiac septal defects . we applied the same technique as a life - saving treatment in a ventilated patient who was considered inoperable due to a high oxygen need . the operation was successful . the patient could be weaned from ventilation and was eventually discharged from the hospital to a rehabilitation facility several weeks after the insertion of the device . until now , endoscopic techniques have only been useful for the treatment of small , peripheral , bronchopleural fistulas and even then only as a bridge to surgery in high - risk surgical patients . in this case report , we demonstrate that the use of an amplatzer device can expand the importance of endoscopic techniques in the treatment of bronchopleural fistulas . an amplatzer device , for endobronchial closure , can indeed be administered for large and central bronchopleural fistulas . moreover , it can be considered as a definite alternative to surgery in inoperable patients .
there has been a recent surge in interest in the eastern philosophies for mental health care . for instance , successful amalgamation of zen 's principles with cognitive behavioral therapy ( cbt ) in the form of dialectical behavioral therapy ( dbt ) , as well as the psychotherapeutic application of mindfulness is on the rise . in most cultures for centuries , different formats of directive or non - directive talk therapies for treatment of mental - health problems have been utilized . a variety of brief and culturally relevant models of psychotherapy have been in use since time immemorial . although psychotherapy as a medical discipline gained greater acceptance following freudian studies on psychodynamic underpinnings . one of the most renowned discourses in hindu philosophy and psychotherapy comes from the bhagavad gita . the timeless teachings of the bhagavad gita are deeply embedded in the hindu psyche and continue to serve as a spiritual guide to the vast majority of hindus around the globe . this scripture consists of 18 chapters and 701 verses ( shlokas ) authored by vyasa and dates back to 2500 to 5000 years bc . the gita represents chapters 25 - 42 of the mahabharata , which has 100,000 shlokas . the storyline in the mahabharatha is based on the conflict between two groups of cousins , the diabolical kauravas and the virtuous pandavas . the pandavas and their supporters , with the aid of lord krishna ( whom the hindus believe to be an incarnation of lord vishnu ) , vanquish the kauravas confederation during the 18-day war fought on the battlefield of kurukshetra . the gita is a prelude to the kurukshetra war ; the context involves the accomplished and astute archer arjuna on a chariot navigated by lord krishna ( the guide and the charioteer ) , getting ready to face the large army of enemies consisting of his relatives , teachers and mentors . though a mighty warrior , arjuna is unwilling as he fears annihilation of his kin 's and mentors . as a result of guilt , doubt and attachment to his loved ones , arjuna contemplates withdrawing from the battlefield . the gita is a discourse by lord krishna , guiding his disciple arjuna to the right course of action to help him fulfill his destiny in the war , a triumph of righteousness over evil the hindus believe the gita to be an essence of the upanishads ( texts that form the core of hindu philosophy ) . arjuna 's dilemma is an allegory of our lives where our internal conflicts related to positive and negative dynamisms are fought on the battlefield of our minds . teachings of the gita communicated by lord krishna lead us to the right course of action . in many ways , resolution of conflict through the gita is quite similar to the task of a mental health professional , who while addressing anxiety and conflicts of the patients , also helps them with symptom resolution and paves the path to long - term recovery . several distinguished indian psychiatrists have recommended the use of principles of the bhagavad gita for psychotherapy and healing . in this manuscript , we briefly discuss some of the parallels between the gita and contemporary psychotherapies . the central theme of psychodynamic theories is the presence of conflict related to unacceptable aspects of the self . in several of these theories , the distress is about a conflict between internal dissonance and external requirement , and by striking a compromise between the two , one promotes adaptation . according to freud 's structural theory , the conflict between the i d , ego and superego is settled through the healthy ego defense mechanisms . the core theme of the gita also involves a successful resolution of conflicts faced by arjuna between parts of the three gunas i.e. , tamsic , rajas , satwic forces , respectively having broader similarities between the i d , ego and superego . figure 1 illustrates several similarities from the teachings of the gita with traditional psychodynamic psychotherapy . psychodynamic theory and the gita ( the verses describe the characteristics of the three gunas . satwa binds to happiness , rajas to action , tamas , over clouding wisdom , binds to lack of vigilance chapter 14 ; shloka 9 ] . of these satwa because it is pure , and it gives light and is the health of life , binds to earthly happiness and to lower knowledge . [ chapter 14 ; shloka 6 ] . darkness , inertia , negligence , elusion - these appear when tamas prevails . [ chapter 14 ; shloka 13 ] ) the gita theorizes that senses ( indriyas ) produce attractions , which in turn lead to desire , and a lust for possession . in a pursuit to nurture and attain that desire , passion and anger may manifest themselves . attributes like kaam ( lust ) , krodh ( unadaptive anger ) , lobh ( greed ) , moh ( insatiable attachment ) and ahankar ( unfounded self glorification ) are tamsic in nature , with noticeable similarity to the i d functions . the gita describes hate and lust to be in an individual 's lesser nature , comparable to the freudian hierarchy of the i d . the gita argues that mind is superior to the power of the senses , analogous to theories describing the interaction between the ego and the super ego . it reasons that a restless violence of senses carries away the stable mind . it claims that passions generate confusion of the mind that leads to loss of reason and makes one forget his / her duty , which may finally culminate in self - destruction . there are several aspects of the unconscious described in psychodynamic literature including , the concept of collective unconsciousness by jung . interestingly , the idea of the whole world 's unconscious ( collective unconscious ) blended into one , is analogous to the concept of atman described in the gita . of the three gunas mentioned above , tamas also presents with self - centeredness and lack of regard for consequences , again with obvious similarities to the i d . the other two components of the three gunas , rajas and satwic are in many ways analogous respectively to the ego and superego . while satwic qualities manifest as good thought , altruistic action and relationships , rajas adopts goal directed action with an expectation of reward similar to ego function . similar to freudian psychodynamic psychotherapy , the three gunas are the sources of conflict and are involved in an everlasting tussle for supremacy that results in symptoms of anxiety . the gita aims for an even higher mode for success in life than just harnessing the satwic qualities . it recommends rising above these gunas and attaining the superior state of unperturbedness by having a mind that is steady , at peace and in a state of bliss . the gita and the upanishads underscore this goal as well by stating that the achievement of true knowledge of self does not lead to salvation , it is the salvation . the gita depicts what may probably be one of the earliest documented sessions in cbt . while fearing the negative consequences of the war , arjuna visualizes the death of his relatives with associated guilt . the resulting anxiety manifests as distress with dry mouth , tremors , dizziness and confusion . he is so distressed that he considers relinquishing participation in the war and drops his weapons . lord krishna initially tries to motivate arjuna describing the glories of a warrior and dishonor associated with non - participation , perhaps a motivational strategy used by the charioteer in those times . having noted that this measure was inadequate this helps to identify and remedy arjuna 's thought process and prepares him for action ; a process akin to change brought by cbt . in addition to catastrophizing the future , arjuna experiences guilt and exhibits several other cognitive distortions [ figure 2 ] . to help combat arjuna 's dilemma , lord krishna explains that the distress he is in is transitory and emphasizes the importance of having an undistorted view of the world ( akin to a view free of cognitive distortions ) . this is analogous to psychoeducation for an anxious subject where the therapist explains the transitory nature of anxiety , followed by an explanation of the role of cognitive distortions contributing to the symptoms . in his model on learned helplessness , seligman theorized that patients perception and blaming themselves for events beyond their control , appeared to be a recurring theme of depression . lord krishna addresses personalization , as arjuna unfairly holds himself responsible for the destruction , by stating that all actions occur due to a natural course and an individual who perceives self to be cause for such actions , is deluded . lord krishna further addresses arjuna 's conflicts by introducing the concept of the soul ( atman ) being eternal , and that arjuna will not annihilate the enemies by destroying their worldly bodies , thereby relieving him of the responsibility of his enemy 's earthly demise . cognitive behavioral therapy and the gita later , lord krishna addresses the avoidance by arjuna with the knowledge of karma , perhaps the most important concept of the gita . the concept of karma yoga is unique whereby the action is in service of the lord without attachment , or expectation of fruits , rewards or consequences . this knowledge addresses the schema that one should not retaliate against family , however , evil they might be , removing a considerable weight off arjuna 's shoulders . the focus on action by an individual is emphasized on several chapters in the gita and could be useful in addressing avoidance as a defense . the gita states that a person attains perfection by action not by mere renunciation and that a man who withdraws from action is a false follower of the path . lord krishna discourages the dwelling on imaginary results ( future telling , a cognitive distortion as in cbt ) . the cognitive - behavioral therapists often use the principles of reciprocal inhibition and prescribe the use of relaxation . the gita recommends the use of relaxation via controlled breathing ( pranayama ) and meditation , as aids towards alleviating anxiety and achieving harmony . with several similarities between the process of cbt and the gita discourse , we believe the examples from this scripture can be used to promote insight into one 's own distorted thinking and motivate behavioral change . mindfulness means awareness or bare attention and refers to a way of paying attention that is sensitive , accepting and independent of thoughts . though this is widely quoted as a zen principle , the gita has several references to this practice . the gita prescribes mindfulness as a way of being detached from the onslaught of the senses , in order to attain the state of sthithapragna ( a state of unperturbedness ) . some of the metaphors in the gita describing this state [ table 1 ] are : one should be tranquil like the ocean which is unaffected by rivers flowing into it , one should draw self away from the senses as a tortoise withdraws its limbs and being similar to water drop on a lotus leaf which does not have an attachment to the leaf . lord krishna suggests reaching the mindful state via meditation and maintaining self in calm and un - agitated state . it is used in conjunction with cbt , dbt and acceptance and commitment therapy . with the proliferation of eclectic therapies listening to a discourse on the bhagavad gita is a routine practice at a hindu funeral , congruent with the popular belief that it helps with the grief process . it provides relations of the deceased solace that the actual soul , the key part of the deceased is eternal , and it is just the body , a carrier of the soul that is destroyed . the gita also talks of inevitability of death and the reincarnation process , thereby reducing the intensity of the grief . re - establishing interests and relationships are one of the key aspects of addressing grief in interpersonal therapy ( ipt ) [ table 2 ] . the gita can be used to motivate the patient move along the grief process . visiting gita 's concept that the supreme being carries off all things can aid alleviate the guilt towards the deceased by diffusing the responsibility towards god . some of these concepts have a heavy tone of spirituality and religion ; hence the patient 's beliefs should be explored and respected prior to using excerpts from the gita as an adjunct to grief therapy . shlokas useful in addressing grief and role transition one of the core strategies used in ipt involves role transition . this concept often involves the individual romanticizing about their previous role and thereby , hesitating to adopt a new role . the gita prescribes action without expecting the reward , and at the same time , advises not to judge one 's duty , either as humble or great , a philosophy that aids successful transition . the concept of duty but not taking the responsibility of the consequences modifies expectations towards the new role . another phase of the ipt , which may also aid role transition , is restoration of self - esteem . in the gita , krishna addresses arjuna paramthapa ( chastiser of enemies ) , purushasresta ( noblest of men ) and several similar positive adjectives by highlighting his strengths and thereby promoting self - esteem . among the addiction treatments to date , gita encourages introspection , degree of weakness over one 's senses and the power the senses have over an individual . often the major problem with addictions is a lack of motivation towards change , motivational enhancement therapy developed by miller and rollnick is widely regarded as the best in overcoming this problem . developing discrepancy and promoting self - efficacy are some of the key elements of this therapy . during the gita discourse , lord krishna cleverly points out the discrepancy between arjuna 's action and words , instills hope that the mind can be mastered [ figure 3 ] . he also promotes self - efficacy by setting his disciple on the course of action from the state of pre - contemplation . motivational enhancement therapy ( motivational enhancement therapy can be used to move any person through the stages of change . these shlokas [ chapter 2 ; shlokas 42 - 44 , 64 , 67 , 71 . chapter 16 ; shloka 21 ] in the gita , might be useful in addiction therapies ) furthermore , the patients with psychiatric disorders have a higher prevalence of physical health morbidities relative to the general population . the body is described as the lord 's kshetra ( abode ) or temple , hence making it pertinent for an individual to take care of it and thereby providing the lord the best place to reside in . with unhealthy lifestyles contributing significantly to physical comorbidity gita 's wisdom supportive psychotherapy is eclectic and practical in approach , and is perhaps the most common used psychotherapeutic modality by psychiatrists and mental health practitioners around the globe . similar to lord krishna 's intentions for arjuna , the therapist uses a conversational style and creates a holding environment for improving self - esteem . here , arjuna 's perceptions are reframed and universalized by addressing his predicament , a tactical for example , killing of relatives , a worry for arjuna is reframed as doing one 's duty . in this way , the gita does not point fingers at arjuna but focuses on the human way of life thereby universalizing his anguish . other striking similarities are providing pragmatic guidance by emphasizing teaching , giving advice , developing adaptive behavior and anticipatory guidance . the success of the spirituality based therapies in aa and mindfulness has not resulted in spirituality being embedded in part of routine psychiatric practice . one of the barriers to the application of spirituality in improving the health of patients and promoting healing has been the belief system of psychiatrists themselves . compared to the general population there is some line of thought among psychiatrists that sharing religious beliefs amounts to boundary violation . however , the dictum of medical ethics is not impinging on patient 's own religious - spiritual beliefs but at the same time religious - spiritual views of a physician should not preclude the prescription of a useful spiritual intervention , which are consistent with the patient 's belief . in their recent guidelines , the royal college of psychiatrists recommends working with spiritual leaders as warranted in treating patients . the zen principles have received acceptance among the psychiatrists and patients worldwide irrespective of spiritual and religious backgrounds . similarly , one needs to note that the gita also has wide secular content , which could be harnessed to benefit patients . we therefore , recommend psychiatrist and mental health practitioners to use spirituality as a part of their therapeutic armamentarium . whilst the cultural background can determine psychopathology and it is also a determinant for the acceptance of a particular treatment , to the extent western psychotherapies are considered inapplicable in some eastern cultures . in contrast to western psychotherapy practice the dyadic relationship between guru and chela , similar to the one between krishna and arjuna has more appeal to indian patients and should be exploited for better therapeutic outcome . with a rise in the number of psychotherapies in the recent years , majority being eclectic , we hope for therapy models embedded in the wisdom of the gita may add additional content to western psychotherapies .
the bhagavad gita is based on a discourse between lord krishna and arjuna at the inception of the kurukshetra war and elucidates many psychotherapeutic principles . in this article , we discuss some of the parallels between the gita and contemporary psychotherapies . we initially discuss similarities between psychodynamic theories of drives and psychic structures , and the concept of three gunas . arjuna under duress exhibits elements of distorted thinking . lord krishna helps remedy this through a process akin to cognitive behavioral therapy ( cbt ) . we ascertain the analogies between the principles of gita and cbt , grief emancipation , role transition , self - esteem , and motivation enhancement , as well as interpersonal and supportive psychotherapies . we advocate the pragmatic application of age old wisdom of the gita to enhance the efficacy of psychotherapeutic interventions for patients from indian subcontinent and to add value to the art of western psychotherapies .
central diabetes insipidus ( cdi ) results from deficiency synthesis , release of arginine vasopressin ( avp ) , or both . polyuria and polydipsia are important clues to the diagnosis ; nonetheless , approximately 40% of the patients have symptoms other than polyuria and polydipsia at presentation . infants may have fever , vomiting , or failure to thrive rather than polyuria and polydipsia . cdi may be a consequence of surgery or a component of multiple pituitary hormone deficiencies ( mphds ) . water deprivation tests and a ddavp ( 1-desamino-8-d - arginine - vasopressin ) trial remain the diagnostic gold standard of cdi , often confirmed by direct measurements of serum avp and copeptin [ 35 ] . . it can be familial ( i.e. , a genetic defect of avp synthesis ) or secondary to diseases that affect the hypothalamic - pituitary system , such as langerhans cell histiocytosis ( lch ) , germinoma , craniopharyngioma , trauma related to surgery or accident , or cranial malformations . hypothalamic magnetic resonance imaging ( mri ) is necessary because it not only may lead to a diagnosis of cdi by lack of posterior pituitary bright spot on t1-weighted imaging , but also can reveal intracranial tumor or lch with a thickened pituitary stalk . however , 2050% of cases are considered idiopathic , either with normal or with thickened pituitary stalk . there may be a delay in the diagnosis of pituitary hormone deficiency , isolated growth hormone deficiency , or mphd . however , the delay in diagnosis of diabetes insipidus did not affect survival rates significantly . furthermore , the underlying cause of pituitary stalk thickening associated with mphd in idiopathic cdi is not completely understood . to date , diagnosis and differential diagnosis of childhood cdi in china are daunting , with lack of systematic follow - up . in our study , we analyzed the clinical , hormonal , and neuroradiological data at diagnosis and follow - up to illustrate the importance of regular follow - up and monitoring of pituitary function . from 2012 to 2014 , 43 patients ( 23 boys and 20 girls ) ranging in age from 1.9 to 11.5 y were diagnosed with cdi at the pediatric endocrinology department of shandong provincial hospital . a family history , chief complaints , physical examinations , and laboratory and radiological evaluation were obtained at presentation . diagnosis of cdi was based on a history of polyuria and polydipsia ( urine volume > 1500 ml / kg / d at birth , 100110 ml / kg / d at 2 y , and 4050 ml / kg / d after 2 y ) , with a consistent urine osmolality < 300 mosm / kg in the 24 h urine specimen . all patients underwent an in - patient water deprivation test and then a desmopressin trial . patients were treated with oral desmopressin acetate after confirmation of cdi , 2 or 3 times daily . the water deprivation test lasted 4 to 7 hours , in accordance with the standard protocol previously reported . blood pressure , pulse rate , and weight were monitored at baseline and hourly during the test . urine samples were also collected hourly for the measurement of urine osmolality and specific gravity . blood samples for measurement of serum sodium and plasma osmolality were obtained at the beginning and end of the water deprivation test . after the water deprivation test , ddavp was administrated by subcutaneous injection ( 0.1 g / kg , maximum 4 g ) as a trial . urine was collected hourly for osmolality and specific gravity . serum sodium and osmolality complete cdi was defined as urine osmolality < 300 mosm / kg after the water deprivation test with a > 50% increase in response to ddavp . partial cdi and partial nephrogenic diabetes insipidus and defined as maximum urine osmolality between 300 and 800 mosm / kg during the water deprivation test and < 50% increase in response to ddavp . complete cdi , partial cdi , and partial nephrogenic diabetes insipidus were distinguished by abolishment of thirst , polyuria , and polydipsia , without development of hyponatremia , in response to a therapeutic trial with a standard dose of desmopressin . blood samples to measure growth hormone levels were obtained at baseline and at 30 , 60 , 90 , and 120 min after the administration of arginine ( 0.5 g / kg , given intravenously over a period of 30 min ) and levodopa ( 10 mg / kg , maximum 500 mg , given orally ) . growth hormone deficiency was defined as growth hormone peak level < 10 ng / ml combined with a subnormal ig-1 ( insulin - like growth factor 1 ) level for chronological age . thyroid - stimulating hormone ( tsh ) deficiency was defined as free thyroxine ( ft4 ) < 12.0 pmol / l with a low or low - to - normal serum concentration of tsh . plasma acth and serum cortisol were measured in the morning ( 08:00 a.m. ) . < 550 nmol / l during insulin - induced hypoglycemia , in concert with an inappropriately low plasma acth concentration . follicle - stimulating hormone / luteinizing hormone ( fsh / lh ) deficiency was diagnosed in 2 patients who had absent / delayed pubertal development . serum fsh and lh were measured at 0 minutes and 30 , 60 , and 90 min after administration of gonadotropin - releasing hormone . low serum testosterone in boys or estradiol in girls , combined with a blunted lh / fsh response to gonadotropin - releasing hormone , was diagnostic for fsh / lh deficiency . all patients underwent hypothalamic - pituitary mri scans , without and then with contrast agent , using a 3.0 t magnetic resonance scanning machine ( siemens & co. , germany ) , in accordance with standard protocol ( 3.0 mm slice thickness , coronal and sagittal orientation , 256 256 matrix size , t1-weighted imaging without and then with contrast agent ) . the contrast agent was intravenous gadolinium - diethylenetriamine pentaacetic acid ( gd - dtpa ) , 0.1 mmol / kg . images were interpreted by 2 independent observers without prior knowledge of the patients , noting posterior pituitary bright spot , pituitary height , and thickness of the pituitary stalk . pituitary height was compared to the normal value for age , gender , and development . a thickened stalk was defined as a diameter > 3 mm in at least one of its 3 portions ( proximal , median , and distal ) . the thickness of the pituitary stalk was characterized as mild ( 3.04.5 mm ) , moderate ( 4.66.5 mm ) , or severe ( > 6.5 mm ) . the height of the pituitary gland was compared to the gender and age reference established by argyropoulou et al . . based on the hypothalamic - pituitary mri , patients were considered tps or tps ( diameter of pituitary stalk 3 mm or > 3 mm , resp . ) . to rule out lch , 27 patients with thickened pituitary stalk underwent skeletal surveys , lung computed tomography ( ct ) scan , whole - body nuclear medicine bone scanning , and skin histopathological test . to detect secretary germinoma , alpha - fetoprotein ( afp ) and -human chorionic gonadotropin ( -hcg ) levels in the blood and spinal fluid were also analyzed . during a 1.5-to-2 y follow - up , patients with idiopathic conditions were seen at 36-month intervals and given physical examination and tested for anterior and posterior pituitary function and also tumor markers ( serum afp and -hcg ) . hypothalamic mri was repeated every 612 months . in those patients with a confirmed etiology , follow - up pearson 's chi - squared test and fisher 's exact test were applied to compare proportions between groups . of these 43 patients ( 23 boys , gender ratio : 1.15 ) , the median age at cdi diagnosis was 7.47 0.49 y ( range : 1.911.5 y ) . the mean interval between the initial manifestation and diagnosis was 22.29 3.67 ( range : 2108 months ) . there were no significant differences between the 2 groups ( table 1 ) . the most common symptoms or signs were polyuria / polydipsia ( n = 39 , 90.6% ) , nocturia ( n = 18 , 41.9% ) , short stature ( n = 17 , 39.5% ) , anorexia ( n = 10 , 23.3% ) , headache ( n = 3 , 6.9% ) , mental retardation ( n = 2 , 4.7% ) , emesis ( n = 1 , 2.3% ) , and rash ( n = 1 ) . there were 5 patients with a normal pituitary stalk and 12 with abnormal pituitary stalk accompanied by short stature , with heights of standard deviation of 3.48 0.45 and 3.13 0.29 , respectively . two patients with mental retardation had comorbidity including hydronephrosis and ureterectasia ; their intervals between presentation and diagnoses were 72 months and 108 months . none of the subjects had a familial etiology , nor a history of surgery , infection , or trauma . all tps cases were idiopathic , whereas 11 tps patients were etiologically diagnosed with germinoma ( n = 5 ) , craniopharyngioma ( n = 4 ) , and lch ( n = 2 ; table 2 ) . short stature , defined as individual height > 2 standard deviations below the corresponding mean height for a given age , gender , and population , was present in 10 patients , except one patient with lch . initial urine osmolality was 128.6 6.8 mosm / kg and serum osmolality was 286.2 1.6 mosm / kg . the ratio of urine osmolality to serum osmolality was < 1.0 and increased significantly to 179.1 0.5 mosm / kg and 297.5 1.9 mosm / kg , respectively , after water deprivation ( p < 0.01 ) . in response to ddavp , urine osmolality increased to 492 18.6 mosm / kg , with a mean increment of 202.4 17.51% ( range : 39450% ) . one patient received a diagnosis of partial cdi ( urine osmolality increased by 39% ) with a standard dose of desmopressin , and 42 patients had complete cdi . the posterior pituitary bright spot was absent on t1-weighted mri in all 43 patients ( 100% ) . of the 27 patients with abnormal pituitary stalk , hypothalamic - pituitary mri revealed suprasellar mass in 9 : germinoma ( n = 5 ) , supported by elevated serum csf/-hcg level , and craniopharyngioma ( n = 4 ) based on histological examination after surgery . two children had lch with thickened pituitary stalk , confirmed histopathologically in skin or skull lesion . craniopharyngioma patients ( n = 4 ) had an invisible pituitary stalk and anterior pituitary gland . in 2 of 3 germinoma patients with severe thickened pituitary stalk , the anterior pituitary was not seen on mri , whereas the other had a reduced anterior pituitary size . anterior pituitary glands in the 3 patients with moderately thickened pituitary stalk ( 1 with lch and 2 with germinoma ) were smaller than normal . seventeen patients ( 1 with lch and 16 with idiopathic cases ) showed mildly thickened pituitary stalk , 3 of whom had a smaller anterior pituitary gland than normal . of the 16 patients with normal pituitary stalk , 4 had hypoplastic anterior pituitaries . in summary , anterior pituitary size was reduced in patients with normal or abnormal pituitary stalk and was undetected by mri in patients with severely thickened and invisible pituitary stalk . anterior pituitary function was assessed in 43 patients ; 23 ( 53.5% ) had at least 1 anterior pituitary hormone deficiency . isolated growth hormone deficiency was the most frequent abnormality ( n = 15 , 37.5% ) and was not associated with pituitary stalk size . among the 16 patients with normal pituitary stalk , 6 ( 37.5% ) had isolated growth hormone deficiency , 4 with small and 2 with normal anterior pituitary . among the 17 patients with mildly thickened pituitary stalk , 6 showed isolated growth hormone deficiency , 3 of whom had decreased size of anterior pituitary . mphd was found in 2 patients with a moderately thickened pituitary stalk , and 2 of 3 patients with severely thickened pituitary stalk developed growth hormone deficiency and tsh deficiency . in addition , 1 patient with germinoma and 1 patient with craniopharyngioma had elevated prl levels ( 29.03 ng / ml and 58.54 ng / ml ) . our study found an association between thickness of the pituitary stalk and the likelihood of mphd ( p < 0.05 ) . two patients with lch are monitored regularly , and one was found to have isolated growth hormone deficiency . a mildly thickened pituitary stalk ( 3.4 mm ) was normal one year after diagnosis but still required ddavp therapy . the pituitary stalk of one patient increased from 3.9 mm to 4.0 mm after 6 months . we analyzed the clinical , biochemical , neuroradiological , and hormonal results from pediatric patients with cdi . a previous study reported that 40% of cdi patients had symptoms other than polyuria / polydipsia at presentation . in the present study , 12 patients ( 27.9% ) presented with short stature and had growth hormone deficiency , and another 5 patients presented with polyuria / polydipsia accompanied by short stature . short stature and growth hormone deficiency were not associated with etiology , which is consistent with previous studies . in addition , other symptoms or signs such as vomiting and headache might be related to intracranial tumors , and rash might be a predictor of lch . in the present study , the mean age at diagnosis was 7.47 0.49 years , in accord with previous reports , widely ranging from 1.9 to 11.5 years . however , for 76.7% , the interval was more than 12 months ; most children 's heights were below the 50th percentile and the body mass index was low . two patients with longer intervals between onset and diagnosis ( 108 and 72 months , resp . ) polydipsia and polyuria exceeding 5 ml / kg / hour with urine specific gravity less than 1.01 , plasma sodium level above 145 mmol / l , and dehydration are the hallmarks of diabetes insipidus in infants and children . in the present study , the mean urine volume over 24 hours was 202.7 9.83 ml / kg , approximately equal to 8.4 ml / kg / hour , much higher than 5 ml / kg / hour . baseline levels of urine osmolality were lower than 300 mosm / kg , and urine specific gravity was below 1.010 . however , the average plasma sodium was 145.4 1.4 mmol / l , which is not consistent with a previous hypernatremia report . as a type of diabetes insipidus , it is important to differentiate cdi from nephrogenic diabetes insipidus and primary polydipsia , because inappropriate treatment can result in severe complications . direct measurement of serum avp is recommended for diagnosis [ 3 , 4 ] , but it has not been accepted due to several shortcomings [ 1 , 1621 ] . in contrast , copeptin , the c - terminal glycoprotein moiety of pro - avp , has been suggested as a stable surrogate marker of avp secretion to improve the differential diagnosis of diabetes insipidus . a recent prospective multicenter study showed significant lower copeptin levels ( both baseline and osmolality stimulated ) in cdi cases . however , we did not test avp and copeptin when our patients were diagnosed , due to limitations . the water deprivation test and ddavp trial still are the gold standard for diagnosis / differential diagnosis of cdi . for example , we confirmed 42 complete cdi and 1 partial cdi using the protocol in our study , but this would have been 39 and 4 , respectively , if we defined complete cdi as a ratio of urinary osmolality to plasma osmolality of 1.0 and partial cdi as > 1.0 . only four patients with baseline urinary osmolality < 300 mosm / kg showed an increase to > 750 mosm / kg after water deprivation , and this may be considered partial cdi if we used another protocol . although there would be different proportions of partial cdi and complete cdi given different interpretations , there was no correlation with ideology . this suggests that a therapeutic trial with the standard dose of desmopressin is important to differentiate partial cdi , partial nephrogenic diabetes insipidus , and primary polydipsia , if measurements of avp and copeptin are limited . one common finding in mri is the absence of a physiological posterior bright spot ( pbs ) on sagittal t1-weighted imaging . some earlier reports showed that absence of a pbs is not specific for cdi diagnosis , because individual cdi cases with persistent pbs have been reported [ 23 , 24 ] . however , the pbs is diminished or absent in both cdi and nephrogenic diabetes insipidus [ 2527 ] , and it is always absent when diabetes insipidus was a presenting symptom [ 13 , 28 ] . a thickened pituitary stalk , isolated or with a mass , is another common finding on mri , in 5060% of the children . lch , germinoma , and craniopharyngioma are the most common causes of thickened pituitary stalk , but neither the pattern nor the thickness of the pituitary stalk correlated with clinical features . it was difficult to distinguish on mri between lch and germinoma because lch can be single system that only involves the hypothalamic - pituitary system ; tumor markers such as afp and -hcg in the blood and central spinal fluid can be negative in the early stage of the tumor ; and lch and germinoma could share the same findings in some cases when cdi was diagnosed . a biopsy of the pituitary stalk can provide a definitive diagnosis . however , physicians in china are conservative on biopsy , due to the risk of surgery and because of the parents . in our study , 2 of the 5 germinoma patients were diagnosed through elevated plasma -hcg levels . one lch patient had a skin rash , while the other 3 germinoma patients and 1 lch patient were diagnosed by the good response to the trial therapeutic treatment ( table 4 ) . four craniopharyngioma patients had a typical pattern on mri , which was confirmed by surgery and pathology . the height of the pituitary gland on mri can be normal , low , or high . maghnie et al . suggested that an associated large antehypophysis and a thickened stalk are highly suspicious of a germinal tumor . dysfunction of the anterior pituitary can be determined at diagnosis and during the follow - up period of cdi . in the present study , 53.5% of the patients had anterior pituitary hormone deficiency when cdi was diagnosed , which was lower than the 80% reported by liu et al . . most of these patients had growth hormone deficiency , not related to etiology . in our study here , the probability of developing mphd was associated with thickness of the pituitary stalk . in addition , our study found higher prevalence of mphd in cases with intracranial tumor compared with lch . . found that the number of anterior pituitary deficiencies seemed to be dependent on the size of the initial lesion . in our patients , 2 lch patients , there was no mphd , perhaps because the sizes of the neoplasms were less than 6.5 cm . however , long - term monitoring is needed , because this can develop years after cdi [ 30 , 31 ] . clinical , radiological , and endocrinological investigations must be performed at diagnosis and follow - up . during follow - ups that ranged from 4.1 to 14.3 years of 43 idiopathic cdi patients ( mean age : 7.4 y ) , 3 patients had lch and one patient developed hodgkin 's lymphoma 8.5 to 10 years after cdi onset . although the follow - up times of our present cases were not long enough , they are still being monitored . an appropriate therapeutic trial may be useful in patients with a persistent uncertain diagnosis ; however , it should be conducted with close supervision . in this study , we have demonstrated the limitations in the diagnosis and follow - up of childhood cdi in china . these limitations are important to note , and the attention of parents and physicians given to the associated symptoms , signs , and diagnostic tests should be improved to prevent delay in diagnosis . as soon as there is a diagnosis of cdi , regular and long - term clinical follow - ups are required that include imaging and tests for tumor markers and pituitary function .
objective . in pediatric central diabetes insipidus ( cdi ) , etiology diagnosis and pituitary function monitoring are usually delayed . this study aimed to illustrate the importance of regular follow - up and pituitary function monitoring in pediatric cdi . methods . the clinical , hormonal , and neuroradiological characteristics of children with cdi at diagnosis and during 1.52-year follow - up were collected and analyzed . results . the study included 43 cdi patients . the mean interval between initial manifestation and diagnosis was 22.29 3.67 months ( range : 2108 months ) . the most common complaint was polyuria / polydipsia . causes included langerhans cell histiocytosis , germinoma , and craniopharyngioma in 2 , 5 , and 4 patients ; the remaining were idiopathic . no significant changes were found during the 1.52 years after cdi diagnosis . twenty - three of the 43 cases ( 53.5% ) had 1 anterior pituitary hormone deficiency . isolated growth hormone deficiency was the most frequent abnormality ( 37.5% ) and was not associated with pituitary stalk diameter . multiple pituitary hormone deficiencies were found in 8 cases with pituitary stalk diameter > 4.5 mm . conclusion . diagnosis of cdi is usually delayed . cdi with a pituitary stalk diameter > 4.5 mm carries a higher risk of multiple pituitary hormone deficiencies . long - term mri and pituitary function follow - ups are necessary for children with idiopathic cdi .
retroperitoneal fibrosis ( rpf ) is a rare disease with an unclear etiology and is characterized by chronic nonspecific inflammation of the retroperitoneum . the hallmark of this disease and its main complication is ureteral entrapment , which is often silent and progressive , . several studies have noted that patients with idiopathic rpf are more likely to suffer from other autoimmune diseases such as autoimmune pancreatitis or riedel 's thyroiditis , . however , there have been few reports of cases of idiopathic rpf associated with hashimoto 's thyroiditis , particularly in patients with a single functioning kidney . in this report , we describe the case of idiopathic rpf in a hashimoto 's thyroiditis patient with a single functioning kidney , which was successfully with corticosteroid therapy and transient intraureteral stent insertion using a double - j catheter . a 73-year - old korean woman presented to our outpatient clinic with a complaint of right flank pain for the past 2 days . she had a 5-year history of hypertension and was taking a calcium channel blocker and a beta - blocker . on admission , both kidneys showed elevated renal parenchymal echogenicity and small size ( right kidney , 8.5 4.4 cm ; left kidney , 6.5 3.1 cm ; fig . her blood urea nitrogen and serum creatinine concentrations were 10.4 mmol / l ( reference value : 2.87.1 mol / l ) , respectively ; 2 weeks earlier , her serum creatinine concentration had been 150.3 mol / l . g / l ) and her serum protein level was 66 g / l ( 60 - 80 the serum concentration of c - reactive protein was 78.6 nmol / l ( 0.76 - 28.5 her thyrotropin , triiodothyronine , and free thyroxine levels were 128.42 iu / ml ( 0.34.0 iu / ml ) , 0.01 nmol / l ( 0.922.76 nmol / l ) , and 5.53 pmol / l ( 1230 pmol / l ) , respectively . her anti - thyroglobulin antibody and anti - microsomal antibody titers were both high at 1,462.54 iu / ml ( 060 iu / ml ) and 4,658.12 iu / ml ( 060 iu / ml ) , respectively . hydronephrosis was suspected and the patient underwent an abdominal computed tomography ( ct ) scan . the scan revealed a diffuse infiltrating mass extending from the lower pole of the right kidney to the level of the aortic bifurcation and right ureteral obstruction , as well as moderate hydronephrotic and hydroureteric changes on both sides ( fig . we diagnosed the patient with postrenal acute renal failure and underlying chronic kidney disease and performed an ultrasonography - guided percutaneous nephrostomy . after percutaneous nephrostomy and consecutive double - j stent insertion , her right flank pain resolved and her serum creatinine level improved to 114.4 mol / l . she underwent tc-99 m diethylenetriamine pentaacetate renography , which revealed the function of the left kidney to be impaired relative to that of the right ( 5.8% vs. 94.2% ; fig . 3 ) . to evaluate the underlying cause of her rpf , the patient underwent positron emission tomography combined with ct , which yielded no additional specific finding except for low attenuation with hypermetabolic activity in both lobes of the thyroid gland . oral administration of prednisolone ( 0.5 mg / kg ) and levothyroxine ( 0.1 mg / day ) was initiated on day 18 of hospitalization on the basis of the presumptive diagnosis of rpf associated with hashimoto 's thyroiditis . after 1 month of steroid and levothyroxine therapy , her thyroid function had recovered to normal levels and a follow - up abdominal ct scan revealed that the retroperitoneal mass almost disappeared ( fig . the dose of corticosteroid was tapered to 6 mg / day during the next 6 months . at the 9-month follow - up visit , we herein presented a case of idiopathic rpf associated with hashimoto 's thyroiditis in a patient with a single functioning kidney . the patient 's serum creatinine level returned to the baseline level after ureteral decompression and corticosteroid treatment . although idiopathic rpf has been reported in association with autoimmune disorders , there have been few reports of idiopathic rpf associated with autoimmune thyroiditis , , . most reports of idiopathic rpf in combination with chronic thyroiditis involved cases of riedel 's thyroiditis , in which the thyroid gland is replaced by fibrous tissue , . a previous study reported that 30% of patients with riedel 's thyroiditis subsequently developed idiopathic rpf . in our case , the patient had severe hypothyroidism and high serum concentrations of autoimmune antibodies , which together were suggestive of hashimoto 's thyroiditis . levothyroxine treatment had restored her thyroid function to normal , as noted during her 1-month follow - up examination . the patient 's renogram showed impaired function of the atrophied left kidney , which was attributed to rpf . patients with an atrophied kidney may be predisposed to develop renal dysfunction rapidly if aggravated idiopathic rpf causes hydronephrosis of the functional contralateral kidney . therefore , percutaneous nephrostomy and consecutive double - j stent insertion should be considered in idiopathic rpf patients with a single functioning kidney . glucocorticoid administration with or without ureteral decompression is generally considered the standard treatment for idiopathic rpf , . however , there is no guideline concerning the optimal dose of steroid or duration of treatment for the management of idiopathic rpf . vaglio et al reported that prednisone is more effective than tamoxifen in preventing the recurrence of rpf ; in their study , patients received 1 mg / kg of prednisone daily for 1 month . however , moulik et al reported the successful treatment of a case of riedel 's thyroiditis and idiopathic rpf with a modest dose of prednisolone ( 30 mg / day ) . therefore , we decided to start treatment with a dose of 30 mg prednisone / day because of the high incidence of steroid - induced complications . , we successfully treated idiopathic rpf in association with hashimoto 's thyroiditis in a patient with a single functioning kidney by corticosteroid therapy and transient intraureteral stent insertion with a double - j catheter . the authors report no conflicts of interest . the authors alone are responsible for the content and writing of the paper .
retroperitoneal fibrosis ( rpf ) is a rare disease characterized by the presence of fibroinflammatory tissue around the abdominal aorta and ureteral entrapment in most cases . idiopathic rpf is frequently reported in association with autoimmune diseases ; however , there have been few reports of idiopathic rpf associated with hashimoto 's thyroiditis . here , we report a case of idiopathic rpf with hashimoto 's thyroiditis in a patient with a single functioning kidney , which was successfully treated by corticosteroid therapy and transient intraureteral stent insertion with a double - j catheter .
