article
stringlengths
0
826k
abstract
stringlengths
174
4.34k
the cytoskeletal components of endothelial cells play important roles in maintaining the fundamental structure of the thin inner layer of the blood vessels called the endothelium . endothelial cells form a single cell layer on the surfaces of blood vessels and are therefore constantly subjected to both fluid shear stress and periodic strain caused by blood pressure induced by the pulsatile flow . endothelial cells have been shown to possess many stress fibers both in vitro and in situ , and these cells are known to be capable of responding to the level of fluid shear stress by changing their shape [ 1 , 2 ] , distribution of cytoskeletal components [ 35 ] , expression of signal transduction - associated proteins [ 6 , 7 ] , and expression of various genes [ 8 , 9 ] . endothelial cells in culture are known to respond to cyclic stretching and hyperosmotic shock . on exposure to uniaxial cyclic stretching , endothelial cells become aligned perpendicular to the axis of stretching [ 10 , 11 ] . cyclic stretching applied to cells in culture is a model of pulsatile stretching induced by blood pressure in vivo , and the effects differ from those of fluid shear stress generated by the blood flow . hemodynamic shear stress caused by blood flow occurs in combination with cyclic stretching caused by the pressure of pulsatile flow generated by blood pressure . previous in vivo experiments indicated that stress fibers in endothelial cells respond to fluid shear stress and show increases in both number and thickness in a manner related to the magnitude of shear stress ( for review , see katoh et al . , previously , we reported increases in number and thickness of stress fibers and focal adhesions in both the apical and basal portions of endothelial cells in an artificial coarctation zone in the abdominal aorta where fluid shear stress is significantly high in comparison to endothelial cells subjected to averaged shear stress . the plaque - like vinculin - containing spots detected at the ends of stress fibers were enlarged in the coarctation area , especially in the apical portions of the cells . in addition , stress fibers and their sites of association with the plasma membrane are closely attached to both the apical and basal portions of endothelial cells , and we suggested that they may play key roles in force transfer by fluid stress [ 13 , 14 ] . our findings also suggested that even in the case of endothelial cells in situ , the apical plaques ( i.e. , stress fiber - plasma membrane attachment sites with accumulation of focal adhesion - associated proteins ) and their associated stress fibers are candidates for sensing and/or transferring mechanical signals of fluid shear stress applied to the laminar surface of endothelial cells [ 6 , 14 ] . apical plaques are enlarged in the apical portion of endothelial cells in the coarctation zone reflecting the response of the apical plaque and its associated stress fibers to mechanical stimuli generated by blood flow . such responses increase according to the magnitude of applied shear stress , in agreement with the observations in traditional in vitro cell culture systems [ 2 , 1518 ] . stress fibers are major higher - order structural components of the cytoskeleton in nonmuscle cells , which are composed of actomyosin filaments and show contractility both in vitro and in situ . we reported previously that stress fibers could be isolated from fibroblasts without loss of morphological or functional characteristics and that they represent a major part of the contractile apparatus within the cell . we also reported that the stress fibers are located not only in the basal portion of the cell , but also in the apical portion in both cultured fibroblasts and in guinea pig aortic endothelial cells , and we called these apically located stress fibers apical stress fibers . some apical stress fibers not only connect to the apical plaques but also make direct connections with focal adhesions in the basal portion of endothelial cells , and the apical stress fibers have the ability to transfer mechanical forces from the apical to the basal portion of the cell . apical stress fibers in endothelial cells in situ are directly subjected to fluid shear stress , and the mechanical stimuli generated by this fluid shear stress are applied directly to the apical stress fibers . blood vessels in the living animal are subjected to pulsatile stretches generated by the heart via the circulatory system . these pulsatile stretches seem to induce changes in endothelial cell shape and the formation of cytoskeletal components . previous in vitro experiments showed that cyclic stretching applied to cells in culture causes the cells to become oriented perpendicular to the direction of stretching [ 10 , 21 , 22 ] consistent with in vivo results . on the other hand , in cells exposed to unidirectional tension , the stress fibers become organized along the axis of tension . in situ experiments indicated that guinea pig venous endothelial cells were elongated in the direction of blood flow to a greater extent than unperturbed aortic endothelial cells . moreover , thick stress fibers located at the basal side of venous endothelial cells were fewer in number than in aortic endothelial cells . the morphological differences between venous and aortic endothelial cells seem to be due to the sustained exposure of the former cell type to significantly lower levels of fluid shear stress than the latter . however , cell culture conditions preclude accurate observations because the cells have been artificially removed from the living animal . therefore , analyses of the fundamental mechanisms involved in the responses to mechanical stimuli , such as fluid shear stress , pulsatile enlargement of blood vessel diameter , and/or stretching , should be performed in living intact blood vessels . in the basal portion of endothelial cells , stress fibers generally run along the axis of blood flow in typical aortic and venous endothelial cells . however , we reported previously that stress fibers in the apical portion of venous endothelial cells run perpendicular to the direction of blood flow . these observations raised questions regarding whether the mechanism by which stress fibers run is independent of the direction of blood flow . both the right and left renal arteries branch off from the abdominal aorta at an angle of 90 and carry blood to the kidneys . blood in the renal artery is filtered by the kidneys , and so the resistance to blood flow applied to the surface of the renal artery should be higher than that in most other arteries . mechanical stress applied to the endothelial cells in the renal artery should be different from the straight portion of the abdominal aorta in situ , and therefore the distribution of cytoskeletal components , such as stress fibers and focal adhesions , should differ considerably between renal artery endothelial cells and endothelial cells experiencing unidirectional flow in situ . the observations outlined above prompted us to examine the detailed distributions of cytoskeletal components and associated proteins . here , we carefully compared the cytoskeletal components of endothelial cells in the renal artery with those of unperturbed arterial and venous endothelial cells . the results indicated that the cytoskeletal components of endothelial cells in the renal artery showed quiet different distribution patterns from the stress fibers in unperturbed aortic and venous endothelial cells . aortae were obtained from adult guinea pigs weighing 250400 g. some animals were treated as described below . after perfusion with 0.85% nacl containing 200 units of heparin sodium via the left ventricle , the abdominal aortae were excised and fixed with 1% or 2% paraformaldehyde using the microwave irradiation method . louis , mo ) , antipaxillin ( bd transduction laboratories , san jose , ca ) , anti - alpha - actinin ( sigma ) , and antiphosphorylated tyrosine - containing protein antibody ( clone py-20 ; icn pharmaceuticals , aurora , oh ) were purchased from the sources indicated . fitc - labeled secondary antibody against rabbit igg was purchased from zymed ( san francisco , ca ) . fixed aortae were rinsed several times with phosphate - buffered saline ( pbs ) and cut into small pieces . after permeabilization with 0.5% triton x-100 in pbs for 5 min , specimens were incubated with antibodies ; some specimens were double - stained with rhodamine - labeled phalloidin . specimens were mounted in 90% glycerol in pbs containing 2.5% 1,4-diazabicyclo[2.2.2]octane ( dabco ; sigma ) and examined by confocal laser scanning microscopy ( clsm ) ( fv-1000 ; olympus , tokyo , japan ) with a plan apochromat 60 ( n.a . stereo pair images were reconstructed from 20 to 30 serial optical sections obtained by clsm using image j software ( nih , bethesda , ml ) . for ultrasound microimaging , renal arteries were obtained from adult guinea pigs weighing approximately 380420 g. ultrasound images of the renal artery were obtained using a high - frequency ultrasound imaging system ( vevo 770 ; visualsonics , toronto , on , canada ) . animals were anesthetized by intraperitoneal injection of pentobarbital sodium at a dose of 10 mg/400 g body weight ( abbott laboratories , abbott park , il ) . after perfusion , the abdomen was surgically opened , and living ultrasound images of the renal artery and abdominal aorta were obtained , and blood flow speed was measured using an ultrasound imaging system . the distributions of stress fibers and focal adhesions were determined by confocal laser scanning microscopy in whole - mount preparations of the guinea pig renal artery . specimens were double stained with rhodamine - labeled phalloidin for visualization of stress fibers and with antivinculin antibody for visualization of focal adhesions ( figure 1 ) . phalloidin - positive actin - containing filaments in the renal artery also showed a punctate linear staining pattern with anti - alpha - actinin antibody , so they were classified as well - developed stress fibers ( data not shown ) . when the focal plane was adjusted at the basal portion of the cell , stress fibers were shown to run perpendicular to the direction of blood flow ( figure 1(b ) ; arrowheads ) . on the other hand , when the focal plane was adjusted to the apical portion of the endothelial cells , many stress fibers were observed running along the direction of blood flow ( figure 1(a ) ; flow ) . some stress fibers were also shown to run perpendicular to the direction of flow ( figure 1(a ) ; arrowheads ) . both ends of the stress fibers were associated with vinculin ( figure 1(d ) ) or paxillin ( data not shown ) , confirming the identity of vinculin - positive spots as focal adhesions . focal adhesions revealed by staining with antivinculin antibody were closely associated with the stress fibers in the basal portion of the cell in a dot - like configuration ( figure 1(d ) ) . significant immunofluorescent staining with antivinculin antibody was not detected at the apical surface of the cells . however , intense staining was also detected at the sites of cell - to - cell association , presumably adherens junctions of the endothelial cells ( figure 1(c ) ) . stress fibers in the unperturbed aortic endothelial cells ran along the direction of blood flow in the basal portion of the cell [ 14 , 28 ] . in the basal portion of the cell , the stress fibers in the renal artery were shown to run perpendicular to the direction of blood flow . in the apical portion of unperturbed endothelial cells located in the abdominal aorta , stress fibers were only observed along the direction of blood flow in both the apical and basal portions . to determine the distribution of stress fibers in renal arterial endothelial cells in greater detail , three - dimensional stereo images stained with rhodamine - labeled phalloidin were reconstructed from confocal serial optical sections ( figure 2(c ) for stereo image ) . many stress fibers running both parallel and perpendicular to the direction of flow were observed in the apical portion of the cell ( figure 2(a ) for a single confocal image ) . only thick stress fibers running perpendicular to the direction of blood flow were observed in the basal portion of the cell ( figure 2(b ) for a single confocal image ; figure 2(c ) for stereo image ) . as certain proteins undergo tyrosine phosphorylation during intracellular signaling events , we next examined the tyrosine phosphorylation levels of endothelial cells in the renal artery ( figure 3 ) . en face preparations stained with an antibody against phosphotyrosine - containing proteins or an antibody against vinculin were examined by confocal laser scanning microscopy . positive staining with antiphosphotyrosine antibody was observed in a uniform pattern at the apical surface of the endothelial cells ( figure 3(a ) ) . when the focal plane was adjusted to the middle level of the cells , staining was detected at sites of cell - to - cell apposition ( figure 3(b ) ) . the focal plane was adjusted to the basal portion of the cell , and staining with antiphosphotyrosine antibody was mainly detected at cell - to - cell adhesion sites , but not along stress fibers or focal adhesions ( figure 3(c ) ) . on the other hand , staining with antivinculin was detected at both sites of cell - to - cell apposition ( figure 3(e ) ) and focal adhesions at the basal side of the cell ( figure 3(f ) ) . no significant staining was detected at the apical surface of the cell ( figure 3(d ) ) . staining with antivinculin and antiphosphotyrosine antibodies did not show complete colocalization at the basal portion of cells ( figures 3(c ) and 3(f ) ) . the renal artery was also double - stained for f - actin with rhodamine - labeled phalloidin and with antiphosphotyrosine antibody . figure 4 shows a stereo view of a cell double - stained with rhodamine - labeled phalloidin to visualize actin filaments and with antiphosphotyrosine antibody , and the results indicated no colocalization of tyrosine - phosphorylated proteins and stress fibers . positive staining for phosphotyrosine was detected on the plasma membrane over endothelial cells , especially along the cell - to - cell adhesion sites . however , the specific distribution of staining for phosphotyrosine was not detected along the stress fibers in the basal or apical portions of the cell . to visualize and measure blood flow in the renal artery , we measured biological parameters using an ultrasound microimaging system . living images of the abdominal aorta and the renal artery are shown in figure 5(a ) . doppler blood flow recordings were also made for the abdominal aorta ( figure 5(b ) ) and renal artery ( figure 5(c ) ) . retrograde blood flow was detected in the renal artery in cyclic diastolic phases ( figure 5(c ) ) , indicating that the renal arterial endothelial cells are subjected to forward and backward force caused by the circulatory pulse . it is difficult to calculate the precise shear stress applied to endothelial cells in the renal artery because of the complicated forward and backward flow , pulsatile pressure , and resistance pressure from the kidney . however , pulsatile flow in the renal artery results in significant fluctuations in the magnitude of shear stress and/or pressure , which are not predicted to occur in unperturbed aortic endothelial cells . further studies are required to precisely determine the fluid shear stress and pressure applied to the endothelial cells in the renal artery . fluctuating and retrograde flow in the renal artery seem to have an influence on stress fiber localization , as stress fibers run perpendicular to the direction of blood flow in the basal portion of the cells ( see figures 1 and 2 ) . endothelial cells respond to fluid shear stress and show changes in morphology and organization of cytoskeletal components . unperturbed aortic endothelial cells , such as those in the straight portion of the abdominal aorta , show elongation along the direction of blood flow . in this region , cytoskeletal components , such as stress fibers and focal adhesions , are also enhanced in a manner corresponding to the magnitude of blood flow [ 6 , 14 ] . we reported previously that cytoskeletal components , such as stress fibers and focal adhesions , are significantly increased in both number and size in the surgical coarctation zone in the straight portion of the abdominal aorta where fluid shear stress is expected to be high . confocal laser scanning microscopy indicated the presence of thick stress fibers in the basal portion of the cells in the artificial coarctation zone . stress fibers were also observed in the apical portion along the direction of blood flow , where they are continually exposed to mechanical stimulation generated by the blood flow . on the other hand , venous endothelial cells had fewer thick basal stress fibers than unperturbed aortic endothelial cells . moreover , many apical stress fibers running perpendicular to the direction of blood flow were seen in the apical region of venous epithelial cells . the results of the present study indicated that stress fibers run perpendicular to the direction of blood flow in both the apical and basal regions of renal endothelial cells . although the renal arterial endothelial cells were elongated along the direction of flow , stress fibers were localized perpendicular to the axis of elongation in the basal portion of these cells . the complex nature of the different environmental conditions seemed to induce alterations in the cytoskeletal components and associated morphological changes in these cells , compared to unperturbed aortic and venous endothelial cells . high fluid shear stress is generally thought to result in increases in both the number and thickness of stress and focal adhesions . however , the results of the present study indicated that the arrangement of stress fibers and cell shape along the direction of blood flow were independently regulated by mechanical stimuli . fluid shear stress induced orientation of the stress fibers and associated focal adhesions along the direction of blood flow , while oscillatory flow caused the stress fibers and focal adhesions to be oriented perpendicular to the direction of blood flow . table 1 summarizes the directions of stress fibers in aortic , venous , and renal arterial endothelial cells . , we showed that tyrosine - phosphorylated proteins are localized at the endothelial cell surface and sites of cell - to - cell apposition in the renal artery . these observations were consistent with those in unperturbed aortic endothelial cells , so that signaling by mechanical stimuli may occur in the same position in renal arterial and other arterial endothelial cells in situ . we and other groups have previously identified several proteins that undergo tyrosine phosphorylation induced by fluid shear stress . pecam-1 , which is mainly localized at the sites of endothelial cell - to - cell apposition , is tyrosine phosphorylated when endothelial cells are subjected to high levels of shear stress . src family proteins are also tyrosine phosphorylated when cells are subjected to high shear stress . moreover , expression of c - src is increased in the artificial coarctation zone in the abdominal aorta . these observations suggested that pecam-1 and c - src are primary candidates for signal transduction of mechanical stimuli in endothelial cells in the renal artery . the bidirectionality of the oscillating blood flow itself may be the key to the perpendicular orientation , or some unique protein(s ) made only by renal endothelial cells may interact to perpendicularly reorient the basal stress fibers . we are currently engaged in studies of the unique molecules expressed in renal arterial endothelial cells . stress fibers running perpendicular to the direction of blood flow were shown to be present at ( 1 ) the apical surface of venous endothelial cells , ( 2 ) the apical surface of aortic endothelial cells in the artificial coarctation zone , ( 3 ) the apical side of renal arterial endothelial cells ( as demonstrated in the present study ) , and ( 4 ) the basal side of renal arterial endothelial cells ( as demonstrated in the present study ) . the directions of stress fibers in endothelial cells in aortic , venous , and renal arteries are summarized in table 1 . venous endothelial cells also possess apical stress fibers that run perpendicular to the direction of blood flow . however , in the basal portion of venous endothelial cells , stress fibers were found to run along the direction of flow . although the reasons for the above discrepancy related to blood flow are still unclear , it is likely that the stress fiber direction is determined not only by the direction of blood flow but also by other mechanical forces , such as pressure and/or stretching force to which the endothelial cells are exposed . it is of interest that endothelial cells in the renal artery were aligned along the direction of blood flow . in the basal portions of the cell , all of the stress fibers ran perpendicular to the direction of blood flow . moreover , focal adhesions in this region were also aligned along the perpendicular stress fibers . the alignments of stress fibers and focal adhesions in this region were completely independent of the direction of blood flow . on the other hand , in the apical portion of the renal arterial endothelial cells , the mechanism underlying the organization of stress fibers that run perpendicular to the direction of blood flow is unclear , but it is likely that these perpendicular stress fibers respond to stretching force generated by blood pressure applied to the endothelial cells . in mesothelial cells subjected to single - direction stretching , stress fibers were aligned in the direction of stretch . on the other hand , cells subjected to cyclic stretch - activated ( sa ) ion channels play a role in reorientation of endothelial cells that is not dependent on fluid shear stress force . an inhibitor of sa channels was shown to block sa - induced reorientation of endothelial cells , but no changes were observed in stress fiber organization by the inhibitor . these observations suggest that the stress fibers running perpendicular to the direction of flow may be organized by the stretching force generated by blood flow . in the apical portion of the cell , stress fibers were found to run along the direction of blood flow as observed in unperturbed aortic endothelial cells . these observations suggested that the orientation of apical stress fibers was primarily induced by the fluid shear stress , because the endothelial cell surface is directly exposed to fluid shear stress together with pulsatile pressure . the organization of cytoskeletal components in endothelial cells on the inner surface of blood vessels in the renal artery is controlled by local mechanical stimuli , consisting of a complex combination of bidirectional fluid shear stress , and oscillatory longitudinal and/or circumferential pressure . in this study , we found a difference between the directionality of stress fibers in renal endothelial cells compared to the unperturbed aortic endothelial cells . the renal artery branches off from the abdominal aorta at an angle of almost 90 and is inserted directly into the kidney . this geometry may result in special physiological blood flow conditions , such as stretching force over the endothelial cells . the morphological alignment of endothelial cells along the direction of blood flow and the organization of cytoskeletal components were shown to be independently regulated . further studies are required to gain insight into the organization of cytoskeletal components and associated changes in cell shape in response to mechanical stimuli applied to endothelial cells in both in situ and in vitro .
the cytoskeletal components of endothelial cells in the renal artery were examined by analysis of en face preparations under confocal laser scanning microscopy . renal arterial endothelial cells were shown to be elongated along the direction of blood flow , while stress fibers ran perpendicular to the flow in the basal portion . focal adhesions were observed along the stress fibers in dot - like configurations . on the other hand , stress fibers in the apical portion of cells ran along the direction of flow . the localizations of stress fibers and focal adhesions in endothelial cells in the renal artery differed from those of unperturbed aortic and venous endothelial cells . tyrosine - phosphorylated proteins were mainly detected at the sites of cell - to - cell apposition , but not in focal adhesions . pulsatile pressure and fluid shear stress applied over endothelial cells in the renal artery induce stress fiber organization and localization of focal adhesions . these observations suggest that the morphological alignment of endothelial cells along the direction of blood flow and the organization of cytoskeletal components are independently regulated .
puberty is an ordinary situation to adolescence and the progress of secondary sexual characteristics leads to the total differentiation between male and female . also , the final height and posture of the male and female adolescents are determined in this period ( 1 ) . the menarche age is often considered for various reasons . it is one of the major indices of the female fertility which includes the period up to the menopause ( 2 ) . there have been studies on the role of height , weight , and body structure on the menarche age ; however , there is a variation on the role of such factors ( 35 ) . some researchers believe that some body fat is necessary in female adolescents and there is a minimum weight requirement for starting the menstruation ( 1 ) . higher food consumption which is often a result of the improved socioeconomic status is among factors leading to the lowered age of menstruation , as witnessed in the present century ( 6 ) . overweight and increased body mass index ( bmi ) have been among the major changes in girls ( 7 ) and most likely being important factors affecting the menarche age . menarche age is related to incidence risk of diseases such as breast cancer , obesity , and endometer cancer ( 810 ) . the purpose of present study was to investigate the relationship between menarche age and bmi in adolescent girls 11 - 17 years of age in kish island , iran 2011 . the study sample consisted of 488 adolescent girls 11 - 17 years old was the entire population of the secondary school girls in kish island , iran , in 2011 . data was collected by measuring height ( cm ) , weight ( kg ) and consequently calculation of bmi by dividing weight ( kg ) into squared height ( m ) . the menarche age was ascertained and recorded using self or parental report . for measuring the weight with an accuracy of 0.1 kg , minimal clothes and no shoes the participants heights were measured by a plastic measuring tape attached to a wall ; the participants were required to put their legs straight together , keep their arms to their sides and keep their knees , shoulders and back of their head all in the same direction ; a ruler touching the top of their head and the measurement was recorded with an accuracy of 0.5 cm . data are presented as mean ( sd ) for numerical or n ( % ) for categorical variables . two - sample independent t - test was applied for comparing weight , height , and bmi of menarche and non - menarche groups . similarly , the adjusted effects of height and bmi were estimated in models 2 and 3 , respectively . to be able to compare the effects of weight , height , and bmi this will help us to identify a factor with minimal correlation with age as the most effective factor predicting menarche . all statistical analyses were conducted in r ( version 2.15.4 ) statistical software ( 11 ) . data was collected by measuring height ( cm ) , weight ( kg ) and consequently calculation of bmi by dividing weight ( kg ) into squared height ( m ) . the menarche age was ascertained and recorded using self or parental report . for measuring the weight with an accuracy of 0.1 kg , minimal clothes and no shoes were required . a portable scale ( made in germany by soehnle ) the participants heights were measured by a plastic measuring tape attached to a wall ; the participants were required to put their legs straight together , keep their arms to their sides and keep their knees , shoulders and back of their head all in the same direction ; a ruler touching the top of their head and the measurement was recorded with an accuracy of 0.5 cm . data are presented as mean ( sd ) for numerical or n ( % ) for categorical variables . two - sample independent t - test was applied for comparing weight , height , and bmi of menarche and non - menarche groups . similarly , the adjusted effects of height and bmi were estimated in models 2 and 3 , respectively . to be able to compare the effects of weight , height , and bmi this will help us to identify a factor with minimal correlation with age as the most effective factor predicting menarche . all statistical analyses were conducted in r ( version 2.15.4 ) statistical software ( 11 ) . table 1 shows the sample proportion of menarche atany given age indicating the cumulative distribution of age of menarche . of course this estimation is based on the definition of age which is defined as the number of birthdays a person has experienced . 1 ) . cumulative distribution of proportion of menarche by age cumulativedistribution ofage of menarche ( kish island , iran 2011 ) the mean weight , height , and bmi by ageseparated for menarcheand non - menarche groups results of three logistic regression models note that since the age distribution of menarche is almost symmetric , such median can be considered as the mean age of menarche as well . table 2 shows that bmi of the menstruated girls were within range of 18.9 - 22.3 kg / m while in non - menarche group ranges between 17.7 and 19.5 . table 2 also shows that generally , in each age group of menarche , children are heavier , taller , and fatter than non- menarche . in fact , apart from age group 11 , all differences between the above two groups regarding the above characteristics were highly statistically significant . table 3 shows the results of three different logistic regression models fitted to data predicting age adjusted effects of variables weight , height , and bmi ( models 1 - 3 ) . as indicated in table 3 ( model 1 ) , adjusting for age , every 1 unit ( kg ) increment of weight increases the odds of menarche by about 7% ( p < 0.001 ) . based on model 2 , adjusting for age , every 1 unit ( cm ) increment of height increases the odds of menarche by about 13% ( p < 0.001 ) . finally , according to model 3 , again adjusting for age , every 1 unit ( kg / m2 ) increment of bmi increases the odds of menarche by 18% ( p < 0.001 ) . in order to compare the adjusted effects of weight , height , and bmi ; new logistic regression models results of these models also indicated ( not shown ) that by every standard deviation unit increment of weight , height , and bmi , the odds of menarche become 2.5 , 2.13 , and 2.10 folds respectively . in this cross sectional study conducted in kish island , in the southern province of iran , most menstruated girls were in the age range of 12 - 14 years old ( 91.8% ) . 1 , the median age at menarche in kish island is 12.85 years which is lower than previous studies in iran , showing a clear decreasing trend of menarche age . in our data analyses we found some interesting results as indicated in table 3 . it has been found that the effect of age on menarche is more pronounced when estimating the bmi effect ( model 3 ; or=3.36 ; 95% ci ( 2.51 , 4.49 ) ) as compared to the other two models . the reason for such phenomenon is that the bmi is less correlated with age ( r=.18 ) than weight and height ( with r=.26 , and r=.35 , respectively of pearson correlation with age ) . after height , weight is more correlated with age . although the correlation between bmi and age is not quite high , it is the most important factor and its impact on menarche is highly significant ( table 3 ) . 1 ) , which is lower in comparison with countries such as bangladesh ( 15.8 ) , congo ( 13.83 ) , ghana ( 13.98 ) , tanzania ( 15.21 ) and senegal ( 16.1 ) ( 12 ) . it is however , similar to countries such as america ( 12.8 ) , greece ( 12.0 ) and italy ( 12.2 ) ( 12 ) . although the timing of puberty is related to the genetic factors , other factors such as geographical location , common health status , nutrition and socioeconomic status affect the onset of menstruation and its progression . since data collections procedures vary in different studies and consequently could affect the results , therefore interpretation and comparison of such findings require some caution . the results of the present study when compared with the other iranian studies indicate that the menarche age in girls in kish island is similar to those in the northern and central parts of iran ( 3 , 4 ) . however , they all show a decreasing trend in the menarche age throughout the last 20 years , as in countries similar to america , europe and asia ( 2 , 4 , 1315 ) . there are many studies showing the decreasing trend of the menarche age in the last 100 years ; one such study is anderson and colleagues study in the us , investigating the changes of the menarche age , which showed that the mean menarche age in american girls had decreased from 12.75 to 12.54 in a 20-year time span ( 16 ) . also , the mean menarche age had decreased within the past 40 years , attributing the reduction to girls increasing obesity ( 17 ) . other researchers also attribute this to other factors including social , economical , health and nutritional improvement ( 6 ) . in the present study , the weight of the menstruated girls in kish island , iran was 51.4310.73 kg , which is higher than the respective figures in other parts of iran ( 18 ) . it seems that lifestyle , health services , familial economic improvements , low physical activity and overconsumption of fast food and regionally particular nutrition are among the factors leading to the heavier weight of the participants in present study . although the mechanisms involved in the negative correlation between obesity and menarche age are not well recognized , it is suggested that many endocrine factors are alleged to affect the speed of sexual puberty and fat accumulation in the body ( 9 ) . firsch believes that in order to start menstruation , girls need to achieve a minimum weight of 47.8 kg ; and more importantly , their body fat should amount to 23.7% ( from 16% ) ( 19 ) . therefore , the puberty starts earlier in medium - obese girls ( with 20 to 30% overweight than normal ) than in girls with normal weight ; in contrast , girls with malnutrition will experience a delay in menstruation ( 12 ) . several studies indicate that the childhood obesity is a predictor of early puberty ( 20 ) . in the present study , this is in line with some earlier studies as well ( 5 , 21 , 22 ) . the increase in the body fat mass can be a significant message to cause the secretion of leptin , stimulating the hypothalamus and consequently the over - secretion of gnrh . moreover , gnrh stimulates the hypophysis - ovarian axis and initiates the speeding up puberty ( 23 ) . mean height of the participants in the present study was 156.0611.35 cm , which is close to figures obtained in studies of other iranian regions . the height of the menstruated girls was significantly taller than the non - menstruated ones . this finding is in line with earlier studies ( 18 , 21 , 22 ) . taller girls ( 148.60 cm ) experience menstruation earlier than shorter ones ( 135 cm ) in california ( 17 ) . the interesting point is that girls with earlier puberty have shorter height in adulthood in comparison with those with delayed puberty , indeed the former experience speeded development and enjoy a taller height at puberty ( 24 ) . it was observed that the menstruated girls bmi was significantly higher than the non - menstruated girls bmi ; this is also congruent with other studies ( 18 , 21 , 22 , 25 , 26 ) . in the present study , 62.2% of the menstruated girls had a bmi of above 18.5 , indicating that physical condition is in agreement to a previous study by einy and colleagues in iran , the menarche age of girls with higher bmi , was lower than those with normal or lower bmi ( 27 ) . the results of the present study indicate that menarche age in iran is experiencing a decreasing trend and parallel to this trend , the height , weight , and bmi is on the rise for children and adolescents in this country as well . in addition bmi of the child was shown to be positively associated with the odds of menarche . it is recommended implementation of educational plans to enhance the knowledge of the adolescent girls on their habits of nutrition and providing them with the appropriate eating patterns . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
abstractbackgroundprediction of the onset of menstruation ( menarche age ) using height , weight and body mass index ( bmi ) is a major health procedure . the present study was conducted to determine the relationship between anthropometric indices and menarche age in 488 girls 11 - 17 years in southern iran ( kish island ) in 2011.methodsdata was collected using questionnaires as well as measurements of the children s height and weight . this data was analyzed using t - test and logistic regression.resultsmedian age of menarche of menstruated girls as inferred from the age of menarche cumulative distribution was 12.9 years . mean ( sd ) bmi in menstruated and non - menstruated girls were 21.97 ( 4.5 ) and 19.17 ( 3.7 ) , respectively . mean ( sd ) weight and height of the menstruated girls were 53.65 ( 12.3 ) kg and 156.06 ( 5.5 ) cm , respectively which are higher than respective figures of the non - menstruated participants 43.70 ( 10.7 ) kg and 150.21 ( 6.3 ) cm , respectively . our results revealed a significant correlation between bmi and menarche age.conclusionmenarche age and bmi are significantly correlated with higher bmi related to lower menarche age .
self - assembled monolayers ( sams ) containing embedded dipolar groups offer the particular advantage of changing the electronic properties of a surface without affecting the sam ambient interface . here we show that such systems can also be used for continuously tuning metal work functions by growing mixed monolayers consisting of molecules with different orientations of the embedded dipolar groups . to avoid injection hot - spots when using the sam - modified electrodes in devices , a homogeneous mixing of the two components is crucial . we show that a combination of high - resolution x - ray photoelectron spectroscopy with state - of - the - art simulations is an ideal tool for probing the electrostatic homogeneity of the layers and thus for determining phase separation processes in polar adsorbate assemblies down to inhomogeneities at the molecular level .
matrix producing carcinoma ( mpc ) of the breast is a rare variant of metaplastic carcinoma with a total of approximately 240 cases have been reported to date . direct transition of carcinomatous elements to cartilaginous or osseous matrix without an intervening spindle cell component make the major diagnostic histopathologic criteria . reports dealing with cytological features of mpc are far more scarce with only a few cases reported to date . it has been suggested that the tumor cells have the features of both epithelial and mesenchymal cells . herein , we report a case of a mpc in a 59-year - old woman with cytological , histopathological and immunohistochemical findings . a 59-year - old woman presented with a palpable , hard nonmobile mass in her left breast . fna smears showed ovoid to cuboidal shaped and spindly cells with bland nuclear features embedded in a chondromyxoid background . these cells also formed sheet - like clusters [ figure 1a ] . between these neoplastic tissue fragments , loosely cohesive , highly pleomorphic epithelial cells with hyperchromatic and angulated nuclei were present [ figure 1b ] . in some microscopic fields , a transition could be observed between epithelial cells and the matrix - stromal complex . some chondrocyte like cells were found to be present in the metachromatic extracellular matrix [ figure 1c ] . histopathological examination showed invasive carcinoma with an abrupt transition to chondromyxoid matrix without an intervening spindle cell component [ figure 2a and b ] . ( a and b ) transition from carcinoma to chondromyxoid matrix without intervening spindle cell component . ( d ) central comedo - necrosis with high grade solid undifferentiated mammary carcinoma medium to large sized chondrocyte - like tumor cells embedded in a chondromyxoid matrix sometimes formed discrete nodules [ figure 2a ] . focal areas of the matrix ranged from mucoid appearing to hyaline cartilaginous matrix [ figure 2c ] . the chondromyxoid matrix was multifocal and mostly of high grade and showed direct transition to a carcinomatous component , which was composed of high grade undifferentiated mammary carcinoma with necrotic areas [ figure 2d ] . the tumor cells were negative for estrogen and progesterone receptors and were also negative for cerb - b2 . overt carcinoma cells of the tumor diffusely stained by pancytokeratin and epithelial membrane antigen ( ema ) while focal positivity was present in matrix producing areas . the patient was treated with six cycles of chemotherapy and local radiation therapy and is well after surgery for 30 months . as a rare entity , cytopathological features of mpc of the breast are limited to individual case reports . in cytological smears , cuboidal to oval and sometimes spindly shaped tumor cells as single or in sheets of cells embedded in a myxoid matrix devoid of any sarcomatous spindle cells are the hallmarks of mpc . if fna biopsy sample shows myxoid matrix material , this should be a clue to the presence of a mesenchymal component in a breast mass . one of the differential diagnoses is the conventional metaplastic carcinoma with myxoid chondrosarcomatous differentiation . in such cases , diagnosis depends on the identification of sarcomatous spindle cells or osteoclastic cells . malignant phyllodes tumor should also be considered in the differential diagnosis due to the presence of various type of sarcomatous elements . however , the epithelial component , which is represented by sheets of epithelial cells and small , round / oval nuclei is benign in malignant phyllodes tumor , whereas the epithelial component of mpcs consists of moderately to poorly differentiated adenocarcinoma . fat necrosis is another entity that can mimic metaplastic carcinoma , due to the presence of bizarre spindle and giant mesenchymal cells , as well as an atypical reactive epithelium . the nature of the matrix component is changeable , which could be a mixture of cartilage and osteoid , mainly osseous metaplasia or mainly cartilaginous . wargotz and norris suggested that tumor cells of mpc might be of epithelial myoepithelial derivation according to the findings on electron microscopy . on the other hand , okuyama et al . found that of the eight mpcs , none of the overt carcinoma cells stained with myoepithelial markers metastatic breast cancer is usually regarded as triple negative breast cancer or basal - like breast cancer . it is proposed that basal - like cancers may undergo epithelial - mesencymal transition , which also has been reported to be an etiological factor in metaplastic carcinoma . our case was also a triple negative breast cancer with both epithelial and mesenchymal compartments staining positive with pancytokeratin , ema ( overt carcinoma cells were diffusely positive , chondromyxoid areas were focally positive ) and s100 ( both components diffusely positive ) . histologically carcinomatous component of mpc 's consists of moderately to poorly differentiated adenocarcinoma , which usually shows central necrosis . high grade matrix , has been shown to be an adverse prognostic factor among patients with mpc whereas downs - kelly et al . furthermore , high proportion of matrix was found to have a more favorable clinical course . equivalent to or more aggressive behavior than invasive ductal carcinomas matched for patient age , stage and tumor grade have been reported . postoperative radiation therapy after breast conserving surgery seems to be important for controlling local disease as a high rate of locoregional recurrences were detected without posteroperative radiation . since most of these tumors are hormone receptor , and her2 negative , systemic chemotherapy after surgery is the mainstay of treatment . as is the case in our patient , axillary lymph node metastases tend to be rare in mpc . however , aggressive systemic therapy is also thought to be necessary regarding the high rate of distant recurrences in spite of the absence of lymph node metastases . matrix producing carcinoma is very rare but at the same time an aggressive subtype of metaplastic carcinoma . this subtype of metaplastic carcinoma should be kept in mind when chondromyxoid ground substance is seen in cytological slides . accurate preoperative diagnosis of this rare tumor could also be achieved when all cytologic criteria is carefully evaluated in fna biopsy samples of the breast .
matrix producing carcinoma ( mpc ) of the breast is a very rare subtype of metaplastic carcinoma with heterelogous elements , which comprises < 0.1% of invasive breast carcinomas . there are very few reports describing the cytological features of mpc . in this article , we aimed to discuss cytological , histopathological and immunohistochemical features of this rare entity in a 59-year - old woman .
blood cultures are the gold standard for the diagnosis of sepsis , however , quantitative real - time amplification systems ( qpcr ) based on the bacterial 16s rdna have been suggested not as a replacement , but as a complementary diagnostic tool to blood cultures because they are faster and more sensitive than conventional amplifications , and when compared to blood cultures are particularly useful to rule out infection due to a high negative predictive value , and also because both , positive and negative results can be released within 24 h . nevertheless , the qpcr has the disadvantage of not being able to identify the bacterium species , unlike blood cultures , is more prone to environmental contamination , and can not discriminate between viable and non - viable bacteria . in all studies with newborns and qpcr [ 24 ] , the amplification results were used only qualitatively ( positive or negative ) and were compared with the blood culture results . the aim of this study was to monitor the bacterial load levels of newborns with proven infections during treatment . this research was approved by the research ethics committee of the participating institutions ( cappesq process number 0889/09 and 587/cep - hujm/08 ) and was carried out in a neonatal intensive care unit of out born patients , located in a tertiary hospital , from january to july 2012 . to be recruited , newborns had to present with a positive blood culture at the time of admission to the neonatal intensive care unit , aside from one sign or symptom suggestive of sepsis , and one altered laboratory parameter in the ancillary exams performed to investigate the potential infection . the reference values were : leukocytosis ( > 20 000 mm ) , leukopenia ( < 5000 mm ) , neutrophilia ( > 13 000 mm ) , neutropenia ( < 1000 mm ) , neutrophil index > 0.2 ( immature neutrophil count / total ) , thrombocytopenia ( < 100 000 mm ) . serum c - reactive protein ( crp ) concentrations were determined by turbidimetry ( crp ultrasensitive kit turbitest aa , wiener , argentina ) with reference values recommended by the manufacturer 5 mg / l . in the present study , only crp values > 10 mg / l were considered high . the exclusion criteria were surgical procedures in the newborn ; the presence of severe perinatal asphyxia defined by an apgar score of less than 4 at 5 min of life ; concurrent metabolic abnormalities such as hypoglycemia and hypocalcemia ; congenital malformations and congenital infections . one milliliter of blood was obtained from a peripheral venepuncture at the time of suspected neonatal infection and used for the culture of aerobic and anaerobic organisms ( bact alert 3d , biomerieux ) . the identification of microbial susceptibility was determined using the vitek 2 , biomerieux ( biomerieux inc . , in addition , 1 ml of blood was obtained at each of the three time points to perform the qpcr . hilden , germany ) was performed with the addition of a specific step for the extraction of bacterial dna . prior to amplification , the solutions were autoclaved , and the reagents were filtered through 0.22-m filters ( merck - millipore , billerica , ma ) . amplifications were performed by an experienced biologist under sterile conditions in an abi stepone real time pcr system ( applied biosystems , foster city , ca ) . the mixture of reagents reached a final volume of 25 l containing quantifast sybrgreen pcr master mix ( hot start taq plus dna , quantifast sybrgreen pcr buffer , dntp mix , sybrgreen ) ( qiagen inc . ) , 0.1 m of the forward and reverse primers ( forward 5-cagctcgt gtcgtgagatgt-3 and reverse 5-cgtaagggccatgatgac t-3 ) , 100 ng of dna extracted from the infected newborns , 100 ng of dna from a known non - infected newborn , and sterile water instead of genomic dna ( non - template sample ) . to determine the detection range of the qpcr , a 10-fold dilution series ranging from 10 to 1 cfu / ml of blood was prepared . the qpcr was performed in 40 cycles of amplification : an initial denaturation step at 95 c for 5 min followed by 10 cycles at 95 c for 30 s and 66 c for 30 s , 10 cycles at 95 c for 30 s and 64 c for 30 s , and 20 cycles at 95 c for 30 s and 62 c for 30 s , ending with the melting curve . the threshold cycle of each duplicate sample could not show differences in more than one cycle . the limit of detection in all experiments was 110 cfu / ml , regardless of the type of bacteria ( gram - positive or gram - negative ) . this is a pilot study , so that the sample size was limited by the period in which the collection and blood cultures could be performed in this particular neonatal intensive care unit . the study recruited 17 patients , 7 full - term and 10 preterm newborns ( table 1 ) . in the group of seven full - term infants 40 ) , while among the 10 preterm infants the median value was 32.5 weeks ( min . gestational ages were estimated at birth by using the ultrasound performed at 2128 weeks , the ultrasound at 29 + weeks , the last menstrual period , and the capurro method . with respect to the birth weight , in the group of seven full - term infants the median value was 2560 g ( min . 3760 ) , while in the preterm group the median value was 1889 g ( min . characterization of the 17 cases of neonatal sepsis included in the study , the bacterial load assessed by qpcr in the three time points ( expressed in cfu / ml ) , the bacterium identified by culture , the antibiotics used for treatment and the clinical outcome . bacterial load ( cfu / ml ) casega ( weeks)bw ( g)d048 h7 daysbacterium isolatedantibioticsoutcome1t39376011.239.5udk . aureusamp + cpefull recovery4t38226020.711.521.1consamp + gendeath5t38194052.324.52.6consamp + cpefull recovery6t40300523.420.218.6consamp + genfull recovery7t38256064.255.6112.7consvan + cftdeath8pt33180444.2ududconsamp + cpefull recovery9pt26105017.9ud41.2consamp + cpedeath10pt30179522.222.512.5s aureusamp + genfull recovery11pt34205451.7ududconsamp + cpefull recovery12pt33197432.1236.933.6l . monocytogenesamp + genfull recovery13pt28129547.020.9udconsamp + gendeath14pt32200642.938.366.8consamp + genfull recovery15pt33235036.319.1udconsamp + genfull recovery16pt32179432.915.7udconsamp + genfull recovery17pt35235035.719.843.5consamp + cpefull recoveryt , full - term ; pt , preterm infant ; ga , gestational age ; bw , birth weight ; cfu , colony forming units ; ml , milliliter ; d0 , day zero ; h , hours ; ud , undetected ; cons , coagulase negative staphylococci ( includes s. epidermidis , s. haemolyticus and s. capitis ) ; amp , ampicillin ; gen , gentamicin ; cpe , cefepime ; cft , cefotaxime ; van , vancomycin . t , full - term ; pt , preterm infant ; ga , gestational age ; bw , birth weight ; cfu , colony forming units ; ml , milliliter ; d0 , day zero ; h , hours ; ud , undetected ; cons , coagulase negative staphylococci ( includes s. epidermidis , s. haemolyticus and s. capitis ) ; amp , ampicillin ; gen , gentamicin ; cpe , cefepime ; cft , cefotaxime ; van , vancomycin . on the day of admission ( day 0 ) , the median age of the newborns was 9 days ( min . 2 max . 15 ) , the most frequent clinical signs / symptoms were respiratory distress and mild to moderate perinatal asphyxia , while the most frequent laboratory abnormalities were crp > 10 mg / l , neutrophilia , leukopenia and thrombocytopenia . the 17 blood cultures showed a predominance of gram - positive bacteria : 12 coagulase - negative staphylococcus , two staphylococcus aureus , one streptococcus agalactiae , one lysteria monocytogenes ; the only gram - negative isolated bacterium was a klebsiella pneumoniae ( table 1 ) . of the 17 cases , 13 fully recovered and four died ( two full - term and two preterm newborns ) . table 1 summarizes the data from the 17 newborns , with the bacterial load levels obtained in the three time points . the bacterial load levels in all the time points were in general low ( < 50 cfu / ml ) . on day 0 , there were two newborns with higher bacterial loads ( 2 t 93.4 cfu / ml ) , s. aureus and s. agalactiae were isolated and both presented full recovery . in all the four infants who died , two full - term and two preterm ( 4 t , 7 t , 9pt , 13pt ) coagulase negative staphylococci were isolated . the median of the bacterial load levels in the three time points of the 17 newborns , or comparing the 13 survivors with the four deaths did not show statistical differences , probably due to the restricted number of cases . regarding the variation of the bacterial loads , in three of the four deaths the values increased until the seventh day , except in the case 13pt that showed an undetectable bacterial load on the seventh day . in this newborn , the cause of death was multiple organ failure . in the group of 13 infants who evolved favorably , in 11 cases the bacterial load decreased from day zero until the third time point ; in one case the bacterial load remained at the same level , and in one case there was an increment ( though these two cases presented full recovery ) . considering the high mortality rates of neonatal sepsis , the identification of a biomarker with high sensitivity , specificity , and also high negative predictive values , i.e. capable of ruling out the presence of infection would be ideal . in this study , our aim was not to apply qpcr to diagnosis but to show that this technique based on the bacterial 16s rdna could be useful and cost - effective to monitor the treatment of neonatal sepsis . it is noteworthy that in three infants of the 13 who progressed favorably , the bacterial load was undetectable from the second time point , and in six cases , the bacterial load was undetectable on the seventh day after the introduction of antibiotics ( table 1 ) . due to the impossibility of guaranteeing benefits to the participants , the research ethics committee did not authorize us to compose a control group of infants without infection . however , in all experiments , two negative controls were added , one represented by the sample containing sterile water instead of dna ( non - template sample ) , and the other negative control represented by a dna sample obtained in the delivery room from placentas ( cord blood ) of full - term newborns , whose mothers received prenatal care and did not present any evidence of infection . nevertheless , it is noteworthy that blood samples taken from placentas did not use the same disinfection protocol when compared to blood samples collected from newborns with suspected infection . because antibiotics are administered for at least two weeks during severe neonatal infections or for prolonged periods in sepsis , qpcr could be useful to reduce hospital costs and the length of hospital stay . . previously showed that approximately eight antibiotic doses and 85 neonatal intensive care unit hours could be saved per infant based on negative pcr results . therefore , because of the high negative predictive value of qpcr , negative results could rule out the presence of infection , directly influencing clinical decisions and practices , resulting in fewer antibiotic doses per patient and shorter hospital stays . figure 1 shows a case in which the qpcr could help an early discontinuation of the treatment . the full - term newborn ( 2 t ) with confirmed sepsis caused by s. agalactiae presented a bacterial load of 120.9 cfu / ml in the first sample evaluated ( day 0 blue lines ) . the bacterial loads at 48 h ( purple lines ) and on the seventh day ( pink lines ) were undetected . the full - term newborn ( 2 t ) with confirmed sepsis caused by s. agalactiae presented a bacterial load of 120.9 cfu / ml in the first sample evaluated ( day 0 blue lines ) . the bacterial loads at 48 h ( purple lines ) and on the seventh day ( pink lines ) were undetected . although qpcr is not able to determine the bacterium species and to distinguish between viable and nonviable bacteria , some studies have shown that this bias constitutes a problem only in samples of untreated patients , with no significant differences for the evaluation of patients receiving treatment . in the present study , our purpose was to highlight the role of a negative qpcr result in the context of neonatal bacterial infections under treatment precisely because the technique is extremely sensitive and susceptible to carry - over , so that a negative result should be valued . in addition , other authors claimed that most of the dna from dead cells is actually lost during the dna extraction procedure , probably together with cell debris . recently , the dna - intercalating agent propidium monoazide ( pma ) which is able to promote cell membranes disruption was used in conjunction with qpcr to selectively detect live cells of pathogenic microorganisms . in future experiments , we plan to perform pma - qpcr to reduce significantly the number of non - viable bacteria , bearing in mind that pma may decrease qpcr signals . taking into account the extreme sensitivity and the high negative predictive value of the qpcr technique , this test could help to monitor the treatment of neonatal sepsis and to assist in medical decision to discontinue antibiotics in infants with favorable clinical outcome and a negative qpcr result , shortening both , the antibiotic treatment and the hospital stay . the authors report no declarations of interest . this work was supported by fapemat ( mato grosso state research foundation , brazil ) , process universal 009/2011 , grant number 752380/2011 , and aux - pe - dinter /
abstract objective : to monitor the bacterial load in newborns with proven infections on the day of admission , 48 h and 7 days after treatment . methods : real - time pcr ( qpcr ) targeting the 16s rdna . results : the study recruited 17 newborns and the bacterial load was in general low ( < 50 cfu / ml ) . in three of four deaths , the bacterial load values increased , and in 11 of the 13 survivors the values decreased until the third evaluation . conclusion : considering the extreme sensitivity and high negative predictive value of qpcr , this test could help to monitor the treatment of neonatal sepsis and to assist in medical decision to discontinue antibiotics .