the dutch healthcare inspectorate is in search for a better insight into how to measure the quality of integrated care . the central purpose of this study was to identify indicators that provide insight into the performance of the chain as a whole , by means of a clinical logic model . the extent to which such requirements are met constitutes an indicator of the quality of care delivered . in order to be able to identify suitable indicators , chain care is charted in the form of a schematic model , a so - called clinical logic. a clinical logic captures the elements of the disease process and the care chain to which it gives rise . the components of the model and the factors that determine the quality of care are described in an analytical manner , based on scientific evidence . measures are selected that capture the following questions : what are the key elements of care at each step in the process? , how does the patient flow through the care system? , where are the major decision points in treatment related to the goal? clinical logics were applied on three patient groups : dementia , heart failure and depression . on the basis of the clinical logic for heart failure patients 15 indicators clinical logics have proven to be a sound method to chart chain / integrated care , but it is mainly focused on the process of care .
introductionthe dutch healthcare inspectorate is in search for a better insight into how to measure the quality of integrated care . the central purpose of this study was to identify indicators that provide insight into the performance of the chain as a whole , by means of a clinical logic model.theory and methodschain care makes high demands on communication and transfer of information between caregivers . the extent to which such requirements are met constitutes an indicator of the quality of care delivered . in order to be able to identify suitable indicators , chain care is charted in the form of a schematic model , a so - called clinical logic.a clinical logic captures the elements of the disease process and the care chain to which it gives rise . the components of the model and the factors that determine the quality of care are described in an analytical manner , based on scientific evidence . measures are selected that capture the following questions : what are the key elements of care at each step in the process? , how does the patient flow through the care system? , where are the major decision points in treatment related to the goal?results and conclusionsclinical logics were applied on three patient groups : dementia , heart failure and depression . on the basis of the clinical logic for heart failure patients 15 indicators were proposed , for dementia 9 indicators and for depression 12 indicators.clinical logics have proven to be a sound method to chart chain / integrated care , but it is mainly focused on the process of care . it is more concrete than the chronic care model . next , the identified indicators will be tested into practice .
in patients with type 2 diabetes , glycaemic control typically deteriorates over time due to the progressive nature of the disease , and a significant proportion of patients with type 2 diabetes will require exogenous insulin therapy to reach glycaemic goals 1,2 . once - daily basal insulin is the most convenient strategy for insulin initiation because it is practical and simple to use , but its efficacy is limited since fewer than 40% of patients meet glycaemic targets 3 . at this time , intensification of insulin therapy is recommended 2,4 and different approaches can be used 2,511 . the administration of a rapid - acting analogue before the meal associated with the largest postprandial glycaemic value in addition to basal insulin is considered to be more flexible and is usually recommended . alternatively , a premixed insulin analogue twice daily ( bid ) may be used , although this strategy is considered to be less flexible and studied 2 . there is a lack of head - to - head studies comparing the efficacy and safety of a premixed insulin analogue bid with that of once - daily basal insulin and once - daily prandial insulin as the second insulin therapy step after the initial basal insulin regimen has failed . this study was therefore conducted to test the hypothesis that glycaemic control with insulin lispro low mixture ( lm25 ) bid is non - inferior to that achieved with once - daily basal insulin glargine and once - daily prandial insulin lispro ( igl ) , as measured by the change in hba1c after 24 weeks of treatment , in patients with type 2 diabetes mellitus who have inadequate glycaemic control on once - daily basal insulin glargine and oral antihyperglycaemic medication ( metformin and/or pioglitazone ) . this multinational , open - label , randomized , parallel - arm , non - inferiority , phase iv trial compared the efficacy and safety of two insulin intensification strategies in patients with type 2 diabetes who were inadequately controlled on once - daily basal insulin glargine and metformin and/or pioglitazone . patients entered a 2-week screening period , and those eligible for the study were randomized in a 1 : 1 ratio , using a computer - generated random sequence , to subcutaneous lm25 ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) bid or igl for 24 weeks . patients continued taking their stable dose of metformin and/or pioglitazone throughout the study , unless dose modifications were required for safety reasons . insulin lm25 was administered before breakfast and dinner , whereas basal insulin glargine was administered at bedtime and prandial insulin lispro was administered before the largest meal of the day [ defined as the meal with the highest 2-h postprandial blood glucose concentration , as determined from three separate 7-point self - monitoring of blood glucose ( smbg ) profiles recorded during the screening period ] . the initial total daily dose of insulin lm25 was equivalent to the patients last dose of insulin glargine , although the total daily dose was split into two equally sized doses . patients in the igl group continued on the same dose of insulin glargine that they were receiving during the screening period and initiated insulin lispro 4 iu daily . randomization was stratified by country and baseline hba1c concentration ( < 8.5% or 8.5% ) . all patients provided written informed consent and the study was conducted in accordance with applicable laws and regulations , good clinical practices and the ethical principles who have their origin in the declaration of helsinki . at the screening visit , patients provided a medical history including pre - existing conditions , concomitant medications , previous diabetes treatments and current dosages of antihyperglycaemic medications ; they underwent a physical examination ; and they provided a fasting blood sample to allow measurement of fasting plasma glucose ( fpg ) at a central laboratory . at the beginning , at regular intervals throughout , and at the completion of the 24-week treatment period , patient data were collected including weight and vital signs , blood glucose data and adverse events , including hypoglycaemia . patients completed 7-point smbg profiles within the 2 weeks before weeks 4 , 12 and 24 of study treatment or before an early discontinuation visit if applicable . patients recorded medication usage , blood glucose measurements and episodes of hypoglycaemia or any other adverse events throughout the treatment period . for each hypoglycaemia episode , patients recorded details of the signs , symptoms , treatment , associated blood glucose concentrations , if obtained , and recovery . clinic or telephone visits were scheduled every 2 weeks during the first 12 weeks of treatment and every 4 weeks thereafter ; additional visits were permitted at any time . investigators reviewed patient diaries and adjusted the patients study insulin doses on an individual basis at each scheduled clinic or telephone visit , if appropriate , according to insulin titration algorithms based on those from previous publications ( table s1 , supporting information ) 6,12,13 . health outcomes questionnaires [ the insulin treatment satisfaction questionnaire ( itsq ) and perceptions about diabetes - medications 21 ( pam - d21 ) ] were completed at the beginning and completion of the study treatment period . eligible patients were aged between 18 and 75 years with type 2 diabetes 14 and had hba1c levels 7.5 and 10.5% at the screening visit ; a fpg concentration 6.7 mmol / l at the screening visit , as determined by central laboratory , or > 6.7 mmol / l if the investigator considered further titration of basal insulin glargine was not possible for safety reasons ; and were receiving stable doses of metformin ( 1500 mg / day for at least 8 weeks ) and/or a stable dose of pioglitazone [ 30 mg / day ( 15 mg / day in korea ) ] for at least 12 weeks ( fixed dose combinations were acceptable ) before screening . all patients must have been receiving treatment with once - daily basal insulin glargine for at least 90 days before the first screening visit . non - pregnant women who were taking precautions against pregnancy or were unable to become pregnant were eligible . patients were excluded from the study if they had a body mass index ( bmi ) > 45 kg / m at first screening visit ; diagnosis of type 1 diabetes ; stable dose of pioglitazone greater than the maximum dose approved for use in combination with insulin in their country ; history of more than 2 weeks of scheduled prandial insulin use ( including mixtures ) within 12 weeks of screening ; more than one episode of severe hypoglycaemia within 24 weeks before screening ; history of concomitant disorders that contraindicated use of study medications ; or were currently participating , or had previously participated , in another study within 30 days of screening . the primary efficacy endpoint was the change in hba1c levels after 24 weeks of treatment . secondary efficacy endpoints were the change in hba1c levels from baseline to 12 weeks ; the proportion of patients who achieved a target hba1c of < 7.0 or 6.5% at 24 weeks ; the change in fpg concentration from baseline to 12 and 24 weeks ; 7-point smbg profiles at 12 and 24 weeks ; glycaemic variability , defined as the standard deviation in 7-point smbg profiles at 12 and 24 weeks ; daily insulin doses ( total , basal and prandial ) at 12 and 24 weeks ; and the change in weight from baseline at 12 and 24 weeks . safety and tolerability were measured by treatment - emergent adverse events ( teaes ) and the incidence , rate and severity of hypoglycaemic episodes ( categorized as overall and documented symptomatic 3.9 patients perceptions about the acceptability and effectiveness of their diabetes medications and perceived emotional and physical adverse events were assessed using the pam - d21 questionnaire 16 . a total of 382 patients in the per - protocol ( pp ) population gave 90% power to conclude non - inferiority at the 5% significance level using a non - inferiority margin of 0.4 , assuming the two treatment regimens were truly no different and the common standard deviation was 1.2% . the recruitment target was set at 478 patients , assuming that 20% of patients would not qualify for the pp population . the primary analysis was a gated procedure that tested the two treatment regimens with respect to the change from baseline in hba1c to 24 weeks for non - inferiority and , if this was met , for superiority . non - inferiority of lm25 to igl was concluded if the upper limit of the 95% confidence interval ( ci ) for the treatment difference ( lm25 minus igl ) was entirely below 0.4% . the treatment difference was estimated using a likelihood - based mixed model for repeated measures ( mmrm ) analysis with baseline hba1c as a covariate ; treatment , country , week of visit and the treatment - by - week interaction as fixed effects ; and patient and error as random effects . the same model was applied to the intention - to - treat ( itt ) population . this hierarchical testing procedure required no adjustment of significance levels to maintain the overall significance level at 5% . the pp population was defined as all randomized patients except those who did not complete the study or were substantially non - compliant ; received study drug different from their randomized study treatment ; or violated study inclusion , exclusion or discontinuation criteria . the itt population was defined as all randomized patients who received at least one dose of study drug . the model included the baseline value of the variable being tested treatment , country , baseline hba1c stratification level , visit and the treatment - by - visit interaction as fixed effects ; and patient as random effects . the number of hypoglycaemic events per patient - year was estimated using a generalized linear model with the assumption of an underlying negative binomial distribution . itsq and pam - d21 questionnaires were analysed using analysis of covariance ( ancova ) . last observation carried forward ( locf ) was applied to these analyses , and missing items handled according to the corresponding scoring algorithm . this multinational , open - label , randomized , parallel - arm , non - inferiority , phase iv trial compared the efficacy and safety of two insulin intensification strategies in patients with type 2 diabetes who were inadequately controlled on once - daily basal insulin glargine and metformin and/or pioglitazone . patients entered a 2-week screening period , and those eligible for the study were randomized in a 1 : 1 ratio , using a computer - generated random sequence , to subcutaneous lm25 ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) bid or igl for 24 weeks . patients continued taking their stable dose of metformin and/or pioglitazone throughout the study , unless dose modifications were required for safety reasons . insulin lm25 was administered before breakfast and dinner , whereas basal insulin glargine was administered at bedtime and prandial insulin lispro was administered before the largest meal of the day [ defined as the meal with the highest 2-h postprandial blood glucose concentration , as determined from three separate 7-point self - monitoring of blood glucose ( smbg ) profiles recorded during the screening period ] . the initial total daily dose of insulin lm25 was equivalent to the patients last dose of insulin glargine , although the total daily dose was split into two equally sized doses . patients in the igl group continued on the same dose of insulin glargine that they were receiving during the screening period and initiated insulin lispro 4 iu daily . randomization was stratified by country and baseline hba1c concentration ( < 8.5% or 8.5% ) . all patients provided written informed consent and the study was conducted in accordance with applicable laws and regulations , good clinical practices and the ethical principles who have their origin in the declaration of helsinki . at the screening visit , patients provided a medical history including pre - existing conditions , concomitant medications , previous diabetes treatments and current dosages of antihyperglycaemic medications ; they underwent a physical examination ; and they provided a fasting blood sample to allow measurement of fasting plasma glucose ( fpg ) at a central laboratory . at the beginning , at regular intervals throughout , and at the completion of the 24-week treatment period , patient data were collected including weight and vital signs , blood glucose data and adverse events , including hypoglycaemia . patients completed 7-point smbg profiles within the 2 weeks before weeks 4 , 12 and 24 of study treatment or before an early discontinuation visit if applicable . patients recorded medication usage , blood glucose measurements and episodes of hypoglycaemia or any other adverse events throughout the treatment period . for each hypoglycaemia episode , patients recorded details of the signs , symptoms , treatment , associated blood glucose concentrations , if obtained , and recovery . clinic or telephone visits were scheduled every 2 weeks during the first 12 weeks of treatment and every 4 weeks thereafter ; additional visits were permitted at any time . investigators reviewed patient diaries and adjusted the patients study insulin doses on an individual basis at each scheduled clinic or telephone visit , if appropriate , according to insulin titration algorithms based on those from previous publications ( table s1 , supporting information ) 6,12,13 . health outcomes questionnaires [ the insulin treatment satisfaction questionnaire ( itsq ) and perceptions about diabetes - medications 21 ( pam - d21 ) ] were completed at the beginning and completion of the study treatment period . eligible patients were aged between 18 and 75 years with type 2 diabetes 14 and had hba1c levels 7.5 and 10.5% at the screening visit ; a fpg concentration 6.7 mmol / l at the screening visit , as determined by central laboratory , or > 6.7 mmol / l if the investigator considered further titration of basal insulin glargine was not possible for safety reasons ; and were receiving stable doses of metformin ( 1500 mg / day for at least 8 weeks ) and/or a stable dose of pioglitazone [ 30 mg / day ( 15 mg / day in korea ) ] for at least 12 weeks ( fixed dose combinations were acceptable ) before screening . all patients must have been receiving treatment with once - daily basal insulin glargine for at least 90 days before the first screening visit . non - pregnant women who were taking precautions against pregnancy or were unable to become pregnant were eligible . patients were excluded from the study if they had a body mass index ( bmi ) > 45 kg / m at first screening visit ; diagnosis of type 1 diabetes ; stable dose of pioglitazone greater than the maximum dose approved for use in combination with insulin in their country ; history of more than 2 weeks of scheduled prandial insulin use ( including mixtures ) within 12 weeks of screening ; more than one episode of severe hypoglycaemia within 24 weeks before screening ; history of concomitant disorders that contraindicated use of study medications ; or were currently participating , or had previously participated , in another study within 30 days of screening . the primary efficacy endpoint was the change in hba1c levels after 24 weeks of treatment . secondary efficacy endpoints were the change in hba1c levels from baseline to 12 weeks ; the proportion of patients who achieved a target hba1c of < 7.0 or 6.5% at 24 weeks ; the change in fpg concentration from baseline to 12 and 24 weeks ; 7-point smbg profiles at 12 and 24 weeks ; glycaemic variability , defined as the standard deviation in 7-point smbg profiles at 12 and 24 weeks ; daily insulin doses ( total , basal and prandial ) at 12 and 24 weeks ; and the change in weight from baseline at 12 and 24 weeks . safety and tolerability were measured by treatment - emergent adverse events ( teaes ) and the incidence , rate and severity of hypoglycaemic episodes ( categorized as overall and documented symptomatic 3.9 patients perceptions about the acceptability and effectiveness of their diabetes medications and perceived emotional and physical adverse events were assessed using the pam - d21 questionnaire 16 . a total of 382 patients in the per - protocol ( pp ) population gave 90% power to conclude non - inferiority at the 5% significance level using a non - inferiority margin of 0.4 , assuming the two treatment regimens were truly no different and the common standard deviation was 1.2% . the recruitment target was set at 478 patients , assuming that 20% of patients would not qualify for the pp population . the primary analysis was a gated procedure that tested the two treatment regimens with respect to the change from baseline in hba1c to 24 weeks for non - inferiority and , if this was met , for superiority . non - inferiority of lm25 to igl was concluded if the upper limit of the 95% confidence interval ( ci ) for the treatment difference ( lm25 minus igl ) was entirely below 0.4% . the treatment difference was estimated using a likelihood - based mixed model for repeated measures ( mmrm ) analysis with baseline hba1c as a covariate ; treatment , country , week of visit and the treatment - by - week interaction as fixed effects ; and patient and error as random effects . the same model was applied to the intention - to - treat ( itt ) population . this hierarchical testing procedure required no adjustment of significance levels to maintain the overall significance level at 5% . the pp population was defined as all randomized patients except those who did not complete the study or were substantially non - compliant ; received study drug different from their randomized study treatment ; or violated study inclusion , exclusion or discontinuation criteria . the itt population was defined as all randomized patients who received at least one dose of study drug . the model included the baseline value of the variable being tested treatment , country , baseline hba1c stratification level , visit and the treatment - by - visit interaction as fixed effects ; and patient as random effects . the number of hypoglycaemic events per patient - year was estimated using a generalized linear model with the assumption of an underlying negative binomial distribution . itsq and pam - d21 questionnaires were analysed using analysis of covariance ( ancova ) . last observation carried forward ( locf ) was applied to these analyses , and missing items handled according to the corresponding scoring algorithm . of the 743 patients screened for participating in the study , 476 were randomized to 24 weeks of treatment with lm25 ( n = 236 ) or igl ( n = 240 ) and received at least one dose of study drug ; an additional two patients were randomized to igl but received no study treatment ( figure 1 ) . patients were most commonly excluded from the study because they did not meet the participating criteria ( n = 255 ; 96.2% of those excluded ) . patients were enrolled at 55 sites across 11 countries ( argentina , brazil , china , egypt , india , mexico , republic of korea , romania , russia , spain and turkey ) . summary of patient disposition . * insulin lispro low mixture ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily ; basal insulin glargine once daily and prandial insulin lispro once daily . at baseline , patients had a mean ( s.d . ) age of 57.5 ( 9.5 ) years and mean ( s.d . ) overall , 99.8% of patients were receiving metformin and 5.9% were receiving pioglitazone at baseline ( one patient in the igl group received concomitant pioglitazone as the only oral medication ; all other patients receiving pioglitazone also received metformin ) . pre - existing conditions were reported by 81.3% of patients , most commonly vascular ( 62.2% ) , and metabolic and nutritional ( 51.3% ) disorders , and 81.7% of patients were receiving concomitant medications for conditions other than diabetes . the majority of patients in the igl group received insulin lispro before lunch ( 45.8% ) or dinner ( 35.0% ) . baseline patient characteristics for the intention - to - treat population bid , twice daily ; bmi , body mass index ; fpg , fasting plasma glucose , hba1c , glycosylated haemoglobin ; igl , insulin glargine once daily and insulin lispro once daily ; lm25 , lispro low mixture ; s.d . , standard deviation ; smbg , self - monitoring of blood glucose . * insulin lispro low mixture ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) ; basal insulin glargine once daily and prandial insulin lispro once daily . measured using the standard deviation of smbg results . the least squares ( ls ) mean ( 95% ci ) treatment difference at week 24 was 0.21 ( 0.38 , 0.04 ) , which showed non - inferiority between the two treatment strategies for the pp population . the corresponding ls mean ( 95% ci ) treatment difference for the itt population was 0.22 ( 0.39 , 0.05 ) indicating a statistically significant advantage for lm25 compared with igl ( p = 0.010 ) . the estimated change [ ls mean ( 95% ci ) ] in hba1c for the itt population after 24 weeks was 1.30 ( 1.44 , 1.16)% with lm25 and 1.08 ( 1.22 , 0.94)% with igl . there was no significant between - treatment difference shown in the secondary efficacy end points of change in hba1c after 12 weeks ; change in fpg at 12 or 24 weeks ; daily average blood glucose level , measured using smbg , at 4 ( data not shown ) , 12 and 24 weeks ; or glycaemic variability at 4 , 12 and 24 weeks ( table s2 ) . no difference between treatments was shown for the percentages of patients achieving hba1c targets of < 7.0 or 6.5% at 12 or 24 weeks ( 34.5% of the lm25 group vs. 30.0% of the igl group achieved hba1c < 7.0% at week 24 ; p = 0.359 ; other data not presented ) . however , some differences were observed between treatments when smbg results were compared at each measurement time : at 12 and 24 weeks , smbg levels were significantly lower in the igl group before breakfast ( p < 0.01 ) , and significantly lower in the lm25 group before lunch ( p < 0.01 ; table s2 ) . glycaemic control throughout the study for the intention - to - treat population receiving insulin lispro low mixture ( lm25 ; insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily or basal insulin glargine once daily and prandial insulin lispro once daily ( igl ) . ( a ) box plot of unadjusted hba1c levels , showing median values ( horizontal line ) and interquartile range ( shaded box ) , with minimum and maximum values ( whiskers ) and mean values ( diamond ) at baseline , and 12 and 24 weeks . ( b ) mean unadjusted 7-point self - monitoring of blood glucose levels at baseline and 24 weeks . * at 12 and 24 weeks , self - monitoring of blood glucose ( smbg ) levels estimated using a likelihood - based mixed model for repeated measure analysis were significantly lower in the igl group before breakfast ( p < 0.01 ) , and significantly lower in the lm25 group before lunch ( p < 0.01 ; estimated values are reported in table s2 ) . daily dose of lm25 was 53.1 ( 24.6 ) iu and total mean ( s.d . ) dose of igl was 50.8 ( 22.0 ) iu ( p = 0.409 ) . respective doses of basal insulin were 39.8 ( 18.5 ) iu and 37.4 ( 18.8 ) iu ( p = 0.102 ) , and respective doses of prandial insulin were 13.3 ( 6.2 ) iu versus 13.5 ( 6.5 ) iu ( p = 0.488 ) . at least one teae was reported by 114 patients ( 48.3% ) in the lm25 group and 94 patients in the igl group ( 39.2% ; p = 0.052 ) , although only 9 ( 3.8% ) and 7 ( 2.9% ) patients , respectively , experienced events that were considered possibly related to the study treatments ( p = 0.621 ) . serious teaes were reported by 11 ( 4.7% ) and 8 ( 3.3% ) patients , respectively ( p = 0.492 ) . two patients in the lm25 group and one patient in the igl group discontinued the study because of adverse events . the percentages of patients experiencing at least one episode of overall , symptomatic , nocturnal or severe hypoglycaemia ( see table2 for definitions ) did not differ significantly between treatment groups ( p > 0.05 for all assessment periods ; table2 ) . similarly , using negative binomial models , the number of episodes of symptomatic ( p = 0.513 ) , nocturnal ( p = 0.810 ) and severe ( p = 0.787 ) hypoglycaemia per patient - year did not differ significantly between treatment groups . reported hypoglycaemia with insulin lispro low mixture ( lm25 ; insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily or basal insulin glargine once daily and prandial insulin lispro once daily ( igl ) in patients with type 2 diabetes documented symptomatic hypoglycaemia ( 3.9 mmol / l ) was defined as any event during which typical symptoms of hypoglycaemia are accompanied by a measured plasma glucose concentration 3.9 mmol / l . mmol / l was defined as any event not accompanied by typical symptoms of hypoglycaemia but with a measured plasma glucose concentration 3.9 severe hypoglycaemia was defined as any hypoglycaemic event in which the patient required the assistance of another person to actively administer carbohydrate , glucagon or other resuscitative actions ; the blood glucose concentration may not have been measured during the event , but neurologic recovery that was attributable to the restoration of a normal blood glucose concentration was considered as sufficient evidence that the event was induced by a low - plasma glucose concentration . the ls mean ( 95% ci ) body weight increase was 1.13 ( 0.75 , 1.52 ) kg with lm25 and 0.50 ( 0.11 , 0.89 ) kg with igl ( p = 0.018 ) . itsq domain and total scores , and pam - d21 questionnaires domain scores at last visit , and changes in these scores from baseline to last visit , showed no statistically significant differences between treatments . of the 743 patients screened for participating in the study , 476 were randomized to 24 weeks of treatment with lm25 ( n = 236 ) or igl ( n = 240 ) and received at least one dose of study drug ; an additional two patients were randomized to igl but received no study treatment ( figure 1 ) . patients were most commonly excluded from the study because they did not meet the participating criteria ( n = 255 ; 96.2% of those excluded ) . patients were enrolled at 55 sites across 11 countries ( argentina , brazil , china , egypt , india , mexico , republic of korea , romania , russia , spain and turkey ) . summary of patient disposition . * insulin lispro low mixture ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily ; basal insulin glargine once daily and prandial insulin lispro once daily . at baseline , patients had a mean ( s.d . ) age of 57.5 ( 9.5 ) years and mean ( s.d . ) overall , 99.8% of patients were receiving metformin and 5.9% were receiving pioglitazone at baseline ( one patient in the igl group received concomitant pioglitazone as the only oral medication ; all other patients receiving pioglitazone also received metformin ) . pre - existing conditions were reported by 81.3% of patients , most commonly vascular ( 62.2% ) , and metabolic and nutritional ( 51.3% ) disorders , and 81.7% of patients were receiving concomitant medications for conditions other than diabetes . the majority of patients in the igl group received insulin lispro before lunch ( 45.8% ) or dinner ( 35.0% ) . baseline patient characteristics for the intention - to - treat population bid , twice daily ; bmi , body mass index ; fpg , fasting plasma glucose , hba1c , glycosylated haemoglobin ; igl , insulin glargine once daily and insulin lispro once daily ; lm25 , lispro low mixture ; s.d . , standard deviation ; smbg , self - monitoring of blood glucose . * insulin lispro low mixture ( insulin lispro protamine suspension 75% and insulin lispro solution 25% ) ; basal insulin glargine once daily and prandial insulin lispro once daily . the least squares ( ls ) mean ( 95% ci ) treatment difference at week 24 was 0.21 ( 0.38 , 0.04 ) , which showed non - inferiority between the two treatment strategies for the pp population . the corresponding ls mean ( 95% ci ) treatment difference for the itt population was 0.22 ( 0.39 , 0.05 ) indicating a statistically significant advantage for lm25 compared with igl ( p = 0.010 ) . the estimated change [ ls mean ( 95% ci ) ] in hba1c for the itt population after 24 weeks was 1.30 ( 1.44 , 1.16)% with lm25 and 1.08 ( 1.22 , 0.94)% with igl . all secondary analyses were performed using the itt population . there was no significant between - treatment difference shown in the secondary efficacy end points of change in hba1c after 12 weeks ; change in fpg at 12 or 24 weeks ; daily average blood glucose level , measured using smbg , at 4 ( data not shown ) , 12 and 24 weeks ; or glycaemic variability at 4 , 12 and 24 weeks ( table s2 ) . no difference between treatments was shown for the percentages of patients achieving hba1c targets of < 7.0 or 6.5% at 12 or 24 weeks ( 34.5% of the lm25 group vs. 30.0% of the igl group achieved hba1c < 7.0% at week 24 ; p = 0.359 ; other data not presented ) . however , some differences were observed between treatments when smbg results were compared at each measurement time : at 12 and 24 weeks , smbg levels were significantly lower in the igl group before breakfast ( p < 0.01 ) , and significantly lower in the lm25 group before lunch ( p < 0.01 ; table s2 ) . glycaemic control throughout the study for the intention - to - treat population receiving insulin lispro low mixture ( lm25 ; insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily or basal insulin glargine once daily and prandial insulin lispro once daily ( igl ) . ( a ) box plot of unadjusted hba1c levels , showing median values ( horizontal line ) and interquartile range ( shaded box ) , with minimum and maximum values ( whiskers ) and mean values ( diamond ) at baseline , and 12 and 24 weeks . ( b ) mean unadjusted 7-point self - monitoring of blood glucose levels at baseline and 24 weeks . * at 12 and 24 weeks , self - monitoring of blood glucose ( smbg ) levels estimated using a likelihood - based mixed model for repeated measure analysis were significantly lower in the igl group before breakfast ( p < 0.01 ) , and significantly lower in the lm25 group before lunch ( p < 0.01 ; estimated values are reported in table s2 ) . daily dose of lm25 was 53.1 ( 24.6 ) iu and total mean ( s.d . ) respective doses of basal insulin were 39.8 ( 18.5 ) iu and 37.4 ( 18.8 ) iu ( p = 0.102 ) , and respective doses of prandial insulin were 13.3 ( 6.2 ) iu versus 13.5 ( 6.5 ) iu ( p = 0.488 ) . at least one teae was reported by 114 patients ( 48.3% ) in the lm25 group and 94 patients in the igl group ( 39.2% ; p = 0.052 ) , although only 9 ( 3.8% ) and 7 ( 2.9% ) patients , respectively , experienced events that were considered possibly related to the study treatments ( p = 0.621 ) . serious teaes were reported by 11 ( 4.7% ) and 8 ( 3.3% ) patients , respectively ( p = 0.492 ) . two patients in the lm25 group and one patient in the igl group discontinued the study because of adverse events . the percentages of patients experiencing at least one episode of overall , symptomatic , nocturnal or severe hypoglycaemia ( see table2 for definitions ) did not differ significantly between treatment groups ( p > 0.05 for all assessment periods ; table2 ) . similarly , using negative binomial models , the number of episodes of symptomatic ( p = 0.513 ) , nocturnal ( p = 0.810 ) and severe ( p = 0.787 ) hypoglycaemia per patient - year did not differ significantly between treatment groups . reported hypoglycaemia with insulin lispro low mixture ( lm25 ; insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily or basal insulin glargine once daily and prandial insulin lispro once daily ( igl ) in patients with type 2 diabetes documented symptomatic hypoglycaemia ( 3.9 mmol / l ) was defined as any event during which typical symptoms of hypoglycaemia are accompanied by a measured plasma glucose concentration 3.9 mmol / l . asymptomatic hypoglycaemia 3.9 mmol / l was defined as any event not accompanied by typical symptoms of hypoglycaemia but with a measured plasma glucose concentration 3.9 mmol / l . severe hypoglycaemia was defined as any hypoglycaemic event in which the patient required the assistance of another person to actively administer carbohydrate , glucagon or other resuscitative actions ; the blood glucose concentration may not have been measured during the event , but neurologic recovery that was attributable to the restoration of a normal blood glucose concentration was considered as sufficient evidence that the event was induced by a low - plasma glucose concentration . the ls mean ( 95% ci ) body weight increase was 1.13 ( 0.75 , 1.52 ) kg with lm25 and 0.50 ( 0.11 , 0.89 ) kg with igl ( p = 0.018 ) . itsq domain and total scores , and pam - d21 questionnaires domain scores at last visit , and changes in these scores from baseline to last visit , showed no statistically significant differences between treatments . to our knowledge , this is the first randomized study comparing these two insulin intensification strategies after basal insulin failure in a clearly defined population during a standard period of time . the published head - to - head data we identified typically involved the use of multiple prandial insulin doses 9,10,17 , in contrast with the single prandial dose used in the basal . however , riddle et al . studied three strategies to initiate and progress insulin therapy , and compared basal plus one prandial and basal plus up to three prandial injections with premixed insulin bid 11 . in this study , patients had inadequate glycaemic control , defined as baseline hba1c7.5% and a fpg concentration of 6.7 mmol / l ( or > 6.7 mmol / l if further titration of basal insulin glargine was not possible for safety reasons or previous recent measurements confirmed that the screening test results were not consistent with the patients clinical situation ) . collectively , these inclusion criteria ensured that enrolled patients had inadequate glycaemic control on their baseline treatment regimen , and required advancing insulin therapy that also targeted postprandial glycaemia . the improvement in hba1c was achieved without a clinically significant effect on fpg , suggesting that it was mainly the postprandial component of hyperglycaemia that was reduced . these results are consistent with other communications 7,18 , probably reflecting the fact that the basal insulin glargine regimen had already been optimized in these patients and the need was for additional prandial coverage . our study differs from others in that we did not include a run - in period to optimize insulin glargine , although it seems that we correctly identified patients who were already receiving optimized doses of basal insulin , as shown by the fpg concentration 6.7 mmol / l . this can be seen as a more pragmatic approach which is applicable in real life clinical practice . although data comparing bid insulin regimens are lacking , the non - inferiority of lm25 compared with igl in this study could be expected . the impact on postprandial glycaemia after breakfast and dinner with lm25 should show at least similar results to the addition of a single injection of insulin lispro with the main meal . despite the significant decrease in hba1c in both groups after 24 weeks , the percentages of patients attaining goals of < 7.0 or 6.5% were low , in agreement with other reports 3 , which might indicate the need for further treatment intensification or that patients entered the study with high baseline hba1c levels . we can not speculate on the potential results of a long - term follow - up , as our study was designed to compare two insulin intensification strategies as a first step after the initial insulin regimen had failed , with a duration that was similar to that of other studies of this type 810,19 . in this study , we did not observe significant differences between the two groups with regard to the total , basal or prandial insulin doses used . interestingly , no obvious differences seemed to exist in the split ( basal / prandial ) between the groups , although the prandial dose was divided into two for patients receiving lm25 , whereas there was only one prandial injection for the igl group . hypoglycaemia has typically been a concern when premixed insulin is considered as a treatment option . in this study , as opposed to that of riddle et al . 11 , we did not find any significant difference in the proportions of patients experiencing overall , symptomatic , asymptomatic or nocturnal hypoglycaemic episodes with lm25 and igl . there were only two patients in the lm25 group with severe hypoglycaemia , but neither of them had to be discontinued from the study . we consider that the mean observed changes in weight were not clinically relevant , and this may be related to the lack of observed differences in insulin dose at the end of the study . several factors require consideration when making the final decision regarding the best therapeutic option for an individual patient , such as patients lifestyle , extent of education on the disease , likely compliance with therapy and the available resources 2 . convenient and effective insulin intensification regimens are important as studies have shown that , despite a knowledge of glycaemic targets , insulin regimens used in clinical practice are often inadequate to achieve or maintain good control 20,21 . in this study , the lack of differences observed in responses to the questionnaires suggests that both regimens are likely to be similarly accepted as therapeutic options by patients with type 2 diabetes . however , that the number of daily injections was same in both groups , and that all patients were previously receiving insulin , may have accounted for the lack of differences observed in responses to the questionnaires . limitations of this study included the open - label design , dictated by the fact that the two regimens used insulin with different appearances , dosing requirements and injection devices . that the mealtime bolus was given with the same meal throughout the study and no flexibility in dose scheduling was allowed may also have been limitations ; however , we believe that this would not have had an impact on study results , as the bolus was given with the largest daily meal ( previously defined by glucose values and patients reports ) , irrespective of the country , diet or time of the day . the study was not powered to assess potential differences between the insulin regimens depending on the timing of the main meal , so any impact of this on glycaemic profile , variability or hypoglycaemia incidence may be further assessed in future studies . the study duration may be seen as a limitation , as long - term effects of these or further intensification strategies were not explored . however , the study was designed to determine patient outcomes after the first insulin intensification step only , and this duration enables comparability with the results of previous studies 810,19 . the heterogeneous nature of the patient population included in this study is both a strength and limitation . between - country differences may exist in clinical practice guidelines , prescribing practices and dietary habits , and the study was not powered to assess the potential differences between treatment arms in each country / region . in contrast , by conducting the study globally in 11 countries , patients of different ethnic origins were included , thereby improving the generalizability of results . further studies may be needed to elucidate the best regimen for any specific population / country . in patients with type 2 diabetes inadequately controlled on once - daily basal insulin glargine and metformin and/or pioglitazone , intensification with either lm25 or igl improved glycaemic control with similar tolerability and acceptability . the reduction in hba1c after 24 weeks was greater with lm25 than with igl . the results of our study support current guidelines , and add to the body of evidence supporting the use of both insulin regimens as an option for insulin intensification in patients inadequately controlled with a basal - only insulin regimen plus oral antihyperglycaemic medications . j. l. g. has received grants / research support from boehringer ingelheim , bristol - myers squibb , eli lilly and novo - nordisk , and served as a consultant or member of a scientific advisory panel / speakers bureau for boehringer ingelheim , bristol - myers squibb , eli lilly and novo - nordisk . f. j. t. has served on scientific advisory boards and received honoraria or consulting fees or grants / research support from astrazeneca , boehringer ingelheim , bristol - myers squibb , eli lilly , glaxosmithkline , hoffmann - la roche , merck serono , msd , novartis , novo - nordisk and sanofi f. j. t. , j. l. g. , a. o. , s. c. and a. r. involved in drafting the manuscript and have read and approved the final version . f. j. t. , j. l. g. and a. o. also contributed to patient enrollment . glycaemic efficacy variables after treatment with insulin lispro low mixture ( lm25 ; insulin lispro protamine suspension 75% and insulin lispro solution 25% ) twice daily or basal insulin glargine once daily and prandial insulin lispro once daily ( igl ) in patients with type 2 diabetes ; intention - to - treat population .
aimsto compare the efficacy and safety of two insulin intensification strategies in patients with type 2 diabetes inadequately controlled on basal insulin glargine with metformin and/or pioglitazone.methodsa multinational , randomized , open - label trial that compared insulin lispro low mixture ( lm25 ; n = 236 ) twice daily with a basal prandial regimen of insulin glargine once daily and insulin lispro once daily ( igl ; n = 240 ) over 24 weeks in patients with hba1c 7.510.5% and fasting plasma glucose 6.7 mmol / l . the primary objective was to assess non - inferiority [ per - protocol ( pp ) population ] , and then superiority [ intention - to - treat ( itt ) population ] , of lm25 versus igl according to change in hba1c after 24 weeks ( non - inferiority margin 0.4% , two - sided significance level 0.05).resultsestimated change [ least squares ( ls ) mean ( 95% ci ) ] in hba1c after 24 weeks : 1.30 ( 1.44 , 1.16)% with lm25 and 1.08 ( 1.22 , 0.94)% with igl . non - inferiority was shown [ ls mean ( 95% ci ) hba1c treatment difference 0.21 ( 0.38 , 0.04 ) ( pp population ) ] ; gated superiority assessment showed a statistically significant advantage for lm25 ( p = 0.010 ; itt population ) . mean blood glucose , glycaemic variability , overall tolerability and hypoglycaemic episodes per patient - year did not show significant differences between treatments during the study.conclusionsin patients with type 2 diabetes inadequately controlled on once - daily basal insulin glargine and metformin and/or pioglitazone , intensification with lm25 was superior to a basal prandial approach in terms of reduction in hba1c after 24 weeks and did not increase hypoglycaemia episodes .
a critical need within the biochemical and biomedical research sector is the identification of low - abundance biomarkers that are predictive of early - stage disease or that correlate with therapeutic outcome or toxicity.(1 ) while the interest in the potential and value of biomarkers has never been greater , the research investment in biomarker discovery and clinical validation has yielded a very poor return to date . this poor return is due in part to the low abundance of early disease biomarkers that exist at a concentration below the detection limit of biomarker discovery platforms . protein biomarker discovery and quantitation by mass spectrometry ( ms ) and multiple reaction monitoring ( mrm ) are powerful approaches but are severely limited in their practical application for complex clinical samples because of their low effective sensitivity.(3 ) the analyte detection sensitivity for ms or mrm applied directly to a complex body fluid is typically greater than 50 ng ml.(4 ) in contrast , the vast majority of diagnostic analytes measured in the clinical laboratory by immunoassay platforms fall in the range between 50 pg ml and 10 ng ml.(5 ) thus , the most important protein biomarkers , particularly those derived from early - stage disease,(6 ) are invisible to conventional ms or mrm.(7 ) ms and mrm lack practical sensitivity because of technical and physiological constraints . the volume of sample introduced into the ms is very small ( < 1 l ) containing only a small number of target analyte molecules and thereby limiting the detection sensitivity . in addition , low - abundance , low - molecular weight proteins and peptides are masked by billion - fold excess quantities of resident proteins such as immunoglobulin and albumin . the ms input sample is strictly limited in the maximum total protein ( < 50 g ) content , a value lower than the serum or plasma protein content in 1 l , the volume of the input sample for the mass spectrometer . consequently , increasing the sensitivity is not simply a matter of concentrating the sample because this will overwhelm the total protein capacity introduced into the ms . a further barrier to biomarker discovery is the lability and perishability of candidate biomarkers ex vivo following clinical sample collection . diagnostic proteins and peptides in body fluids are subject to rapid enzymatic degradation following collection.(8 ) in the present study we show that modified hydrogel nanoparticles can provide a means to overcome all of these technical and physiological barriers and significantly improve the sensitivity of detection , and the preservation , of candidate biomarkers in a single step . hydrogel nanoparticles have been extensively described in the literature as good candidate materials for drug delivery and in vivo imaging purposes.(13 ) in contrast to their application as drug delivery vehicles , we have proposed the use of hydrogel nanoparticles for sequestering rather than releasing target molecules . in this study , specific dye chemistries immobilized in the particle core possess extremely high affinity for select classes of proteins and peptides ( figure 1 ) . unwanted high - molecular weight proteins such as albumin and immunoglobulins are excluded from entering the particles because of the restrictive , effective pore size of the hydrogel that acts as a molecular sieve . albumin fragments are also an unwanted contaminant present in the blood.(20 ) to further exclude unwanted contaminating albumin fragments small enough to penetrate the shell , the shell contains a chemical species ( vinylsulfonic acid , vsa ) that selectively prevents entry of albumin - derived peptides of all sizes ( figure 1 ) , without hindering the capture of non - albumin proteins and peptides small enough to enter the particle . ( a ) schematic representation of core ( b ) porous nature of the hydrogel particle shell has an effective pore size that acts as a molecular sieve with a cutoff determined by the cross - link density . proteins small enough to enter the particle are captured by the high - affinity bait . the high affinity permits very rapid sequestration of target analytes and dissociation from carrier proteins . the shell contains a chemical species ( vinylsulfonic acid , vsa ) that selectively prevents entry of contaminating albumin - derived peptides of all sizes without hindering the capture of non - albumin proteins and peptides small enough to enter the particle . ( c ) nanoparticles can be produced in large quantities with uniform size distribution ( atomic force microscopy image ) . some classes of organic dyes ( indocyanine green,(21 ) cibacron blue f3ga,(22 ) coomassie blue,(23 ) triarylmethane dyes,(24 ) eosin dyes(25 ) ) have been used in the past as protein binding agents and inhibitors of protein protein interactions.(26 ) cibacron blue f3ga and related dyes are most extensively studied as ligands in affinity chromatography . a widely accepted mechanism that has been proposed to explain the high - affinity binding of cibacron blue f3ga and related dyes to proteins protein interaction depends mainly on hydrophobic interactions , whereas electrostatic forces contribute to the stability of interaction.(27 ) the dye binding site on the surface of the target protein is a nonpolar pocket surrounded by hydrophilic amino acid residues.(28 ) moreover , the protein binding sites are often located in areas overlapping with the binding sites of biological ligands with respect to other parts of the protein surface.(29 ) organic reactive dyes can insert aromatic rings into nonpolar hydrophobic pockets of the protein surface , while the flanking portions of the dye and protein molecules can rearrange , depending on energy constraints . since both active protein sites and dye molecules have limited conformational freedom , some specificity is achieved.(30 ) increasing the size of the dye molecule ring system can enhance the specificity.(28 ) for example , cibacron blue f3ga forms a strong bond with specific classes of enzymes ( dehydrogenases and kinases ) because the 1-amino-4-(4-aminophenylamino)-anthraquinone-2,3-disulfonic acid part of the dye fits well to a structural element of the enzyme called the dinucleotide binding fold.(31 ) in addition to high specific binding of some classes of proteins , cibacron blue f3ga also forms nonspecific complexes with additional proteins . this latter attribute is most likely due to the ability of the dye to act as weak cation exchanger through its sulfonic groups.(28 ) most of the bait dyes used in this work have never been used for affinity chromatography or protein capture in the past and were found to have high affinity for select classes of proteins ( see figure 2 ) . in fact it can be hypothesized , on the basis of the proposed mechanism of binding , that all ionic aromatic compounds , separate from cibacron blue f3ga and related dyes , should be capable of binding all classes of proteins and peptides that have a sufficiently large exposed hydrophobic region.(28 ) high - affinity chemical baits covalently incorporated into hydrogel nanoparticle cores or shells . abb , db3 , pr1 , ab48 , dy3 , ab1 , do3 , dy9 , r12 , tbo , pr , and ab2 have not been previously used for protein affinity chromatography . dye - functionalized nanoparticles can be introduced into whole blood at the time of collection ( figure 3 ) . in one step , in solution , and in minutes , the nanoparticle ( a ) affinities capture all the target analytes in the entire fluid phase ( plasma ) , ( b ) strip target analytes off of the carrier proteins , ( c ) protect the captured target protein from degradation , and ( d ) exclude all size classes of albumin - derived peptides . the buoyant , open - meshwork , spherical nanoporous particles ( 0.50.7 m diam ) remain as a colloid in suspension in the fluid phase and are in open exchange with the surrounding plasma . target molecules not excluded by the shell freely enter the hydrogel inner meshwork to be captured by the bait(s ) . the open - meshwork hydrogel particles are 95% occupied by the surrounding solution phase and do not have the disadvantages of boundary layers , pressure gradients , and volume requirements of affinity bead columns . since the nanoparticles do not settle by gravity , the plasma containing the hydrogel particles can be separated from the cellular elements of the blood by low - speed centrifugation ( figure 3 ) . one step , in solution affinity capture and separation of low - abundance target biomarkers in whole blood ( plasma ) . shell hydrogel particles are introduced into the vacutainer collection tube and are allowed to incubate with blood for 15 min . low - speed centrifugation is used to pellet the blood cells , while buoyant , open - meshwork hydrogel particles remain in suspension in the plasma . proteins are eluted from the nanoparticle pellet and analyzed by mass spectrometry ( ms ) , multiple reaction monitoring ( mrm ) , or any other analytical platform ( e.g. , immunoassay ) . hydrogel nanoparticles , poly(n - isopropylacrylamide - co - acrylic acid ) ( poly(nipam - co - aac ) ) , were synthesized by precipitation polymerization(32 ) and covalently functionalized with amino - containing dyes using amidation chemistry.(33 ) zero - length cross - linking amidation strategies were performed in water or organic solvents on the basis of the hydrophilic / hydrophobic properties of the dyes . amine - containing hydrogel nanoparticles , poly(nipam - co - aa ) , were created by precipitation polymerization and covalently functionalized with cibacron blue f3ga ( cb ) dye by nucleophilic substitution of the amine groups in the nanoparticles and a chloride atom in the cb dye . an outer shell containing vinylsulfonic acid ( vsa ) copolymer was created on the dye - functionalized particles by a second polymerization reaction as described below . n - isopropylacrylamide ( nipam , sigma - aldrich , 4.750 g , 0.042 mol ) , n , n-methylene bisacrylamide ( bis sigma - aldrich , 0.400 g , 0.0026 mol ) , and acrylic acid ( aac , sigma - aldrich , 0.525 l , 0.0073 mol ) were dissolved in 500 ml of h2o , filtered using a nitrocellulose membrane disk filter ( 0.45 m pore size , millipore ) , and transferred in a three - neck round - bottom flask . the solution was purged with nitrogen for 1 h at room temperature , at medium stirring rate , and then heated to 70 c . potassium persulfate ( kps , sigma - aldrich , 0.276 g , 0.001 mol ) was dissolved in 5 ml of h2o and was added to the solution to initiate the polymerization . the reaction was maintained at 70 c under nitrogen for 6 h. particles were washed five times by centrifugation ( 19,000 rpm , 50 min , 25 c ) to eliminate the unreacted monomer and then resuspended in 600 ml of h2o . dye molecules containing an amine group were coupled by condensation to the carboxylic group of acrylic acid present in the poly(nipam - co - aac ) particles . the reaction was conducted in a water - based solvent for the following dyes : acid blue 22 ( ab2 , sigma ) , remazol brilliant blue r ( rbb , sigma ) , acid black 1 ( ab1 , sigma ) , brilliant blue r250 ( bb , fisher ) , toluidine blue o ( tbo , j.t . baker ) , rhodamine 123 ( r12 , sigma ) , disperse yellow 3 ( dy3 , fluka ) , and disperse blue 3 ( db3 , sigma ) . briefly , 10 ml of the poly(nipam - co - aac ) particle suspension was centrifuged ( 16.1 rcf , 25 c , 15 min ) , the supernatant was discarded , and the particle pellet was resuspended in 10 ml of 0.2 m nah2po4 ph 5 . the particle suspension was transferred in a three - neck round flask , and to this were added 1 ml of 1% sds ( w / v ) , 824 mg of n-(3 dimethylaminopropyl)-n-ethyl carbodiimide hydrochloride ( edc ; fluka analitical ) , and 612 mg of solid n - hydroxy succinimide ( nhs ; sigma - aldrich ) . then , the suspension was centrifuged ( 19,000 rpm , 50 min , 25 c ) , the supernatant was discarded , and the particle pellet was resuspended in 20 ml of 0.2 m na2hpo4 ph > 8 . after this activation step , an appropriate amount of dye ( molar ratio of dye / acrylic acid 10:1 ) was dissolved in 180 ml of 0.2 m na2hpo4 buffer ph > 8 , that was filtered by 0.22 m ca filter ( corning ) and added to the activated particles ; the reaction was held at room temperature at medium stirring rate overnight . the number of acrylic acid moles in 10 ml of particle suspension was 0.0000121 . in order to eliminate the unreacted dye , poly(nipam / dye ) particles were washed five times with water by centrifugation ( 19,000 rpm , 50 min , 25 c ) . the amidation reaction was conducted by phosponium / uranium activation in dimethylformamide ( dmf ) for the following dyes : disperse orange 3 ( do3 , sigma ) , pararosaniline base ( pr , sigma ) , disperse yellow 9 ( dy9 , sigma ) , pigment red 177 ( pr1 , international laboratory u.s.a . ) , and acid black 48 ( ab4 , acros organic ) . briefly , 10 ml of poly(nipam - co - aac ) nanoparticles ( acrylic acid moles = 0.0000121 ) was freeze - dried and resuspended in 10 ml of dmf ( sigma - aldrich ) in a three - neck round flask . the particle suspension was purged with nitrogen for 15 min at room temperature under medium stirring . then , 68.84 mg of o - benzotriazole - n , n , n,n-tetramethyl - uronium - hexafluorophosphate ( hbtu , peptides international ) , 24.52 mg of n - hydroxybenzotriazole ( hobt , gl biochem ) , and 40 l of n - methylmorpholine ( nmm ; fluka biochemika ) were added to the particle suspension and reacted at room temperature at medium stirring rate for 5 min under a nitrogen atmosphere . after 5 min , an appropriate amount of dye ( molar ratio of dye / aac = 10:1 ) dissolved in dmf was added to the three - neck round flask . the reaction was maintained under nitrogen atmosphere for 6 h. poly(nipam / dye ) particles were washed five times by centrifugation ( 19,000 rpm , 50 min , 25 c ) with decreasing concentrations of dmf ( 90% , 75% , 50% , 25% , and 5% ) in water in order to eliminate unreacted dye and to favor particle rehydration . nipam ( 0.475 g , 0.0042 mol ) , bis ( 0.040 g , 0.026 mol ) , and vinyl sulfonic acid ( vsa ; sigma - aldrich , 0.80.4 l , 0.00073 mol ) were dissolved in 60 ml of h2o , filtered using a nitrocellulose membrane disk filter ( 0.45 m pore size ) , and transferred into a three - neck round - bottom flask . the solution was purged with nitrogen for 1 h at room temperature , at medium stir rate , and then heated to 70 c . kps ( 0.028 g , 0.0001 mol ) was dissolved in 2.5 ml of h2o and was added to the solution to initiate the polymerization . the reaction was maintained at 70 c under nitrogen for 6 h. the particles were washed five times in water by centrifugation ( 19,000 rpm , 50 min , 25 c ) and then resuspended in 60 ml of h2o . nipam ( 0.89 g , 7.83 mmol ) and bis ( 0.042 g , 0.27 mmol ) were dissolved in 30 ml of water and then passed through a 0.2 m nylon membrane filter . the solution was purged with nitrogen for 15 min at room temperature with a medium stirring rate . aa ( sigma , 0.051 g , 0.90 mmol ) was added ; the solution was purged with nitrogen for 15 min and then heated to 70 c . kps ( 0.0070 g , 0.025 mmol ) was dissolved in 1.0 ml of water and was added to the solution to initiate the polymerization . the reaction was maintained at 70 c under nitrogen for 3 h. the reaction was subsequently allowed to cool to room temperature and stirred overnight . particles were washed five times by centrifugation ( 19,000 rpm , 50 min , 25 c ) with water in order to eliminate the unreacted monomer and then resuspended in 30 ml of h2o . in order to incorporate cibacron blue f3ga ( cb ) dye , cb ( 0.76 g , 0.90 mmol ) was dissolved in 10 ml of 0.1 m aqueous sodium carbonate . the poly(nipam - co - aa ) particle suspension ( 10 ml volume ) was purged with nitrogen for 15 min with a medium stirring rate in a three - neck round - bottom flask . solid sodium carbonate ( 0.106 g , 1.0 mmol ) was added to the suspension . the suspension the cb solution was then added to the poly(nipam - co - aa ) particle suspension , and the combined reaction mixture was then stirred at room temperature under nitrogen for 48 h. the resulting poly(nipam / cb ) particles were harvested and washed using centrifugation ( 19,000 rpm , 50 min , 25 c ) . in order to build a vsa shell on the poly(nipam / cb ) core , 20 ml of poly(nipam / cb ) particle suspension was heated at 70 c and purged with nitrogen for 1 h. nipam ( 0.156 g , 1.38 mmol ) , bis ( 0.013 g , 0.084 mmol ) , vsa ( 26 ul , 0.334 mmol ) , and kps ( 0.092 g , 0.328 mmol ) were dissolved in 20 ml of water and passed through a 0.2 m nylon membrane filter . three milliliters of this solution was added to the poly(nipam / cb ) particle suspension , and the remaining 17 ml of solution was added in aliquots of 3 ml every 5 min . poly(nipam - co - vsa ) shell particles were washed five times in water by centrifugation ( 19,000 rpm , 50 min , 25 c ) . the temperature dependence of particle size was determined via photon correlation spectroscopy ( submicrometer particle size analyzer , beckman coulter ) . the measurement of particle diameter was performed using water as a diluent ( refractive index ( ri ) = 1.333 , diluent viscosity = 0.890 cp ) . the test angle was 90. average values were calculated for three measurements using a 200 s integration time , and the solutions were allowed to thermally equilibrate for 10 min before each set of measurements . einstein relationship.(34 ) the particles were further characterized by atomic force microscopy ( afm ) using an nscriptor dpn system ( nanoink ) . particles in suspension ( 1 g / ml ) were deposited on freshly cleaved mica in a humid atmosphere for 15 min and dried under nitrogen before measurement . images were acquired under ac mode using a silicon tip with a typical resonance frequency of 300 khz and a radius smaller than 10 nm . incorporation of dye in the particles was assessed by weighing the dry particles before and after dye coupling . aliquots of 500 l of serum and edta plasma were diluted 1:2 with 50 mm trishcl ph 7 , mixed with 500 l of hydrogel particles functionalized with the molecular baits described above , and incubated for 15 min at room temperature . particles were separated by centrifugation ( 16.1 rcf , 25 c , 10 min ) and washed with buffers specific for the molecular baits listed in table 1 . the particle pellet was incubated for 15 min at room temperature with 600 l of elution buffer specific for the molecular baits listed in table 1 and then centrifuged ( 16.1 rcf , 25 c , 10 min ) . the elution step was repeated twice , and the eluates were combined in the same vial and then dried in a vacuum concentrator . blood was collected in edta - containing blood collection tubes ( vacutainer edta tubes , becton dickinson ) . aliquots of 1 ml of blood were diluted 1:2 with physiologic solution ( 0.9% nacl ) . one milliliter of hydrogel particle suspension was added to the blood and incubated for 15 min . in order to separate the blood cells , the blood particle mixture was centrifuged ( 200 rcf , 25 c , 10 min ) , and the plasma supernatant was saved . the plasma was then centrifuged at higher speed ( 16.1 rcf , 25 c , 10 min ) , the supernatant was discarded , and the particle pellet was washed and eluted as previously described , using appropriate buffers for each type of particle ( table 1 ) . proteins ( human growth hormone ( lilly ) , hepatocyte growth factor ( antigenix america inc . ) , fibroblast growth factor 22 ( cell sciences ) , vascular endothelial growth factor ( cell signaling technologies ) , eotaxin 2 ( abd serotec ) , igf binding protein 7 ( igfbp7 ) ( preprotech ) , interleukin-6 ( abd serotech ) , chemokine ( c c motif ) ligand 22 ( ccl22 ) ( r&d systems ) , survivin ( novus biologicals ) , b - cell lymphoma 2 ( bcl-2 ) ( fisher scientific ) , osteopontin ( novus biologicals ) , troponin - i ( abd serotec ) , and kallikrein-6 ( arp american research products ) ) were each dissolved in 25 l of 50 mm trishcl ph 7 at a concentration of 0.05 g/l , mixed with 25 l of particle suspension , and incubated for 15 min at room temperature . particles were separated by centrifugation ( 16.1 rcf , 25 c , 10 min ) , washed with water ( 16.1 rcf , 25 c , 10 min ) , and analyzed by sds page . interleukin-8 ( il8 ) was dissolved in synthetic sweat ( corkig ) at a concentration of 0.05 g/l , and the ph of the solution was adjusted to 8 with 1 m naoh . trypsin ( promega ) was added to the il8 solution at a 100:1 protein to protease w / w ratio . poly(nipam / dy9 ) particles were added to the il8 , trypsin - containing solution and the mixture left to incubate for 3 h at 37 c . aliquots of 100 l of poly(nipam - co - vsa ) particles were mixed with 2 g of trypsin - digested human serum albumin ( michrom bioresources ) and allowed to incubate for 30 min . the eluate was dried in a speedvac and injected into an ltq - orbitrap mass spectrometer ( thermofisher ) . isoelectric points and molecular weights of trypsin - generated peptides derived from albumin were calculated online at http://isoelectric.ovh.org/. poly(nipam / db3 ) and poly(nipam / rbb ) particles were mixed with a solution of troponin - i ( in 50 mm tris hcl ph 7 ) , incubated for 15 min at room temperature and then were separated by centrifugation ( 16.1 rcf , 25 c , 10 min ) . the concentration of troponin - i was measured using the immulite 1000 troponin - i system ( siemens healthcare diagnostics ) . particle eluates were lyophilized overnight , reconstituted in immulite sample diluent ( siemens healthcare diagnostics ) , and assayed according to the manufacturer s instructions . the dissociation constant between the particles and troponin - i was estimated by solving the ordinary differential equations derived from the dissociation equilibrium reaction of bound versus free analyte using the r software , desolve package.(35 ) eluates from the particles were analyzed by mass spectrometry . proteins were dried in a speedvac and were reconstituted in 8 m urea , reduced by 10 mm dtt , alkylated by 50 mm iodoacetamide , and digested by trypsin ( promega ) at 37 c overnight . tryptic peptides were further purified by zip - tip ( millipore ) and analyzed by reversed - phase liquid chromatography nanospray tandem mass spectrometry ( lc ms / ms ) using an ltq - orbitrap mass spectrometer ( thermofisher ) . after sample injection by autosampler , the c18 column ( 0.2 mm 50 mm , michrom bioresources , inc . ) was washed for 2 min with mobile phase a ( 0.1% formic acid ) , and peptides were eluted using a linear gradient of 0% mobile phase b ( 0.1% formic acid , 80% acetonitrile ) to 50% mobile phase b in 90 min at 500 nl / min , then to 100% mobile phase b for an additional 5 min . the ltq mass spectrometer was operated in a data - dependent mode in which each full ms scan was followed by five ms / ms scans where the five most abundant molecular ions were dynamically selected for collision - induced dissociation ( cid ) using a normalized collision energy of 35% . tandem mass spectra were searched against the ncbi human database with sequest using tryptic cleavage constraints . high - confidence peptide identifications were obtained by applying the following filter criteria to the search results : xcorr versus charge 1.9 , 2.2 , 3.5 for 1 , 2 , 3 ions ; cn > 0.1 ; probability of randomized identification 0.01 . human urine was centrifuged ( 10 min , 1000 rpm , 4 c ) in order to remove the cellular debris , and the specific gravity was recorded . human growth hormone ( hgh ) was spiked in human urine at a concentration of 50 ng / ml . aliquots of 1 ml of urine containing hgh were incubated with 500 l of remazol brilliant blue r particles for 30 min at room temperature . the particles were separated by centrifugation ( 16.1 rcf , 10 min , 25 c ) and washed with water ( 16.1 rcf , 10 min , 25 c ) . proteins captured by the particles were eluted with 500 l of elution buffer ( 70% acetonitrile , 10% ammonium hydroxide ) and dried in a vacuum concentrator . fifty microliters of urine solution and particle eluate were prepared for mrm analyses by : ( 1 ) reduction with 10 mm dithiothreitol in 1 m urea/50 mm ammonium bicarbonate ( nh4hco3 ) at room temperate for 60 min , ( 2 ) alkylation with 50 mm iodoacetamide at room temperature in the dark for 20 min , ( 3 ) overnight enzymatic digestion with 0.5 g of sequencing grade trypsin in 50 mm ammonium bicarbonate , ph 8 at 37 c . digestions were quenched with the addition of 2 l of concentrated trifluoroacetic acid and then dried in a vacuum concentrator . samples were then reconstituted with 50 l of 200 g / ml glucagon ( sigma - aldrich , st . sample digests were analyzed with a tsq quantum ultra triple quadrupole mass spectrometer ( thermofisher scientific ) . samples were loaded onto a 1 mm 150 mm hypersil gold 3 m particle c-18 reversed phase column ( thermofisher scientific ) with an accela autosampler ( thermofisher scientific ) fitted with a 10 l sample loop . the lc pump was an accela ( thermofisher scientific ) operated at 160 l / min , and effluent was directed into the mass spectrometer using an ionmax source . after sample injection , the column was washed for 5 min with 98% mobile phase a ( 0.1% formic acid ) , and peptides were eluted using a linear gradient of 2% mobile phase b ( 0.1% formic acid in acetonitrile ) to 50% mobile phase b in 20 min . the instrument divert valve was switched to waste before and after the peptides eluted in order to keep the source free of excess salts and debris . the scan width was 0.002 m / z , and dwell time was 15 ms . collision energies ( ce ) were calculated according to the formula : 0.034 precursor ion mass m / z + 3.314 . peptide fptiplsr ( 465.77 ) from hgh , with transitions 392.24 , 472.29 , 585.37 , 686.42 , and 783.47 were chosen for mrm analyses on the basis of previous work with tryptic digests of hgh standards . mrm results were loaded into the pinpoint program , version 1.0 ( thermofisher scientific ) for data analysis . data were divided into two groups : ( 1 ) nanoparticle - enriched urine sample ( triplicate analyses ) and ( 2 ) non - nanoparticle urine sample ( triplicate analyses ) . peak width tolerance was 30 s , the alignment error tolerance was 0.5 min , and the minimum signal threshold was 100 . the fragment ion peak areas for all transitions were summed and the average areas calculated using the triplicate analyses for the nanoparticle and non - nanoparticle samples . we identified a series of small novel organic dye molecules possessing extremely high protein - binding affinity ( kd < 10 m , figure 2 ) . these dyes act as molecular baits by binding proteins and peptides , likely through a combination of hydrophobic and electrostatic forces , by inserting their aromatic rings into hydrophobic pockets present on the protein surfaces.(30 ) we immobilized the baits by binding amino groups in the dyes to carboxylic groups in the particles ( figure 4 shows the changes in the hydrodynamic volume after dye functionalization ) . zero - length cross - linking amidation strategies were used and optimized on the basis of hydrophilic / hydrophobic dye properties.(33 ) light - scattering analysis of particles functionalized with different chemical baits . as shown in figure 5 when hydrogel nanoparticles containing one of 17 different classes of organic chemistries were screened against a panel of 13 known low - abundance diagnostically relevant biomarker proteins , strong bait selectivity for specific proteins or classes of proteins was noted . for example , hepatocyte growth factor ( hgf ) was captured by poly(nipam / dy3 ) particles and excluded by poly(nipam / db3 ) particles ( see also figures 6 and 7 ) . nanoparticles functionalized with 17 different molecular baits ( poly(nipam / abb ) , poly(nipam / db3 ) , poly(nipam / rbb ) , poly(nipam / pr1 ) , poly(nipam / ab4 ) , poly(nipam - co - vsa ) , poly(nipam / dy3 ) , poly(nipam / ab1 ) , poly(nipam / do3 ) , poly(nipam / dy9 ) , poly(nipam / r12 ) , poly(nipam / tbo ) , poly(nipam - co - aac ) , poly(nipam / pr ) , poly(nipam / bb ) , poly(nipam / ab2 ) , poly(nipam / cb ) ) show preferential high affinities for 13 specific low - abundance protein analytes as indicated by the color of the cell . the expected concentrations of the indicated proteins in serum / plasma were derived from the literature .. heat map representation of serum proteins captured by nanoparticles functionalized with different molecular baits ( poly(nipam / rbb ) , poly(nipam / cb ) , poly(nipam - co - vsa ) , poly(nipam / dy9 ) , poly(nipam / do3 ) , poly(nipam / dy3 ) , poly(nipam / pr1 ) , poly(nipam / ab4 ) , poly(nipam / bb ) , poly(nipam - co - aac ) , poly(nipam / ab1 ) , poly(nipam / abb ) . dyes incorporated in the particles are shown on the x axis , proteins identified with ms analysis of serum preprocessed with the particles are shown in the y axis . each dye bait is represented by a different color . poly(nipam / dy9 ) and poly(nipam / do3 ) particles capture unique groups of proteins from serum . addition of two types of hydrogel particles complement each other by combining their respective protein repertoire . we determined that the affinity of dye protein binding reactions was dependent on the type of reactive group substitution ( figure 8a ) . troponin - i , a biological marker for cardiac muscle tissue injury , is present in the blood at low concentrations ( 5 pg / ml),(47 ) below the detection limit of routine mass spectrometry . remazol brilliant blue r ( rbb)-functionalized particles sequestered more than 99.9% of troponin - i present in solution ( estimated dissociation constant kd < 1.1 10 m ) so that the troponin - i concentration in the supernatant outside the particle at equilibrium ( < 10 min ) was reduced below the detection limit ( 50 pg / ml ) of the immulite clinical immunoassay . modification in the chemical group substitution ( keeping the bait molecules equimolar ) reduced the capture efficiency due to a 10-fold reduction in the kd ( 2.4 10 m , figure 8a ) . ( a ) bait chemical structure determines affinity and can capture or exclude select proteins . poly(nipam / db3 ) and poly(nipam / rbb ) nanoparticles were incubated with troponin - i . db3 and rbb are anthraquinone rings that differ in their side groups . rbb depleted greater than 99.9% ( estimated dissociation constant kd < 10 m ) while db3 depleted 83% ( kd = 10 m ) , at equilibrium ( < 10 min ) . interleukin-8 ( il8 ) diluted in artificial sweat was incubated with excess trypsin at 37 c in the presence or absence of poly(nipam / dy9 ) particles . sds page analysis revealed that in the absence of poly(nipam / dy9 ) particles , the il8 band disappeared , and a fainter band at lower molecular weight appeared , indicating the presence of a degradation product ( lane 2 ) . in the presence of poly(nipam / dy9 ) particles , il8 is fully protected from trypsin degradation ( lane 5 ) . incubation of il8 with sweat alone at 37 c caused the intact il8 band to disappear ( lane 3 ) , while poly(nipam / dy9 ) particles yielded a full density band for the intact protein ( lane 4 ) , suggesting that il8 was protected from degradation at 37 c by the nanoparticles . the advantage of such high - affinity binding dye chemistries is several fold : ( a ) high on / off rate ratio ( estimated 9.2 10 m for poly(nipam / rbb ) nanoparticles and 4.2 10 m for poly(nipam / db3 ) ) nanoparticles achieves rapid complete capture of all low - abundance ligands , ( b ) high - affinity binding can protect captured proteins from degradation(19 ) ( figure 8b ) , and ( c ) targeted low - molecular weight proteins bound to abundant carrier proteins in biological fluid can be competed away by the high - affinity bait and stripped away from the carrier protein.(19 ) as shown in figure 9 , when poly(nipam / rbb ) nanoparticles are introduced into a 1 ml sample containing 50 ng / ml of hgh , all of the hgh ( 50 ng ) is sequestered in the nanoparticles in one step and can be eluted in 50 l , yielding a 20-fold increase in analyte concentration to meet the mrm limits of sensitivity . poly(nipam / rb ) particles effectively increase the detection sensitivity for mrm analysis of human growth hormone ( hgh ) spiked in human urine . our results suggest that particles containing organic structures , such as vinyl sulfonic acid ( vsa ) , excluded ( 1 ) full - length albumin by size sieving and ( 2 ) peptides derived from albumin that are below the size cutoff of the effective pore size of the particle by selective repulsion . vsa - containing particles excluded albumin but still retained affinity for wide classes of other proteins and peptides . these findings are consistent with previous literature in which vsa - containing polymers were selectively able to prevent albumin absorption(49 ) but retained the ability to form complexes with proteins such as trypsin.(50 ) poly(nipam - co - vsa ) particles completely excluded full - length bovine serum albumin ( bsa ) while sequestering interleukin-6 from solution ( figure 10a ) . in a separate experiment , fragment peptides derived from trypsinization of albumin were incubated with poly(nipam - co - vsa ) particles . albumin - derived peptides below the size exclusion cutoff for the poly(nipam - co - vsa ) particles ( figure 5 ) were consistently excluded by the poly(nipam - co - vsa ) particles at a variety of ph values ( table 2 ) . these same particles that excluded low - molecular weight albumin fragments continued to sequester a broad variety of non - albumin peptides below the size exclusion cutoff of the poly(nipam - co - vsa ) particles ( figure 5 and supporting information table 1 ) . the mechanism by which poly(nipam - co - vsa ) particles repel albumin - derived peptides is not completely known and can not be explained by simple charge effects . in fact , albumin peptides below their calculated isoelectric point at ph 8 ( therefore carrying net positive charges ) did not bind to the highly ionized sulfonate groups . excluded peptides derived from albumin may not display the correct pattern of hydrophobic residues and charge distribution that matches the vsa - functionalized nanoparticle landscape . exclusion of classes of peptides by specific bait chemistries is a new principle in peptide separation . ( a ) poly(nipam - co - vsa ) particles excluded albumin while capturing interleukin 6 ( il6 ) . sds page analysis shows that all the albumin is left in the supernatant ( lane 2 ) while all the il6 is captured by the particles ( lane 3 ) . for comparison purposes , poly(nipam / cb ) in this case all il6 was captured ( lane 4 ) , but albumin was also detectable in the particles ( lane 5 ) because cb binds to albumin species . ( b ) the addition of a vinylsulfonic acid ( vsa)-functionalized shell to cibacron blue f3ga ( cb)-containing particles decreased the number of unwanted albumin peptide hits ( upper ) while at the same time increased the frequency of ms hits for target proteins ( e.g. , apo - ci ) ( lower ) ( supporting information table 4 ) . ( c ) poly(nipam / cb ) core(nipam - co - vsa ) shell particles greatly enhance the low - molecular weight protein concentration in whole blood ( lane 3 ) while fully excluding high - molecular weight abundant proteins such as albumin and immunoglobulins . in order to maximize the performance of the particles cb is known to bind albumin and albumin peptides ( along with a broad number of other proteins ) with high affinity . albumin peptide hits present in the particle eluate dramatically decreased if the cb bait in the core was separated from the plasma by the vsa shell ( figure 10b ) . since the molecular weight cutoff of the particles is 30 kda ( figure 10c ) and albumin fragments are normally present in the blood,(20 ) albumin species excluded by the particles are not only full - length molecules but also albumin fragments below 30 kda . poly(nipam - co - vsa ) particles excluded all albumin tryptic peptides at ph 8 . the addition of the vsa shell did not hinder the capture of other target analytes ( e.g. , apo ci , figure 10b ) . poly(nipam - co - vsa ) shell particles allowed for the sequencing of low - abundance , low - molecular weight plasma proteins ( table 3 ) that were not identified without the dual function nanoparticles . poly(nipam - co - vsa ) shell particles is shown in supporting information table 3 . since the molecular weight cutoff of poly(nipam / cb ) core poly(nipam - co - vsa ) shell particles is 30 kda we can state that 65% of captured proteins was represented in serum as fragments of the parent molecule.(51 ) we investigated the power and extent of protein and peptide enrichment for low - molecular weight , low - abundance proteins in a pool of healthy donor sera or plasma . ms / ms analysis by 4 orders of magnitude as demonstrated by examples of more than 200 low - abundance proteins specified in supporting information table 3 . conventional ms / ms analysis ( 90 min linear gradient at 500 nl / min , data - dependent mode , xcorr versus charge 1.9 , 2.2 , 3.5 for 1 , 2 , 3 ions ; cn > 0.1 ; probability of randomized identification 0.01 ) was used to compare the same serum set before and after nanoparticle processing . a large number of diagnostic low - molecular weight proteins and peptides whose concentration in blood is less than 10 ng / ml were identified by ms after poly(nipam / cb ) core moreover , an additional set of peptides belonging to low - abundance proteins were identified that were not previously found by ms analysis in whole blood , serum , or edta plasma , nor included in the peptideatlas database , the most comprehensive high confidence collection of ms identified proteins ( supporting information figures 1 and 2 and tables 1 and 2 ) . compared to the samples processed without nanoparticle harvesting , the ability of the nanoparticles to concentrate the low - abundance peptidome from whole blood was evident by sds page analysis ( figure 10c ) . the presence of the vsa shell greatly increases the number and dynamic range of proteins sequestered for discovery . thus , the nanoparticle technology described herein can be used for biomarker discovery in whole blood as a single preprocessing step . the nanoparticles will remain in the plasma following low - speed centrifugation to remove the cellular content ( figure 3 ) . in the future it will be important to evaluate the effect of potential interfering substances present in whole blood and plasma such as lipemia , bilirubinemia , and hemolysis . harvesting hydrogel nanoparticles possess important features , as we have demonstrated in previous studies using poly(nipam - co - aac ) and poly(nipam / cb ) : ( a ) use of the nanoparticles amplifies the effective sensitivity ( by concentrating the sample analyte into a smaller volume and excluding unwanted contaminants ) while maintaining the linearity of quantitative immunoassays;(16 ) ( b ) nanoparticle preprocessing generated high yields and high precision when applied to clinical grade biomarker studies;(17 ) ( c ) if a quantitative immunoassay is previously established , nanoparticle preprocessing is highly suitable for verification and validation of ms - identified candidate biomarkers.(18 ) the new type of hydrogel core shell nanoparticles ( poly(nipam / cb ) poly(nipam - co - vsa ) shell particles ) described herein achieved a 10,000 fold effective amplification of the low - abundance , low - molecular weight proteins and peptides that could be identified by ms as demonstrated by examples of more than 200 low - abundance proteins ( supporting information table 3 ; figure 11 ) . the result was the identification of a large series of novel candidate proteins not previously identified with mass spectrometry analysis in human serum ( table 3 , supporting information tables 1 and 2 and figure 1 ) . while these candidate protein spectra have been manually validated ( supporting information figure 2 ) and high stringency ms cutoff filters have been applied ( experimental section ) , a limitation of the current study is that completely new antibodies and quantitative immunoassays will have to be developed to independently verify these proteins by immunochemical methods in serum . shell hydrogel nanoparticles covalently functionalized with combinations of novel organic dye baits offer a one - step technology for biomarker harvesting , concentration , and stabilization , with simultaneous exclusion of unwanted abundant molecules . the nanoparticles exhibit three physicochemical properties : ( 1 ) specific novel dye chemistries immobilized in the particle core possess extremely high affinity for select classes of proteins and peptides ; ( 2 ) a chemical species present in the shell , vsa , selectively excludes fragments and peptides derived from albumin , and ( 3 ) the outer shell of the particle performs physical size sieving , excluding large unwanted abundant molecules such as immunoglobulins . dual - function hydrogel nanoparticles can dramatically magnify small protein and peptide identification and measurement from complex biological solutions , using any current or future analytical platform , while stabilizing the analytes against degradation . the fluid samples used in the present sample were blood , urine , and sweat . we are currently incorporating nanoparticles into a skin patch that continuously harvests , concentrates , and preserves analytes present in the skin transudate for proteomic analysis . shell nanoparticles are being used for biomarker discovery in lymph , saliva , and cerebrospinal fluid .
many low - abundance biomarkers for early detection of cancer and other diseases are invisible to mass spectrometry because they exist in body fluids in very low concentrations , are masked by high - abundance proteins such as albumin and immunoglobulins , and are very labile . to overcome these barriers , we created porous , buoyant , core shell hydrogel nanoparticles containing novel high affinity reactive chemical baits for protein and peptide harvesting , concentration , and preservation in body fluids . poly(n - isopropylacrylamide - co - acrylic acid ) nanoparticles were functionalized with amino - containing dyes via zero - length cross - linking amidation reactions . nanoparticles functionalized in the core with 17 different ( 12 chemically novel ) molecular baits showed preferential high affinities ( kd < 1011 m ) for specific low - abundance protein analytes . a poly(n - isopropylacrylamide - co - vinylsulfonic acid ) shell was added to the core particles . this shell chemistry selectively prevented unwanted entry of all size peptides derived from albumin without hindering the penetration of non - albumin small proteins and peptides . proteins and peptides entered the core to be captured with high affinity by baits immobilized in the core . nanoparticles effectively protected interleukin-6 from enzymatic degradation in sweat and increased the effective detection sensitivity of human growth hormone in human urine using multiple reaction monitoring analysis . used in whole blood as a one - step , in - solution preprocessing step , the nanoparticles greatly enriched the concentration of low - molecular weight proteins and peptides while excluding albumin and other proteins above 30 kda ; this achieved a 10,000-fold effective amplification of the analyte concentration , enabling mass spectrometry ( ms ) discovery of candidate biomarkers that were previously undetectable .