data from numerous epidemiological studies indicate that low cardio - respiratory fitness is a strong independent risk factor for all - cause and cardiovascular disease ( cvd ) mortality in asymptomatic individuals , persons with comorbid conditions ( hypertension , obesity , and type 2 diabetes mellitus ) , and those with established coronary artery disease . it is reported that the strength of association between low cardio - respiratory fitness and mortality is comparable to that between mortality and traditional cvd risk factors such as obesity , hypertension , hypercholesterolemia , and smoking [ 35 ] . this association is very important , especially for clinical populations known to have an exacerbated cvd risk . it has been shown that cvd accounts for up to 50% of deaths in ra , and , typically , cvd events occur earlier , and to a greater extent in this population relative to age - matched healthy controls , and sometimes even before the fulfilment of all criteria of ra . it is hypothesised that inflammation is the major contributor to cvd in ra with other traditional risk factors having a less significant role than that observed in the general population . however , ra patients have also been shown to have alarmingly low levels of physical fitness2030% lower in comparison to individuals without ra . this is likely due to physical inactivity during inflammatory stages of the disease and continued physical inactivity during stages of disease remission . despite cardio - respiratory fitness being widely recognised as an important health indicator , the assessment of fitness is often overlooked from a clinical perspective compared with other cvd risk factors . the criterion measure of cardio - respiratory fitness is maximal oxygen uptake ( v.o2max ) typically expressed in litres of o2 consumed per minute ( lmin ) or millilitres of o2 consumed per kilogram of body mass per minute ( mlkgmin ) . accurate measurement of v.o2max usually requires expensive testing systems , treadmills or cycle ergometers , suitably trained personnel ; and , maximal effort from the subject . it could be argued , therefore , that the requisites for measuring v.o2max might preclude routine assessment of cardio - respiratory fitness in patients at risk or incapable of maximal exercise . on the other hand , v.o2max can be estimated relatively easily from a short bout of sub - maximal exercise lasting approximately from 3 to 9 minutes . a wide variety of predictive sub - maximal exercise protocols are available for use ; these include treadmill walking [ 12 , 13 ] and cycle ergometry tests . however , motorised treadmills and cycle ergometers are not always available in a clinical setting . in contrast , step tests that require limited equipment ( i.e. , step , metronome , heart rate monitor , and stop watch ) represent an attractive modality for assessing cardio - respiratory fitness in clinic . since the earliest reported step test , now known as the harvard step test , numerous sub - maximal step test protocols have been developed . these include the queens college step test , the canadian home fitness test , the chester step test , and the siconolfi step test . predictive exercise tests are population specific and to our knowledge the validity and the reliability of a sub - maximal step exercise test in ra has not been established . therefore , the purpose of this study was to determine the validity and reliability of a predictive sub - maximal step test protocol in patients with ra . the siconolfi protocol was chosen over others as it may be completed at relatively low levels of exercise . this is very important in low active , clinical groups like patients with ra where exercise intolerance is a feature of their disease . based on cohen 's values , a correlation of 0.5 or greater represents a strong correlation . for the current power calculation , a correlation of 0.8 was used to represent a strong correlation . assuming a type 1 and type 2 error of 5% and 20% , respectively , therefore , we aimed to recruit 30 participants in order to allow for drop outs and missing data . with ethical approval , a prospective validation study was conducted in adults attending rheumatology out - patient services of the betsi cadwaladr university health board ( west ) . patients diagnosed with ra according to the american rheumatism association 's 1987 criteria for the classification of rheumatoid arthritis , who attended the rheumatology clinic , were considered as potential participants for this study . exclusion criteria were a current ra flare , joint surgery in the preceding two months , patients taking beta blockers , established cardiovascular disease , recent upper respiratory tract infection , and , history of substance abuse . consequently , 30 individuals ( 24 females ) with ra provided written informed consent and entered the study ( figure 1 ) . the visits were separated by 1 to 3 weeks and scheduled for the same time of day . participants were instructed to avoid performing strenuous exercise 24 hours prior to testing and not to consume any food , caffeine , alcohol , or tobacco in the 3 hours before being assessed . height and body mass were measured by standard procedures , and body mass index ( bmi ) was calculated ( kgm ) . the systolic and diastolic blood pressures were taken by the standard auscultatory technique . functional status ( disease activity was assessed using the disease activity score based on 28 joint assessments ( das28 ) , a validated tool for estimating ra disease . then , each participant undertook the siconolfi step test , which has been described previously . briefly , this sub - maximal test consists of stepping up and down from a portable 10 inch ( 25.4 cm ) step for 3 minutes per stage , for a maximum of three stages . initially , the stepping rate for stage 1 is 17 steps per minute ; if required , this is increased to 26 and 34 steps per minute for stages 2 and 3 , respectively . if the heart rate at the end of a stage , measured by telemetry ( model rs400 , polar electro oy , finland ) , is less than 65% of that predicted by the maximal heart rate prediction equation ( i.e. , 220age ) , the participant is instructed to complete another stage . each individual 's v.o2max is estimated from the exercise heart rate at the end of the test according to established equations . upon completion of the step test , each participant was familiarized with the equipment and procedures for a graded exercise test to volitional exhaustion using a cycle ergometer ( ergomedic 828e , monark exercise ab , sweden ) ; this included familiarization with the borg categorical scale for rating perceived exertion ( rpe ) . during the second testing session , this test is a direct measurement of maximal oxygen uptake ( cardio - respiratory fitness ) . typically , v.o2max tests can be performed on a treadmill or cycle ergometer . for this study , a maximal cycle test was chosen to determine maximal oxygen consumption rather than a treadmill protocol for several reasons . firstly , cycle ergometer and step tests have been shown to yield similar v.o2max results , with both methods having a tendency to result in lower v.o2max values when compared to treadmill tests . secondly , maximal cycling tests in older and inactive adults increase safety by allowing smaller gradations in work and a higher quality ecg . the test involved pedalling at a constant rate of 50 revolutions per minute ( rpm ) for two minutes with no resistance added to the flywheel . thereafter , resistance increased in increments of 25 watts every two minutes , until volitional exhaustion . expired gases and air flow were monitored breath - by - breath using an automated system ( 800ergo test , zan gmbh , germany ) heart rate and ratings of perceived exertion ( rpe ) were measured at the end of every two - minute stage . it was anticipated that many of these deconditioned patients would not be able to obtain a true maximal aerobic capacity , defined as a plateau in oxygen consumption during the final stage , maximal heart rate > 85% of age - adjusted predicted maximal heart rate ( 220age ) , respiratory exchange ratio ( rer ) > 1.10 , and ratings of perceived exertion ( rpe ) > 17 ; therefore , the highest v.o2 recorded during the maximal cycling exercise test was considered to be the v.o2 peak value . the primary outcome measure obtained during each of the step tests was estimated v.o2max ( expressed as mlkgmin ) , determined using the equations developed by siconolfi et al . . outcome measures obtained during the cycling test to volitional exhaustion included v.o2 peak , peak heart rate , rer , and ratings of perceived exertion ( rpe ) . data was entered into a database and statistical analyses were performed ( spss , version 19 for windows , spss , chicago , il ) . the mean and standard deviation ( sd ) were calculated for normally distributed data . the concurrent validity of v.o2max estimated from the siconolfi step test was assessed using the pearson correlation coefficient ( r ) and the bland and altman technique . the paired t - test was used to establish whether there was a significant systematic bias between test measurements ; a two - tailed p < 0.05 was considered significant . the inter - day reproducibility of estimated v.o2max was assessed using the intraclass correlation coefficient ( icc ) , pearson correlation coefficient and the bland and altman technique . one hundred and ten consecutive patients were contacted over 13 months regarding potential participation in the study . of these , 80 were unwilling to participate ; thus , 30 ( 24 females ) patients were recruited to the study ; however , 5 recruits ( 5 females ) failed to complete all of the tests and 1 male withdrew due to a previously undiagnosed cardiac complaint ( figure 1 ) . the demographic data , disease characteristics , and disability scores of the remaining 24 patients are given in table 1 . two female patients did not complete the graded exercise test for the determination of v.o2 peak . mean peak values for hr , v.o2 , rer , and rpe of the remaining 22 patients are presented in table 2 . the mean values for v.o2max estimated from the second step test ( visit 2 ) and directly measured v.o2 peak were ( 22.0 4.5 ) and ( 19.9 4.2 ) mlkgmin , respectively ( p = 0.003 ) . the pearson correlation coefficient ( r ) was 0.79 ( 95% ci 0.55 to 0.91 ) . when v.o2max estimated from the first step test ( visit 1 ) was used for the same analyses , the findings were found to be very similar ( r = 0.77 ; 95% ci 0.52 to 0.90 ) . the bland - altman plot of within - subject differences between estimated v.o2max and directly measured v.o2 peak versus the mean of the two tests is presented in figure 2 . the systematic bias between estimated v.o2max and directly measured v.o2 peak was 2.1 mlkgmin , the 95% limits of agreement ( loa ) were 5.7 mlkgmin , and the see was 2.6 mlkgmin ( 95% ci 2.0 to 3.8 mlkgmin ) . the mean value for v.o2max estimated at visit 1 ( 22.5 4.7 mlkgmin ) was marginally , albeit significantly , higher than that at visit 2 ( 22.0 4.5 mlkgmin , p = 0.049 ) . the intraclass correlation coefficient ( icc ) was 0.97 ( 95% ci of 0.94 to 0.99 ) , and the pearson correlation coefficient ( r ) was 0.97 ( 95% ci 0.93 to 0.99 ) . the bland - altman plot ( figure 3 ) of the within - subject change for estimated v.o2max versus the mean for both step tests ( i.e. , visit 1 and visit 2 ) indicates a small systematic bias ( 0.5 mlkgmin ) between the first and second tests . the findings presented here demonstrate that administration of the siconolfi step test provides a valid and reproducible estimation of cardio - respiratory fitness ( v.o2max ) in routine clinical practice . these findings are important ; v.o2max , the measure of an individual 's cardio - respiratory fitness , is a strong independent predictor of mortality in asymptomatic individuals as well as in clinical patients . low cardio - respiratory fitness carries the same or higher strength of association or risk for mortality as routinely measured clinical risk factors such as hypertension , hyperlipidemia , diabetes , family history of cvd , and smoking . furthermore , meta - analysis indicates that a cardio - respiratory fitness below ~28 mlkgmin results in substantially higher rates of all - cause mortality and chd / cvd events in healthy persons . this is alarming considering the fact that the average cardio - respiratory fitness level of the ra patients in this investigation was 19.9 4.2 mlkgmin . despite all the evidence to support the use of cardio - respiratory fitness as an additional clinical measure for identifying cvd risk , assessment of v.o2max is usually not performed in most , if not all , clinical practices . direct measurement of v.o2max may place certain patient groups like ra patients at risk and is not always practical in many healthcare settings . in contrast , estimation of v.o2max from sub - maximal testing appears to have greater applicability , particularly for assessment of cardio - respiratory fitness in a clinical setting . sub - maximal predictive tests like the siconolfi step test provide a simple , safe , and valid estimate of v.o2max. originally developed to estimate v.o2max in apparently healthy individuals , the purpose of the present study was to determine if administration of the siconolfi step test provided a valid and reliable estimate of v.o2max in patients with ra , a population with increased cvd risk and low exercise tolerance . the findings presented here indicate that the siconolfi step test is a valid measure of cardio - respiratory fitness in patients with ra . v.o2max estimation from the siconolfi step test was strongly correlated with measured v.o2 peak ( r = 0.79 ) . v.o2max estimation from the siconolfi step test was also in reasonable agreement with the criterion measure , that is , directly measured v.o2 peak . however , there was a small significant positive bias in the estimated versus the actual v.o2max. the bias indicated that the siconolfi step test could potentially overestimate v.o2max by 3.6 mlkgmin in ra patients . furthermore , the overall standard error of estimate means that the accuracy of the v.o2max estimation in ra patients with an actual v.o2max ranging from 12.9 to 27.0 mlkgmin was approximately 10 to 20% . an estimated value for v.o2max that is higher than the directly measured v.o2 peak may reflect differences between stepping and cycling exercise . it is possible that local muscle fatigue experienced by those unaccustomed to cycling exercise may have resulted in some of the maximal exercise tests being terminated before attainment of true v.o2max. however , other indicators of maximal effort concomitant with v.o2max , such as attaining a heart rate within 15 bpm of the age - predicted maximal value , a respiratory exchange ratio of greater than 1.10 , and rpe greater than 17 , were achieved in ra patients . this suggests that the current patients did exercise at or close to their maximal effort . another possible explanation for overestimation of cardio - respiratory fitness by the step test may be related to the timing of tests performed on visit 2 . however , the short duration of the step test ( i.e. , 3 minutes ) and the longer rest period ( i.e. , 30 minutes minimum ) between tests argue against this . the test - retest repeatability of the estimated v.o2max via the step test in the current study was excellent . the pearson correlation coefficient and icc indicated a very strong positive correlation between the two step tests . thus , we conclude that the siconolfi step test is a reliable measure of cardio - respiratory fitness in patients with ra . thus , an increase in estimated v.o2max of approximately 2.5 mlkgmin or above following an exercise training intervention could be considered a change that is due to factors other than chance . in ra patients , this would equate to an increase in cardio - respiratory fitness of around 20% for the individual with the lowest v.o2max , whereas the person with the highest v.o2max would experience a 10% increase . we know of only one other study that has investigated the validity and test - retest reproducibility of the siconolfi step test in a patient group . marcora and colleagues found that the siconolfi step test was reasonably valid and highly reliable in patients with well - controlled systemic lupus erythematosus ( sle ) . compared to the patients in the present study , the sle patients in that study were younger , weighed slightly less , had similar bmi , and had a higher directly measured v.o2max relative to body mass . the validity and reliability analyses for our study compare well with those of marcora et al . the most concerning , but unsurprising finding , of this study is the very low value for the directly measured v.o2max in our ra patients . previous reports indicate that v.o2max may be 20 to 30% lower in ra patients compared with age - matched healthy controls [ 3336 ] . a major determinant of v.o2max is the degree of physical activity over recent weeks and months . evidence suggests that approximately 68% of ra patients in the uk are physically inactive ; therefore , compromised cardio - respiratory fitness in patients with ra is hardly surprising . despite knowing that increased incidence of cvd - related morbidity and mortality is a common feature of ra [ 38 , 39 ] , the relative contributions of physical inactivity , traditional risk factors , and high grade systemic inflammation to the exacerbated cvd risk in this population remain unclear [ 4043 ] . however , exercise is recognized as useful adjunct treatment for ra , although the relationships between cardio - respiratory fitness , exercise training , and cv risk in ra patients require more research . the strengths and weaknesses of this study warrant comment . the siconolfi step test is easy to administer , requires minimal equipment , and is relatively quick since it can be completed at low levels of exercise . thus , there is considerable potential for its use as a clinical tool for routine assessment of cardio - respiratory fitness in patients with ra and other clinical populations who are at risk of developing cvd . although fatigue , pain , limited joint mobility , and impaired muscle strength are all common features of ra [ 22 , 35 ] , the step test was reasonably well tolerated by patients in this study . potential sources of error in the study include prediction of maximum heart rate from the 220age formula , assumption of a linear relationship between heart rate and v.o2 , and the individual 's ability to maintain the correct stepping tempo , all of which are common to sub - maximal exercise testing . due to ra being primarily a joint disease , we specifically chose to compare the step test to a cycling - based v.o2max test . even though cycling is not a weight - bearing activity , it may put the knee joint under a similar strain / range of movement than a walking - based test . a treadmill - based v.o2max test may have resulted in a higher v.o2max than what was obtained in this study ; however , our v.o2max results compare well to other studies that also used sub - maximal cycle tests to estimate ra patient fitness levels . another limitation is the modest sample size ; however , it was sufficient to meet the study objectives , with suitable measures of validity and test - retest reliability being observed . finally , the suitability of the step test as a measure of cardio - respiratory fitness from a clinical perspective warrants comment . this discrepancy is acceptable and expected of a predictive sub - maximal exercise test like the siconolfi step test . however , when interpreting the estimated values provided by the step test , it must be noted that there is a trend for the discrepancy to increase when average cardio - respiratory fitness levels are lower . the present study is the first to demonstrate that the siconolfi step test is a valid and reliable method for assessing cardio - respiratory fitness in an ra population . in light of considerable epidemiological evidence that supports the cardioprotective effects of regular physical activity and cardio - respiratory fitness , the current findings indicate a role for simple , clinically available physiological estimation of v.o2max. another important finding is the very low cardio - respiratory fitness in patients with ra when assessed using both step and cycle tests . it is well known that this group is twice as likely to die from a cvd - related event when compared to the general population . therefore , following on from the current study it is believed that patients with ra and other chronic diseases with increased risk of cvd should have their cardio - respiratory fitness measured as part of their cardiovascular screening and are advised to maximise as part of any long - term management plan .
purpose . exercise tests represent an important clinical tool to evaluate cardio - respiratory fitness and to predict future adverse cardiovascular events . however , use of such tests in patients with rheumatoid arthritis ( ra ) is relatively uncommon despite well - established evidence that low exercise capacity and high cvd mortality are features of this disease . therefore , this study examined the validity and reliability of a sub - maximal step test for use in ra patients . methods . thirty patients ( 24 females ) ( mean sd age 53 10 years ) performed a sub - maximal step test on two occasions to estimate the criterion measure of cardio - respiratory fitness ( v.o2max ) . a further maximal cycling test provided a direct fitness measurement ( v.o2 peak ) . pearson correlation coefficient , intraclass correlation coefficient ( icc ) , bland and altman plots , and 95% limits of agreement ( loa ) were used to determine the validity and reliability of the sub - maximal test . results . estimated v.o2max correlated well with directly measured v.o2 peak ( r = 0.79 , loa 5.7 mlkg1min1 ) . test - retest reproducibility for estimated v.o2max was excellent ( icc = 0.97 , loa 2.2 mlkg1min1 ) . conclusion . the sub - maximal step test studied here represents a valid and reproducible method to estimate cardio - respiratory fitness in ra patients . this test may be useful for the assessment and management of cvd risk in a clinical setting .
three male patients and one female patient with sensory exotropia over 75 pd were included in this report . none of the patients had other causes of exotropia such as third nerve palsy , any restrictive cause , orbital wall fracture or previous ocular surgery . we carefully explained alternative approaches , namely bilateral surgery ; and possible outcomes , especially enophthalmos , narrowing of the lid fissure and limitation on abduction . the amount of recession was determined by the maximal possible exposure of the surgical field at the time of surgery . the amount of resection was planned roughly according to the results of rayner and jampolsky . adjustable sutures were placed on resected medial rectus muscle during surgery , but no adjustments were needed in any of the cases . digital photographs were taken preoperatively , at low resolution , and postoperatively , at high resolution , on the day of their last visit , except for case 1 . although limited abduction and excessive adduction in the operated eye were noticeable in all four cases , it was only conspicuous in extreme horizontal gaze positions , as shown in our photographs . none of the patients complained of limitation of abduction , enophthalmos or narrowing of lid fissure , but they were aware of the injection and lump on the nasal conjunctiva in our relatively short follow - up period . a 10 mm left medial rectus muscle resection and 13 mm left lateral rectus muscle recession was performed . at 3 months after surgery , there remained no horizontal deviation , but 10 pd left hypertropia ( photographs were not taken ) . case 2 was a 51-year - old female whose left vision was lost because of extensive macular degeneration . we measured 75 pd left exotropia preoperatively . left medial rectus muscle resection 9 mm and left lateral rectus muscle recession 14 mm were performed and the eyes were straight at 5 months after surgery ( fig . we performed 11 mm resection of the left medial rectus muscle and 14 mm recession of the left lateral rectus muscle . at 7 months after surgery , after performing 11 mm right medial rectus resection and 10 mm right lateral rectus recession , his exodeviation decreased to 8 pd at 3 months after surgery ( fig . when sensory exotropia is present , combined recession - resection operation only on the eye with visual loss is preferred . but , if the deviation angle is too large to be corrected by conventional two - muscle surgery , the surgeon faces a challenge of choosing between additional one- or two - muscle surgery on the seeing eye or doing extra large amount of surgery on the visually poor eye alone leaving the seeing eye intact . partitioning the surgical dose over 3 or 4 muscles is a rational option in cases of large exotropia with equal vision in both eyes . if the surgeon plans on unilateral surgery , limitation on abduction will ensue and will cause diplopia in the field of gaze limitation . however , since there is no fusional potential in these patients , rayner and jampolsky stress that the surgical procedure should be a ' mechanical ' operation , using large resection of the medial rectus as a stay suture to mechanically prevent an exotropic recurrence , while recession of the lateral rectus and conjunctiva releases the restrictive forces . indeed , they reported 2 cases during a 15-year follow - up with stable results for 22 patients . but even though long stability of alignment is a significant benefit of the surgical procedure , if the overall disfigurements , most probably caused by limited abduction , outweigh the benefit , the surgeon will certainly have to reconsider the procedure . thus , prior to the surgery , we discussed this possibility with the patients in detail and they all chose unilateral extra large recession - resection , in order to spare their only seeing eye from potential surgical risks . in contrast to our expectations , as shown in postoperative photographs , the disfigurements were not severe . limitation on abduction and excessive adduction were certainly noticeable , but only in extreme horizontal gaze positions . other expected disfigurements , such as narrowing of the palpebral fissure or enophthalmos , were not prominent . the explanation for such a result is merely speculative in this small number of patients , but , we assume that the long - standing large exotropic position of the eye caused eventual stretching and elongation of the medial rectus . thus , an extra large resection probably does not cause the usual restriction on abduction that is seen in muscles of relatively normal length . there is another suggested method that consists of conventional maximum horizontal rectus recession - resection plus weakening of both obliques of the poorly seeing eye , releasing additional sites of contracture . this might circumvent the problem of limited abduction , however , as mentioned in the article , postoperative hypertropia of the deviated eye is the principal disadvantage and the results were 10 pd exotropia and hypertropia of 5 pd at best in their 8 subjects . in conclusion , in large - angle ( greater than 75 pd ) sensory exotropia , supermaximal medial rectus resection and lateral rectus recession only on the visually poor eye can be a clinically feasible surgical option .
in cases of extropia with an exodeviation angle over 50 prism diopter ( pd ) , a 3- or 4-muscle surgery is a rational option . but , in patients with sensory exotropia , there is usually a strong preference for a monocular procedure to avoid surgery on the single seeing eye . thus , we confined surgery to visually poor eyes , and performed a medial rectus muscle resection with a mean of 10.3 mm ( range , 9 - 11 mm ) and a lateral rectus muscle recession with a mean of 12.8 mm ( range , 10 - 14 mm ) in 4 adult sensory exotropia patients who had a mean deviation of 82.3 pd ( range , 75 - 90 pd ) . the mean postoperative angle of exodeviation was 2.0 pd ( range , ortho-8 pd ) . the limitation on abduction was not disfiguring . other expected disfigurements , such as narrowing of the palpebral fissure or enophthalmos , were not conspicuous . the mean follow - up period was 4.5 months ( range , 3 - 7 months ) . in large - angle sensory exotropia , instead of additive surgery on the seeing eye , supermaximal medial rectus resection and lateral rectus recession only on the visually poor eye is a clinically feasible surgical option .
parkinson s disease ( pd ) is a progressive , chronic , neurodegenerative disease characterized by rigidity , tremor , bradykinesia and postural instability secondary to dopaminergic deficit in the nigrostriatal system.13 currently , disease - modifying therapies are not available , and levodopa ( ld ) treatment remains the gold standard for controlling motor symptoms of the disease.47 nonmotor symptoms ( eg , cognitive decline , psychiatric symptoms , autonomic and sleep disturbance , etc ) also cause a marked decrease in the quality of life , but currently there is limited evidence that ld treatment can alleviate these symptoms . furthermore , within 5 years of treatment , ~50% of patients develop motor fluctuations and dyskinesia.1,2,8 the pathophysiology behind motor complications is that instead of physiologic , tonic stimulation , there is a reduced and pulsatile dopaminergic stimulation of striatal neurons.9 this is due to fluctuations in the plasma concentration of ld and progressive neuronal cell death in the nigrostriatal system.10 therefore , the aim of improving treatment is to provide a steadier and more sustained plasma concentration of ld and consequent continuous dopaminergic transmission in the basal ganglia . ld is the precursor of dopamine ( da ) , and unlike da , it can penetrate through the blood however , after oral intake , ld is extensively and rapidly metabolized by peripheral enzymes , namely , aromatic amino acid decarboxylase ( aadc ) and catechol - o - methyltransferase ( comt ) . comt catalyzes the transfer of a methyl group from s - adenosyl methionine ( sam ) to catechol estrogens and endogenous catecholamines.11 after the transfer , the co - substrate becomes s - adenosyl homocysteine ( sahcy ) . the catalytic cycle is complete when sahcy is exchanged to sam and comt can catalyze another o - methylation . in the central nervous system ( cns ) , ld is broken down to homovanillic acid ( hva ) by comt and monoamine oxidase ( mao ) . when ld is administered alone , approximately only 1% of the oral dose reaches the cns.1214 when ld is administered with an aadc inhibitor ( benserazide [ bz ] or carbidopa [ cd ] ) , ~90% of ld is converted to 3-o - methyldopa ( 3-omd ) by comt , which could compete with ld for transport through the bbb.1517 the clinical significance of 3-omd as a competitive antagonist to ld is questionable.16,17 3-omd is considered as a biomarker of peripheral comt inhibition.18 currently , there are three comt inhibitors that can be used in the treatment of pd , entacapone ( ent ) , tolcapone ( tcp ) , and since its approval for medical use by the european medicines agency in june 2016 , opicapone ( opc ; ongentys , developed by bial - portela & ca . s.a.).19,20 opc is indicated as an adjunctive therapy to combinations of ld / dopa decarboxylase inhibitors ( ddcis ) in adult pd patients with end - of - dose motor fluctuations whose symptoms can not be stabilized with these preparations . peripheral comt inhibitors , like opc , increase the half - life of ld , whereas central inhibitors slow its metabolism within the cns.9 our review highlights the biochemical properties of opc and summarizes preclinical investigations and clinical trials with this novel comt inhibitor . opc ( 2,5-dichloro-3-[5-(3,4-dihydroxy-5-nitrophenyl]-1,2 - 4-oxadiazol-3-yl)-4,6-dimethylpyridine 1-oxide , previously known as bia 9 - 1067 ) is a novel third - generation nitrocatechol comt inhibitor that has been approved for medical use by the european medicines agency in june 2016.20,21 figure 2 shows the chemical structure of opc . it is indicated as an adjunctive therapy to combinations of ld / ddci in adult pd patients with end - of - dose motor fluctuations whose symptoms can not be stabilized with these combinations . opc has a pyridine n - oxide residue at position 3 , providing high - affinity comt inhibition and avoidance of cell toxicity.22 opc has a very high protein - binding affinity in the plasma ( > 99%).23 kiss et al22 found that opc does not cross the bbb in rats and monkeys . an in vitro study using parallel artificial membrane permeability assay ( pampa ) also confirmed that opc does not penetrate into the brain.24 consequently , it was concluded that opc inhibits only peripheral comt enzymes . comt is present in all mammalian tissues and has been shown to have the highest activity in the liver , kidney and cells of the gastrointestinal tract.25 human erythrocytes also contain comt and are generally used in clinical trials for the assessment of comt activity . opc has a remarkably high - affinity binding to comt ( dissociation constant is in the subpicomolar range).26 in comparison , the same constant is two magnitudes higher for tcp . almeida et al27 found that after a single oral administration of various doses ( 10 mg , 25 mg , 50 mg , 100 mg , 200 mg , 400 mg , 800 mg and 1,200 mg ) of opc to healthy subjects , the terminal half - life ranged between 0.8 h ( for 50 mg ) and 3.2 h ( for 1,200 mg ) . ld was given concomitantly and maximum ld concentration was detected between 1.5 h and 3.5 h. the maximum comt inhibition was dose dependent and ranged between 36.1% ( 10 mg opc ) and 100% ( 200 mg1,200 mg opc ) . the inhibitory effect reached its peak between 0.7 h and 6.2 h post - dose.27 after 24 h of intake , opc exerted comt inhibitory effect ranging from 26.1% ( 10 mg ) to 76.5% ( 800 mg ) . at 72 h post - dose , opc still had comt inhibitory effect : 5.9% ( 10 mg opc ) to 54.6% ( 800 mg).27 systemic exposure to opc was significantly lower after a high - fat , high - calorie meal compared to after fasting , implying that opc should be taken before meals . the only metabolite detected in the urine of participants was bia 9 - 1106 . despite its relatively quick elimination from the circulation rocha et al28 hypothesized that the long - lasting effect of opc might be related to its binding to the complex of comt sahcy , thus blocking the exchange of sam to sahcy and therefore hindering the o - methylation of another opc molecule . in nonclinical studies , the following five metabolites of opc have been detected : bia 9 - 1100 and bia 9 - 1101 are inactive methylated metabolites , bia 9 - 1103 is an inactive sulfated metabolite , bia 9 - 1106 is an inactive glucuronide metabolite and bia 9 - 1079 is an active comt - inhibitor metabolite.27,28 opc is mainly metabolized by sulfation to bia 9 - 1103 . 9 - 1106 are alternate metabolic routes.27,28 a total of 70% of orally administered radiolabeled c - opc was eliminated by feces in human beings,23 whereas 12% of the drug was excreted by urine . therefore , hepatobiliary excretion seems to be the main elimination pathway for opc . in patients with moderate liver impairment ( child - pugh category b , scores 79 ) , compared to healthy controls , increased bioavailability of opc was detected , possibly due to decreased first - pass effect in the liver . no serious adverse events or treatment - related adverse events were found in either groups.23 pinto et al29 have demonstrated that neither 50 mg nor 800 mg of opc caused clinically significant changes in electrocardiogram ( ecg ) morphology and intervals . a study was conducted where healthy white and japanese subjects were given 5 mg , 25 mg and 50 mg opc or placebo ( plc).30 no statistically significant differences were found in the pharmacokinetics and pharmacodynamics of opc between the two populations . in one study , opc was given orally to rats and resulted in significant reduction in comt activity.31 the maximum plasma concentration was detected at 4 h following administration . opc could not be detected after 8 h post - admission . when ld / bz was given to rats 2 h and 24 h after administration of opc , the maximum plasma concentration of ld increased by 1.6- and 1.4-fold , bioavailability of ld increased by 1.9-and 1.3-fold and 3-omd exposure decreased by 6.3- and 1.6-fold , respectively.31 in the same study , adenosine triphosphate ( atp ) concentrations and mitochondrial membrane potentials were measured after 24 h of incubation of human primary hepatocytes to investigate cytotoxic properties . compared to tcp and ent , opc was the least potent compound to decrease mitochondrial membrane potential and atp content of hepatocytes.31 in brain and liver homogenates of rats , opc caused a more sustained comt inhibitory effect compared to ent and tcp.32 the medications were administered through a gastric tube 1 h after intake , and comt inhibition reached 99% , 82% and 68% , respectively , with opc , tcp and ent . after 9 h of administration , opc still showed a 91% reduction in comt activity . no inhibitory effects of ent could be detected and tcp produced only a 16% decrease in comt activity.32 bonifcio et al33 examined systemic and central bioavailability of ld and its metabolites in cynomolgus monkeys . microdialysis probes were inserted into the substantia nigra , dorsal striatum and prefrontal cortex of monkeys . the animals received either vehicle or 100 mg / kg opc for 14 days , and then they were challenged with a combination of ld and bz ( 12/3 mg / kg ) . blood samples and extracellular dialyzate from the brain were collected for measurements . compared to plc , a significant increase in ld levels was observed in the plasma and also in the dialyzate samples obtained from all three brain regions ( 1.7- , 1.4- and 2.3-fold increase in dorsal striatum , substantia nigra and prefrontal cortex , respectively).33 in addition , reduced 3-omd exposure was observed ( fivefold decrease in plasma and fivefold , sevenfold and 2.4-fold decrease in the dorsal striatum , substantia nigra and prefrontal cortex , respectively ) . almeida et al27 investigated the pharmacokinetic and pharmacodynamic properties and tolerability of opc after a single oral administration of various doses ( 10 mg , 25 mg , 50 mg , 100 mg , 200 mg , 400 mg , 800 mg and 1,200 mg ) . the half - life of comt inhibition was 61.6 h. detailed results of the trial are discussed in the second paragraph of the pharmacokinetic and pharmacodynamic properties of opc section of this article . in a dose - escalation , double - blind , plc - controlled study , healthy male subjects were given 5 mg , 10 mg , 20 mg or 30 mg opc for 8 days.28 the pharmacokinetic and pharmacodynamic properties of opc and its metabolites were investigated . the terminal half - life of opc ranged from 1 h to 1.4 h. bia 9 - 1103 was identified as the main metabolite . its terminal half - life was between 25.1 h and 26.9 h. although bia 9 - 1079 is an active metabolite , it only represented < 20% of systemic exposure to opc . therefore , it only has minor relevance in the therapeutic effect of opc.28 comt inhibition was found to be dose dependent . the maximum inhibition was detected between 3.8 h and 7.7 h after the first administration and 3.7 h and 5.3 h after the last intake of opc . the last dose 16.3% , 21.3% , 31.4% and 20.3% decrease in comt activity still remained with 5 mg , 10 mg , 20 mg and 30 mg opc , respectively.28 previously , the maximum comt inhibition for 100 mg and 200 mg tcp and 200 mg ent was found to be 72% , 80% and 65% respectively.34,35 comt activity returned to baseline within ~18 h and 8 h after tcp and ent , respectively . in another study , healthy individuals received 25 mg , 50 mg , and 75 mg opc or plc for 11 days.36 on the 12th day , subjects in the plc group received 200 mg ent and ld / cd three times a day . individuals in the opc group were also administered ld and cd three times daily to assess the effects of opc on ld pharmacokinetics . the minimum ld plasma concentration increased in all active treatment groups compared to the plc arm ( 1.7- and 3.3-fold with 200 mg ent and 75 mg opc , respectively ) . all active treatments resulted in increased ld bioavailability and significant decrease in 3-omd exposure in relation to the plc group.36 compared to ent , opc showed a more sustained effect on erythrocyte comt inhibition . adverse events were mild , the most common ones being nausea , vomiting , headache and dizziness . it was concluded that opc was more efficacious compared to ent in increasing ld bioavailability.36 table 1 summarizes the main findings of clinical trials in healthy subjects . in a phase ii study , patients diagnosed with idiopathic pd , who had at least 1.5 h long off state in the waking day and a modified hoehn yahr stage of < 5 in the off state , received 25 mg , 50 mg , and 100 mg opc or plc once daily in addition to their previous 100/25 mg ld and cd or bz therapy.37 the maximum plasma concentration of ld dose dependently increased after opc intake compared to plc . a marked decrease was observed in peak 3-omd levels and also in the extent of exposure with 100 mg opc . all active treatments inhibited the extent and rate of comt activity in a dose - dependent , albeit disproportional , manner.37 motor responses were also measured . a marked decrease in time to on and time to best on on duration increased by 18% and 25% with 25 mg and 50 mg opc , respectively . adverse events were mostly mild to moderate in intensity.37 ferreira et al38 investigated the effects of 28-day long administration of 5 mg , 15 mg and 30 mg opc on ld pharmacokinetics , comt inhibition and motor fluctuations in pd patients . all active treatments increased ld bioavailability in a dose - dependent manner , caused sustained dose - dependent but not proportional comt inhibition and consequently a significantly lower exposure to 3-omd . based on the participants diaries , all active treatments caused a dose - dependent decrease in the absolute off time ( 15.6 min and 145 min with 5 mg and 30 mg opc , respectively).38 overall , 15 mg and 30 mg opc reached statistical significance compared to plc in improving on time without dyskinesia . no serious adverse events occurred during the study.38 bipark i was a phase iii , randomized , double - blind , multicenter , plc- and active - controlled trial that assessed the efficacy and safety profile of opc.21 opc was administered as an adjunct therapy to ld in pd patients with motor fluctuations . participants were aged between 30 years and 83 years , had a clinical diagnosis of pd for at least 3 years , a hoehn yahr stage of 13 during the on state and had to have end - of - dose motor fluctuations for at least 4 weeks before screening . initially , 600 patients met the inclusion criteria and were randomly assigned to five groups : patients either received plc , 200 mg ent or 5 mg , 25 mg , or 50 mg opc for 1415 weeks in addition to ld ( administered three to eight times a day ) . the primary end point was the change in the absolute time in the off state assessed by daily patient diaries.21 key secondary end points included the change in the proportion of patients showing at least 1 h of reduction in the absolute time in the off state . moreover , the proportion of patients achieving at least 1 h increase in the absolute time spent in the on state was assessed . a significantly different reduction in the off time was reported for 50 mg opc compared to plc ( 116.8 min and 56 min , respectively ) . ent also showed a statistically different reduction in the absolute time spent in the off state ( 96.3 min).21 these findings were in accordance with previous studies.39 based on these results , the authors concluded that 50 mg opc was superior to plc and non - inferior to ent . the 5 mg and 25 mg doses of opc did not show significant reduction in the time spent in the off state compared to plc . regarding the secondary end points , a significantly higher proportion of patients showed at least 1 h reduction in the off state in the 25 mg and 50 mg opc groups compared to plc . in addition , the proportion of patients who had at least 1 h increase in the on state was significantly higher in the 50 mg opc arm . in all , 190 patients had treatment - related adverse events in the opc groups.21 most common adverse events were dyskinesia ( 44 patients among those receiving opc ) , insomnia ( 16 patients ) and constipation ( 11 patients taking opc ) . altogether , nine patients had serious adverse event in the opc groups , including one who had a marked increase in the level of liver enzymes but no hyperbilirubinemia . ii study ( as of yet , data are available only as abstract ) , which was a multinational , plc - controlled , double - blind , parallel - group study , 25 mg and 50 mg opc were administered once daily for 407 patients with pd showing end - of - dose motor fluctuations.40 the inclusion and exclusion criteria were similar to that of the bipark i study . based on patients diaries , the reduction in the off time was significantly greater in both 25 mg and 50 mg opc groups compared to plc ( 1.7 h , 2.0 h and 1.1 h , respectively ) . the increase in the on time with or without non - troublesome dyskinesia in both opc groups was also greater than that in the plc group ( 1.4 h , 1.43 h and 0.8 h in 25 mg and 50 mg opc and plc groups , respectively ) . opc was found to be safe and well tolerated.40 table 2 summarizes the main findings of clinical trials in pd patients . pooled analyses of the bipark i and bipark ii studies have been carried out . currently , only abstracts are available . the double - blind phases of both studies were pooled and assessed for hepatobiliary adverse events.41 no clinically relevant changes were observed in hepatic enzyme levels . it was found that opc improved motor fluctuations regardless of concomitant da agonist or mao - b inhibitor therapy at baseline.42 exploratory post hoc analysis showed that opc improved motor fluctuations as early as in the first week of treatment ( decreased the off time by 61 min and 75 min with 25 mg and 50 mg opc , respectively ) and had maximum and sustained beneficial effects after 23 weeks.43 it was also demonstrated that opc treatment resulted in a significant improvement in motor fluctuations regardless of the baseline hoehn yahr stage or disease duration.44 patients older than 70 years also responded well to the opc therapy.45 the mean off time was reduced by 1.40 h , 1.77 h and 2.26 h with plc , 25 mg and 50 mg opc treatment , respectively . hallucinations ( 4.6% ) and weight loss ( 4.6% ) were more common in this subpopulation of patients , but still , opc was found to be safe and well tolerated . one - year open - label extension studies for both bipark i and bipark ii were performed . to date , data are available only as abstracts . all participants received 25 mg opc for 1 week , and then the investigators could freely adjust doses of both opc ( 5 mg , 25 mg and 50 mg ) and ld according to clinical response and safety concerns . after the double - blind phase , 495 patients continued the bipark i study for 1 year.46,47 the primary end point was the change in the off time based on patients diaries . in relation to the open - label extension baseline , the mean off time decreased by 34 min.46 participants who previously received plc and ent showed a statistically significant reduction in the off time ( 65 min and 39 min , respectively ) and increase in the on time without troublesome dyskinesia ( 43 min and 46 min , respectively ) compared to the open - label baseline . those who were initially receiving opc had a sustained beneficial effect regarding both on and off times . unified parkinson s disease rating scale ( updrs ) ii scores in on and off states and updrs iii score at the end point of the open - label phase ( 2.2 , 4.4 and 7.4 points , respectively ) showed improvement compared to previous plc treatment.47 the most common adverse events in the extension study were related to dopaminergic effects : dyskinesia ( 14.5% ) , decrease in the effect of the medication ( 12.1% ) , and worsening of parkinsonism ( 6.7%).45 a total of 11 deaths occurred during the trial ; however , none was found to be related to opc treatment . a total of 367 patients participated in the 1-year open - label extension of the bipark ii trial.48 the primary end point was the change in the off time compared to baseline based on patients diaries . a marked reduction in the off time ( ~1.5 h ) was observed compared to the open - label baseline for patients previously taking plc . the off time reductions ( 12.5% ) , percentage of the off time responders ( 67.5% ) and increase in the on time with or without non - troublesome dyskinesia ( ~1.7 h ) were consistent with the results of the double - blind phase of the trial.48 the most common treatment - related adverse events were dyskinesia ( 21.5% ) , worsening symptoms of pd ( 17% ) , falls ( 9.1% ) , increased level of blood creatine phosphokinase ( 7.4% ) , insomnia ( 5.7% ) and orthostatic hypotension ( 5.4%).49 these adverse events were mild to moderate . one confirmed case of melanoma was reported , and 4% of subjects had impulse control disorders ( icds ) . no effects of opc on suicidality have been shown.49 pooled analyses of the double - blind and open - label stages of bipark i and bipark ii have been carried out . the results of both bipark i and ii were pooled and analyzed for ecg abnormalities.51 a total of 3,060 ecgs were examined . slight , albeit clinically irrelevant , increase in the qrs interval ( 1.6 ms and 0.9 ms with 25 mg and 50 mg opc treatment , respectively ) was observed . opc is a promising new peripheral comt inhibitor that has been approved for adjunctive therapy to ld / ddci in pd patients showing motor fluctuations . preclinical and clinical studies have shown that opc , compared to the previous two comt inhibitors , is more efficacious , has a significantly longer effect and is less toxic . therefore , if long - term results will show similar beneficial effects , it should become the first - choice comt inhibitor . although ent is a safe medication , its efficacy is limited and requires frequent administration.52 tcp compared to ent is more efficacious and has a more sustained effect on comt activity . three cases of fatal hepatotoxicity were previously reported.5355 owing to its hepatotoxic effect , the administration of tcp requires frequent liver function monitoring and therefore it is only recommended to a few selected patients among those showing motor fluctuations and poor motor control.56 the recommended dose for opc is 50 mg once daily taken at bedtime at least 1 h before or after intake of ld therapy.57 since it has > 24 h long comt inhibitory effect , it can be expected that coadministration of this novel drug to ld / ddci medications will result in better control of motor and maybe even nonmotor symptoms of pd patients . it is also possible that the required doses for ld / ddci medications can be reduced due to the sustained effects of opc and should allow for better compliance from the patients . opc therapy is thus far only recommended for patients who have been taking ld therapy for years and are inevitably showing signs of motor fluctuations . in the future , it would be interesting to see the effects of opc treatment before the occurrence of motor fluctuations . in the stride - pd study , early initiation of ent treatment in addition to ld / cd did not delay the occurrence of dyskinesia compared to ld / cd alone.58 in fact , the time of onset of dyskinesia was shorter and the frequency of dyskinesia was increased in the ld / cd / ent group compared to the ld / cd arm . the authors hypothesized that these findings were probably due to higher ld dose equivalents in the first group and that continuous dopaminergic stimulation was not achieved . still , we believe that there is a possibility that opc can delay the onset of the adverse effects of ld therapy by providing steadier and continuous plasma ld concentrations .
parkinson s disease ( pd ) is a progressive , chronic , neurodegenerative disease characterized by rigidity , tremor , bradykinesia and postural instability secondary to dopaminergic deficit in the nigrostriatal system . currently , disease - modifying therapies are not available , and levodopa ( ld ) treatment remains the gold standard for controlling motor and nonmotor symptoms of the disease . ld is extensively and rapidly metabolized by peripheral enzymes , namely , aromatic amino acid decarboxylase and catechol - o - methyltransferase ( comt ) . to increase the bioavailability of ld , comt inhibitors are frequently used in clinical settings . opicapone is a novel comt inhibitor that has been recently approved by the european medicines agency as an adjunctive therapy to combinations of ld and aromatic amino acid decarboxylase inhibitor in adult pd patients with end - of - dose motor fluctuations . we aimed to review the biochemical properties of opicapone , summarize its preclinical and clinical trials and discuss its future potential role in the treatment of pd .
antigen recognition is a key event during t cell activation . here , we introduce nanopatterned antigen arrays that mimic the antigen presenting cell surface during t cell activation . the assessment of activation related events revealed the requirement of a minimal density of 90140 stimulating major histocompatibility complex class ii proteins ( pmhc ) molecules per m2 . we demonstrate that these substrates induce t cell responses in a pmhc dose - dependent manner and that the number of presented pmhcs dominates over local pmhc density .
in fact , relevant and required information should be correctly identified , and then the process begins . rapid increase in information and specialization of sciences has made the accessibility to appropriate information difficult . it is essential to identify the information needs of each individual or society correctly and to plan for fulfilling them in a society where everything is based on the information and everyone searches for fast and easy access to information . besides , one of the priorities of information system designers is to identify the method of searching and applying information ( information - seeking behavior ) of users . information seeking is a process by which a person purposefully tries to change the status of the knowledge . as we know , people use information to solve problems , to do work , or to increase knowledge . therefore , identifying their seeking behavior as a part of social behavior helps us to design better information systems . patients are among the groups of people who need to have information about their disease because this way , they would be able to control their diseases , reduce the risks of their illness , recognize the side effects of medicines , find appropriate medical centers , and be informed about their treatment . despite the strong need of patients to learn about their disease and the importance of their information - seeking behavior , these few ones are about the information - seeking behavior in medical team such as physicians and nurses . ghasemi found that doctors use medical journals in the first place , followed by books and monographs for keeping up with new advances in medicine in masjed soleyman . also , 77.1% of the respondents said that their main impersonal problem for keeping up with the new developments in medicine had been lack of network and databases ; 74.2% mentioned lack of time as the personal problem . forty - five percent of the respondents had used internet to get up - to - date information . the results of the paper written by davarpanah and azami showed that consulting with colleagues and doctors and studying patients documents have been the most important information sources for nurses . the most important obstacles among nurses have been shortage of time , having no access , lack of information - seeking skills , and not being familiar with information resources . leydon found in his research while all patients wanted basic information on diagnosis and treatment , not all of them wanted further information at different stages of their illness . cancer patients attitudes to cancer and their strategies for coping with their illness can constrain their wish for information and their efforts to obtain it . the results of a study by talosig - garciaa and davis showed that the top sources for cancer information were books , brochures , and pamphlets and doctors or other health professionals ; only 17% of the study respondents had ever used the internet . the patients tended to want more information , particularly related to prognosis . educational attainment , age , treatment status , gender , and ethnicity were all significant predictors of scores in various domains . milewski and chen found in their research that the most important barriers for patients to search information are lack of motivation , passiveness , inconsistency of information , generality of information , and loss of information . gleser et al . showed that majority of the patients receiving information identified doctors as the primary source . the patients prioritized needs for information were all the aspects of their diagnosis and treatment and the side effects of radiotherapy . overall , the results indicate that most patients required information about their treatment and also experienced a variety of symptoms . the majority of patients obtained information from their physician , and they believed that their physician was a very or concluded that participants with low health literacy were less likely to be engaged with health information - seeking behavior . participants with intermediate health literacy were more likely to source arthritis - focused health information from newspapers , television , and within their informal social network . those with high health literacy sourced information from the internet and specialist health sources , and were providers of information within their informal social network . mufunda et al . studied diabetic patients and showed the majority of the respondents scored average knowledge on all three sub - scales : general knowledge , insulin use , and total knowledge . low diabetes knowledge was associated with female gender and could be a risk factor for development of diabetes - related complications . the results of the study by naidoo indicated that patients current needs influenced their need to seek out information . the study concluded that the patients relied heavily on the information provided by the doctor , the dietician , and the hand - outs and pamphlets that were available at the clinic . healthcare - seeking behavior in patients with diabetes mellitus has been investigated by hjelm and atwine . they found that healthcare was mainly sought among doctors and nurses in the professional sector . hicks showed in a study that the doctor was the only source of information for 27% of participants . also , 44.4% of the respondents reported obtaining information from the media and a total of 72.9% of the respondents cited family and friends as a source of information . 's study indicate that the most important information needs for the majority of the respondents are symptoms of disease , etiology and course of disease , specific diagnosis information , treatment plan , treatment description , and advice on symptom management . yan described in his study that to seek information , professional health sites were the majority sites visited . health topics searched ranged from women's / men 's health to chronic diseases such as heart diseases , cancer , and diabetes . over 60% considered online health information useful ; however , about 44% were uncertain about the reliability of this information . as it can be seen , studies from iran are about information - seeking behavior in the medical team and none of them have dealt with patients seeking health information . therefore , the aim of this study was to identify the information - seeking behavior of cardiovascular patients hospitalized in isfahan university of medical sciences hospitals . the study population consisted of all cardiovascular patients hospitalized in isfahan university of medical sciences hospitals ( shahid chamran , alzahra , feiz , and noor - ali asghar ) during the winter of 2013 . according to statistics obtained from the hospitals , the number of patients was approximately 6000 . the sample size was determined based on the formula of cochran and 400 patients were randomly selected . the second part consisted of 43 five - choice questions which had been planned in likert scale . four dimensions of information - seeking behavior were measured this way : attitude on health information - seeking behavior ( questions 16 ) , information needs ( questions 7 - 20 ) , information sources ( questions 21 - 35 ) , and barriers to access health information ( questions 1 - 6 ) . validity of the questionnaire was confirmed by medical information specialists and reliability of the questionnaire was obtained as 0.723 using cronbach 's alpha test . researcher went to the hospitals to visit the patients directly for data gathering , so that the questions could be clarified for illiterate patients or patients of lower education level . data were analyzed by descriptive statistics and inferential statistics . in descriptive statistics , frequency distribution , mean , and standard deviation were used , and in inferential statistics , one - sample t - test , independent t - test statistics , analysis of variance ( anova ) , and pearson and spearman correlation tests were used . the demographic data showed that 41.5% of the respondents were females and 58.5% were males . considering the age of respondents , 6% were below 30 years old , 19.8% were 31 - 40 years old , 36% were 41 - 50 years old , 31% were 51 - 60 years old , and 7.3% were above 60 years of age . regarding the level of education , 47% had not finished high school , 29.8% had high school diploma , 10.3% had associate degree , 11.3% had bachelor 's degree , and 1.3% had master 's degree and higher . in terms of job , 24.8% of patients were workers , 5.3% were employees , 21% had nongovernmental jobs , 18.5% were retired , 1.3% was students , 7.5% had no job , and 21% had other jobs . in terms of place of residence , 61.4% lived in esfahan city and 28.9% in the subsidiary cities of esfahan and 9.6% in villages . to study the patients attitude about their disease this means that a positive attitude exists toward the usefulness of this type of information . they found information about their disease not only useful , but also as a tool for disease control , and knew the best ways of treating . the results of one - sample t test for patients attitude toward health information as patients have their own specific information needs like other groups , one - sample t - test was used to determine their most important information needs . table 2 shows the results of this test . as it can be seen , being aware of the chances of recovery , finding the right medical centers , and awareness of the appropriate methods of treatment are the most significant needs of patients . the results of one - sample t test for patients information needs to determine the amount of various information sources to get health information by patients and to identify which of these sources of information had been used more , the one - sample t - test was used . as it is obvious in table 3 , usage of different information sources is either average or more than average , except the internet , librarian , telephone counseling service , healthcare organizations , and medical books . the results showed that physicians , television , and radio were the most important sources of health information but . the results of one - sample t test for patients usage of information sources one - sample t - test was used to investigate and evaluate the problems and barriers that patients faced in obtaining information about their disease . , the mean score is average or above average . results also show that lack of familiarity with medical terminology and the lack of staff 's accountability were the most important problems in obtaining information related to their disease . the results of one - sample t test for patients barriers to access health information as gender was measured in nominal scale ( two values ) and information - seeking behavior in interval scale , independent - samples t - test was used to determine the relationship between these two items . the obtained significance level ( p > 0.001 ) shows that there was no significant difference in the information - seeking behavior between women and men in any of the four dimensions . to determine the relationship between age and the patients information - seeking behavior , pearson correlation coefficient was used because both the variables were quantitative . except the barriers to access information , there was an indirect relationship between age and information - seeking behavior of patients in other dimensions , considering the level of significance ( p < 0.001 ) . as education was measured in ordinal scale and information - seeking behavior in interval scale , spearman correlation was used to determine the relationship between these two items . there was a direct significant positive correlation between level of education and information - seeking behavior of patients according to the calculated level of significance ( p < 0.001 ) in all four dimensions . as occupation was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . there was a significant difference between the information - seeking behaviors of different occupations in all dimensions except for the dimension of barriers to access health information . the test results indicate that there were differences between the groups of employees and workers , employees and self - employed , retired and employees , and the employees and other jobs . as place of residence was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . according to the obtained significance level , there was a significant difference between information - seeking behavior and different places of residence in the dimension of attitudes toward health information and in the dimension of information needs . but no significant difference was seen in the other two dimensions ( information sources usage and barriers to access information ) . to study the patients attitude about their disease , one - sample t - test was used . this means that a positive attitude exists toward the usefulness of this type of information . they found information about their disease not only useful , but also as a tool for disease control , and knew the best ways of treating . as patients have their own specific information needs like other groups , one - sample t - test was used to determine their most important information needs . as it can be seen , being aware of the chances of recovery , finding the right medical centers , and awareness of the appropriate methods of treatment are the most significant needs of patients . to determine the amount of various information sources to get health information by patients and to identify which of these sources of information had been used more , the one - sample t - test was used . as it is obvious in table 3 , usage of different information sources is either average or more than average , except the internet , librarian , telephone counseling service , healthcare organizations , and medical books . the results showed that physicians , television , and radio were the most important sources of health information but . one - sample t - test was used to investigate and evaluate the problems and barriers that patients faced in obtaining information about their disease . , the mean score is average or above average . results also show that lack of familiarity with medical terminology and the lack of staff 's accountability were the most important problems in obtaining information related to their disease . as gender was measured in nominal scale ( two values ) and information - seeking behavior in interval scale , independent - samples t - test was used to determine the relationship between these two items . the obtained significance level ( p > 0.001 ) shows that there was no significant difference in the information - seeking behavior between women and men in any of the four dimensions . to determine the relationship between age and the patients information - seeking behavior , pearson correlation coefficient was used because both the variables were quantitative . except the barriers to access information , there was an indirect relationship between age and information - seeking behavior of patients in other dimensions , considering the level of significance ( p < 0.001 ) . as education was measured in ordinal scale and information - seeking behavior in interval scale , spearman correlation was used to determine the relationship between these two items . there was a direct significant positive correlation between level of education and information - seeking behavior of patients according to the calculated level of significance ( p < 0.001 ) in all four dimensions . as occupation was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . there was a significant difference between the information - seeking behaviors of different occupations in all dimensions except for the dimension of barriers to access health information . the test results indicate that there were differences between the groups of employees and workers , employees and self - employed , retired and employees , and the employees and other jobs . as place of residence was measured in nominal scale ( multiple values ) and information - seeking behavior in quantitative scale , to determine the relationship between them , anova was used . according to the obtained significance level , there was a significant difference between information - seeking behavior and different places of residence in the dimension of attitudes toward health information and in the dimension of information needs . but no significant difference was seen in the other two dimensions ( information sources usage and barriers to access information ) . the results showed patients positive attitudes toward using health information as most of them found it useful . they believe that having health information can play an important role in controlling the disease and side effects of drugs . these findings are in accordance with the findings of mufunda et al . and yan . our findings showed that the awareness of the probability to recover , finding appropriate medical care centers , and knowing the methods of treatment were the most significant information needs of patients . , gleser et al . , and yang et al . the range of information sources usage is more than average based on the results of this study . also , doctor , television , and radio were the most important sources of health information . this result is consistent with the results of davarpanah and azami , lin , naidoo , and hjelm and atwine , and does not agree with the results of the studies of ghasemi , afshar et al . , talosig - garcia and davis , and yan . it seems that the main reason for this inconsistency is the different characteristics of the statistical population and the research place and facilities . lack of familiarity with medical terminology and inadequate information by healthcare staff , particularly physicians , had been the most important problems in obtaining information by the patients . this can be due to the characteristics of the research population and their information needs and environmental facilities . however , there was a significant relationship between some of the demographic characteristics ( e.g. age , education , and place of residence ) and patients information - seeking behavior . the research findings show that although some patients may prefer to be unaware of their disease , the patients who had been studied in this research believed that knowing the details of the disease could help them to control it and prevent aggravation . in total , they had a positive attitude toward health information and found it useful to know the details of their condition . the information they needed the most was about the chance of healing and finding appropriate treatment centers . this information may be received by different ways such as through health staff , media channels , and informal channels . the results , despite the mentioned obstacles , showed that doctors and television were the most important sources of information for the patients to get health information . since most of our patients were elderly and had a low educational level , these results could be predictable . there was no significant difference between the information - seeking behavior of men and women , while it was different based on some of the characteristics such as age , education , and place of living . younger patients who normally have higher education levels had different information - seeking behavior in terms of information needs , information sources used , and also the mentioned obstacles . these differences were observed in the patients living in the center of the province with better educational and healthcare facilities than in the patients living in towns and villages . considering the findings of this research , it is suggested that medical staff inform the patients according to their level of education and some effective factors mentioned above . also , since media such as television play a considerable role in providing health information to the public , they can be helpful in distributing health information .