most of the procedures are performed under sedation and/or analgesia due to the discomfort or pain , and adequate sedation may improve the quality of colonoscopy . sedation for endoscopy can be classified into minimal , moderate , and deep sedation , depending on the different types of procedures , and moderate sedation level is regarded as the minimal requirement for colonoscopy . propofol sedation with or without opioid agents is one of the most acceptable strategies for sedation in colonoscopy in anesthesiologists or non - anesthesiologist physicians , because of the rapid onset of action and the short - term effect [ 79 ] . however , the adverse effects on cardiovascular and respiratory systems remain the main limitation of its use in sedation for endoscopy . intermittent bolus and continuous infusion are both alternatives for administration of propofol ; however , the great variation in individual responses to propofol may be an important concern regarding the safety of colonoscopy sedation . target - controlled infusion ( tci ) is an automatically adjusted system for intravenous anesthetics based on the predicted pharmacokinetics models using parameters such as age , sex , and body mass index . compared with manually - controlled infusion ( mci ) of propofol , tci was demonstrated to provide faster recovery time and more stable hemodynamic and respiratory status . training of sedation for endoscopy is crucial to maintain patient safety for both anesthesiologists and non - anesthesiologist staffs . the present study aimed at comparing the sedation outcome with tci or mci techniques in training anesthesiology residents . this was a prospective , randomized , crossover study including 18 training residents in anesthesiology from 2011 to 2012 . all residents were in their second year of the 3-year resident training program in shanghai city . before coming to the endoscopy center , all of them received the general anesthesia training for orthopedic surgery and general surgery , with full understanding of intravenous anesthesia and inhalational anesthesia . they were also taught theoretical and practical lessons in tci and mci for endoscopy sedation . the 18 residents were randomly allocated to receive tci or mci training based on computer - generated numbers ( n=9 for each group ) . during the first month of their stay in the endoscopy center , tci - training residents used tci technique while mci - training residents used mci technique for colonoscopy sedation . at the end of that month , the data of the last 2 patients undergoing colonoscopy were collected as an examination . during the second month , tci - training residents used mci technique while mci - training residents used tci technique for colonoscopy sedation . at the end of the second month , the data of the last 2 patients undergoing colonoscopy test were collected as an examination . finally , the outcomes of the patients chosen at the end of each month were compared to assess the training results ( figure 1 ) . the inclusion criteria of the patients included : patients meeting the indications of elective colonoscopy based on the endoscopist ; age 18 years ; and american society of anesthesiologist ( asa ) physical status 1 or 2 . the exclusion criteria included : morbid obesity ( bmi 30 kg / m ) ; predicted difficult airway ; hypertension ; known cardiac diseases ; acute or chronic hepatic and renal dysfunction ; long - term use of anesthetics or opioids ; and patients undergoing invasive procedures under colonoscopy . the same endoscopist , who was blinded of the grouping , performed all colonoscopy procedures . the local ethics committee approved the protocol of the study and all patients provided their written informed consent . after arrival in the operating room , the patients were monitored with the electrocardiogram , pulse oximetry ( spo2 ) , and non - invasive blood pressure . both the tci system and conventional microinfusion pump were connected to the peripheral venous line with propofol on them to achieve blinding for endoscopist and patients . for sedation induction , fentanyl ( 2 g / kg ) ( renfu , yichang , china ) was slowly administered and propofol ( astrazeneca , milan , italy ) was then administered , according to the grouping . in the tci group , propofol was infused through the module dps tci system ( fresenius kabi , bad homburg , german ) using the marsh model . the primary plasma concentration was set as 3.0 g / ml and an adjustment of 0.2 g / ml was made upon the patients response based on the observer s assessment of alertness / sedation ( oaas ) score . in the mci group , propofol was injected at a bolus of 1.5 mg / kg and then continuously infused at 6 mg / kg / h using the conventional continuous microinfusion pump ( smiths medical , hangzhou , china ) . a bolus of 0.5 mg / kg propofol was be injected as required . after colonoscopy , the patients were awakened and discharged after a modified aldrete score system 9 was achieved . the sedation quality was assessed as the satisfactory score of the endoscopist and patients on a 100-mm visual analogue scale ( vas ) . intraoperative heart rate ( hr ) , spo2 , and blood pressure ( bp ) was recorded every 3 min . the respiratory and cardiovascular stability was assessed by the highest and lowest hr and mean blood pressure ( map ) , as well as the lowest spo2 . severe adverse effect was defined as a spo2 lower than 90% , an hr lower than 50 bpm , or a map lower than 55 mmhg . the recovery time was also recorded as the time from termination of propofol infusion to the full recovery of orientation . all statistical analyses were performed with ibm spss statistics version 20.0 ( armonk , ny ) . the continuous data are expressed as mean sd and compared with student s t test for normally distributed data . this was a prospective , randomized , crossover study including 18 training residents in anesthesiology from 2011 to 2012 . all residents were in their second year of the 3-year resident training program in shanghai city . before coming to the endoscopy center , all of them received the general anesthesia training for orthopedic surgery and general surgery , with full understanding of intravenous anesthesia and inhalational anesthesia . they were also taught theoretical and practical lessons in tci and mci for endoscopy sedation . the 18 residents were randomly allocated to receive tci or mci training based on computer - generated numbers ( n=9 for each group ) . during the first month of their stay in the endoscopy center , tci - training residents used tci technique while mci - training residents used mci technique for colonoscopy sedation . at the end of that month , the data of the last 2 patients undergoing colonoscopy were collected as an examination . during the second month , tci - training residents used mci technique while mci - training residents used tci technique for colonoscopy sedation . at the end of the second month , the data of the last 2 patients undergoing colonoscopy test were collected as an examination . finally , the outcomes of the patients chosen at the end of each month were compared to assess the training results ( figure 1 ) . the inclusion criteria of the patients included : patients meeting the indications of elective colonoscopy based on the endoscopist ; age 18 years ; and american society of anesthesiologist ( asa ) physical status 1 or 2 . the exclusion criteria included : morbid obesity ( bmi 30 kg / m ) ; predicted difficult airway ; hypertension ; known cardiac diseases ; acute or chronic hepatic and renal dysfunction ; long - term use of anesthetics or opioids ; and patients undergoing invasive procedures under colonoscopy . the same endoscopist , who was blinded of the grouping , performed all colonoscopy procedures . the local ethics committee approved the protocol of the study and all patients provided their written informed consent . after arrival in the operating room , the patients were monitored with the electrocardiogram , pulse oximetry ( spo2 ) , and non - invasive blood pressure . both the tci system and conventional microinfusion pump were connected to the peripheral venous line with propofol on them to achieve blinding for endoscopist and patients . for sedation induction , fentanyl ( 2 g / kg ) ( renfu , yichang , china ) was slowly administered and propofol ( astrazeneca , milan , italy ) was then administered , according to the grouping . in the tci group , propofol was infused through the module dps tci system ( fresenius kabi , bad homburg , german ) using the marsh model . the primary plasma concentration was set as 3.0 g / ml and an adjustment of 0.2 g / ml was made upon the patients response based on the observer s assessment of alertness / sedation ( oaas ) score . in the mci group , propofol was injected at a bolus of 1.5 mg / kg and then continuously infused at 6 mg / kg / h using the conventional continuous microinfusion pump ( smiths medical , hangzhou , china ) . a bolus of 0.5 mg / kg propofol was be injected as required . after colonoscopy , the patients were awakened and discharged after a modified aldrete score system 9 was achieved . the sedation quality was assessed as the satisfactory score of the endoscopist and patients on a 100-mm visual analogue scale ( vas ) . intraoperative heart rate ( hr ) , spo2 , and blood pressure ( bp ) was recorded every 3 min . the respiratory and cardiovascular stability was assessed by the highest and lowest hr and mean blood pressure ( map ) , as well as the lowest spo2 . severe adverse effect was defined as a spo2 lower than 90% , an hr lower than 50 bpm , or a map lower than 55 mmhg . the recovery time was also recorded as the time from termination of propofol infusion to the full recovery of orientation . all statistical analyses were performed with ibm spss statistics version 20.0 ( armonk , ny ) . the continuous data are expressed as mean sd and compared with student s t test for normally distributed data . there were no significant differences between the 2 groups regarding age , sex , height , weight , bmi , asa score , baseline level of heart rate and pressure , and procedure time . the satisfactory score of the endoscopist was significantly higher in the tci group than in the mci group , 81.37.2 versus 74.29.5 ( p=0.003 ) . patient satisfaction was similar between the 2 groups , 77.26.7 versus 76.87.8 ( p=0.808 ) . the lowest and highest hr were similar between the 2 groups ( p=0.204 and 0.196 , respectively ) , but the lowest map was significantly higher ( p=0.001 ) , while the highest map was significantly lower in tci groups ( p=0.009 ) . moreover , the lowest spo2 in the mci group was significantly lower than in the tci group ( 95.63.0% versus 97.42.0% ) ( p=0.008 ) . patients in the tci group had a shorter recovery time than in the mci group ( 9.12.4 versus 11.32.6 ) ( p<0.001 ) ( table 2 ) . our present study demonstrated that tci showed a better sedation result in training residents of anesthesiology as manifested by the satisfactory score in the endoscopist . propofol administrated by tci resulted in more stable hemodynamic and respiratory status than that by mci . satisfaction of the endoscopist and patients was chosen as the primary outcome to evaluate the sedation quality , because they were blinded to the grouping without any idea how propofol was administrated . in some studies satisfaction of the senior anesthesiologists however , in our opinions , it was really hard to have the senior anesthesiologist blinded to the grouping , and the risk of bias would be high to analyze the satisfaction data from the senior anesthesiologists . although the patient satisfaction was similar using tci and mci techniques , the endoscopist satisfaction suggested that tci sedation might make colonoscopy easier to perform . moreover , based on the predicted pharmacokinetic model , tci promoted earlier recovery after termination of propofol infusion than mci . cardiovascular or respiratory compromise is the main concern of propofol use for endoscopy sedation , especially when administered by inexperienced training residents and non - anesthesiologist staff . nevertheless , propofol has been widely accepted as an ideal agent for endoscopy sedation among anesthesiologist or non - anesthesiologist staff because of the rapid onset of action and short recovery time [ 1921 ] . it is necessary to keep a balance between adequate sedation depth and minimized adverse effects . however , the peak plasma concentration of propofol might be twice the concentration 10 min after a bolus injection and the concentration of propofol might be slowly but constantly increased after continuous infusion . therefore , the unstable plasma concentration of propofol resulted from mci technique may be one the causes of its adverse effects on cardiovascular and respiratory systems . some important parameters are not taken into account during mci , such as age , sex , and bmi , which may lead to significant changes in pharmacokinetics of propofol . therefore , we need to tailor the dose of propofol to specific individuals based on the clinical experience , which might be difficult for inexperienced training residents . fortunately , tci can provide relatively stable plasma concentrations as required , so as to reduce the incidence of adverse events . given the fact that training residents of anesthesiology were less experienced in colonoscopy sedation , propofol tci is an ideal infusion mode for them to improve sedation quality and promote stable cardiovascular and respiratory status .
backgroundpropofol is widely used in sedation for colonoscopy , but its adverse effects on cardiovascular and respiratory systems are still concerning . the present study investigated whether target controlled infusion ( tci ) of propofol could provide a better sedation quality than manually controlled infusion ( mci ) in training inexperienced anesthesiology residents.material/methodseighteen training residents were allocated into 2 groups receiving tci and mci training in their first month in the endoscopy center , while receiving mci and tci training instead in their second month . the last 2 patients at the end of each month were included to analyze the sedation quality of tci and mci techniques by comparing satisfaction of endoscopist and patients based on the visual analogue scale ( vas ) . heart rate ( hr ) , mean blood pressure ( map ) , spo2 , and recovery time were also compared as the secondary outcomes.resultsthe demographic data were similarly distributed among the tci and mci patients . endoscopist s satisfaction score in the tci group was significantly higher than in the mci group , 81.37.2 versus 74.29.5 ( p=0.003 ) , but the patients satisfaction score was similar between the 2 groups . more stable hemodynamic status was obtained in the tci group , manifested as higher lowest map and lower highest map than in the mci group . lowest spo2 in the tci group was significantly higher than in the mci group . patients in the tci group recovered earlier than in the mci group.conclusionstci is a more effective and safer technique for anesthesiology residents in sedation for colonoscopy .
over the past 20 years , erythropoiesis stimulating agents ( esas ) have been a mainstay in anemia treatment in chronic kidney disease ( ckd ) and end - stage renal disease ( esrd ) patients . although anemia treatment improves survival in this population , correction of hemoglobin ( hb ) to a normal range using esas did not demonstrate an additional benefit in previous randomized trials [ 14 ] . furthermore , two of these trials unexpectedly showed worse outcomes in patients randomized to achieve higher hb targets above 13 g / dl [ 3 , 4 ] . in those studies , the mean esa dose was greater in the high hb target arm than in the lower hb target arm . it has been debated whether high esa dose mediates the excess observed mortality risk . as esa dose and other markers of nutrition and inflammation change over time , the esa - mortality association remains vulnerable to biases that would arise using conventional survival models . a marginal structural model ( msm ) is a type of analysis which can address time - varying covariates that may simultaneously act as a confounder and intermediate variable [ 68 ] . notably , hb level fits this description as it is a critical time - varying confounder that is affected by the previous esa dose , and it influences the future esa dose and survival , upon evaluating esa dose - mortality associations . furthermore , time - varying esa dose and nutritional markers may be associated with a greater likelihood of informed censoring . the msm method attempts to account for these potential time - varying biases by creating weights for each patient at each time interval . these weights estimate the inverse probability of a patient being at his or her exposure ( esa ) level for that time interval , and them not having been censored at a prior time interval . the weights are constructed according to baseline and time - varying covariates and attempts to address time - varying confounding leading to esa dose fluctuations ( changes in exposure level ) or informative censoring ( esa dose leading to a higher probability of kidney transplant ) . holding particular assumptions true in the use of msm , associations found from msm are believed to have a causal interpretation . thus using a msm and a large cohort of hemodialysis ( hd ) patients , we aimed to examine the causal effects of weekly epoetin- dose levels and mortality . among a total of 164 789 esrd patients receiving dialysis treatment from july 1 , 2001 , through june 30 , 2006 , in any one of the outpatient facilities of a large dialysis organization ( davita healthcare partners ) in the united states , we examined data from 128 598 patients who met the following inclusion criteria : being of age 18 years , having underwent hd for at least 90 days , and having had complete data on the main exposure and core covariate ( esa dose and hb level ) ( figure 1 ) . in sensitivity analyses , we restricted analyses to an incident hd cohort , defined as patients whose hd duration at cohort entry was less than 6 months . the institutional review committees of los angeles biomedical research institute at harbor - ucla , university of california , irvine , and davita clinical research approved this study . given the large sample size , anonymity of the patients studied and nonintrusive nature of the research , the requirement for consent was waived . the primary exposure was weekly epoetin- dose ( u / week ) , which was calculated and averaged for every 3-month interval ( calendar quarter ) in order to minimize measurement variability . esa dose was divided into 6 preselected ordinal categories : < 6 000 u / week ( reference ) , 6 000 to < 12 000 u / week , 12 000 to < 18 000 u / week , 18 000 to < 24 000 u / week , 24 000 to < 30 000 u / week , and 30 000 u / week . esa < 6 000 u / week was designated as the reference group . the in - hospital esa dose was imputed using the most recent esa dose prior to hospitalization . the primary outcome was all - cause mortality , and the secondary outcomes were cardiovascular ( cv ) or infectious mortality ( see supplement table 1 in supplementary materials available online at http://dx.doi.org/10.1155/2016/6087134 ) . detailed information on cause of death was obtained from the us renal data system ( usrds ) cdeath codes , which are derived from the esrd death notification form ( cms-2746 ) provided by esrd networks to the usrds . cause of death was categorized as cardiovascular , infectious , or others by clinician decision according to these cdeath codes . patients were followed until the time of death or the end of study period ( june 30 , 2007 ) . patients were censored at the time of renal transplantation , change of dialysis modality , that is , hd to peritoneal dialysis , or transfer to a non - davita facility . demographic covariates included baseline age , sex , race / ethnicity ( caucasian , african american , hispanic , asian , and others ) , marital status ( married , divorced , single , and widowed ) , primary insurance ( medicare , medicaid , private insurance , and others ) , comorbid conditions ( see below ) , calendar quarter of cohort entry , and dialysis vintage ( < 6 months , 6 months to < 24 months , 2 to < 5 years , and 5 years ) , for which information was obtained from the usrds . the following comorbidities were considered : diabetes mellitus , hypertension , ischemic heart disease , congestive heart failure , cerebrovascular disease , peripheral vascular disease , chronic obstructive pulmonary disease , malignancy , nonambulatory state , and current smoking status . dialysis duration was defined as the duration of time between the first day of dialysis treatment and the first day that patients entered the cohort . time - varying lab covariates , also averaged over a successive 3-month ( calendar quarter ) interval , included hb level , serum albumin , creatinine , calcium , phosphorus , bicarbonate , total iron binding capacity , ferritin , white blood cell count , lymphocyte percentage , normalized protein nitrogen appearance ( a metric of dietary protein intake ) , dialysis adequacy ( single - pool kt / v ) , and body mass index . most laboratory data were measured monthly , except for serum ferritin level that was measured at least quarterly . blood samples were drawn before hd using uniform techniques in all dialysis clinics and were transported to the central laboratory , usually within 24 hours ( davita laboratory , deland , fl ) . inverse probabilities of treatment weights ( iptws ) were created on the basis of the inverse of the predicted probability of a patient receiving the treatment that was actually received ( the above - mentioned esa dose categories ) , given the baseline and time - varying covariates . we used ordinal logistic regression to calculate iptws at baseline and for each subsequent quarter of follow - up . iptws can result in excessively large weights when there is an atypical treatment decision or data error . hence , stabilized iptws have been applied to reduce the potential for extreme iptws . in the stabilized iptws , the numerator is the calculated probability of the observed treatment ( esa dose ) given the previous esa dose and baseline patient characteristics , while the denominator is the calculated probability of esa dose , previous esa dose , and both baseline and time - varying covariates . baseline covariates included age , gender , race , insurance , marital status , comorbidities , and baseline lab values , while time - varying covariates included time - updated quarterly lab values and their respective lag ( previous quarter ) values . estimated weights were then truncated at the 1st and 99th percentile values and used in the analyses . to address informative censoring , we fitted logistic regression models to calculate the inverse probability of censoring weights ( ipcws ) at each time interval . as done with iptws , we used the same covariates for the numerator and denominator of the stabilized ipcw modeling the calculated probability of observed censorship . as large censoring weights were not observed , truncation was not performed for ipcw values . the final stabilized weights were calculated as the product of the stabilized iptws and stabilized ipcws . we estimated the odds ratio ( or ) using a generalized estimating equation that included esa dose category and the final stabilized weights on the basis of all baseline covariates . the esa dose category of < 6 000 u / week was treated as the reference group . both the overall and incident study populations , data were missing for less than 5% and 1% , respectively . to further impute missing time - varying covariates in each time window baseline characteristics of the overall patient cohort and stratified across esa categories are summarized in table 1 . during the baseline quarter , there were 6 644 ( 5% ) , 23 314 ( 18% ) , 26 852 ( 21% ) , 21 487 ( 17% ) , 15 278 ( 12% ) , and 35 023 ( 27% ) patients receiving a weekly esa dose of < 6 000 , 6 000 to < 12 000 , 12 000 to < 18 000 , 18 000 to < 24 000 , 24 000 to < 30 000 , and 30 000 u / week . the mean standard deviation ( sd ) age was 62 15 years , 55% of the patients were women , 32% and 14% were african american and hispanic , respectively , and 57% were diabetic . the baseline mean sd hb level was 12.1 1.0 g / dl , and the median ( interquartile range , iqr ) duration of follow - up was 2.2 ( 1.23.6 ) years . patients receiving a higher esa dose tended to be african american and male and had lower albumin and lymphocyte percentage . stabilized weights had a maximum value of 80.9 and 78.9 in the overall and incident patient cohorts , respectively . the mean stabilized weights were 0.84 and 0.88 , respectively . weekly esa doses 18 000 u / week were associated with higher risks of death as compared with a weekly epoetin- dose of < 6 000 u / week . weekly esa doses of 18 000 to < 24 000 , 24 000 to < 30 000 , and 30 000 u / week showed 17% , 27% , and 52% higher risk of mortality , respectively ( table 3 ) . weekly esa dose also showed a strong relationship with cv mortality risk ( table 3 ) . weekly esa doses of 6 000 to < 12 000 , 12 000 to < 18 000 , 18 000 to < 24 000 , 24 000 to < 30 000 , and 30 000 u / week showed 13% , 21% , 23% , 35% , and 44% higher risks of cv mortality , respectively . risk of infectious death was only significantly increased in weekly esa dose of 30 000 u / week ( table 3 ) , while esa levels < 30,000 u / week exhibited a trend toward higher risk of infectious death , compared to reference . in incident patients ( n = 56 447 ) , the relationship between weekly esa dose and mortality risk was less apparent compared to the overall cohort , which included prevalent patients ( figure 2 and table 4 ) . only a weekly esa dose 30 000 u / week was significantly associated with higher mortality compared to a weekly esa dose of < 6 000 u / week ( or : 1.29 , 95% confidence interval ( ci ) : 1.151.44 ) . based on our observation that a weekly esa dose of 30 000 u / week was associated with a higher risk of mortality in both the overall and incident patient cohorts , we dichotomized weekly esa dose with cutoffs at 30 000 u / week . also , using a msm , we then reexamined mortality risk of weekly esa doses 30 000 versus < 30 000 u / week ( reference ) in various subgroups : men versus women , age 65 versus < 65 years , race / ethnicity ( caucasian versus african american versus hispanic ) , diabetic versus nondiabetic , prior history versus no history of ischemic heart disease , body mass index 23 versus < 23 kg / m , and serum albumin level 3.8 versus < 3.8 g / dl . among all subgroups , adjusted ors were significantly higher in weekly esa dose of 30 000 u / week than in that of < 30 000 u / week ( figure 3 ) . in this study , we used a msm to evaluate the relationship between esa dose and mortality in a large cohort of hd patients . we observed a dose - dependent relationship as higher esa dose after recent randomized trials showed worse outcomes in patients randomized to higher hb targets [ 3 , 4 ] , the us food and drug administration recommended a more conservative esa dosing regimen for the treatment of patients with ckd . however , the causal relationship between esa dose and mortality has still been debated and the ideal esa dosing regimen remains unknown . the examination of the causal effect of esa is challenging due to the strong relationship between patient 's comorbidity and esa requirements and especially with the presence of time - dependent confounding of hb in observational studies . the current esa dose is influenced by previous esa dose and hb and affects future esa dose and hb . however , an increase in hb independent of esa dose may not be associated with higher mortality risk . in presence of this type of complex confounding , we used a msm to control this time - dependent confounding [ 6 , 7 , 10 , 13 ] . we observed significantly higher or estimates in esa doses over 18 000 u / week as compared to that of < 6 000 u / week . weekly esa dose 30 000 u / week showed a 52% increased mortality risk . previous studies have tried to control time - dependent confounding using msm , but they have reported conflicting results . reported no harmful effect of median cumulative esa dose over 30 000 u / week in elderly ( 65 years old ) hd patients . however , an additional study by the same group investigating a larger cohort later reported a 32% increased risk of mortality with esa dose greater than 40 000 u / week compared with 20 000 to 30 000 u / week especially in diabetic elderly patients . wang et al . reported a mortality hazard ratio for the highest esa doses ( > 49 000 u/2 weeks ) of 0.98 ( 95% ci : 0.761.74 ) compared with esa dose 14 000 u/2 weeks . they concluded that there is appreciable confounding by indication at higher esa doses and that esa dose was not associated with increased mortality in analysis using msm . recently , in a european cohort , suttorp et al . reported that the excess mortality risk for patients with high esa dose did not fully disappear within analysis using the msm approach . the msm estimated a hazard ratio of 1.54 ( 95% ci : 1.082.18 ) for patients with esa dose above 6 000 u / week compared to the counterpart of less than 6 000 u / week , which is in line with our results . the msm estimates what would happen if a patient is always exposed to higher doses of esa , which is difficult to interpret in clinical practice but nonetheless begs the question if a patient treated with a lower dose of esa would benefit more from treatment than with a higher esa dose . in addition , our results could be interpreted causally under the fundamental assumptions of msm . an important assumption is positivity , the condition that there are both exposed and unexposed individuals at every level of the confounders . a relatively large study may have zero proportion for particular exposure and covariate histories as the number of covariates increases . estimated weights with a mean far from one or very extreme values are indicative of nonpositivity or misspecification of the weight model . in our study , it could be debated whether the mean of the stabilized weights of 0.84 in overall patients and 0.88 in incident patients is close enough to one to justify the conclusion that models were well specified . however , there is a tradeoff between reducing confounding bias and increasing bias / variance due to nonpositivity . the distribution of weights in our study is comparable to that of other msm studies although the mean of weights in our study is smaller [ 9 , 16 ] . thin evidence for biologic plausibility also dampens a conclusive consensus of a causal relationship between esa dose and mortality . considering that the most common cause of death in ckd patients is related to cv disease , a harmful effect of high esa dose , if any , there is a very rapid rise and supraphysiologic peak in serum concentration of erythropoietin after injection , followed by a rapid decline [ 17 , 18 ] . repetitive supraphysiologic stimulation could disorder cardiac modeling , increase vulnerability to stress , or impair the ability of higher hb to diminish left ventricular hypertrophy [ 1820 ] . another hypothesis is that iron depletion , increased platelet reactivity and platelet numbers , and associated relative thrombocytosis might contribute to increased cv events upon administering a high esa dose . a 2014 review summarized additional potential mechanisms , including esa effect on arterial blood pressure via increasing blood viscosity and vasoconstriction . in our study , estimated ors for cv death were greater than those for all - cause mortality , although the differences were small ( tables 3 and 4 ) . the association between esa dose and mortality was observed even in incident patients , but the strength of association was weaker than in the overall cohort , which additionally included prevalent patients . this may be due to the relatively small number of patients or the cumulative effect of esa exposure . prevalent patients receiving a high esa dose during the study period tend to have greater cumulative exposure to esa prior to enrollment . this observation may not be present in incident hd patients because esa dose administered during the predialysis ckd stages is usually lower compared to the dose administered during maintenance hd . if a cumulative effect of esa exposure exists , estimated ors may be augmented in the overall cohort compared to that of the incident cohort . another speculation is that , in the early period after hd initiation , other mortality risk factors are more dominant than esa dose . survivor bias is more likely to affect studies of prevalent patients opposed to incident patients . first , the validity of our analysis depends on the assumption that we have adjusted for all confounders ( exchangeability ) . given the detailed level of information on a variety of demographics , laboratory parameters , and dialysis adequacy in our data , we believe that we have controlled for the most important confounding . however , the possibility of residual confounding or confounding by indication can not be completely excluded . although we included serum albumin , white blood cell counts , and lymphocyte percentage in the models , we did not have data for other inflammatory markers , such as c - reactive protein [ 27 , 28 ] . it might be interpreted as a high or estimate for infectious mortality with esa dose over 30 000 u / week in our results . considering that there is no evidence to date that esa causes infectious complications , a small effect on infectious mortality could indicate residual confounding . second , the estimates for our msm could be affected by the level of weight truncation , which is reflective of the tradeoff between control of confounding and precision of our effect estimates . although this approach may not reflect actual in - hospital esa dosing exactly , it may be an alternative solution to address this missing esa data problem . despite these limitations , our cohort is one of the largest ones to investigate the esa - mortality association and is nationally representative of the united states adult hd population . furthermore , our cohort was followed up for an extended period of time , giving sufficient power in this analysis . in conclusion , estimating the causal relationship between esa dose and mortality is complex due to the strong relationship between comorbidity , esa requirements , and time - dependent confounding of hb . using a msm , we observed a possible causal relationship between higher esa dose and excess mortality risk in hd patients . it supports the current conservative esa dosing regimen which balances the benefit of anemia correction and a potential harm of higher esa dose . further studies ( including biological and prospective studies ) are warranted to establish the ideal esa dosing algorithm in ckd and esrd patients and to further unveil the complex pathophysiological relationship between esa dose and mortality .
it has been previously reported that a higher erythropoiesis stimulating agent ( esa ) dose in hemodialysis patients is associated with adverse outcomes including mortality ; however the causal relationship between esa and mortality is still hotly debated . we hypothesize esa dose indeed exhibits a direct linear relationship with mortality in models of association implementing the use of a marginal structural model ( msm ) , which controls for time - varying confounding and examines causality in the esa dose - mortality relationship . we conducted a retrospective cohort study of 128 598 adult hemodialysis patients over a 5-year follow - up period to evaluate the association between weekly esa ( epoetin- ) dose and mortality risk . a msm was used to account for baseline and time - varying covariates especially laboratory measures including hemoglobin level and markers of malnutrition - inflammation status . there was a dose - dependent positive association between weekly epoetin- doses 18 000 u / week and mortality risk . compared to esa dose of < 6 000 u / week , adjusted odds ratios ( 95% confidence interval ) were 1.02 ( 0.941.10 ) , 1.08 ( 1.001.18 ) , 1.17 ( 1.061.28 ) , 1.27 ( 1.151.41 ) , and 1.52 ( 1.371.69 ) for esa dose of 6 000 to < 12 000 , 12 000 to < 18 000 , 18 000 to < 24 000 , 24 000 to < 30 000 , and 30 000 u / week , respectively . high esa dose may be causally associated with excessive mortality , which is supportive of guidelines which advocate for conservative management of esa dosing regimen in hemodialysis patients .
non - melanomatous skin cancer ( nmsc ) is the single most common cancer in the us with an incidence of 2 - 3 million cases per year . nmsc is comprised of basal cell carcinoma ( bcc ) and squamous cell carcinoma ( scc ) , and also includes merkel cell carcinoma ( mcc ) and adnexal tumors . while surgical excision is the standard of care , radiotherapy ( rt ) is an excellent alternative with high cure rates and good cosmetic outcome [ 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 ] . high - dose - rate ( hdr ) brachytherapy and external beam radiotherapy ( ebrt ) have been described as treatment modalities for nmsc [ 5 , 7 , 15 , 16 ] . hdr brachytherapy is often delivered in the form of a surface mold applied in multiple fractions but can also be delivered through use of a custom mold , leipzig applicator , valencia applicator , or a variety of other techniques [ 12 , 13 , 16 ] . orthovoltage radiotherapy is another mainstay treatment option but requires a dedicated machine for delivery , which limits widespread use and precluded inclusion in this institutional review . this study seeks to examine differences in local control and overall survival among patients receiving different modalities of radiotherapy treatment . an institutional review board - approved , retrospective evaluation was undertaken of patients treated for nmsc from june 2005 to march 2013 . sixty one patients received treatment for 66 primary lesions treated with hdr brachytherapy ( n = 9 ) , hypofractionated ebrt ( n = 30 ) , or standard fractionation ebrt ( n = 22 ) as indicated in table 1 . the primary outcome measure was local control ( lc ) , which , for the purposes of analysis , was assessed at the most remote follow - up appointment . secondary outcome measures were overall survival ( os ) , cosmetic outcome , and toxicity . patient , treatment , and tumor characteristics sd standard deviation , scc squamous cell carcinoma , bcc basal cell carcinoma , rtog radiation therapy oncology group the treating physician determined cosmetic outcome upon follow - up visit 6 months or greater after completion of radiotherapy . cosmetic outcome was graded as excellent if there was no telangiectasia or fibrosis and no or slight pigment change , good if there was mild telangiectasia or pigment change or mild - to - moderate fibrosis , and poor if there was severe fibrosis or skin contracture . skin toxicity was measured using radiation therapy oncology group ( rtog ) acute radiation morbidity scoring criteria . patient demographic and tumor and dose characteristic data was also collected including patient age and gender , tumor histology , tumor size , total dose , number of fractions , and dose per fraction . hdr brachytherapy was delivered as a surface mold using an iridium-192 isotope as previously described . briefly , a surface mold of the tumor is constructed of pliable material , such as silicone or polymethyl - methacrylate ( figure 1 ) . dose distribution calculations were performed to determine optimal placement of radioactive sources on the surface mold to obtain uniform dose coverage throughout the tumor volume . a representation of a nasal hdr applicator for treatment of skin cancer of the nose ebrt treatment was performed with a linear accelerator manufactured by varian ( palo alto , usa ) . electrons were delivered as 6 - 12 mev beams and were shape using custom wood 's metal blocks to improve conformation . the first was which modality was likely to obtain the most favorable dosimetric distribution ; uneven surfaces such as the nasal ala may compromise electron dose distribution . such lesions favor treatment with brachytherapy , which can provide more uniform dose to uneven locations . patients who were unable to come for standard fractionation therapy were likely to be recommended to undergo brachytherapy or hypofractionated ebrt . dose characteristics for all treatment modalities are in table 2 . treatment parameters for brachytherapy , hypofractionated ebrt , and standard fractionation ebrt ebrt external beam radiotherapy ; gy gray ; fx fractions univariate analysis was performed to determine association of treatment modality and tumor histology with lc using pearson chi - square test . univariate analysis was performed to determine association of treatment modality with cosmetic outcome and toxicity using pearson chi - square test . univariate analysis was performed to determine association of age with cosmetic outcome and toxicity using anova and student t - test , respectively . multivariate analysis was not undertaken due to the relatively small number of outcome events in the study . os was assessed using kaplan - meier analysis and comparison was made between treatment modalities with log - rank testing . an institutional review board - approved , retrospective evaluation was undertaken of patients treated for nmsc from june 2005 to march 2013 . sixty one patients received treatment for 66 primary lesions treated with hdr brachytherapy ( n = 9 ) , hypofractionated ebrt ( n = 30 ) , or standard fractionation ebrt ( n = 22 ) as indicated in table 1 . the primary outcome measure was local control ( lc ) , which , for the purposes of analysis , was assessed at the most remote follow - up appointment . secondary outcome measures were overall survival ( os ) , cosmetic outcome , and toxicity . patient , treatment , and tumor characteristics sd standard deviation , scc squamous cell carcinoma , bcc basal cell carcinoma , rtog radiation therapy oncology group the treating physician determined cosmetic outcome upon follow - up visit 6 months or greater after completion of radiotherapy . cosmetic outcome was graded as excellent if there was no telangiectasia or fibrosis and no or slight pigment change , good if there was mild telangiectasia or pigment change or mild - to - moderate fibrosis , and poor if there was severe fibrosis or skin contracture . skin toxicity was measured using radiation therapy oncology group ( rtog ) acute radiation morbidity scoring criteria . patient demographic and tumor and dose characteristic data was also collected including patient age and gender , tumor histology , tumor size , total dose , number of fractions , and dose per fraction . hdr brachytherapy was delivered as a surface mold using an iridium-192 isotope as previously described . briefly , a surface mold of the tumor is constructed of pliable material , such as silicone or polymethyl - methacrylate ( figure 1 ) . dose distribution calculations were performed to determine optimal placement of radioactive sources on the surface mold to obtain uniform dose coverage throughout the tumor volume . a representation of a nasal hdr applicator for treatment of skin cancer of the nose ebrt treatment was performed with a linear accelerator manufactured by varian ( palo alto , usa ) . electrons were delivered as 6 - 12 mev beams and were shape using custom wood 's metal blocks to improve conformation . the first was which modality was likely to obtain the most favorable dosimetric distribution ; uneven surfaces such as the nasal ala may compromise electron dose distribution . such lesions favor treatment with brachytherapy , which can provide more uniform dose to uneven locations . patients who were unable to come for standard fractionation therapy were likely to be recommended to undergo brachytherapy or hypofractionated ebrt . dose characteristics for all treatment modalities are in table 2 . treatment parameters for brachytherapy , hypofractionated ebrt , and standard fractionation ebrt ebrt univariate analysis was performed to determine association of treatment modality and tumor histology with lc using pearson chi - square test . univariate analysis was performed to determine association of treatment modality with cosmetic outcome and toxicity using pearson chi - square test . univariate analysis was performed to determine association of age with cosmetic outcome and toxicity using anova and student t - test , respectively . multivariate analysis was not undertaken due to the relatively small number of outcome events in the study . os was assessed using kaplan - meier analysis and comparison was made between treatment modalities with log - rank testing . treatment with brachytherapy achieved 100% local control but no significant association was found between treatment modality and local control ( table 3 ) . no significant association was found for lc between bcc and scc histologies when compared directly ; however , lc was significantly reduced among tumors having merkel cell and basosquamous histologies ( p = 0.03 ; table 3 ) . univariate analysis for local control scc squamous cell carcinoma ; bcc basal cell carcinoma os data was available for 40 patients and median follow - up for patients with os data was 30 months . os was not significantly associated with treatment modality either when comparing all modalities ( p = 0.66 ; figure 2 ) or when performing pair - wise comparisons . kaplan - meier survival by treatment modality cosmetic outcome was excellent or good for 86% of patients . five out of six patients noted to have a poor cosmetic outcome were treated with standard fractionation ebrt , however no significant difference in cosmetic outcome was found when comparing all treatment modalities ( table 4 ) . more favorable cosmetic outcomes tended to be observed in older patients but cosmetic outcome was not significantly associated with patient age . grade 2 toxicity rate was observed to be greatest among patients treated with standard fractionation ebrt ( 38% ) and least among patients treated with hypofractionation ebrt ( 10% ) , however no significant difference in grade 2 toxicity was found when comparing all treatment modalities ( table 5 ) . standard deviation ; rtog radiation therapy oncology group grade 2 toxicity was largely related to skin desquamation . mucositis was observed in some patients with facial lesions , and some patients with periorbital lesions experienced conjunctivitis . one patient had facial cellulitis treated with antibiotics , and the other patient had mucositis , difficulty swallowing , and extreme fatigue , which resolved upon cessation of ebrt . both patients with grade 3 toxicity treatment with brachytherapy achieved 100% local control but no significant association was found between treatment modality and local control ( table 3 ) . no significant association was found for lc between bcc and scc histologies when compared directly ; however , lc was significantly reduced among tumors having merkel cell and basosquamous histologies ( p = 0.03 ; table 3 ) . univariate analysis for local control scc squamous cell carcinoma ; bcc basal cell carcinoma os data was available for 40 patients and median follow - up for patients with os data was 30 months . os was not significantly associated with treatment modality either when comparing all modalities ( p = 0.66 ; figure 2 ) or when performing pair - wise comparisons . five out of six patients noted to have a poor cosmetic outcome were treated with standard fractionation ebrt , however no significant difference in cosmetic outcome was found when comparing all treatment modalities ( table 4 ) . more favorable cosmetic outcomes tended to be observed in older patients but cosmetic outcome was not significantly associated with patient age . grade 2 toxicity rate was observed to be greatest among patients treated with standard fractionation ebrt ( 38% ) and least among patients treated with hypofractionation ebrt ( 10% ) , however no significant difference in grade 2 toxicity was found when comparing all treatment modalities ( table 5 ) . standard deviation ; rtog radiation therapy oncology group grade 2 toxicity was largely related to skin desquamation . mucositis was observed in some patients with facial lesions , and some patients with periorbital lesions experienced conjunctivitis . one patient had facial cellulitis treated with antibiotics , and the other patient had mucositis , difficulty swallowing , and extreme fatigue , which resolved upon cessation of ebrt . both patients with grade 3 toxicity the rate of local control obtained in treatment of bcc and scc with radiotherapy has been observed to be in the range of 92 - 97% in previous analyses of ebrt [ 4 , 7 ] and hdr brachytherapy . one possible explanation is that several of the tumors treated in this review were quite large , ranging in size up to 8 cm in greatest dimension . . there may be other patient selection factors that were not assessed that additionally contributed to the reduced lc . of note , brachytherapy achieved a lc of 100% in this study , which is consistent with very high levels of lc obtained in previous studies of hdr brachytherapy . although the rate of lc observed among patients treated with brachytherapy was high , the overall lc rate for the study was lower since brachytherapy was utilized in only 15% of the patient population . no statistical difference in lc between treatment modalities was observed in this study . to our knowledge , this is the first analysis to compare brachytherapy , hypofractionated ebrt , and standard fractionation ebrt . a review of the literature identified one previous analysis that assessed for a difference in lc between ebrt and orthovoltage rt . greater dose per fraction was associated with greater lc but no difference was detected in lc between treatment modalities . scc is considered to represent a more aggressive histology than bcc , and one analysis observed reduced lc rate of 80% among scc treated with ebrt . the present study observed no difference in lc between bcc and scc , which is consistent with the prevailing literature . among nmsc histologies the finding in this study of greatly reduced lc among patient with mcc is consistent with the known biology , however the lc rate is not necessarily representative given the low number of tumors with merkel cell histology . basosquamous histology is considered to be intermediate between bcc and scc and should display concomitantly intermediate aggression . it is thus not expected that basosquamous tumors in this analysis display a low rate of lc . cosmetic outcome in this study was favorable with 86% of patients achieving excellent or good outcome . this is consistent with previous reports , which have found excellent or good outcome in 92% and 83 - 87% of patients . although no significant difference was observed in cosmetic outcome between treatment modalities , the patients treated with standard fractionation accounted for five of the six poor cosmetic outcomes observed , indicating that this treatment modality may tend to yield poorer cosmetic outcomes than the others . paradoxically , cosmetic outcome tended to be better in older patients , however this finding was not significant and is likely spurious . though the finding is not significant , it may be speculated that shallower treatment and smaller margins perhaps contributed to better quality cosmesis . treatment was overall well tolerated with 22% of patients experiencing rtog grade 2 toxicity . patients treated with hypofractionated ebrt fared the best with only 10% grade 2 toxicity , while patients treated with standard fractionation experienced nearly 40% grade 2 toxicity . additionally , the only two patients who experienced grade 3 toxicity were treated with standard fractionation ebrt . the finding of higher grade toxicity and a greater portion of patients experiencing toxicity among standard fractionation therapy is counter to expectations . there was no statistical significance to the finding and it is not likely to be meaningful . radiobiologically , one would be led to believe that a hypofractionated schedule should result in greater toxicity in light of expected late effects of radiation . it is not clear why the opposite finding was observed ; perhaps it is the result of a small sample size . this is likely related to the generally favorable prognosis for nmsc and the long follow - up required to observe adverse events . one report was found of 333 patients treated for 434 lesions of bcc or scc with two different hypofractionated schedules of ebrt . one group of patients was treated with 54 gy in 18 fractions of 3 gy while the other group was treated with 44 gy in 10 fractions of 4.4 gy . after median follow - up of 42.8 months , 3-year os of 75% was observed . no significant difference in lc between study groups was detected ; difference in os between study groups was not reported . the 2-year os of 89% and 3-year os of 79% observed in this study is moderately more favorable but essentially consistent with the previously reported os . this study observed no difference in os when comparing all three treatment modalities or when conducting pair - wise comparison of treatment modalities . although the kaplan - meier curves in figure 2 diverge somewhat after 3 years of follow - up , this is likely due to the low number of remaining patients at risk , making the plot more unpredictable . there were relatively few total events for os analysis , which likely made detection of any existing difference between modalities more difficult . this study found no difference in local control or overall survival between patients treated for nmsc with brachytherapy , hypofractionated ebrt , and standard fractionation ebrt . standard fractionation ebrt was found to have a non - significantly increased rate of rtog grade 2 toxicity as compared to other treatment modalities , and the greatest proportion of poor cosmetic outcome also occurred in patients treated with standard fractionation ebrt . however , these findings are counter to expectations , and given that , they lack statistical significance , it is unlikely that such a result is meaningful .