background : patients , as one of the most prominent groups requiring health - based information , encounter numerous problems in order to obtain these pieces of information and apply them . the aim of this study was to determine the information - seeking behavior of cardiovascular patients who were hospitalized in isfahan university of medical sciences hospitals.materials and methods : this is a survey research . the population consisted of all patients with cardiovascular disease who were hospitalized in the hospitals of isfahan university of medical sciences during 2012 . according to the statistics , the number of patients was 6000 . the sample size was determined based on the formula of cochran ; 400 patients were randomly selected . data were collected by researcher - made questionnaire . two - level descriptive statistics and inferential statistics were used for analysis.results:the data showed that the awareness of the probability to recover and finding appropriate medical care centers were the most significant informational needs . the practitioners , television , and radio were used more than the other informational resources . lack of familiarity to medical terminologies and unaccountability of medical staff were the major obstacles faced by the patients to obtain information . the results also showed that there was no significant relationship between the patients gender and information - seeking behavior , whereas there was a significant relationship between the demographic features ( age , education , place of residence ) and information - seeking behavior.conclusion:giving information about health to the patients can help them to control their disease . appropriate methods and ways should be used based on patients willingness . despite the variety of information resources , patients expressed medical staff as the best source for getting health information . information - seeking behavior of the patients was found to be influenced by different demographic and environmental factors .
according to the world health organization , an adverse drug reaction ( adr ) may be defined as a response to a drug which is noxious and unintended , and which occurs at doses normally used or tested in man for the prophylaxis , diagnosis , or therapy of disease , or for the modification of physiological function . the latter is characterized by features of an allergic reaction without detectable reactions of the adaptive immune system . it has been estimated that medical in - patients receive a total of 90 million courses of drug therapy per year and that the frequency of adrs is about 5% . by limiting the use of the term allergic to those reactions that are immunologically mediated or can reasonably be presumed to be , estimates are that drug allergy may account for 610% of these adverse reactions . recognizing the magnitude of this problem , the national institute of allergy and infectious diseases noted that if knowledge gained from research findings in drug allergy could be widely used , it should be possible not only to improve diagnosis and treatment but also to prevent allergic drug reactions . drug allergy is one type of unpredictable adr that encompasses a spectrum of immunologically mediated hypersensitivity reactions with varying mechanisms and clinical presentations . . a wide spectrum of drugs can sometimes give rise to numerous adverse oral manifestations , particularly dry mouth , taste disturbances , oral mucosal ulceration and/or swelling . fde is characterized by onset of round / oval , erythematous well - defined macules on the skin and/or mucosa associated with itching and burning sensation . the exact mechanism causing fde is unknown , although studies strongly suggest involvement of the immune system . the oral cavity may be the target organ for a number of diverse abnormalities that develop from the side - effects of medications . 5-nitroimidazole derivatives have been used in the treatment of various intestinal protozoal infections for many years . among these agents , metronidazole is a common anti - protozoal agent that is used worldwide , while ornidazole is a relatively new derivative that is used in some countries in treating particular protozoal infections and that has higher patient compliance because of its longer half - life . ornidazole is typically employed in the treatment of infections throughout the organism , especially in the case of intestinal infections or vaginal / urinary tract infections , as it has been proven to have a strong effect against invasive amoeba and anaerobic bacteria . in many cases , ornidazole is also indicated as a prophylactic agent in order to prevent infections from occurring as a result of surgical procedures . a 58-year - old male patient reported to the outpatient department ( opd ) of the ranchi institute of neuro - psychiatry and allied sciences , kanke , ranchi , jharkhand , india with the chief complaint of dirty teeth . the patient gave a history of dirty teeth since 10 years and he got his teeth extracted ( 31 , 32 , 33 , 34 , 35 , 36 , 41 , 44 , 46 , 47 ) 15 years back because of mobility . the patient had history of chewing pan masala with tobacco ( three to four pouches per day ) since 23 years . the patient used to clean his teeth with commercially available dried tooth powder . on examination , the patient was moderately built and nourished and his vital signs were within normal limits . intraoral examination revealed a generalized edema of gingiva with bleeding on probing and deposits of stains and calculus . cervical abrasion was present in 11 , 13 , 14 , 15 , 16 , 24 , 25 , 27 and 43 and root stumps of 12 , 21 , 22 , 23 and 43 were also present . the patient was advised complete oral prophylaxis , extraction of root stumps ( 12 , 21 , 22 , 23 and 43 ) , restoration of cervically abraded teeth and fabrication of prosthesis for replacement of missing teeth . oral prophylaxis was performed under aseptic conditions and ornidazole 500 mg was prescribed to the patient in the form of tablet with a dose of one tablet twice daily and the patient was recalled after 3 days . the next day , the patient again came to the outpatient department with a complaint of ulcers in the mouth with burning sensation . the patient gave a history of intake of tablet ornidazole and , 64 h after ingestion of the tablet , he noticed a burning sensation in the oral cavity along with painful ulcers . intraoral examination revealed a well - defined erythematous macule in the hard palate approximately 4 cm 4 cm in size that was located on the mid portion of the hard palate having ill - defined margins associated with some grayish white lesions over the erythmatous base . he recalled that 10 years back he had similar lesions on the same locations on taking some anti - diarrheal ; on the initial history taking , he had missed on divulging this information . on palpation , all findings were confirmed and the lesion was 4 cm 3.5 cm in size , shallow , tender on palpation [ figure 1 ] . the lesion was approximately 6 cm 3 cm in size extending from the right upper buccal vestibule to attached gingiva of 16 , 15 , 14 , 13 , 12 and 11 , extending mesially across the mid line and extending over the upper left buccal vestibule to attached gingiva of 21 , 22 , 23 , 24 , 25 and 26 . the lesion was tender on palpation and revealed an erythmatous area on gentle rubbing [ figure 2 ] . based on history and clinical examination , a provisional diagnosis of mucosal fde due to ornidazole was given . lesion on the labial mucosa the patient was advised to stop intake of ornidazole and he was prescribed prednisolone 10 mg po thrice daily for 3 days followed by one tablet twice daily for 3 days , followed by one tablet once daily for 3 days along with levocetrizine 5 mg once daily for 7 days . the patient was recalled after 7 days and satisfactory healing was seen [ figure 3 ] . drug hypersensitivity reactions can manifest in a great variety of clinical symptoms and diseases , some of which are quite severe and even fatal . in the clinical setting , adrs are a common and important public health problem , and they always need to be included in the differential diagnosis of patients under treatment with drugs . the most commonly used classification , proposed by rawlins and thompson , differentiates these reactions into two major subtypes : type a reactions that are due to a pharmacological propriety of the causative drug and are thus predictabletype b reactions that occur only in predisposed individuals and are thus hard to predict . type a reactions that are due to a pharmacological propriety of the causative drug and are thus predictable type b reactions that occur only in predisposed individuals and are thus hard to predict . gell and coombs classified immune - mediated allergic reactions to drugs , which describes the predominant immune mechanisms involved in these reactions . this classification system includes : type i - immediate - type reactions mediated by immunoglobulin e ( ige ) antibodies type ii - cytotoxic reactions mediated by immunoglobulin g ( igg ) or immunoglobulin m ( igm ) antibodies type iii - immune - complex reactions type iv - delayed - type hypersensitivity reactions mediated by cellular immune mechanisms , such as the recruitment and activation of t cells . fde has been reported in male patients after history of sexual contact with their spouses , who were found to be receiving the same medication to which the male partners were hypersensitive . genetic polymorphisms in the human leukocyte antigen as well as viral infections such as human immunodeficiency virus ( hiv ) and the epstein - barr virus ( ebv ) have also been linked to an increased risk of developing immunologic reactions to drugs . in addition , topical , intramuscular and intravenous routes of administration are more likely to cause allergic drug reactions than oral administration , while intravenous administration is associated with more severe reactions . prolonged high doses or frequent doses are more likely to lead to hypersensitivity reactions than a large single dose . fde is usually solitary in the initial attack , but with each subsequent exposure , the number of involved sites may increase and preexisting sites may increase in size . the eruption may initially be morbilliform , scarlatiniform or erythema multiforme like . however , urticarial , nodular or eczematous lesions are uncommon . the exact pathogenesis of fde is unknown , although antibodies , antibody - dependent cell - mediated cytotoxicity and serum factors have been implicated . cd8 + t cells seem to play a major role in initiating epidermal injury by producing interferon g and interacting with other inflammatory cells . even if a drug is responsible for activation of cd8 + t cells , it does not seem to be the antigen recognized by cd8 + t cells . the reason for recurrence of lesions at the same site may be explained by the persistence in situ of cd8 + memory t cells . the involvement of cd8 + t cells may suggest a role for cell - mediated hypersensitivity in the pathogenesis of fde . fde represents a unique cdr pattern characterized by skin lesion ( s ) that recur at the same anatomic site ( s ) upon repeated exposures to an offending agent . most commonly , the skin lesion is a dusky erythematous macule and is usually found on the extremities , lips , genitalia and perianal areas , although any skin or mucosal surface may be involved . the skin lesions may be associated with a burning sensation and may be present in multiple numbers or progress to the development of central vesicles and bullae , particularly after the repeated use of an agent . the most characteristic feature of fde is reactivation of the inflammatory process in the previously involved site ( s ) with each subsequent exposure . the classic morphology of fde lesion is dusky red painful patch ( es ) that leave long - lasting or permanent deep postinflammatory hyperpigmentation . other , nonclassic lesions of fde are occasionally seen , including erythema multiforme , steven johnson syndrome , cheilitis , psoriasis , lichen planus - like , hand eczema , melasma , discoid lupus erythematosus , pemphigus vulgaris or hypermelanosis of the vulva and peri - anal area . , we could find only seven cases of intraoral involvement of fde in the english literature [ table 1 ] . cases of intraoral involvement of fde fde due to ornidazole in previously documented three cases had involved the lips , chest and antero - lateral aspect of the thigh . the case described here is unique as it involved the intra - oral site of the hard palate , labial mucosa ( a site rarely associated with fde ) , resulting due to the use of ornidazole . the management of fde depends on the severity of the reaction . for mild cases , withdrawal of the offending drug , with application of mild to moderate topical corticosteroids , and systemic antihistamines are usually sufficient . in severe reactions , the management is similar to other cases of severe allergic reactions , including intensive supportive , maintaining fluid and electrolyte balance , infection control , systemic corticosteroids and systemic antihistamines . although allergic reactions to antibiotics account for only a small proportion of reported adrs , they are associated with substantial morbidity and mortality and increased health care costs . awareness among dental and medical practitioners about fde can lead to correct diagnosis and treatment in order to prevent unnecessary morbidity and the potential risk of death from these severe reactions , and to provide proper medical advice on future drug use .
fixed - drug eruption ( fde ) is an unusual and rare adverse drug reaction . this type of reaction is actually a delayed type of hypersensitivity reaction that occurs as lesions recurring at the same skin site due to repeated intake of an offending drug . here is a case report of a 58-year - old male patient who developed intraoral fdes after ingestion of the first dose of ornidazole .
methylene dianiline ( ddm ) is a chemical intermediate in the production of isocyanates and other industrial chemicals , and it is hepatotoxic in humans . the acute hepatotoxicity of orally administered ddm was characterized in rats . rats receiving ddm ( 25 - 225 mg / kg , per os ) demonstrated a dose - dependent elevation in serum alanine aminotransferase activity , g - glutamyltransferase activity , and serum bilirubin concentration . ddm also caused a decrease in bile flow and an elevation in liver weight . significant changes in these markers of liver injury occurred between 8 and 12 hr after a single , oral administration of ddm . histologically , ddm caused multifocal , necrotizing hepatitis with neutrophil infiltration . changes in the portal regions consisted of bile ductular necrosis , portal edema , neutrophil infiltration , mild fibrin exudation , and segmental necrotizing vasculitis . the role of cytochrome p450 monooxygenase ( mo)-mediated metabolism in ddm hepatotoxicity was evaluated using the mo inhibitors , aminobenzotriazole and skf-525a and the mo inducers phenobarbital and beta - naphthoflavone . aminobenzotriazole provided protection from ddm - induced hepatotoxicity , whereas skf-525a had no effect . the effect of phenobarbital pretreatment depended on the dose of ddm administered . at a dose of ddm that produced a maximal hepatotoxic response , phenobarbital did not influence hepatotoxicity . however , phenobarbital pretreatment provided protection against the hepatotoxic effects of a lower dose of ddm . beta - naphthoflavone pretreatment had a more modest effect on ddm - induced hepatic insult . these results demonstrate that ddm causes acute hepatotoxicity in the rat that is dose and time dependent . results using inducers and inhibitors of mo suggest that ddm requires bioactivation to exert toxicity ; however , the relationship between metabolism and toxicity may be complex.imagesfigure 2 . afigure 2 . bfigure 2 . cfigure 2 . d
temporomandibular joint ( tmj ) response to mandibular advancement surgery is sporadically associated to arthralgia ( pain ) , functional limitations , condylar resorption and skeletal relapse . when the mandible is advanced and fixed , the adjacent tissues are stretched and tend to displace the distal segment back toward its original position . this response to mandibular advancement is countered bilaterally by the tmjs and may contribute to less stability . the adverse effects of mandibular advancement surgery on the tmjs form a pertinent theme well explored in the literature . the tmj response ranged from adaptive , which included physiological bone remodeling , to irreversible complications . undesired tmj responses to treatments in both short and long - term follow - up periods , such as condyle torque , joint sounds ( clicking , popping , crepitus ) , deteriorated discomfort and pain , deviated or limited mouth opening , and condylar resorption ( cr)have all been reported . however , the limitations and heterogeneity of the studies can not be overlooked , and because the tmj response is of multifactorial origin and there is a wide range of individual variability as well as different surgical techniques , there is still controversy as to whether mandible advancement surgery is detrimental to the tmj . systematic reviews published in this field found an intermediate degree of evidence and proved inconclusive . moreover , for ethical reasons , randomized clinical trial designs involving surgery are limited . in order to understand the conflicting information on the tmj response to mandibular advancement surgery and to allow the practitioner to take this into consideration during treatment planning , this overview centered on five risk factors : disk displacement , arthralgia , cr , mandibular fixation techniques , and the amount of mandibular advancement . high - quality research , such as randomized clinical trials , systematic reviews and meta - analysis , is uncommon in the surgical field , despite current high levels of emphasis on evidence - based dentistry . hence , intermediate degrees of evidence were found in systematic reviews published on this theme . although the issue in this research refers to intervention , the study design pertained to a wider spectrum of studies , which included animal searches , serial cases , updates and observational studies on temporomandibular disorders ( tmd ) , comprising a narrative review ( non - systematic review ) . publications were identified through searches of the following databases : cochrane , pubmed , scopus and web of science in the period from january 1980 through march 2013 . the following search terms were used and combined ( and ) : " condylar resorption " , " mandibular advancement surgery " , " rigid internal fixation " ( rif ) , " sagittal split ramus osteotomy " ( ssro ) , " temporomandibular disorder " ( tmd ) , and " relapse " . in addition , a hand search of the reference lists was carried out to identify additional papers . data was pooled into evidence tables and grouped according to the subjects ( 1-articular disc displacement , 2- arthralgia , 3- cr , 4- mandibular fixation techniques , and 5- amount of advancement ) . the study design was identified and a descriptive summary was performed . high - quality research , such as randomized clinical trials , systematic reviews and meta - analysis , is uncommon in the surgical field , despite current high levels of emphasis on evidence - based dentistry . hence , intermediate degrees of evidence were found in systematic reviews published on this theme . although the issue in this research refers to intervention , the study design pertained to a wider spectrum of studies , which included animal searches , serial cases , updates and observational studies on temporomandibular disorders ( tmd ) , comprising a narrative review ( non - systematic review ) . publications were identified through searches of the following databases : cochrane , pubmed , scopus and web of science in the period from january 1980 through march 2013 . the following search terms were used and combined ( and ) : " condylar resorption " , " mandibular advancement surgery " , " rigid internal fixation " ( rif ) , " sagittal split ramus osteotomy " ( ssro ) , " temporomandibular disorder " ( tmd ) , and " relapse " . in addition , a hand search of the reference lists was carried out to identify additional papers . data was pooled into evidence tables and grouped according to the subjects ( 1-articular disc displacement , 2- arthralgia , 3- cr , 4- mandibular fixation techniques , and 5- amount of advancement ) . the study design was identified and a descriptive summary was performed . retrospective and prospective clinical studies involving tmj and mandibular advancement surgery were classified and distributed according to the above - mentioned subjects , and shown in table 1 . classification and distribution of retrospective and prospective clinical studies tmj = temporomandibular joint disc displacement ( or internal derangement ) is subdivided into disc displacement with and without reduction and the latter is further subdivided into with or without limited mouth opening . disc displacement with reduction and no further signs or symptoms is considered not clinically relevant . anterior and medial or lateral disc displacement is the most common tmj disorder in people in general and seems to be more prevalent in patients with dentofacial deformity . arthralgia is not always followed by disc displacement , but noise ( clicking ) or restricted mouth opening are the most frequently found clinical signs . clicking and arthralgia have been proven to fluctuate over time , and , because of this complex interaction , a wide range ( 26 to 97% ) of disc displacement has been found in asymptomatic patients seeking orthognathic surgery . no association was seen between disc displacement , pain and the type of dentofacial deformity . the relationship between disc displacement and degenerative bony changes has still not been fully clarified . there is a consensus that the natural progression of disc displacement with reduction precedes disc displacement without reduction , but the natural progression of the joint disc displacement in cr has not been well defined . the clinical signs and symptoms of anterior disc displacement without reduction tended to alleviate during the natural course of the condition , except for a quarter of patients who showed no improvement after 2.5 years of follow - up , but there was no deterioration either or change in cr during this period of time . disc displacement and cr probably often occur simultaneously , but are considered independent disorders , with cr being trigged by other factors , including age . systematic reviews on temporomandibular disorder ( tmd ) both before and after orthognathic surgery have also reported a heterogeneous study design and controversial results . hackney , et al.(1989 ) did not find any significant difference in the incidence of tm pain or clicking following bilateral sagittal split osteotomy and rigid fixation . but the major evidence with regard to clicking after orthognathic surgery points to the fact that there is greater likelihood of improvement rather than deterioration , even if such improvement is temporary . for these reasons , there is no individual guarantee for the evolution of clicking , in contrast to disc displacement and crepitus which do not seem to be affected by ssro for mandibular advancement or setback , unless a specific surgical intervention is undertaken to recapture the disc in tmj . temporomandibular arthralgia can be defined as pain and tenderness in the joint capsule and/or the synovial lining of the tmj due to an inflammatory process . the diagnosis is based on pain during palpation in one or both joint sites ( lateral pole and/or posterior attachment ) , plus one or more self - reports of pain in the region of the joint , during maximum opening and/or during lateral excursion . arthralgia can lead to a reduction in chewing efficiency and limitation of mouth opening , and can be detected beforeand / or afterorthognathic surgery . there are doubts about the efficiency of mandibular surgical advancement in mitigating temporomandibular symptoms . in general , in terms of arthralgia , there is greater likelihood of improvement rather than deterioration after orthognathic surgery , but there is no individual guarantee of its evolution . in the short term , an increase in muscle and tmj symptoms was normally found after mandibular advancement surgery , and this tended to decline over time , without being considered a risk factor for tmd . on the other hand , it can not be overlooked that there is also a risk of asymptomatic patients developing tmd after surgery , and the condition of patients with tmj symptoms worsening after surgery . it has been suggested that class ii malocclusions with severe mandibular retrognathism and a hyperdivergent skeletal pattern are risk factors for painful tmd , and are subject to lesser improvement after surgery . studies have concluded that ssro of the mandible has a favorable effect on tmj symptoms , with better evolution for mandibular prognathism than mandibular retrognathism . ( 1995 ) found significantly fewer post - operative tmj symptoms in normal / low angle mandibular deficiency deformity , while there was no significant difference in the high angle group . in both animal and human studies , condylar and fossa remodeling ellis and hinton(1991 ) have shown remodeling changes occurring in the tmj of the adult macaca mulatta monkey . in human tomographic radiographs , superficial change with no major clinical relevance has been detected in the contour of healthy tmj after surgery . changes in joint loading , muscle activity and the new condylar position may contribute to this adaptive occurrence . on average , a more severe irreversible change in condylar shape can take place in approximately 5% of patients who undergo surgery to advance the mandible , but , in the literature , a larger range of 1 to 31% was found . besides the tmj compression generated by orthognathic surgery , other factors such as autoimmune and connective tissue diseases ( rheumatoid arthritis , lupus erythematosis , scleroderma ) , trauma , infection , hormone imbalance ( hyperparathyroidism , extremely irregular menstrual cycles , low 17-estradiol ) , nutritional status , drugs ( steroid use ) , repetitive oral habits , age and genetic background , the shape and degree of severity of degenerative bony changes has been detected by ct scans . such shape changes have been classified as followsaccording to an earlier report : flattening ( a flat bony contour deviating from the convex form ) , erosion ( a localized area of decreased density in the cortical condylar surface and adjacent subchondral bone ) , and osteophyte ( a marginal bony overgrowth on the anterior part of the condyle ) ( figure 1 ) . degrees of resorption of the articular surface have varied from superficial changes to complete destruction at advanced stages(figure 2 ) . cone - beam computed tomography images of temporomandibular joint showing morphological variation of the mandibular condyle . b- flattening ( coronal view ) ; c- erosion ( coronal view ) ; and , d- osteophyte ( sagittal view ) cone - beam computed tomography images of temporomandibular joint ( coronal view ) showing advanced destruction of mandibular condyle the spectrum of clinical and pathological changes in cr may include disc displacement , perforation and destruction ; crepitus ; hyperplastic synovial tissue ; synovitis ; and loss of articular fibrocartilage . in addition , there have been changes in shape and a reduction in the size of condyles . some of the patients affected are asymptomatic , except for joint sounds , while a quarter may develop pain , crepitus , or irregular or limited mouth opening . so , symptoms may , or may not , be detected and may vary pre- and post - surgically , and may worsen after surgery . pain intensity was not correlated with the severity of the cr , except in one study using 3d surface models . localized ( non - systemic ) inflammatory disease has been called idiopathic cr when individual susceptibility is present and no identified etiologic factor is detected . this bone loss has also been named condylisis ( or condylolysis ) , condylar atrophy , progressive condylar resorption , or progressive mandibular retrusion . first described by sesanna and raffaini(1985 ) and confirmed by others , a progressive , slow irreversible relapse of the mandible develops after mandibular advancement surgery , with a subsequent reduction in the height of the ramus , downward and backward rotation of the mandible , resulting in skeletal class ii malocclusion with an anterior open bite , a steep mandibular plane angle , increased lower facial height , and decreased chin projection . both joints can be symmetrically affected , or just one with minor occurrence , while bilateral involvement with an asymmetric outline is also common . several studieshave shown that the first signs of postsurgical development were detected 6 months or more after surgery and developed up to 2 years after surgery and was related to a long - term skeletal relapse . on the other hand , idiopathic cr has not been found only after orthognathic surgery , and may be observed during or after active dental restorative , orthodontic or before orthognathic surgery . idiopathic cr is a multifactorial disease , with surgical and non - surgical risk factors . retrospectiveand prospectivestudies have named some morphological features and outlined some risk factors . from these studies , it was concluded that idiopathic cr primarily affects 16 to 26-year - old females with a mean male / female ratio of 1/8 , with skeletal class ii malocclusion due to mandibular retrognathism , and high mandibular plane angles combined with a low posterior facial height . short condyles with posterior inclination , and/or bone loss before treatment were prone to cr after surgery , and there was a positive correlation with the amount of mandibular advancement and the degree of maxillomandibular counter - clockwise rotation . contributing surgical factors have been associated with mechanical overloading and a reduction in vascular supply to the condyle , which may exacerbate the disease in susceptible patients who have undergone mandibular advancement surgery . methods of stabilizing the proximal to distal segments at the moment of surgery have progressed from wire fixation to rigid internal fixation ( rif ) . wire osteosynthesis was performed in conjunction with a 6 to 8-week period of maxillomandibular fixation ( mmf ) and was linked , with some exceptions , to postsurgical relapse , due to the weak bone union of the segments which permits proximal segment rotation at the osteotomy sites . however , in terms of temporomandibular joint painand the mandibular range of motion , no differences were detected between mmf and rif . his method involved using three lag - screws at the osteotomy site ( two above the neurovascular bundle , and one below ) . the advantages of rif included an early return to normal function , better nutrition support and improved stabilization of the bony segments , which allows for faster bony repair without mmf . studies on mechanical proprieties and stability at the osteotomy site have attested that rif is better than wire fixation . however , the major concern when the mandible is being surgically advanced and rigidly fixed is the risk of damaging the neurovascular bundle and imprecise condylar positioning due to the torque of the rami . in this respect , animal studieshave detected a more pronounced effect of the condyle when the rigidity of the fixation method was greater . the intense rigidity brought about by bicortical lag - screws may close the gap between the bone segments and torque the condyle , move it out of the mandibular fossa and cause transverse displacements of the proximal segments . consequently , several modifications of rif patterns have been proposed , varying according to type , number , site , size and placement of screws and miniplates . one way of maintaining the gap while at the same time applying stable fixation is to use positional bicortical screws ( non - compressive or non - lag ) , miniplate systems , or both ( hybrid technique ) . large gaps between the proximal and distal segments can be minimized by the removal of bone interferences or by using secondary osteotomy before fixation of the mandible . positional bicortical screws have been commonly applied in three linear or l designs(pattern , backward , inverted , and inverted backward ) ; and inserted at 90 ( perpendicular ) or 60 angles . one of the advantages of using screws at a 60 angle is the possibility of intrabuccal insertion . miniplate systems have been used with the technical variant of a horizontal or oblique direction , and fixed with monocortical screws . they also obviate the need for transcutaneous puncture , and its subsequent scarring , reduce time spent in surgery , and pose less risk of nerve damage and condylar torque . because the system is less rigid , it is also called semi - rigid fixation . several hybrid techniques have been cited , such as the miniplate with monocortical screw fixation and positional screws placed bicortically , by means of the plate , or placed separately above or below the plate . retrospective clinical studieshave shown that postsurgical stability and condylar changes were not significantly different after using either the miniplate system or positional screws in sagittal split ramus osteotomy . however , in vitro and finite elementstudies have shown that miniplate systems provided less mechanical stability in bone segments when compared with different arrangements of bicortical positional screws , and this has been supported by clinical reports that malocclusions developed from a loss of miniplate fixation after mandibular advancement surgery . in summary , earlier biomechanical studies compared different designs of mandibular fixation and showed that : 1 ) three positional screws were equivalent to the hybrid technique with one miniplate fixed with monocortical screws and one positional screw ; 2 ) 2.7 mm screws offered no advantage over 2.0 mm bicortical screws ; 3 ) the angle of insertion of the screw at 90 ( percutaneous placement ) or 60 ( transoral placement ) made no significant difference in the resistance of sheep osteotomized mandibles . however , perpendicular insertion ( 90 ) of the screws in inverted - l and linear configurations offered greater laboratory resistance in polyurethane models ; and , 4 ) obliquely placed miniplates offered greater biomechanical stability than those placed horizontally . the amount of mandibular advancement is another surgical aspect which would appear to contribute towards increasing mechanical loading on tmj . elis and sinn(1994 ) demonstrated that the extent of the stretched tissue correlated with the amount of mandibular advancement , suggesting that a larger surgical movement showed a greater tendency towards distal displacement of the surrounding soft tissue in the postsurgical period . in consonance with this statement , several studies corroborated a considerable correlation between the amount of mandibular advancement and an increase in condylar displacement , muscle and tmj symptoms , relapse rateand the occurrence of cr . however , others failed to demonstrate a tendency towards relapse , probably because there were not many patients in the samples with greater mandibular advancement . a systematic review conducted by joss and vassalli(2009 ) , with regard to surgical stability , pointed out that a 7 mm mandibular advancement predisposed towards horizontal relapse . in the literature , suprahyoid miotomy involved detaching the geniohyoid and anterior digastric muscle in order to reduce stretched tissue at the time of mandibular advancement . disc displacement ( or internal derangement ) is subdivided into disc displacement with and without reduction and the latter is further subdivided into with or without limited mouth opening . disc displacement with reduction and no further signs or symptoms is considered not clinically relevant . anterior and medial or lateral disc displacement is the most common tmj disorder in people in general and seems to be more prevalent in patients with dentofacial deformity . arthralgia is not always followed by disc displacement , but noise ( clicking ) or restricted mouth opening are the most frequently found clinical signs . clicking and arthralgia have been proven to fluctuate over time , and , because of this complex interaction , a wide range ( 26 to 97% ) of disc displacement has been found in asymptomatic patients seeking orthognathic surgery . no association was seen between disc displacement , pain and the type of dentofacial deformity . the relationship between disc displacement and degenerative bony changes has still not been fully clarified . there is a consensus that the natural progression of disc displacement with reduction precedes disc displacement without reduction , but the natural progression of the joint disc displacement in cr has not been well defined . the clinical signs and symptoms of anterior disc displacement without reduction tended to alleviate during the natural course of the condition , except for a quarter of patients who showed no improvement after 2.5 years of follow - up , but there was no deterioration either or change in cr during this period of time . disc displacement and cr probably often occur simultaneously , but are considered independent disorders , with cr being trigged by other factors , including age . systematic reviews on temporomandibular disorder ( tmd ) both before and after orthognathic surgery have also reported a heterogeneous study design and controversial results . hackney , et al.(1989 ) did not find any significant difference in the incidence of tm pain or clicking following bilateral sagittal split osteotomy and rigid fixation . but the major evidence with regard to clicking after orthognathic surgery points to the fact that there is greater likelihood of improvement rather than deterioration , even if such improvement is temporary . for these reasons , there is no individual guarantee for the evolution of clicking , in contrast to disc displacement and crepitus which do not seem to be affected by ssro for mandibular advancement or setback , unless a specific surgical intervention is undertaken to recapture the disc in tmj . temporomandibular arthralgia can be defined as pain and tenderness in the joint capsule and/or the synovial lining of the tmj due to an inflammatory process . the diagnosis is based on pain during palpation in one or both joint sites ( lateral pole and/or posterior attachment ) , plus one or more self - reports of pain in the region of the joint , during maximum opening and/or during lateral excursion . arthralgia can lead to a reduction in chewing efficiency and limitation of mouth opening , and can be detected beforeand / or afterorthognathic surgery . there are doubts about the efficiency of mandibular surgical advancement in mitigating temporomandibular symptoms . in general , in terms of arthralgia , there is greater likelihood of improvement rather than deterioration after orthognathic surgery , but there is no individual guarantee of its evolution . in the short term , an increase in muscle and tmj symptoms was normally found after mandibular advancement surgery , and this tended to decline over time , without being considered a risk factor for tmd . on the other hand , it can not be overlooked that there is also a risk of asymptomatic patients developing tmd after surgery , and the condition of patients with tmj symptoms worsening after surgery . it has been suggested that class ii malocclusions with severe mandibular retrognathism and a hyperdivergent skeletal pattern are risk factors for painful tmd , and are subject to lesser improvement after surgery . studies have concluded that ssro of the mandible has a favorable effect on tmj symptoms , with better evolution for mandibular prognathism than mandibular retrognathism . ( 1995 ) found significantly fewer post - operative tmj symptoms in normal / low angle mandibular deficiency deformity , while there was no significant difference in the high angle group . in both animal and human studies , condylar and fossa remodeling are common response to treatment involving mandibular advancement surgery . ellis and hinton(1991 ) have shown remodeling changes occurring in the tmj of the adult macaca mulatta monkey . in human tomographic radiographs , superficial change with no major clinical relevance has been detected in the contour of healthy tmj after surgery . changes in joint loading , muscle activity and the new condylar position may contribute to this adaptive occurrence . on average , a more severe irreversible change in condylar shape can take place in approximately 5% of patients who undergo surgery to advance the mandible , but , in the literature , a larger range of 1 to 31% was found . besides the tmj compression generated by orthognathic surgery , other factors such as autoimmune and connective tissue diseases ( rheumatoid arthritis , lupus erythematosis , scleroderma ) , trauma , infection , hormone imbalance ( hyperparathyroidism , extremely irregular menstrual cycles , low 17-estradiol ) , nutritional status , drugs ( steroid use ) , repetitive oral habits , age and genetic background , the shape and degree of severity of degenerative bony changes has been detected by ct scans . such shape changes have been classified as followsaccording to an earlier report : flattening ( a flat bony contour deviating from the convex form ) , erosion ( a localized area of decreased density in the cortical condylar surface and adjacent subchondral bone ) , and osteophyte ( a marginal bony overgrowth on the anterior part of the condyle ) ( figure 1 ) . degrees of resorption of the articular surface have varied from superficial changes to complete destruction at advanced stages(figure 2 ) . cone - beam computed tomography images of temporomandibular joint showing morphological variation of the mandibular condyle . b- flattening ( coronal view ) ; c- erosion ( coronal view ) ; and , d- osteophyte ( sagittal view ) cone - beam computed tomography images of temporomandibular joint ( coronal view ) showing advanced destruction of mandibular condyle the spectrum of clinical and pathological changes in cr may include disc displacement , perforation and destruction ; crepitus ; hyperplastic synovial tissue ; synovitis ; and loss of articular fibrocartilage . in addition , there have been changes in shape and a reduction in the size of condyles . some of the patients affected are asymptomatic , except for joint sounds , while a quarter may develop pain , crepitus , or irregular or limited mouth opening . so , symptoms may , or may not , be detected and may vary pre- and post - surgically , and may worsen after surgery . pain intensity was not correlated with the severity of the cr , except in one study using 3d surface models . localized ( non - systemic ) inflammatory disease has been called idiopathic cr when individual susceptibility is present and no identified etiologic factor is detected . this bone loss has also been named condylisis ( or condylolysis ) , condylar atrophy , progressive condylar resorption , or progressive mandibular retrusion . first described by sesanna and raffaini(1985 ) and confirmed by others , a progressive , slow irreversible relapse of the mandible develops after mandibular advancement surgery , with a subsequent reduction in the height of the ramus , downward and backward rotation of the mandible , resulting in skeletal class ii malocclusion with an anterior open bite , a steep mandibular plane angle , increased lower facial height , and decreased chin projection . a decrease in the pharyngeal air way space has also been mentioned . both joints can be symmetrically affected , or just one with minor occurrence , while bilateral involvement with an asymmetric outline is also common . several studieshave shown that the first signs of postsurgical development were detected 6 months or more after surgery and developed up to 2 years after surgery and was related to a long - term skeletal relapse . on the other hand , idiopathic cr has not been found only after orthognathic surgery , and may be observed during or after active dental restorative , orthodontic or before orthognathic surgery . idiopathic cr is a multifactorial disease , with surgical and non - surgical risk factors . retrospectiveand prospectivestudies have named some morphological features and outlined some risk factors . from these studies , it was concluded that idiopathic cr primarily affects 16 to 26-year - old females with a mean male / female ratio of 1/8 , with skeletal class ii malocclusion due to mandibular retrognathism , and high mandibular plane angles combined with a low posterior facial height . short condyles with posterior inclination , and/or bone loss before treatment were prone to cr after surgery , and there was a positive correlation with the amount of mandibular advancement and the degree of maxillomandibular counter - clockwise rotation . contributing surgical factors have been associated with mechanical overloading and a reduction in vascular supply to the condyle , which may exacerbate the disease in susceptible patients who have undergone mandibular advancement surgery . methods of stabilizing the proximal to distal segments at the moment of surgery have progressed from wire fixation to rigid internal fixation ( rif ) . wire osteosynthesis was performed in conjunction with a 6 to 8-week period of maxillomandibular fixation ( mmf ) and was linked , with some exceptions , to postsurgical relapse , due to the weak bone union of the segments which permits proximal segment rotation at the osteotomy sites . however , in terms of temporomandibular joint painand the mandibular range of motion , no differences were detected between mmf and rif . his method involved using three lag - screws at the osteotomy site ( two above the neurovascular bundle , and one below ) . the advantages of rif included an early return to normal function , better nutrition support and improved stabilization of the bony segments , which allows for faster bony repair without mmf . studies on mechanical proprieties and stability at the osteotomy site have attested that rif is better than wire fixation . however , the major concern when the mandible is being surgically advanced and rigidly fixed is the risk of damaging the neurovascular bundle and imprecise condylar positioning due to the torque of the rami . in this respect , animal studieshave detected a more pronounced effect of the condyle when the rigidity of the fixation method was greater . the intense rigidity brought about by bicortical lag - screws may close the gap between the bone segments and torque the condyle , move it out of the mandibular fossa and cause transverse displacements of the proximal segments . consequently , several modifications of rif patterns have been proposed , varying according to type , number , site , size and placement of screws and miniplates . one way of maintaining the gap while at the same time applying stable fixation is to use positional bicortical screws ( non - compressive or non - lag ) , miniplate systems , or both ( hybrid technique ) . large gaps between the proximal and distal segments can be minimized by the removal of bone interferences or by using secondary osteotomy before fixation of the mandible . positional bicortical screws have been commonly applied in three linear or l designs(pattern , backward , inverted , and inverted backward ) ; and inserted at 90 ( perpendicular ) or 60 angles . one of the advantages of using screws at a 60 angle is the possibility of intrabuccal insertion . miniplate systems have been used with the technical variant of a horizontal or oblique direction , and fixed with monocortical screws . they also obviate the need for transcutaneous puncture , and its subsequent scarring , reduce time spent in surgery , and pose less risk of nerve damage and condylar torque . because the system is less rigid , it is also called semi - rigid fixation . several hybrid techniques have been cited , such as the miniplate with monocortical screw fixation and positional screws placed bicortically , by means of the plate , or placed separately above or below the plate . retrospective clinical studieshave shown that postsurgical stability and condylar changes were not significantly different after using either the miniplate system or positional screws in sagittal split ramus osteotomy . however , in vitro and finite elementstudies have shown that miniplate systems provided less mechanical stability in bone segments when compared with different arrangements of bicortical positional screws , and this has been supported by clinical reports that malocclusions developed from a loss of miniplate fixation after mandibular advancement surgery . in summary , earlier biomechanical studies compared different designs of mandibular fixation and showed that : 1 ) three positional screws were equivalent to the hybrid technique with one miniplate fixed with monocortical screws and one positional screw ; 2 ) 2.7 mm screws offered no advantage over 2.0 mm bicortical screws ; 3 ) the angle of insertion of the screw at 90 ( percutaneous placement ) or 60 ( transoral placement ) made no significant difference in the resistance of sheep osteotomized mandibles . however , perpendicular insertion ( 90 ) of the screws in inverted - l and linear configurations offered greater laboratory resistance in polyurethane models ; and , 4 ) obliquely placed miniplates offered greater biomechanical stability than those placed horizontally . the amount of mandibular advancement is another surgical aspect which would appear to contribute towards increasing mechanical loading on tmj . elis and sinn(1994 ) demonstrated that the extent of the stretched tissue correlated with the amount of mandibular advancement , suggesting that a larger surgical movement showed a greater tendency towards distal displacement of the surrounding soft tissue in the postsurgical period . in consonance with this statement , several studies corroborated a considerable correlation between the amount of mandibular advancement and an increase in condylar displacement , muscle and tmj symptoms , relapse rateand the occurrence of cr . however , others failed to demonstrate a tendency towards relapse , probably because there were not many patients in the samples with greater mandibular advancement . a systematic review conducted by joss and vassalli(2009 ) , with regard to surgical stability , pointed out that a 7 mm mandibular advancement predisposed towards horizontal relapse . in the literature , suprahyoid miotomy involved detaching the geniohyoid and anterior digastric muscle in order to reduce stretched tissue at the time of mandibular advancement . several studies point to mandibular advancement surgery as a potential factor in bringing about tmj changes , especially in condylar position and shape . a successful functional outcome depends on the final tmj position and the patient 's health , including the remission of preexisting tmd . this study reviewed the response of the tmj to mandibular advancement surgery by analyzing certain risk factors , which included three tmj changes ( disk displacement , arthralgia , and cr ) and two treatment variables ( fixation techniques and the amount of advancement ) . overall , surgery did not manage to change the presurgical disc position or correct the anterior disc displacement ; although it tended to improve preexisting arthralgia without individual guarantees or in a predictable way ; and increased the risk of cr , especially in identified high - risk cases . the amount of mandibular advancement , counterclockwise rotation , and the rigidity of the fixation techniqueseemed to influence tmj position and health . however , the literature frequently presented methodological problems , which limited the final evidence . little information was found in the literature to reduce bias and strengthen the evidence . certain methodological problems were identified , including : sample size ; a lack of defined inclusion criteria ; the presence of heterogeneous groups made up of patients who had undergone different types of surgery ; the presence of confounding factors ; longitudinal studies with short follow - up periods ; error analysis method ; blinding in measurements;inadequate statistics ; extrapolation from animal studies to humans ; generalization of in vitro biomechanical results without considering individual variation ; little research on the correlation between clinical findings and tmj images;poor imaging techniques ; lack of longitudinal observational and interventional studies ; tmd type not always identified ; unrecognized tmj problems before surgery ; lack of functional data ; different characteristics of the sample with regard to the skeletal relationship , race and age ; and lack of internal controls . although magnetic resonance imaging is the diagnostic " gold standard " for disc displacement , few studies used this methodology before or after orthognathic surgery in a long follow - up period . nevertheless , relevant data from this overview is useful for clinical comprehension and practice . it has been assumed that joints with preexisting displaced discs and crepitus are more likely not to change or improve after mandibular surgery , unless a specific surgical intervention is undertaken to recapture the discin tmj . this could be explained by the persistent compression of the condyle against the posterior ligament after surgery . the significance of this persistent disc displacement after surgery is unknown especially in relation to the onset of degenerative disease , as the natural course of the disease could be superimposed on the effects of the treatment and act as a confounding factor ( figure 3 ) . presurgical magnetic resonance of temporomandibular joint showing disc displacement with reduction ( a and b ) , and 10 years after mandibular surgical advancement ( c and d ) showing the maintenance of the disc status and the onset of condylar degeneration most patients present limited or deviated mouth opening shortly after surgery . when it is of muscular origin , it is attributed to myositis , associated with surgical trauma and can lead to severe functional impairment and disability . but the condition improves post surgically , and most patients regain their full range of movement in the long - term . it is also hypothesized that improvement in self - image after surgery reduces patients ' negative feelings , irrespective of the functional outcome . on the other hand , it can not be ruled out that persistent orofacial pain after surgery can be modulated by the central nervous system . when of joint origin it is presumed to be temporary . it would also be associated with disc displacement without reduction , which does not seem to be directly influenced by the surgery . it has been considered that minimal condylar and fossa remodeling are unavoidable after mandibular advancement surgery , thus falling within the physiological range of adaptation . an exception is greater condylar destruction , which extrapolates the level of adaptive tolerance and precipitates the development of occlusal and skeletal changes . according to proffit(2000 ) , a loss of more than 2 mm occurred in 10%of patients undergoing mandibular advancement surgery and occlusal instability was foundin half ( 5% ) of these patients . the amount of bone loss in tmj detected in images extrapolating the level of adaptive tolerance in unknown , but the precise limit can be established in accordance with the development of occlusal and skeletal changes . because idiopathic cr is more common among females , it has been proposed that it may be related to the sex hormone . in animal studies , estrogen has been implicated as a mediator of degenerative remodeling of the tmj , and the increased number of receptors may predispose to an exaggerated response to the loading of the condyle after mandibular advancement surgery . a factor also to be considered in this context isthe higher prevalence of tmj dysfunction among females . the wide range ( 1 to 31% ) of occurrence of cr after orthognathic surgery expressed in the literature may be due to the lack of well - defined diagnostic criteria and the variety of image techniques used . recent guidelines have recommended computed tomography(ct ) as the modality of choice for evaluating tmj osseous change , as ct images are considered more accurate than panoramic images or cephalograms . adequate parameters of fov and voxel size should be adopted , because they strongly influence the diagnostic efficacy to detect erosions in the tmj . moreover , a refinement in image analysis for accurate visualization through the reconstruction of 2d images in a 3dsurface - mapping technique using cone - beam ct ( cbct ) images might provide the location and quantification of previously unidentified cr . it is also equally important to consider the idiopathic and rheumatoid cr activity(active or inactive ) and the stage of condylar destruction and jaw discrepancy ( mild , moderate or severe ) . this condition has a natural course of evolution and may express a different prognosis . active resorption has an unpredictable course of duration , but it is known that the idiopathic condition primarily affects young adult females of the age of those most frequently undergoing orthognathic surgeries . it has been presumed that active cr arises out of a loss of cortical bone coverage , typically found at the erosion stage in ct or in magnetic resonance imaging evidencing the lack of cartilaginous integrity of the condylar surface . it is also detected on bone scintigraphy . because false positive and false negative may occur with scintigraphy exam , longitudinal ct images should be recommended to identify presurgical condylar variants and map the stages of disease progression after treatment . most studies involving cr have focused on post surgical occurrence and associated long - term relapse . the treatment adopted in cases of relapse has varied from non - surgical ( splint therapy , orthodontic camouflage and restorative dentistry ) to surgical ( re - intervention ) approaches . however , cr may be present prior to surgery , with onset during adolescence and may be of traumatic , rheumatoid , oridiopathic origin ; and related to a secondary and late development of skeletal class ii with open bite malocclusion . it has been well documented that tmj degeneration does not improve with surgery , and can lead to unfavorable surgical outcomes because of post surgical mechanical overloading combined with active resorption ( figures 4 and 5 ) . for this reason , in cases of pre existing active cr , doubts arise about the best therapeutic option in terms of preventive management . a 23-year - old woman who had maxillary posterior impaction , mandibular auto rotation and genioplasty for advancement . relapse of class ii maloclusion was evident at long - term post surgery due to condylar resorption . facial photos before orthognathic surgery ( a ) ; 6 months ( b ) and 3 years ( c ) after orthognathic surgery are shown . patient signed informed consent authorizing the publication of these pictures sequence of figure 6 presenting panoramic images before ( a ) and after ( b ) surgery showing the pre - existing juvenile idiopathic arthritis and the deterioration after surgery cases of minor jaw discrepancies have been treated by conservative procedures ( splint therapy ; restorative dentistry ; orthodontic treatment with or without skeletal anchorage ) . however , when major jaw discrepancies are present they are mainly treated by surgical protocols for functional and esthetic recovery . mandibular advancement surgery in cases of preexisting active cr has been associated with long - term relapse . therefore , different protocols have been suggested to help control the advance of condyle resorption or prevent surgical relapse . more recently , pharmacological control has been recommended both before and during orthodontic surgical treatment in order to stabilize active cr . the different options of treatment include condylectomy and reconstruction with costochondral grafting ; disc repositioning;alloplastic joint reconstruction , recommended in cases of advanced condyle destruction ( figure 6 ) . complete destruction of condyle in a patient who had undergone orthognathic surgery , and was re - treated with the aid of temporomandibular joint prostheses . before surgery ( a ) , 3d image of the mandible showing bilateral absence of condyles ( b ) , and after surgery ( c ) careful attention has been recommended for surgical procedures in high - risk cr patients , including the avoidance of excessive mechanical loading on the tmj . transverse rotation of the condyles always accompanies ramus surgery to advance the mandible and is thought to be related to how much tmj dysfunction has occurred . biomechanical studies of rif methods after mandible advancement surgery have tested the parameter of biomechanical stability . although ssro is relatively standardized , in the literature there is no agreement about the procedure for rif , which was selected according to the surgeon 's choice . the exception was the lag - screw , which was considered detrimental . in recent years , the hybridtechnique , defined as varying combinations of the use of positional screw(s ) and miniplates , is among the most frequently chosen ostheosynthesis methods . the question that arises is if this same hierarchy of rigidity for fixing the mandibule in the in vitro model is the same as that transmitted to tmj , in terms of stress generation : does the rigidity of fixation imply that the more rigid it is , the more stability there is for early functioning , but , on the other hand , the less stress distribution there is , the more susceptible it is to condylar malpositioning ( torque),resorption and relapse ? in vivo animal studies investigated the response of the tmj to mandibular surgical advancement . there was a more pronounced effect on the condyle ( retrusion , erosion , flattening and osteophyte ) when positional screws were used than when mini plates were used , suggesting that this was developed by the higher impact of the screws transmitted to the condyle . however , no evidence with clinical design has been published with respect to the tmj response to the type of fixation , except studies which showed a greater skeletal long - term relapse rate in patients treated with bicortical screws than with mini plates . the choice of type and design of mandibular synthesis should be based on the treatment planning rather than on the surgeon 's preference . the use of more rigid fixation techniques ( positional screws ) should be the choice for patients with greater bite force , larger advancements ( > 7 mm ) and no preexisting active cr , while , on the other hand , a less rigid fixation ( mini plates ) would be a better choice in cases with a risk factor of cr . as is well known , relapse generally occurs with larger mandibular advancement and in response to cr . before surgery , any signs of cr should also be studied to identify preexisting resorption . besides the mechanical aspects of surgical correction , the treatment of class ii malocclusions with severe mandibular retrognathism in association with a hyper divergent skeletal pattern is considered a clinical challenge . this craniofacial morphology is considered a risk factor for disc displacement , painful tmj beforeand aftersurgery , is subject to less painful improvement after surgeryand is prone to cr before and after surgery , especially if the condylar neck is posteriorly inclined , and results in higher frequency and greater magnitude of horizontal relapse . mandibular advancement surgery maintained the relationship between the articular discand condyle ; improved preexisting arthralgia without any individual guarantees or in any predictable manner ; and , increased the risk of cr , especially in susceptible cases . the amount of mandibular advancement , the degree of maxillomandibular counter - clockwise rotation and the increased joint loading due to the greater rigidity of the mandibular fixation technique contributed to influencing tmj position and health . females with skeletal class ii malocclusion and a high mandibular plane angle pattern were subject to less improvement in painful tmd after surgery and were prone to cr before and after surgery , especially in cases associated with a posteriorly inclined condyle , which contributed to greater horizontal relapse .
objectivein order to understand the conflicting information on temporomandibular joint ( tmj ) pathophysiologic responses after mandibular advancement surgery , an overview of the literature was proposed with a focus on certain risk factors . methodsa literature search was carried out in the cochrane , pubmed , scopus and web of science databases in the period from january 1980 through march 2013 . various combinations of keywords related to tmj changes [ disc displacement , arthralgia , condylar resorption ( cr ) ] and aspects of surgical intervention ( fixation technique , amount of advancement ) were used . a hand search of these papers was also carried out to identify additional articles . resultsa total of 148 articles were considered for this overview and , although methodological troubles were common , this review identified relevant findings which the practitioner can take into consideration during treatment planning : 1- surgery was unable to influence tmj with preexisting displaced disc and crepitus ; 2- clicking and arthralgia were not predictable after surgery , although there was greater likelihood of improvement rather than deterioration ; 3- the amount of mandibular advancement and counterclockwise rotation , and the rigidity of the fixation technique seemed to influence tmj position and health ; 4- the risk of cr increased , especially in identified high - risk cases . conclusionsyoung adult females with mandibular retrognathism and increased mandibular plane angle are susceptible to painful tmj , and are subject to less improvement after surgery and prone to cr . furthermore , thorough evidenced - based studies are required to understand the response of the tmj after mandibular advancement surgery .
in the last decade , a rapid rise in the demand for natural health products has become evident . this prominent trend stems from increasing awareness of the potential for significant adverse effects caused by pharmacologic interventions , along with a growing interest in preventive medicine strategies . a group of plants that has been shown to possess strong anti - inflammatory and antioxidative abilities is the cruciferous plants of the brassica genus . vegetables of the family brassicaceae ( also called cruciferae ) are generally referred to as cruciferous vegetables . these vegetables are widely cultivated , with many genera , species , and cultivars being raised for food production . the most common brassica vegetables eaten by people are in a single species ( b. oleracea ) , including kale , collard greens , cabbage , brussels sprouts , kohlrabi , broccoli , and cauliflower . numerous other species in the genus are also edible such as mustard ( b. nigra ) , chinese cabbage ( b. rapa ) , and oilseed rape ( b. napus ; sometimes referred to as rapeseed oil or canola ) . some members of this group have received wide acclaim as potential natural preventers or attenuators of several health conditions such as coronary artery disease , gastritis , and cancer [ 38 ] . recent studies reveal that these therapeutic effects may extend to the fetus as well : an international case - control study showed that maternal consumption of cruciferous vegetables during pregnancy decreases the risk of childhood anaplastic astrocarcinomas ; a study in rats found that offspring of spontaneously hypertensive rats that consumed broccoli sprouts during gestation had lower blood pressure and reduced markers of oxidative stress and inflammation , compared to controls . the impetus for this systematic review stems from work done in our laboratory that has shown the potential benefit of supplementing the diet of pregnant dams with broccoli sprouts in preventing perinatal brain injury . in this regard , we have established a model of chronic placental insufficiency that results in fetal growth restriction and damage to the white matter of the brain , reminiscent of periventricular leukomalacia , the anatomic hallmark of cerebral palsy . supplementing the maternal diet during the last trimester of pregnancy and first weeks of infant nutrition these findings suggest , for the first time , a safe and efficacious approach to the prevention of developmental disability and cerebral palsy . in order to provide the background in which to determine whether this therapy would be acceptable for humans , a thorough determination of the safety of the cruciferous species of plants in humans is necessary . researchers now believe that the key to the therapeutic abilities of cruciferous plants is their high content of phase-2 enzyme inducers such as sulforaphane , which induce the transcription of genes found under the control of the antioxidant response element ( are ) . this causes an upregulation of the endogenous antioxidant glutathione , crucial to the cell 's ability to withstand oxidative stress [ 1214 ] . several reviews evaluated the safety and health benefits of some components of cruciferous plants , such as indole-3-carbinol and isothiocyanates , and found them safe for humans [ 15 , 16 ] . however , to our knowledge , a systematic review evaluating the safety of cruciferous plants , namely , the degree of certainty that they would not cause any adverse effects , has not yet been published . the purpose of this paper is to systematically collect and synthesize all published reports of human adverse events associated with exposure to cruciferous plants . this approach of analyzing safety of a multi - ingredient natural product is especially important when considering consumption of the whole plant as a therapeutic means , as opposed to treatment with an isolated component or metabolite of a plant . this systematic paper was undertaken in line with the relevant criteria of the prisma ( preferred reporting items for systematic reviews and meta - analyses ) statement . the following methods used in the systematic review , including identification , screening , eligibility criteria , inclusion , and data extraction , were agreed upon by the authors a priori . references were identified through comprehensive search strategies , which were developed in conjunction with a research librarian . an electronic search of the following four databases was performed : medline , embase , pascal , and ipa ( international pharmaceutical abstracts ) , from inception to july 2010 , irrespective of language . the following search terms were used : isothiocyanate , brassica , cruciferous , glucoraphanin , sulforaphane , broccoli , kale , cabbage , cauliflower , collard green , brussels sprout . a list of the search strategies is available as supplemental material available online at doi : 10.1155/2012/503241 . the research question and eligibility criteria were developed by using picos ( patient , intervention , comparators , outcome , study design ) . the inclusion criteria were any studies reporting original data , addressing safety of cruciferous plants , their derivatives , or their constituents , to humans . full texts for potentially relevant studies were obtained and reviewed for inclusion based on predetermined criteria . disagreement was resolved by consensus , and if necessary a third party was consulted ( jyy ) . data relating to the patient or group , the intervention , the comparator group ( where relevant ) , the outcomes measured ( adverse events or lack thereof ) , and the study design were extracted as detailed in table 1 . the degree of association between the intervention and the adverse event was independently assessed by the two reviewers using the causality algorithm used by health canada and the who collaborating centre for international drug monitoring ( health canada 2009 ) . categories for assessment were certainly , likely , possibly , unlikely , conditional / unclassified , and unassessible / unclassifiable . the studies were finally categorized into 3 groups : ( 1 ) trials , ( 2 ) observational studies , and ( 3 ) case reports . studies were classified as controlled clinical trials when involving one or more test treatments , at least one control treatment , specified outcome measures for evaluating the studied intervention , and when the method for assigning patients to the test treatment was not a mathematical randomization technique . randomized controlled trials , on the other hand , were defined as studies in which randomization using mathematical techniques , such as the use of a random numbers table , is employed to assign patients to test or control treatments . studies were classified as single - case experimental design trials when the subjects served as his / her own control , rather than using another individual or a group . we did not perform a meta - analysis as the inclusion criteria for subjects , interventions , clinical outcomes , and study designs were very heterogeneous ; conducting a meta - analysis using these data would not have been appropriate . after screening of titles and abstracts , the full texts of 367 articles were obtained . of these , 45 were published in english , 2 were published in german , and one each was published in italian , french , and spanish . articles were excluded for the following reasons : not human subjects ( 210 ) , not evaluating adverse effects or lack thereof ( 21 ) , intervention or substance exposure does not include cruciferous plants ( 2 ) , not presenting original data ( 47 ) . thirty - seven articles discussing toxic oil syndrome ( 37 ) were excluded post hoc for reasons presented below . of the 50 included studies , 13 were trials ( 6 single - case experimental design trials , 4 controlled clinical trials , and 3 randomized control trials ( rcts ) ) , 13 were observational studies ( 7 cohort studies , 3 case - control studies , 2 cross - sectional studies , and 1 qualitative survey ) , and 24 were case reports ( figure 1 ) . thirteen trials were included , reporting adverse events in 53/496 patients ( 10.7% ) [ 1830 ] . three of them were randomized controlled trials ( rcts ) , 4 were controlled clinical trials , and 6 were single - case experimental design ( sced ) trials . six of the trials were classified as safety trials , meaning that their stated primary aim was to assess safety of interventions [ 1823 ] , whereas 7 were nonsafety trials which evaluated efficacy of interventions but also reported adverse events [ 2430 ] ( table 2 ) . the safety trials [ 1823 ] included 1 rct , 1 controlled clinical trial , and 4 sced trials . the only safety rct was a double - blinded trial in 12 healthy subjects , ages 2857 , of whom 9 consumed daily doses of broccoli sprout extract combined with myrosinase ( an enzyme found in all brassica which converts glucosinolates to active isothiocyanates ) over a period of 7 days . extracts contained 25 mol glucosinolate , 100 mol glucosinolate , or 25 mol isothiocyanate . the second safety trial was a double - blind controlled clinical trial in 76 subjects , ages 339 . thirty - eight subjects had a reported mustard allergy , and 38 age- and gender - matched controls suffered from dust - mite allergy but had no mustard allergy . of the 38 patients , 14 had a positive mustard challenge , of which 12 had oral allergy syndrome ( pruritus , mild angioedema of lips , tongue , and throat ) , 1 had more severe angioedema with bronchial asthma , and 1 had systemic anaphylaxis . it is important to mention that of the 38 patients , 35 were atopic ( including rhinitis , and/or bronchial asthma , atopic dermatitis ) . the last four safety trials were all single - case experimental design trials ( sced ) . the first was a trial in 10 healthy subjects , ages 2130 , which strived to determine the effect of cruciferous vegetables on phenacetin and antipyrine metabolism . subjects started by consuming a control diet for 13 days , after which they were placed on a diet containing 300 g / day of brussels sprouts and 200 g / day of cabbage over a period of 7 days , and finally returned to the control diet for the last 10 days . in parallel , every morning the subjects were given either 900 mg of phenacetin or 1.8 mg / kg of antipyrine . researchers found that the cruciferous diet enhanced the phenacetin metabolism in the gastrointestinal tract and/or during its first pass in the liver , increasing its rate of elimination . it is worth noting that the us food and drug administration ordered the withdrawal of drugs containing phenacetin in november 1983 , owing to its carcinogenic and kidney - damaging properties ( federal register of october 5 , 1983 ( 48 fr 45466 ) ) . the second sced trial included 10 healthy subjects , ages 2335 , and aimed to determine the effect of cruciferous vegetables on acetaminophen and oxazepam metabolism . subjects started by consuming a control diet for 10 days , after which they were put on a diet containing 300 g / day of brussels sprouts and 200 g / day of cabbage over a period of 10 days , and finally returned to the control diet for the last 10 days . in parallel , every morning the subjects were given either 45 mg of oxazepam or 1500 mg of acetaminophen . the mean plasma concentrations of either drug were measured at different intervals after administration , and a 24 h urinary recovery of conjugates was performed . researchers found that the cruciferous diet enhanced the acetaminophen metabolism and glucuronide conjugation ; however , they mention that the decreased levels of cysteine conjugate in urine actually indicate reduced toxicity . no changes in oxazepam metabolism the third safety sced trial included 10 healthy subjects , ages 2240 ; the goal of this study was to determine the effect of a diet rich in brussels sprouts on warfarin metabolism . subjects consumed their customary diets for 3 days and were then instructed to consume 400 g / day of brussels sprouts for the next 18 days . warfarin administration ( 20 mg ) was provided twice on days 1 and 18 . mean plasma concentrations of warfarin were measured at different time periods , as well as prothrombin activity , and clearance rates were calculated . the last safety sced trial included 6 subjects , ages 2038 , with a history of recurrent allergic reactions to consumption of raw cabbage . this study aimed to determine the sensitivity profile of such patients to other cruciferous vegetables ( cauliflower , mustard , and broccoli ) , as well as to cooked versus raw cabbage . skin prick tests were performed for a variety of allergens ; later , food challenges were performed with cooked cabbage , and levels of cabbage - specific ige were measured in patients ' sera . all patients were found to be atopic ( 5 with allergic rhinitis ) ; all had positive skin prick tests to mugwort ( artemisia vulgaris ) pollen and other aeroallergens ( for instance , pollen of plants from the genera parietaria and olea ) , and 5 had positive skin prick tests to hazelnuts , walnuts , and peanuts . the nonsafety trials [ 2430 ] included 2 rcts , 4 controlled clinical trials , and 1 single - case experimental design trial , of which only one identified adverse events . the trial which reported the adverse events was a controlled clinical trial in 18 subjects , ages 2.561 , who suffered from recurrent respiratory papillomatosis and underwent complete surgical removal . all subjects received oral indole-3-carbinol supplementation for a period of 924 months in order to examine whether the supplements reduced the occurrence of the papillomas . doses were 200 mg twice a day for adults , and individually calculated for pediatric patients based on body weight . adverse events were reported in 3 patients : 1 adult , who was receiving a higher dose ( 400 mg twice a day ) for 10 days according to the researchers ' recommendation , suffered from imbalance and tremor and 2 girls , 2.5 and 12 years old , who took an overdose by mistake , suffered from unsteadiness and nausea . the symptoms in the adult resolved after returning to original dose and resolved spontaneously in the girls within a few hours to a day . according to the authors , the supplement did not cause any other side effects or complications ( including acceleration of the disease ) and was generally well tolerated . it is unclear from this paper which other medications these specific individuals were taking , and whether they had any other acute health conditions which may have contributed to the adverse events described . all other non - safety trials reported no adverse events with oral consumption of broccoli sprout infusion / homogenate , mustard oil , cauliflower leaves powder or indole-3-carbinol supplements , or with topical application of broccoli sprouts extract [ 2530 ] . these studies included both adult and pediatric populations , whose concurrent medical conditions included none ( healthy ) , nutritional deficits ( haemoglobin and retinol ) , recurrent respiratory papillomatosis , and acute myocardial infarction ( table 2 ) . thirteen observational studies were included , reporting adverse events related to cruciferous plants in 1,247 patients [ 3143 ] . seven of them were cohort studies , 3 were case - control studies , 2 were cross - sectional studies , and 1 was a qualitative survey ( table 3 ) . three cohort studies , one case - control study , and one cross - sectional survey examined prevalence of allergic reactions to oilseed rape [ 3135 ] . in the first cohort , 7/1478 subjects who were naturally exposed to oilseed rape had either a positive skin test , a positive radio - allergosorbent test , or nasal sensitivity in response to oilseed rape exposure , whereas the proportion of such allergic reactions was 14/37 in those who were occupationally exposed to oilseed rape . in the second cohort , only 147/4468 subjects with suspected oilseed allergy showed positive skin prick test to oilseed rape ; most of the subjects in this study were allergic to a variety of other antigens . in the third cohort , 12/22 village residents reported increased allergic symptoms during a year when oilseed rape surrounded the village , compared with a year when another crop surrounded the village . however , authors mention that the symptoms reported did not correlate with oilseed rape pollen levels measured . they were therefore not sure what the true cause could be . in a case - control study , 37 people complained of seasonal allergic symptoms and bronchial reactivity in response to an unknown allergen , of whom 23 were tested . however , only 2 were found to be allergic to oilseed rape and only 10 ( including those 2 ) were found to be atopic . the authors concluded that the symptoms could not be attributed to oilseed rape in most of these cases of seasonal allergy . in the cross - sectional survey , 683/869 of village residents who were exposed to oilseed rape complained of seasonal cough , wheeze , and headaches . however , the authors concluded that the proportion of people who suffered from such symptoms was not much higher in subjects living in close proximity to oilseed rape in comparison to control subjects who do not ; this suggests that the seasonal symptoms in rural areas can not be attributed to oilseed rape allergy alone . yet another observational study dealing with allergic reactions was a cohort in 259 individuals with suspected contact allergy to foods containing allyl - isothiocyanate . of 259 subjects who underwent allergy skin tests , 43 had a questionable reaction , of whom 15 had irritation and 3 had follicular reaction . the first was a cohort study in 64,327 women in japan , ages 4079 , which examined the possible connection between dietary habits and risk of ovarian cancer death , based on food - frequency questionnaires . whereas no adverse events were reported with consumption of cabbage or green leafy vegetables , a positive association was established between moderate - high consumption of chinese cabbage and ovarian cancer . the authors suggest that this might be attributed to the fact , that , in many cases , chinese cabbage is eaten pickled , as pickled food was proven to increase the risk of cancer . the researchers did not adjust for total energy consumption , or for comalignancies such as breast / endometrial cancer ; the first is important as several studies found an association between total energy consumption and increased risk for various types of cancer [ 38 , 39 ] . the latter is crucial , as many women with a history of such comalignancies are at a higher risk of developing ovarian cancer than the general population [ 40 , 41 ] . the second suggested a connection between cruciferous vegetables and cancer in a case - control study from kuwait in which 313 thyroid cancer patients were paired with age- and gender - matched controls ; the study 's aim was to examine the relationship between different sociodemographic , medical or dietary factors and thyroid cancer , based on questionnaires . whereas no adverse events were associated with broccoli consumption , a nonstatistically significant positive association was established between moderate - high consumption of cauliflower or cabbage and thyroid cancer ( p = 0.08 and p = 0.16 , resp . ) . the authors conclude that no clear association between consumption of cruciferous vegetables and thyroid cancer could be established . the last study bringing up a possible association between cruciferous vegetable consumption and cancer is a case - control study which paired 246 thyroid cancer patients from sweden and norway with 440 age- and gender - matched controls . the goal of the study was to evaluate the relationship between certain dietary habits and the risk of follicular and papillary thyroid carcinomas . with regard to cruciferous vegetables , researchers found that for people who , at any time , resided in areas of sweden where goiter and iodine deficiency were endemic until the 1960 's , there was an increased risk for thyroid cancer with consumption of cruciferous vegetables . authors suggest that this dual effect might be related to interactions between cruciferous vegetables and other food components such as iodine . they also expressed surprise , as their findings stood in contradiction to those of many research groups that found a protective effect of cruciferous vegetables against thyroid cancer [ 4851 ] . the next observational study included in our paper was a cross - sectional study which aimed to determine the association between broccoli consumption and chronic atrophic gastritis in 438 men , ages 3960 years . the authors found that consumption of broccoli once or more weekly increased the risk for chronic atrophic gastritis , based on serological tests for pepsinogen i and ii . however , the authors acknowledge some major drawbacks to their work . first , h. pylori infection , which increases the risk for chronic atrophic gastritis , was not measured . second , serologic criteria were used for diagnosis , meaning that the results were prone to measurement errors . moreover , it is unclear whether the changes in enzyme profiles were accompanied by any clinical manifestations . the last observational study reporting adverse events was a qualitative survey which examined the relationship between consumption of certain foods by breast - feeding mothers , and the appearance of colic symptoms in their babies ( 4 months old or younger ) . the survey conductors found a positive association between consumption of cruciferous vegetables ( cabbage , cauliflower , and broccoli ) and colic symptoms : abdominal pain , irritability , and intense crying . this study exhibited several major limitations : first , all determinants of colic symptoms , as defined by the authors ( intense crying , irritability , and abdominal pain ) can be subjected to subjective interpretation ; the diagnosis of infantile colic , as established over 50 years ago , requires a healthy baby to exhibit periods of intense , unexplained fussing / crying lasting more than 3 hours a day , more than 3 days a week for more than 3 weeks . in the study , however , no such objective temporal requirements were defined ; any presentation of the symptoms , regardless of duration , was considered to constitute colic . furthermore , since the questionnaire was administered over the course of one week only , instead of the 3 weeks which are required for diagnosis of colic , it is doubtful whether such diagnosis can be made at all . moreover , since food intake and colic symptoms were reported only for a week , it is hard to establish proper temporal relationships between the two . two cohort studies included in our paper identified no adverse events with exposure to cruciferous plants or their constituents ; the first study included 12 subjects who ingested 57 mg / kg / day of indole-3-carbinol . the second study , which followed 27,111 male smokers over a period of 12 months , attempted to discover whether intakes of fruits , vegetables , carotenoids , or vitamins a , e , or c could be associated with risk of bladder cancer in these people . the study determined that no association between bladder cancer risk and chronic consumption of cruciferous vegetables could be established . twenty - four case reports were included in the review , reporting adverse events in 35 individuals . the patients ranged from 17 to 70 years of age , whose concurrent medical conditions included allergies , both to cruciferous plants and to a variety of other allergens , asthma , bronchitis , atopy , cardiovascular diseases , and different skin conditions ( eczema , pruritus , eryhtema , dermatitis , dryness and scaling , and blisters ) ( table 4 ) . the adverse events occurred after topical , respiratory , or oral exposure to different cruciferous plants , their constituents , or their derivatives . twenty - one case reports reported allergic or hypersensitivity reactions in 31 individuals , including allergic contact dermatitis / contact urticaria , contact hypersensitivity , aggravation of eczema , cutaneous lesions similar to pityriasis rosea , asthma , rhinoconjunctivitis , aggravation of cough and chest pain , local swelling and itching , and anaphylaxis . the suspected agents triggering these reactions were turnip seeds , cabbage , broccoli , oilseed rape ( flour or pollen ) , cauliflower , mustard ( a variety of preparation forms ) , isothiocyanates in paint , and diplotaxis erucoides ( brassica erucoides ) pollen . it is important to note that 18 of the individuals ( approximately 50% of total ) had previous risk factors such as atopy , allergies to allergens unrelated to cruciferous plants ( for instance , grasses , dust mite , nuts ) , different skin conditions , or asthma . furthermore , 12 of those people had been exposed to the allergens occupationally , for chronic periods of time , presumably leading to the adverse events [ 5373 ] . the first patient had a prosthetic aortic valve and a history of myocardial infarctions with prolonged prothrombin time . the second had pulmonary embolism , and the third suffered from an unspecified cardiovascular disease . the adverse event in the first patient was attributed to excessive consumption of lettuce and greens ( turnip , mustard greens , broccoli ) ; the patient was a 35 years old woman who intended to lose weight by consuming only the above - mentioned foods , which led to a consumption of 6000 g / day of vitamin k ( 60 times higher than the recommended consumption ) . after 5 weeks of dieting , she felt substernal chest pain and was referred to the hospital , where a myocardial infarction was diagnosed . the second and third cases were attributed to chronic consumption of up to 450 g / day of broccoli ; one of them required treatment with coumadin . all three cases ended up in full resolution of adverse events and a recommendation to restrict consumption of vitamin k - rich foods [ 74 , 75 ] . the last case report reported a suspected toxic irritative dermatitis ( nonallergic ) in an individual who applied a home - made mustard wrap in order to relieve the symptoms of bronchitis ; authors believe the wrap may have contained some toxic compounds and concluded that the reaction was not an allergic one . hence , they advised against the use of home - made wraps . this case was very brief and lacked a great deal of information regarding previous medical history and whether other medications had been used to treat the patient 's bronchitis . of the 317 papers excluded , 280 did not fulfill the criteria for our systematic review ( i.e. , they did not evaluate adverse effects or lack thereof , intervention or substance exposure did not include cruciferous plants , or did not present original data ) . another 37 articles were excluded since they dealt with toxic oil syndrome . in order to promote transparency in our decision - making process toxic oil syndrome is the name given to a disease outbreak in spain in 1981 . its first appearance was as an acute lung disease , which was followed by a range of other chronic symptoms affecting the lungs , the liver , the kidneys , the skin , the joints , the central nervous system , and the immune system [ 7783 ] . the cause for the disease was traced to the consumption of cheap , refined , rapeseed oil that had been intended for industrial use rather than for human consumption . olive oil and was therefore used for cooking . according to the world health organization , toxic compounds derived during the refinement process , used to remove the aniline and to denature oils intended for industrial use , were responsible for causing the disease . hence , toxic oil syndrome has come to be considered a chemical incident , rather than a side effect associated with consumption of rapeseed oil , since consumption of non - industrial rapeseed oil does not cause the disease . in fact , the specific refinement process of the oil that caused the disease was so unique that experimental studies performed in a variety of laboratory animals have hitherto failed to reproduce the symptoms of human toxic oil syndrome . research conducted in the last decade supports the notion that some cruciferous plants and their derivatives may serve to prevent or attenuate several medical conditions . to further this field of investigation , we conducted this systematic paper to determine the safety parameters surrounding the use of cruciferous plants . in this regard , our review identified adverse events in 1335 individuals , out of a total of 101,198 individuals who were included in all studies . of these , 1292 adverse events were ranked as only possibly or unlikely to be caused by cruciferous plants . only 43 were determined to have been certainly or likely caused by exposure to cruciferous plants . adverse events , which could certainly or likely be attributed to members of the brassica genus , included allergic reactions ( including anaphylaxis ) , changes in metabolism of acetaminophen , phenacetin and warfarin , and warfarin resistance . most adverse events reported in our paper were allergic or hypersensitivity reactions ; however , their significance for the general healthy population is hard to infer , due to confounding medical histories or low causality ratings . adverse events from both allergy trials and case reports were mostly in individuals who suffered from atopy , allergies to cruciferous plants and/or other allergens ( for instance , grasses , ragweed , dust mite , pollen , dogs , cats and different fruit and nuts ) , asthma , or a variety of skin conditions such as eczema , pruritus , erythema , dermatitis , dryness and scaling , or blisters . a possible conclusion from these case reports , however , is that occupational exposure to brassica plants may predispose to develop an allergy to these plants . with regards to observational studies which investigated allergies to cruciferous plants or their derivatives , all concluded that the cases could not be attributed to the suspected culprits . a second category of adverse events included changes in metabolism of phenacetin , acetaminophen , and warfarin . while phenacetin has been banned for use by the fda , acetaminophen and warfarin continue to be widely used . as such , it was important to understand if these changes in metabolism pose any risk to those who use these drugs . as for acetaminophen , the authors explain that the decreased levels of the cysteine conjugate of acetaminophen found in subjects ' urine actually indicate decreased toxicity ; thus , cruciferous plants may not pose any risk to individuals who consume acetaminophen . with regards to warfarin , however , the finding that cruciferous vegetables alter its metabolism might bear greater clinical relevance . it has been suggested that foods high in vitamin k , such as cruciferous vegetables , may interact with warfarin and its anticoagulant activity . in all case reports describing warfarin resistance , the patients had consumed very large amounts of cruciferous vegetables ( up to 450 g / day or the equivalent of 6000 g vitamin k / day ) , amounts not warranted for consumption by the general population . however , it is possible that lower doses would have some effects on anticoagulation as well . similarly large amounts of cruciferous vegetables ( 400 g / day ) were given to subjects in the sced trial which examined changes in warfarin resistance . as many foods interact with warfarin , among which are mango , avocado , fish oil , soy milk , and foods high in vitamin k , it is imperative for physicians to discuss the consumption of such foods ( including cruciferous vegetables ) with their patients when starting treatment with anticoagulants . reports of other types of adverse events identified in our systematic review , including cancer , chronic atrophic gastritis , infantile colic , and toxicity - related events , could only be ranked as possibly or unlikely to be caused by exposure to cruciferous plants , as there was not enough evidence to establish a stronger causal relationship between the suspected culprits and the adverse events . further research employing better methodology should be undertaken in order to establish whether positive association exists between consumption of brassica vegetables and any of the above - mentioned adverse events . finally , a number of studies did not find any adverse events associated with consumption of cruciferous plants or their derivatives in subjects with a variety of health conditions , including history of myocardial infarction , nutritional deficits , or recurrent respiratory papillomatosis , or in healthy individuals . in summary , to date , adverse events presumably related to cruciferous plants have been reported in 1335 individuals , identified through 50 studies which included a total of 101,198 individuals . however , the number of those which were certainly / likely caused by brassica plants ( including allergic reactions , changes in drug metabolism , and warfarin resistance ) was much lower : only 43 of all reported adverse events received such high causality rating . for comparison , the literature shows that the pooled prevalence of adverse drug reactions ranges from 4.2 to 6% . this frequency , if applied to cruciferous plants , would translate into 42506072 reports of adverse events out of the included 101,198 individuals , a value much higher than what was found in our current study . when analysing our findings , one must bear in mind that the total number of individuals included in all studies comprises both those who were definitely exposed to brassica plants and those who were presumptively exposed as the degree of exposure could not be ascertained in all cases . this might cause the frequency of occurrence of adverse events to appear lower than the actual value . on the other hand , our study also included case reports of individuals , all of whom were exposed , and reported adverse events . in this regard , the frequency of adverse events tends to be an overestimation , since individuals who are exposed , but do not experience an adverse event , are likely not to report . hence , the inclusion of these case report , in which essentially all individuals exposed report adverse events , may serve to balance this underestimation . we advise the reader to treat the broad pooled frequency presented in the previous paragraph ( 1335/101,198 ) as merely gross estimations of the actual frequency , as conducting a meta - analysis per se was deemed inappropriate given the heterogeneity of study parameters ( subjects , interventions , clinical outcomes , and study designs ) . however , individuals with known allergies / hypersensitivities to a certain member of the brassica genus , or those taking warfarin , should consult with their physician before consuming such vegetables . in the future , if cruciferous derivatives are to be investigated as potential therapeutic agents , we recommend that adverse events be monitored . as our findings reflect positively on the safety of brassica plants in humans and evidence from the current experimental literature of their benefit in certain disease states , we would encourage further exploration of their potential use in the clinical setting . the use of brassica or similar food products may have the potential to provide a safer alternative for the treatment of disease in comparison to current pharmaceutical interventions .
some cruciferous plants may serve as preventive treatments for several medical conditions ; our objective was to systematically investigate their safety in humans . four electronic databases were searched , and , of 10,831 references identified , 50 were included . data were extracted by two independent reviewers , whereafter the association between interventions and adverse events was assessed . adverse events in 53 subjects were identified through clinical trials ; of these , altered drug metabolism was rated as certainly / likely caused by cruciferous plants . adverse events in 1247 subjects were identified through observational studies , of which none received high causality ratings . adverse events in 35 subjects were identified through case reports , of which allergies and warfarin resistance were rated as certainly / likely caused by cruciferous plants . we conclude that cruciferous plants are safe in humans , with the exception of allergies . individuals treated with warfarin should consult their physician . further investigation of uses of cruciferous plants in preventative medicine is warranted .
ewing 's sarcoma is a rare mesenchymal malignancy which is histologically similar to primitive neuroectodermal tumors ( pnets ) . the extraosseous / intracranial form of ewing 's sarcoma tumors is particularly rare , and often presents in the pediatric population . particular care must be taken to distinguish the two malignancies in the differential diagnosis , as the treatment approach for each varies . in this report , we present the case of a middle - aged male patient with refractory intracranial ewing 's sarcoma treated at our institution with vorinostat , etoposide , and bevacizumab . a 50-year - old man developed severe headache with diplopia , right - sided hearing loss , and tinnitus . mri of the brain revealed mild hydrocephalus and a cystic mass in the posterior third ventricle . he sought the opinion of 5 independent neurosurgeons , 4 of whom recommended resection or biopsy . after 5 years , a cystic mass was noted again with some enlargement , and the area of enhancement had decreased in size . due to his daughter 's diagnosis of neuroblastoma and subsequent treatments , he did not pursue further evaluation until 4 years later , when he developed severe right hip and lower back pain . six months later , brain and spinal mri showed increased size of the pineal mass as well as a 1.5-cm mass located at l5s1 along the lumbothoracic spine , radiologically consistent with leptomeningeal dissemination . histopathological diagnosis of the tumor at that time was felt to be consistent with pnet , likely pineoblastoma . per our review of records from that time , cytological analysis of the cerebrospinal fluid ( csf ) was not performed peri - operatively . he was subsequently treated with induction chemotherapy with cyclophosphamide , followed by autologous stem cell transplant . the reason for treating with cyclophosphamide as opposed to standard combination chemotherapy was patient preference in light of his underlying hearing loss . he was then treated with radiation to the entire craniospinal axis to a total radiation dose of 3,600 cgy administered over 24 fractions , followed by a boost to the lower spine ( t11s3 ) . however , after several more months the patient was noted to have weight loss , diminished appetite , and lethargy , which gradually improved . he was started on isotretinoin ( accutane ) and continued this medication for 5 months . mri revealed recurrence of the malignancy in the form of a small residual pineal mass , which was deemed unresectable by surgical consultants . this finding was best visualized on t1 coronal imaging with gadolinium contrast ; enhancement was seen at the pineal gland mass abutting the tectum of the midbrain ( fig . lumbar spine mri showed multiple areas of linear enhancement best noted on an axial t1 image with gadolinium contrast and fat saturation , with enhancement seen at the cauda equina ( fig . these findings were consistent with progression of disease and new drop metastases . of note , , nearly 11 years had elapsed from the time of initial diagnosis and approximately 5 years from his initial surgery . recommendations at other institutions included temozolomide in combination with oral etoposide ; cisplatinum , lomustine ( ccnu ) , and vincristine ; or procarbazine with lomustine and vincristine ( pcv regimen ) . his medical history was only notable for right - sided hearing loss and tinnitus of undetermined etiology ; he had presented with these symptoms shortly before initial diagnosis 11 years prior . family history was significant for a daughter who died of neuroblastoma at age 9 , as well as a sister diagnosed with melanoma at age 41 ; another sister with breast cancer had been diagnosed in her early forties . his neurologic and physical exams were unremarkable aside from his bilateral hearing loss , for which he required hearing aids . upon presentation to our institution , the initial tumor sample from the laminectomy 5 years prior was re - examined by our neuropathology team . microscopic examination of the biopsy showed a solid proliferation of small , round , blue cells with scant cytoplasm . in light of findings possibly consistent with a rare intracranial form of ewing 's sarcoma rather than pnet , further analysis was performed to revisit the initial diagnosis . by immunohistochemistry fluorescence in situ hybridization ( fish ) testing confirmed rearrangement involving the ewsr1(22q12 ) gene region as detected by break - apart signals ( fig . the diagnosis of a neuroectodermal neoplasm consistent with ewing 's sarcoma was made . in consideration of the patient 's pre - existing bilateral hearing loss and strong desire to avoid any debilitating peripheral neuropathy , we recommended a non - platinum - containing 28-day regimen consisting of the following drugs : etoposide ( vp-16 ) at 100 mg oral for 21 days on/7 days off ; vorinostat ( zolinza ) 400 mg oral daily on a 7-days - on/7-days - off schedule ; and bevacizumab 10 mg / kg iv every 2 weeks . eight weeks after initiation of this regimen , brain mri was performed and was consistent with significant radiographic response of his disease at the level of the pineal gland with no evidence of change in the spinal images . t1 coronal mr images of the brain with gadolinium contrast demonstrated reduction in enhancement seen at the pineal gland mass abutting the tectum of the midbrain ( fig . a sagittal t1 mr image of the lumbar spine with gadolinium contrast revealed no significant change in enhancement ( fig . the patient continued this treatment regimen for a total of 16 months with no evidence of radiographic or clinical progression . during the treatment course , primary toxicities included diarrhea ( grade 1 ) and fatigue ( grade 1 ) . despite these toxicities , he was able to main an active work schedule and good quality of life . at 17 months into his current treatment regimen , the patient was found to have new disease at the right cranial nerves vii and viii in the right internal acoustic canal along with new disease in the thoracic spinal cord and cauda equina . salvage therapy was started consisting of metronomic temozolomide 50 mg / m with bevacizumab 10 mg / kg i.v.q . the ewing 's sarcoma family of tumors is a rare group of primary tumors of mesenchymal origin which includes axial ewing 's sarcoma as well as pnet . extraosseous / intracranial ewing 's sarcomas are even rarer , occurring nearly exclusively in the pediatric population . reported cases of extraskeletal ewing 's sarcoma of the spine in the pediatric [ 1 , 2 , 3 ] and adult [ 1 , 4 , 5 ] populations have been documented . there are even fewer case reports of ewing 's sarcoma occurring in the intracranial cavity [ 4 , 5 , 6 , 7 , 8 ] , and even then those cases occurred in children . the rarity of this malignancy , in combination with the unusual presentation and location of our adult patient 's tumor , contributed to the difficulty in making the histopathological diagnosis . while pnets are similar in appearance to ewing 's sarcoma cells morphologically , the importance of making a firm distinction between the two is underscored by their varied biologic behavior , responses to different modes of treatment , and clinical prognosis . in this case , the diagnosis of pnet was made following confirmation of cd99 immunostaining and presence of the11;22 ews - fli1 chromosomal translocation . extraskeletal ewing 's tumors are composed of malignant small , round cell tumors with chromosomal aberrations involving ews1 or ewsr1 on chromosome 22q12 . the most common result is fusion of ews with fli1 a member of the ets gene family on chromosome 11q24 which is homologous to murine friend 's leukemia . this fusion results in the characteristic t(11;22)(q24;q12 ) chromosomal translocation and ets transcription factor which is present in up to 80% of such cases . the cell surface glycoprotein cd99 ( mic2 ) is strongly expressed in ewing 's sarcoma and aids in the diagnosis , as does positive staining for vimentin . the absence of glial fibrillary acidic protein and synaptophysin helped to rule out glial tumors and neural tumors , respectively , as the cause of the primary brain malignancy . published case series or reports of intracranial or spinal ewing 's sarcomas have documented treatment using a variety of approaches , including combinations of vincristine , doxorubicin , cyclophosphamide , actinomycin - d , followed by either radiation , or carboplatin and etoposide leading to autologous stem cell transplant ; vincristine , doxorubicin , ifosfamide , and actinomycin - d concurrent with radiation ; cyclophosphamide , vincristine , and doxorubicin concurrent with radiation ; or vincristine , cisplatin , cyclophosphamide with radiation , with generally poor results . at our institution , pediatric patients ( < 10 years old ) have previously been treated with a total of 6 cycles of vincristine , cyclophosphamide , and doxorubicin alternating with ifosfamide and etoposide , as well as either focal or craniospinal irradiation , with more promising results . alkylating agents have traditionally formed the backbone of treatment for ewing 's sarcomas , while platinum - based chemotherapy is the basis of treatment of pnets ; thus it is important to distinguish between the 2 entities . furthermore , it has been suggested that the natural history and prognosis for intracranial ewing 's sarcoma may be more favorable than that of central pnets , although the information is limited due to the rarity of this disease . histone deacetylase ( hdac ) inhibitors have gained favor as a new approach to targeted therapy of various forms of cancer in the past few years . no published clinical trials have yet demonstrated the utility of this class of drug in ewing 's sarcomas , although there is preclinical evidence that hdac inhibitors inhibit expression of the ews - fli1 protein in vitro . valproate , an anti - epileptic and weak hdac inhibitor , has been shown to improve survival in patients with glioblastoma undergoing treatment with concurrent temozolomide and radiation . inhibitors of vascular endothelial growth factor ( vegf ) have also been considered as a potential therapy for ewing 's sarcomas . preclinical models have demonstrated the ability of such inhibitors , including bevacizumab , to significantly delay tumor growth in animal models . furthermore , higher levels of vegf in resected specimens from patients correlates with higher 10-year relapse - free and overall survival , indicating that the natural course of the disease is at least somewhat favorable independent of treatment . while our patient 's disease did eventually recur on this regimen , this combination of vorinostat with oral etoposide and bevacizumab did provide some control of his leptomeningeal disease . this presents a potential alternative approach for pediatric and adult patients with this rare diagnosis .
the ewing sarcoma family of tumors comprises a rare class of cancers of mesenchymal origin . cases of ewing 's sarcoma in the central nervous system specifically , intracranial ewing 's are extremely rare . almost all reported cases have occurred in children . however , this rare presentation can also occur in the adult population . it is important to distinguish these tumors from primitive neuroectodermal tumors at the time of diagnosis . testing for ewsr1(22q12 ) gene rearrangement using fluorescence in situ hybridization is a useful tool for making the distinction between these 2 similar but distinct entities . we present here the case of a middle - aged male patient with intracranial ewing 's sarcoma , and discuss diagnostic challenges and potential new treatment approaches for this rare disease .