purposenon - melanomatous skin cancer ( nmsc ) is the single most common cancer in the us . radiation therapy is an excellent treatment alternative to surgery . high - dose - rate ( hdr ) brachytherapy and external beam radiotherapy ( ebrt ) are commonly used radiation treatment modalities but little data is published comparing these modalities . we present our institution 's experience and outcomes with these therapeutic options.material and methodsfrom june 2005 to march 2013 , 61 patients were treated with hdr brachytherapy ( n = 9 ) , hypofractionated ebrt ( n = 30 ) , or standard fractionation ebrt ( n = 22 ) for nmsc . the primary outcome measure was local control at most remote follow - up and secondary outcome measures were overall survival , cosmetic outcome , and toxicity . univariate analysis was performed to compare outcomes between treatment modalities . kaplan - meier analysis and log - rank test were used to compare overall survival.resultsmedian follow - up was 30 months . the most common histologies were bcc ( 47% ) and scc ( 44% ) ; mean patient age was 83.3 years . local control was 81% and 2-year actuarial overall survival was 89% . there was no statistical difference in local control or overall survival between treatment modalities . there was no statistical difference in cosmetic outcome or toxicity between treatment modalities , although five of six poor cosmetic outcomes and the only grade 3 toxic events were found in the standard fractionation ebrt group.conclusionsall modalities investigated represent effective treatments for nmsc and have good cosmetic outcomes and acceptable toxicity profiles . the finding of higher grade toxicity and a greater portion of patients experiencing toxicity among standard fractionation therapy is counter to expectations . there was no statistical significance to the finding and it is not likely to be meaningful .
human respiratory syncytial virus ( rsv ) is one of the most important infectious agents causing acute lower respiratory tract illness , such as bronchiolitis and pneumonia , in infants and young children [ 1 , 2 ] . viral rna generated during rsv replication is recognized by host pattern recognition molecules , such as toll - like receptor 3 ( tlr3 ) and retinoic acid inducible gene - i ( rig - i ) , and it induces type i and type iii interferon [ 3 , 4 ] . transcriptional induction of proinflammatory cytokines , chemokines , and interferons is mediated by nf-b and interferon regulatory factors ( irfs ) [ 5 , 6 ] . these mediators are believed to contribute to the pathophysiology of rsv infection , such as mucous hypersecretion , swelling of submucous , and infiltration of lymphocytes , neutrophils , eosinophils , and macrophages . frequently , there are coinfections with respiratory viruses , including rsv , and bacteria that cause community - acquired respiratory diseases , such as streptococcus pneumoniae and haemophilus influenzae . there is evidence for a positive correlation between infections with s. pneumoniae and rsv in the pathogenesis of otitis media , pneumonia , and meningitis [ 811 ] . s. pneumoniae and h. influenzae colonize to the host respiratory epithelium via host cell surface receptors , such as the platelet - activating factor ( paf ) receptor [ 1214 ] . these bacteria interact with the paf receptor via phosphorylcholine , which is a component of the bacterial cell surface . both live and heat - killed s. pneumoniae cells show an increased adhesion to human epithelial cells infected with rsv . the upregulation of paf receptor expression that is induced by respiratory virus infections , including those caused by rsv , results in the enhanced adhesion of s. pneumoniae and h. influenzae to respiratory epithelial cells [ 1517 ] . paf receptor expression and s. pneumoniae cell adhesion are also upregulated by exposure to acid , which causes tissue injury and an inflammatory response . clarithromycin ( cam ) is 14-membered ring macrolide antibiotic that also acts as a biological reaction modifier with anti - inflammatory properties . in japan , cam is applied to diffuse panbronchiolitis , chronic bronchiolitis , otitis media , and chronic sinusitis as an immunomodulator [ 1921 ] . the anti - inflammatory mechanism of cam has not yet been completely clarified , but one of the important mechanisms for its anti - inflammatory action is considered to be the suppression of nf-b [ 2224 ] . recently , we reported that fosfomycin , which is an antibiotic , suppressed rsv - induced interleukin ( il)-8 , regulated on activation , normal t - cell expressed and secreted ( rantes ) , and the paf receptor by suppressing nf-b activity [ 25 , 26 ] . on the other hand , wang et al . report that cam suppressed rhinovirus - induced staphylococcus aureus and h. influenzae adhesions to nasal epithelial cells . so we anticipate that cam suppresses rsv - induced bacterial adhesion to epithelial cells , because expression of paf receptor is controlled by nf-b [ 28 , 29 ] in the present study , we examined the effect of cam on cytokine production , paf receptor expression , and rsv infection - induced s. pneumoniae adhesion to respiratory epithelial cells . rsv strain long , human type ii pulmonary epithelial cell line a549 and s. pneumoniae strain r6 were obtained from the american type culture collection ( atcc , manassas , va ) . the virus titer of rsv was determined using a plaque - forming assay with hep-2 cells as the indicator cells . rsv infection to a549 cells was performed at multiplicity of infection ( moi ) of 1 . cam was donated by abbott japan ( tokyo , japan ) . a paf receptor antagonist , 1-o - hexadecyl-2-acetyl - sn - glycero-3-phospho(n , n , n ,- an nf-b inhibitor , pyrrolidine dithiocarbamate ( pdtc ) , was purchased from sigma - aldrich ( st . louis , mo ) . after 24-hour infection , culture supernatants of rsv - infected and -uninfected cells were collected . the amounts of il-6 , il-8 , and rantes in the culture supernatants were determined by enzyme - linked immunosorbent assay ( elisa ) ( duoset elisa development kit , r&d systems , minneapolis , mn ) . semiquantitative rt - pcr was carried out as described previously [ 4 , 30 ] . the cell surface expression of the paf receptor was examined by flow cytometry as previously described . the cells were harvested from culture flasks using a cell scraper and then incubated with 2.5 g / ml of mouse anti - paf receptor monoclonal antibody ( 11a4 ( clone 21 ) ; cayman chemical , ann arbor , mi ) or mouse igg2a , isotype control antibody ( ebioscience , san diego , ca ) . after incubation at 4c for 30 min , cells were collected by centrifugation and washed once with dulbecco 's phosphate - buffered saline ( pbs ( ) ) . cell suspensions were incubated with a phycoerythrin - conjugated goat anti - mouse igg f(ab)2 fragment antibody ( 1 : 100 dilution ) ( abcam , cambridge , uk ) at 4c for 30 min , and the stained cells were assessed with facscalibur ( bd bioscience , san jose , ca ) . s. pneumoniae adhesion was assayed using fluorescein - isothiocyanate- ( fitc- ) labeled s. pneumoniae as previously described . briefly , a bacterial suspension in 0.1 m nacl-50 mm sodium carbonate buffer ( ph9.5 ) at 1 10 cfu / ml was prepared . fitc isomer - i ( dojindo laboratories , kumamoto , japan ) was added at a concentration of 1 mg / ml , and the mixture was incubated at 4c for 1 h. the cells were washed three times with pbs ( ) . cam was added to monolayers of a549 cells 1 h prior to rsv infection . the a549 cells infected with rsv at an moi of 1 for 24 h and uninfected a549 cells were incubated with fitc - labeled s. pneumoniae cells at moi of 10 for 30 min at 37c . for the control experiments , either 20 g / ml of the paf receptor antagonist or 10 g / ml of the mouse anti - paf receptor monoclonal antibody ( 11a4(clone 21 ) ) was added to the a549 cells 1 h prior to the addition of the fitc - labeled bacteria . the cell monolayer was gently washed three times with pbs ( ) and observed by fluorescence microscopy . alternatively , the cells were harvested with cell scraper and then assessed by flow cytometry as previously described . first , we examined the effect of cam on rsv replication in a549 cells . rsv infection to a549 cells was performed at moi of 1 . after 24 and 36 h of infection , significant alterations of the rsv titers or expression levels of g mrna were not observed by the addition of cam even at a concentration of 100 g / ml ( figure 1 ) . when a549 cells were infected with rsv at moi of 1 , rantes , il-8 , and il-6 these cytokine inductions were significantly suppressed in the presence of cam in a dose - dependent manner ( figure 2 ) . the degree of suppression by cam was less than that by an nf-b inhibitor , pdtc . paf receptor expression on the cell surface is upregulated during rsv infection in a549 cells . the rsv - induced upregulation of the paf receptor was significantly suppressed by cam and pdtc in a dose - dependent manner ( figure 3 ) . suppression of the paf receptor expression was also observed when a549 cells were posttreated with cam ( 4 or 12 h after rsv infection ) ( data not shown ) . we examined the adhesion of fitc - labeled s. pneumoniae cells to a549 cells by fluorescence microscopy ( figure 4 ) and flow cytometry ( figure 5 ) . rsv infection significantly enhanced the adhesion of s. pneumoniae to a549 cells , and this enhancement was suppressed by adding a paf receptor antagonist ( figures 4 and 5 ) or anti - paf receptor monoclonal antibody ( data not shown ) . this result indicated that the rsv - induced s. pneumoniae adhesion occurs via the paf receptor on a549 cells . these lines of evidence confirmed that the expression of the paf receptor was induced by rsv infection and indicated that this induction , and subsequent rsv - induced s. pneumoniae adhesion , can be suppressed by cam treatment . macrolides , with the exception of the 16-membered ring type , have both anti - inflammatory and antibacterial functions [ 20 , 21 ] . one of the important mechanisms of anti - inflammatory action is the suppression of nf-b activation [ 2224 ] . our recent studies show that rsv upregulates proinflammatory cytokines , such as il-6 , and chemokines , such as il-8 and rantes , in the respiratory epithelial cell line a549 . furthermore , the induction of chemokines by rsv is significantly suppressed by an antibiotic , fosfomycin , via suppression of nf-b activation . in the present study , cam was shown to suppress il-6 , il-8 , and rantes , which are induced by rsv infection , at concentrations of 10 and 100 g / ml . patel et al . reported that the concentration of cam in fluid of the bronchopulmonary epithelial lining was 34.2 5.16 g / ml at 4 h , 23.01 11.9 g / ml at 12 h in healthy adults orally administered cam 500 mg . we observed that cam did not affect rsv replication even at a concentration of 100 g / ml . however , it is reported that respiratory virus , such as rsv , rhinovirus [ 33 , 34 ] , and influenza virus , replication is suppressed by 14-membered ring macrolides , including cam . these two studies used different types of epithelial cells and different experimental conditions of rsv infection . used primary human tracheal epithelial cells , and in contrast we used a549 cell line . carry out infection at a lower titer of rsv ( 10 tcid50/cell ) and measuring virus titer at a longer period ( 35 days ) after infection . our results indicated that suppression of the rsv - induced cytokines by cam was not caused by the amount of replicated rsv . in other words , both il-8 and rantes , which are strongly upregulated during rsv infection , play important roles in pathogenesis [ 36 , 37 ] . rantes is secreted from respiratory epithelial cells and promotes migration of eosinophils , basophils , monocytes , and neutrophils . in particular , rantes is an efficient eosinophil chemoattractant involved in the pathogenesis of asthma . cam has been suggested to suppress the inflammatory disorders induced by rsv . in the present study , we also observed that cam suppressed enhanced s. pneumoniae adhesion by rsv infection in a549 cells . the rsv - induced s. pneumoniae adhesion was mainly mediated by host paf receptor , as indicated by that suppressed by the paf receptor antagonist and anti - paf receptor monoclonal antibody . the paf receptor acts as a receptor for s. pneumoniae and h. influenzae [ 1214 ] . transcription of the paf receptor gene is controlled by nf-b [ 28 , 29 ] . we confirmed it by that the rsv - induced paf receptor expression and s. pneumoniae adhesion were suppressed by an nf-b inhibitor , pdtc . we revealed that cam also suppressed paf receptor expression induced by rsv infection and s. pneumoniae adhesion to rsv - infected a549 cells . . reported that cam suppressed rhinovirus - induced s. aureus and h. influenzae adhesions to nasal epithelial cells . they show that the expressions of fibronectin and carcinoembryonic antigen - related cell adhesion molecule ( ceacam ) , which act as receptors for s. aureus and h. influenza , respectively , are induced by rhinovirus and suppressed by cam . the present study indicated that cam suppressed the paf receptor - phosphorylcholine ( host - bacteria ) interaction , which is enhanced by rsv infection , by inhibiting paf receptor expression . cam showed more potent suppression of rsv - induced s. pneumoniae adhesion and production of proinflammatory cytokines and chemokines than fosfomycin , as we reported previously [ 25 , 26 ] . notably , cam significantly suppressed rsv - induced il-6 production , whereas fosfomycin did not significantly . this finding may be caused by that cam is more potent than fosfomycin ; however , the actual reason for this disparity is not clear . the upregulation of paf receptor expression and the enhanced adhesion of pathogenic bacteria , such as s. pneumoniae , to respiratory epithelial cells are considered to be a major risk factor for secondary bacterial infections after primary respiratory viral infections . cam may suppress both secondary bacterial infections and immunological disorders induced by rsv , without suppressing viral replication . infection with other respiratory viruses , such as human parainfluenza virus 3 and rhinovirus , also upregulates known receptors for the pathogenic bacteria , including paf receptor and s. pneumoniae adhesion . on the other hand , influenza virus does not upregulate the known receptors for bacteria , whereas bacterial adhesion is increased by the infection . mccullers reported that influenza - induced bacterial adhesion to a549 cells was not inhibited by paf receptor antagonist , and the paf receptor knock - out mice did not show lower susceptibility to experimental secondary pneumonia caused by s. pneunimoae following influenza infection compared to the parent mice . lines of evidence suggest that adherent inducing mechanisms of s. pneumoniae to host respiratory epithelial cells are varied among viruses . we proposed that clarithromycin efficiently suppressed paf receptor - mediated streptococcus pneumoniae adhesion to respiratory epithelial cells as well as rsv - induced proinflammatory cytokine and chemokine production .
human respiratory syncytial virus ( rsv ) sometimes causes acute and severe lower respiratory tract illness in infants and young children . rsv strongly upregulates proinflammatory cytokines and the platelet - activating factor ( paf ) receptor , which is a receptor for streptococcus pneumoniae , in the pulmonary epithelial cell line a549 . clarithromycin ( cam ) , which is an antimicrobial agent and is also known as an immunomodulator , significantly suppressed rsv - induced production of interleukin-6 , interleukin-8 , and regulated on activation , normal t - cell expressed and secreted ( rantes ) . cam also suppressed rsv - induced paf receptor expression and adhesion of fluorescein - labeled s. pneumoniae cells to a549 cells . the rsv - induced s. pneumoniae adhesion was thought to be mediated by the host cell 's paf receptor . cam , which exhibits antimicrobial and immunomodulatory activities , was found in this study to suppress the rsv - induced adhesion of respiratory disease - causing bacteria , s. pneumoniae , to host cells . thus , cam might suppress immunological disorders and prevent secondary bacterial infections during rsv infection .
clinical pharmacologists play an important role in the development of these skills by teaching clinical pharmacology and therapeutics ( cp&t ) to undergraduate medical students . although the approaches to teaching cp&t have undergone many changes over the last decennia , it is essential that the actual teaching of cp&t continues to be a major part of the undergraduate medical curriculum . the learning objectives of cp&t teaching in terms of developing the therapeutic competencies of undergraduate medical students are described , with an emphasis on therapeutic decision - making . on the basis of current theories of cognitive psychology and medical education , context - learning the field of modern clinical pharmacology began to develop in the second half of the 19th century when physicians began to realise that agents such as heavy metals and plant extracts , then in use , more often made diseases worse instead of better . in 1969 , a study group on clinical pharmacology was convened by the world health organisation ( who ) in order to demarcate the scope of this relatively new discipline . they concluded that the tasks of the clinical pharmacologist include : ( 1 ) research into the action of drugs in humans , ( 2 ) services such as providing information on drugs and ( 3 ) teaching clinical pharmacology and therapeutics ( cp&t ) to medical students , hospital staff and physicians . while both research and services are important areas of clinical pharmacology , it is in their roles as teachers of cp&t to medical students that clinical pharmacologists have an extremely important effect on the development of rational prescribing by medical doctors . however , despite this importance , the undergraduate teaching of cp&t has not , in contrast to the two other functions of the clinical pharmacologist , achieved an international level of recognition [ 3 , 4 ] . the lesser attention given to teaching cp&t for example , only about 20 articles on teaching cp&t were published in the european journal of clinical pharmacology between 1980 and 2000 . in many medical schools , undergraduate students learn little about the therapeutic use of drugs and even after graduation , some doctors read little on the subject and rely too much on the promotional efforts and information from the pharmaceutical industry . as indicated by a survey conducted under the auspices of the who in 1989 , in european medical schools , an average of only 28 h was devoted to teaching clinical pharmacology , even though over 100 h were devoted to pharmacology [ 5 , 6 ] . however , the number of hours spent teaching cp&t is probably underestimated since clinical pharmacology and particularly therapeutics are taught implicitly during the clinical clerkships . the european association of clinical pharmacology and therapeutics ( eacpt ) was founded in 1993 to promote the field of cp&t . one of the important objectives of the eacpt was to develop cp&t in europe by improving and harmonising the teaching of the rational use of drugs at the undergraduate and postgraduate levels . an education subcommittee of the eacpt was subsequently established in 1997 to increase the amount of attention given to as well as the quality of teaching cp&t . the first task of this subcommittee was to identify the educational requirements of medical students in terms of cp&t . a positive consequence of the expanded attention for the teaching of cp&t has been the substantial increase of scientific publications on teaching cp&t during the past decade : there have been about 32 articles published between 2000 and 2007 in the european journal of clinical pharmacology , which is twice as many as during the preceding two decades . unfortunately , despite the increasing amount of attention being given to the teaching of cp&t , cp&t educational programmes are still not optimal in many medical schools . nowadays , many graduates still feel insufficiently prepared to assume prescription responsibilities after graduation . therefore , it is important to improve the undergraduate teaching in cp&t . in this review , we shall endeavour to indicate the essential aspects of teaching cp&t to undergraduate medical students . to this end , we first describe what is known about the general learning objectives in cp&t that medical students should master before graduation . subsequently , we focus on an essential ( in our opinion ) core learning objective : therapeutic decision - making. we go on to describe how medical students and physicians arrive at a therapeutic decision and discuss the possibilities of teaching medical students rational pharmacotherapy . finally , we recommend approaches for organising , presenting and assessing cp&t in the undergraduate medical curriculum . in many curricula , the teaching in clinical disciplines is centred on symptoms and diagnosis , and little or no time is given to the principles of drug treatment . in the past , cp&t was only taught as short courses in medical schools in which information was presented in the form of dogmatic indications of which drug to use and when . in some medical schools , however , clinical pharmacologists participated in basic pharmacology courses , usually given early in the clinical part of the curriculum . notwithstanding , much of the postgraduate and continuing education of the practicing physician has been left to the persuasive methods of the pharmaceutical industry . it was only in 1989 that the council for medical student education in clinical pharmacology and therapeutics stressed the importance of defining a core curriculum for clinical pharmacology in the medical curriculum . based on consensus between 40 clinical pharmacology teachers , nierenberg formulated a list of core knowledge , skills and attitudes that every medical student should master before graduation in order to be able to prescribe effectively and safely [ 8 , 9 ] . core knowledge in clinical pharmacology deals with the facts that are necessary to make rational and optimal therapeutic plans ; it includes the principles needed to organise these facts into useful information and to recognise when essential facts are missing [ 5 , 8 ] . core skills are in many ways similar to core knowledge because knowledge must be learned and used as the medical student develops skill in practicing rational therapeutics . core attitudes include attitudes about what constitutes valid information , what kind of information is likely to be in error and what new information must be continuously acquired from reliable sources . based on the learning objectives as formulated by nierenberg , a questionnaire on core learning objectives was subsequently developed in the united kingdom by walley . senior academic clinical pharmacologists who were active in teaching cp&t in the uk or ireland assessed the relative importance of each learning objective as an element of a core curriculum . this resulted in a list of core knowledge , skills and attitudes that largely matched the learning objectives as formulated by nierenberg . in addition to the approach of nierenberg and walley to defining the core curriculum in cp&t , orme described two other approaches to developing a core curriculum for cp&t . first , based on the who concept of an essential drug list , he developed two lists of drugs ; one list consisted of approximately 120 essential drugs that students would be expected to know in detail , and a shorter list consisted of drugs that students would be expected to be familiar with but were not required to know in any detail . this list of essential drugs was then examined by the education subcommittee of the eacpt . the second approach to defining a core curriculum for cp&t was the disease - based approach . three types of disease process were defined : ( 1 ) 67 diseases that were common and that the student must know how to manage ; ( 2 ) 158 diseases that were less common but that students must be able to diagnose , after which the appropriate therapy could be found in the literature ; ( 3 ) 36 diseases that were rare but that students should be aware of . defining a core curriculum for cp&t as presented by nierenberg , walley and orme is important to defining the shape and boundary of the discipline and may be helpful as part of a medical student 's examination . however , in addition to knowledge , physicians must also have prescribing skills in order to prescribe rationally . therefore , the who action programme on essential drugs has developed , in collaboration with the university of groningen , a manual for undergraduate medical students on the principles of rational prescribing , the so - called guide to good prescribing ( ggp ) . this manual provides a normative model for therapeutic reasoning and prescribing and provides a six - step guide to the process of rational prescribing that will be necessary throughout the clinical career of the medical student ( table 1 ) . all six steps are based on the core learning objectives , knowledge , skills and attitudes as formulated by nierenberg and walley and on positive experience in the netherlands [ 13 , 14 ] . table 1world health organisation six - step model of rational prescribing stepsdescriptionstep 1define the patient s problemstep 2specify the therapeutic objectivestep 3achoose your standard treatment ( p - drug)step 3bverify the suitability of your treatment ( p - drug)step 4start the treatmentstep 5give information , instructions and warningsstep 6monitor ( and stop ? ) treatment world health organisation six - step model of rational prescribing in addition , the content is based on an observational study among general practitioners and clinicians in the netherlands and on 10 years of experience with pharmacotherapy courses for medical students in dutch medical faculties and abroad . the ggp has also been reviewed and examined by a large body of international experts in the teaching of pharmacotherapy . as reported by de vries et al . , a short interactive training course in pharmacotherapy , using the ggp , was evaluated in a controlled study among 219 undergraduate international medical students . this study indicated that undergraduate students who used the ggp performed significantly better than students who did not used the ggp . in addition , students not only remembered how to solve old problems , but they could also apply their skills to new problems , a so - called transfer effect . a new framework for the innovation of medical curricula has been recently introduced , called the canmeds . the canmeds framework describes aspects of competence related to seven roles of a clinical specialist : the role of medical expert , communicator , health advocate , collaborator , manager , scholar and professional . despite the fact that many doctors agree with the importance of these aspects of competence and that many countries have already adopted the canmeds roles in their curricula , there is limited information on how these roles can be applied in an international context and in different specialities , such as cp&t . therefore , before clinical pharmacology as a discipline can adopt the canmeds competencies , the core learning objectives as determined in the last decades will have to be translated into the canmeds competencies . in conclusion , in order to improve the competency of future doctors to prescribe effectively and safely , several clinical pharmacologists have attempted to determine what every medical student should master before graduation . a common feature of all of the competencies formulated is that all students must acquire a knowledge of the clinical pharmacology of essential drugs and diseases and must master prescribing skills in order to become competent in the rational prescription of drugs . although , as described previously , there are many essential therapeutic skills , the final choice of a ( drug ) treatment for a patient can be looked upon as a core skill in therapeutics . in order to find effective ways to teach our future doctors , therapeutic decision - making or therapeutic reasoning is , together with diagnostic reasoning , an important part of the process of clinical reasoning . therapeutic reasoning can be defined as the step in clinical reasoning that pertains to the choice of therapy . however , in contrast to the process of diagnostic reasoning , which has been investigated extensively , little is known about the process of therapeutic reasoning . to our knowledge , the first attempt to investigate therapeutic reasoning in real practice was a small observational study carried out in 1984 in the netherlands . the results of this unpublished study constituted the basis for the development of the who six - step model . over 500 patient consultations by 25 general practitioners and 25 clinical specialists were observed and recorded . in addition , all doctors were interviewed about their therapeutic reasoning . based on this study , it became evident that doctors generally based their choice of ( drug ) treatment on two steps : ( 1 ) doctors initially used treatment guidelines or drug formularies as a starting point ; ( 2 ) this was followed by a verification of the suitability of this treatment for the individual patient and a modification of the choice of treatment if necessary ( for example , in case of co - morbidity or co - medication ) . moreover , it was also observed that the more experienced physicians knew more standard treatments by heart compared to less experienced physicians . the first study that described the process of how therapeutic decisions are made in practice in greater detail was performed by denig . by interviewing 169 different general practitioners and 72 hospital physicians , she studied how doctors arrive at a choice of drug and what factors influence this drug choice [ 19 , 20 ] . this study indicated that when a doctor is confronted with a diagnosis for example , a patient with both essential hypertension and a renal disorder he or she immediately thinks of a number of pharmacotherapeutic possibilities , referred to as the evoked set. depending on the diagnosis , the evoked set consists of 1.75 different pharmacotherapeutic options that are influenced by many factors , such as refresher courses , the literature , experience and advertisements from the pharmaceutical industry . the ultimate choice out of the evoked set for an individual patient may be either in contrast to the scarcity of information available on therapeutic decision - making , much research has been done on diagnostic reasoning . when an experienced doctor is confronted with a patient with certain symptoms and signs , so - called illness scripts are called up from memory . illness scripts contain clinically relevant information on diseases , their consequences , the context in which diseases develop , including the personal circumstances , and the experience of the doctor with previous patients . these scripts are generated by the frequent solving of diagnostic clinical problems [ 21 , 22 ] . based on recognition , experienced doctors are able to choose the right script for solving a specific diagnostic problem efficiently , particularly in routine cases . in order to verify whether this is the right script for the individual patient , two types of diagnostic reasoning may be used analytical reasoning is characterised as a slow and relatively time - consuming process that is carried out consciously and systematically and , if possible , evidence - based . less or inexperienced doctors , such as medical students , mostly use this type of reasoning , mainly because they do not possess the ability to call up so - called illness scripts. in contrast to analytical reasoning , non - analytical reasoning is carried out rapidly and subconsciously and is based on experience and pattern recognition . when an experienced doctor is confronted with a complex patient case , he or she will also use analytical reasoning . based on the similarities between therapeutic and diagnostic reasoning , it is possible to construct a hypothetical model of therapeutic reasoning ( fig . 1 ) . when the diagnosis has been determined , one or more treatment scripts will be called up from the memory . in order to determine the right treatment , an analytical or non - analytical process , or the chosen treatment and its effect will contribute to the modification of the existing treatment scripts or may result in a new treatment script . 1hypothetical model of therapeutic reasoning hypothetical model of therapeutic reasoning however , in order to validate this hypothetical model , further research should be performed , particularly in terms of how experienced doctors arrive at their choice of treatment . in addition , we need to find out how these experienced doctors differ from less - experienced doctors , such as medical students and interns . the answers to these questions will provide more insight into how we should teach therapeutics to students although it can already be stated that early clinical practice will support the development of treatment scripts by undergraduate medical students . gaining knowledge and at the same time applying this knowledge in practice is essential for learning in general and , presumably , also for the development of treatment scripts by medical students . this so - called context - learning seems to be more effective in many ways than sequential learning , in which learning and applying knowledge is separated [ 22 , 25 , 26 ] . the positive effect can be explained by theories from cognitive psychology and medical problem - solving [ 22 , 2628 ] . these theories suggest that the way in which knowledge is stored in the brain is essential for its recall and application . therefore , storing pharmacotherapeutic knowledge in combination with the situation in which this knowledge will be applied benefits the speed and quality with which the information is recalled [ 21 , 22 , 29 ] . context - learning is defined as learning in a setting that is similar to the setting of the future profession . context - learning is based on four basic principles : setting , repetition , feedback and responsibility . the setting in which therapeutics is taught or learned should be the same as or as similar as possible to the setting of the future profession ; for medical students , this is the clinical setting , such as in primary health care , hospitals or nursing homes . this clinical setting gives students the opportunity to gain experience the same way doctors do , allowing them to generate networks of organised knowledge in their memory and to develop illness and treatment scripts . subsequently , students should be given the opportunity to repeat the therapeutic problem - solving process as much as possible . frequent exposure to patients and pharmacotherapeutic problems gradually condense these networks into readily accessible therapeutic scripts . furthermore , students should also receive feedback immediately after their performance to assure the condensation of correct therapeutic scripts . argumentation and motivational feedback may be a rapid way to reveal the process of therapeutic thinking and its possible errors . it is the student 's own responsibility to repair any lack of knowledge or skills discovered during their clinical work and feedback sessions . apart from the most extreme form of context - learning , which is the clinical setting , different variations with lower levels of concreteness of the context are possible , varying from role - playing sessions with standardised patients in a simulated practice setting to the solution of written patient problems in small working groups and patient demonstrations during lectures . however , there are many ways to improve the setting , such as by using real case histories instead of written patient problems or through the use of video materials , laboratory test results or roentgenograms . one possible approach to organising a context - learning programme in therapeutics is described by vollebregt et al . . these authors described a context - learning programme consisting of weekly - organized , role - playing sessions in the form of consulting hours . the role - playing sessions consist of three phases : consultation , argumentation and feedback . first , a student doctor must carry out three therapeutic consultations of 10 min each . before the start of a consultation , subsequently , the student patient and student assessor enter the consultation room , and the doctor has to choose and prescribe the ( drug ) treatment interactively with the patient . , the doctor has to substantiate the chosen therapy . finally , during the third phase , all students sit together and discuss the various ( drug ) treatments and the performance of the doctors , guided by a clinical pharmacologist . in addition to teaching therapeutics , assessing students therapeutic knowledge and skills is an essential component of the medical curriculum . in 1990 , miller suggested a framework for clinical assessment ( fig . 2 ) . according to this framework , students , residents or physicians must have knowledge in order to carry out the required professional functions effectively . for example , they must develop the skill that is needed to acquire information from a variety of human and laboratory sources , to analyse and interpret data and , finally , to translate such findings into a rational diagnostic or therapeutic plan . furthermore , students must not only be able to demonstrate that they know and know how , but also to show how they do it when confronted with a patient , which is called performance . finally , it is important what a graduate actually does when functioning independently in clinical practice . according to miller , 2pyramid by miller as an illustrative framework for discussing the assessment of clinical skills , competence and performance pyramid by miller as an illustrative framework for discussing the assessment of clinical skills , competence and performance the objective structured clinical examination ( osce ) and structured clinical examinations in general are well - known and approved methods for assessing competence and performance . as far as the osce is concerned , this has also been shown to be useful for assessing therapeutic competence . nevertheless , it is important that the manner in which the students are assessed is as similar as possible to the approach used in teaching them . in conclusion , based on theories as to how physicians arrive at their therapeutic decisions , context - learning seems to be an effective way to teach cp&t to medical students . it is obvious that the ideal situation , i.e. real practice with real patients , is not always attainable , but various suboptimal forms of context - learning and assessment can be applied . in this document , the learning objectives of teaching cp&t to undergraduate medical students have been described , with an emphasis on therapeutic decision - making . based on current theories of cognitive psychology and medical education , we have also discussed context - learning as an effective approach to teaching medical students how to prescribe rationally . until recently , there were only two groups of people who were permitted to prescribe drugs registered medical practitioners and registered dental practitioners . since 2006 , some nurses , pharmacists and physician assistants have also been able to prescribe drugs for medical conditions within their area of competence . consequently , given this increasing number of registered prescribers with different qualifications , it has become increasingly important to train prescribers sufficiently in how to choose and prescribe drugs rationally . in addition , most curricula are changing from discipline- and subject - based teaching to competence and integrated or problem - based learning , resulting in less visibility of cp&t . the importance of teaching cp&t is further supported by the fact that many graduates still feel insufficiently prepared to assume prescribing responsibilities after graduation . furthermore , many hospital admissions and even deaths are caused by possibly avoidable medication errors . clinical pharmacologists should play an important role in the development of prescribing skills by teaching cp&t to undergraduate medical students . it is recommended that they formulate a cp&t context - learning curriculum within the medical curriculum of course , in collaboration with physicians . this curriculum must be based on the final learning objectives of the cp&t education programme in which the required level of therapeutic competence of medical graduates has been determined . in addition , the curriculum must fulfil the criteria of context - learning , i.e. gaining knowledge and skills simultaneously in a ( simulated ) clinical practice setting . furthermore , for the sake of clarity , it is stressed that the cp&t curriculum should be a visible part of the medical curriculum and that students must know , from the beginning , the required level of competence when they graduate . current medical students often do not recognise the various cp&t teaching activities since they are scattered through the medical curriculum . the emphasis lies on gaining cp&t knowledge and simultaneously learning to apply this knowledge by training skills in therapeutics . during this phase in the following study years , as cp&t knowledge and therapeutic skills increase , increased emphasis is given to prescribing in clinical practice , while the acquisition of knowledge and skills diminish . 3a design of a clinical pharmacology and therapeutics ( cp&t ) context - learning curriculum ( adapted from hjm van rossum ) a design of a clinical pharmacology and therapeutics ( cp&t ) context - learning curriculum ( adapted from hjm van rossum ) in conclusion , effective undergraduate teaching of cp&t is essential to improve rational prescribing and will immunize students against factors that may induce irrational prescribing after graduation . therefore , based on current knowledge about learning , cognitive psychology and research in therapeutic teaching , a cp&t curriculum should be a prominent part of the medical curriculum . the cp&t curriculum should also be linked to postgraduate and continuing education in order to maintain an optimal competence in rational prescribing after graduating . finally , to achieve a cp&t curriculum , allies should be found because clinical pharmacologists can and should not work on this alone . medical students are already allies ; they are interested in clinical pharmacology and really want to learn how to prescribe drugs rationally . physicians should also become allies , since they can provide the clinical context for teaching and can prevent students from copying the bad prescribing habits of some of the physicians that train medical students . associate clinical pharmacologists must collectively determine the current state and perspectives of the undergraduate education of cp&t in europe . to this end , a european research project , which is organised jointly by the eacpt and british pharmacological society , has recently been started . ultimately , clinical pharmacologists , students and physicians collectively may be able to convince the policy - makers , such as the faculty boards , of the need for a cp&t curriculum . such a joint effort is truly necessary because , unfortunately , the following words , spoken by miller in 1990 , are , to a great extent , still valid : it will not be easy to convince conservative medical faculties , reasonably comfortable with the current conventions that allow clinical impressions to substitute for systematic accumulation of behavioural evidence , that change ( in teaching , ed . ) is in order . the horizontal lines represent the three learning components : knowledge [ upper line : basic pharmacology , clinical pharmacology , therapeutics ( 1 ) and therapeutics ( 2 ) ] , clinical practice ( middle line : video patients , patient demonstrations , observation of consultations and prescribing drugs ) and skills [ lower line : prescription , drug formulary , prescribing ( 6-steps ) and cp&t literature ] . the vertical lines describe the simultaneous use of these three components in order to realise a context - learning curriculum . 4outline of a cp&t curriculum outline of a cp&t curriculum let us use the example of a clinical pharmacology department that provides a course of lectures in basic and clinical pharmacology during the first three years of a classical medical curriculum . the aim of the department is to expand its teaching activities and use the context - learning methodology as much as possible . therefore , the lectures in basic and clinical pharmacology must be transformed according to the criteria of context - learning , i.e. by adding patient cases ( clinical practice ) and prescription writing ( skills ) . p-450-dependent oxidation is placed into the clinical context by presenting a video of a patient case illustrating a drug interaction as the result of a wrong drug choice ( who step 3b ) . the lecture concludes by discussing the patient case according to the six - step approach , including how to write a new prescription . the clinical pharmacology lectures in the second and third year can be transformed in a similar way by presenting real patients , followed by lectures on different classes of drugs . simultaneously with the clinical pharmacology lectures , students must develop a personal drug formulary by , for example , using an e - learning programme . in the fourth year , students start on their clinical clerkships . in collaboration with their clinical colleagues , students must observe several consultations by clinicians in a structured way according to the who six - step approach and discuss these in small groups during therapeutic sessions with a clinical pharmacologist and/or physician . concurrently , students must follow a skills training programme in order to learn how to prescribe rationally ( six steps ) . during the clinical clerkships in the fifth and sixth years , prescriptions written by the students are evaluated by a clinical pharmacologist in collaboration with a physician and pharmacist during therapeutic sessions . finally , students must attend a course on how to evaluate cp&t literature and how they must apply this knowledge in practice . it is evident that in an integrated or problem - based medical curriculum it will be difficult to organise lectures . however , an advantage of this type of curriculum is that teaching is already centred on patient cases . as a result , clinical pharmacologists can introduce learning tasks with respect to basic and clinical pharmacology and therapeutics . in such a curriculum , it will probably be easier to train students in the six - step approach in small group - teaching sessions and practice prescribing in a clinical setting . obviously , there are various possibilities for context - learning teaching activities , and the above - mentioned are just a few examples of these . more detailed information on how to determine learning objectives for therapeutics and on methods for teaching and assessing therapeutics can be found in the who teacher s guide to good prescribing . in addition , this guide also provides information on how to mobilise support for changing and implementing a cp&t curriculum and how to perform research in this field .