estimates of health - state utility ( hsu ) are an integral part of an analysis of the cost - effectiveness of a new therapy . utility values are typically sourced either from a clinical study or from the published literature , using a validated generic preference - based multiattribute utility instrument , such as euroqol ( eq)-5d . where utility estimates relevant to the decision problem are not available directly from a clinical study or from the literature , it may be possible to use a mapping algorithm to translate scores recorded on a disease - specific instrument , such as functional assessment of cancer therapy ( fact ) , into a utility value using a generic measure , such as eq-5d . the purpose of this research was to identify and apply possible mapping algorithms that could be used to estimate hsu values ( hsuvs ) for use in an economic model from fact data collected in a phase ii trial of olaparib as maintenance therapy in patients with platinum - sensitive ovarian cancer.1,2 olaparib is an oral poly(adenosine diphosphate - ribose ) polymerase inhibitor that has been investigated as a maintenance treatment for women with platinum - sensitive relapsed serous ovarian cancer ( psroc ) who have received two or more courses of chemotherapy and shown objective response to their last chemotherapy.1,2 in a phase ii randomized , double - blind , placebo - controlled study ( nct00753545 ) , olaparib capsules ( 400 mg twice daily ) significantly improved progression - free survival ( hazard ratio 0.35 , 95% confidence interval [ ci ] 0.250.49 ; p<0.0001 ) , and had no observed detrimental effects on health - related quality of life ( hrqol).3 the safety profile of olaparib was considered appropriate for long - term maintenance therapy.2 in the olaparib study , hsu was not measured directly . hrqol was measured using the fact ovarian ( fact - o ) questionnaire.1,2 fact - o is a 39-item questionnaire that includes a general measure of qol , fact general ( fact - g ) , and an ovarian cancer subscale.4 both fact - g and fact - o are validated patient - reported instruments that have been used extensively in cancer trials.4 literature evidence on the hsuv of patients with psroc is limited.5 only two clinical trials have reported hsuv in ovarian cancer.6,7 both trials reported hsuvs from patients actively receiving chemotherapy . only one trial reported hsuvs in patients with psroc.8 these data may not adequately represent the hsuvs of patients eligible for maintenance therapy , given that patients in these clinical trials have recurrent disease requiring immediate chemotherapy , while patients eligible for maintenance therapy have successfully completed chemotherapy and achieved a complete or partial response . in addition , there may be differences in the tolerability profile of treatments given at the time hsuv is measured . previous studies have demonstrated the use of mapping algorithms to generate hsuvs from fact - g.9,10 the objectives of this retrospective analysis were to generate hsuvs from fact data collected in nct00753545 , and to explore the associations between hsuvs and clinical events occurring in the study , with the purpose of generating hsuvs for an economic evaluation of olaparib maintenance therapy . the analysis was conducted in three phases : 1 ) identification of algorithms , 2 ) comparative appraisal of algorithms , and 3 ) modeling the association between hsuvs and clinical events in nct00753545 . relevant mapping algorithms were identified from a previously reported systematic review of hrqol studies in ovarian cancer conducted in 2014,5 and hand - searching the health economic research centre ( herc ) online database of hsuv - mapping studies.11 further detail on the review methodology is provided in supplementary materials . the hand - searching of the herc database focused on algorithms that mapped fact - o or fact - g to hsuvs . the criteria for selecting the preferred algorithm included a comparative assessment of goodness - of - fit statistics and a comparison of the characteristics of patients in nct00753545 with the populations sampled to develop each algorithm . the goodness - of - fit indicators included prediction of mean , standard deviation , median , and range of values from the original mapping survey , alongside adjusted r and mean absolute error statistics . for each algorithm , a mean overall rank was calculated , with the best - performing algorithm having the lowest overall rank score . all algorithms identified in the search were applied to the fact - o or fact - g data collected in nct00753545 . fact data were collected at screening and at regular 4-weekly scheduled visits up to discontinuation of study drug.1 data included in the mapping data set included : randomization group , breast cancer antigen mutation ( brcam ) status , adverse events ( aes ; graded using the common terminology criteria for adverse events ) , progression - free survival , time to first subsequent therapy following discontinuation of study treatment , and time to discontinuation of study treatment.1,2 the relationship between events and hsuvs was established by identifying fact - o questionnaires collected within 7 days of a clinical event , including data collected at the time of an ae . a 7-day period was selected , because fact - o requires respondents to evaluate their well - being over the previous 7 days.4 analyses were conducted on the intention - to - treat ( itt ) , germ - line brcam , and brcam ( germ - line and somatic mutation ) populations . summary statistics were generated for each of the four sets of hsuvs derived using the algorithms , and for each period of the study ( screening , scheduled routine assessments every 28 days , and unscheduled assessments ) . all statistical analyses were conducted using the statistical software r.12 statistical differences in the four sets of hsuvs were assessed using the concordance correlation coefficients ( cccs ) , pearson ccs ( pccs ) , and a comparison of mean values using a paired t - test . cccs and pccs greater than 0.72 represented good agreement among hsuvs.9 statistical significance was set at the 5% level . a 0.06-point change was considered to be a minimally important difference ( mid ) in eq-5d , based on a study reporting a retrospective analysis of eq-5d data collected from a sample of 534 cancer patients , including patients with ovarian cancer.13 linear mixed - effect regression models were used to estimate the relationship between hsuvs and time since randomization , brcam status , randomization group , and clinical events . an initial analysis was conducted using single - variable regression models to identify individual factors associated with changes in hsuv , and a multivariable regression model was then developed to predict hsuvs . the factors included in the multivariable model were selected from the results of the single - variable analyses , and by application of a backward stepwise selection method using the akaike information criterion ( aic ) to exclude irrelevant factors . repeated measures of hsuvs were modeled using the random - effect component of the regressions . a series of correlation structures were assessed , with the lowest aic used to select the appropriate structure . the variance covariance matrix for the multivariate regression model is reported in supplementary materials . relevant mapping algorithms were identified from a previously reported systematic review of hrqol studies in ovarian cancer conducted in 2014,5 and hand - searching the health economic research centre ( herc ) online database of hsuv - mapping studies.11 further detail on the review methodology is provided in supplementary materials . the hand - searching of the herc database focused on algorithms that mapped fact - o or fact - g to hsuvs . the criteria for selecting the preferred algorithm included a comparative assessment of goodness - of - fit statistics and a comparison of the characteristics of patients in nct00753545 with the populations sampled to develop each algorithm . the goodness - of - fit indicators included prediction of mean , standard deviation , median , and range of values from the original mapping survey , alongside adjusted r and mean absolute error statistics . for each algorithm , a mean overall rank was calculated , with the best - performing algorithm having the lowest overall rank score . all algorithms identified in the search were applied to the fact - o or fact - g data collected in nct00753545 . fact data were collected at screening and at regular 4-weekly scheduled visits up to discontinuation of study drug.1 data included in the mapping data set included : randomization group , breast cancer antigen mutation ( brcam ) status , adverse events ( aes ; graded using the common terminology criteria for adverse events ) , progression - free survival , time to first subsequent therapy following discontinuation of study treatment , and time to discontinuation of study treatment.1,2 the relationship between events and hsuvs was established by identifying fact - o questionnaires collected within 7 days of a clinical event , including data collected at the time of an ae . a 7-day period was selected , because fact - o requires respondents to evaluate their well - being over the previous 7 days.4 analyses were conducted on the intention - to - treat ( itt ) , germ - line brcam , and brcam ( germ - line and somatic mutation ) populations . summary statistics were generated for each of the four sets of hsuvs derived using the algorithms , and for each period of the study ( screening , scheduled routine assessments every 28 days , and unscheduled assessments ) . all statistical analyses were conducted using the statistical software r.12 statistical differences in the four sets of hsuvs were assessed using the concordance correlation coefficients ( cccs ) , pearson ccs ( pccs ) , and a comparison of mean values using a paired t - test . cccs and pccs greater than 0.72 represented good agreement among hsuvs.9 statistical significance was set at the 5% level . a 0.06-point change was considered to be a minimally important difference ( mid ) in eq-5d , based on a study reporting a retrospective analysis of eq-5d data collected from a sample of 534 cancer patients , including patients with ovarian cancer.13 linear mixed - effect regression models were used to estimate the relationship between hsuvs and time since randomization , brcam status , randomization group , and clinical events . an initial analysis was conducted using single - variable regression models to identify individual factors associated with changes in hsuv , and a multivariable regression model was then developed to predict hsuvs . the factors included in the multivariable model were selected from the results of the single - variable analyses , and by application of a backward stepwise selection method using the akaike information criterion ( aic ) to exclude irrelevant factors . repeated measures of hsuvs were modeled using the random - effect component of the regressions . a series of correlation structures were assessed , with the lowest aic used to select the appropriate structure . the variance covariance matrix for the multivariate regression model is reported in supplementary materials . four studies reporting the mapping of fact to eq-5d were identified from hand - searching the herc database of mapping studies.11 two of the four studies15,16 reported fact prostate and fact melanoma mapping . one of the fact - g studies reported two mapping algorithms ( ordinary least squares [ ols ] and tobit).17 two studies were retrieved from the systematic review.18,19 one of the studies18 was already reported in the herc database . the other19 reported fact - g to time trade - off mapping , and was not included in the database . none of the studies retrieved from the review or mapping database reported fact - o to eq-5d , and for this reason , the four fact - g mapping algorithms ( three studies ) were applied in the analysis . the four mapping algorithms were derived from data collected in three surveys that enrolled patients with a mixture of cancer types , eastern cooperative oncology group ( ecog ) performance scores , and baseline demographics.1720 the baseline age and ecog performance status of the surveyed population in longworth et al17 were broadly similar to the baseline values in nct00753545 ( 59.5 vs 57.5 years , 71.8% vs 100% with ecog status 01 ) . by comparison , the surveyed population in cheung et al18 was younger ( 49.3 years ) , and the surveyed population in dobrez et al19 had higher ecog scores at baseline ( 55.5% with ecog 01 ) than the population in nct00753545 . a varied mix of cancer types were reported in the surveyed populations ( table 1 ) . the population in long - worth et al included patients with advanced gynecological cancer who had undergone at least two prior cycles of chemotherapy.17 the surveyed population in cheung et al also included patients with advanced gynecological cancer ( 6%);18 however , exposure to past chemotherapy was not reported . none of the patients surveyed by dobrez et al had gynecological cancer.9,19 the ranking of each algorithm by goodness of fit is shown in table 2 . overall , the ols algorithm was the best fit ( mean 1.67 ) , followed by cheung et al ( 1.83 ) , tobit ( 2.40 ) , and dobrez et al ( 4.0 ) . the ols was the best - performing algorithm in predicting mean hsuv from its original surveyed population . the preferred algorithm for this analysis was longworth et al s ols,17 chosen based on its goodness - of - fit profile and the comparability between nct00753545 and the population used to derive the algorithm . all four algorithms were applied to patient - level fact - o data from nct00753545 . hsuvs were generated for 247 of the 264 patients in nct00753545 ( table 3 ) . applying the preferred algorithm ( ols ) , mean utility values in the itt population were 0.786 ( interquartile range : 0.6990.885 ) and 0.720 ( interquartile range : 0.6320.820 ) for scheduled routine and unscheduled assessments , respectively . in the brcam subpopulation , mean utility values were 0.768 ( 0.6810.871 , scheduled routine assessments ) and 0.708 ( 0.5940.811 , unscheduled assessments ) . figure 1 shows the distribution of predicted hsuv , total fact - g , and total fact - o scores . the ols and cheung et al hsuvs were left - skewed , with values clustered toward the upper limit of 1 . the tobit and dobrez et al hsuvs had a multimodal distribution , with values clustered in the ranges 0.800.85 and 0.951.00 . there was strong statistical agreement between ols and tobit ( ccc 0.915 , 95% ci 0.9070.923 ) , and ols and cheung et al ( ccc 0.851 , 95% ci 0.8380.863 ) . in comparison to dobrez et al , there was only moderate statistical agreement with ols ( ccc 0.629 , 95% ci 0.6040.653 ) and tobit ( ccc 0.619 , 95% ci 0.5930.643 ) . the results of the pcc analysis were consistent with the concordance analysis ( supplementary materials ) . between ols , cheung et al , and dobrez et al , table 4 shows the estimated coefficients for the single - variable and multivariable regression models . in the single - variable models , randomization to placebo ( versus olaparib ) and a positive brcam status were associated with lower hsuvs . the incidence of grade 1 or 2 and/or grade 3 or above aes was associated with a decline in hsuvs ( between 0.01 and 0.03 ) . the coefficients for aes and the randomization group were not statistically significant ( p>0.05 ) . there was no evidence of a time trend in the predicted hsuvs ( p=0.290 ) . of the three measures of disease progression , only discontinuation of study drug was associated with a statistically significant ( p=0.0001 ) and important ( 0.06 ) change in hsuvs . radiological disease progression was associated with a numerical decline in hsuvs of 0.023 ( p=0.065 ) , which was not considered statistically significant . there was no change in hsuvs with the use of first subsequent therapy ( p=0.792 ) . the first subsequent treatment analysis should be interpreted with caution , because only ten fact - g observations were recorded at the time of subsequent treatment . in the multivariable modeling , treatment discontinuation ( important and statistically significant predictor of hsuvs ) , aes , randomized group ( to reflect potential differences in hsuvs between groups ) , and brcam status ( statistically significant predictor of hsuvs ) were included in the stepwise algorithm . aes were included as a categorical variable ( ae grade 12 only , ae grade 3 or above only , both - grade aes , and no aes ) . radiological progression and first subsequent therapy were not considered in the stepwise algorithm to avoid multicollinearity with treatment discontinuation . in the stepwise routine , only brcam status and treatment discontinuation were included in the final model . aes and the randomized group were dropped from the regression , as their inclusion increased the aic value . treatment discontinuation was associated with an important and statistically significant decline in hsuvs ( 0.06 , p=0.0009 ) . positive brcam status was associated with lower hsuvs ( 0.03 , p=0.0511 ) , although the difference was not considered ( clinically ) important . four studies reporting the mapping of fact to eq-5d were identified from hand - searching the herc database of mapping studies.11 two of the four studies15,16 reported fact prostate and fact melanoma mapping . one of the fact - g studies reported two mapping algorithms ( ordinary least squares [ ols ] and tobit).17 two studies were retrieved from the systematic review.18,19 one of the studies18 was already reported in the herc database . the other19 reported fact - g to time trade - off mapping , and was not included in the database . none of the studies retrieved from the review or mapping database reported fact - o to eq-5d , and for this reason , the four fact - g mapping algorithms ( three studies ) were applied in the analysis . the four mapping algorithms were derived from data collected in three surveys that enrolled patients with a mixture of cancer types , eastern cooperative oncology group ( ecog ) performance scores , and baseline demographics.1720 the baseline age and ecog performance status of the surveyed population in longworth et al17 were broadly similar to the baseline values in nct00753545 ( 59.5 vs 57.5 years , 71.8% vs 100% with ecog status 01 ) . by comparison , the surveyed population in cheung et al18 was younger ( 49.3 years ) , and the surveyed population in dobrez et al19 had higher ecog scores at baseline ( 55.5% with ecog 01 ) than the population in nct00753545 . a varied mix of cancer types were reported in the surveyed populations ( table 1 ) . the population in long - worth et al included patients with advanced gynecological cancer who had undergone at least two prior cycles of chemotherapy.17 the surveyed population in cheung et al also included patients with advanced gynecological cancer ( 6%);18 however , exposure to past chemotherapy was not reported . none of the patients surveyed by dobrez et al had gynecological cancer.9,19 the ranking of each algorithm by goodness of fit is shown in table 2 . overall , the ols algorithm was the best fit ( mean 1.67 ) , followed by cheung et al ( 1.83 ) , tobit ( 2.40 ) , and dobrez et al ( 4.0 ) . the ols was the best - performing algorithm in predicting mean hsuv from its original surveyed population . the preferred algorithm for this analysis was longworth et al s ols,17 chosen based on its goodness - of - fit profile and the comparability between nct00753545 and the population used to derive the algorithm . all four algorithms were applied to patient - level fact - o data from nct00753545 . hsuvs were generated for 247 of the 264 patients in nct00753545 ( table 3 ) . applying the preferred algorithm ( ols ) , mean utility values in the itt population were 0.786 ( interquartile range : 0.6990.885 ) and 0.720 ( interquartile range : 0.6320.820 ) for scheduled routine and unscheduled assessments , respectively . in the brcam subpopulation , mean utility values were 0.768 ( 0.6810.871 , scheduled routine assessments ) and 0.708 ( 0.5940.811 , unscheduled assessments ) . figure 1 shows the distribution of predicted hsuv , total fact - g , and total fact - o scores . the ols and cheung et al hsuvs were left - skewed , with values clustered toward the upper limit of 1 . the tobit and dobrez et al hsuvs had a multimodal distribution , with values clustered in the ranges 0.800.85 and 0.951.00 . there was strong statistical agreement between ols and tobit ( ccc 0.915 , 95% ci 0.9070.923 ) , and ols and cheung et al ( ccc 0.851 , 95% ci 0.8380.863 ) . in comparison to dobrez et al , there was only moderate statistical agreement with ols ( ccc 0.629 , 95% ci 0.6040.653 ) and tobit ( ccc 0.619 , 95% ci 0.5930.643 ) . the results of the pcc analysis were consistent with the concordance analysis ( supplementary materials ) . between ols , cheung et al , and dobrez et al table 4 shows the estimated coefficients for the single - variable and multivariable regression models . in the single - variable models , randomization to placebo ( versus olaparib ) and a positive brcam status the incidence of grade 1 or 2 and/or grade 3 or above aes was associated with a decline in hsuvs ( between 0.01 and 0.03 ) . the coefficients for aes and the randomization group were not statistically significant ( p>0.05 ) . there was no evidence of a time trend in the predicted hsuvs ( p=0.290 ) . of the three measures of disease progression , only discontinuation of study drug was associated with a statistically significant ( p=0.0001 ) and important ( 0.06 ) change in hsuvs . radiological disease progression was associated with a numerical decline in hsuvs of 0.023 ( p=0.065 ) , which was not considered statistically significant . there was no change in hsuvs with the use of first subsequent therapy ( p=0.792 ) . the first subsequent treatment analysis should be interpreted with caution , because only ten fact - g observations were recorded at the time of subsequent treatment . in the multivariable modeling , treatment discontinuation ( important and statistically significant predictor of hsuvs ) , aes , randomized group ( to reflect potential differences in hsuvs between groups ) , and brcam status ( statistically significant predictor of hsuvs ) were included in the stepwise algorithm . aes were included as a categorical variable ( ae grade 12 only , ae grade 3 or above only , both - grade aes , and no aes ) . radiological progression and first subsequent therapy were not considered in the stepwise algorithm to avoid multicollinearity with treatment discontinuation . in the stepwise routine , only brcam status and treatment discontinuation were included in the final model . aes and the randomized group were dropped from the regression , as their inclusion increased the aic value . treatment discontinuation was associated with an important and statistically significant decline in hsuvs ( 0.06 , p=0.0009 ) . positive brcam status was associated with lower hsuvs ( 0.03 , p=0.0511 ) , although the difference was not considered ( clinically ) important . in this analysis , mapping algorithms were used to generate hsuvs from fact - o data collected in a phase ii study of olaparib maintenance therapy for patients with psroc . the longworth et al ols17 was selected as the preferred approach , because it was the highest - ranked on a series of goodness - of - fit indicators . a different preferred algorithm may have been selected if mean absolute error ( cheung et al ) or prediction of median hsuv ( tobit ) were the only selection criteria . reimbursement decisions are typically based on the mean results of economic evaluations , making accurate prediction of mean hsuv a desirable property . on this basis , ols was the best - performing algorithm . the selection of a preferred algorithm becomes important when there are significant differences in mean hsuv , and this was the case in this analysis . this finding is consistent with a previous comparison of hsuvs generated by fact - g mapping in patients with ovarian cancer.9 mean hsuvs generated using ols were similar to those generated using the tobit regression and lower than those generated in cheung et al18 and dobrez et al.19 between ols and dobrez et al , there was a clinically important difference in mean hsuv that was consistently observed across populations ( itt and brcam ) . these differences highlight the importance of assessing the hsuvs generated by different algorithms . in the regression modeling , treatment discontinuation was the only statistically significant ( p<0.05 ) and clinically important predictor of hsuvs . this association may be explained by the latent development of symptomatic disease , which triggers both the cessation of the study drug and decline in hsuvs . this is supported by data on the reasons for drug discontinuation in nct00753545 , where 87 of 113 olaparib patients and 110 of 125 placebo patients discontinued the drug because their condition worsened.2 the only other factor associated with a change in hsuvs was positive brcam status at baseline . there was no significant or meaningful association between aes , radiological progression , first subsequent therapy use , and hsuvs . the absence of a statistical association between radiological progression and hsuvs was unexpected , as previous analyses have reported meaningful differences between the progression phases of clinical trials.21,22 this finding has potential implications for any future economic evaluations of maintenance treatments in psroc , as it indicates that changes in hsuvs should be modeled based on treatment discontinuation and not radiological progression . despite these findings , radiological progression remains an important measure of the underlying tumor - growth rate and activity of antitumor therapy . one explanation for the lack of association between radiological progression and hsuvs is that a high proportion of patients had initially experienced asymptomatic progression , which masked the impact of progression on hsuvs . the common occurrence of asymptomatic progression is plausible in the context of nct00753545 , as the enrolled population was in disease remission at baseline , and progression of limited baseline disease ( remission ) may not lead to an immediate change in symptoms . routine radiographic scanning was not required beyond the first interim analysis ( june 2010).2 an analysis of the time to discontinuation of the study drug was conducted to assess radiological progression - free survival with additional maturity.2 in our analysis , treatment discontinuation was associated with a clinically important and statistically significant decline in hsuvs of 0.06 , which was consistent with the difference in mean hsuv between progression phases of a previous study in psroc ( 0.069 , 0.7180.649).8 with longer follow - up , a similar association between hsuvs and disease progression may have been observed . the absence of a meaningful association between aes and hsuvs may be explained by the effective management of aes through concomitant medication , dose reduction ( 36% of olaparib patients ) , and treatment interruption ( 42% of olaparib patients).2 olaparib is generally well tolerated and aes considered to be manageable , and this is reflected in the small number of patients who permanently discontinued treatment due to aes ( nine of 264 patients ) in the study.2 there was no significant or meaningful difference in hsuvs between olaparib and placebo - treated groups throughout the study follow - up , indicating that there was no detrimental effect of olaparib on hrqol . this finding is consistent with the primary analysis of fact - o in nct00753545.3 as an adjustment for the randomized group was not required , the summary hsuvs reported in this study can be applied to both patient groups in future cost utility evaluations ( eg , the same hsuvs should be applied to patients receiving olaparib and to patients undergoing routine disease surveillance [ placebo ] ) . external validation of the results of this analysis is challenging , given that the objective was to fill an evidence gap on the hsuvs of patients receiving maintenance treatment . only one clinical study had previously reported hsuvs in psroc:5 the ova-301 trial.7,23 by comparison , the mean hsuvs ( 0.786 ) in the itt population of nct00753545 were higher than those reported in ova-301.8 patients in these studies were at different stages of treatment when data were collected ; ova-301 patients were actively undergoing chemotherapy , whereas patients enrolled in nct00753545 had completed chemotherapy and were in clinical remission . reassuringly , the mean hsuv reported at the unscheduled visit ( 0.720 , table 3 ) of nct00753545 , where the majority of patients had discontinued the study drug and were candidates for subsequent chemotherapy , was comparable to the hsuv reported during the chemotherapy - treated phase of ova-301 ( 0.718).21 the analysis presented in this paper is subject to a number of limitations . our analysis considers the generation of hsuvs using mapping algorithms and patient - level data from nct00753545 . hsuvs generated through mapping analyses tend to be associated with increased uncertainty and error when compared to hsuvs collected from patients.24 we addressed this uncertainty by using four different mapping algorithms to generate a range of plausible hsuvs for use in economic evaluations . our preferred algorithm generated conservative estimates of the hsuvs of maintenance patients , when compared to cheung et al , dobrez et al , and tobit . the interpretation of our results also depends on the definition of an mid in hsuvs . in our analysis , the threshold for meaningful change was predefined at the level of 0.06 , based on a published study of mids in eq-5d in patients with cancer.13 other studies have reported mids between 0.033 and 0.082 in noncancer - specific populations.25,26 across studies , there is variability in the threshold for an important change , which results from differences in methodology and the effects of variability in patient characteristics on threshold values.27 because of the effects of patient variability , our predefined mid was set using data from a cancer - specific study . reassuringly , the threshold used in our analysis is consistent with values reported elsewhere.25,26 the lack of association between aes and hsuvs may also be partly explained by a limitation in data collection in nct00753545 . this is because the association between hsuvs and aes was modeled by identifying fact - o data collected at the time of an event . fact - o data were collected at screening , scheduled visits , and on treatment discontinuation . between scheduled visits , patients may have experienced an event that resolved prior to the next fact - o assessment . to comprehensively capture the effect of aes on hsuvs , because of a lack of published algorithms , we were unable to map fact - o to hsuvs directly . the impact of excluding the ovarian subscale of fact - o from the analysis is unclear , and can only be assessed through the development of a fact - o mapping algorithm , and by comparing the hsuvs generated with this algorithm to those estimated in this analysis . future studies should consider the use of fact - o mapping algorithms , if algorithms become available . importantly , the use of different algorithms may impact on the conclusions of cost utility analyses . for example , the application of higher hsuvs can lead to higher quality - adjusted life - year gains for more effective treatments , as each additional year free of health complications is assigned a higher quality - adjusted weight . because of this , it is important to justify the choice of algorithm used in the base - case analysis . to do this requires an understanding of which of the available algorithms is likely to provide the most robust estimate of hsuvs . the approach adopted in this study was to select a preferred algorithm by ranking each algorithm on predefined criteria . the preferred algorithm was then used to generate the base - case hsuv . with this approach , decision makers can have greater confidence that the most appropriate algorithm was used , as opposed to the one that yields the most favorable cost utility estimate . however , there is no guarantee that the preferred algorithm will generate the most clinically plausible hsuvs , and thus it remains important to assess the impact of different algorithms on predicted hsuvs and associated cost the justification for choice of preferred mapping algorithm is also particularly important when presented with a large number of competing algorithms and thus potential hsuvs . in our analysis , only four relevant algorithms were identified , and thus it was feasible to compare all potential hsuvs . appropriate algorithm selection will become more important , though , as the number of published mapping studies increases and it becomes less feasible to compare all potential hsuvs . the assessments we used to select our preferred algorithm may also be used in excluding algorithms considered to have poor performance or lacking relevance . this approach may help in screening for algorithms that best meet the requirements of the analysis , where it is not feasible to consider all potential hsuvs . in conclusion , the results of this analysis addressed an important evidence gap in the economic evaluation of ovarian cancer . the mean hsuvs generated in this analysis appear consistent with the existing literature , although different algorithms generated different hsuvs . ols provides a plausible and conservative estimate of hsuvs in this population that can be used in economic evaluations of maintenance treatment in psroc . further research will be necessary to validate the findings of this analysis using hsuv data to be collected in future clinical studies of olaparib in psroc . a systematic review was carried out with the aim of identifying and synthesizing evidence from studies reporting utility values in patients with advanced ovarian cancer measured using direct ( standard gamble [ sg ] , time trade - off ( tto ) , or visual analog scale [ vas ] ) or indirect ( euroqol [ eq]-5d , standard form 6 dimension ( sf-6d ) , or health utility index [ hui]-3 ) instruments . the electronic databases embase and medline were searched in june 2013 using the search terms presented in table s1 . in addition , hand - searching was also carried out in health - technology assessment websites , including national institute for health and care excellence ( nice ) , haute autorite de sante ( has ) , the norwegian medicines agency ( noma ) , canadian agency for drugs and technologies in health ( cadth ) , pharmaceutical benefits advisory committee ( pbac ) , institute for quality and efficiency in health care ( iqwig ) , the dental and pharmaceutical benefits agency ( tlv ) , scottish medicines consortium ( smc ) . data were extracted from selected studies that included study design , country , elicitation methods , health - state description , mean ( standard deviation ) , or median of utility values . the variance covariance matrix for the multivariable regression analysis is reported in table s2 . the results of pearson correlation - coefficient analysis assessing the correlation between algorithms are reported in table s3 . search terms used for identification of studies reporting health - state utility values abbreviations : hrqol , health - related quality of life ; rct , randomized controlled trial . pearson correlation coefficients between sets of utility values generated by different algorithms abbreviation : ols , ordinary least squares .
objectivesin the absence of euroqol 5d data , mapping algorithms can be used to predict health - state utility values ( hsuvs ) for use in economic evaluation . in a placebo - controlled phase ii study of olaparib maintenance therapy ( nct00753545 ) , health - related quality of life was measured using the functional assessment of cancer therapy ovarian ( fact - o ) questionnaire . our objective was to generate hsuvs from the fact - o data using published mapping algorithms.materials and methodsalgorithms were identified from a review of the literature . goodness - of - fit and patient characteristics were compared to select the best - performing algorithm , and this was used to generate base - case hsuvs for the intention - to - treat population of the olaparib study and for patients with breast cancer antigen mutations.resultsfour fact general ( the core component of fact - o ) mapping algorithms were identified and compared . under the preferred algorithm , treatment - related adverse events had no statistically significant effect on hsu ( p>0.05 ) . discontinuation of the study treatment and breast cancer antigen mutation status were both associated with a reduction in hsuvs ( 0.06 , p=0.0009 ; and 0.03 , p=0.0511 , respectively ) . the mean hsuv recorded at assessment visits was 0.786.conclusionfact general mapping generated credible hsuvs for an economic evaluation of olaparib . as reported in other studies , different algorithms may produce significantly different estimates of hsuv . for this reason , it is important to test whether the choice of a specific algorithm changes the conclusions of an economic evaluation .
petrochemical plastics have been developed into a major industry and are resistant to natural and chemical breakdowns ( 1 ) . alternatively , bioplastics are polyesters synthesized by bacteria under unbalanced growth conditions ( 2 ) . poly hydroxyalkanoate ( pha ) , the most known source of bioplastics , is a potential candidate for substitution of petrochemical plastics , because of its biodegradability properties . biodegradable polymers are made from renewable resources , and thus do not lead to depletion of finite resources ( 3 ) . these biopolymers have many desirable physical and chemical properties of conventional synthetic polymers ( 4 ) . to this point , high production costs have limited the use of biopolymers ; however , if these costs be reduced , there would be a widespread economic interest ( 5 ) . the phb biosynthetic pathway includes three enzymatic reactions , catalyzed by three distinct enzymes . in the first reaction , b - ketoacyl coa thiolase ( encoded by the phba gene ) condenses two acetyl - coa molecules into acetoacetyl - coa . the second reaction is the reduction of acetoacetyl - coa to ( r)-3-hydroxybutyryl - coa by an acetoacetyl - coa dehydrogenase ( encoded by the phbb gene ) . finally , p ( 3hb ) polymerase ( encoded by the phbc gene ) polymerizes the ( r)-3-hydroxybutyryl - coa monomers into phb ( 7 ) . only a few bacteria such as alcaligenes latus , bacillus megaterium , ralstonia eutropha , and pseudomonas oleovorans have been used for the production of pha . r. eutropha is a non - spore - forming , gram - negative bacterium and the most common bacterium for pha production ( 2 ) . natural pha - producing bacteria usually harbor native machinery for polymer degradation and are often hard to lyse , making the recovery of pha difficult ( 2 ) . the use of recombinant escherichia coli for pha production is beneficial in some points as fast growth , high cell density , ability of using several cheap carbon sources , and easy purification ( 8) . our objective was cloning and expression of the phb operon of r. eutropha h16 to e. coli bl21 , and then phb production from the recombinant bacteria . dried culture of r. eutropha h16 ( dsm 428 ) was purchased ( dsmz , gmbh ) . r. eutropha was cultured on nutrient broth ( 8% w / v ) at 30c for 24 hours . nutrient agar containing 5 g peptone , 3 g meat extract and 15 g agar was dissolved in 950 ml distilled water ; the final ph was adjusted at 7.3 . distilled water was added up to 1 l and then the final solution was autoclaved . these strains were cultured on luria - bertani ( lb ) medium ( 9 ) at 37c for 16 hours . the total genomic dna of r. eutropha was extracted ( 9 ) . the desired fragment ( 3851 bp for phbcab genes ) was amplified by designed primers which possessed cutting sites on their 5 ' ends for bamhi and hindiii restriction enzymes . the sequence of phb bamhi - forward primer was gccggatccatggcgaccggcaaa and the one for phb hindiii - reverse primer was gccaagctttcagcccatatgcaggcc . the phusion master mix kit with gc buffer ( bio lab , new england ) was used for amplification of this fragment . the thermo - cycler program was as follows : 98c for three minutes , then 30 cycles of 98c for 15 second , 65c for one minute , 72c for two minutes , and finally 72c for 10 minutes . the pcr product and pet-28a vector were digested by bam hi and hind iii restriction enzymes at 37c for 16 hours and they were purified from the gel . purification was performed according to silica bead dna gel extraction kit ( fermentas , ca ) . afterwards , ligation of the pcr product and vector was performed by t4 ligase at 16c for 16 hours . the transformation was performed according to green and sambrook s guideline ( 9 ) . to prove the successful cloning of pcr products , the plasmid dna was extracted from some bacterial clones and digested with bam hi and hind iii ( fermentas , ca ) overnight at 37c and the lb medium ( supplemented with 30 g / ml kanamycin ) , inoculated with an overnight culture of recombinant cells , was incubated at 37c until reaching the optimized optical density . afterwards , isopropyl l - beta - d - thiogalactopyranoside ( iptg ) was added at a final concentration of 0.4 mm and the incubation continued for eight hours at 37c with shaking at 150 rpm . the smear was air - dried and stained with a 3% sudan black b solution ( 3 gram w/100 mlv in 70% ethanol , sigma ) for 10 minutes . the sample was stained with safranin ( 5% w / v in distilled water , sigma ) for 10 seconds , washed again with distilled water , and dried and observed under oil immersion lens ( 10 ) . dried culture of r. eutropha h16 ( dsm 428 ) was purchased ( dsmz , gmbh ) . r. eutropha was cultured on nutrient broth ( 8% w / v ) at 30c for 24 hours . nutrient agar containing 5 g peptone , 3 g meat extract and 15 g agar was dissolved in 950 ml distilled water ; the final ph was adjusted at 7.3 . distilled water was added up to 1 l and then the final solution was autoclaved . these strains were cultured on luria - bertani ( lb ) medium ( 9 ) at 37c for 16 hours . the total genomic dna of r. eutropha was extracted ( 9 ) . the desired fragment ( 3851 bp for phbcab genes ) was amplified by designed primers which possessed cutting sites on their 5 ' ends for bamhi and hindiii restriction enzymes . the sequence of phb bamhi - forward primer was gccggatccatggcgaccggcaaa and the one for phb hindiii - reverse primer was gccaagctttcagcccatatgcaggcc . the phusion master mix kit with gc buffer ( bio lab , new england ) was used for amplification of this fragment . the thermo - cycler program was as follows : 98c for three minutes , then 30 cycles of 98c for 15 second , 65c for one minute , 72c for two minutes , and finally 72c for 10 minutes . the pcr product and pet-28a vector were digested by bam hi and hind iii restriction enzymes at 37c for 16 hours and they were purified from the gel . purification was performed according to silica bead dna gel extraction kit ( fermentas , ca ) . afterwards , ligation of the pcr product and vector was performed by t4 ligase at 16c for 16 hours . the transformation was performed according to green and sambrook s guideline ( 9 ) . to prove the successful cloning of pcr products , the plasmid dna was extracted from some bacterial clones and digested with bam hi and hind iii ( fermentas , ca ) overnight at 37c and the lb medium ( supplemented with 30 g / ml kanamycin ) , inoculated with an overnight culture of recombinant cells , was incubated at 37c until reaching the optimized optical density . afterwards , isopropyl l - beta - d - thiogalactopyranoside ( iptg ) was added at a final concentration of 0.4 mm and the incubation continued for eight hours at 37c with shaking at 150 rpm . the smear was air - dried and stained with a 3% sudan black b solution ( 3 gram w/100 mlv in 70% ethanol , sigma ) for 10 minutes . the sample was stained with safranin ( 5% w / v in distilled water , sigma ) for 10 seconds , washed again with distilled water , and dried and observed under oil immersion lens ( 10 ) . in r. eutropha , the lengths of phbc , phba and phbb genes were respectively 1770 bp , 1182 bp and 741 bp . a pair of primers was designed for amplifying the phbcab genes , which include the beginning of the phbc gene to the end of the phbb gene and the hindiii and bamhi restriction site sequence was added to the ends of the primers . the pcr product was checked by 1% agarose gel and a 3851 bp fragment was seen ( figure 1 ) . the pet-28a recombinant vector was constructed as described above ; it is about 9200 bp . after transformation of the pet-28a recombinant vector including the desired insert into e. coli , a number of the single colons were taken from the selective medium ( lb - kanamycin ) . the transformation was confirmed with colony pcr , digestion of extracted plasmid ( figure 2 ) , and sequencing . after the digestion , the pcr product ( 3851 bp ) and the pet-28a vector ( 5369 bp ) were separated . production of phb was confirmed by sudan black b staining under a light microscope ( figure 3 ) . pha - producing genes exist in various bacteria . although these genes are dispersed on chromosome in some organisms , they are in tandem in other bacteria such as r. eutropha h16 . although the capacity of r. eutropha to produce and accumulate polymers is well - known , the use of these kinds of bacteria has some limitations . hence , many efforts have been accomplished to create recombinant bacteria and use economic carbon sources . in a report by galehdari et al . ( 11 ) they separately amplified the phbb , phba and phbc genes from the extracted azotobacter genome and cloned the fragments in pcr2.1-topo cloning vector with subsequent transformation of e. coli dh5. in their study , three types of recombinant e. coli were created and none of them could produce phb . in our study , the whole operon of phb was extracted and an expression vector was constructed ; then , the production of phb was confirmed in the recombinant bacteria . many other reports used phb genes from r. eutropha and a. latus for production of phb in e. coli ( 12 , 13 ) . various metabolic and fermentation methods have been used in some bacterial strains for phb production . the use of a recombinant system harboring the phb synthesis genes can produce phb in higher concentrations compare to natural pha - producing bacteria ( 2 ) . the high - yield production of phb in natural pha - producing bacteria can be reduced by high activity of intracellular depolymerase . to overcome this bottleneck , metabolically - engineered e. coli strains ( without dehydrogenase ) harboring heterologous pha synthesis intensive efforts are being made to reduce the cost of production by means of bioprocess designing and metabolic engineering of the production strains ( 2 ) . in this study , we successfully cloned and expressed the recombinant pet-28a containing the phb - biosynthesis genes . phb granules were observed in e. coli by sudan black b staining under the light microscope . in sudan black b staining , lipid inclusion granules were stained blue - black or blue - grey , whilst the bacterial cytoplasm was stained light pink .
background : poly 3-hydroxybutyrate ( phb ) , a class of poly hydroxyalkanoates ( phas ) , is a group of bacterial storage polymers , produced by various microorganisms in response to nutrient limitation . phas are biodegradable polymers which could be a good substitute for current petrochemical plastics . phb has been synthesized during three enzymatic steps including three genes.objectives:our aim was phb production from recombinant bacteria.materials and methods : ralstonia eutropha was cultured and its genomic dna was extracted . the phbcab operon was amplified using designed primers . the fragment was cloned into pet-28a expression vector and then transformed into escherichia coli bl21 . sudan black staining was used to show the production of phb.results:the extracted recombinant plasmid was digested with restriction enzymes . separation of the desired fragment from the vector was performed to prove the correct insertion of the pcr products into the vector . the colony pcr and sequencing results confirmed the successful transformation . the production of phb was confirmed by sudan black b staining under a light microscope.conclusions:various metabolic and fermentation methods have been used in some bacterial strains for phb production . the use of a recombinant system harboring phb synthesis genes can produce phb in higher concentrations compare to natural pha - producing bacteria . the present study was one of the most important and basic steps of designing a recombinant e. coli that can produce phb .
psoriatic arthritis ( psa ) is a multifactorial chronic inflammatory joint disease associated with psoriasis , usually with no detectable rheumatoid factor ( rf ) , and belongs to the seronegative subgroup of spondyloarthritis . clinically , patients with psa present with different manifestations such as mild mono-/oligoarthritis , destructive polyarthritis , dactylitis , enthesitis , and spondylitis . psa is estimated to be present in 642% of patients with skin psoriasis , but unlike rheumatoid arthritis ( ra ) psa is equally common in men and women . whilst the pathogenesis is not fully understood , the immunological process , occurring in the skin of patients with psoriasis , resembles the events occurring in the joints when synovial cells begin to proliferate . psa has many similarities with ra in addition to separate and specific clinical properties . in comparison to ra , erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) levels are not as diagnostically reliable when measured in samples from patients with psa as both , or either , are often within the normal range despite the presence of an advanced joint disease . found that s - calprotectin related to radiographic changes rather than disease activity in patients with low disease activity but in the study they also found that s - calprotectin was associated with patients with moderate / high activity measured as physicians ' global assessment and more than three swollen joints . calprotectin , a member of the family of s100 leukocyte proteins secreted primarily by neutrophilic granulocytes and monocytes , is a calcium binding protein with antimicrobial properties . the calprotectin heterocomplex consists of two different proteins , s100a8 and s100a9 ( mrp14/mrp8 or calgranulin a / b ) , encoded by the s100a8/s100a9 gene located on chromosome 1q21 . the presence of calcium induces conformational changes in the heterodimer , thereby allowing the binding of other proteins . moreover , calprotectin contains zinc - binding domains involved in an antibacterial activity . in the cytosol of neutrophilic granulocytes , calprotectin has been estimated to account for more than 40% of the total protein content [ 9 , 10 ] ; conversely calprotectin is not usually present in lymphocytes . calprotectin is also an important mediator of many regulatory functions such as chemotactic activity , deactivation of macrophages , and inhibition of immunoglobulin synthesis . elevated levels of calprotectin have been identified at sites of inflammation and in the extracellular fluid in patients with ra , cystic fibrosis , sjgren 's syndrome , and abscesses . in plasma from patients with ra , the concentration of calprotectin is known to be increased compared with that in healthy individuals . measurement of faecal calprotectin levels is a diagnostic tool , and a biomarker , for inflammatory activity in bowel diseases such as ulcerative colitis and crohn 's disease . a high concentration of calprotectin has been detected in the synovial fluid from patients with psa and ra . production of calprotectin is also expressed in the epidermal keratinocytes of patients with psoriasis whereas the normal epidermis from healthy individuals shows very low levels . in addition to its biological effects , calprotectin is involved in epidermal proliferation , differentiation , and inflammatory cell migration . numerous proinflammatory cytokines and chemokines have been found in skin lesions , blood , and synovial fluid of patients with inflammatory conditions such as arthritis and psoriasis , although their etiological significance is not fully understood [ 1424 ] . cytokines such as interleukin ( il)-17a and il-22 have been suggested to be involved in hyperproliferative and inflammatory reactions in the psoriatic epidermis based on the therapeutic effects of cytokine antagonists as a part of the treatment in patients with psa and plaque psoriasis [ 15 , 16 ] . interleukin-17a is also known to increase the production of il-16 and to induce the expression of ccl20 in primary cultures of keratinocytes . an overexpression of il-12 and il-23 has been reported to occur in the psoriatic process , whilst it has been proposed that il-15 and il-18 participate in the pathogenesis of ra [ 19 , 20 ] . high concentrations of il-22 have been detected in the synovial fluid from patients with psa and ra , and a correlation between the levels of il-22 and area of the psoriatic lesion(s ) and severity index ( pasi ) score has been identified . in an early phase of psa development , elevated levels of cxcl10 have been found , whilst a decrease has been observed in long lasting psa . a recent study revealed a correlation of il-33 concentrations between the synovial fluid and serum of patients with ra . the high expression of cxcl12 in the synovium of ra patients is believed to attract cd4 + memory t cells . the aim of this cross - sectional study was to analyse different inflammatory markers , that is , s100a8/s100a9 ( calprotectin ) and cytokines in blood in patients with psa in order to identify a potential marker for psa or the clinical subtypes of psa . blood samples were collected from 65 patients with psa ( 33 males/32 females , age 50.5 14.2 years ( mean sd ) ) . the patients with psa were compared with 31 healthy controls matched for age and gender . s - calprotectin , high sensitivity- ( hs- ) crp , and cytokines in plasma were analysed in both patient and control groups whilst the measurement of esr was only performed for the patients with psa . all of the patients fulfilled the caspar criteria and/or the moll and wright criteria for psa . of the patients , 32 fulfilled the moll and wright criteria for mono-/oligoarthritis and 33 patients fulfilled the criteria for polyarthritis at the time of the study . all patients in this study were examined clinically for inflammatory joint manifestations and skin involvement . the number of tender and swollen joints , with a duration of more than 6 weeks , was assessed using 66-joint count . mono-/oligoarthritic disease pattern was defined when four or less tender and swollen joints were present at the time of the medical examination , and polyarthritic disease pattern was diagnosed when more than four tender and swollen joints were present . using a five - point scale , the affected skin area was graded from no actual lesion to extensive involvement , and the activity of skin involvement ( erythema , induration , and scaling ) was graded using four grades , that is , no activity , mild , moderate , and severe activity . the study was approved by the regional research ethics committee of ume university . calprotectin in serum ( ng / ml ) was analysed using the phical calprotectin elisa kit ( immundiagnostik , bensheim , germany ) . erythrocyte sedimentation rate ( mm / h , westergren method ) was measured using routine laboratory methods . analysis of high sensitivity crp ( hs - crp ) in serum was performed using immunoturbidimetry ( cobas 6000/8000 , roche diagnostics , usa ) . the cytokines were measured in plasma samples ( pg / ml ) using multiplex detection kits from bio - rad ( hercules , ca , usa ) . a 7-plex kit was used to measure the concentrations of il-12 , il-15 , il-17a , il-22 , il-23 , il-33 , and ccl20 , a 2-plex kit was used for il-16 and il-18 , and single kits were used for measurements of cxcl10 and cxcl12 . the assays were performed according to the manufacturer 's protocols and analyzed with a bio - plex 200 system using bio - plex manager 6.1 software ( bio - rad , hercules , ca , usa ) . differences between the collected data were tested for using the kruskal wallis test and/or mann - whitney test , and for identifying correlations the spearman rank - order equation was used . to assess the utility of s - calprotectin and hs - crp as inflammatory markers for psa , sensitivity and specificity the receiver operating curve ( roc ) was used to identify the relationship between the sensitivity and specificity . for multivariate analysis , logistic regression enter method was performed with variables showing significant differences in the association analyses , with psa as independent variable . all p values refer to a two sided test and a p value 0.05 was considered statistically significant . esr values were not included in the multivariate analysis because laboratory measurements of esr were only available for the patients with psa . s - calprotectin and hs - crp levels were significantly higher in patients with psa compared with controls ( p < 0.001 , resp . ) . the serum levels of calprotectin were significantly higher in patients with mono-/oligoarthritis as well as polyarticular disease than in healthy controls ( p < 0.001 , resp . ) , and the levels in the polyarticular group were higher than in patients with mono / oligoarticular disease ( p = 0.017 ) ( table 1 ) . in addition , hs - crp levels were significantly higher in patients with mono-/oligoarthritis compared with the control group ( p = 0.026 ) , and patients suffering from polyarthritis have significantly higher levels of hs - crp than both the control and patient groups with mono-/oligoarthritis ( p < 0.001 and p = 0.012 , resp . , table 1 ) . esr was significantly higher in patients with polyarthritis compared with individuals suffering from mono-/oligoarthritis ( p = 0.002 ; table 1 ) . the levels of s - calprotectin correlated with hs - crp ( p < 0.001 ; rs = 0.441 ) , swollen joint count ( p = 0.002 , rs = 0.397 ) , and cxcl10 ( p = 0.046 , rs = 0.678 ) ( table 2 ) but not with any of the other cytokines . cxcl10 correlated with s - calprotectin ( p = 0.046 , rs = 0.678 ) , hs - crp ( p = 0.05 , rs = 0.400 ) , esr ( p = 0.008 , rs = 0.347 ) , and swollen join count ( p = 0.033 , rs = 0.278 ) ( table 2 ) . none of the cytokines was associated with psa or its clinical subtypes nor did they correlate with the number of swollen joints . however , several of the cytokines correlated with tender joints ( il-12 ( p = 0.039 , rs = 0.270 ) , il-15 ( p = 0.014 , rs = 0.319 ) , il-17a ( p = 0.007 , rs = 0.348 ) , il-22 ( p = 0.046 , rs = 0.260 ) , il-33 ( p = 0.026 , rs = 0.290 ) , and ccl20 ( p = 0.018 , rs = 0.306 ) ) , and correlations were found between the cytokines il-12 , il-15 , il-17a , il-22 , il-23 , il-33 , and ccl20 ( p < 0.001 ; data not shown ) . the roc curve was used to identify the optimal cut - off for s - calprotectin and hs - crp . the roc curve indicated 475.00 ng / ml to be the optimal cut - off value for s - calprotectin ( area under the curve ( auc ) = 0.866 , or = 42.00 , and 95% ci = 8.023197.683 , p < 0.001 ) with a sensitivity of 75.0% , a specificity of 93.3% , and a positive predictive value of 95.7% ( figure 1 ) . when analysing hs - crp , the roc - curve indicated 3.75 mg / l as the optimal cut - off ( auc = 0.751 , or = 6.88 , 95% ci = 1.8825.190 , p = 0.004 , sensitivity = 43.3% , specificity = 90% , and positive predictive value 89.7% ) ( figure 2 ) . in multiple logistic regression analysis , s - calprotectin , hs - crp , and cxcl10 s - calprotectin was the only variable significantly associated with psoriatic arthritis ( p = 0.002 , or = 1.006 , and 95% ci = 1.0021.010 ) . no significant difference was found for the s - calprotectin level between either the area of the affected skin or activity of the skin disease , and there were no correlations between age , gender , or the cytokines analysed apart from cxcl10 ( data not shown ) . identification of a marker for the diagnosis and/or predicting a prognosis of psa , as well as supporting the evaluation of disease activity , has been a long - term target for rheumatologists . there is no known , clinically useful marker , and laboratory parameters , such as esr and/or crp , are not always increased in patients with psa , even those suffering from a diagnosed and clinically active disease . until recently , calprotectin was known to be increased in the faeces of patients with inflammatory bowel disease and was primarily used as a marker for the diagnosis and evaluation of inflammatory bowel diseases ( i.e. , crohn 's disease and ulcerative colitis ) . an increased level of calprotectin in serum is found in patients with other inflammatory diseases , such as ra and psoriasis , and a high concentration of s100 proteins has been detected in the inflamed synovial tissue from patients with psa and ra . several cytokines are known to be elevated in inflammatory diseases , including psa , and studies on treatment options that modify cytokine regulation are ongoing [ 1424 ] . the primary aim of this study was to examine the levels of s - calprotectin , hs - crp , and cytokines in relation to psa , the peripheral disease pattern , and the disease activity in patients with psa and , secondly , to evaluate the utility of these variables as markers of inflammation . s - calprotectin levels were found to be significantly higher both in patients with mono-/oligoarthritis and in those with polyarthritis compared with controls , thus showing that , even in patients with a disease pattern usually associated with less inflammation , a laboratory detectable parameter could be measured . there was also a correlation of s - calprotectin with esr , hs - crp , and the number of swollen joints ( using a 66-joint scoring system ) confirming that s - calprotectin can be used as an inflammatory marker . when evaluating the utility of s - calprotectin and hs - crp as disease markers , s - calprotectin was found to be a better predictor for psa than hs - crp at the optimum cut - off value based on analysis of the roc - curve . in a multiple logistic regression model including s - calprotectin , hs - crp , and cxcl10 , s - calprotectin was found to be the best predictor for psa which further strengthens the proposal of s - calprotectin being a potential marker for psa . madland et al . have reported a correlation between s - calprotectin and radiographic changes rather than disease activity of psa in patients with low disease activity . we have not evaluated radiographic findings in our study as we wanted to study possible differences between disease patterns , but the findings of associations between s - calprotectin and moderate / high disease activity and more than three swollen joints are in line with our findings . the cytokines analysed in this study did not associate with psa or any of the clinical subtypes of psa . this is contrary to other published studies and could be a result of the small number of patients included in this study . s - calprotectin did show strong association with psa , despite the small number of patients , and our findings indicate that s - calprotectin reflects the burden of the joint disease , even in those patients with only a few joints involved and who often have normal esr and/or crp . this study generated promising results since it was possible to detect an increased serum level of s - calprotectin in patients with psa and also to identify it as a better predictor of ongoing disease than hs - crp or any of the proinflammatory cytokines il-12 , il-15 , il-16 , il-17a , il-18 , il-22 , il-23 , il-33 , ccl20 , cxcl10 , and cxcl12 . although the results are very promising the number of patients in this study is small , which could be reflected in the quite low or , and further investigation of the relationship between psa and s - calprotectin levels should be undertaken in order to confirm the results .
objective . to analyse levels of s100a8/s100a9 ( calprotectin ) and selected cytokines , in blood , in patients with psoriatic arthritis ( psa ) . methods . sixty - five patients with psa were examined for clinical manifestations and laboratory measurements of s - calprotectin , esr , hs - crp , and selected cytokines . thirty - two patients had mono-/oligoarthritis and 33 had polyarthritis . s - calprotectin , hs - crp , and cytokines were measured using elisa , immunoturbidimetry , and multiplex technology ( bio - plex ) . patients with psa were compared with 31 healthy controls . results . s - calprotectin and hs - crp levels were significantly higher in patients with psa compared with controls ( p < 0.001 and p < 0.001 , resp . ) . patients suffering a polyarthritic disease pattern presented with significantly higher levels of s - calprotectin compared with controls and patients with mono-/oligoarthritis ( p < 0.001 and p = 0.017 , resp . ) . the levels of s - calprotectin correlated with hs - crp ( p < 0.001 ; rs = 0.441 ) , swollen joint count ( p = 0.002 , rs = 0.397 ) , and cxcl10 ( p = 0.046 , rs = 0.678 ) but not with any of the other cytokines evaluated . in multiple logistic regression analysis , s - calprotectin was the only variable significantly associated with psoriatic arthritis ( p = 0.002 , or = 1.006 , 95% ci = 1.0021.010 ) . conclusion . s - calprotectin and hs - crp levels were significantly higher in patients with psa . a polyarthritic disease pattern showed higher levels of s - calprotectin than mono-/oligoarthritis . s - calprotectin is considered a potential marker of disease activity in patients with psa .