backgroundthe rational prescribing of drugs is an essential skill of medical doctors . clinical pharmacologists play an important role in the development of these skills by teaching clinical pharmacology and therapeutics ( cp&t ) to undergraduate medical students . although the approaches to teaching cp&t have undergone many changes over the last decennia , it is essential that the actual teaching of cp&t continues to be a major part of the undergraduate medical curriculum.objectivesthe learning objectives of cp&t teaching in terms of developing the therapeutic competencies of undergraduate medical students are described , with an emphasis on therapeutic decision - making . on the basis of current theories of cognitive psychology and medical education , context - learning is presented as an effective approach by which to achieve therapeutic competencies . an example of a cp&t curriculum is presented .
allogeneic hematopoietic stem cell transplantation ( hsct ) is the treatment of choice for many hematological malignancies and primary immunodeficiencies . gvhd , the life - threatening and frequent complication of allogeneic hsct ( 1 ) , is due to mature donor t cells present in the transplant . however , removal of these t cells before grafting is rarely envisaged because it leads to graft failure ( 2 ) , prolonged immunosuppression ( 3 ) , and leukemia relapse ( 4 ) . to date , standard immunosuppressive treatments of gvhd , consisting in the administration of cyclosporin and methotrexate , are only partially effective ( 5 , 6 ) . this emphasizes the need to develop innovative therapeutic strategies to limit the pathological effects of donor - alloreactive t cells . mice that are rendered deficient for these cells develop multiple t cell mediated organ - specific autoimmune diseases ( 713 ) . the mechanism of action of these regulatory t cells is poorly understood and largely controversial . in vitro studies showed that these cells inhibit the activation of both cd4 and cd8 conventional cd25 t cells by acting either directly on target t cells or on apcs ( 13 , 14 ) . ctl antigen 4 or tgf- have been suggested to play a critical role in their t cell suppressive functions ( 15 , 16 ) . depending on the model of autoimmune disease , in vivo prevention of autoimmunity by regulatory cd4cd25 t cells has been shown to involve , or not involve , il-10 , il-4 , or tgf- ( 13 , 1719 ) . it is thus likely that more than one mechanism is involved in the immunosuppressive activity of these cells . three studies recently suggested that the cd4cd25 regulatory t cells could also control alloreactive responses . ( 20 ) showed that these cells have a modest capacity to down - regulate the activation of alloreactive - specific cd4 t cells in vivo . in addition , the transfer of cd4cd25 regulatory t cells from mice tolerant to allografts can protect syngeneic recipients from rejection of allogeneic islets and skin transplantation ( 21 , 22 ) . the capacity of these cells to control pathogenic effects of alloreactive t cells in vivo leads us to investigate whether these regulatory t cells could also control gvhd after allogeneic hsct . in this study , we show that the few cd4cd25 t cells naturally present in the transplant during allogeneic hsct regulate gvhd . the addition of cd4cd25 t cells at the time of grafting delays or even prevents the disease . these therapeutic effects were obtained with either fresh cells or ex vivo expanded cells specific to recipient - type alloantigens . thus , cd4cd25 regulatory t cells represent a new feasible , therapeutic tool for controlling gvhd . c57bl/6 ( b6 ; h-2 ) , balb / c ( h-2 ) , ( b6 dba/2 [ d2])f1 ( h-2 ) , and c3h ( h-2 ) mice were obtained from charles river laboratories . mice were manipulated according to european economic community guidelines . unless otherwise stated , experiments were performed as previously described ( 23 ) . in brief , 24 h after lethal irradiation of ( b6 d2)f1 ( 11 gy ) and b6 ( 10 gy ) or c3h ( 9.5 gy ) mice , recipients were transplanted with cells from b6 or balb / c donor mice , respectively . the transplants were constituted of 5 10 t cell depleted bone marrow ( bm ) cells , 10 10 t cells collected from pooled spleen and peripheral ln ( referred to as total t cells in the text ) , and when indicated , purified of cd4cd25 t cells . in control mice , the transplantation of only the t cell depleted bm cells did not induce gvhd . cells from the spleen and peripheral ln were sequentially incubated with saturating amounts of biotin - labeled anti - cd25 antibody ( 7d4 ; bd biosciences ) and streptavidin microbeads ( miltenyi biotec ) for 30 min on ice , followed by purification of magnetic cell separation using ls columns ( miltenyi biotec ) according to the manufacturer 's instructions . to increase cell purification , the cd25-depleted cells that did not bind to the anti - cd25coated beads were harvested from the flow through and contained < 0.3% cd4cd25 t cells . the fresh cd4cd25 t cells and the cd25-depleted cells were washed twice with pbs before injection in hsct . for in vivo cell expansion , cd4cd25 t cells were additionally enriched . cells were stained for 30 min on ice with fitc - labeled anti - cd4 ( gk1.5 ) , phycoerythrin - labeled anti - cd62l ( mel-14 ) , and streptavidin - cychrome ( all from bd biosciences ) , which bound to free biotin - labeled cd25 molecules uncoupled to beads . the cd4cd25cd62l t cells were sorted on a facstar ( becton dickinson ) , giving a purity of 99% . highly purified cd4cd25cd62l t cells from b6 or balb / c mice were stimulated with total splenocytes from ( b6 d2)f1 or c3h and b6 mice , respectively . cultures were performed in rpmi 1640 ( gibco brl ) supplemented with 10% fcs ( gibco brl ) , l - glutamine , antibiotics , 10 mm hepes , 5 10 m 2--mercaptoethanol , and 30 ng / ml mouse il-2 ( r&d systems ) . at the beginning , 10 cd4cd25cd62l t cells / ml were cocultured with 2 10 irradiated ( 20 gy ) splenocytes / ml . after 5 d of culture , cells were counted and cell density was adjusted to 10/ml with fresh medium if necessary . at day 8 , cells were reseeded at 0.1 10/ml and restimulated with 2 10 irradiated splenocytes / ml . after 4 d , cells were counted and cell density was adjusted to 0.2 10/ml with fresh medium if necessary . cells were analyzed by flow cytometry after staining with fitc - labeled anti - cd4 ( gk1.5 ) , phycoerythrin - labeled anti - cd62l ( mel-14 ) , and streptavidin - cychrome ( all from bd biosciences ) on a facscalibur ( becton dickinson ) , or washed twice in pbs and used for hsct . cd4cd25cd62l cells purified from balb / c mice were stimulated for 15 d by irradiated c3h or b6 splenocytes as described above . 10 t cells of both cultures were then restimulated by either 10 irradiated c3h or b6 splenocytes in the presence of 30 ng / ml il-2 in flat - bottom 96-well plates for 4872 h , and then pulsed with methyl-[h]thymidine for the last 15 h. cd4cd25cd62l cells purified from balb / c mice and stimulated by irradiated c3h splenocytes for 5 wk were also tested for their in vitro suppressive activity . after two washes to remove il-2 , different numbers of expanded regulatory t cells were added to the culture of 4 10 fresh , cd25-depleted t cells ( purified from balb / c spleen and lns ) stimulated by 10 irradiated c3h splenocytes without il-2 . cells cultured in round - bottom 96-well plates for 72 h were pulsed with methyl-[h]thymidine for the last 6 h. statistical analyses were performed using statview software ( sas inc . ) . c57bl/6 ( b6 ; h-2 ) , balb / c ( h-2 ) , ( b6 dba/2 [ d2])f1 ( h-2 ) , and c3h ( h-2 ) mice were obtained from charles river laboratories . mice were manipulated according to european economic community guidelines . unless otherwise stated , experiments were performed as previously described ( 23 ) . in brief , 24 h after lethal irradiation of ( b6 d2)f1 ( 11 gy ) and b6 ( 10 gy ) or c3h ( 9.5 gy ) mice , recipients were transplanted with cells from b6 or balb / c donor mice , respectively . the transplants were constituted of 5 10 t cell depleted bone marrow ( bm ) cells , 10 10 t cells collected from pooled spleen and peripheral ln ( referred to as total t cells in the text ) , and when indicated , purified of cd4cd25 t cells . in control mice , the transplantation of only the t cell depleted bm cells did not induce gvhd . cells from the spleen and peripheral ln were sequentially incubated with saturating amounts of biotin - labeled anti - cd25 antibody ( 7d4 ; bd biosciences ) and streptavidin microbeads ( miltenyi biotec ) for 30 min on ice , followed by purification of magnetic cell separation using ls columns ( miltenyi biotec ) according to the manufacturer 's instructions . to increase cell purification , the cd25-depleted cells that did not bind to the anti - cd25coated beads were harvested from the flow through and contained < 0.3% cd4cd25 t cells . the fresh cd4cd25 t cells and the cd25-depleted cells were washed twice with pbs before injection in hsct . for in vivo cell expansion , cd4cd25 t cells were additionally enriched . cells were stained for 30 min on ice with fitc - labeled anti - cd4 ( gk1.5 ) , phycoerythrin - labeled anti - cd62l ( mel-14 ) , and streptavidin - cychrome ( all from bd biosciences ) , which bound to free biotin - labeled cd25 molecules uncoupled to beads . the cd4cd25cd62l t cells were sorted on a facstar ( becton dickinson ) , giving a purity of 99% . highly purified cd4cd25cd62l t cells from b6 or balb / c mice were stimulated with total splenocytes from ( b6 d2)f1 or c3h and b6 mice , respectively . cultures were performed in rpmi 1640 ( gibco brl ) supplemented with 10% fcs ( gibco brl ) , l - glutamine , antibiotics , 10 mm hepes , 5 10 m 2--mercaptoethanol , and 30 ng / ml mouse il-2 ( r&d systems ) . at the beginning , 10 cd4cd25cd62l t cells / ml were cocultured with 2 10 irradiated ( 20 gy ) splenocytes / ml . after 5 d of culture , cells were counted and cell density was adjusted to 10/ml with fresh medium if necessary . at day 8 , cells were reseeded at 0.1 10/ml and restimulated with 2 10 irradiated splenocytes / ml . after 4 d , cells were counted and cell density was adjusted to 0.2 10/ml with fresh medium if necessary . cells were analyzed by flow cytometry after staining with fitc - labeled anti - cd4 ( gk1.5 ) , phycoerythrin - labeled anti - cd62l ( mel-14 ) , and streptavidin - cychrome ( all from bd biosciences ) on a facscalibur ( becton dickinson ) , or washed twice in pbs and used for hsct . cd4cd25cd62l cells purified from balb / c mice were stimulated for 15 d by irradiated c3h or b6 splenocytes as described above . 10 t cells of both cultures were then restimulated by either 10 irradiated c3h or b6 splenocytes in the presence of 30 ng / ml il-2 in flat - bottom 96-well plates for 4872 h , and then pulsed with methyl-[h]thymidine for the last 15 h. cd4cd25cd62l cells purified from balb / c mice and stimulated by irradiated c3h splenocytes for 5 wk were also tested for their in vitro suppressive activity . after two washes to remove il-2 , different numbers of expanded regulatory t cells were added to the culture of 4 10 fresh , cd25-depleted t cells ( purified from balb / c spleen and lns ) stimulated by 10 irradiated c3h splenocytes without il-2 . cells cultured in round - bottom 96-well plates for 72 h were pulsed with methyl-[h]thymidine for the last 6 h. cd4cd25 t cells represent 510% of the normal t cell compartment in mice and humans ( 7 , 24 ) . during allogeneic hsct we first analyzed whether this population plays a role in the control of gvhd . in our murine model , cd4cd25 t cells represent 35% of the donor cells collected from the spleen and ln . the incidence of gvhd was compared after the allogeneic hsct of lethally irradiated ( b6 d2)f1 mice receiving bm cells with either total donor t cells or cd25-depleted donor t cells from b6 mice . in this semiallogeneic combination between donor and recipient , the infusion of 10 10 total t cells induced lethal gvhd ( fig . 1 ) . all mice had ongoing clinical signs of gvhd and were dead by day 41 . when the mice were grafted with the same number of cd25-depleted t cells , the onset of clinical signs of gvhd such as weight loss , diarrhea , and hunching , appeared much sooner and all mice were dead by day 21 after transplantation ( fig . 1 ) . this result revealed an unforeseen effect of cd4cd25 regulatory t cells present in the transplant , i.e. , they play a major role in the control of gvhd . cd4cd25 regulatory t cells naturally present in the transplant modulate gvhd . lethally irradiated ( b6 d2)f1 mice were grafted with semiallogeneic b6 bm cells supplemented with either 10 10 b6 t cells ( ; n = 10 ) or 10 10 cd25-depleted b6 t cells ( ; n = 10 ) . kaplan - meier survival curves were established for each group with the indicated p - values . the effect of regulatory t cells on gvhd after hsct suggested their potential use for therapeutic intervention . therefore , we investigated whether gvhd would be delayed if additional numbers of cd4cd25 t cells were injected . first , we verified that cd4cd25 t cells did not induce gvhd . when lethally irradiated mice were grafted with a bm transplant supplemented with 5 10 cd4cd25 purified t cells , no gvhd was observed ( unpublished data ) in accordance with a previous report ( 20 ) . we then grafted irradiated ( b6 d2)f1 mice with bm cells and 10 10 t cells supplemented with 5 10 cd4cd25 purified t cells from b6 mice . these mice remained healthy until about day 25 , as opposed to the control mice ( bm cells plus total t cells ) , which rapidly developed clinical signs of gvhd from days 8 to 10 ( unpublished data ) . significantly , two out of four mice receiving additional regulatory t cells survived without any additional treatment ( fig . 2 a ) . when these two mice were killed at day 60 , we did not observe any histopathological signs of gvhd in the liver , a target organ of gvhd , and one mouse displayed moderate signs of gvhd in the spleen ( unpublished data ) . we reproduced this experiment with a different genetic combination . when c3h mice were grafted with balb / c donor cells , gvhd - related mortality occurred very fast in the control group transferred with bm cells and 10 10 t cells ( 100% of the mice died by day 10 ) . the addition of 5 10 cd4 cd25 purified t cells significantly delayed mortality compared with the control group . clinical signs of gvhd were not observed before day 29 and no mice died until day 35 ( fig . altogether , these results demonstrate that the sole addition of fresh cd4cd25 regulatory t cells significantly delays or even prevents gvhd after allogeneic hsct . prevention of gvhd by the addition of fresh cd4cd25 regulatory t cells . lethally irradiated mice were grafted with allogeneic bm cells supplemented with either 10 10 t cells ( ; n = 5 ) or 10 10 t cells and 5 10 freshly isolated cd4cd25 t cells ( ; n = 4 ) . ( a ) survival of ( b6 d2)f1 recipients transplanted with semiallogeneic b6 cells . ( b ) survival of c3h recipients transplanted with fully allogeneic balb / c cells . a major limitation in the potential use of regulatory t cells for preventing gvhd is the difficulty in obtaining a sufficient number of these relatively rare cells . we chose to stimulate these cells by allogeneic apcs in the presence of il-2 with the aim to increase their number ( 2427 ) and specificity to recipient - type alloantigens . we started with highly purified populations of cd4cd25cd62l t cells constituting the major fraction of the cd4cd25 regulatory t cells ( 26 ) to limit the contamination with conventional activated cd4cd25cd62l t cells ( 28 ) . the cells purified from balb / c or b6 mice were then cocultured with irradiated c3h or ( b6 d2)f1 splenocytes , respectively . in both cultures , 10 balb / c cd4cd25 t cells , we were able to produce 100 10 regulatory t cells ( 20-fold expansion ) after 15 d of culture . in the same manner , the number of b6 cd4cd25 t cells was increased 10-fold during the first 2 wk and 100-fold during the next 2 wk of culture ( fig . similar expansion was observed in another genetic combination , in which balb / c cd4cd25 t cells were stimulated by b6 splenocytes ( unpublished data ) . importantly , these cells kept the phenotype of regulatory t cells because they expressed even higher levels of cd25 and most of them maintained high levels of cd62l expression ( fig . interestingly , the absence of down - regulation of cd62l expression after repeated activation could be an intrinsic characteristic of these regulatory t cells . because regulatory t cells were stimulated by allogeneic splenocytes , we tested whether this population was enriched in cells responding preferentially to these alloantigens . after 2 wk of culture of balb / c regulatory t cells stimulated by irradiated c3h apcs , these cells did not respond to b6 apcs after short - term stimulation , although they continued to proliferate to c3h apcs . we then analyzed whether these ex vivo expanded regulatory t cells maintained their in vitro suppressive properties . when added to a culture of fresh cd25 t cells stimulated by allogeneic apcs ( a ) 0.2 10 b6 ( ) or 5.5 10 balb / c ( ) purified cd4cd25cd62l t cells were stimulated with il-2 and irradiated splenocytes from ( b6 d2)f1 or c3h mice , respectively . ( b ) flow cytometry analyses for the expression of cd4 , cd25 , and cd62l ( inset ) on total cells and cd4cd25cd62l t cells after cell sorting ( fresh ) and after 2 wk of stimulation with allogeneic irradiated splenocytes and il-2 ( cultured ) . ( c ) cd4cd25cd62l t cells from balb / c mice were stimulated with c3h apcs ( left ) or b6 apcs ( right ) . after 2 wk of culture , t cells were restimulated with either the same allogeneic apcs ( ) or third - party allogeneic apcs ( ; b6 on the left and c3h on the right ) . proliferation was assessed after 2 , 2.5 , or 3 d of stimulation . in both assays , t cell proliferation to third - party allogeneic apcs in the presence of il-2 , and the one obtained in the culture without apcs in the presence of il-2 , was comparable and below 10,000 cpm . ( d ) a constant number of balb / c cd25-depleted cells ( effector t cells ) was stimulated by c3h apcs . cells were cocultured with different numbers of balb / c - expanded cd4cd25 t cells to assess their suppressive activity at different ratios between regulatory t cells and effector cells . inhibition of the proliferation of effector t cells as compared with the culture without regulatory t cells ( 10,125 cpm ) is shown . to test the capacity of the ex vivo expanded cd4 cd25cd62l t cells to regulate gvhd , we performed experiments similar to those presented in fig . 2 using cultured cd4cd25cd62l t cells instead of freshly isolated cd4cd25 t cells . in the b6b6 d2)f1 combination , the addition of 7 10 cd4cd25 t cells cultured in the presence of recipient - type alloantigens to bm cells and 10 10 t cells remarkably prolonged mouse survival compared with the control group ( fig . 4 a ) . this observation was confirmed when balb / c regulatory t cells cultured in the presence of c3h alloantigens were used to modulate gvhd in the balb / cc3h combination . we then tested whether the regulation of gvhd required the use of regulatory t cells specific to recipient - type alloantigens . in the balb / c b6 combination , the addition of 7 10 balb / c regulatory t cells cultured in the presence of b6 alloantigens significantly delayed the occurrence of gvhd , which confirmed the capacity of specific regulatory t cells to regulate gvhd in a third genetic combination . in comparison , the addition of 7 10 balb / c regulatory t cells cultured in the presence of third - party c3h alloantigens had no effect on gvhd mortality in the balb / c b6 combination . this control culture also shows that the sole injection of ex vivo expanded cd4 t cells was not sufficient to regulate gvhd . remarkably , in the three genetic combinations , the mice that had received cd4cd25 regulatory t cells cultured in the presence of recipient - type alloantigens appeared completely healthy for several weeks . their clinical status then suddenly and rapidly deteriorated and they finally developed clinical signs of severe gvhd . thus , although the use of ex vivo expanded cd4cd25 t cells significantly delayed gvhd , it did not preclude the occurrence of a delayed severe gvhd . this suggests that ex vivo expanded regulatory t cells have a limited half - life after adoptive transfer and sequential injection of these cells should be required to induce long - term protection from gvhd . nevertheless , we observed that the clinical status of mice receiving cultured regulatory t cells improved compared with mice receiving fresh regulatory t cells injected in comparable proportions ( 5 and 7 million for fresh and cultured cells , respectively ) during the first few weeks after transfer ( unpublished data ) . in sum , these results demonstrate that a high number of cd4cd25 t cells can be generated ex vivo without altering their phenotype nor their regulatory property toward gvhd . regulation of gvhd by the addition of expanded cd4cd25 regulatory t cells . at the end of the culture ( days 15 and 28 for regulatory t cells from balb / c and b6 mice , respectively ) ( a ) lethally irradiated mice were grafted with allogeneic bm cells supplemented with either 10 10 fresh t cells ( ; n = 5 per group ) or 10 10 fresh t cells and 7 10 expanded cd4cd25 t cells ( ; n = 5 per group ) . for both genetic combinations , ( b ) lethally irradiated b6 mice were grafted with balb / c bm cells and 10 10 fresh babl / c t cells ( , gvhd control group ; n = 5 ) supplemented with 7 10 expanded regulatory t cells derived from cultured cd4cd25 t cells stimulated by c3h splenocytes ( , nonspecific regulatory t cells ; n = 5 ) , or b6 splenocytes ( , specific regulatory t cells ; n = 5 ) . the difference in survival between the gvhd control group and mice receiving nonspecific cd4cd25 t cells is statistically insignificant . when statistically significant , kaplan - meier survival curves were established with the indicated p - values . so far , cd4cd25 regulatory t cells have been shown to regulate both autoimmune diseases ( 7 , 8) and the rejection of allogeneic solid organ transplantation ( 21 , 22 ) . in this study , we show that the few regulatory t cells naturally present in the inoculum during allogeneic hsct significantly delay the occurrence of gvhd and associated mortality , and can be used in cell therapy . it should be noted that even if these cells are regarded as having a major therapeutic potential in autoimmune diseases , such effect has only been demonstrated to date in cd25-deficient animals ( 79 ) . cd4cd25 regulatory t cells have also been demonstrated to efficiently prevent the rejection of allogeneic solid organ transplants , but this effect was obtained with cells purified from mice that had previously received an in vivo treatment for tolerance induction ( 21 , 22 ) . thus , our work is the first report demonstrating that the addition of freshly isolated regulatory t cells from unmanipulated animals can control an immunopathology in a model mimicking a clinical setting . in gvhd , we obtained a therapeutic effect after the addition of regulatory t cells in similar proportions to donor t cells . furthermore , our results suggest that repeated injections of regulatory t cells could be required for long - term protection from gvhd . thus , the purification of sufficient numbers of regulatory t cells could be a bottleneck for applying this strategy to humans . indeed , 3 billion t cells are usually present in the infused transplant , whereas a maximum of 100 million cells of fresh regulatory t cells could be collected from the blood of the same donor . to date , the only realistic use of these cells in humans would be to expand them ex vivo . this led us to test the functionality of cd4cd25 regulatory t cells in gvhd after their ex vivo expansion . previous reports demonstrated that cultured regulatory t cells from both mice and humans remain functional after expansion , but their suppressor activity was only shown in in vitro assays ( 2427 ) . here , we show for the first time that extensively expanded regulatory t cells can still be used to modulate an immunopathological process in vivo and could consequently be envisaged as a new therapeutic tool when a large number of regulatory t cells is required . the ex vivo expansion of regulatory t cells stimulated by recipient - type alloantigens presents three additional advantages . first , the repertoire of regulatory t cells specific to recipient alloantigens can be selected , whereas nonalloreactive cells die during the culture in the absence of tcr - mediated activation as suggested in this study . in this case , the regulatory effects of these expanded cells could be preferentially targeted to the pathogenic donor t cells specific to the recipient alloantigens . as a result , gvhd would be controlled without altering the immune reconstitution after allogeneic hsct . second , the extensive proliferation of regulatory t cells during culture is compatible with retroviral gene transfer . this offers the possibility to transduce these cells with suicide genes , for example , to control or eliminate them in case of significant side effects after their injection ( 29 ) . finally , the possibility to produce high numbers of regulatory t cells should provide versatility in designing therapeutic schemes adapted to different clinical setting of allogeneic hsct . our results suggest that the therapeutic use of cd4cd25 regulatory t cells could not only be envisaged in putative pathologies linked to a deficiency of these cells , but also for the treatment of multiple t cell dependent immunopathologies .
cd4+cd25 + immunoregulatory t cells play a pivotal role in preventing organ - specific autoimmune diseases and in tolerance induction to allogeneic organ transplants . we investigated whether these cells could also control graft - versus - host disease ( gvhd ) , the main complication after allogeneic hematopoietic stem cell transplantation ( hsct ) . here , we show that the few cd4+cd25 + t cells naturally present in the transplant regulate gvhd because their removal from the graft dramatically accelerates this disease . furthermore , the addition of freshly isolated cd4+cd25 + t cells at time of grafting significantly delays or even prevents gvhd . ex vivo expanded cd4+cd25 + regulatory t cells obtained after stimulation by allogeneic recipient - type antigen - presenting cells can also modulate gvhd . thus , cd4+cd25 + regulatory t cells represent a new therapeutic tool for controlling gvhd in allogeneic hsct . more generally , these results outline the tremendous potential of regulatory t cells as therapeutics .
each year 300 million to 3 billion people are infected and more than 600,000 die , making malaria the most important vector - borne disease in the world . of the five parasites that infect humans ( p. falciparum , p. vivax , p. malariae , p. ovale , and p. knowlesi ) , p. falciparum causes the most severe disease and the most morbidity and mortality . its manifestations range from asymptomatic to fatal infection [ 4 , 5 ] and there are major gaps in our understanding of its pathogenesis and the changes in gene expression responsible for the host response that are the focus of this study [ 7 , 8 ] . previous studies have shown that humans with malaria release proinflammatory mediators , such as tumor necrosis factor ( tnf ) , interferon gamma ( ifn- ) , and nitric oxide ( no ) , which may damage organs such as brain , lung , and kidney , and suggest that the levels of these mediators are related to the severity of disease [ 913 ] . potential parasite virulence factors include the glycolipids that anchor parasite proteins to the red cell surface [ 14 , 15 ] , var genes [ 16 , 17 ] , and hybrid sequences in parasite proteins on the surface of parasitized red blood cells ( block 2 region of merozoite surface protein 1 [ oa koita : personal communication ] ) . however , until now , it has been difficult to study host gene expression in malaria because methods available could examine only a few genes at a time ( northern blots , reverse transcriptase pcr ) . in contrast , cdna and oligonucleotide microarrays [ 19 , 20 ] permit examination of the entire human transcriptome . to examine host gene expression in malaria , it was necessary to examine and resolve ( 1 ) effects of ambient temperatures > 45c on rna stability , ( 2 ) transport of rna preparations from malarious areas to the u.s . , ( 3 ) potential confounding by host genomic differences and host variation in gene expression , ( 4 ) the effects of antimalarial treatment on host gene expression , and ( 5 ) potential false - positive and false - negative microarray results . venous blood samples ( 3 ml ) were drawn from children 316 years of age with uncomplicated malaria and transferred to tubes containing ficoll - hypaque ( cpt tube 362760 , becton dickinson ) . after centrifugation at 1,500 g for 20 min at room temperature , peripheral blood mononuclear cells ( pbmcs ) formed a 1 - 2 mm layer 5 mm above the gel separator which was aspirated manually ( samco pipet 335 , san fernando , ca ) , mixed with 1.3 ml rnalater ( ambion , austin , tx ) , and stored at 0c ( ice - water bath ) . within 2 hours , rna was isolated from this suspension using the ribopure - blood kit ( ambion ) . was assessed by agarose gel ( figure 1 ) and od 260/280 ratios in mali . samples with distinct 18s and 28s bands on agarose gel and od 260/280 ratios 1.7 were stored in sodium acetate : ethanol ( 0.1 vol 3 m sodium acetate , [ ph 5.2 ] : 2.5 vol 98% ethanol ) at 20c until transport to new orleans where they were stored at 20c for 4 weeks . rna was purified by ethanol precipitation , followed by cleanup with the rneasy kit ( qiagen ) . rna was then reexamined using the rna 6000 nano marker green kit ( 256,000 nt standards , ambion ) and the 2100 bioanalyzer ( agilent technologies , waldbronn , germany ) to identify 18s and 28s ribosomal peaks on the electropherogram and estimate the rna integrity number ( rin ) . samples with well - defined 18s and 28s peaks on the electropherogram , 1.0 g rna , and rins 6.5 were converted to biotinylated crna and hybridized ( figure 1 ) . double - stranded cdna was synthesized using the superscript system ( invitrogen ) , purified by phenol : chloroform extraction , and concentrated by ethanol precipitation . in vitro transcription was used to produce biotin - labeled crna ( genechip in vitro transcription labeling kit , affymetrix ) . biotinylated crna was cleaned ( rneasy ) , fragmented , and hybridized on hg - u133 plus 2.0 chips ( affymetrix ) . after washing , chips were stained with streptavidin - phycoerythrin , amplified with biotinylated anti - streptavidin ( vector laboratories ) , and scanned for fluorescence ( genechip scanner 3000 ) using the genechip operating software , version 1.0 ( gcos ) . fluorescence intensities for perfect match ( pm ) and mismatch ( mm ) nucleotides were used to determine whether mrna for specific genes was present ( p ) , marginally present ( m ) or absent ( a ) . scanned images were transferred to dchip [ 2325 ] and corrected for image discontinuities . to compare results across chips , one array was chosen as baseline ( 147c , median intensity 167 ) to which others were normalized by calculating expression values based on pms and mms . negative results were assigned a value of one . was performed to identify genes with changes in expression between ( 1 ) acute illness ( a ) and recovery ( c ) , ( 2 ) acute illness ( a ) and treatment ( b ) , or ( 3 ) treatment ( b ) and recovery ( c ) based on 90% confidence in a 1.5-fold change in fluorescence ( p < 0.01 ) and a p - call 70% for samples with up- or downregulation . samples were permuted 100 times to estimate the false discovery rate which was 0.0% ( median ) , 90% ci : 16.425.2% . the three sets of genes were then combined by removing duplicate genes and genes with redundant probe sets . expression values were standardized by adjusting samples linearly to a mean of zero with a standard deviation of one and by determining correlation coefficients ( r values ) for normalized expression ( intergenic distances defined as 1 r ) . genes with the shortest distances between them were merged into supergenes , connected in dendrograms using lengths proportional to genetic distance ( centroid - linkage ) , and repeated n 1 times to cluster all genes . five patterns of expression on the heat maps were examined for gene ontology ( go ) term enrichment across the entire microarray by using the exact hypergeometric distribution ( significant p values < 0.01 ) . was based on acute illness samples and used analysis of variance ( p values 0.01 and p - calls 20% ) ; hierarchical clustering was used to identify patterns of expression and to test for go term enrichment . identified genes with differences in expression between acute illness and recovery based on ( 1 ) 90% confidence in 2-fold changes in expression ( up or down ) and ( 2 ) p - calls of 100% for the samples in which genes were up- or downregulated . included 4 subjects who received chloroquine and one who received placebo ( 5% dextrose in saline ) . after normalization based on sample 2405a ( median intensity 153 ) , crna from these subjects was analyzed similarly using dchip . was performed with taqman low density arrays using cdna prepared from total rna ( iscript kit , bio - rad ) , loaded in low density cards , and run on an abi 7900 ht real - time thermocycler using 50100 ng cdna per well . data were normalized using endogenous 18s cdna as the control to calculate fold changes between samples with 95% cis for genes with valid threshold cycle data for 3 or more of 4 replicates ( based on acute illness or recovery samples ) . genes with changes in expression that overlapped the baseline sample ( based on the 95% ci ) were excluded from the subsequent analyses . identification of infected subjects was performed at the banconi clinic in bamako using giemsa - stained thick blood smears , a positive parasite antigen test , and pcr for the polymorphic block 2 region of msp1 . informed consent was obtained before enrollment from the parents or guardians of children with uncomplicated p. falciparum malaria using a protocol approved by the mali irb in bamako and the tulane irb in new orleans . to control for host genomic variation and variation in gene expression , three samples were obtained from each subject ( figure 1 ) : ( 1 ) an acute sample at the time of diagnosis on day 1 before beginning treatment ( a ) , ( 2 ) a treatment sample on day 3 or 4 after completion of the 3-day course of treatment ( b ) , and ( 3 ) a recovery sample 710 days after treatment ( c , no signs or symptoms of malaria , no asexual parasites on the thick smear ) . the recovery sample served as the baseline to which the other samples were compared to identify changes from baseline ( normal ) gene expression . relevant clinical data , including parasitemia and temperature ( table 1 ) , were obtained at the time of diagnosis and during follow - up visits . to control for the effects of antimalarials on gene expression , uninfected healthy controls were identified in the village of missira in the kolokani district ( 160 km nw of bamako ) based on a negative giemsa - stained thick smear , negative parasite antigen test , and the absence of symptoms or signs of malaria . after obtaining consent , these subjects were enrolled in the study and randomized to receive either chloroquine or placebo ( 5% dextrose in saline ) . identified three sets of genes with 1.5-fold changes between ( 1 ) acute illness and treatment ( n = 127 ) , ( 2 ) acute illness and recovery ( n = 67 ) , or ( 3 ) treatment and recovery ( n = 57 ) . these three sets of genes ( = 251 ) contained 219 unique genes , which were reduced to 182 by removing redundant probes . conversely , when these criteria were used with samples from uninfected controls , only one gene was identified , indicating that antimalarial treatment produced no identifiable changes in gene expression . gene expression patterns in the treatment and recovery groups ( b and c ) clustered closest to each other , with the acute illness group ( a ) being most distant . however , those patterns were not observed with the uninfected controls . hierarchical clustering indicated that the uninfected controls were most similar to the recovery samples ( c ) and thus the recovery samples provided an accurate profile of gene expression in healthy subjects . hierarchical clustering of these 182 genes identified five expression profiles , four of which were linked to gene ontology ( go ) categories such as host immune response or apoptosis ( figure 2 ) . these four profiles included ( 1 ) genes upregulated during acute illness ( a ) , ( 2 ) genes upregulated during both acute illness and treatment ( ab ) , ( 3 ) genes upregulated during both treatment and recovery ( bc ) and ( 4 ) genes upregulated only at the time of recovery ( c ) . the fifth profile ( b ) , which contained genes upregulated only during treatment , was not included in the subsequent analyses because those genes were scattered across gene ontology categories . expression profile a ( 79 upregulated genes , 65 in 41 go categories ) included genes involved in the innate immune response , effector cell activation , and chemotaxis : leukocyte immunoglobulin - like receptor ( lir ) family , neutrophil / monocyte / macrophage chemotactic chemokine receptor - like 2 ( ccrl2 ) , toll - like receptor 5 ( tlr-5 ) , aquaporin 9 , complement component receptor c3ar1 , acute - phase cytokine il-6 , and the il-1 receptor antagonist . expression profile ab ( 44 upregulated genes , 41 in 25 go categories ) included genes involved in the immune response , apoptosis , and cell death . immune response genes included complement components c1qa , c1qb , c1qg , and c2 , chemokine ligand cxcl16 , and fc iii -receptors cd16a and cd16b . upregulated apoptosis- and cell death - related genes included bcl2-related x - protein ( bax ) , bh3 interacting domain death agonist ( bid ) , baculoviral iap repeat - containing 5 ( survivin ) , and caspase 5 . expression profile bc ( 7 upregulated genes , 7 in 13 go categories ) included genesinvolved in cellular development and the response to injury such as myosin regulatory protein myl9 , bone morphogenic protein 6 , thrombospondin 1 , and the oxytocin receptor . expression profile c ( 31 upregulated genes , 27 in 7 go categories ) includedgenes upregulated at recovery ( 1014 days after acute illness ) such as human leukocyte antigens hla - doa and hla - dob , transcription factor 7 , cd6 , cd1c antigen , and the fc ige receptor , fcer1a . based on pathway analyses , a number of cytokine and inflammatory response genes were upregulated , including il-6 , il-10 , il-1 , and tnf ( figure 3 ) . examination of the apoptosis pathway ( figure 4 ) demonstrated simultaneous upregulation of genes that facilitate apoptosis ( bax , nf-1b , tnf sf10 , gzm b , and tnf ) and concomitant downregulation of genes that inhibit apoptosis ( c - myc , tnf r sf25 , irf4 , kbbkg , caspase 8 , and fas ligand g ) . genmapp analyses revealed differences in the inflammatory and apoptosis pathways between subjects with low parasitemias and subjects with medium or high parasitemias . within the inflammatory , immune response , and host response pathways , the differences were most striking for acute phase mediators such as ifn- , il-1 , il-1 , il-6 , il-7 , il-10 , il-15 , and tnf ( figures 3(a)-3(b ) ) . within the apoptosis pathway , the differences were most striking for tp53 ( p53 ) , fas , fas ligand , mcl1 , caspases 6 , 8 , and 10 , tnf , and tnfsf10b and 25 ( figures 4(a)-4(b ) ) . similar upregulation was observed in subjects with elevated temperatures ( < 39c versus 39c , data not shown ) . quantitative real - time pcr using taqman low density arrays demonstrated excellent correlations between the changes observed in the microarrays and low density arrays . the magnitudes of changes ( fold increase or decrease ) in gene expression in the inflammatory response and apoptosis pathways varied similarly with parasitemia in both the microarrays ( figures 3 - 4 ) and the low density arrays ( data not shown ) . the effects of ambient temperatures > 45c in mali on rna quality were addressed by rapid sample processing , by storage of pbmc preparations at 0c in rnalater until the time of rna extraction , and by the evaluation of rna quality on - site in bamako and again in new orleans . confounding by individual variation in gene expression this study design also permitted the study of changes in expression over time in pathways that were initially up- or downregulated . confounding by antimalarial treatment was addressed by demonstrating that antimalarial treatment alone had no effect on gene expression . these results provide the first information of which we are aware for upregulation of the apoptosis pathway with concomitant downregulation of apoptosis inhibitory genes during acute malaria ( figure 4 ) . in contrast , the upregulation of inflammatory , host response , and proinflammatory cytokine genes observed ( tnf , ifn- ) is consistent with previous reports ( figure 3 ) [ 5 , 7 , 9 , 10 , 15 , 23 , 24 ] and there was no upregulation of immune response genes in the uninfected controls ( data not shown ) . although some immune - related genes were downregulated , those downregulated genes had immune - modulatory functions ( figure 2 , profile bc ) . revealed upregulation of cytokine , immune response , inflammatory response , complement activation ( figure 3 ) , apoptosis ( figure 4 ) , and fas pathways [ 3032 ] in subjects with higher parasitemias ( 25,000100,000 per l and > 100,000 per l , figures 3 - 4 ) and higher temperatures ( 39c , data not shown ) . is supported by the upregulation of toll - like receptors ( tlr 5 ) [ 36 , 37 ] , nk cell receptors ( lilrs , kirs ) , and chemokines during the acute illness ( day 1 ) . indeed , several studies have suggested that the glycosylphosphatidylinositol ( gpi ) lipopolysaccharide which anchors p. falciparum proteins to parasite and red cell surfaces may stimulate the production of proinflammatory cytokines such as tnf , and zhu et al . have shown that gpi induction of il-6 , il-12 , and tnf is dependent on tlr activation via the p38- and nf-b pathways . in these studies , il-1 , il-6 , and tnf were upregulated more frequently in subjects with higher parasitemias ( figures 3 - 4 ) and higher temperatures ( data not shown ) . in addition , studies in uganda suggest that individuals heterozygous for the tlr 2 22 polymorphism may be protected from cerebral malaria . the data reported here are likewise consistent with previous studies suggesting that apoptosis plays an important role in the pathogenesis of uncomplicated falciparum malaria [ 32 , 3941 ] . because they indicate that genes involved in apoptosis , such as fas , bax , and tp53 , are upregulated during uncomplicated p. falciparum malaria in vivo ( figure 4 ) , they suggest that apoptosis may be initiated through several different pathways in uncomplicated malaria , including tnf binding to tnfrsf , fas ( which can be induced by tnf ) , tnf binding to fasl , and possibly hmox in response to oxidative stress . in these studies , upregulation of apoptosis - related genes correlated with higher parasitemias ( > 100,000 per l , figure 4 ) and higher body temperatures ( 39c , data not shown ) . these results are also consistent with the findings of wassmer et al . who suggested that tgf-1 from activated platelets may stimulate endothelial cell apoptosis and death in cerebral malaria . despite the evidence from these and other studies for apoptosis in p. falciparum infection , the actual role(s ) of apoptosis in malaria remains unclear although a number of studies have reported that this pathway is upregulated in severe malaria [ 6 , 43 , 44 ] . the data reported here indicate that the immune response , proinflammatory , and apoptosis pathways are upregulated at the time of acute illness in uncomplicated p. falciparum malaria . the apoptosis pathway remains upregulated for several days ( days 13 ) before returning to normal . in contrast , immune - modulatory and apoptosis inhibitory genes are downregulated initially ( days 13 ) and return to normal by the time of clinical recovery 710 days later .
to examine human gene expression during uncomplicated p. falciparum malaria , we obtained three samples ( acute illness , treatment , and recovery ) from 10 subjects and utilized each subject 's recovery sample as their baseline . at the time of acute illness ( day 1 ) , subjects had upregulation of innate immune response , cytokine , and inflammation - related genes ( il-1 , il-6 , tnf , and ifn- ) , which was more frequent with parasitemias > 100,000 per l and body temperatures 39c . apoptosis - related genes ( fas , bax , and tp53 ) were upregulated acutely and for several days thereafter ( days 13 ) . in contrast , the expression of immune - modulatory ( transcription factor 7 , hlv - doa , and cd6 ) and apoptosis inhibitory ( c - myc , caspase 8 , and fas ligand g ) genes was downregulated initially and returned to normal with clinical recovery ( days 710 ) . these results indicate that the innate immune response , cytokine , and apoptosis pathways are upregulated acutely in uncomplicated malaria with concomitant downregulation of immune - modulatory and apoptosis inhibitory genes .
pmds were obtained from lister et al . , generated from bisulfite sequencing in fibroblast cells . dnam data and hypomethylation block regions were obtained from hansen et al .. affymetrix hgu133plus2 expression data was obtained from the gene expression barcode project . idat files for 17 normal colon and 34 colon tumor samples were obtained from the tcga project . data was preprocessed and normalized using the standard illumina method , hypomethylation block finding was performed using the method in minfi . raw count tables at the exon level were obtained for 3 normal colon and 37 colon tumor samples from the tcga project . analyses were performed using bioconductor packages minfi ( v. 1.8.9 ) and epivizr ( v. 1.3.3 ) . the epiviz web application is hosted at http://epiviz.cbcb.umd.edu , the epivizr bioconductor package is available through the bioconductor project . javascript files defining exon - level expression visualization tracks are available as github gists ( http://gist.github.com/11279474 and http://gist.github.com/11279449 ) . open source code for all components is available in the epiviz project github page : http://github.com/epiviz , api descriptions and other documentation for epiviz is available online at http://epiviz.cbcb.umd.edu/help . pmds were obtained from lister et al . , generated from bisulfite sequencing in fibroblast cells . dnam data and hypomethylation block regions were obtained from hansen et al .. affymetrix hgu133plus2 expression data was obtained from the gene expression barcode project . idat files for 17 normal colon and 34 colon tumor samples were obtained from the tcga project . data was preprocessed and normalized using the standard illumina method , hypomethylation block finding was performed using the method in minfi . raw count tables at the exon level were obtained for 3 normal colon and 37 colon tumor samples from the tcga project . analyses were performed using bioconductor packages minfi ( v. 1.8.9 ) and epivizr ( v. 1.3.3 ) . the epiviz web application is hosted at http://epiviz.cbcb.umd.edu , the epivizr bioconductor package is available through the bioconductor project . javascript files defining exon - level expression visualization tracks are available as github gists ( http://gist.github.com/11279474 and http://gist.github.com/11279449 ) . open source code for all components is available in the epiviz project github page : http://github.com/epiviz , api descriptions and other documentation for epiviz is available online at http://epiviz.cbcb.umd.edu/help .
visualization is an integral aspect of genomics data analysis where the output of procedures performed in computing environments like bioconductor is often visualized . algorithmic - statistical analysis and interactive visualization are usually disjoint but are most effective when used iteratively . we introduce tools that provide this tight - knit integration : epiviz ( http://epiviz.cbcb.umd.edu ) , a web - based genome browser , and the epivizr bioconductor package allowing interactive , extensible and reproducible visualization within a state - of - the - art data analysis platform .
during the last decades , there have been great advancements in the field of preventive medicine . research has demonstrated that nutrition plays a crucial role in the prevention of chronic diseases . it proposes to consider food not only vital to survive , but also a mean for mental and physical well - being , contributing to the prevention and reduction of risk factors for diseases . however , there is evidence that the concept was believed by ancient physicians as well . rhazes said ; as long as a disease could be treated with food , medicine should be avoided we carried out a review of avicenna s canon of medicine and rhazes books for the definition of food and drug and similar concepts of functional food . rhazes has a book called manafe al - aghziyeh , in which he writes about the medicinal benefits of different nutrition . five concepts ( food , drug , medicinal food , nutritional medicine and antidote or poison ) were noted in these books . there are many recommendations on food for the prevention and treatment of diseases in tpm books , which can be the basis for novel research studies .
background : during the last decades , there have been great advancements in the field of preventive medicine . research has demonstrated that nutrition plays a crucial role in the prevention of chronic diseases . the concept of functional food was first introduced in japan during the 1980s . it proposes to consider food not only vital to survive , but also a mean for mental and physical well - being , contributing to the prevention and reduction of risk factors for diseases . however , there is evidence that the concept was believed by ancient physicians as well . one of the traditional systems of medicines is traditional persian medicine ( tpm ) . rhazes said ; as long as a disease could be treated with food , medicine should be avoidedmethods : we carried out a review of avicenna s canon of medicine and rhazes books for the definition of food and drug and similar concepts of functional food . we listed the identified concepts along with their examples.results:the classification of food and their therapeutic use were explained in canon of medicine . rhazes has a book called manafe al - aghziyeh , in which he writes about the medicinal benefits of different nutrition . five concepts ( food , drug , medicinal food , nutritional medicine and antidote or poison ) were noted in these books.conclusion:there are many recommendations on food for the prevention and treatment of diseases in tpm books , which can be the basis for novel research studies .
service quality is an important element in growth , success and survival of any given organization , assuming the importance of a principle for predicting future developments of the organization ( 1). considering the ongoing globalization process , health care rendering systems development as well as the increase in people s awareness , maintaining sustainable service quality accessible to all is of most importance to the organizations ( 2 , 3 ) . in today s competitive environment , health care providers have forced to make breakthrough , control cost and increase quality ( 4 - 7 ) . health care provider organizations globally have focused on the use of clinical quality indexes to identify health care improvement opportunities , measurement of dedicated interventions efficiency and presenting a quantitative link between care quality and cost effectiveness ( 8) . thus , all organizations interested in accurate and reliable tools to assess the quality of services ( 9 , 10 ) . to make a conscious decision regarding hospital service quality , accurate and reliable information is needed , especially for care systems whose objective is to minimize the costs ( 11 ) . suggest that evaluation of health care services is an important element in defining a suitable and cost effective health care system ( 12 ) . accreditation is a constant tool that promotes the desirable standards and improves the results in the health care sector ( 9 , 10 , 13 , 14 ) . in public sector systems , it is considered as a quality assurance solution ( 15 ) . accreditation is not a fast modification program , but rather a long term strategy ( 16). accreditation program having been implemented in many developing countries , is used as a monitoring tool that will assure service quality and optimum resource use ( 13 ) . haj - ali et al . ( 14 ) studied the relationship between hospital accreditation and patient s satisfaction through evaluation of patient s willingness to recommend the hospital to others . accreditation program is renowned as a comprehensive accreditation program in the world by joint commission international ( jci ) standards ( 17 ) . undertaken studies indicate that jci standards have provided a specific framework and systematic methodology for efficiency and effectiveness of the hospital ( 18 ) . moreover , numerous studies have been carried out using jci standards for evaluation of the health care centers . the analytical hierarchical process ( ahp ) method formulates decision making for problems in a hierarchical structure and therefore resolves complicated problems in areas such as planning , resource evaluation , efficiency measurement , resource allocation , selecting the best policy after finding a set of options , and prioritization adjustment . it provides a suitable analyzing method because ahp is a multi - criteria decision making technique that allows subjective as well as objective parameters to be considered in the decision making process . the hierarchical process provides the possibility of studying the problem as a whole , while paying attention to the interaction between intra - hierarchical components . in this method , each decision making problem can be designed in a tree framework , so that the levels of the tree include the goals , criteria to achieve the goals , sub - criteria and finally , the understudy options . by breaking the problem into decision - making levels , diagnostic radiology is an integral part of the health care system with many clinical advantages influencing the significant decisions in any of the patient management procedures . at the same time , in case the quality of the services provided is lower than the desirable level , unnecessary costs shall arise from the consequences , putting the health care system of the country under pressure . therefore , evaluation of this department has gained considerable importance ( 3 ) . investigating the present status and comparing it with the valid standards is considered as the key factor in reliability and usefulness of this facility ( 22 ) . measuring the service quality and ranking of the hospitals has the potential that enables health care investors to identify weak performances . meanwhile , the patients and the consumers can choose the best hospital to solve their problem . results of this program are of high importance , especially when considering their vast consequences specifically on the budget and financial allocations of the hospitals ( 20 ) . this study is the first study that has been conducted on evaluating the quality of radiology services using ahp . the main objective of the present study was to introduce and evaluate ahp method as a good model for ranking radiology departments based on the provided services . the main objective of this study was to propose a ranking method for radiology departments of selected understudy hospitals in tehran using ahp and quality evaluation of their services . the study was carried out in radiology departments of hospitals affiliated to shahid beheshti university of medical sciences , iran in january of 2015 . based on the taxonomy of hospitals , only homogenous hospitals could be compared with each other , the hospitals participated in this study were similar in structure ; i.e. they were educational , and grade 1 ( based on the grade granted to them by the ministry of health and medical education ) hospitals and the average weight of referees to the department of radiology in these hospitals were close to each other . also , the number of beds and consequently the number of services provided by them were almost close to each other . in this study , six hospitals affiliated to shahid beheshti university of medical sciences were selected . participants in this study consisted of 10 evaluation experts of the hospitals who collaborated with the third author in the process of weighting and ranking hospitals based on jci standards . at least 5 years of working experience in hospital evaluation was considered as inclusion criteria for selecting the evaluators . the checklist includes standards oriented around four axes of management and organizing , management and empowerment of human resources , safety , quality improvement and data accumulation requirements and facilities . to study the examined criteria weights , a researcher - made questionnaire was prepared using jci standards and designed in matrix of paired comparisons . the source of the questionnaire was jci standards , which was a standard source . in this questionnaire , measures ( criteria ) were first compared two by two ; then the hospitals were compared two by two based on each criterion . six questions were designed for weighting the criteria ; and 15 questions for weighting each hospital based on each criterion . as there were four criteria , a total of 60 questions were designed based on four criteria . for content validity of the questionnaire , the viewpoint of experts working in the scope of hospital evaluation , as well as the indices of the content validity index ( cvi ) and content validity rate ( cvr ) , which were equal to 0.78 and 0.77 , respectively , were used . the importance of each criterion compared with other criteria was determined using numbers 1 - 9 ( table 1 ) . in this study , the criteria that were the same as jci standards were first compared two by two by the experts using a matrix of pairwise comparisons . the weight and ranking of criteria ( jci standards ) were determined based on this comparison . after this stage , the hospitals were compared with each other , two by two , using a matrix of pairwise comparisons and based on main topics of jci , the rank and weight of each hospital in each topic was generally determined . prioritization was done using ahp , which is one of the frequently used methods for multi criterion decision making ( mcdm ) using expert choice 10.0 software . ahp enables the decision - makers to determine the simultaneous interactions of many complex and uncertain situations and helps them set the priorities . - drawing the hierarchical tree : in the hierarchical tree , the purpose of the study was placed at the first level ( selection of the best department of radiology ) . jci standards and options ( radiology departments ) were placed at the second and third levels , respectively ( figure 1 ) . - performing pairwise comparisons : then paired comparisons are conducted by the experts using a scale of 1 to 9 to determine the relative importance of each option compared to the other options using any criteria . - normalizing pairwise comparisons matrix : in order to normalize each criterion in each column of the matrix , each number is divided by the sum of the numbers of that column . - calculating relative weights : to calculate the relative weights of each criterion , the arithmetic mean of each row is calculated . it means that the sum of the numbers in each row of the matrix is divided by the total number of the numbers in that row . - multiplying relative weights of the criteria by relative weights of the options : after calculation of the relative weights of the criteria and the relative weight of the options , they are multiplied together . - ranking the options : values obtained by multiplying the criteria and options are sorted based on the order of value ; the options are prioritized . - calculating inconsistency rate : paired comparisons are consistent if the inconsistency rate is less than or equal to 0.1 . the study was carried out in radiology departments of hospitals affiliated to shahid beheshti university of medical sciences , iran in january of 2015 . based on the taxonomy of hospitals , only homogenous hospitals could be compared with each other , the hospitals participated in this study were similar in structure ; i.e. they were educational , and grade 1 ( based on the grade granted to them by the ministry of health and medical education ) hospitals and the average weight of referees to the department of radiology in these hospitals were close to each other . also , the number of beds and consequently the number of services provided by them were almost close to each other . in this study , six hospitals affiliated to shahid beheshti university of medical sciences were selected . the hospitals were selected using non - probability and purposeful method . participants in this study consisted of 10 evaluation experts of the hospitals who collaborated with the third author in the process of weighting and ranking hospitals based on jci standards . at least 5 years of working experience in hospital evaluation was considered as inclusion criteria for selecting the evaluators . the checklist includes standards oriented around four axes of management and organizing , management and empowerment of human resources , safety , quality improvement and data accumulation requirements and facilities . to study the examined criteria weights , a researcher - made questionnaire was prepared using jci standards and designed in matrix of paired comparisons . the source of the questionnaire was jci standards , which was a standard source . in this questionnaire , measures ( criteria ) were first compared two by two ; then the hospitals were compared two by two based on each criterion . six questions were designed for weighting the criteria ; and 15 questions for weighting each hospital based on each criterion . as there were four criteria , a total of 60 questions the viewpoint of experts working in the scope of hospital evaluation , as well as the indices of the content validity index ( cvi ) and content validity rate ( cvr ) , which were equal to 0.78 and 0.77 , respectively , were used . the importance of each criterion compared with other criteria was determined using numbers 1 - 9 ( table 1 ) . in this study , the criteria that were the same as jci standards were first compared two by two by the experts using a matrix of pairwise comparisons . the weight and ranking of criteria ( jci standards ) were determined based on this comparison . after this stage , the hospitals were compared with each other , two by two , using a matrix of pairwise comparisons and based on main topics of jci , the rank and weight of each hospital in each topic was generally determined . the checklist includes standards oriented around four axes of management and organizing , management and empowerment of human resources , safety , quality improvement and data accumulation requirements and facilities . to study the examined criteria weights , a researcher - made questionnaire was prepared using jci standards and designed in matrix of paired comparisons . the source of the questionnaire was jci standards , which was a standard source . in this questionnaire , measures ( criteria ) were first compared two by two ; then the hospitals were compared two by two based on each criterion . six questions were designed for weighting the criteria ; and 15 questions for weighting each hospital based on each criterion . as there were four criteria , a total of 60 questions the viewpoint of experts working in the scope of hospital evaluation , as well as the indices of the content validity index ( cvi ) and content validity rate ( cvr ) , which were equal to 0.78 and 0.77 , respectively , were used . the importance of each criterion compared with other criteria was determined using numbers 1 - 9 ( table 1 ) . in this study , the criteria that were the same as jci standards were first compared two by two by the experts using a matrix of pairwise comparisons . the weight and ranking of criteria ( jci standards ) were determined based on this comparison . after this stage , the hospitals were compared with each other , two by two , using a matrix of pairwise comparisons and based on main topics of jci , the rank and weight of each hospital in each topic was generally determined . prioritization was done using ahp , which is one of the frequently used methods for multi criterion decision making ( mcdm ) using expert choice 10.0 software . ahp enables the decision - makers to determine the simultaneous interactions of many complex and uncertain situations and helps them set the priorities . - drawing the hierarchical tree : in the hierarchical tree , the purpose of the study was placed at the first level ( selection of the best department of radiology ) . jci standards and options ( radiology departments ) were placed at the second and third levels , respectively ( figure 1 ) . - performing pairwise comparisons : then paired comparisons are conducted by the experts using a scale of 1 to 9 to determine the relative importance of each option compared to the other options using any criteria . - normalizing pairwise comparisons matrix : in order to normalize each criterion in each column of the matrix , each number is divided by the sum of the numbers of that column . - calculating relative weights : to calculate the relative weights of each criterion , the arithmetic mean of each row is calculated . it means that the sum of the numbers in each row of the matrix is divided by the total number of the numbers in that row . - multiplying relative weights of the criteria by relative weights of the options : after calculation of the relative weights of the criteria and the relative weight of the options , they are multiplied together . - ranking the options : values obtained by multiplying the criteria and options are sorted based on the order of value ; the options are prioritized . - calculating inconsistency rate : paired comparisons are consistent if the inconsistency rate is less than or equal to 0.1 . otherwise , the decision maker must revise paired comparisons . result indicated that among the assessed standards , management and empowerment of human resources ( weight = 0.465 ) and requirements and facilities ( weight = 0.139 ) gained the highest and lowest importance respectively . the calculated inconsistency rate is equal to 0.04 ; accordingly the consistency of criteria with the study aim is acceptable ( table 2 ) . in total ranking , hospitals ms ( weight = 0.316 ) , md ( weight = 0.259 ) , at ( weight = 0.14 ) , ts ( weight = 0.108 ) , mo ( weight = 0.95 ) , and lh ( weight = 0.082 ) acquired the first to sixth ranking respectively . considering management and organizing criterion , hospital ms ( weight = 0.332 ) obtained the first and hospital at ( weight = 0.07 ) acquired the last ranking . hospital lh ( weight = 0.385 ) obtained the first ranking ( weight = 0.437 ) considering management and empowerment of human resources , safety , quality improvement , and data accumulation criteria . considering requirement and facility criterion , hospitals ts ( weight = 0.407 ) and at ( weight = 0.03 ) obtained the first and last ranking respectively . weight and ranking of the other hospitals are represented in table 3 . nowadays , health care managers are forced to change their attitude and use new mathematical methods in addition to scientific management for planning ( 24 ) . in this study , for the first time in the ranking of radiology departments of hospitals , patient and management oriented standards were weighted and compared to each other using comparison matrix , and their ranking was calculated using ahp method . this model enables service receivers to judge the hospitals well and choose the best one to meet their needs ( 20 ) . results showed human resource management and capacity building standards were of more importance compared to other ones . in practice , human resource capacity building can result in organizational effectiveness by facilitating their participation in organizational decision making and work - related affairs . in fact , participation of the personnel in organizational and work - related affairs leads to their individual success in doing their jobs and creates a supportive environment to help organizational performance on a higher level ( 25 ) . mosadeghrad ( 26 ) states that the quality of health care can be improved by supportive leadership , rational planning , education , effective management of resources , employees , processes , and collaboration of providers of this service . if policy makers and managers intend to improve the quality of health care services , they should apply techniques and tools to operate this quality management structure ( 26 ) . the results showed that ms hospital has the best overall performance and the highest quality of service , whereas it was also the best in terms of management and organizing criteria . this could be due to the higher interest of ms hospital in informing the public and personnel about the mission and strategic plan of the organization , and putting educated people in key positions in the radiology department . as hoe ( 27 ) recommends , radiology department managers - who seek to improve quality of their services should clarify their mission and declare it to the employees . then , they should plan on this basis and implement it in order to ensure quality of services in accordance to regulatory plans such as jci . the findings suggested that standards on human resource management and capacity building criteria were met in lh hospital as compared to other hospitals , of which md hospital had the weakest performance . human resource planning , supply and distribution were very good and senior managers determined the required characteristics of the employees , necessary feasibility studies were conducted , and the personnel were properly trained at their entry stage and periodically . documentation of the evidence was fully computer - based and human errors in recording were minimal . before interventional measures were taken , patients and their attendants were informed and their consent letter was received , while in md hospital , preliminary personnel training and maintenance of the radiology department were ignored . ( 28 ) revealed that standards of patient and their family s rights , patient health care and training needed to improve in those hospitals , which was consistent with findings of this paper . satisfied and bound staff will have a better performance in delivering services , which will be followed by better results and higher patient satisfaction ( 29 , 30 ) . in terms of compliance with standards of safety , quality improvement , and data collection , lh hospital was the best , in which all safety codes were met in its radiology department and quality improvement and internal auditing were implemented and reported thoroughly in given intervals . low rank of mk hospital in connection with these standards was also a result of lack of a quality improvement plan and internal auditing documents in this department . aseweh abor et al . ( 31 ) showed that hospitals with quality management systems are more successful in implementation of monitoring , leadership and management standards . the findings showed that standards on hospital requirements and utilities were fully implemented in ts hospital , which received the highest rank in terms of access to emergency and other utilities for the personnel to take safe actions . the lowest rank was recorded in md hospital , where the radiology department was completely partitioned from other departments , and necessary emergency and sanitary utilities were not available . ( 32 ) suggested that only 26% of hospital had thyroid and gonad shields , lead glasses and apron , which is very disappointing since these protective clothing should be used to protect children and teenagers against the radiation . focus on protection by the authorities , availability of protective devices , continuous monitoring of concerned authorities on usage of protective devices , and observing sanitary principles could play a major role in reducing the absorbed dose ( 33 ) . old equipment increase the run time and the results might not be reliable . in a study in india , servqual criteria were used to evaluate the quality of services in the hospitals , which are different from the criteria used in our research . servqual model is not comprehensive enough and unlike jci standards , can not evaluate the quality of hospital services accurately because it is based on interpretation of patients perception of quality , which is very difficult to interpret ( 34 ) . another study showed that side effects play a critical role in hospital care quality evaluation . concluded that intensity and the number of effects should be taken into consideration in hospital ranking ( 35 ) . according to another study , ranking of hospitals is based on an unreliable ranking ( 36 ) . in this study , crisp sets are actually the same ordinary sets that were introduced at the beginning of the sets classical theory . the present study used ahp technique to rank radiology departments of hospitals , which can be encouraging to promote the evaluation systems and consequently promote performance of health care systems . the present model can fill the existing gap in hospital accreditation systems related to scoring and comparing hospitals with regard to degrees of importance and value of each standard , consider a combination of qualitative and quantitative criteria , and take very important steps to make health and treatment evaluation systems more efficient and effective . therefore , the ahp method can be used as an acceptable method to evaluate the quality of services and rank radiology departments around the world .
background : radiology department as a service provider organization requires realization of quality concept concerning service provisioning knowledge , satisfaction and all issues relating to the customer as well as quality assurance and improvement issues . at present , radiology departments in hospitals are regarded as income generating units and they should continuously seek performance improvement so that they can survive in the changing and competitive environment of the health care sector.objectives:the aim of this study was to propose a method for ranking of radiology departments in selected hospitals of tehran city using analytical hierarchical process ( ahp ) and quality evaluation of their service in 2015.materials and methods : this study was an applied and cross - sectional study , carried out in radiology departments of 6 tehran educational hospitals in 2015 . the hospitals were selected using non - probability and purposeful method . data gathering was performed using customized joint commission international ( jci ) standards . expert choice 10.0 software was used for data analysis . ahp method was used for prioritization.results:management and empowerment of human resources ( weight = 0.465 ) and requirements and facilities ( weight = 0.139 ) were of highest and lowest significance respectively in the overall ranking of the hospitals . ms ( weight = 0.316 ) , md ( weight = 0.259 ) , at ( weight = 0.14 ) , ts ( weight = 0.108 ) , mo ( weight = 0.095 ) , and lh ( 0.082 ) achieved the first to sixth rankings respectively.conclusion:the use of ahp method can be promising for fostering the evaluation method and subsequently promotion of the efficiency and effectiveness of the radiology departments . the present model can fill in the gap in the accreditation system of the country s hospitals in respect with ranking and comparing them considering the significance and value of each individual criteria and standard . accordingly , it can predict an integration of qualitative and quantitative criteria involved and thereby take a decisive step towards further efficiency and effectiveness of the health care evaluation systems .
obesity is linked to many deleterious health consequences , including insulin resistance , type 2 diabetes ( t2d ) and the metabolic syndrome , a group of metabolic risk factors predisposing to t2d , and cardiovascular disease . low - grade , chronic inflammation is considered as one of the most important mechanisms explaining the etiology of insulin resistance , t2d , and the metabolic syndrome . however , evidence is accumulating that inflammation when confined to the liver may not be causal to metabolic dysfunction in obesity ( for review see ) . for instance , we recently demonstrated that hepatic inflammation does not contribute to insulin resistance in tnfr1-non - sheddable mice expressing a mutated tnfr1 ectodomain incapable of shedding and dampening the hepatic inflammatory response . furthermore , we showed that cholesterol - induced hepatic inflammation does not advance the development of systemic insulin resistance in male ldlr mice . being consistent with the outcome of these gain - of - function studies , others have shown that reduced hepatic inflammation not necessarily corresponds to enhanced insulin sensitivity in mice [ 5 , 6 ] , further indicating that factors other than hepatic inflammation may be causal in triggering insulin resistance . dyslipidemia , provoked by elevated plasma low - density lipoprotein ( ldl ) cholesterol and/or very low - density lipoprotein ( vldl ) triglycerides levels and decreased high - density lipoprotein ( hdl ) cholesterol levels , may be such a causal factor in the development of insulin resistance . indeed , several studies have shown that dyslipidemia is an independent predictor of insulin resistance and t2d [ 8 , 9 ] . furthermore , lipid - lowering drugs have been shown to exhibit a positive effect on insulin sensitivity . nevertheless , dyslipidemia may also occur as a result of insulin resistance since hepatic lipogenesis , in contrast to gluconeogenesis , remains sensitive to insulin . this leads to an increased production of plasma lipids due to overstimulation of insulin receptor pathways caused by hyperinsulinemia . hampered by the coexisting nature of dyslipidemia and obesity , its exact role in the etiology of insulin resistance therefore remains ill defined . to further elaborate on these studies , we assessed the extent to which hepatic inflammation may explain the reported predisposition towards insulin resistance in dyslipidemic ldlr mice . furthermore , the rapid development of dyslipidemia [ 13 , 14 ] and hepatic inflammation [ 14 , 15 ] in these mice allows us to investigate their effect on insulin resistance before alterations in body weight occur . we opted to use female mice only as they confer a natural resistance against diet - induced obesity . this is of particular importance as adiposity drives the metabolic phenotype in most studies and differences in insulin resistance have been shown to disappear after matching the mice for body weight . our data show that hepatic inflammation is not a causal factor in the development of hepatic insulin resistance in ldlr mice . thus , in line with the studies mentioned above , but contrasting with the current dogma , our data do not support a role for hepatic inflammation in triggering insulin resistance . age - matched ( 1216 weeks ) female ldlr mice on a c57bl/6j background and wild type ( wt ) c57bl/6j mice were used for all experiments . breeding pairs of ldlr mice were obtained from the jackson laboratory ( bar harbor , me , usa ) and ldlr mice were bred in house . mice were placed on a standard rodent chow diet , a high fat ( hf ) diet ( containing 21% fat from milk butter and 0.02% cholesterol ; scientific animal food and engineering , villemoisson - sur - orge , france ) , or a high fat , high cholesterol ( hfc ) diet ( containing 21% fat from milk butter and 0.2% cholesterol ; scientific animal food and engineering , villemoisson - sur - orge , france ) for a period of 2 weeks with ad libitum access to food and water . animals were anesthetized by isoflurane during all surgical operations and discomfort was minimized as much as possible . all animal experiments were approved by the ethics committee of the university of groningen , which adheres to the principles and guidelines established by the european convention for the protection of laboratory animals . mice were fasted for 6 hours before performing an oral glucose tolerance test ( ogtt ) or an insulin tolerance test ( itt ) . for the ogtt , a glucose bolus of 2 g / kg body weight of 20% glucose solution was given by gavage . for the itt , an insulin dose of 0.3 u / kg body weight was injected intraperitoneally . glucose levels were measured with a one touch ultra glucose meter before the test and at 15 , 30 , 60 , 90 , and 120 minutes after gavage or injection . in addition , fasted insulin levels were measured with an ultrasensitive insulin elisa kit ( alpco diagnostics , salem , nh ) . the homeostasis model assessment of insulin resistance ( homa - ir ) was calculated from fasted insulin and glucose levels ( fasted insulin ( u / ml ) fasted glucose ( mmol / liter)/22.5 ) . a hyperinsulinemic - euglycemic clamp ( hiec ) was performed in conscious mice as described previously , with a modified protocol . in brief , mice were cannulated in the right vena jugularis to allow infusion of fluids for an hiec . they were allowed to recover for 57 days before the hiec was started . before the hiec mice were infused at a rate of 0.10 ml / h for 4 hours with a solution containing 1% bovine serum albumin ( sigma aldrich , zwijndrecht , netherlands ) , 30% glucose ( 3% [ u - c ] glucose ; 27% glucose ) , 110 mu / ml insulin ( actrapid , novo nordisk , bagsvaerd , denmark ) , and 40 g / ml somatostatin ( eumedica nv , brussels , belgium ) . to maintain euglycemia , a 30% glucose solution was infused ( 3% [ u - c ] glucose ; 27% glucose ) via a second line and pump speeds were adjusted to the needs of the animal . every 15 min , a blood sample was taken from the tail vein to determine plasma glucose levels , and every 30 minutes , a blood spot was collected on filter paper for gas chromatography - mass spectrometry ( gc - ms ) analysis . extraction of glucose from blood spots and gc - ms analysis of extracted glucose were performed according to van dijk et al . . hepatic glucose production and metabolic clearance rate were calculated from gc - ms results using mass isotopomer distribution analysis as previously described . tissues were rapidly removed , snap - frozen in liquid nitrogen , and stored at 80c until further analysis . for histology , tissues were frozen or fixed in paraformaldehyde and embedded in paraffin . blood was collected by a heart puncture and separated by centrifugation ( 3000 g , 10 min , 4c ) . hepatic and plasma triglyceride and cholesterol levels were measured using commercially available kits from roche ( mannheim , germany ) . hepatic free cholesterol levels were determined using a commercially available kit from diasys ( holzheim , germany ) . for diacylglycerol ( dag ) determination , lipids were extracted from frozen - crushed livers with meoh : chcl3 ( 1 : 2 ) and separated by thin - layer chromatography . lipids were visualized with cuso4 and quantified by comparing the density to a standard amount of dag . protein concentration was equalized and proteins were separated with sds - page and transferred to polyvinylidene difluoride membranes ( ge healthcare life sciences , diegem , belgium ) . membranes were incubated overnight at 4c with an antibody against pakt ( ser473 , cell signaling technology , leiden , netherlands ) or akt ( cell signaling technology ) in 5% bovine serum albumin . the following day , membranes were incubated with a secondary antibody containing horse - radish peroxidase ( goat - anti - rabbit : bio - rad , veenendaal , netherlands ) . to visualize the immune complex , membranes were treated with enhanced chemiluminescence reaction reagent and a picture was taken using gel doc xr+ imaging system ( bio - rad ) . protein bands were analyzed using image lab 3.0.1 ( bio - rad ) . to isolate rna , liver biopsies were homogenized in qiazol reagent and rna was isolated according to the manufacturer 's procedure ( qiagen , venlo , netherlands ) . adipose tissue rna was isolated using a commercially available kit ( qiagen ) . from liver and adipose tissue rna , cdna was synthesized for rt - pcr using a commercially available kit ( bio - rad ) . the following primer sequences were used for rt - pcr : tnfa , forward catcttctcaaaattcgagtgacaa , reverse tgggagtagacaaggtacaaccc ; mcp1 , forward gctggagagctacaagaggatca , reverse acagacctctctcttgagcttggt ; cd68 , forward tgacctgctctctctaaggctaca , reverse tcacggttgcaagagaaacatg ; cd11b , forward tcagagaatgtcctcagcag , reverse tgagacaaactccttcatcttc ; ppia forward ttcctcctttcacagaattattcca , reverse ccgccagtgccattatgg . paraffin - embedded adipose tissue biopsies were sectioned at 4 m and stained with hematoxylin - eosin . frozen liver sections of 5 m were used to stain for the macrophage marker cd68 ( fa11 , abcam , cambridge , uk ) . 2-way anova followed by bonferroni posttests to correct for multiple testing was performed using graph - pad prism 5.0 ( san diego , usa ) to determine the differences between groups . 1-way anova ( kruskal - wallis ) was used followed by dunns multiple comparison test was used to determine the differences in phosphorylation of akt between the groups . to ensure that the assumption of homogeneity of variances was met , this was tested before performing an anova . values are expressed as mean sem and group sizes are indicated in the figure legends . since dyslipidemia is an independent predictor of insulin resistance , we first assessed plasma lipid levels of wt and ldlr mice fed a chow , hf , or hfc diet for 2 weeks . body weight ( figure 1(a ) ) did not differ between both genotypes ; however , liver weight ( figure 1(b ) ) was slightly increased in both wt and ldlr mice fed an hfc - diet compared to chow - fed wt and ldlr mice ( hfc versus chow , p < 0.05 ; hfc wt versus hfc ko , ns ) . plasma triglyceride ( figure 1(c ) ) and cholesterol levels ( figure 1(d ) ) were significantly elevated in ldlr mice fed an hf- and hfc - diet compared to hf- and hfc - fed wt mice and ldlr mice fed a chow - diet ( figures 1(c ) and 1(d ) ) . nevertheless , plasma triglyceride levels were significantly lower in hfc - fed ldlr mice compared to hf - fed ldlr mice ( figure 1(c ) ) . in contrast , plasma cholesterol levels were significantly higher in hfc - fed ldlr mice compared to hf - fed ldlr mice ( figure 1(d ) ) . in addition , glucose levels were significantly elevated in ldlr mice fed an hf - diet compared to hf - fed wt mice ( figure 1(e ) ) and did not differ between chow- or hfc - fed ldlr mice ( figure 1(e ) ) . however , insulin levels were significantly elevated in ldlr mice fed an hf and hfc diet compared to chow - fed ldlr mice ( figure 1(f ) ) but were not further increased by cholesterol addition to the hf diet ( figure 1(f ) ) . in line with this , the homa - ir was significantly elevated in ldlr mice fed an hf and hfc diet compared to both hf- and hfc - fed wt mice and chow - fed ldlr mice ( figure 1(g ) ) , confirming the reported predisposition towards insulin resistance in dyslipidemic ldlr mice . homa - ir levels did not differ between hf- and hfc - fed ldlr mice ( figure 1(g ) ) . to validate the degree of hepatic inflammation in wt and ldlr mice fed a chow , hf , and hfc diet , we performed cd68 immunostaining and measured the expression of the proinflammatory genes cd68 , cd11b , tnfa , and mcp in livers of wt and ldlr mice fed a chow , hf , and hfc diet . as expected , ldlr mice fed an hfc diet showed an increased staining of cd68 in the liver ( figure 2(a ) ) , indicating an increased number of macrophages in their livers . being consistent with the histological analysis of the liver , ldlr mice on an hfc diet showed marked levels of hepatic inflammation compared to hfc - fed wt mice . we observed a 5-fold and a 2-fold increase in the mrna levels of the macrophage markers cd68 and cd11b , respectively ( figures 2(b ) and 2(c ) ) , compared to hfc - fed wt mice . in addition , a 5-fold increase in the expression of the cytokine tnfa ( figure 2(d ) ) and a 10-fold increase in the expression of the chemokine mcp1 ( figure 2(e ) ) were observed in hfc - fed ldlr mice compared to hfc - fed wt mice . furthermore , increased cd68 expression was also observed in ldlr mice following 2 weeks of hf feeding compared to hf - fed wt mice ( figure 2(b ) ; p < 0.05 ) . however , this hf - diet induced increase in cd68 expression was significantly lower compared to ldlr mice fed an hfc - diet ( figure 2(b ) ) . moreover , hf feeding did not increase the expression levels of cd11b , tnfa , or mcp1 in the livers of ldlr mice whereas hfc feeding did ( figures 2(c)2(e ) ; ldlr hf versus ldlr hfc , p < 0.05 for all genes ) . despite marked inflammation in the livers of ldlr mice fed an hfc diet , hematoxylin and eosin staining of white adipose tissue sections did not show signs of inflammation ( figure 3(a ) ) . in addition , no significant changes in the gene expression of the inflammatory markers cd68 , cd11b , tnfa , and mcp were found in white adipose tissue ( figures 3(b)3(e ) ) , confirming the absence of adipose tissue inflammation in ldlr mice fed any of the given diets . to investigate the degree of systemic insulin resistance in dyslipidemic ldlr mice with or without hepatic inflammation , we performed an ogtt and an itt in ldlr mice fed a chow , hf , and hfc diet . the ogtt ( figure 4(a ) ) and itt ( figure 4(b ) ) did not detect differences between the groups , suggesting that 2 weeks of hf and hfc feeding did not induce notable changes in glucose and insulin tolerance between the mice . we next performed a hyperinsulinemic - euglycemic clamp ( hiec ) to distinguish between hepatic and peripheral insulin resistance . the glucose infusion rate ( gir ; figure 4(c ) ) and the metabolic clearance rate of glucose ( mcr ; figure 4(d ) ) did not differ between the mice fed a chow , hf , or hfc diet , confirming the similar glucose curves observed during the ogtt and the itt . however , we observed a significant increase in hepatic glucose production in ldlr mice fed an hf diet compared to hf fed wt mice ( figure 4(e ) ) . these findings indicate that ldlr mice fed an hf diet suffered from hepatic insulin resistance , while peripheral insulin resistance remained unaffected . hepatic glucose production was not increased in ldlr mice fed an hfc - diet compared to hfc - fed wt mice ( figure 4(e ) ; ns ) and was not worse than ldlr mice fed an hfc diet ( figure 4(e ) ; ns ) . although clear hepatic insulin resistance was observed in ldlr mice fed an hf - diet , the ser473 phosphorylation of akt ( figures 4(f ) and 4(g ) ) in the liver was not affected following insulin stimulation . in fact , no difference was observed in the insulin stimulated akt response for any of the given diets ( figure 4(g ) ) . since the accumulation of lipid species in the liver has been associated with the development of hepatic insulin resistance [ 2022 ] , we measured hepatic lipid accumulation in wt and ldlr mice fed a chow , hf , or hfc diet for 2 weeks . no difference was observed in hepatic triglyceride accumulation between wt and ldlr mice fed either diet ; however , compared to chow - fed mice triglyceride levels were moderately increased in livers of wt mice ( figure 5(a ) ; wt hfc versus wt chow , p < 0.05 ) . as expected , hfc feeding increased total cholesterol levels in both wt and ldlr mice compared to chow and hf - fed mice and did not differ between the genotypes ( figure 5(b ) ) . free cholesterol was significantly increased but only in ldlr mice fed an hfc diet ( figure 5(c ) ) . in particular , however , dag levels were similar in both genotypes and on all diets ( figure 5(d ) ) . in summary , these results suggest that differences in hepatic lipid accumulation can not account for the hepatic insulin resistance observed in ldlr mice this study was designed to determine the effect of hepatic inflammation on the development of insulin resistance in ldlr mice , while excluding body weight gain as a confounding factor . our results show that ldlr mice develop hepatic insulin resistance within 2 weeks of hf feeding , while peripheral insulin resistance remained unaffected . our data also show that both systemic insulin resistance and hepatic insulin resistance are not more advanced in ldlr mice fed an hfc diet , even though these mice had increased levels of hepatic inflammation compared to both chow and hf - fed ldlr mice . these results illustrate that hepatic insulin resistance can develop prior to alterations in body weight gain . moreover , our findings suggest that hepatic inflammation induced by dietary cholesterol is not associated with the onset of hepatic insulin resistance during this time frame and indicate that cholesterol - induced hepatic inflammation can not explain the predisposition towards insulin resistance in these ldlr mice . our results also suggest that dyslipidemia is not causal to the development of hepatic insulin resistance as the degree of dyslipidemia was identical amongst the hf- and hfc - fed ldlr mice ( figures 1(b ) and 1(c ) ) whereas hepatic insulin resistance was only observed in the hf - fed ldlr mice ( figure 4(e ) ) . this argues against a causal relationship in the well - established metabolic link between hyperglycemia and dyslipidemia . indeed , dyslipidemia , at the clinical level , is associated with elevated plasma glucose levels and insulin resistance . furthermore , patients diagnosed with familial combined hyperlipidemia have an increased incidence of insulin resistance and t2d [ 2327 ] . moreover , dyslipidemia is an independent predictor for the development of insulin resistance and t2d later in life . nevertheless , there is a complex genetic regulation and metabolic interplay between lipid and glucose metabolism , as we have recently observed that the genetic predisposition to dyslipidemia is related to lower levels of fasting plasma glucose , hba1c , and homa - ir . out of the 15 loci that are associated with both lipids and glucose - related traits independently , 8 ( cetp , mlxipl , pltp , gckr , apob , apoe - c1-c2 , cyp7a1 , and timd4 ) in contrast to several publications that indicate that hepatic inflammation can cause insulin resistance [ 29 , 30 ] , we found that hepatic inflammation did not advance the development of peripheral insulin resistance in female ldlr mice . this confirms our previous findings in male ldlr mice fed a 2-week hfc diet suggesting that similar phenomena exist between male and female ldlr mice in terms of systemic insulin resistance . whether hepatic insulin resistance is also unrelated to hepatic inflammation in male ldlr mice remains to be investigated . an explanation for the lack of an effect of hepatic inflammation on insulin resistance may be found in the cell type driving inflammation . described how inflammation was induced by hepatocyte activation of ikk , and this resulted in hepatic and systemic insulin resistance . though being not assessed in this paper , previous studies have shown that kupffer cells become foamy in ldlr mice within 7 days of hfc feeding and may be responsible for the initiation of hepatic inflammation in this model [ 14 , 15 ] . kupffer cells are thought to contribute to insulin resistance by the production of proinflammatory cytokines that inhibit insulin signaling in hepatocytes . nevertheless , there is conflicting evidence for the role of kupffer cells in hepatic insulin resistance . some papers report an amelioration of insulin resistance with a depletion of kupffer cells [ 32 , 33 ] , whereas others show deterioration in insulin resistance . moreover , depleting kupffer cells after the induction of insulin resistance has no therapeutic effect on metabolic changes . therefore , the cell type driving the hepatic inflammation may be important in determining the effect on insulin resistance . hepatocyte - derived inflammation may be more important than kupffer cell activation in the development of insulin resistance , highlighting the need for more studies focusing on cell type - specific induction of inflammation . the lack of an effect of hepatic inflammation on insulin resistance may also reflect a time - dependent effect . a recent paper reported that inflammation was only involved in diet - induced insulin resistance once obesity had been established and not during the onset of obesity . when obesity is established hence , an hfc diet induces insulin resistance in ldlr mice only after 24 weeks of hfc feeding , which is presumably caused by adipose tissue inflammation . in another study , the proinflammatory cytokines secreted from adipose tissue were shown to be able to induce insulin resistance in hepatocytes . hepatic inflammation has been shown to develop within 4 days of hfc feeding in female ldlr mice . thus , in our experimental model , hepatic inflammation was present for approximately 1.5 weeks , without increased body weight gain or adipose tissue inflammation ( figures 2(b ) and 3(c ) ) being present . this may not be long enough for hepatic inflammation to inhibit insulin signaling in the liver . our data indicate that cholesterol - induced hepatic inflammation , in the absence of adipose tissue inflammation , is not enough to induce insulin resistance in hepatocytes . within this 2-week time frame hepatic insulin resistance may be primarily caused by factors other than hepatic inflammation and dyslipidemia . while there is no doubt about the hepatic insulin resistance observed in ldlr fed an hf diet during the hiec , we were not able to confirm these results by measuring phosphorylation of akt in the livers of insulin injected mice . this may be explained by the many pathways and molecules that are involved in insulin signaling . interference with insulin signaling may take place at a different part of the insulin signaling cascade than at the level of akt . in addition , while we excluded differences in hepatic lipid content that may affect hepatic insulin resistance , we can not rule out that other changes that could occur in ldlr mice might contribute to their hepatic insulin resistance . lack of the ldlr may lead to differences in intracellular signaling cascades that could affect insulin signaling . however , in chow - fed ldlr mice , we observed no changes in either hepatic or peripheral insulin resistance , indicating that the effects on hepatic insulin resistance are not intrinsic to the ldlr deficiency but are related to the hf - diet intervention in these mice . moreover , the fact that hfc feeding induced more severe hepatic inflammation and less insulin resistance than did hf feeding does not necessarily indicate that inflammation can be denied as being the cause of insulin resistance in ldlr mice . the results may thus suggest that cholesterol addition to the hf diet alleviates hepatic insulin resistance in ldlr mice . as a result , we can not exclude that deterioration of insulin resistance induced by the hepatic inflammation may have been overcome by the insulin sensitizing effect of cholesterol . nevertheless , we can not explain why cholesterol addition to the hf diet confers protection against the development of hepatic insulin resistance in ldlr mice . this may be related to kupffer cell activation triggered by the cholesterol in the diet , since factors derived from kupffer cells have been shown to work in a transacting manner to maintain hepatic lipid homeostasis . in conclusion , our data show that neither cholesterol - induced hepatic inflammation nor dyslipidemia is causally related to the development of hepatic insulin resistance in ldlr mice . as chronic inflammation is considered a causal risk factor predisposing to insulin resistance , our data suggests that inflammation when confined to the liver may not be causal to metabolic dysfunction .