fungi of this genus have been isolated from a wide range of hosts such as humans , woody plants , and the larvae of bark beetles , but only some species of this genus have been reported as pathogens of humans [ 2 , 3 ] . presently , the phaeoacremonium genus , formerly known as phialophora , includes more than 20 species [ 4 , 5 ] . the occurrence of phaeoacremonium species varies , with phaeoacremonium aleophilum being the most frequently isolated species in esca diseased grapevines . the term phaeohyphomycosis was first introduced in 1974 to describe local infections caused by darkly pigment - ed molds ( black mold ) [ 6 , 7 ] . however , only a few human phaeohyphomycosis cases have been reported in the literature worldwide . we report the first case of primary phaeohyphomycosis by phaeoacremonium species in a kidney transplant patient in korea . a 54-yr - old man with a large subcutaneous mass on the third finger of his right hand was admitted to our hospital in august 2005 ( fig . he had chronic renal failure caused by diabetes mellitus , and therefore , he underwent kidney transplantation in october 2000 . after the operation , he was prescribed immunosuppressive agents such as tacrolimus , deflazacort , and mycophenolate mofetil . he had no history of trauma , but had a small nodule on the third finger since 1995 . the patient had high serum glucose levels of 341 mg / dl , which suggested post - tra - nsplant diabetic mellitus ; his serum blood urea nitrogen / creatinine levels were 33.5/1.5 mg / dl . in complete blood count analysis , the white blood cell count and hb and hct levels were within reference ranges , although platelet count was slightly low at 117,000/l . the patient underwent excision of the mass , which was followed by culture of the wound aspirate collected in the operating room . 1b ) . in the bacterial culture , no colonies formed on the blood agar , macconkey agar , or thioglycolate broth after incubation for 48 hr at 35 and ambient temperature . periodic acid - schiff staining performed on the histology slide showed many fungal hyphae ( fig . few white waxy colonies with a woolly texture were observed on sabouraud dextrose agar at 30 , and the colonies changed into a dark - brown color . when the fungal hyphae were separated on the slide culture , pcr using its1 ( 5 ' tcc gta ggt gaa cct gcg g 3 ' ) and its4 ( 5 ' tcc tcc gct tat tga tat gc 3 ' ) primers was performed for species identification . the -tubulin and actin genes were detected according to clsi guidelines , 2008 . even though -tubulin and actin were not amplified , nucleotide sequencing of its1 and its4 revealed 100% sequence homology to both p. aleophilum anamorph and togninia minima teleomorph . as such , antifungal agents , including fluconazole and amphotericin b , were administered to the patient empirically for 2 days , and the patient recovered without any sequelae . five years after the wide excision , the patient has had no further subcutaneous lesions . phaeohyphomycosis is the term used to describe a subcutaneous fungal infection caused by darkly pigmented molds ( black mold ) , such as those from the species phaeoacremonium , phialophora , alternaria , exophiala , and pyrenochaeta [ 6 , 7 ] . this condition is rare in humans , but it can involve the skin , subcutis , paranasal sinuses , or the central nervous system . the genus phaeoacremonium has been isolated from patients who experience traumatic implantation of fungi from contaminated plant thorns or soil , and was usually known as a causal agent of grapevine diseases such as petri disease and esca , which can cause leaf drop and wood discoloration [ 7 , 11 ] . recently , cases of phaeohyphomycosis caused by phaeoacremonium species have been increasingly reported in humans [ 7 , 8 ] . notably , these diseases have been described in immunocompromised patie - nts with renal transplantation . in our case , although he lived in an urban area , he frequently climbed mountains as a hobby before the appearance of the subcutaneous mass . when we consider the natural ecological niches of the phaeoacremonium species , the patient may have been exposed to this pathogen during his frequent mountain - climbing trips . it is difficult to explain how he acquired the infection because he did not report any injury . however , it is possible that microtraumas to the skin and immunosuppressive therapy may have played a role . morphologically , the genus phaeoacremonium is an intermediate between the genera acremonium and phialophora [ 8 , 13 ] . organisms of the genus acremonium usually produce delicate hyaline septate hyphae , which carry unbran - ched tapering conidiophores with elliptical - shaped unicellular conidia . the characteristic tapering phialides of these organisms are derived from septate hyphae with one - celled ellipsoidal conidia . in contrast , organisms of genus phialophora show melanized hyphae and slimy one - celled conidia at their apex with distinct collarettes . the phialides have a funnel - shaped collarette and show a wide variety of diverse forms , including ellipsoidal , obovate , cylindrical , or allantoid ( sausage - like ) . the morphological distinctions from a number of other relatively similar phaeoacremonium species have been summarized by mostert et al . . although it is difficult to identify the species in our isolate on the basis of morphological criteria , it could be distinguished from species of brown colonies , such as phaeoacremonium parasiticum and phaeoacremonium inflatipes , by its short and usually unbranched conidiophores . however , molecular - based tools must be used in order to confirm the species . although the additional pcrs for -tubulin and actin were unsuccessfully repeated several times , sequence analysis of internal transcribed spacer ( its ) revealed 100% sequence homology to p. aleophilum and t. minima . clsi guidelines indicate that the its region in phaeoacremonium only provides limited resolution for species identification . thus , we are able to conclude that the pathogen was of the genus phaeoacremonium . optimal treatment of phaeohyphomycosis usually involves surgical wound excision combined with antifungal agents for several months . for this patient , empirical antifungal agents were administered for 2 days and the wound excision was successfully completed . herein , we have reported the first case of phaeohyphomycosis caused by the phaeoacremonium species in a kidney transplant patient in korea .
phaeohyphomycosis is a subcutaneous infection caused by dark pigmented fungi , including fungi of the species phaeoacremonium , alternaria , exophiala , and pyrenochaeta . in august 2005 , a 54-yr - old man who had received a renal transplant 5 yr ago was admitted to our hospital with a subcutaneous mass on the third finger of the right hand ; the mass had been present for several months . he had been receiving immunosuppressive agents for several years . he underwent excision of the mass , which was followed by aspiration of the wound for bacterial and fungal cultures . many fungal hyphae were observed on the histology slide treated with periodic acid - schiff stain . a few white waxy colonies with a woolly texture grew on the sabouraud dextrose agar at 30 and changed to dark brown in color . nucleotide sequencing of internal transcribed spacer regions revealed 100% homology to the phaeoacremonium aleophilum anamorph and togninia minima teleomorph ( 514 bp/514 bp ) . the patient completely recovered after wide surgical excision . here , we report the first case of phaeohyphomycosis caused by phaeoacremonium species in a kidney transplant patient in korea .
in recent years , evidence has accumulated that breast arterial calcifications ( bac ) noted on mammography are indicators of coexisting cardiovascular disease . cardiovascular diseases are a significant cause of morbidity and mortality in women over 50 years and the feasibility of early diagnosis is important . we examined the prevalence of bac in a population of women undergoing both screening and diagnostic mammography in order to establish a local database . in addition , we examined the degree of bac in order to examine the change of this parameter with age . during a 1-year period around 1786 women 's ( age range 40 - 93 years ) underwent screening or diagnostic examinations in our mammography unit . in addition to the routine screening for intrinsic breast pathology , all cases were evaluated for bac . degree of calcification ranged from 0 to 3 ; criteria are summarized in table 1 . degrees of calcification according to mammography criteria the examined population was divided into seven age groups ( 40 - 44 years , 45 - 49 years , 50 - 54 years , 55 - 59 years , 60 - 64 years , 65 - 69 years , and 70 - 93 years ) . for statistical analyses , presence of bac in each age group was calculated and the data , in percentages , were arcsine square transformed . the relationship between age and bac presence was described by pearson correlation coefficient and a linear regression . the prevalence of bac significantly increased with age [ table 2 , figure 1 ] , rising from 1% to 2% in women under the age of 50 years , to over 50% in women over the age of 70 years . < < 0.001 ) and the dependence of bac presence ( after transformation ) on age was described by the following regression equation : y = 0.691 + 0.018 * ( age ) . prevalence of calcification ( % ) in various age groups prevalence of breast arterial calcification in the different age groups studied . the degree of calcification also rose significantly with increasing age [ table 3 , figure 2 ] ( spearman 's correlation = 0.4 , p < < 0.001 ) . prevalence and degree of bac in the various age groups presence of calcification in different age groups . calcification ( arcsine sqrt of proportion ) versus age . of women under 60 years of age with bac , 80 - 90% were grade 1 bac ; in women over 60 years , this dropped to 40 - 50% of women having grade 1 bac , with a concomitant increase in grades 2 and 3 [ figure 3 ] . in the united states , about 250,000 women die every year from acute myocardial infarction , whereas 40,000 die from breast cancer . more than 60% of women who die suddenly from coronary heart disease were previously asymptomatic . the prevalence of coronary heart disease is more than 8% in women from ages 55 to 64 years . imaging examinations can also provide evidence of cardiovascular risk , such as been demonstrated for coronary arterial calcifications on computed tomography ( ct ) , aortic calcifications on plain films , and bac on mammograms . however , since there is significant overlap in the ages of peak vulnerability to breast cancer and to cardiovascular illness , the use of mammography to help stratify the population into higher- and lower - risk subsets could be advantageous . bac results from diffuse calcification of the arterial media , as opposed to atherosclerotic calcification of the intima . in their early stage , both atherosclerotic intimal calcifications and calcifications of the arterial media increase with increasing patient age and studies have found a higher incidence of bac in patients with diabetes , chronic renal failure , and atherosclerotic coronary disease . in two large studies , the increased risk of cardiovascular events associated with bac has been calculated as 1.32 for coronary heart disease , 1.8 for myocardial infarction , 1.4 for stroke / transient ischemic attack , 1.52 for heart failure , and 1.5 for thrombosis . however , this subject is still unsettled : a recent study by maas et al . the authors found an association between bac and age , previous pregnancy and history of lactation . another study showed no correlation between bac and coronary heart disease detected on coronary angiography ; however , degree of bac was not considered . in our study , we planned to record both the presence and degree of bac in women of various ages . we did not record additional information such as body habitus or concurrent illness , since our intention was to provide a database based only on patient age and mammographic findings . we hypothesize that the use of degree of calcification may aid stratification of the population for planning further investigations to discover cardiovascular disease and its risk factors in asymptomatic women . a study from the netherlands found 9% prevalence in a screening population aged 50 - 69 years . a study from california found 2.7% prevalence in women from 50 to 69 years of age and 17.7% in women 70 - 79 years old . our study showed 14.1% prevalence of bac in the age group 50 - 69 years , which is significantly higher than previous reports ( chi - square test p < 0.001 ) . the california study was a long - term longitudinal analysis using mammograms obtained over a 30-year period and the authors admit to the possibility of lower sensitivity and possibly lower reporting rates from the reading physicians . in our study the bac prevalence of only 1.6% in women under 50 years confirms the previously published conclusion that further investigation is warranted when bac are discovered in a woman under 50 years of age . few studies have addressed the degree of bac . in a preliminary study by iribarren and molloi , in 39 women with bac , quantitation of total bac was achieved using a densitometric technique in a digital mammography system . whether quantification is feasible in practice or is clinically relevant awaits further study . since we had no possibility of quantifying our observations of bac , we used a qualitative assessment , which combines extent and severity . the increase of bac severity with age is clear , since 91% of grade 2 and 3 calcifications occurred in women over 60 years of age , whereas women over 60 years made up only 31% of the examined population . the clinical implication is the observation of higher - grade calcification in a woman less than 60 years is unusual and might merit further investigation . limitations of our study include the subjective nature of our mammographic calcification grading system and the lack of additional patient information other than age and mammographic findings . however , the goal of our study was to provide a general database of prevalence and severity of bac in a population of women presenting for mammography . as such , the relevance of other risk factors is limited in a woman presenting with high grade calcification ; whether she has or has no other risk factors does not alter the mammographic finding . the appropriate work - up of an asymptomatic woman found to have bac is not settled . certainly routine , inexpensive and non - invasive tests are warranted , as they are in all patients of a certain age . the question remains whether more expensive and more invasive tests might be warranted in the case of presence of bac in a young woman or higher - grade bac than expected for age . the utility of additional imaging examinations such as carotid sonography , coronary calcium scoring or even ct coronary angiography would have to be established by further study of women with different grades of bac . according to our results , the infrequency of bac in a woman less than 50 years of age and of high - grade bac in a woman less than 60 years of age suggests that findings should be made known to the referring physician for further cardiovascular investigations .
objectives : the purpose of this study is to establish a database including prevalence and degree of breast arterial calcifications ( bac ) in our population of women presenting for mammography.materials and methods : the mammograms of 1786 women over the age of 40 years were examined for the presence and degree of bac . statistical analysis was performed to correlate patient 's age and ethnic origin with the presence and degree of bac.results:there was statistically significant and strong correlation between the patient 's age and presence of bac . there was also a less strong yet statistically significant correlation between patient age and degree of bac . regression analysis showed the likelihood of bac at various ages . the prevalence of bac is only 2% of women under 50 years of age ; the prevalence of grade 2 - 3 bac is only 1% in women under 60 years of age.conclusion:there is a predictable increase with age in both prevalence and degree of bac in women . the presence of high degree bac in women under 60 years of age or any bac in women under 50 years of age is unusual .
microvascular complications are major contributors to morbidity , mortality and costs of both non - insulin - dependent ( niddm ) and insulin - dependent diabetes mellitus ( iddm ) . damage of the small vessels in the kidney can lead to end - stage renal disease , structural alterations of the smaller vessels that supply nutrients and oxygen to peripheral nerves contribute to neuropathy and damage of the microvasculature of the eye is the leading cause of loss of vision in working - age adults . the clinical manifestations of microvascular disease are so characteristic of the disease that diabetes itself is defined primarily by the level of hyperglycaemia which causes microvascular complications . alterations in the microcirculation involve small resistance arteries , arterioles , capillaries and post capillary venules . mechanisms possibly involved in the development of microvascular alterations are summarized in table 1 . a relevant role in the impairment of vascular distensibility may be played by advanced glycosylation end - products , which may be involved in the formation of collagen cross - links . changes in the mechanics of small vessels may also induce changes in the structure . although there is a huge amount of data about microangiopathy ( capillary and arterioles ) , very few data about morphology of small resistance arteries ( diameter ranging from 100 to 350 m ) in diabetes mellitus are presently available . in one study , no difference in subcutaneous small artery structure was observed between control patients and patients with iddm . on the contrary , it has been demonstrated that , in both hypertensive and normotensive patients with niddm , marked alterations in small artery structure are present , and that these alterations are more pronounced in hypertensive patients with niddm than in patients with essential hypertension or in normotensive diabetics ( fig . 1 ) . in addition , in diabetic patients a clear increase in the media cross - sectional area of the vessels was observed , thus suggesting the presence of hypertrophic remodelling ( vascular smooth muscle cells hypertrophy or hyperplasia ) [ 4 , 5 ] ( fig . this was not the case of patients with essential hypertension , in which a eutrophic remodelling ( re - arrangement of the same amount of wall material around a narrowed lumen ) is usually observed [ 4 , 5 ] . mechanisms possibly involved in the genesis of microangiopathy left : media to lumen ratio in subcutaneous small resistance arteries from normotensive patients ( nt ) , essential hypertensive patients ( ht ) , normotensive patients with niddm ( dm 2 type ) and hypertensive patients with niddm ( dm 2 type and ht ) . a clear increase may be observed in all three pathologic groups , which is more evident in hypertensive patients with niddm . right : collagen to elastin ratio ( measured with electronic microscope ) in the different groups . an increase was observed in essential hypertensive patients and in hypertensive patients with niddm . * * * p < 0.001 versus normotensive patients ; # p < 0.05 versus essential hypertensive patients . medial cross - sectional area in subcutaneous small resistance arteries from normotensive patients ( nt ) , essential hypertensive patients ( ht ) , normotensive patients with niddm ( dm 2 type ) and hypertensive patients with niddm ( dm 2 type and ht ) . an increase may be observed in the diabetic patients , which is more evident in normotensive patients with niddm . . a weak , but significant correlation between circulating levels of insulin and media to lumen ratio of subcutaneous small arteries was observed in diabetic patients , thus suggesting a possible role of insulin or insulin - like growth factor-1 in the genesis of hypertrophic remodelling in these patients . however , an alternative explanation for the presence of hypertrophic remodelling in these vessels has been proposed . in fact , a possible stimulus for hypertrophic remodelling could be the increased wall stress , as a consequence of the impaired myogenic response . myogenic response is a pressure - induced vasoconstriction , which is the key component of blood flow autoregulation and stabilization of capillary pressure . the observation by schofield et al . of the lack of such a myogenic response in diabetic patients may therefore be responsible for the development of hypertrophic remodelling of small arteries ( fig . diabetic patients with niddm also show particularly evident alterations of the vascular extracellular matrix , as suggested by the observation of increased collagen to elastin ratio in their small arteries ( fig . lumen diameter relations for arteries from control patients ( ) , patients with eh ( ) and hypertensive patients with niddm ( ) . active pressure lumen diameter relations for arteries from control patients ( ) , patients with essential hypertension ( ) and hypertensive patients with niddm ( ) . although small resistance arteries and arterioles may undergo a remodelling process and fibrosis in patholological conditions , capillaries may undergo a functional or structural rarefaction , with consequent reduction in the density per area units of tissue . this process of vascular rarefaction was previously observed in patients with hypertension and also in patients with niddm , at least in the skeletal muscle . on the contrary , in other vascular districts such as the retina , microvascular proliferation may be observed . in fact , diabetic retinopathy results either from capillary leakage or from new vessel formation ( neovascularization , angiogenesis ) , caused by capillary closure and retinal ischemia . the capillaries leak lipid products and fluid in the area around the fovea and thicken the retina , which may lead to macular oedema . angiogenesis is the result of retinal ischemia , and retinal haemorrhages are the consequence of the fragility of neovessels . several mechanisms and metabolic abnormalities , acting alone or in concert with each other , may lead to capillary death , leakage and occlusion and to the release of growth factors , finally resulting in new vessel formation and increased vascular permeability . a relevant role is played by vascular endothelial growth factor . whereas vascular endothelial growth factor is involved in vascular leakage and angiogenesis , growth hormones and the insulin - like growth factor-1 are involved , as mediators , in angiogenesis . at present , inhibitors of these growth factors are under investigation in clinical trials in patients with diabetic retinopathy . as previously mentioned , the extent of structural alterations in small resistance vessels is more pronounced in patients with both diabetes mellitus and hypertension , thus suggesting that clustering of risk factors may have synergistic deleterious effects on the vasculature [ 4 , 5 ] . an important pathophysiological and clinical consequence of the presence of structural alterations in small resistance arteries and arterioles may be an impairment of vasodilator reserve . in fact , as mentioned in the previous section , remodelling of small resistance arteries is characterized by a narrowing of the lumen , which leads to an increase of flow resistance even at full dilatation , i.e. in the absence of vascular tone . a significant correlation between coronary flow reserve and subcutaneous small resistance artery remodelling has been observed in hypertensive patients , suggesting that structural alterations in small resistance arteries may be present at the same time in different vascular districts , including those of paramount clinical importance , such as coronary circulation . an impaired microvascular hyperaemic response ( which may reflect an altered flow reserve ) has been observed in children with diabetes mellitus as well as in adult patients with niddm . thus , alterations in the microcirculation may play an important role in the development of organ damage not only in hypertension but also in diabetes mellitus . in fact , a relevant prognostic role of an increased media to lumen ratio of subcutaneous small resistance arteries in a high - risk population ( including normotensive and hypertensive diabetic patients ) has been previously demonstrated . more recently , these data have been re - evaluated , taking into account also the characteristics of the vascular remodelling . as previously mentioned , an increased media to lumen ratio in small arteries may be ascribed either to eutrophic or to hypertophic remodelling . for the same values of internal diameter , those patients who suffered cardiovascular events had a greater media cross - sectional area , in comparison with those without cardiovascular events , thus suggesting the presence of vascular smooth muscle cell growth . therefore , it seems that , for the same size of the vessels explored , a greater amount of vascular wall material , suggesting the presence of hypertrophic remodelling , such as that observed in diabetic patients , could mean an even worse prognosis . it may be postulated that hypertrophic remodelling might be a less physiological adaptation to increased blood pressure levels , thus playing a role in the development of target organ damage , both in hypertension and in diabetes mellitus . it has been also suggested , as previously reported , that an impairment of myogenic response may have a relevant role in the development of hypertrophic remodelling in patients at high cardiovascular risk . in addition , an impaired myogenic response in small vessels may also induce an increase of high blood pressure flow to target organs and downstream increase in capillary pressure , with consequent increased permeability and capillary leakage . some data support the presence of an increased capillary pressure in patients with diabetes mellitus , especially if they have increased blood pressure values , although presently there is no general agreement about this issue . the increase in capillary pressure seems to be related to the extent of clinical complications as well as to metabolic control . in fact , it has been demonstrated that in patients with niddm , the mechanisms through which insulin is able to increase total limb flow or achieve optimal microvascular perfusion is impaired . an impairment of the endothelial function , as evaluated by the vasodilator response to acetylcholine , has been detected in large and small arteries of patients with iddm [ 1721 ] as well as of those with niddm [ 4 , 5 , 2224 ] . endothelial cells are known to have important regulatory effects on the cardiovascular system through the release of vasodilator and vasoconstrictor factors . in addition , platelet aggregation as well as leucocyte extravasation through endothelium may be influenced by locally produced compounds . therefore , endothelial dysfunction and damage may contribute to the inflammatory and thrombotic vascular lesions . we and others have previously demonstrated the presence of an impaired dilatation to acetylcholine and bradykinin in subcutaneous small resistance arteries of hypertensive and normotensive patients with niddm [ 4 , 5 , 24 ] . however , the concomitant presence of the two cardiovascular risk factors does not seem to induce a further worsening of endothelial function [ 4 , 24 ] . a possible explanation is that , both in hypertension and in diabetes mellitus , oxidative stress , resulting from the vascular production of free radicals and/or cyclooxygenase - dependent substances , may reduce nitric oxide bioavailability . if the pathogenetic mechanism of endothelial dysfunction is similar in the two conditions , no additive effect should be expected . a second important point relates to the mechanisms of endothelial dysfunction in small resistance arteries of hypertensive and diabetic patients . in essential hypertensive patients , the relatively small vasodilator responses to acetylcholine and bradykinin infused into the brachial artery are not usually blocked by inhibitors of nitric oxide synthase ( i.e. l - nmma ) , whereas in normotensive patients the inhibitory effect of l - nmma is preserved . in subcutaneous small arteries of patients with essential hypertension , and also in those with niddm , inhibitors of nitric oxide synthase are able to block about 50% of the vasodilator effect of acetylcholine or bradykinin , whereas the remaining vasodilatation is blocked by ouabain , thus suggesting that production of both nitric oxide and endothelium - derived hyperpolarizing factor may be involved [ 4 , 24 ] . no effect has been observed when indomethacin was added to the organ bath ; therefore , the production of cyclooxygenase - dependent substances seems to be of minor importance [ 4 , 24 ] . it has been also proposed that insulin and insulin resistance may be involved in the genesis of endothelial , and in general , microvascular dysfunction in diabetes mellitus . insulin is able to induce a vasodilating effect in the microcirculation ( which is , at least in part , endothelium dependent ) in normal patients [ 25 , 26 ] . in addition , insulin may recruit skeletal muscle capillaries in vivo by a nitric oxide dependent action , and this increased capillary recruitment may contribute to the subsequent glucose uptake . hyperinsulinaemia , as a result of insulin resistance may have detrimental effects on microvascular function also in the pre - diabetic state . on the other hand microvascular therefore , a complex interplay of structural and functional alterations of the microcirculation may , at least in part , explain the detrimental consequences of diabetes mellitus in terms of organ perfusion , and , ultimately , in terms of increased incidence of cardiovascular events . there are relatively few data about the effect of treatment on structural and functional alterations in the microcirculation of patients with diabetes mellitus . in the united kingdom prospective diabetes study , a large randomized controlled trial that included almost 5000 patients , it has been demonstrated that a tight haemodynamic and metabolic control is associated with a lower incidence of microvascular disease , and , in general , of clinical end - points related to microvascular disease . even fewer data are presently available about the effects of antihypertensive drugs on small artery structure in hypertensive diabetic patients . despite effective antihypertensive treatment , resistance arteries from hypertensive diabetic patients showed marked remodelling , greater than that of vessels from untreated , non - diabetic , hypertensive patients , in agreement with the high cardiovascular risk of patients suffering from both diabetes and hypertension . recently , a study has compared the effects of 1-year treatment with the angiotensin - converting enzyme ( ace ) inhibitor ( enalapril ) or the angiotensin ii receptor blocker ( candesartan ) , on subcutaneous small artery structure in hypertensive patients with niddm . the two drugs were equally effective in reducing media to lumen ratio of small arteries ( fig . 4 ) ; however , candesartan was more effective than enalapril in normalizing vascular collagen content , probably through a more pronounced stimulation of the local production of metalloproteinase 9 ( a collagen - degrading enzyme ) . at variance to what observed in the majority of studies in normoglycaemic hypertensive patients , media to lumen ratio of small arteries in treated diabetic patients did not reach the values observed in normotensive controls , therefore suggesting that a complete regression of vascular hypertrophic remodelling is probably more difficult to obtain . angiotensin ii receptor blockers seem to be effective in diabetic hypertensive patients also when given on top of an ace inhibitor treatment . in addition , angiotensin ii receptor blockers seem to be also particularly effective in terms of improvement of endothelial function in small resistance arteries ( fig . 5 ) . it has been recently proposed that drugs that may stimulate ppar- or ppar- receptors ( such as fibrates of glitazones ) may be useful in terms of vascular protection and regression of structural alterations in the microcirculation in addition we do not know whether a regression of vascular structural or functional alterations in diabetic patients may be prognostically relevant , i.e. whether it is associated to a real protection from cardiovascular events . media to lumen ratio in subcutaneous small resistance arteries from hypertensive patients with niddm , before and after 1-year treatment with the ace inhibitor enalapril or the angiotensin ii receptor blocker candesartan . bp = blood pressure * * = p < 0.01 versus basal ( from ) . dilatation of vessels comparing control patients with normotensive and hypertensive type 2 dm ( a ) and response assessed by change in ec50 , maximal relaxation and overall relaxation to candesartan in normotensive ( b ) and hypertensive ( c ) type 2 dm exposed to increasing concentrations of acetylcholine after pre - constriction with norepinephrine ( from ) . recently , it was observed that small arteries from patients with type 1 diabetes mellitus show hypertrophic growth in response to elevated blood pressure , similar to that seen in type 2 diabetes mellitus . however , metabolic improvements enable eutrophic remodelling to occur in response to an increase in blood pressure . the relative invasiveness of the fat tissue biopsy , the limited availability of the technique ( performed in few laboratories ) and the lack of prognostic data about regression of microvascular alterations , makes this approach unsuitable for general use. we are presently waiting for non - invasive approaches , which may provide us with further important insight about the effect of antihypertensive drugs , and , more importantly , about the possible prognostic impact of the regression of vascular structural alterations in hypertension and diabetes . the recently proposed evaluation of the media to lumen ratio of retinal arteries seems to represent a promising approach in this regard . the relative invasiveness of the fat tissue biopsy , the limited availability of the technique ( performed in few laboratories ) and the lack of prognostic data about regression of microvascular alterations , makes this approach unsuitable for general use. we are presently waiting for non - invasive approaches , which may provide us with further important insight about the effect of antihypertensive drugs , and , more importantly , about the possible prognostic impact of the regression of vascular structural alterations in hypertension and diabetes . the recently proposed evaluation of the media to lumen ratio of retinal arteries seems to represent a promising approach in this regard . alterations in the microcirculation represent a common finding , and microangiopathy is one of the most important mechanisms involved in the development of organ damage as well as of clinical events in patients with diabetes mellitus . both patients with essential hypertension and those with niddm are characterized by alterations in the resistance vasculature , i.e. an increased media to lumen ratio , which in diabetics is the consequence of the so - called hypertrophic remodelling . structural alterations of small arteries are associated with an increased cardiovascular risk in hypertensive and diabetic patients , perhaps as a consequence of an impaired organ flow reserve in several vascular districts , including the coronary vascular bed . in fact , it has been observed that the presence of an increased wall to lumen ratio in the subcutaneous resistance arteries is associated with a worse prognosis in high - risk patients . hypertrophic remodelling , such as that observed in diabetic patients , seems to be associated with an even worse prognosis . data about the effect of therapy on microvascular structure in diabetic patients are scarce ; however , renin angiotensin system blockade seems to be effective in regressing , at least in part , the microvascular structure , although we do not know whether this improvement is associated with a better clinical prognosis .
abstractthe aim of this article is to briefly review available data regarding changes in the structure of microvessels observed in patients with diabetes mellitus , and possible correction by effective treatment . the development of structural changes in the systemic vasculature is the end result of established hypertension . in essential hypertension , small arteries of smooth muscle cells are restructured around a smaller lumen and there is no net growth of the vascular wall , although in some secondary forms of hypertension , a hypertrophic remodelling may be detected . moreover , in non - insulin - dependent diabetes mellitus a hypertrophic remodelling of subcutaneous small arteries is present . indices of small resistance artery structure , such as the tunica media to internal lumen ratio , may have a strong prognostic significance in hypertensive and diabetic patients , over and above all other known cardiovascular risk factors . therefore , regression of vascular alterations is an appealing goal of antihypertensive treatment . different antihypertensive drugs seem to have different effect on vascular structure . in diabetic hypertensive patients , a significant regression of structural alterations of small resistance arteries with drugs blocking the renin angiotensin system ( angiotensin - converting enzyme inhibitors , angiotensin ii receptor blockers ) was demonstrated . alterations in the microcirculation represent a common pathological finding , and microangiopathy is one of the most important mechanisms involved in the development of organ damage as well as of clinical events in patients with diabetes mellitus . renin angiotensin system blockade seems to be effective in preventing / regressing alterations in microvascular structure .
the study population consisted of 30 subjects belonging to both sexes and all the subjects selected were from the outpatient clinics of the department of periodontics , in jkkn dental college . the following parameters were evaluated for the subjects : plaque index ( pi ) , the gingival index ( gi ) , probing depth ( pd ) , and clinical attachment loss ( cal ) . fifteen subjects with good oral hygiene , no bleeding on probing , no visual signs of gingival inflammation , gi = 0 , no cal were included in group i. the chronic periodontitis group ( group ii ) consisted of 15 subjects with pd 5 mm and cal 2 mm . exclusion criteria were gingivitis , aggressive forms of periodontal disease , history of periodontal treatment received in the past 6 months , medications that would affect the periodontal status , history of underlying systemic disease , anomalies of the immune system , smoking and tobacco chewing habits . approval from the ethical committee of the institution was obtained , the nature and purpose of the study were explained to the subjects and written consent was taken . selection of the test site , detailed case history , clinical examination , and supragingival scaling were done 1-day before the collection of gcf . on the subsequent day after drying the area with a blast of air , a supragingival plaque was removed without touching the marginal gingiva , and the gcf was collected . a standardized volume of 3 l was collected from each test site with an extracrevicular approach ( unstimulated ) , using volumetric capillary pipettes ( sigma - aldrich chemicals company limited , usa ) that were calibrated from 1 to 10 l . the collected gcf was transferred immediately to plastic vials and stored at 70c until the time of assay . adam8 was determined using a commercially available enzyme - linked immunosorbent assay kit according to the manufacturer 's instructions . the data were analyzed statistically , to find the mean and test of significance of mean values for the various parameters between the groups . the p < 0.05 was considered statistically significant . the pearson correlation analysis was done to assess the relationship between the various clinical parameters and adam8 levels in each study group . the data were analyzed statistically , to find the mean and test of significance of mean values for the various parameters between the groups . the kruskal the pearson correlation analysis was done to assess the relationship between the various clinical parameters and adam8 levels in each study group . the clinical parameters recorded were compared between group i and ii and depicted in table 1 . the adam8 level in the study groups is described in table 2 and graph 1 . the adam8 levels in group i ranged between 0.29 and 0.84 ng / ml and between 5.56 and 20.97 ng / ml in group ii . comparison of the levels of adam8 in the two different groups showed that the mean adam8 level in group ii ( 10.35 4.435 ) is significantly higher than the mean adam8 level in group i ( 0.57 0.179 ) ( p < 0.05 ) . the relationship between adam8 level and various clinical parameters within the study group is shown in table 3 . comparison of clinical parameters between group i and group ii comparison of adam8 levels between group i and ii comparison of a disintegrin and metalloproteinase 8 levels between group i and ii correlation of clinical parameters with adam8 levels in group ii ( correlation coefficient ) periodontal diseases are a complex group of diseases characterized by inflammation and the subsequent destruction of the tooth supporting tissue . the destruction of the periodontal tissue is caused by the bacterial infection and host immune response , either directly or indirectly by various mediators that can activate osteoclastic activity . the loss of periodontal attachment and bone destruction during periodontitis is at least partly due to mmps . as gcf permeates through the diseased soft tissue of the periodontal pocket , contains molecules from the periodontal disease process and so it is considered the most promising source of biochemical indicators like mmps . according to hannas et al . , mmp activity is observed in a transmembrane protein containing both adam domain presenting both cell adhesion and protease activity . adams are glycoproteins that share homology with snake venom metalloproteinase / disintegrins and sperm surface proteins . among other biological functions , adams are involved in the release of membrane - anchored proteins , such as tumor necrosis factor- ( tnf- ) , transforming growth factor- , and l - selectin , from the plasma membrane . a disintegrin and metalloproteinase 8 plays various role in the pathogenesis of periodontal disease . for example , the proteolytic activity is exerted by the metalloproteinase domain of adam8 , which contributes to the destruction of the extracellular matrix . the shedding of l - selectin and vascular cell adhesion molecule-1 by the metalloproteinase domain may regulate and limit the influx of some subsets of leukocytes into the periodontal tissues as determined by gmez - gaviro et al . choi et al . , found that the disintegrin and cysteine - rich domains of adam8 are involved in cell to cell fusion of osteoclast precursors to become mature multinucleated osteoclasts , may be responsible for alveolar bone resorption in periodontitis . kataoka et al . , experimented murine cd156 gene and found that adam8 is expressed mainly in cells of the immune system particularly monocytes and granulocytes . furthermore , its expression has been shown to be inducible by lipopolysaccharide and interferon and by tnf- in the central nervous system . a disintegrin and metalloproteinase family is involved in ectodomain shedding , by which the biologically active cytokines , growth factors , and their receptors are released from membrane - bound precursors . adam8 is able to cleave membrane - bound cd23 , low - affinity ige receptor as detected by fourie et al . according to them , adam8 dependent soluble cd23 release requires proteolytically active adam8 and a physical association of adam8 with the membrane - bound form of cd23 . this proteolytic release of soluble cd23 by the metalloprotease activity caused up - regulation of ige production and the induction of inflammatory cytokines . as adam8 is expressed in the same cell types as cd23 , they finalized that adam8 can contribute to ectodomain shedding of cd23 , and thus it is a potential target for intervention in allergy and inflammation . elevated levels of soluble adam8 are detected in serum , bronchoalveolar lavage fluid , and amniotic fluid in association with several pathologic and inflammatory - related conditions , including myocardial infarction , asthma , pneumonia , allergy , rheumatoid arthritis , and preterm delivery . the presence of adam8 and the raised adam8 levels in gcf of patients with periodontal diseases corresponds well with the elevated levels of adam17 ( tnf--converting enzyme ) , another member of the adamalys in subfamily in periodontitis . tnf- , which is one of the major proinflammatory cytokines in periodontal diseases , induces the expression of adam8 in astrocytes and neuronal cells as determined by schlomann et al . black et al . , found that increased levels of adam17 , which primarily cleaves membrane - anchored protein tnf- to activate soluble tnf- and may generate a greater than normal level of tnf- in gcf , which may lead to an enhancement of adam8 production in periodontal disease . , concluded that there is an increase in the level of adam8 in periodontitis condition . the present study was undertaken to determine the potential role of adam8 in the subjects by quantifying its level in the gcf in periodontal health and disease . the main finding of our study was that the mean concentration of adam8 in gcf was found to increase progressively from health ( 0.57 0.179 ng / ml ) to periodontitis ( 10.35 4.435 ng / ml ) . this was in accordance with that of a study done by khongkhunthian et al . , who reported increasing adam8 levels in gcf with the progression of periodontal disease . , investigated that the median adam8 levels were increased in accordance with severity of periodontal disease , that is , the patients with chronic and aggressive periodontitis had significantly higher median adam8 levels than did patients with gingivitis . this explained by the fact that adam8 plays a pivotal role in both inflammation and bone loss , would be expected to have higher adam8 levels than the sites with only gingival inflammation without periodontal tissue loss in gingivitis . it is also due to an accumulation of various types of inflammatory cells in diseased periodontal tissues because adam8 is mainly expressed in neutrophils , b - lymphocytes , dendritic cells , and monocytes . when the pair - wise comparison was done , a statistically significant difference was observed between healthy and chronic periodontitis group . the correlation of adam8 concentration with the four clinical parameters of periodontal status were investigated . the adam8 concentration was positively correlated with pi and gi score in group ii ( 0.864816 and 0.857188 , respectively ) , indicating that the adam8 levels are associated with the degree of periodontal tissue inflammation . moreover , the adam8 concentration were also positively correlated with pd and cal in group ii ( 0.602501 and 0.910716 , respectively ) , indicating that the adam8 levels are positively associated with the degree of periodontal tissue destruction . the pathogenesis and progression of periodontitis are mainly caused by bacterially induced aberrant host immunity . as adam8 regulates the functions of neutrophils , it was concluded that it has a significant role in innate immunity . some studies have shown that cytokines produced by th1 subsets and th2 subsets in acquired immunity can up - regulate adam8 expression in systemic organs . since our data shows that all the gcf samples tested positive to adam8 , it can be considered as a biomarker of periodontal disease progression . however , controlled longitudinal , with a larger population and more solid phase assays are needed to verify this possibility .
aim and background : a disintegrin and metalloproteinase 8 ( adam8 ) is a marker belonging to the class of adam family of metalloproteinase which is found to be involved in inflammation and bone resorption in periodontal disease by acting as osteoclast stimulating factor . in several systemic inflammatory diseases , elevated levels of adam8 are detected in human serum and other body fluids . recently , adam8 was even detected in gingival crevicular fluid ( gcf ) of patients with periodontal diseases . hence , the aim of the study was to estimate the levels of adam8 in gcf of healthy and chronic periodontitis subjects.materials and methods : periodontal examination and collection of gcf by the extracrevicular method was performed in 30 subjects selected randomly and categorized into two groups . group i ( healthy , n = 15 ) and group ii ( chronic periodontitis , n = 15 ) . adam8 levels in gcf were estimated by enzyme - linked immunosorbent assay.results:adam8 was detected in both group i and ii . highest mean adam8 concentration was obtained for group ii , whereas the lowest concentration was seen in group i. this suggests that adam8 levels increase proportionally with the progression of periodontal disease . there was a significant correlation between adam8 levels and clinical parameters in the study group.conclusion:the results of our study indicate that the adam8 levels in gcf are positively associated with periodontal disease , which may provide a useful tool in monitoring its progression . nevertheless , further longitudinal studies are required with larger sample sizes in which adam8 levels are progressively estimated and compared to baseline values .
bacterial strains : a total of 123 strains of s. aureus isolated in 2007 and 2008 from subclinical bovine mastitis ( scm ) milk samples were included in this study . the bacterial strains were identified as s. aureus by colonial and microscopic morphology examination and tube tests for coagulase and catalase activity . the strains were additionally tested by using pcr analysis to amplify the part of the nuc gene , encoding thermostable nuclease , specific for s. aureus . the primer sequences and pcr conditions are presented in table 1table 1.sequences of starters used for pcr analysisno.detected geneprimer sequencessize of thepcr product ( bp)references1nucnucf : 5 gcgatagatggtgatacggttnucr : 5 agccaagccttgacgaactaaagc2702mecamec1 : 5aaaatcgatggtaaaggttggmec2 : 5agttctgcagtaccggatttgc5333blazblaz1 : 5aagagatttgcctatgcttcblaz2 : 5 gcttgaccacttttatcagc517 . this part of the analyses was performed during our previous research aimed at analysis of the biofilm production of these strains . antimicrobial susceptibility testing : bacteria were grown at 37c for 18 to 24 hr on a nonselective luria agar medium ( a&a biotechnology , gdynia , poland ) , and their antimicrobial susceptibility was evaluated using the disk diffusion method on mueller - hinton agar ( sigma - aldrich corp . , st . louis , mo , u.s.a . ) according to the guidelines of the clinical and laboratory standards institute ( clsi ) . lenexa , ks , u.s.a . ) were tested : penicillin ( p ; 10 i.u ) , amoxicillin ( aml ; 25 g ) , amoxicillin with clavulanic acid ( amc ; 30 g ) , ampicillin ( amp ; 10 g ) , cephalothin ( kf ; 30 g ) , clindamycin ( da ; 2 g ) , cloxacillin ( ob ; 5 g ) , cefoperazone ( cfp ; 75 g ) , erythromycin ( e ; 15 g ) , gentamicin ( cn ; 10 g ) , enrofloxacin ( enr ; 5 g ) , lincomycin ( my ; 15 g ) , linezolid ( lzd ; 30 g ) , neomycin ( n ; 30 g ) , vancomycin ( va , 30 g ) , oxacillin ( ox ; 1 g ) , rifampicin ( rd ; 5 g ) , streptomycin ( s ; 10 g ) , tetracycline ( te ; 30 g ) and trimethoprim / sulfamethoxazole ( sxt ; g ) . the inoculated agar plates with discs were left at room temperature for 30 min and then incubated at 35c for 24 hr . following the incubation , the diameters of the inhibition zones were measured in millimeters and compared with the ranges suggested by the manufacturer of the disks ( oxoid , thermo fisher scientific inc . ) . the strains were classified as resistant , intermediate or susceptible on the basis of the size of the inhibition zone . mic assay : the strains that exhibited resistance to at least one tested antibiotic ( n=37 ) and two strains susceptible to all chemotherapeutics were additionally analyzed for resistance to lysostaphin , nisin , polymyxin b and lysozyme ( all from sigma - aldrich corp . ) . the minimal inhibitory concentration ( mic ) values of these agents were determined using the broth microdilution method according to the standard protocol of the clsi with a slight modification proposed by kusuma and kokai - kun . briefly , twofold dilutions of tested agents were performed in cation - adjusted mueller - hinton broth ( sigma - aldrich corp . ) supplemented with 2% of nacl and 0.1% of bovine serum albumin ( bsa ; sigma - aldrich corp . ) . wells of a 96-well polystyrene plate were inoculated with 5 10 cfu / ml of s. aureus strains per well diluted from the overnight culture of the bacteria grown on luria agar . a control comprised of growth of strains with no tested agents was included in each assay . the determination of the mic values of the tested agents was performed by measuring the absorbance at 531 nm using a vector microplate reader ( perkinelmer , inc . , the lowest concentration of antibiotic yielding inhibition of growth equal or higher than 90% of growth control was taken as the mic value . the presence of 0.1% of bsa in each well was necessary to inhibit nonspecific lysostaphin ( and probably other agents ) adherence to the polystyrene plate , which was previously observed by climo et al . . -lactamase production : the production of -lactamases , the enzymes responsible for resistance to -lactam antibiotics , was analyzed using nitrocefin discs according to the manufacturer s instructions ( remel , thermo fisher scientific inc . , the strains were additionally tested for presence of the blaz gene coding for these enzymes . isolation of dna : each isolate was subcultured overnight in 1 ml of luria broth ( a&a biotechnology ) . after centrifugation ( 12,000 g , 1 min ) , dna was purified from bacterial cells using a bacterial & yeast genomic dna purification kit ( eurx , gdask , poland ) according to the manufacturer s instruction with minor modifications . namely , 10 l of lysostaphin ( 1 u ; sigma - aldrich corp . ) solution was added to the cell suspension for enzymatic lysis of s. aureus cell wall murein . the mixture was incubated at 37c for 30 min . obtained dna solutions were stored at 20c until further analysis . pcr conditions : the amplification reactions were performed using an automated thermocycler ( eppendorf mastercycler gradient ; eppendorf poland , warszawa , poland ) . three different targets were amplified : nuc , meca and blaz . in all three cases , the same composition of reaction mixtures was used : 2 l of dntps ( 2.5 mm each ) , 2.5 l of 10 pcr reaction buffer ( 100 mm tris - hcl , ph 8.8 , 1 mm dtt , 0.1 mm edta , 100 mm kcl , 0.5% nonidet p40 and 0.5% tween 20 ) , 2 l of mgcl2 solution ( 50 mm ) , 1 l of each of the 2 required primer solutions ( 10 m ) , 1 l of dna solution ( prepared as described above ) , 0.2 l ( 1 u ) of polymerase delta from pyrococcus woesei(dna - gdask ii s.c . , poland ) and deionized sterile water to adjust the mixture volume to 50 l . the primer sequences applied are presented in table 1 . in the case of all three genes , the following pcr conditions were used to generate the amplicons : 94c for 240 sec ; 35 cycles of 94c for 30 sec , 55c for 30 sec and 72c for 30 sec ; and then 72c for 300 sec for final extension . the gels were stained with ethidium bromide ( 1 g / ml ) , and bands were visualized in uv light . the level of antibiotic resistance of the investigated group of strains was low overall ( table 2table 2.the resistance rates of s. aureus subclinical mastitis isolates for particular antibioticsno.antibioticnumber of resistant / intermediatelyresistant strains% of resistant/ intermediatelyresistant strainscode number of resistant / intermediatelyresistant isolate1p29/023.6/01 , 5 , 9 , 11 , 29 , 34 , 38 , 39 , 42 , 54 , 70 , 71 , 72 , 74 , 75 , 78 , 83 , 84 , 86 , 93 , 94 , 95 , 101 , 102 , 103 , 104 , 105 , 112 , 113 / -2amp28/022.8/01 , 5 , 9 , 11 , 29 , 34 , 38 , 39 , 42 , 54 , 70 , 71 , 72 , 74 , 75 , 78 , 83 , 84 , 86 , 93 , 94 , 95 , 102 , 103 , 104 , 105 , 112 , 113 / -3aml22/117.9/0.81 , 5 , 9 , 11 , 29 , 54 , 70 , 71 , 72 , 74 , 75 , 83 , 84 , 86 , 93 , 94 , 95 , 102 , 103 , 104 , 105 , 113 / 784s13/010.6/06 , 11 , 27 , 66 , 76 , 84 , 88 , 93 , 94 , 95 , 101 , 116 , 119 / -5e3/02.4/027 , 101 , 112 / -6my2/01.6/027 , 101 / -7te2/01.6/053 , 70 / -8n2/01.6/027 , 101 / -9amc2/01.6/01 , 11 / -10da2/01.6/027 , 101 / -11sxt1/00.8/012 / -12cfp0/50/4.1- / 1 , 83 , 84 , 86 , 103 , 10513ox0/10/0.8- / 101p : penicillin , amp : ampicillin , aml : amoxicillin , s : streptomycin , e : erythromycin , my : lincomycin , te : tetracycline , n : neomycin ; amc : amoxicillin with clavulanic acid , da : clindamycin , sxt / trimethoprim / sulfamethoxazole , cfp : cefoperazone , ox : oxacillin . ) . eighty - six out of 123 examined isolates were susceptible to all 20 tested antibiotics ( 70% ) . cephalothin , cloxacillin , enrofloxacin , gentamicin , linezolid , rifampicin and vancomycin were active against all strains tested . the highest percentage of resistance was observed in the case of streptomycin ( n=13 ; 10.6% ) and -lactam antibiotics : amoxicillin ( n=22 , 17.9% ) , ampicillin ( n=28 , 22.8% ) and penicillin ( n=29 , 23.6% ) . in fact , all strains resistant to amoxicillin and ampicillin were also resistant to penicillin ( n=22 , 17.9% ) . twenty - five of the penicillin - resistant strains were also found to carry the blaz gene coding for -lactamases , which was generally in concordance with the nitrocefin test . although the level of antibiotic resistance was low overall , the worrisome problem is isolation of several strains that could be classified as multidrug resistant ( mdr ) strains ( table 3table 3.the antibiotic resistance profile of s. aureus mastitis isolatesno.number of antibioticsfor resistance / intermediate resistancephenotype of resistancenumber of strains11/0sxt1te1p1s522/0amp+p432/1amp+p / aml143/0amp+p+aml11amp+p+e153/1amp+p+aml / cfp364/0amp+p+aml+s4amp+p+aml+te174/1amp+p+aml+amc / cfp1amp+p+aml+s / cfp185/0amp+p+aml+amc+s1da+e+my+s+n196/1p+da+e+my+s+n / ox1p : penicillin , amp : ampicillin , aml : amoxicillin : s : streptomycin : e : erythromycin , my : lincomycin : te : tetracycline , n : neomycin : amc : amoxicillin with clavulanic acid , da : clindamycin , sxt : trimethoprim / sulfamethoxazole , cfp : cefoperazone , ox : oxacillin . ) carrying resistance to 6 antibiotics and intermediate resistance to 1 agent ( n=1 , 0.8% ) , five antibiotics ( n=2 , 1.6% ) , four antibiotics and intermediate resistance to 1 agent ( n=2 , 1.6% ) and four antibiotics ( n=5 , 4.0% ) . the strains resistant to 6 and 5 antibiotics were found to be meca positive , so they could also be classified as mrsa ( methicillin - resistant s. aureus ) ; however , only the first one was phenotypically intermediately resistant to oxacillin in the disc diffusion assay . in the case of nonantibiotic agents tested by the microdilution method , the best results were obtained for lysostaphin ( table 4table 4.bactericidal activity of the alternative agents against s. aureus isolates resistant to at least one of the tested antibiotics . sensitive strains , with numbers 2 and 3 , were used as a controlcode numberof the strainlysostaphin mic(g / ml)nisin mic(g / ml)polymyxin b mic(g / ml)lysozyme mic(g / ml)10.12551.264>204850.12551.264>204890.03151.264>2048110.01612.832>2048120.01612.864>2048270.01651.264>2048290.12551.264>2048340.551.232>2048380.12551.264>2048390.01625.664>2048420.03112.864>2048530.00825.664>2048540.01625.664>2048660.00812.864>2048700.06325.664>2048710.06312.864>2048720.01651.264>2048740.03112.864>2048750.00825.664>2048760.01625.632>2048780.01625.664>2048830.01651.264>2048840.06351.232>2048860.03125.664>2048880.06325.664>2048930.00825.664>2048940.01625.632>2048950.01651.2128>20481010.00851.264>20481020.00851.2128>20481030.00851.264>20481040.06351.264>20481050.06351.264>20481120.5>51.264>20481130.00851.264>20481160.03112.864>20481190.01625.632>204820.06325.664>204830.00812.864>2048 ) . there is no defined or officially accepted mic value for this protein that could be used as a susceptibility breakpoint . however , some authors , for example , kusuma and kokai - kun , classify staphylococci as resistant to lysostaphin , if the mic value is higher than 32 g / ml . the lysostaphin mic values for all strains tested were definitely lower and were in the range from 0.008 to 0.5 g / ml , so all of them can be classified as susceptible . polymyxin b was able to inhibit the growth of most of the strains tested ( n=31 , 79.5% ) at a concentration of 64 g / ml ; for 6 isolates , the mic value for this agent was 32 g / ml , and 2 strains required a higher concentration , 128 g / ml , for growth inhibition . p : penicillin , amp : ampicillin , aml : amoxicillin , s : streptomycin , e : erythromycin , my : lincomycin , te : tetracycline , n : neomycin ; amc : amoxicillin with clavulanic acid , da : clindamycin , sxt / trimethoprim / sulfamethoxazole , cfp : cefoperazone , ox : oxacillin . p : penicillin , amp : ampicillin , aml : amoxicillin : s : streptomycin : e : erythromycin , my : lincomycin : te : tetracycline , n : neomycin : amc : amoxicillin with clavulanic acid , da : clindamycin , sxt : trimethoprim / sulfamethoxazole , cfp : cefoperazone , ox : oxacillin . taking into account this value , 18 out of 39 isolates from our collection were resistant to this agent s activity . however , in the case of 17 of them , the mic value was 51.2 g / ml and was not much higher than the susceptibility breakpoint value , and only in the case of 1 strain ( assigned as 112 ) , the nisin mic value was above 51.2 g / ml . the same strain was less susceptible to lysostaphin activity , which suggests a modified composition of the cell wall . however , the detailed mechanism of higher resistance to both agents was not determined and in our opinion requires further investigation . as expected , all strains tested were resistant to lysozyme activity ( mic above 2048 g / ml ) . the presented results indicated a considerable prevalence of antibiotic resistant strains among s. aureus isolated from bovine mastitis in the eastern part of poland . similar to studies of other authors from different regions of the world , the highest rate of resistance was detected for -lactam antibiotics . the resistance to other tested agents was less common , which is also in agreement with the general trend observed worldwide . however , earlier published reports aimed at analysis of the antibiotic resistance of s. aureus strains isolated from mastitis in poland indicated markedly higher levels of antibiotic resistance . in comparison , among the isolates examined by malinowski et al . , the rates of resistance to penicillin , tetracycline and lincomycin were 62.3% , 41.7% and 39.4% , respectively ( in each case , over 800 strains were tested ) . additionally , the authors found that over 20% of the investigated strains were resistant to bacitracin and cephalexin . higher occurrence of resistance among s. aureus isolates was also observed by sachanowicz et al . , who analyzed strains from the same region , although earlier , in 2005 and 2006 . high percentages of resistance against -lactam antibiotics were also observed in several different geographical regions . among 103 strains isolated in turkey , the rates of resistance to penicillin , ampicillin and amoxicillin were 62.1% , 56.3% and 45.6% , respectively . in the same study , about 50% resistance was found in the case of gentamicin ( 56.3% ) and trimethoprim / sulfamethoxazole ( 45.6% ) . additionally , eighteen of these strains were found to be phenotypically resistant to methicillin . however , aslanta et al . , who analyzed a group of 104 strains isolated from subclinical bovine mastitis cases during 2006 to 2008 in hatay province , turkey , found that 25% of them were resistant to macrolide and lincosamide ( ml ) antibiotics . resistance to -lactam antibiotics , ampicillin ( 59.5% ) and penicillin ( 61.4% ) , was very common in a group of over 170 strains isolated in estonia . in the same study , markedly high resistance other tested antibiotics , i.e. , tetracycline , erythromycin and gentamicin , were much more active with resistance rates below 10% . according to results presented by klimiene et al . , among 176 strains isolated in lithuania , the percentages of resistance to penicillin , ampicillin and amoxicillin were 76.7% , 78.4% and 81.3% , respectively , and 38.1% of isolates were resistant to the combination of amoxicillin and clavulanic acid . the same strains were highly sensitive to cephalosporin s activity , and the rates of sensitivity rate to cephalothin and cephalexin were 95.5% and 93.2% , respectively . antibiotic susceptibility testing of 236 strains isolated from china showed an overall high level of resistance to tested antimicrobial agents . among twenty tested antibiotics , the most active ones were two aminoglycosides , kanamycin and gentamicin with sensitivity rates of only 74.6% and 69.9% , respectively . the highest rate of resistance was observed in the case of penicillin ( 87.3% ) . recently , gao et al . analyzed antibiotic resistance in a group of 52 strains isolated from one chinese herd . interestingly , nearly all of the isolates were resistant to penicillin ( 96.3% ) and tetracycline ( 98.1% ) , and all of them were susceptible to oxacillin , cefazolin and ciprofloxacin . a high level of resistance to penicillin ( 82.4% ) was also observed in the case of s. aureus isolated from mastitis in ethiopia ; however , a very limited group , only 17 strains , was analyzed . the isolates were even more resistant to clindamycin ( 88.2% ) and were highly resistant to erythromycin ( 58.8% ) , whilst the rates of sensitivity to chloramphenicol and nalidixic acid were 58.8% and 82.4% , respectively . a high prevalence of mrsa ( 13.1% ) was observed in a group of 107 strains isolated in india . the bacteria were also highly resistant to most of the other tested antibiotics , i.e. , 36.4% were resistant to streptomycin , 33.6% were resistant to oxytetracycline , 29.9% each were resistant to gentamicin and ampicillin , 28.9% were resistant to penicillin and 26.2% each were resistant to chloramphenicol , pristinamycin and ciprofloxacin . the authors also revealed a high prevalence of genes coding for different pathogenicity factors , mainly adhesins and toxins , among the tested isolates . a very similar pattern of resistance was observed among 193 strains from switzerland and 150 isolates from france . the resistance to most of the 16 antibiotics tested was low overall in both countries ; however , in the case of penicillin , the susceptibility rates were 77.7% and 70% , respectively . six and 8 isolates ( from switzerland and france , 3.1% and 5.3% , respectively ) were resistant to tetracycline . even lower rates of antibiotic - resistant isolates were identified in sweden . among a group of 109 strains , persson et al . tested the activities of 9 antibiotics and found only 4 ( 3.7% ) strains resistant each to kanamycin and penicillin and only 3 strains characterized by resistance to tetracycline . the observed worldwide predominance of resistance for -lactam antibiotics is probably the consequence of the fact that they are still one of the most widely used classes of agents for treatment of bovine mastitis . based on a questionnaire completed by 109 practicing veterinarians representing all regions of poland , krasucka et al . proved that penicillins are the antimicrobials most often used in treatment of cattle infections ( about 35% of cases ) . additionally , in a study carried out by the same authors , a comprehensive analysis of available statistic data revealed that -lactams are the most popular agents used in veterinary service in several other european countries including the czech republic , denmark and norway . frequent contact of bacteria with a specific antibiotic can cause an increase in resistance and decrease the effect of treatment . in fact , s. aureus pathogens have developed a broad spectrum of mechanisms of antibiotic resistance , which make them difficult targets even for treatment using agents from different chemical groups or combine therapy with more than 1 antibiotic from different chemical groups . the most common mechanism of -lactam resistance is based on production of -lactamases encoded by blaz , which was confirmed in this report . the ability to produce low - affinity penicillin binding protein 2a ( pbp2a ) determined by the presence of the chromosomal gene meca is still found incidentally among staphylococci isolated from mastitis , which is in concordance with the presented results . the current situation in the dairy industry and veterinary service require limitation of spreading of s. aureus antibiotic resistance and urgent development of new antimicrobial agents that would not covered by existing mechanisms of resistance . the first goal can be achieved only if the treatment is preceded by an antimicrobial susceptibility test and selection of the most accurate agent . such practice should be in fact commonly used in human medicine and veterinary service . given the current state of knowledge , the most promising alternative strategies in the case of s. aureus diseases seem to be therapies with antimicrobial proteins and peptides , bacteriophages and plant- ( e.g. , stilbenoids and flavonoids ) and animal - derived compounds ( e.g. , chitosan and propolis ) as well as usage of vaccines and photodynamic therapy . the results of our examination clearly indicate that polymyxin b , nisin and especially lysostaphin should be considered potential agents to treat infections caused by staphylococci including bovine mastitis . polymyxin b is very effective in treatment of infections caused by g - negative bacteria . it s breakpoint mic value for pseudomonas aeruginosa is 4 g / ml . the mechanism of bactericidal activity of this agent is based on destabilization of outer and inner cell membranes surrounding the cells of g - negative bacteria . g - positive bacteria are protected by a thick cell wall composed of peptidoglycan ; therefore , they are more resistant to polymyxin b. among the analyzed group of isolates , the mic values for polymyxin b are in the range from 32 to 64 g / ml ( except for 2 strains with an mic value of 128 g / ml ) . quite similar results were obtained by boyen et al . , who tested the activity of polymyxin b against 24 canine mrsa isolates and observed mic values in the range of 864 g / ml . the observed mic values for all strains tested in both investigations are definitely higher than the susceptibility breakpoint for this agent , established for p. aeruginosa , which in our opinion disqualifies using this peptide as a potential chemotherapeutic in infections caused by staphylococci , including bovine mastitis . quite satisfactory bactericidal anti - staphylococcal activity was also found in the case of nisin ( 54% strains classified as susceptible ) . in our opinion , identification of 17 resistant strains does not disqualify this peptide as a potential agent for treatment of bovine mastitis caused by staphylococci . in fact , only in the case of one strain was the mic value higher than 51.2 g / ml , and the mic value for other resistant strains was 51.2 g / ml and close to the susceptibility breakpoint ( 32 g / ml ) . definitely , the most promising results were obtained in the case of lysostaphin . all strains tested were susceptible to its activity , and the determined mic values were very low ( from 0.008 to 0.5 g / ml ) and much lower the susceptibility breakpoint of 32 g / ml established by kusuma and kokai kun . the high anti - staphylococcal bactericidal activity of this protein has been also confirmed in many animal models of different types of infections , such as keratitis , endocarditis and many others , that have been widely discussed in review articles by kumar and szweda et al . . the high potential of this protein as an alternative s. aureus mastitis agent has been also confirmed by other authors . zhang et al . revealed high in vitro bactericidal activity of lysostaphin against s. aureus isolated from mastitis in china . but , the most promising results have been published by wall et al . , who produced transgenic cows secreting lysostaphin at concentrations ranging from 0.9 to 14 g / ml of their milk . protection against s. aureus mastitis appears to be achievable with as little as 3 g / ml of lysostaphin in milk . the positive therapeutic effects of using nisin in treatment of bovine mastitis have been earlier confirmed previously by several authors . analyzing a group of 90 lactating holstein cows with subclinical mastitis , which were randomly divided into nisin - treated ( n=46 ) and control ( n=44 ) groups , wu et al . indicated that nisin therapy had bacteriological cure rates of 90.1% for streptococcus agalactiae ( 7 of 14 ) , 41.2% for coagulase - negative staphylococci ( 7 of 17 ) and 65.2% for all cases ( 30 of 46 ) . meanwhile , only 15.9% ( 7 of 44 ) of untreated cows spontaneously recovered . similar results were also presented by cao et al . , who revealed that nisin therapy for mastitis offered a clinical cure rate similar to gentamicin . however , it has been shown that polymyxin b is well distributed throughout the bovine mammary gland and is absorbed to a significant degree into the systemic circulation from the acutely inflamed udder . less data are available about trials that have considered use of polymyxin b as a mastitis therapeutic agent . our investigation revealed low potential for antistaphylococcal activity of this peptide . the results of the present research indicate that lysostaphin and nisin are promising alternative agents to combat staphylococcal infections . without doubt
abstractthe aim of this study was to analyze the resistance of staphylococcus aureus isolates from bovine mastitis in the eastern part of poland to a set of 20 antibiotics and three alternative agents : lysostaphin , nisin and polymyxin b. eighty - six out of 123 examined isolates were susceptible to all 20 tested antibiotics ( 70% ) . the highest percentage of resistance was observed in the case of -lactam antibiotics : amoxicillin ( n=22 , 17.9% ) , ampicillin ( n=28 , 22.8% ) , penicillin ( n=29 , 23.6% ) and streptomycin ( n=13 ; 10.6% ) . twenty - five of the penicillin - resistant strains were found to carry the blaz gene coding for -lactamases . two strains were found to be meca positive and a few strains were classified as multidrug resistant ( mdr ) , one of them was simultaneously resistant to six antibiotics . all strains , resistant to at least one antibiotic ( n=37 ) and two control strains , were susceptible to lysostaphin with mic values of 0.0080.5 g / ml ( susceptibility breakpoint 32 g / ml ) . twenty - one ( 54% ) isolates were susceptible to nisin . the mic value of this agent for 17 ( 44% ) strains was 51.2 g / ml and was not much higher than the susceptibility breakpoint value ( 32 g / ml ) . polymyxin b was able to inhibit the growth of the strains only at a high concentration ( 32128 g / ml ) . the presented results confirmed the observed worldwide problem of spreading antibiotic resistance among staphylococci isolated from bovine mastitis ; on the other hand , we have indicated a high level of bactericidal activity of nisin and especially lysostaphin .