chronic inflammation is considered a causal risk factor predisposing to insulin resistance . however , evidence is accumulating that inflammation confined to the liver may not be causal to metabolic dysfunction . to investigate this , we assessed if hepatic inflammation explains the predisposition towards insulin resistance in low - density lipoprotein receptor knock - out ( ldlr/ ) mice . for this , wild type ( wt ) and ldlr/ mice were fed a chow diet , a high fat ( hf ) diet , or a high fat , high cholesterol ( hfc ) diet for 2 weeks . plasma lipid levels were elevated in chow - fed ldlr/ mice compared to wt mice . although short - term hf or hfc feeding did not result in body weight gain and adipose tissue inflammation , dyslipidemia was worsened in ldlr/ mice compared to wt mice . in addition , dyslipidemic hf - fed ldlr/ mice had a higher hepatic glucose production rate than hf - fed wt mice , while peripheral insulin resistance was unaffected . this suggests that hf - fed ldlr/ mice suffered from hepatic insulin resistance . while hfc - fed ldlr/ mice displayed the anticipated increased hepatic inflammation , this did neither exacerbate systemic nor hepatic insulin resistance . therefore , our results show that hepatic insulin resistance is unrelated to cholesterol - induced hepatic inflammation in ldlr/ mice , indicating that hepatic inflammation may not contribute to metabolic dysfunction per se .
clubroot caused by the obligate soil - borne parasite plasmodiophora brassicae is considered the most important soil - borne disease of brassica crops , such as broccoli , cabbage , canola and others ( dixon 2014 ; donald and porter 2009 ; donald and porter 2014 ) . primary phases that occur in the root hair and secondary phases that occur in the cortex . an amoeboid form of the pathogen may link the phases of infection ( donald et al . 2008 ) . ultimately , infection can result in abnormal tissue proliferation in the host and the formation of root galls , which are characteristic of the disease . changes in auxin and cytokinin metabolism are thought to be key mechanisms in the development and formation of clubroot galls ( devos et al . compared with healthy plants , concentrations of indole-3-acetic acid ( iaa ) or conjugated iaa in infected roots alternate from higher to lower levels ( kavanagh and williams 1981 ; ludwig - mller et al . 2005 ) , with the transition possibly correlating with the change from primary to secondary phases of infection ( devos et al . 2005 ) . by comparison , most authors report increased cytokinin activity in infected compared with healthy plants ( dekhuijzen and overeem 1971 ; dekhuijzen 1980 ) , with mller and hilgenberg ( 1986 ) showing that plasmodia of p. brassicae can synthesise the cytokinin , trans - zeatin . however , devos et al . ( 2005 ) found that infection reduced the total active cytokinin content of root tissue and hypothesised that plasmodia of p. brassicae act as a sink for zeatin in the primary infection phases . in arabidopsis ( 2006 ) found that genes involved in auxin homeostasis were upregulated whereas those involved in cytokinin homeostasis were downregulated during the infection process . despite the potential role of auxins and cytokinins in the formation of clubroot galls , there are few studies on the effects of exogenous applications of these and other growth regulators on pathogenesis , especially when they are applied in seaweed extracts . it is well documented that seaweed extracts can improve crop health when applied as soil amendments or foliar treatments in horticultural systems ( khan et al . ( 2013 ) showed that a commercial extract from the brown algae durvillaea potatorum and ascophyllum nodosum reduced the incidence of white blister , caused by albugo candida , in the establishment of broccoli seedlings by 23 % . seaweed extracts can affect soil - borne diseases through a direct suppressive effect on pathogens and pathogenicity ( mattner et al . 2014 ) or through stimulation of antagonistic microflora in treated soil ( dixon and walsh 2004 ) . most evidence , however , suggests that seaweed extracts or their components , such as laminarins , can stimulate resistance mechanisms in the host against pathogen infection ( aziz et al . moreover , growth regulators contained in seaweed extracts , including auxins , cytokinins and betaines , have the potential to further moderate these resistance mechanisms ( kazan and manners 2009 ; naseem and dandekar 2012 ) . in australia , a significant number of brassica growers have applied seaweed extracts as components of their management strategies for clubroot . despite this , few scientific studies report on the effects of seaweed extracts on infection of brassicas by p. brassicae or on clubroot . in pot trials , stewart ( 2008 ) found that soil amendment with two commercial seaweed products derived from ascophyllum nodosum , a laminaria sp . and a sargassum sp . reduced the disease severity of clubroot by up to 33 % , although this was not significant at the p 0.05 level . when considering the activity of commercial seaweed extracts on plant health , it is important to recognise that their effects and properties may differ due to the species of seaweed utilised and the commercial extraction systems employed in their production ( verkleij 1992 ) . our study used a sand solution technique to test the hypothesis that a commercial seaweed extract from d. potatorum and a. nodosum can reduce infection of broccoli by p. brassicae . the sand solution technique used in this experiment is described by donald and porter ( 2004 ) and is an established method to observe infection of brassicas by p. brassicae . in this technique , acid - washed , coarse sand ( banksia nurseries , knoxfield , australia ) was autoclaved ( 121 c/100 kpa ) and loosely packed into 5ml tapered pipette tubes ( oxford labware , usa ) . marathon , henderson seeds , templestowe lower , australia ) was surface - sterilised for 3 min in a 70 % ethanol/10 % sodium hypochlorite solution , followed by three rinses in sterile distilled water , and dried in a laminar flow cabinet overnight on sterile filter paper . two tubes were placed inside a larger 50-ml falcon tube containing a buffered nutrient solution ( mes solution , usa ) . this nutrient solution was developed by myers and campbell ( 1985 ) to maximise p. brassicae infection , without causing nutrient stress in the host , and consists of the following : mgso4 ( 1 mm ) , kno3 ( 2.5 mm ) , ca(no3)2 ( 2.5 mm ) , kh2po4 ( 0.5 mm ) , h3bo3 ( 92 m ) , mncl3 ( 18 m ) , cuso4 ( 0.64 m ) , h2mo2o4 ( 0.14 m ) , znso4 ( 1.5 m ) and fe - edta ( 1.3 m ) . at 5 days after sowing , 2 ml of seaweed extract ( 1:25 or 1:200 dilutions , see below ) or sterile distilled water for the control were applied to the sand within the pipette tubes . at 28 days after sowing , stored ( 20 c ) spore suspensions of p. brassicae collected from infected broccoli plants in werribee south , victoria , australia ( ecd code 16/19/31 ) , were thawed and resuspended in sterile distilled water to contain a concentration of 10 spores ml , using a haemocytometer . plants in the pipette tubes were inoculated by applying 0.2 ml of the spore suspension to the sand . seedlings were kept in a growth cabinet ( 25 c day , 20 c night , 90 % relative humidity , 12-h days ) for the duration of the experiment , and nutrient / seaweed extract solutions replaced as required . the seaweed extract used in the experiment was an alkaline hydrolysis product ( arioli et al . 2015 ) from d. potatorum and a. nodosum ( seasol commercial , seasol international , bayswater , australia ) , which was sterilised by exposure to uv for 2 h in a laminar flow cabinet . this method has previously sterilised small volumes ( 15 ml ) of the extract without reducing its bioactivity ( mattner et al . the undiluted extract has a ph of 10.5 and contains 0.2 % ( w / v ) n , 0.02 % p , 3.7 % k , 0.3 % s , 458 mg l ca , 972 mg l mg , 115 mg l fe , 2 mg l mn , 15 mg l b , and 5 mg l zn ( seasol international 2015 ) . in addition to low concentrations of nutrients , the undiluted extract contains 7 % ( w / v ) total laminarins , 154 g l total auxins , 36 g l total cytokinins ( including zeatin , dihydrozeatin , isopentenyl - adenine , and their corresponding ribosides and glucosides ; tay et al . 1985 , 1987 ) and 382 g l total betaines ( seasol international 2015 ) . total concentrations of nutrients and growth regulators in the sand solutions in the different treatments were determined based on these figures and the prepared concentrations of the buffered nutrient solution ( see above ) . in addition , the ph of the sand solutions in the different treatments was measured using a ph meter . infection was assessed at 14 , 28 and 45 days after inoculation ( d.a.i . ) . at each assessment date , the roots of six plants per treatment ( i.e. two replicate plants by three blocks ) were harvested , rinsed free of sand , fixed with formyl acetic acid and then stained with ffa phloxine b to allow observation of the development of infection by p. brassicae . twenty root sections ( 200 m long ) per plant ( i.e. 120 root sections in each treatment ) were examined under compound microscope for the number of plasmodia in the root hairs and cortical cells . each block contained six replicate plants of each treatment ( i.e. a total of 18 plants per treatment ) . two plants per treatment per block ( i.e. six plants per treatment ) were harvested at each of the three sampling dates ( see above ) . treatments included 1:25 ( plus and minus inoculation ) and 1:200 ( plus inoculation ) dilutions of seaweed extract , and sterile distilled water ( plus and minus inoculation ) as the control . data were analysed by anova using genstat v. 12.1 ( vsn international , uk ) . homogeneity of variance was determined from plots of fitted values versus residuals , while histograms of residuals were examined for normality of distribution . fisher s least significance difference test was used to identify significant differences between treatment means . the sand solution technique used in this experiment is described by donald and porter ( 2004 ) and is an established method to observe infection of brassicas by p. brassicae . in this technique , acid - washed , coarse sand ( banksia nurseries , knoxfield , australia ) was autoclaved ( 121 c/100 kpa ) and loosely packed into 5ml tapered pipette tubes ( oxford labware , usa ) . marathon , henderson seeds , templestowe lower , australia ) was surface - sterilised for 3 min in a 70 % ethanol/10 % sodium hypochlorite solution , followed by three rinses in sterile distilled water , and dried in a laminar flow cabinet overnight on sterile filter paper . two tubes were placed inside a larger 50-ml falcon tube containing a buffered nutrient solution ( mes solution , usa ) . this nutrient solution was developed by myers and campbell ( 1985 ) to maximise p. brassicae infection , without causing nutrient stress in the host , and consists of the following : mgso4 ( 1 mm ) , kno3 ( 2.5 mm ) , ca(no3)2 ( 2.5 mm ) , kh2po4 ( 0.5 mm ) , h3bo3 ( 92 m ) , mncl3 ( 18 m ) , cuso4 ( 0.64 m ) , h2mo2o4 ( 0.14 m ) , znso4 ( 1.5 m ) and fe - edta ( 1.3 m ) . at 5 days after sowing , 2 ml of seaweed extract ( 1:25 or 1:200 dilutions , see below ) or sterile distilled water for the control were applied to the sand within the pipette tubes . at 28 days after sowing , stored ( 20 c ) spore suspensions of p. brassicae collected from infected broccoli plants in werribee south , victoria , australia ( ecd code 16/19/31 ) , were thawed and resuspended in sterile distilled water to contain a concentration of 10 spores ml , using a haemocytometer . plants in the pipette tubes were inoculated by applying 0.2 ml of the spore suspension to the sand . seedlings were kept in a growth cabinet ( 25 c day , 20 c night , 90 % relative humidity , 12-h days ) for the duration of the experiment , and nutrient / seaweed extract solutions replaced as required . the seaweed extract used in the experiment was an alkaline hydrolysis product ( arioli et al . 2015 ) from d. potatorum and a. nodosum ( seasol commercial , seasol international , bayswater , australia ) , which was sterilised by exposure to uv for 2 h in a laminar flow cabinet . this method has previously sterilised small volumes ( 15 ml ) of the extract without reducing its bioactivity ( mattner et al . the undiluted extract has a ph of 10.5 and contains 0.2 % ( w / v ) n , 0.02 % p , 3.7 % k , 0.3 % s , 458 mg l ca , 972 mg l mg , 115 mg l fe , 2 mg l mn , 15 mg l b , and 5 mg l zn ( seasol international 2015 ) . in addition to low concentrations of nutrients , the undiluted extract contains 7 % ( w / v ) total laminarins , 154 g l total auxins , 36 g l total cytokinins ( including zeatin , dihydrozeatin , isopentenyl - adenine , and their corresponding ribosides and glucosides ; tay et al . 1985 , 1987 ) and 382 g l total betaines ( seasol international 2015 ) . total concentrations of nutrients and growth regulators in the sand solutions in the different treatments were determined based on these figures and the prepared concentrations of the buffered nutrient solution ( see above ) . in addition , the ph of the sand solutions in the different treatments was measured using a ph meter . infection was assessed at 14 , 28 and 45 days after inoculation ( d.a.i . ) . at each assessment date , the roots of six plants per treatment ( i.e. two replicate plants by three blocks ) were harvested , rinsed free of sand , fixed with formyl acetic acid and then stained with ffa phloxine b to allow observation of the development of infection by p. brassicae . twenty root sections ( 200 m long ) per plant ( i.e. 120 root sections in each treatment ) were examined under compound microscope for the number of plasmodia in the root hairs and cortical cells . each block contained six replicate plants of each treatment ( i.e. a total of 18 plants per treatment ) . two plants per treatment per block ( i.e. six plants per treatment ) were harvested at each of the three sampling dates ( see above ) . treatments included 1:25 ( plus and minus inoculation ) and 1:200 ( plus inoculation ) dilutions of seaweed extract , and sterile distilled water ( plus and minus inoculation ) as the control . data were analysed by anova using genstat v. 12.1 ( vsn international , uk ) . homogeneity of variance was determined from plots of fitted values versus residuals , while histograms of residuals were examined for normality of distribution . fisher s least significance difference test was used to identify significant differences between treatment means . due to the low nutrient content of the undiluted seaweed extract and the dilutions used in this experiment , differences in the ph and nutrient content of the sand solutions in the different treatments were negligible , except for k and fe ( table 1 ) . in particular , the nutrient content between the control and the 1:200 seaweed extract treatment were similar . unlike the seaweed extract treatments , however , the sand solution in the control contained no laminarins or growth regulators.table 1calculated concentration of elements and compounds in the sand solutions of different seaweed extract ( se ) treatmentscomponentcontrolse ( 1:25)se ( 1:200)ph5.736.145.79n ( mg l)97.3103.298.0p ( mg l)14.314.914.4k ( mg l)108.6218.2122.3s ( mg l)29.738.630.9ca ( mg l)92.794.192.9 mg ( mg l)22.525.422.9fe ( g l)67.2408.0109.8mn ( g l)915.6921.5916.4b ( g l)920.9965.4926.5zn ( g l)90.8105.692.7mo ( g l)24.924.924.9cu ( g l)37.637.637.6laminarins ( mg l)0.0207.425.9auxins ( g l)0.000.450.06cytokinins ( g l)0.000.111.3 10 betaines ( g l)0.001.130.14 calculated concentration of elements and compounds in the sand solutions of different seaweed extract ( se ) treatments in the primary phases of infection , treatment with the seaweed extract reduced the number of plasmodia formed by p. brassicae in broccoli root hairs by up to 55 % compared with the control ( table 2 ) . the effect was statistically significant at 28 d.a.i . , but not at 14 d.a.i . at 45 d.a.i . , in the secondary phases of infection , plasmodia had formed in cortical cells and there were up to 84 % fewer in the roots of plants in the seaweed extract treatments than in the control ( table 2 ) . the dilution of seaweed extract ( 1:25 or 1:200 ) had no significant effect on the numbers of plasmodia formed by p. brassicae in root hairs or cortical cells of broccoli . no plasmodia formed in the non - inoculated treatments.table 2number of plasmodia ( per 200 m length of root section ) in the root hairs and cortical cells of broccoli following treatment with a seaweed extract ( se ) and inoculation with plasmodiophora brassicae treatmentplasmodia in the root hairplasmodia in cortical cells14 d.a.i.28 d.a.i.45 d.a.i.inoculated se ( 1:25)2.11.316.4 se ( 1:200)2.11.28.1 control ( water)3.02.751.7non - inoculated se ( 1:25)0.00.00.0 control ( water)0.00.00.0lsd ( p = 0.05)1.70.68.9 lsd least significant difference where p = 0.05 , d.a.i . days after inoculation number of plasmodia ( per 200 m length of root section ) in the root hairs and cortical cells of broccoli following treatment with a seaweed extract ( se ) and inoculation with plasmodiophora brassicae lsd least significant difference where p = 0.05 , d.a.i . days after inoculation to our knowledge , this is the first published report of a commercial seaweed extract directly suppressing infection of broccoli by p. brassicae . in this study , suppression of infection was observed as fewer numbers of plasmodia in the roots of the host . the seaweed extract had a greater effect in suppressing the secondary phases of infection ( plasmodia in the root cortex were reduced by up to 84 % ) than the primary phases of infection ( plasmodia in the root hairs were reduced by up to 55 % ) . the underlying biological reasons for this difference , however , could not be determined by the current study and warrant further investigation . it is possible that the extracts slowed the development of infection , or they interfered with transition from the primary to secondary phases of infection . it is important to recognise that suppression of infection does not always translate to reduced clubroot severity or improved commercial yields of broccoli . despite this , our unpublished field and glasshouse research conducted under conditions of low disease expression showed a trend towards reduced clubroot severity and gall sizes in broccoli treated with the seaweed extract . similarly , stewart ( 2008 ) found a trend towards reduced clubroot severity in broccoli plants treated with a different seaweed extract from a. nodosum , although this was not significant at the p 0.05 level . further field and glasshouse trials conducted under higher disease pressures are needed to determine if the effect of the seaweed extract in suppressing infection of broccoli by p. brassicae translates to lower clubroot severity . infection of brassicas by p. brassicae is strongly influenced by ph , with infection increasing under acidic conditions ( donald and porter 2004 , 2009 ) . using the identical sand solution method as the current experiment , donald and porter ( 2004 ) found that raising the ph of the nutrient solution from 5.5 to 8.0 reduced the proportion of root hairs of broccoli infected by p. brassicae by 70 % . in contrast , raising the ph of the nutrient solution from 5.5 to 6.5 only reduced infection by 5 % . in the current experiment , the addition of seaweed extract at dilutions of 1:25 and 1:200 raised the ph of the nutrient solution from ph 5.73 to 6.14 and 5.79 , respectively . given that both dilutions of seaweed extract inhibited p. brassicae infection to an equivalent level and the comparative results of donald and porter ( 2004 ) , there is little evidence that the effect in the current trial was due to ph . nonetheless , the use of alkaline seaweed extracts to modify ph in the rhizosphere of brassica crops warrants further investigation as a possible component in clubroot management . infection of brassicas by p. brassicae is also influenced by some nutrients ( donald and porter , 2009 ) . for example , increased levels of ca ( donald and porter 2004 ) , mg ( myers and campbell 1985 ) , and b ( webster and dixon 1991 ) have the capacity to decrease infection . the nutrient content of the sand solution in the current trial was sufficient to prevent nutrient stress in the host plant but allow maximum expression of infection ( myers and campbell 1985 ) . due to the dilutions used and their relatively low nutrient content , the addition of the seaweed extract treatments to plants in the experiment did not markedly affect nutrient concentrations in the sand solution ( table 1 ) , except for increased levels of fe and k. fe is not noted to affect infection of brassicas by p. brassicae ( donald and porter 2009 ) , while increased levels of k can enhance infection rather than suppress it ( prabhu et al . 2007 ) . this in addition to the fact that dilution of the seaweed extract did not affect its ability to suppress infection , suggesting that a direct nutrient effect from the extracts in reducing infection is highly unlikely . previous research has shown that the undiluted seaweed extract used in the current study can have a direct suppressive effect on the survival and growth of some pathogens ( e.g. sclerotinia minor ) or on their pathogenicity ( mattner et al . the extracts used in the current studies were diluted , so a direct biocidal effect against zoospores of p. brassicae seems unlikely . moreover , there was no difference in the ability of high and low dilutions of the extract to suppress infection . rather , it is hypothesised that the suppression of infection by the seaweed extract was due to its stimulation of resistance mechanisms in the host and/or the effect of exogenous growth regulators or other undiscovered molecules in the extract disrupting the infection process . it is well established that some elicitors ( e.g. salicylic acid ) can increase the expression of resistance genes and nanomolar concentrations of defence compounds in arabidopsis thaliana challenged by p. brassicae ( agarwal et al . other experiments have detected similar gene responses in arabidopsi thaliana treated with seaweed extracts from ascophyllum nodosum ( jayaraj et al . similarly , laminarins contained in various seaweed extracts can elicit defence responses in plants ( klarzynski et al . 2000 ; aziz et al . 2003 ) . it is possible that the ability of the seaweed extract to reduce infection of broccoli by p. brassicae in the current study was due to a similar effect , since the diluted extracts contained laminarins ( table 1 ) . brassicae system are needed to test this hypothesis . even though cytokinins and auxins play an important role in the development of clubroot dekhuijzen and overeem ( 1971 ) demonstrated that p. brassicae - infected and non - infected callus tissue of turnip required different concentrations of exogenous auxins and cytokinins to support their growth . siemens et al . ( 2006 ) found that a cytokinin overexpressing line of arabidopsis thaliana was resistant to clubroot disease . in contrast , stewart ( 2008 ) postulated that application of exogenous cytokinins would increase disease severity in brassica crops by stimulating root hair formation , which is the primary site of infection for p. brassicae . 2015 ) reported the presence of other growth regulators , i.e. strigolactones and brassinosteroids , in the seaweed extract investigated in the current trial . the effects of growth regulators on the interaction between plant development and pathogen infection are complex ( kazan and manners 2009 ; naseem and dandekar , 2012 ) . more chemical characterisation and investigation of complex seaweed extracts is needed to uncover the true mode of action for the seaweed extract we found to disrupt the infection process of p. brassicae in broccoli .
a sand solution technique demonstrated the capacity for a commercial seaweed extract from durvillaea potatorum and ascophyllum nodosum ( seasol commercial ) to significantly suppress infection of broccoli by plasmodiophora brassicae . in the primary stages of infection , the extract reduced the number of plasmodia formed in the root hairs by 55 % . later , in the secondary stages of infection , the extract reduced plasmodia in the root cortical cells by up to 84 % . the suppression of infection was found to be independent of the dilution of the extract applied ( 1:25 and 1:500 ) . the basis for these results is unlikely to be a nutrient or ph effect since the extract had little impact on these parameters , particularly at the lower dilution ( 1:200 ) . rather , we hypothesise that the suppression of infection by the seaweed extract was due to its stimulation of resistance mechanisms in the host , which is possibly related to laminarins in the extract and/or the effect of exogenous growth regulators or undiscovered molecules in the extract disrupting the infection process .
all procedures followed the nih guidelines for the care and use of laboratory animals , and were approved by the columbia university or national institute of dental and craniofacial research animal care and use committees . t2r32-sapphire mice are transgenics engineered to express the blue shifted gfp - derivative , sapphire , under the control of the t2r32 ( also referred to as tas2r139 , pubmed gene # nm_181275.1 ) promoter . these mice , generated by ken mueller ( ucsd thesis , 2004 ) , contained 10 kbp upstream of the t2r32 start codon fused to the gfp reporter . expression of sapphire in taste tissue was characterized using double label in situ hybridization ( see supplementary figure 3 ) . briefly , fungiform trcs were loaded in vivo with calcium green-1 dextran 3 kd ( invitrogen ) by electroporating individual taste buds . tongues were removed 24 36 h after dye loading and the epithelium was peeled enzymatically and placed in a custom recording chamber . the apical surface of the preparation was bathed in a constant flow of artificial saliva , and taste stimuli were delivered by focal application to individual taste buds . tastants were applied for 1 s , with a minimum of 10 s of artificial saliva between stimuli . changes in [ ca]i were monitored using a 5-live confocal microscope ( zeiss ) equipped with a 40 c - apochromat 1.20w objective ; images were captured at 4 hz , and f / f from individual trcs analyzed and pseudo - colored as described previously . to identify sapphire positive cells in t2r32-sapphire mice , we used 405-nm excitation laser to separate sapphire and calcium green-1 fluorescence . mean cellular fluorescence intensity ( f ) was calculated for the individual trcs and basal fluorescence ( fo ) was assigned to each cell by averaging fluorescence intensity over 3 s just before tastant application . f / f was calculated as [ f fo ] / fo ; taste cells were considered responders when f / f exceeded 3 standard deviations above fo within 5 s of tastant application . lingual stimulation and recording procedures were performed as previously described ; data analysis used the integrated response during the 5 s of tastant stimulation . compounds used for nerve recordings were : 0.03 1 m nacl ( with and without 10 m amiloride ) or 0.03 1 m kcl ( salty ) ; 20 mm acesulfamek ( sweet ) ; 50 mm monopotassium glutamate ( mpg ) plus 0.5 mm inosine monophosphate ( imp ) ( umami ) ; 0.1 mm cycloheximide ( bitter ) ; and 20 mm citric acid ( sour ) . for pharmacological blocking experiments , 3 mm aitc was applied to the tongue for 5 min prior to initiation of the recording session ; use of higher doses and/or repeated application of aitc often led to less specific inhibition of responses . responses to 20 mm citric acid ( figure 1 and supplementary figure 1 ) , 60 mm nacl ( figure 3 , supplementary figure 7 , 8b and 9 ) or 250 mm kcl before aitc application ( supplementary figure 8a ) were used to normalize responses for each experimental series . for figure 2 , data were normalized to 20 mm citric acid and then scaled to wt responses before aitc application . data were analyzed for statistical significance using an unpaired , one - tailed student s t - test and 95% confidence limits . to compute the amiloride - sensitive salt component , the stimulation regime involved sequential applications of nacl solutions first without and then with amiloride ( 5 sec pre- or pre-/post- incubation and co - application with nacl solution ) in the same experimental series . the amiloride - insensitive component was defined as the response in the presence of amiloride . the fraction of the response inhibited by amiloride was defined as the amiloride - sensitive component ( amiloride - sensitive component = response without amiloride response with amiloride ) . for pharmacological inhibition studies using allyl isothiocyanate ( aitc ) , responses to a series of taste stimuli then 3 mm aitc ( aldrich , 377430 - 5 g ) was applied to the tongue at a rate of 6 ml / min for 5 min . the tongue was washed with artificial saliva for 1 min and nerve responses to the same series of taste stimuli measured ; responses before and after aitc were compared for each animal . to minimize effects of recovery , responses after aitc were recorded within 15 min of aitc treatment . for pharmacological studies using bicarbonate , taste responses were measured in the presence or absence of 30 mm khco3 ( ph7.4 ) ( 5 sec pre - incubation and co - application with stimuli ) . in dorzolamide ( dza ) experiments , responses were monitored before and after incubation of the tongue with 0.5% dza ( w / v ) for 5 min . to study effects of ph on nerve responses , we adjusted the ph of artificial saliva ( 7.4 ) to 5.5 with hydrochloric acid . behavioral assays used a custom - made gustometer to measure immediate lick responses as described previously . for salt - attraction assays , mice were injected with furosemide ( 50 mg / kg ) and were placed in their home cage for 3 h without food or water before testing . for salt aversion assays , three or four ( attraction assay ) or two ( aversion assay ) different concentrations of tastant and water were presented to animals in each experimental session . differences between knockout and control mice were analyzed for statistical significance using a two - way anova with a bonferroni post hoc test . all procedures followed the nih guidelines for the care and use of laboratory animals , and were approved by the columbia university or national institute of dental and craniofacial research animal care and use committees . t2r32-sapphire mice are transgenics engineered to express the blue shifted gfp - derivative , sapphire , under the control of the t2r32 ( also referred to as tas2r139 , pubmed gene # nm_181275.1 ) promoter . these mice , generated by ken mueller ( ucsd thesis , 2004 ) , contained 10 kbp upstream of the t2r32 start codon fused to the gfp reporter . expression of sapphire in taste tissue was characterized using double label in situ hybridization ( see supplementary figure 3 ) . , fungiform trcs were loaded in vivo with calcium green-1 dextran 3 kd ( invitrogen ) by electroporating individual taste buds . tongues were removed 24 36 h after dye loading and the epithelium was peeled enzymatically and placed in a custom recording chamber . the apical surface of the preparation was bathed in a constant flow of artificial saliva , and taste stimuli were delivered by focal application to individual taste buds . tastants were applied for 1 s , with a minimum of 10 s of artificial saliva between stimuli . changes in [ ca]i were monitored using a 5-live confocal microscope ( zeiss ) equipped with a 40 c - apochromat 1.20w objective ; images were captured at 4 hz , and f / f from individual trcs analyzed and pseudo - colored as described previously . to identify sapphire positive cells in t2r32-sapphire mice , we used 405-nm excitation laser to separate sapphire and calcium green-1 fluorescence . mean cellular fluorescence intensity ( f ) was calculated for the individual trcs and basal fluorescence ( fo ) was assigned to each cell by averaging fluorescence intensity over 3 s just before tastant application . f / f was calculated as [ f fo ] / fo ; taste cells were considered responders when f / f exceeded 3 standard deviations above fo within 5 s of tastant application . lingual stimulation and recording procedures were performed as previously described ; data analysis used the integrated response during the 5 s of tastant stimulation . compounds used for nerve recordings were : 0.03 1 m nacl ( with and without 10 m amiloride ) or 0.03 1 m kcl ( salty ) ; 20 mm acesulfamek ( sweet ) ; 50 mm monopotassium glutamate ( mpg ) plus 0.5 mm inosine monophosphate ( imp ) ( umami ) ; 0.1 mm cycloheximide ( bitter ) ; and 20 mm citric acid ( sour ) . for pharmacological blocking experiments , 3 mm aitc was applied to the tongue for 5 min prior to initiation of the recording session ; use of higher doses and/or repeated application of aitc often led to less specific inhibition of responses . responses to 20 mm citric acid ( figure 1 and supplementary figure 1 ) , 60 mm nacl ( figure 3 , supplementary figure 7 , 8b and 9 ) or 250 mm kcl before aitc application ( supplementary figure 8a ) were used to normalize responses for each experimental series . for figure 2 , data were normalized to 20 mm citric acid and then scaled to wt responses before aitc application . data were analyzed for statistical significance using an unpaired , one - tailed student s t - test and 95% confidence limits . to compute the amiloride - sensitive salt component , the stimulation regime involved sequential applications of nacl solutions first without and then with amiloride ( 5 sec pre- or pre-/post- incubation and co - application with nacl solution ) in the same experimental series . the amiloride - insensitive component was defined as the response in the presence of amiloride . the fraction of the response inhibited by amiloride was defined as the amiloride - sensitive component ( amiloride - sensitive component = response without amiloride response with amiloride ) . for pharmacological inhibition studies using allyl isothiocyanate ( aitc ) , responses to a series of taste stimuli then 3 mm aitc ( aldrich , 377430 - 5 g ) was applied to the tongue at a rate of 6 ml / min for 5 min . the tongue was washed with artificial saliva for 1 min and nerve responses to the same series of taste stimuli measured ; responses before and after aitc were compared for each animal . to minimize effects of recovery , responses after aitc were recorded within 15 min of aitc treatment . for pharmacological studies using bicarbonate , taste responses were measured in the presence or absence of 30 mm khco3 ( ph7.4 ) ( 5 sec pre - incubation and co - application with stimuli ) . in dorzolamide ( dza ) experiments , responses were monitored before and after incubation of the tongue with 0.5% dza ( w / v ) for 5 min . to study effects of ph on nerve responses , we adjusted the ph of artificial saliva ( 7.4 ) to 5.5 with hydrochloric acid . behavioral assays used a custom - made gustometer to measure immediate lick responses as described previously . for salt - attraction assays , mice were injected with furosemide ( 50 mg / kg ) and were placed in their home cage for 3 h without food or water before testing . for salt aversion assays , mice were water deprived for 24 h before testing . three or four ( attraction assay ) or two ( aversion assay ) different concentrations of tastant and water were presented to animals in each experimental session . differences between knockout and control mice were analyzed for statistical significance using a two - way anova with a bonferroni post hoc test .
in the tongue , distinct classes of taste receptor cells detect the five basic tastes , sweet , sour , bitter , sodium salt , and umami1,2 . among these qualities , bitter and sour stimuli are innately aversive , whereas sweet and umami are appetitive , and generally attractive to animals . in contrast , salty taste is unique in that increasing salt concentration fundamentally transforms an innately appetitive stimulus into a powerfully aversive one37 . this appetitive - aversive balance helps maintain appropriate salt consumption3,4,6,8 , and represents an important part of fluid and electrolyte homeostasis . we have previously shown that the appetitive responses to nacl are mediated by taste receptor cells expressing the epithelial sodium channel , enac8 , while the cellular substrate for salt aversion was unknown . here we explore the cellular and molecular basis for the rejection of high concentrations of salts ( > 300 mm nacl or kcl ) . we now show that high - salt recruits the two primary aversive taste pathways by activating the sour and bitter taste - sensing cells . we also demonstrate that genetic silencing of these pathways abolishes behavioral aversion to concentrated salt , without impairing salt attraction . notably , mice devoid of salt - aversion pathways now exhibit unimpeded , continuous attraction even to exceedingly high concentrations of nacl . we propose that the co - opting of sour and bitter neural pathways evolved as a means to ensure that high levels of salt reliably trigger robust behavioral rejection , thus preventing its potentially detrimental effects in health and well - being .