esophageal carcinoma is one of the six most common malignant tumors in the world and is associated with significant morbidity and mortality . with a high incidence in the provinces of hebei , henan , and guangdong , china , both genetic and environmental factors have been implicated in the development of esophageal carcinoma : however , its etiology and pathogenesis are not well understood [ 25 ] . at present , research into esophageal cancer is concentrated on the isolation and identification of genes and proteins involved in tumor development . several biological markers , including cyclin d1 , surviving , p53 , p21 , pax , rb , cox-2 , ras , c - myc , mdm2 , and caveolin-1 , have all been found to be aberrantly expressed in esophageal adenocarcinoma and squamous cell carcinoma [ 610 ] . tumor necrosis factor ( tnf ) is a cytokine that is produced by activated macrophages as well as by several other cell types , including lymphocytes , fibroblasts , and hepatocytes . the effects of tnf are mediated by two distinct cell - surface receptors that are expressed simultaneously on almost all cell types : tnfr1 and tnfr2 . tnfr1 seems to have a greater role than tnfr2 in tnf signaling in most cell types . tnfr1 can suppress apoptosis by activating the nf-b and jnk / sapk signal transduction pathways , and can induce apoptosis through a series of caspase cascade reactions [ 12 , 13 ] . however , it is not yet clear what role tnfr1 expression may play in human esophageal carcinoma . rna interference ( rnai ) induces sequence - specific posttranscriptional gene silencing in many eukaryotes , by using 21- and 22-nt rna fragments that are homologous with sequences of the target gene . this effect can also be observed in mammalian cells when small interfering rnas ( sirnas ) are used , and hence the method has been exploited as a powerful tool for reverse genetics in the post - genome era . in the present study we detected expression of tnfr1 at the gene and protein levels in the esophageal carcinoma cell line ec109 . then , by applying a specific sirna , we silenced the expression of tnfr1 and recorded the changes in cell proliferation and apoptosis . the human esophageal carcinoma cell line ec109 was obtained from the state key laboratory of molecular oncology , chinese academy of medical sciences , and grown in dulbecco 's modified eagle 's medium ( dmem , invitrogen ) supplemented with 10% fetal bovine serum . the cells were kept in culture at 37c under an atmosphere of 5% carbon dioxide . to keep the cells under optimal proliferation conditions , they were passaged at 80% confluence and the sirna duplex oligonucleotides used in this study were based on the human cdna coding for tnfr1 , the efficacy of the oligonucleotides in silencing having been confirmed in a prior publication . the sirna sequences applied to target the tnfr1 mrna were 5-ggaaccuacuuguacaaugactt-3(sense ) and 5-gucauuguacaaguagguucctt-3(antisense ) . twenty - four hours before transfection , 5 10 cells were seeded in a 6-well plate . the transfection was performed using lipofectamine 2000 transfection reagent ( invitrogen ) according to the manufacturer 's instructions . the ec109 cells were divided into three groups : blank control group ( without transfection reagent or sirna ) , negative control group ( with transfection reagent and negative control - sirna ) and experimental group ( with transfection reagent and tnfr1-sirna ) . total rna was extracted using rnaiso reagent ( takara ) and reverse transcription was performed using the improm - ii reverse transcription system ( promega ) according to the manufacturer 's instructions . the primer sequences for the genes and expected product sizes were as follows : 5-accaagtgccacaaaggaacc-3(forward ) , 5-tacacacggtgttctgtttctcc-3(reverse ) for tnfr1 ( 320 bp ) and 5-atggatgatgatatcgccgcg-3(forward ) , 5-ctccatgtcgtcccagttggt-3(reverse ) for -actin ( 249 bp ) . the thermal cycler conditions were as follows : 94c for 5 minutes , followed by 30 cycles of 94c for 1 minute , 55c for 45 seconds , 72c for 1 minute , and then 72c for 10 minutes . the cells were washed twice with cold phosphate - buffered saline ( pbs ) and then membrane protein components containing tnfr1 were extracted from ec109 cells using a proteoextract subcellular proteome extraction kit ( merck ) according to the manufacturer 's instructions . the proteins were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) and then transferred to a nitrocellulose membrane ( huamei ) . after blocking with 5% skim milk at room temperature for 1 hour , the nitrocellulose membrane was incubated with monoclonal antibodies recognizing tnfr1 or actin ( r & d ) at 37c for 2 hours and then with horseradish peroxidase ( hrp)-conjugated secondary antibodies ( jackson ) for 1 hour at room temperature . the proteins were visualized with chemiluminescence regents ( santa cruz ) and analyzed with a fluorchem 8900 system . twenty - four hours before transfection , 5 10 cells were seeded in a 96-well plate . the transfection was performed using lipofectamine 2000 transfection reagent according to the manufacturer 's instructions . four duplicate wells were set up for each group and after 8 , 16 , 24 , and 32 hours of incubation , 10 l mtt ( 5 mg / ml , sigma ) was added to each well and incubated for 4 hour . the reaction was stopped by the addition of 100 l of dimethyl sulfoxide ( dmso , sigma ) . absorbance of the samples was measured at 570 nm and each assay was performed in triplicate . cell proliferation ( mean absorbance standard deviation ) was plotted versus time . for cell count analyses , cell suspensions were diluted in pbs 8 , 16 , 24 , 32 hours after transfection . fifty microliters of trypan blue ( 0.4% ) were added into 50 l of cell suspension . the number of cells without stain was counted using a hemocytometer under an inverted phase contrast microscope . apoptosis was determined by using the annexin v - fitc apoptosis detection kit ( merck ) according to the manufacturer 's instructions . in brief , cells were washed twice in cold pbs and then resuspended in 1 binding buffer at a concentration of 1 10 cells / ml . a volume of 500 l of the solution ( 5 10 cells ) was transferred to another tube , and 1.25 l annexin v - fitc were added . the cells were gently agitated and incubated in the dark for 15 minutes at room temperature , and then 500 l of cold 1 binding buffer and 10 l propidium iodide ( pi ) was added and the cells were analyzed with a facscalibur flow cytometer ( bd ) within 1 hour . rt - pcr analysis of tnfr1 mrna in ec109 cells is shown in figure 1(a ) : the 320 bp bright band reflects high expression of tnfr1 at the genetic level . a representative western blot analysis of tnfr1 in lysates of ec109 cells is shown in figure 1(b ) : specific antibodies detected tnfr1 as a distinct band with a molecular weight of about 55 kda . to confirm the silencing of tnfr1 expression in ec109 cells , rt - pcr and western blot analysis were performed 24 hours after the transfection ( figure 2 ) . the expression intensities of tnfr1 mrna in the blank control group ( 1 ) , the experimental group ( 2 ) , and the negative control group ( 3 ) are shown ( figure 2(a ) ) . a representative western blot analysis of cell lysates from the blank control group ( 1 ) , the experimental group ( 2 ) , and the negative control group ( 3 ) is shown in figure 2(b ) . to address whether sirna directed against tnfr1 had a promoting effect on ec109 cell growth , cell proliferation was assessed by using the mtt assay ( figure 3(a ) ) and by cell counting ( figure 3(b ) ) . we found that treatment of ec109 cells with tnfr1-sirna was associated with a time - dependent promotion of cell proliferation , with an accelerated cell proliferation level ( p < .05 ) observed 24 hours after transfection . no significant promotion effect was observed in cells of the blank control group or the negative control group ( p > .05 ) . twenty - four hours after transfection , the annexin v - fitc apoptosis detection kit was employed to assess levels of apoptosis in the blank control , the negative control , and the experimental groups . the rates of apoptosis were 8.93 1.24% and 8.60 2.75% in the blank control group and the negative control group , respectively , with no statistically significant difference ( p > .05 ) . in contrast , the rate of apoptosis in the experimental group after transfection with tnfr1-sirna was 4.64 1.59% , which is significantly lower than in the control groups ( p < .05 ) ( figure 4 ) . the ec109 cell line , derived from a surgically excised squamous cell carcinoma specimen , was established in 1976 by researchers in the department of cell and molecular biology , cancer institute , chinese academy of medical sciences . today , the cell line is widely used for esophageal cancer - related disease research [ 17 , 18 ] . we first detected tnfr1 expression by rt - pcr and western blot , and the results show tnfr1 has a high expression in ec109 cells compared with the immortalized esophageal epithelial cell line shee ( data not shown ) . at present , sirna has been adapted as a functional genomics tool , although it also has the potential for therapeutic application in cancer [ 1921 ] . here treatment of ec109 cells with tnfr1-sirna was associated with a time - dependent promotion of cell proliferation , as measured by the mtt assay and direct cell counts , and with a significant reduction in the rate of apoptosis . tnfr1 is known to mediate two signaling pathways : ( 1 ) tnf receptor - associated death domain ( tradd ) protein binds to tnfr1 through its death domain ( dd ) sequence . then , tradd recruits the downstream signaling adaptor molecules fas - associated death domain ( fadd ) and receptor interacting molecule ( rip ) to constitute complex ii . fadd interacts with caspase-8 or caspase-10 precursors through a death effector domain ( ded ) sequence . then another dd - containing molecule , caspase-2 , and ripk1 domain containing adaptor with death domain ( raidd ) are recruited to tnfr1 where they interact with rip to activate tnfr1 to initiate apoptotic signaling . ( 2 ) tnf receptor - associating factor 2 ( traf2 ) is recruited to tnfr1 indirectly through a specific interaction with tradd . traf2 is capable of interacting with downstream signaling molecules , resulting in the activation of nf-b , p38mapk , and c - jun n - terminal kinase ( jnk ) stress kinases . thus , tnfr1 plays different roles in different cells and tissues ; we are interested in the role that tnfr1 plays in the ec109 cell line as a model of esophageal cancer . the flow cytometry results showed that tnfr1 may mediate apoptosis in ec109 cells , which is supported by the mtt results . the reduction of apoptosis rate after silencing of tnfr1 may be due to inhibition of the fadd - dependent complex ii . another report showed that nf-b is highly expressed in ec109 , and that an activated nf-b signaling pathway exists and has an effect on the survival and proliferation of these esophageal carcinoma cells . the relationship between the nf-b signaling pathway and anti - tumor cell apoptosis has been extensively studied . initially , beg et al . observed that the livers of nude mice lacking the nf-b gene showed degenerative changes because of excessive apoptosis . then a report showed that tumor cells with high nf-b expression had a higher tolerance to ionizing radiation and anti - tumor drugs , and that inhibition of nf-b activity could significantly increase the therapeutic sensitivity and induce apoptosis . therefore , the search for the relationship between the nf-b signaling pathway and tumor - cell apoptosis has been intensive and includes the study of many functional components , including ciap1 and 2 , flip , traf1 and 2 , a1/bfl1 , and bcl - xl . the genes encoding these proteins , all of which have anti - apoptotic effects mediated by tnf- and similar positive regulatory factors , are up - regulated by activated nf-b . tnfr1 in ec109 is apt to induce apoptosis and we speculate that this may be suppressed by highly - activated nf-b . it was reported that the expression rate of tnfr1 in ten different cell lines involving ec109 showed no significant differences , but that administration of new recombinant human tnf ( nrhtnf ) exerted significantly different effects on the different cells . as nrhtnf did not inhibit the growth of five cell lines involving ec109 , it was concluded that there was no correlation between the inhibitory effect of the drug and the expression of tnfr1 , which supports our theory . our results indicate that tnfr1 may mediate apoptosis in ec109 cells but the details are still unclear . regulation of the numerous factors involved in the pathway , the relationship between tnfr1 and other relevant factors , and the specific mechanism of the pathway still need further study .
tumor necrosis factor receptor 1 ( tnfr1 ) is a membrane receptor able to bind tnf- or tnf-. tnfr1 can suppress apoptosis by activating the nf-b or jnk / sapk signal transduction pathway , or it can induce apoptosis through a series of caspase cascade reactions ; the particular effect may depend on the cell line . in the present study , we first showed that tnfr1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line ec109 . then , by applying a specific sirna , we silenced the expression of tnfr1 ; this resulted in a significant time - dependent promotion of cell proliferation and downregulation of the apoptotic rate . these results suggest that tnfr1 is strongly expressed in the ec109 cell line and that it may play an apoptosis - mediating role , which may be suppressed by highly activated nf-b .
it is important in conveying the daily cycle of light and darkness to the body , thus regulating circadian rhythms . in addition to its regulatory role , melatonin has antioxidative capacity , immunomodulatory potency , and also appears to be protective against certain types of cancers . type 1 diabetes mellitus ( t1 dm ) is a t cell - mediated autoimmune disease characterized by excess inflammation , independent of adiposity and glycemic control . the incidence of t1 dm diabetes is increasing at 3 - 5% per year worldwide , and this increase can not be accounted for by known genetic factors . it has been well known that both oxidative stress and inflammatory activity play crucial roles in the pathogenesis of t1 dm . little information is available on the different patterns of type 1 diabetes progression following diagnosis , particularly in the pediatric population . the relation between melatonin and t1 dm in children and adolescents was not investigated before . forty children and adolescents with t1 dm ( 18 boys and 22 girls , mean age 10.43 3.25 years ) and 30 healthy control subjects ( 17 boys and 13 girls , mean age 9.83 4.36 years ) participated in the study . all patients followed in pediatric endocrinology and metabolism unit of gaziantep university faculty of medicine and also control subjects had no hypertension , obesity , hyperlipidemia , anemia , and infection . patients with other forms of diabetes ( type 2 , maturity - onset diabetes of the young , thiamine responsive megaloblastic anemia ) were not included in the study . in the present study we enrolled only children who fulfilled the following eligibility criteria for control group : 1 ) prepubertal and pubertal age ; 2 ) absence of acute or chronic inflammatory and autoimmune diseases ; 3 ) lack of diabetes mellitus , primary hyperlipidemia , hypertension , anemia and obesity ; and 4 ) no current regular medications . antropometric data included height , body weight , body mass index ( bmi ) , and blood pressure . bmi was calculated using measured weight ( kilograms ) , hemoglobin , hematocrit , white blood cell count , free thyroxine , thyroid stimulating hormone and antithyroid peroxidase antibody levels were divided by measured height ( meters ) squared . blood samples were collected during routine analysis , after overnight fasting between 08:30 and 09:00 a.m. after separation , serum samples were immediately stored at -70c until analyzed for measuring melatonin . serum glucose , total cholesterol , high - density lipoprotein , low - density lipoprotein , triglyceride evaluated by chemical immunoassay method in patients and controls . glycosylated hemoglobulin ( hba1c ) was measured as a marker of glycemic control in diabetic patients . hba1c levels were mathematically standardized to the diabetes control and complications trial reference range of 4.05 - 6.05% using multiple of the mean transformation . hba1c was not measured in control group because there were no diabetic patients in control group . thyroid peroxidase antibodies were defined as positive if higher than 40 u / ml ( antibody titer ) . the diagnosis of hashimoto thyroiditis was established by demonstrating high level of antithyroid peroxidase antibody levels . tissue transglutaminase antibody level was analysed by enzyme - linked immunosorbent assay ( elisa ) . celiac disease was suspected if tissue transglutaminase antibody level were higher than 15 u. in this study , melatonin levels were detected with a sandwich enzyme - linked immonosorbent assay ( elisa ) . the assay procedure follows the basic principle of competitive elisa whereby there is competition between a biotinylated and a non - biotinylated antigen for a fixed number of antibody - binding sites . the amount of biotinylated antigen bound to the antibody is inversely proportional to the analyzed concentration of the sample . the differences between groups were tested by the t - test for independent samples with normal data distribution or by the mann - whitney non - parametric test . the differences between groups were tested by the t - test for independent samples with normal data distribution or by the mann - whitney non - parametric test . the mean diabetic duration was 2.89 2.69 years and the mean age of diabetes was 10.49 3.23 years . there was no obesity , hyperlipidemia , hypertension , thyroid dysfunction , anemia , and infection in diabetic patients . there was no obesity , hypertension , hyperglycemia , hyperlipidemia , thyroid dysfunction , hashimoto thyroiditis , celiac disease , anemia , and infection in controls . characteristics of the patients and controls in the study population there were no statistically significant differences in age , sex , bmi distribution between diabetic group and control group ( p > 0.05 ) . mean melatonin level in diabetic group was 6.75 3.52 pg / ml and mean melatonin level in control group was 11.51 4.74 pg / ml . melatonin levels were significantly lower in diabetic group compared to controls ( p < 0.01 ) [ table 1 ] . the present study looked for clues for preventing complications related with t1 dm by investigating melatonin level in these patients . there are extra - pineal sites of melatonin production , such as the retina , skin , bone marrow , lymphocytes and the gut , from where it may influence other physiological functions . melatonin is synthesized from its precursor , the essential amino acid tryptophan ( trp ) in a series of four enzymatic steps . the rate of melatonin formation depends on the activity of enzymes - arylalkylamine - n - acetyltransferase and to a lesser extent , tryptophan hydroxylase . if intake of trp is severely restricted , synthesis of melatonin is significantly reduced in humans . several vitamins and minerals like folate , b6 vitamin , and b12 vitamin act as co - factors in these processes . pineal melatonin levels begin increasing in the late evening , reaching the maximum in the early hours between 2:00 and 4:00 a.m. , followed by a slow decline to lower daytime levels . endogenous nocturnal melatonin production has been estimated to be about 10 - 80 g per night , daytime production being significantly less . the following physiological variables attain peak levels during sleep : tsh , prolactin , melatonin , acth , fsh , lh , cortisol , and lymphocyte and eosinophil counts . circadian rhythms are generated by suprachiasmatic nucleus in the hypothalamus and are influenced by a variety of factors . disruption of the circadian rhythm and sleep - wake cycles are considered risk factors for a variety of health problems including obesity and cardiovascular disease . several preclinical studies have identified dietary components , such as glucose , sodium , ethanol , or caffeine being capable of phase - shifting circadian rhythms by modifying the expression of genetic components of the biological clock , i.e. clock genes . we estimate that alterations in metabolism like t1 dm are able to entrain physiological clocks , resulting in changes to the rhythms . this study showed that melatonin levels were significantly lower in diabetic group compared to controls . even though melatonin levels were not at peak level and single blood sample in the morning may be insufficient to estimate total melatonin levels over a 24-hour period the conditions were the same for diabetic group and control group . despite these limitations investigations showed that hyperinsulinemic goto - kakizaki rats , which are a rat model of type 2 diabetic rats , and humans have decreased melatonin plasma levels , whereas a streptozotocin - induced rat model of diabetes developed reduced insulin levels combined with increased melatonin levels . this finding is supported by the other study in goto - kakizaki rats that an increase of plasma insulin was combined with a decrease of plasma noradrenaline ( norepinephrine ) , the most important activator of melatonin synthesis . melatonin is anabolic hormone like insulin and it relates to the promotion of restorative or anabolic physiological processes . in humans , elevated melatonin levels have been associated with reduced core temperature , increased heat loss , decreased cardiovascular output , reduced alertness , and enhanced immune responsiveness ; therefore , insulin treatment may affect melatonin secretion . exogenous melatonin has been used for the treatment of sleep disorders of circadian origin such as jet lag and delayed sleep phase syndrome and as a complement of other therapeutic drugs for the treatment of numerous diseases including glaucoma , irritable bowel disease , and certain types of cancers mainly to either enhance the therapeutic effect of conventional drug therapy or to reduce their toxicity thus ameliorating the side - effects . in addition to melatonin 's role as an endogenous synchronizer , growing evidence suggests its anti - oxidative activity as well as its having a role in modulating immune responses . it is well known that oxidative stress is thought to be involved in both development of t1 dm and its further complications . melatonin protects pancreatic -cells and several diabetes - affected organs including kidney , brain , retina and vasculature system from the associated nitro - oxidative stress . this preliminary study raises the possibility that exogenous melatonin treatment may play role in preventing process of inflammation and oxidative stress patients with t1 dm because melatonin levels were significantly lower in diabetic group .
objective : melatonin is an indolamine hormone , synthesized from tryptophan in the pineal gland primarily . melatonin exerts both antioxidative and immunoregulatory roles but little is known about melatonin secretion in patients with type 1 diabetes mellitus ( t1 dm ) . the aim of this study was to measure serum melatonin levels in patients with t1 dm and investigates their relationship with type 1 diabetes mellitus.materials and methods : forty children and adolescents with t1 dm ( 18 boys and 22 girls ) and 30 healthy control subjects ( 17 boys and 13 girls ) participated in the study . all patients followed in pediatric endocrinology and metabolism unit of gaziantep university faculty of medicine and also control subjects had no hypertension , obesity , hyperlipidemia , anemia , and infection . blood samples were collected during routine analysis , after overnight fasting . serum melatonin levels were analyzed with elisa.results:there were no statistically significant differences related with age , sex , bmi distribution between diabetic group and control group . mean diabetic duration was 2.89 2.69 years . the variables were in the equation . mean melatonin level in diabetic group was 6.75 3.52 pg / ml and mean melatonin level in control group was 11.51 4.74 pg / ml . melatonin levels were significantly lower in diabetic group compared to controls ( p < 0.01).conclusions : melatonin was associated with type 1 diabetes mellitus significantly . because of the varied roles of melatonin in human metabolic rhythms , these results suggest a role of melatonin in maintaining normal rhythmicity . melatonin may play role in preventing process of inflammation and oxidative stress .
nevus lipomatosus cutaneous superficialis ( nlcs ) is a rare benign hamartomatous condition , which usually presents at birth or manifests in the first two decades of life . the classical presentation is with multiple painless soft pedunculated , yellowish cerebriform masses commonly located on the pelvic and gluteal region . we report here a case of nlcs with huge swellings on the back and prominent peau - d orange appearance at places . a 10-year - old boy presented with multiple humps on the upper and lower back , present for the preceding 2 years . starting as a single swelling on the upper back , it gradually increased in number and size to attain the present dimension . the surface showed fine wrinkling and peau - d orange appearance at places [ figure 2 ] . there was no evidence of ulceration or comedo - like plugs associated with the lesions . there was no underlying developmental anomaly , caf-au - lait macule , neurological abnormality or evidence of any systemic disease . histological examination showed beneath a normal epidermis , aggregates of mature adipocytes in the upper dermis [ figure 3 ] . the patient was counseled and referred to department of plastic surgery but was subsequently lost to follow - up . note the swellings over the lower back also close - up photograph showing fine wrinkling and peau - d orange appearance . besides , there are smaller satellite nodules in the surrounding skin photomicrograph showing a normal epidermis , increased melanization of the basal layer , aggregates of mature adipocytes in the upper dermis , normal vascularity and lack of infiltrate . nlcs is a rare hamartoma that is characterized by the presence of ectopic isolated adipocytes or mature adipose tissue in the dermis . morphologically , the lesions of classical nlcs are asymptomatic , soft , skin colored to yellow papulo - nodules , often coalescing to form plaques . the surface may be smooth , wrinkled , cerebriform , and associated with comedones and peau dorange texture . in our case , the lesions showed prominent peau dorange appearance . the distribution may be linear , systematized , zosteriform or along the lines of skin folds . the lesions are usually located on the pelvic girdle , lumbar area , buttocks and upper thighs , with rare instances of involvement of the scalp , face , shoulder , thorax and abdomen . the disorder may coexist with pigmentary conditions like cafe - au - lait macules , hypertrichosis , leukoderma , capillary hemangioma and trichofolliculoma . however , electron microscopic appearance of lipocytesin in close association with the capillaries suggests hamartomatous origin from the pericytes . we considered the clinical differential diagnoses of plexiform neurofibroma , smooth muscle hamartoma and leiomyoma cutis . the characteristic histopathological finding is the presence of ectopic fat cells in dermis , mostly around blood vessels . goltz syndrome is characterized by the absence of collagen and associated underlying deformities . the pedunculated appearance and later onset in life help to distinguish lipofibroma from nevus lipomatosus . our case had a few unique findings like multiple huge swellings on the back mimicking smooth muscle hamartoma and plexiform neurofibroma , presence of fine wrinkling and peau - d orange appearance at places .
nevus lipomatosus cutaneous superficialis ( nlcs ) is a benign dermatosis , histologically characterized by the presence of mature ectopic adipocytes in the dermis . we hereby report a case of a 10-year - old boy who presented with multiple huge swellings on the scapular regions and lower back . the lesions were surmounted by small papules , along with peau - d orange appearance at places . histology showed features consistent with nlcs . the case is being reported for the unusual clinical presentation .
in south africa , the global epicenter of both tuberculosis ( tb ) and human immunodeficiency virus ( hiv ) , the menacing convergence of these diseases : one viral and one bacterial , one emergent , and one ancient , presents a near insurmountable challenge to health , social , economic , and developmental welfare . these dual epidemics threaten to undo the health care gains of the past decades in an already ailing health care system . women now account for nearly a half of all global infections and 77% of all women living with hiv are in sub - saharan african . acquired immune deficiency syndrome ( aids ) accounts for more deaths in women than all causes of maternal mortality combined . while the global incidence of hiv is decreasing , new infections among young women aged 15 to 24 years have steadily increased in south africa , which is due to multifactorial and complex biological , social , economic and behavioural factors . the world health organization ( who ) , in an effort to address the challenges of hiv associated tb , has proposed a framework of strategic collaborative activities for tb and hiv services which foster a more comprehensive approach to the synergistic dual epidemics . in settings of generalized hiv and aids epidemics , like south africa , who recommends expanding hiv surveillance to include tb patients . anonymous unlinked testing for hiv by means of a noninvasive sputum antibody test has been proposed as a means of hiv surveillance within south african tb facilities . this approach is cost - effective , sustainable , and feasible for rapid expansion of hiv surveillance in south africa . comprehensive hiv surveillance is central to understanding the epidemic , the unique challenges in each country , the trajectory of the epidemic , resultant morbidity and mortality , and the impact of interventions . the who initiated unlinked , anonymous testing ( uat ) through sentinel seroprevalence surveys amongst antenatal attendees as the global standard for hiv surveillance where heterosexual transmission is dominant . in uat , blood drawn for routine purposes in the health care setting are stripped of patients - identifiers , unlinked from patient records , and tested for hiv . this method has the primary advantage of eliminating nonresponse bias typically associated with other hiv surveys where consent is required . since then this method has been the universally adopted standard throughout the world and serves as the methodological basis for comparing the prevalence of hiv across the globe , especially in generalized epidemics . as an additional surveillance activity to antenatal surveys , hiv surveillance among tb patients is strongly recommended , especially in countries like south africa where tb and hiv are deleteriously intertwined coepidemics . expanding hiv surveillance to include tb patients will serve as an indicator of the level and maturity of the epidemic , as well as an indicator of the effect of hiv on health services . the who guidelines for second generation hiv surveillance reiterate the need for additional data on hiv trends , not obtained from antenatal clinic surveys . these guidelines promote a comprehensive hiv surveillance system , to better understand hiv trends and the factors that drive the epidemic in a country , by focusing on flexible surveillance in specific high risk populations to improve prevention and care activities . the specific objectives of hiv surveillance among tb patients in generalized hiv epidemics are ( a ) to inform the targeting of resources and planning of activities for people with hiv associated tb and for monitoring the effectiveness of these activities ; ( b ) to increase political , professional , and civil society awareness of coepidemics ; ( c ) to assess the need for collaboration between hiv and tb programmes on formulation and implementation of a joint tb - hiv strategy ; ( d ) to provide information on the hiv and aids epidemic and its impact on tb patients ; and ( e ) to quantify the need for providing antiretroviral ( art ) to tb patients . one of the main challenges in conducting hiv surveillance among tb patients is the ethical concerns primarily surrounding the use of anonymous , unlinked testing . in settings with increasing availability of art , there is considerable controversy about the ethical validity of anonymously testing for hiv where emphasis should be placed on counseling and testing for hiv and the provision of art to patients who require it . however , in general , testing without informed consent , for the purpose of surveillance , has been considered ethical if anonymous , unlinked testing is employed . moreover , in generalized epidemics with a high burden of tb - hiv coinfection , such as south africa , the benefits of surveillance justify its inclusion as an additional method of surveillance . hiv surveillance among tb patients in the south african context using unlinked , anonymous testing will increase the epidemiological utility of the data by eliminating participation bias and will occur as part of a response to the public health emergency characterised by tb - hiv coinfection . an existing challenge to anonymous , unlinked testing for hiv among tb patients is the lack of routine blood testing in tb on which hiv testing can piggyback . this has fuelled concerns as to whether the inclusion of routine bloods in tb will be driven by the covert intention to introduce anonymous , unlinked hiv testing , rather than out of a real need in the patient 's interest . the use of novel methods for hiv testing on sputum specimens is rapidly gaining momentum in response to such concerns . sputum , in contrast to blood , is routinely collected from tb patients , discarded after its use , and is being shown by an expanding evidence base to be useful in the diagnosis of hiv [ 7 , 912 ] . the main ethical proviso regarding hiv surveillance among tb patients is that consent may only be omitted if samples are taken from routine specimens and testing is anonymous and is not linked to patient identifiers . additionally , all tb patients included in hiv surveillance activities should have access to voluntary counseling and testing ( vct ) for hiv infection . this paper explores anonymous unlinked hiv testing of tb suspects as a means to understand the local coinfection epidemic and the need to integrate services . the survey was conducted at an out - patient tuberculosis facility in durban , south africa . the clinic , situated in the central business district adjacent to a transportation nodal point , provides diagnosis and treatment of tb for those who reside or work in durban . the study sample included all adult patients presenting for tb diagnostic services who provided a sputum specimen during the study period . oraquick hiv 1/2 antibody testing was performed by a trained technician as per manufacturer guidelines on all sputum specimens prior to discard , irrespective of its suitability for tb microscopy . all data was processed and analysed using sas software ( sas 9.1.3 , sas institute , inc . the 5% significance level was used ; correspondingly , 95% confidence intervals were used to describe effect size . all data was assessed for normality , and nonparametric tests were used where necessary . hiv prevalence for tb cases and suspects was calculated and selected demographic risk factors associated with the patients hiv status were measured using chi - squared tests for categorical data ( participants age categories , gender , and visit type ) and analysis of variance techniques for continuous variables ( age ) . ethical approval was obtained from the biomedical research ethics committee of the africa university of kwazulu - natal ( reference number bfc031/08 ) . permission to conduct the study at a municipal health facility was obtained from the ethekwini municipality health unit . the mean age of the survey population was 35.7 years ( sd 11.3 years ) . the mean ages of males and females were similar ( 36.9 versus 33.6 years , p = 0.234 ) . two - thirds ( 467/741 ) of the study sample were male . of the total , 622 ( 84% ) were between 20 and 50 years old , an identical proportion in both males ( 84% ) and females ( 84% ) ( table 1 ) . only 15 ( 3% ) of the males were younger than 20 years old , compared to 21(8% ) of the females ( p < 0.05 ) . there was a significantly higher proportion of males than females over 50 years of age ( 13% versus 8% , p < 0.05 ) . a total of 229 ( 31% ) tb suspects did not have a diagnosis of tb confirmed , of which 153(66.8% , 95% ci : 60.772.9 ) tested sputum hiv antibody positive . the balance of the study population of tb suspects , 512 ( 69% ) , was diagnosed with tb , of which 369 ( 72.1% , 95% ci : 68.276.0 ) were hiv positive . there was no statistical difference in hiv prevalence between these two groups ( p = 0.15 ) . the prevalence of hiv was 69.8% ( 95% ci : 65.374.2 ) and 81.6% ( 95% ci : 72.990.3 ) in those with pulmonary and extrapulmonary tb , respectively ( figure 1 ) . the hiv prevalence in tb suspects accessing the clinic varies by age , sex , and by the presence or absence of tb disease . in those without tb disease , the age- and sex - specific hiv prevalence reflects a similar pattern to the general population . females have a higher age- specific hiv prevalence in all age groups except those 50 years and older , have an earlier peak prevalence than males ( 2029 years versus 3039 years ) , and have a higher peak prevalence ( 83.3% versus 75.6% ) than males ( figure 2 ) . in those diagnosed with tb , the age - specific hiv prevalence in females was higher than in males in age groups under 20 , 2029 , and however , the peak prevalence ( 86% ) of hiv in females occurred in the 4049 years age group as compared to a peak male hiv prevalence of 87% in the 3039 years age group . females with and without tb ( overall ) have higher age- specific prevalence than males with and without tb in the younger age groups , while the males have higher age - specific prevalence than females in those 50 years and older . the male - to - female sex ratio in all patients with pulmonary tb ranges from 0.79 in the under 20 years age group , to 5.3 in the greater than or equal to 50 years age group ( table 2 ) . the representation of males increases across the increasing age groups . in hiv associated pulmonary tb , the male - to - female ratio ranges from 0.38 in the under 20 years age group to 7.5 in those 50 years and older . the proportion of females increases in the age groups less than 20 years , 20 to 29 years , and 40 to 49 years . in these age groups , there exists a significant positive correlation ( r = 0.87 , p < 0.05 ) between the change in the sex ratio between all those with ptb and ptb associated hiv and the sex ratio of hiv prevalence across the age groups . the primary objective of this study was to provide an estimate for the prevalence of hiv among attendees at an urban tb facility in durban , south africa , using a novel sputum - based hiv antibody test . the paucity of such information in the past has limited the ability of health services to exploit the opportunities presented by the changing epidemiology of tb and hiv in this setting . analysis of the age and sex distribution of hiv associated tb in this study reflects the impact of a maturing hiv epidemic on tb in south africa . only 37% of tb patients were female , and the male - to - female ratio of 1.7 is lower than global and historic trends [ 14 , 15 ] . globally , in 2007 , there was a 2 : 1 male - to - female ratio of cases notified to public health authorities . nonetheless , in low income countries , tb kills more women than all causes of maternal mortality combined . there was more pulmonary tb in females than in males under 30 years in this study . this increased burden of tb in young women has been attributed to biological , social , and methodological factors . young women have up to 34% higher risk of progression to tb disease than men up to the age of 30 years initially attributed to reduced immunity associated with the stresses of pregnancy . however , this hypothesis was not supported by a case - control study which demonstrated that pregnancy was not an exposure associated with tb disease . in addition , young women have lower cumulative tb infections in adolescence , inferring that new postadolescence infection might be significantly greater amongst women . new infection with tb carries a greater likelihood to progress to tb disease , and to do so more rapidly . females are more likely to encounter health services during their reproductive years , increasing their likelihood of having tb diagnosed . similarly , the lower prevalence of tb disease in older women compared to men may reflect their differential access to healthcare due to a combination of complex social , economic , cultural , and logistical factors . this may be particularly true in settings such as south africa where active case finding is too poorly implemented to rectify possible undernotification of women and their possible underrepresentation at health facilities . this age - sex trend of tb is similar to who estimates for other african countries with a high hiv prevalence where there are more female than male cases notified up to 25 years . the estimate was confirmed in this high hiv - burdened setting , with a male - to - female ratio of 0.9 in cases of pulmonary tb under 30 years of age . the disproportionate burden of hiv on young women has largely been attributed to intergenerational sex of young women with older men , who are likely to have multiple concurrent sexual partners [ 2 , 18 , 19 ] . young women have a 7-fold increased risk of acquiring hiv when in relationships with men between 5 and 7 years older [ 2023 ] . the exact reasons for the increased risk of acquiring hiv in young women are not yet understood but include increased transmissibility from males to females , anatomy , condom use , sexual networking , poverty , education , economic autonomy , power imbalances between men and women , gender based violence , access to sexual and reproductive health services , and political and sociocultural issues . the pattern of a higher hiv prevalence among young women in comparison to men in the same age group is now being reflected in the age - specific trends of tb . the impact of hiv on tb is reflected in the age - specific hiv prevalence figures generated by this study and confirms that hiv is shaping the evolving epidemiology of tb in this setting . with nearly 70% of all tb patients being coinfected with hiv , it is not surprising that the age and sex distribution of tb is increasingly resembling the distribution of hiv in this region of hyperendemicity . the male - to - female ratio among hiv negative individuals was 1.98 while the male - to - female ratio among those living with hiv drops to 1.58 . the increased representation of females in comparison to males in hiv associated pulmonary tb is significantly correlated with the sex - specific hiv prevalence figures in those age groups . there is a clear indication that hiv is driving the increased representation of females among tb patients with age groups in which females have the higher hiv prevalence containing a greater number of females with tb . a previous study in this setting demonstrated a significantly higher burden of tb disease among women in the 20 to 29 years age group , in keeping with predictions by mathematical models on the impact of hiv on tb in areas of dual hyperendemicity . whether this is due to biological or structural reasons is uncertain , but the greater representation of females at tb facilities in high hiv settings has multiple programmatic implications . a growing recognition of the gradually changing face of tb in this setting will allow for the exploitation of the opportunities presented by this evolving epidemiology . the unique opportunity to seek out synergies between tb - hiv and women 's health services must be seized . the broadening of services may serve to appropriately orientate the existing tb services with regards to the changing demographic profile of patients to augment women 's health services , to respond to the need for comprehensive primary health care services , and , most importantly , to acknowledge the presence of multiple pathologies in an individual patient that can not adequately be addressed by a vertical programme design . the demographic profile of tb patients mirrors the patterns observed in those living with hiv and suggests that hiv infection does fuel the tb epidemic in this setting . the increased number of young women , in particular , at tb services presents the opportunity to design more demographically sensitive tb services which include a more comprehensive health service package . the benefit of including women friendly reproductive health services at tb facilities requires further evaluation . overall , this survey demonstrates the possibility of using a novel hiv antibody assay on sputum and an anonymous survey design for achieving additional hiv surveillance in a generalized hiv epidemic with tb endemicity . a better understanding of both of these epidemics and how they interact is crucial to optimise a consolidated comprehensive public health response . the richness of data that is generated is a clear indication of the potential benefits that may accrue from better understanding the confluence of these dual epidemics . the idea of an expanded surveillance programme for hiv in tb facilities is a direct response to a call from who to optimize the position of health systems to understand , appreciate , and react to the emerging destructive synergy between tb and hiv epidemics . this study has highlighted that the problem of tb - hiv coinfection is not a homogenous entity but rather a composite of many complex subepidemics . this is largely due to the various drivers of hiv and tb which have differential effects on various strata of the population , most notably subpopulations by age and sex . a striking feature of the tb - hiv coepidemic is the direct influence that the epidemiology of hiv has had on the evolving tb epidemic , with young women representing a significant proportion of tb facility attendees . the hyperendemicity of tb and hiv in south africa coupled with the existing demographic distribution of the coepidemics has serious implications for the social , health , and economic status of the nation and threatens to be a significant limitation to national growth and development . vertical programme designs have failed to demonstrate that they are capable of responding to the synergism of multiple morbidities in individuals . a more integrated approach is more attractive as it promises the possibility of increasing clinical and operational efficiency . this is the central theme of the who call for closer collaboration between tb and hiv services . however , the guiding tenet of all health care initiatives is to ensure that programmes are responsive to the needs of patients and that any intervention is tailored to respond to those needs while being informed by the unique epidemiology of the local epidemic . the local epidemic , as demonstrated in this study , is characterised by a broad cross - section of patients , with the majority of coinfected individuals in the economically active age group , and with the majority of women in their reproductive years . there are therefore several opportunities to maximize the impact of any healthcare contact with these individuals when they present to a tb facility . sexual health services , in particular , would be well positioned in tb facilities and could aim to provide sexual health education , positive prevention , condom promotion , screening for sexually transmitted diseases , and the treatment thereof . this study has confirmed that the burden young women face in terms of their heightened vulnerability for hiv infection has been translated to an increased vulnerability for tb . existing tb programmes do not adequately reflect the needs of young women in their design . women 's health and basic reproductive health services would have a significant target audience at tb facilities . this might include access to family planning , pap smear evaluations , and targeted interventions for young women such as microbicide gels in future . a more comprehensive service may lead to greater public access , more equitable access for all patients , a more convenient and satisfying service , and better health overall . new tb service design must begin to reflect the presence of young women as a significant group burdened by the disease .
background . expanded hiv surveillance in tb patients forms part of the world health organization framework for strategic collaborative activity . surveillance helps understand the epidemiology of the local dual epidemic and enables design of a tailored response to these challenges . methods . we conducted an observational , cross - sectional study of anonymous unlinked hiv testing for 741 consecutive tb suspects attending an urban tb facility during a seven - week period in 2008 . results . a total of 512 patients were found to have tb . the mean age was 35.7 years , and 63% were male . the prevalence of hiv was 72.2% ( 95% ci : 68.275.9 ) in all tb cases , 69.8% ( 95% ci : 65.374.2 ) in pulmonary tuberculosis ( ptb ) , 81.6% ( 95% ci : 72.990.3 ) in extrapulmonary disease , and 66.8% ( 95% ci : 60.772.9 ) in those without tb disease . hiv prevalence in tb patients was higher in females than males and in younger age groups ( 1829 years ) . the sex ratio of ptb patients correlated with the sex ratio of the prevalence of hiv in the respective age groups ( p < 0.05 ) . conclusion . the use of a rapid hiv test performed on sputum anonymously provides an opportunity for hiv surveillance in this high - burdened setting , which has the potential to lend valuable insight into the coepidemics .
traditional therapy for uterine hyperplasia , carcinoma , or sarcoma includes total abdominal hysterectomy ( tah ) with salpingo - oophorectomy , and when pathologic stage is higher than ib or tumor grade is 3 , lymph node sampling is performed . in 1993 , laparoscopic - assisted vaginal hysterectomy ( lavh ) with indicated node dissection was described as an alternative to tah for clinical stage i endometrial cancer patients . lavh has also been shown to be appropriate for women over the age of 75 with endometrial cancer , conferring a similar blood loss , equal or higher node counts , longer operating times , shorter hospital stays , and less pain than tah . in randomized trials comparing tah versus lavh for benign indications , similar overall complications , less blood loss , longer operating times , fewer transfusions , less pain , and shorter hospital however , lavh is predicated upon the ability to dissect the cervix and lower uterine segment through the vagina . obesity , nulliparity , and senior age , the 3 most common risk factors for endometrial cancer , may all contribute to making the vagina longer , narrower , and thus it is more difficult to complete the vaginal portion of the lavh . many obese , senior , and nulligravid women will not qualify for the lavh because they lack sufficient uterine prolapse or vaginal capacity . the total laparoscopic hysterectomy ( tlh ) has been described over the last 10 years as potentially quicker , more efficient , and associated with less blood loss than lavh . in 2003 , we reported our tlh data from a series of patients and observed it to be safe in the care of obese patients with pelvic masses and early ovarian carcinoma . although a randomized clinical trial would be the standard for confirming the indications , safety , efficacy , and complication rates of tlh in women with endometrial neoplasia , as yet , no large cohort reviews of tlh procedures have been conducted for this indication to serve as pilot data . this retrospective , nonrandomized cohort review delineates the surgical and pathological findings of a clinical series of all patients with early endometrial cancer , hyperplasia , or sarcoma in a private practice in which over 611 tlhs have been performed . the standard in this practice is to assign patients to tlh or tah based on evaluation of the medical history , physical examination , and clinical testing , with specific documentation of severe adhesions from prior surgeries , a large uterus ( > 250 g ) confirmed by ultrasound , or significant chronic obstructive pulmonary disease ( copd ) . the objective of this retrospective cohort analysis was to generate pilot data that confirm the safety of this selective approach to assigning the appropriate surgical method . chart abstraction with investigational review board approval was undertaken for all cases of hysterectomy performed by 1 attending surgeon from september 5 , 1996 to november 15 , 2004 , at 4 san francisco bay area hospitals for patients with clinically localized , pathologically confirmed , endometrial carcinoma , hyperplasia , or sarcoma . the names were obtained by searching the computer billing data for current procedural terminology ( cpt ) code diagnoses 621.3 , 179.0 , and 182.0 . women with metastatic disease by clinical or radiographic assessment were not included in this retrospective study . at the time of their initial presentation , patients were assigned to an abdominal approach if they had any of the following : documentation of severe adhesions from a prior operative report , a large uterus that would not fit through the vagina without morcellation , or significant copd that precluded a 45-degree trendelenburg position . patient 's weight , height , ( body mass index ) bmi , and age were not considerations in selection of the approach , because both bmi and age have previously been shown to not impact outcomes of tlh . copd was defined as any history of severe asthma or moderate to severe pulmonary obstructive disease considered poorly controlled . all patients received general anesthesia and standard prophylactic cephalosporin antibiotic , a subcutaneous injection of an antithrombin agent , and wore sequential compression devices on their upper and lower legs . tah is defined as an abdominal hysterectomy with a 10-cm to 15-cm vertical incision in the abdominal wall , through which the standard operation is carried out . patients usually require a 3-day to 5-day hospitalization , followed by a 6-week recovery time . for both approaches , all uteri with grade 1 and 2 carcinomas were given to the pathologist for frozen section examination for indicators of lymph node sampling : cervical invasion , deep myometrial invasion , or lymphatic space invasion . the pelvic lymph node dissection consists of resecting the fibro - fatty lymph - bearing tissue from the genitofemoral nerve medially , over the external iliac artery and vein down to the crossing of the deep circumflex iliac vein over the external iliac artery , including the tissue around the internal iliac artery , anterior and medial to the obturator nerve , and lateral to the superior vesical artery and ureter . aortic node dissections included the fibro - fatty nodebearing tissue anterior to the vena cava , the aorta , and to the left of the aorta from the ureters up to the inferior mesenteric artery . the term tlh because this is a relatively new application of surgical technique in gynecologic oncology , the specific steps will be delineated : the patient is positioned in a modified lithotomy position with the hips at about a 180-degree extension and the knees flexed at nearly 90 degrees , with the table tilted nearly 45-degrees trendelenburg . the arms are tucked along the patient 's side and secured in a sled , and large gel or foam bolsters are taped to the table above the shoulders to prevent sliding on the table . after injecting the umbilical apex with marcaine , towel clips are used to elevate the abdominal wall , and a bladed 5-mm endoethicon trocar is inserted vertically without preinsufflation . after insufflation with co2 to 12 mm hg , 3 additional 5-mm ports are inserted under direct visualization , 1 suprapubic and 2 positioned 2 cm medial and superior to the anterior superior iliac crests . the abdominal inspection and cytologic washing are performed before inserting the humi uterine manipulator ( coopersurgical , inc . all adhesions are lysed , and any peritoneal lesions are biopsied or excised before the hysterectomy . once the ureters are identified through the peritoneum at the pelvic brim , the infundibulopelvic ligaments are cauterized with bipolar cautery and incised with the 5-mm lcs harmonic scalpel ( ethicon endo - surgery , cincinnati , oh ) . then , the broad and round ligaments are incised with the harmonic scalpel . to replicate the effects of traction - counter - traction , to facilitate parametrial dissection , the uterus is placed under tense axial elevation by pushing the uterine manipulator directly cephalad . the bladder flap is opened and incised with the harmonic scalpel exposing the anterior cervical fascia . from this point to the incising into the vagina , the cervico - vaginal margin is repeatedly , carefully confirmed by using instrument palpation of the firmer cervix stroma , which moves together as a solid mass , compared with the more pliant upper lateral vagina that dimples easily . also , the surface of the cervix anteriorly and posteriorly are frequently visualized and palpated with the instruments to replace the usual open palpation of the cervico - vaginal margin by the fingers . if it is difficult to identify the precise cervico - vaginal margin , a right angle retractor or ribbon can be passed into the vagina anterior to the uterine manipulator to identify the junction anteriorly so that the harmonic scalpel can by used to puncture into the vagina at 12 o'clock . the uterine arteries are then skeletonized and extensively cauterized at the junction of the lower and middle third of the cervical body by using the bipolar cautery , and incised with the harmonic scalpel directly through to the glistening white , smooth cervical fascia beneath . these are incised in 3 bundles , anteriorly , then posteriorly to include the uterosacral ligament , and lastly medially and inferiorly . this last incision usually identifies the exact edge of the cervico - vaginal margin and allows for the next medial bite to pierce into the vagina at either 9 o'clock or 3 o'clock . entry into the vagina is confirmed by rapid loss of pneumoperitoneum . the uterine manipulator is then removed and a folded glove containing 2 dry , fluffed 4x4-inch gauze is placed in the vagina to maintain the pneumoperitoneum . with direct exposure of the cervical os by using toothed biopsy forceps as graspers on the vagina and the cervical edge , it is possible to expose and incise along the precise margin between the cervix and vagina . once the entire cervix is cut away from the vagina , a tenaculum is inserted through the vagina , beside the glove , to grasp the cervix and deliver the tissue out of the vagina . if node dissection is not indicated , the vaginal apex is closed by using toothed biopsy forceps as graspers and # 1 vicryl laparoscopic suture ( jk-10 endo ethicon ) with an st-3 needle in 3 or more figure - eight ( technically spiral ) sutures made with a wolfe or ethicon needle driver , fixing the vaginal angle to the proximal - most uterosacral ligaments for suspension . patients are given printed information about their bowel preparation , and their inpatient postoperative and home recovery . discharge instructions recommend resumption of all activities as soon as tolerable , and early ambulation and resumption of floor exercise is encouraged . patients are instructed not to engage in any vaginal penetration until after their 6-week vaginal checkup . all patients are seen postoperatively for an abdominal incision check at 10 days and again at 6 weeks . patients are referred for radiation if they have a grade 3 cancer with any invasion , lymphatic channel invasion , or stage ic or higher . office and hospital charts were then reviewed for patient data regarding age , height , weight , parity , preoperative diagnosis , procedure(s ) , estimated blood loss ( ebl ) , duration of surgery , duration of hospital stay , pathologic data including uterine dimensions , weight , cancer characteristics like depth of invasion , grade , presence or absence of lymph - vascular invasion , cervical invasion , pelvic cytologic washings , number of nodes dissected , and complications . the data were analyzed with spss statistical analysis software , with anova and the t test used for comparison of continuous data , and chi - square analyses including fisher 's exact test for nominal data . chart abstraction with investigational review board approval was undertaken for all cases of hysterectomy performed by 1 attending surgeon from september 5 , 1996 to november 15 , 2004 , at 4 san francisco bay area hospitals for patients with clinically localized , pathologically confirmed , endometrial carcinoma , hyperplasia , or sarcoma . the names were obtained by searching the computer billing data for current procedural terminology ( cpt ) code diagnoses 621.3 , 179.0 , and 182.0 . women with metastatic disease by clinical or radiographic assessment were not included in this retrospective study . at the time of their initial presentation , patients were assigned to an abdominal approach if they had any of the following : documentation of severe adhesions from a prior operative report , a large uterus that would not fit through the vagina without morcellation , or significant copd that precluded a 45-degree trendelenburg position . patient 's weight , height , ( body mass index ) bmi , and age were not considerations in selection of the approach , because both bmi and age have previously been shown to not impact outcomes of tlh . copd was defined as any history of severe asthma or moderate to severe pulmonary obstructive disease considered poorly controlled . all patients received general anesthesia and standard prophylactic cephalosporin antibiotic , a subcutaneous injection of an antithrombin agent , and wore sequential compression devices on their upper and lower legs . tah is defined as an abdominal hysterectomy with a 10-cm to 15-cm vertical incision in the abdominal wall , through which the standard operation is carried out . patients usually require a 3-day to 5-day hospitalization , followed by a 6-week recovery time . for both approaches , all uteri with grade 1 and 2 carcinomas were given to the pathologist for frozen section examination for indicators of lymph node sampling : cervical invasion , deep myometrial invasion , or lymphatic space invasion . the pelvic lymph node dissection consists of resecting the fibro - fatty lymph - bearing tissue from the genitofemoral nerve medially , over the external iliac artery and vein down to the crossing of the deep circumflex iliac vein over the external iliac artery , including the tissue around the internal iliac artery , anterior and medial to the obturator nerve , and lateral to the superior vesical artery and ureter . aortic node dissections included the fibro - fatty nodebearing tissue anterior to the vena cava , the aorta , and to the left of the aorta from the ureters up to the inferior mesenteric artery . the term tlh means all surgery was performed entirely through the laparoscopic ports . because this is a relatively new application of surgical technique in gynecologic oncology , the specific steps will be delineated : the patient is positioned in a modified lithotomy position with the hips at about a 180-degree extension and the knees flexed at nearly 90 degrees , with the table tilted nearly 45-degrees trendelenburg . the arms are tucked along the patient 's side and secured in a sled , and large gel or foam bolsters are taped to the table above the shoulders to prevent sliding on the table . after injecting the umbilical apex with marcaine , towel clips are used to elevate the abdominal wall , and a bladed 5-mm endoethicon trocar is inserted vertically without preinsufflation . after insufflation with co2 to 12 mm hg , 3 additional 5-mm ports are inserted under direct visualization , 1 suprapubic and 2 positioned 2 cm medial and superior to the anterior superior iliac crests . the abdominal inspection and cytologic washing are performed before inserting the humi uterine manipulator ( coopersurgical , inc . all adhesions are lysed , and any peritoneal lesions are biopsied or excised before the hysterectomy . once the ureters are identified through the peritoneum at the pelvic brim , the infundibulopelvic ligaments are cauterized with bipolar cautery and incised with the 5-mm lcs harmonic scalpel ( ethicon endo - surgery , cincinnati , oh ) . then , the broad and round ligaments are incised with the harmonic scalpel . to replicate the effects of traction - counter - traction , to facilitate parametrial dissection , the uterus is placed under tense axial elevation by pushing the uterine manipulator directly cephalad . the bladder flap is opened and incised with the harmonic scalpel exposing the anterior cervical fascia . from this point to the incising into the vagina , the cervico - vaginal margin is repeatedly , carefully confirmed by using instrument palpation of the firmer cervix stroma , which moves together as a solid mass , compared with the more pliant upper lateral vagina that dimples easily . also , the surface of the cervix anteriorly and posteriorly are frequently visualized and palpated with the instruments to replace the usual open palpation of the cervico - vaginal margin by the fingers . if it is difficult to identify the precise cervico - vaginal margin , a right angle retractor or ribbon can be passed into the vagina anterior to the uterine manipulator to identify the junction anteriorly so that the harmonic scalpel can by used to puncture into the vagina at 12 o'clock . the uterine arteries are then skeletonized and extensively cauterized at the junction of the lower and middle third of the cervical body by using the bipolar cautery , and incised with the harmonic scalpel directly through to the glistening white , smooth cervical fascia beneath . the arterial pedicle is pushed inferiorly exposing the cardinal ligament fibers . these are incised in 3 bundles , anteriorly , then posteriorly to include the uterosacral ligament , and lastly medially and inferiorly . this last incision usually identifies the exact edge of the cervico - vaginal margin and allows for the next medial bite to pierce into the vagina at either 9 o'clock or 3 o'clock . the uterine manipulator is then removed and a folded glove containing 2 dry , fluffed 4x4-inch gauze is placed in the vagina to maintain the pneumoperitoneum . with direct exposure of the cervical os by using toothed biopsy forceps as graspers on the vagina and the cervical edge , it is possible to expose and incise along the precise margin between the cervix and vagina . once the entire cervix is cut away from the vagina , a tenaculum is inserted through the vagina , beside the glove , to grasp the cervix and deliver the tissue out of the vagina . if node dissection is not indicated , the vaginal apex is closed by using toothed biopsy forceps as graspers and # 1 vicryl laparoscopic suture ( jk-10 endo ethicon ) with an st-3 needle in 3 or more figure - eight ( technically spiral ) sutures made with a wolfe or ethicon needle driver , fixing the vaginal angle to the proximal - most uterosacral ligaments for suspension . patients are given printed information about their bowel preparation , and their inpatient postoperative and home recovery . discharge instructions recommend resumption of all activities as soon as tolerable , and early ambulation and resumption of floor exercise is encouraged . patients are instructed not to engage in any vaginal penetration until after their 6-week vaginal checkup . all patients are seen postoperatively for an abdominal incision check at 10 days and again at 6 weeks . patients are referred for radiation if they have a grade 3 cancer with any invasion , lymphatic channel invasion , or stage ic or higher . office and hospital charts were then reviewed for patient data regarding age , height , weight , parity , preoperative diagnosis , procedure(s ) , estimated blood loss ( ebl ) , duration of surgery , duration of hospital stay , pathologic data including uterine dimensions , weight , cancer characteristics like depth of invasion , grade , presence or absence of lymph - vascular invasion , cervical invasion , pelvic cytologic washings , number of nodes dissected , and complications . the data were analyzed with spss statistical analysis software , with anova and the t test used for comparison of continuous data , and chi - square analyses including fisher 's exact test for nominal data . of the 105 patients with endometrial pathology , 76 qualified for tlh , and 29 underwent tah . patients had a significantly higher mean age in the tah group , ( 68 vs. 61 years , p=0.021 ) ( table 1 ) . no significant differences existed in height , weight , body mass index ( bmi ) , or parity . therefore , the surgico - pathological analyses that would be affected by age were done controlling for age . patient demographics ( anova ) most women had a diagnosis of endometrial carcinoma preoperatively ( 83.8% ) as well as a final diagnosis postoperatively ( 81% ) . the tah group had more cases of endometrial carcinoma than did the tlh group both by preoperative biopsy assessment ( 97% vs. 79% , p=0.036 ) , and by postoperative final pathology ( 97% vs. 78% , p=0.021 ) . one patient in each group had complete staging for a pelvic mass and was later confirmed to have 2 primaries : stage ia endometrial carcinoma and stage ia ovarian carcinoma . two patients were found to have a sarcoma , a stage ic low - grade sarcoma , and a stage ia high - grade stromal sarcoma ( table 2 ) . patient diagnoses ( fisher 's exact test ) in table 3 , the surgical data are stratified by approach , adjusting the means for age . the mean durations of surgery for abdominal and laparoscopic approaches were similar ( 154 min ) . blood loss was higher in the tah group ( 504 ml vs. 138 ml , p<0.001 ) , and transfusions were more common ( 0.69 units / patient vs. 0.04 , p=0.001 ) . length of hospital stay was longer for tah than for tlh ( 5.4 days vs. 1.8 days , p<0.0001 ) . surgical data by approach ( anova ) mean adjusted for age . in table 4 , uterine sizes were larger in the abdominal approach groups by width ( p=0.018 ) , depth ( p=0.041 ) , and weight ( p=0.008 ) , but not length . tah cases were more likely to have outer third myometrial invasion ( 48% vs. 17% , p=0.001 ) , but tlh cases had more superficial or noninvasive tumors ( 28% vs 68% , p=0.001 ) . tumor grade and incidence of cervical invasion or peritoneal fluid spread were similar in both approaches , but a higher incidence of lymph vascular space invasion ( lvsi ) ( 38% vs. 17% , p=0.036 ) occurred in the tah group . more patients with 1998 figo stage ii or higher were assigned to the tah group ( 35% vs. 17 , p=0.038 ) . tah group patients were more likely to have a node dissection indicated by virulence factors ( 79% vs. 28% , p=0.001 ) ; however , the lymph node yields were similar ( p=0.810 ) : 16.3 nodes by laparotomy ( range , 2 to 45 ) and 18.0 nodes by laparoscopy ( range , 4 to 56 ) . no significant difference existed in total complication rates for the abdominal or laparoscopic groups ( 14% vs. 5% , p=0.111 ) or in reoperative complication rates ( 10 vs. 3% , p=0.128 ) ( table 5 ) . four complications occurred in the tah group : 2 cases of wound dehiscence and 1 case of postoperative hemorrhage requiring reoperation , and 1 case of postoperative wound infection treated with packing . among the tlh cases , 1 case each of trocar site herniation and small - bowel adhesions to the vaginal cuff causing small - bowel obstruction required reoperation . one patient had prolonged diverticulitis after her tlh , and one had vaginal cuff dehiscence , both resolving with expectant management . one tlh patient was converted to open laparotomy when bulky metastatic lesions were identified in the nodes , and on the peritoneal surfaces . this study documents a series of patients with clinically early uterine neoplasia assigned by clinical safety parameters to tlh as default , or to tah when necessary . based on the results of this series , tlh can be recommended for randomized clinical trials as a potentially safe alternative to tah for many women , with no increased morbidity . obese , elderly , and nulliparous women have a higher incidence of uterine carcinoma in comparison with others . although we did not use bmi , age , or parity in the assignment of surgical approach , historically , obesity and senior age have been seen by some as a relative contraindications to a laparoscopic approach . obese patients sustain more blood loss and more incisional and infectious complications from laparotomy and may incur significant potential benefit from a laparoscopic approach . although obese women can tolerate increased intraperitoneal pressure well if they have normal cardiac function , respiratory mechanics can be adversely affected for the duration of the pneumoperitoneum . in particular , obese women often need higher than usual inspiratory pressures in the trendelenburg position , because the weight of the abdominal wall , bowel , and omentum on the diaphragm reduces ventilatory compliance during surgery . peritoneal insufflation has also been shown to cause a significant reduction in cardiac output , increases in mean arterial pressure and pulmonary vascular resistance , demonstrating that senior patients with copd are not candidates for a laparoscopic approach . in one series , a higher risk of conversion to open laparotomy was observed with increasing bmi over 30 . in our entire series of laparoscopic hysterectomies reported elsewhere , which now totals over 611 , we have not observed higher complications , blood loss , surgical durations , hospital stay , or conversions to laparotomy due to obesity , senior age , or cardiorespiratory problems . in this uterine neoplasia series , 56/105 ( 53% ) of our tlh patients had bmi over 30 with no increase in complications . our heaviest patient weighed 331lbs , with a bmi of 60 , and sustained a 50cc operative blood loss , taking 90 minutes to complete , and was discharged the day after surgery . senior women have been observed to benefit from a laparoscopic approach in multiple gynecologic cancer sites . we have previously reported our series of total laparoscopic hysterectomies for women with oncologic problems stratifying our outcomes by age , showing no increase in rate of complications , surgical durations , volume of blood loss , or hospital stays . twenty of 76 ( 26% ) women in this laparoscopic series were over age 70 , with the eldest being 90 . none required conversion to laparotomy , but one had trocar - site herniation . in both treatment groups in this study , although lavh has been reported for treatment of women with endometrial carcinoma , many nulliparous women , lacking descensus , will still require open laparotomy or risk conversion to laparotomy when the vaginal dissection becomes impossible . because all of the dissections in the tlh are performed abdominally via a laparoscopic approach , this procedure is available for women with no descensus or who have long , narrow vaginas . we believe that if surgeons learn to perform hysterectomy entirely via laparoscopes , morbidity from hysterectomy would be reduced . in addition , avoiding any vaginal approach , even among women with adequate descensus or vaginal capacity , may also reduce the risk of subsequent urinary incontinence and vault prolapse , both of which are seen more often after vaginal hysterectomies than after laparotomy hysterectomies . many are concerned that significantly longer operating times are necessary with any laparoscopic approach , especially with lavh ; however , shorter endoscopic operating times have been reported with greater laparoscopic surgical experience and with a total laparoscopic approach when compared with lavh . our data support this , showing no difference in operating times between our tlh and tah groups , which persists even when all patients having node dissection are excluded ( 154 min vs. 138 minutes , p=0.535 ) . as expected , we observed a lower mean blood loss and fewer transfusions with tlh ; however , this information should be tempered with the observation that women undergoing abdominal approaches had significantly larger uteri than women having laparoscopic approaches . our tlh blood losses have decreased over time . from the 20 most recent laparoscopic cases , 13 patients lost under 100 ml , with 9 of these patients undergoing node dissections . the shorter median and mean hospital stay for the tlh patients ( mean , 5.4 days vs. 1.8 days , currently , we discharge patients in the afternoon of postoperative day 1 even if they require a node dissection . from the 20 most recent tlh cases , with 9 of these patients undergoing node dissections , 19 went home the first day after surgery . the tah group also had significantly larger uteri , deeper myoinvasion , more lymphatic channel invasion and a trend to higher grade ; thus , significantly more lymph node dissections . this may also relate to the fact that the tah patients were older , as senior women with endometrial cancers have been shown to have more aggressive disease . women with larger uteri may have had more progression of their disease before diagnosis and thus be assigned to open approach more often . prior reports from this cohort have confirmed that node dissections were not more complicated in senior or obese women compared with node dissections in younger or more ideal - weight patients . laparoscopic node dissections are generally easier and incur less blood loss because the vasa vasorum are much more clearly seen and clipped . in fact , we analyzed blood loss in tlh cases with and without node dissection and found no difference ( 148 vs. 124 ml , p=0.841 ) . peritoneal cytology was positive in similar proportions of both groups ( 22% vs. 15% ) , and roughly similar to other reports of 11% in clinically early stage series . some of our patients had undergone hysteroscopy before referral to our oncology service , which may have contributed to risk of peritoneal cytology positivity and obscured finding natural differences in tumor virulence . unfortunately , we did not collect data on the use of preoperative hysteroscopy to analyze the effects of this procedure . recent reports have associated lavh with a higher risk of positive cytology , possibly because of excessive uterine manipulation during the procedure extruding malignant cells out through the fallopian tubes . in our practice , we minimize risks of iatrogenic peritoneal positivity by strongly discouraging the use of diagnostic hysteroscopy among our referral base unless uterine cancer has been ruled out . we also do not insert the uterine manipulator until after coagulating the tubes , and we use only gentle and minimal manipulation of the uterus . the rate of urologic complications seen so often in patients undergoing lavh or tlh was surprisingly not seen in this series , although other patients in the surgical practice of the authors have sustained urologic injuries , which are reported elsewhere . currently , after completing 611 tlhs for all gynecologic indications , 15 patients ( 2.5% ) sustained a urologic injury , with 7 ( 1.2% ) undergoing recognition and immediate repair ( 4 cystotomy repairs and 2 ureteroureterostomies ) , and 8 ( 1.3% ) requiring re - operation ( 4 ureteral stents , and 4 ureteroneocystotomies ) . all but 2 of the urologic injuries occurred during the first two thirds of cases . we attribute the decreasing rate of urologic injuries in this series to the learning curve and to our method of dissection of the cardinal ligament precisely on the cervical fascia , with rigorous use of traction - counter - traction , and frequent palpatory and visual reappraisal of the cervico - vaginal anatomy . no port - site recurrences were noted , but 1 patient had a vaginal cuff recurrence and is disease free after radiation . although 2 patients developed wound dehiscence in the tah group , 1 tlh patient herniated her small bowel through a 5-mm trocar site , and all required reoperation . vaginal dehiscence developed in another patient after sexual penetration at 6 weeks , which healed without re - operation . many serious challenges exist to the utility and validity of comparing these 2 groups of patients in a single practice , most having to do with the initial nonrandom , clinically based assignment of approach . such selection bias does significantly mimic clinical practice standards , offering implications for surgeons in practice , but this selection bias also hinders the broader utility of these data except as a pilot series . in the absence of the randomized clinical trials confirming any guidelines for assignment of approach , our conservative pattern of assignment was entirely clinically based : pulmonary disease , metastatic disease , documented severe adhesions , or a measurably large uterus , but randomized clinical trials are now needed and indicated . the nonrandom assignment to approach is also the most probable cause of the age disparity observed between the patients undergoing the 2 approaches . older women are more likely to have had more surgeries , developed pulmonary disease , and to be at risk for postoperative medical complications . age is not normally a limiting factor for laparoscopic approaches , but pulmonary function must be grossly normal or evaluated and cleared preoperatively . the nonrandom assignment criteria for surgical approach are likely also responsible for the observation of tah group patients having larger uteri , deeper myoinvasion , higher stage , and trend of higher grade , and thus more node dissections . however , the lymph node yields were similar in both approaches , and similar to yields previously reported for either laparotomy or laparoscopy . another of the initial assignment criteria , that the uterus not be overly enlarged precluding its removal per vagina without morcellation , also contributes to the observation of larger uterine size in the laparotomy group and may predispose to larger , more invasive lesions . this criterion was initially important because of the concern about spill - age of cancer cells into the peritoneum with morcellation of a large , cancerous uterus . recently , we have obviated that concern in multiparous women to some degree by using a lapsac ( cook surgical , chicago , il ) ripstop nylon 5x8-inch sack with a purse string . the sack is passed through the 10-mm umbilical trocar , encasing the uterus with the cervix pointing toward the open end , and passed out of the vagina , draw string first , allowing morcellation of the uterus from within the sack , with no peritoneal spillage . the laparoscopic techniques used and described above roughly parallel that of the traditional open technique ( except the morcellation ) , making the procedure more easily learned by abdominal gynecologic surgeons . one can safely obtain experience and practice the technique during open surgery by performing the entire open laparotomy hysterectomy with the cs harmonic scalpel , which is the hand - held , shorter version of the 5-mm laparoscopic lcs harmonic scalpel , designed for open procedures . other safety procedures , similar in both the open and laparoscopic , and familiar to every gynecologic surgeon , include frequent identification of the ureters , constant traction - counter - traction to separate the uterine arteries from the ureters with constant upward axial pressure on the uterine manipulator , and frequent palpatory identification of the cervical and parametrial anatomy . the last limitation is the great variability of surgeons ' experience at laparoscopic surgery and ability to convert their open skills to laparoscopic skills . we recommend that surgeons learning these techniques should work with other attending surgeons in their early series , because residents are not typically able to prevent complications when they are also learning these techniques . we are hopeful that these data will serve to justify prospective , randomized clinical trials . the series exposes difficulties , highlights risks that need to be minimized , and confirms the safety of the procedure , which will be important in designing randomized trials . taking into account concerns about the assignment to approach and the disparities in age , comparison of data from the 2 different approaches is still very useful and mimics actual clinical practice standards . rather , they evaluate each patient 's surgical and medical history , physical examination , and radiological testing data to determine the safest and most feasible approach . they also perform additional procedures to address pelvic floor dysfunction and anomalous findings as needed . this series reflects just that standard , documents the surgical difficulties and clinical utility of each approach , and illuminates the need for study in prospective randomized trials . many serious challenges exist to the utility and validity of comparing these 2 groups of patients in a single practice , most having to do with the initial nonrandom , clinically based assignment of approach . such selection bias does significantly mimic clinical practice standards , offering implications for surgeons in practice , but this selection bias also hinders the broader utility of these data except as a pilot series . in the absence of the randomized clinical trials confirming any guidelines for assignment of approach , our conservative pattern of assignment was entirely clinically based : pulmonary disease , metastatic disease , documented severe adhesions , or a measurably large uterus , but randomized clinical trials are now needed and indicated . the nonrandom assignment to approach is also the most probable cause of the age disparity observed between the patients undergoing the 2 approaches . older women are more likely to have had more surgeries , developed pulmonary disease , and to be at risk for postoperative medical complications . age is not normally a limiting factor for laparoscopic approaches , but pulmonary function must be grossly normal or evaluated and cleared preoperatively . the nonrandom assignment criteria for surgical approach are likely also responsible for the observation of tah group patients having larger uteri , deeper myoinvasion , higher stage , and trend of higher grade , and thus more node dissections . however , the lymph node yields were similar in both approaches , and similar to yields previously reported for either laparotomy or laparoscopy . another of the initial assignment criteria , that the uterus not be overly enlarged precluding its removal per vagina without morcellation , also contributes to the observation of larger uterine size in the laparotomy group and may predispose to larger , more invasive lesions . this criterion was initially important because of the concern about spill - age of cancer cells into the peritoneum with morcellation of a large , cancerous uterus . recently , we have obviated that concern in multiparous women to some degree by using a lapsac ( cook surgical , chicago , il ) ripstop nylon 5x8-inch sack with a purse string . the sack is passed through the 10-mm umbilical trocar , encasing the uterus with the cervix pointing toward the open end , and passed out of the vagina , draw string first , allowing morcellation of the uterus from within the sack , with no peritoneal spillage . the laparoscopic techniques used and described above roughly parallel that of the traditional open technique ( except the morcellation ) , making the procedure more easily learned by abdominal gynecologic surgeons . one can safely obtain experience and practice the technique during open surgery by performing the entire open laparotomy hysterectomy with the cs harmonic scalpel , which is the hand - held , shorter version of the 5-mm laparoscopic lcs harmonic scalpel , designed for open procedures . other safety procedures , similar in both the open and laparoscopic , and familiar to every gynecologic surgeon , include frequent identification of the ureters , constant traction - counter - traction to separate the uterine arteries from the ureters with constant upward axial pressure on the uterine manipulator , and frequent palpatory identification of the cervical and parametrial anatomy . the last limitation is the great variability of surgeons ' experience at laparoscopic surgery and ability to convert their open skills to laparoscopic skills . we recommend that surgeons learning these techniques should work with other attending surgeons in their early series , because residents are not typically able to prevent complications when they are also learning these techniques . we are hopeful that these data will serve to justify prospective , randomized clinical trials . the series exposes difficulties , highlights risks that need to be minimized , and confirms the safety of the procedure , which will be important in designing randomized trials . taking into account concerns about the assignment to approach and the disparities in age , comparison of data from the 2 different approaches is still very useful and mimics actual clinical practice standards . rather , they evaluate each patient 's surgical and medical history , physical examination , and radiological testing data to determine the safest and most feasible approach . they also perform additional procedures to address pelvic floor dysfunction and anomalous findings as needed . this series reflects just that standard , documents the surgical difficulties and clinical utility of each approach , and illuminates the need for study in prospective randomized trials . we report this retrospective , observational series of total laparoscopic hysterectomies and total abdominal hysterectomies to document the safety and reasonable surgical parameters so that more surgeons will undertake a total laparoscopic approach for their patients with endometrial pathology when safely indicated . given that a laparoscopic approach can never be recommended for all women with clinically early endometrial cancer due to the previously mentioned contraindications , selective assignment of approach the data generated from this series , which demonstrate the feasibility , benefits , and utility for select patients in real clinical practice , should serve as a basis for conducting future randomized clinical trials .
objective : retrospective analysis of surgico - pathologic data comparing total laparoscopic hysterectomy ( tlh ) with total abdominal hysterectomy ( tah ) patients with uterine neoplasiamethods : we conducted a chart abstraction of all patients undergoing hysterectomy for uterine neoplasia from september 1996 to november 2004 . patients were assigned to undergo the abdominal or laparoscopic approach based on established clinical safety criteria.results:the study included 105 patients , 29 with tah and 76 with tlh . tah patients were older ( 68 vs. 61 , p=0.021 ) ; however , both groups had similar body mass indexes ( 31 ) and parities ( 1.6 ) . controlling for age , surgical duration was similar ( 152 minutes ) . average blood loss was higher for tah , ( 504 vs.138 ml , p<0.001 ) . hospital stays were significantly longer for patients with tah than for those with tlh ( 5.4 vs. 1.8 days , p<0.0001 ) . uterine weight was greater ( 197 vs. 135 g , p=0.008 ) and myometrial invasion deeper in the tah group ( 48% outer half vs. 17% , p=0.001 ) . more patients had stage ii or higher disease in the tah group ( 35% vs. 17% , p=0.038 ) . more tah patients needed node dissection ( 79% vs. 28% , p<.001 ) . node yields from dissections of 23 tah cases and 21 laparoscopic cases were similar ( 17 nodes ) . total and reoperative complications from tah versus tlh were not statistically different in our small sample ( 14.3 vs. 5.2% total , ns ; 10.3 vs. 2.6% reoperative ) . one conversion was necessary from laparoscopy to laparotomy for unsuspected bulky metastatic disease.conclusion:based on clinical selection criteria , tlh performed for endometrial pathology has few complications and is well tolerated by select patients . the advantages are less blood loss and a shorter length of hospital stay for qualified patients .
kathleen canning has used the german factory to locate her work on the dichotomy between experience and discourse to contend that the study of when canning s theoretical framework was applied to medical records captured in the nineteenth - century irish convict prison , this research found that the experience of incarceration not only affected behaviour : it also made an impact on body mass . to ensure order , efficiency and efficacy , institutions required the convict was stripped of worldly possessions , denied freedom of movement by being confined in a particular space , and then subjected to regimes of diet , work and exercise . it would be reasonable to assume that the balance of power was weighted in favour of the prison authorities but this study highlights that there were exceptions . using 251 medical sheets extrapolated from general prison board ( gpb ) files in 1885 and 1895 this article traces anthropometrical change to argue that within the irish convict system the prison medical service ( pms ) and , to a lesser extent , the chaplaincy became sites of challenged , resisted and contested power . it is divided into four main parts : the introduction provides a background to the gpb in order to place the function of the pms and of the prison medical officers ( pmo ) in the wider penological context . the second section focuses on the prison medical sheets , which provide strong evidence of the pmos consciousness of their role in rehabilitating deviant bodies . the third section discusses weight fluctuation among men using bmi calculations and finds that the convict was not without agency . the final section profiles a selection of accounts of individual convict experiences to show how convict interaction with the pms was a gendered affair . the focus on individual cases provides an alternative perspective to foucault s universalised convict body. in 1877 the gpb was formed to replace the offices of the inspector general of prisons and the director of convict prisons . both these bodies were established under the 1854 convict prisons act to deal with the transition from transportation involving distant locations like australia and barbados , to a policy of confinement in ireland . although the primary aim of the act was to centralise governance and thereby reduce costs , it also aimed to streamline the number of detention centres . by 1880 there were just four remaining convict prisons in ireland : mountjoy male , mountjoy female , and lusk , all located in dublin , while spike island was in cork harbour ( it closed in 1883 and its functions were absorbed by maryborough ) . as william vaughan states , patrick carroll - burke s work , for example , traces the development of prisons from the eighteenth century , but focuses on the shift away from deportation towards domestic confinement and the development of a reformatory system . however , the analysis ends in 1870 , owing to the increasingly complex nature of irish administration in that period . it is not surprising then that the function of the pmo as a key agent of the disciplinary mechanisms within the irish penitentiary system the development of british penology has enjoyed a much longer history ; of particular note are barry godfrey et al.s work on the nature of crime and sean mcconville s multi - volume work on the history of imprisonment . there has also been a greater degree of engagement with michel foucault s work by scholars of the british prison system , with michael ignatieff , joe sims and david garland all challenging the chronology of his confinement theory . foucauldian approaches , however , have also enriched the british analysis , and his argument that prison functioned not merely to curtail personal freedom , but also as an instrument for the modulation of the penalty , has found fruitful expression . michael ignatieff , for example , recognised that , within prison power structures , the function of the pms was as much to discipline and regulate behaviour as it was to provide healthcare . this research parallels findings in the irish system , where the pms functioned as a central modality of power in the everyday of the part of the discipline of the prison was to subject the convict body to a strict regime of rules and regulations involving early mornings , allocated work , dietary asceticism and exercise . apart from the initial compulsory physical examination and a final weigh - in , engagement with the pms was voluntary , in the absence of disease . given its extensive remit , it is unsurprising that the infirmary became a very important site of arbitration over food , work , exercise and personal hygiene . anne hardy traces the origins of pms power in england to an 1850 act for the better government of convict prisons . from that point she notes that pmos were quick to organise as a professional body with a discernible career progression . in ireland the convict system was a much smaller entity that was run separately from that in england , wales and scotland . the legislation that governed the appointment and main duties of medical officers , apothecaries and chaplains was outlined in sections 7174 of the prisons ( ireland ) act , 1826 . when the 1877 act threatened their position irish pmos were quick to react , and given quarter , albeit brief . for example in august 1878 , dr george e. brunker from the association of infirmary and gaol surgeons wrote to the royal college of physicians of ireland ( rcpi ) seeking its support in opposing the stipulation that that pmos were to compound and dispose of their own medicines , thus making the office of apothecary obsolete and , in the process , lessening the professional importance of the physician - surgeon . this suggests that after over fifty years of incremental professional gains they were unwilling to accept any challenge to their authority . when a new approved diet was introduced in june 1879 it was criticised heavily by the irish pmos for being insufficient and unsuitable . it was better than its predecessors in its inclusion of more meat but perhaps this was an expression of dissatisfaction with the limitation of their power to mete out micro - punishments . joe sims indicated a similar discontent among english pmos who were aware of their role in the hierarchy of punishment . they recognised how critical control of the stomach was to their power and they were slow to relinquish such claims : the power of the stomach as an implement of education , moral and intellectual it is a pity to surrender any power left to us of improving the manners of criminals. in ireland a medical commission was initiated in late 1879 to consider pmo complaints . it concluded that the diet devised was adequate for ordinary inmates and that it would be unnecessary for medical officers of prisons to interfere with the suggested scales in the direction of any increase , except under circumstances distinctly connected with the existence of disease in individual prisoners. despite the contractions in power in 1877 pmos could still exact considerable control over all aspects of the daily grind . along with general medical care , which comprised a careful balance between monitoring the prevalence of infectious disease and the policing of malingering , the infirmary regulated food rations , permission to smoke and all manner of relative luxuries within the penal system . by statute the relationship between the convict and the pms was forged within a week of their reception . apart from assigning the class of labour and , therefore , the punishment the convict was suited to , the pmo also had power over civil liberties . the personal hygiene of convicts was also determined by the medical staff , with decisions regarding whether or not men were permitted to wear beards , the length of their hair and whether they could be exempt from washing resting in their hands . the pmo played a crucial part in the sanction of corporal punishment for deviants within the convict system ; effectively he had the power to overrule the governor if he found from the outset that the convict was physically unable to withstand it . if , during the administration of lashes , there was a threat to health the pmo could halt the process . in foucault s discourse the agency of individual prisoners receives little consideration : he focuses rather on their collective subjugation by power structures and the daily routine . but an examination of individual records reveals the subtlety of power politics , and the negotiation of roles and privileges within the system . although the records are not without their limitations and were constructed for specific carceral functions , this analysis of 251 prison medical sheets and case studies of individual convicts indicates that the authority of the medical officer was not absolute , and that convicts and their behaviour manipulated practice . for the convict the starkness of corporeal realities became apparent on arrival . but clever and , in particular , recidivist convicts quickly concluded that their bodies and how they managed them could yield relative luxuries during incarceration . they recognised that the infirmary could in fact be a useful survival mechanism , which , if exploited correctly , could ease the severity of their incarceration . this process of manipulation brought with it the risk of a malingering charge , which could mean the punishment of additional time and the forfeiture of marks earned . sims suggests that there was certain degree of resistance to medical power in his work on the english system , but the datasets used here highlight the contrary , with a large degree of voluntary engagement with , and a natural recourse to , the pms , particularly among male convicts . male convicts exhibit a certain degree of physiological knowledge of disputable matters like abstract pain , while varicose veins , weak chests and heart conditions ( real or imagined ) could be useful and easily exploitable disabilities within the system . sara horrell et al have found that weight gain or loss in british bridewells was sensitive to many factors , especially stage of life and gender . this paper shows that convicts , the majority of whom were habitual criminals , had healthy baseline weights on entry , which increased during incarceration . as cormac grda and joel moykr write on their findings from a study of east india company soldiers heights and weights , this paper asserts that it is too reductionist to posit that weight gain can be solely attributed to superior dietaries . instead it points to an imbalance between calorific intakes and physical expenditure as a more likely cause of weight gain . the importance of the prison medical sheet records to scholars of the irish social history of medicine can not be understated . despite the voracious appetite for ethnographic data in the late victorian period of political and medical endeavour the empirical method employed in this article has been shaped by the organisation of the gpb penal files at the national archives of ireland , which are catalogued by year of release . a note on record limitations : it is difficult to align these data meaningfully with the annual reports , which are mainly arranged by year of incarceration and total number of releases in a given year . at a basic level : not all convict files survive . in 1895 , 129 penal files are extant but , according to the gpb annual report a total of 154 convicts were released . each of the gpb files contains a prison medical sheet , the purpose of which was to document the medical examination of each convict on arrival to determine his suitability for hard labour . as a result , a corpus of anthropometrical evidence survives , which is indicative of general good health on admission and significant weight fluctuation during incarceration . there were four categories into which the convicts were placed : stout and strong , fat , spare but muscular and finally spare and weak ( see figure 1 ) . there could be a significant variation in body types : in 1885 a mere fifteen convicts were described as spare but muscular , while one robert mcauley who was 56 and weighed 14 stone , was described as fat. at the opposite end of the spectrum , seven were returned as spare and weak , one was described as the terms spare and weak and spare and muscular were used to describe bodies in healthy weight ranges of which there were sixty convicts . as figure 1 illustrates , a further sixty - six were described as stout , while three had no entry . what is most valuable in anthropometrical terms is that they were also weighed on departure so it is possible to determine total weight gain or loss over a this is in contrast with the wandsworth data of horrel et al . , where exit weight was not consistently recorded and , of course , sentences in bridewells were much shorter . what is also clear is that the resident physicians appear to have been influenced by the nature of crime committed and their original assessments of body mass determined the type of experience a convict would have . pmos were at the outset acutely aware of their role in the modulation of the penalty and this is reflected in the way they dealt with perpetrators of heinous crimes . for example , murderers and wife - beaters elicited very little sympathy , irrespective of age and physical condition . vaughan s work has shown that definitions of what constituted capital crime , whether felony or misdemeanour were sensitive to acts of parliament and the ebb and flow of judicial decision - making , but by the time the gpb was established sentencing for serious crime was more formulaic . this was the effect of the crofton system developed in the 1850s and 1860s by sir walter crofton , director of the irish penal system throughout that period . his rhetoric was shaped by the perception that the habitual criminal problem was on the rise , a belief strengthened by the effect of the cessation of transportation in the 1850s . crofton s penological formula depended upon a system of standardised sentences , for example , serial offenders incarcerated for larceny were routinely sentenced to five years penal servitude . there was , however , an early release phase and most convicts were released on licence after serving two thirds of their sentence . in all aspects of crofton s intricate mark system ( where convicts earned marks for obedience and industry ) the pmo played a central part in determining just how strenuous hard labour could be for individual prisoners . experience. pmos could also petition the lord lieutenant for clemency in cases where a convict s life was in danger . as these data were derived from convict prison records , it must be borne in mind that they principally concern the seasoned criminal . in 1885 , 59.6% of those in local prisons were recommitments. the majority of those who presented to the convict prison were recidivists who had crossed the judicial rubicon by the nature and frequency of their crimes . of the 124 convicts incarcerated in the year ended 31 march 1886 , only thirty - one or 25% were first time offenders ; in the case of seven , or 5.6% , antecedents were unknown ; but eleven had offended fifteen times or more . there was a sliding scale of prior convictions among the remaining seventy - five convicts . thomas reid , alias robert mccracken ( c165 ) , was in many respects a typical recidivist : in 1887 at the age of 26 he was sentenced to ten years . his criminal career began early : in 1875 he absconded from an industrial school , after which he spent five years in a reformatory . shortly after his release in june 1880 he was apprehended for larceny , and again in 1881 for housebreaking and larceny . foucault has noted that in france , crime became less violent long before punishment became less severe and this shift from a criminality of blood to a criminality of fraud is strongly reflected in the irish convict records . crimes such as larceny significantly outweighed serious crimes like manslaughter and murder in the incarceration records of the late nineteenth century . for example , in 1885 sixty - five of the 123 prisoners released were originally incarcerated for theft related crimes , as against eight counts of manslaughter . some offenders were incarcerated for more than one offence at a time , which of course reduces overall classification accuracy . other offences included single incidences of sodomy , assault on a police constable , placing an obstruction , arson , obtaining money under false pretences , receipt of stolen goods and breaking into a chapel . there was little difference between these and the 1895 sample save a doubling of the number of convicts released after serving terms for manslaughter . complicated intricacies of legislation and its practice aside , those incarcerated for violent crime such as murder were convicts whose sentences were commuted to penal servitude , invariably for life . it was in such cases that the pmos consciousness of their role in the modulation of the penalty was most pronounced . in 1890 , 80-year - old peter keenan received a life sentence for manslaughter . he was categorised by the pmo dr patrick okeefe as spare but muscular and consequently able for light work , notwithstanding his age . following several pleas by his son to the lord lieutenant on the grounds of ill health he was released on licence in 1895 for the remainder of his natural life. keenan s case is tabulated in the annual gpb report under release on medical grounds , where it also cites that his debility and old age were noted prior to conviction . okeefe s stern medical convictions appear to have been influenced by the type of convict he was dealing with , and keenan , whose incarceration was due to the accidental death of a neighbour following a dispute over land , had six priors . in 1883 , okeefe , who had spent a decade at spike island , took charge of mountjoy pms , and was remembered in obituary as having a remarkable memory for faces , and few returned prisoners escaped recognition by him. while periods of incarceration were often commuted , meaning that prisoners rarely served their full term , those who misbehaved within the system , or while they were released on licence , could serve their full sentence as punishment . thus william ryan , released on a sixty - day licence when he assaulted daisy hall , was convicted by dublin metropolitan police court on 29 march 1895 and his licence revoked . there are several examples of those who moved address without notifying the local constabulary and were therefore returned to fulfil the rest of their sentence . in this manner , serving a full sentence became itself a punishment within a system that routinely diminished sentences as a reward , or on compassionate or health grounds . the prison sentences served by those released in 1885 tended to be longer than those released in 1895 . this trend was underpinned by changing attitudes to sentencing combined with sensitivity to the problem of over - crowding in prisons . most prisoners were shifted between prisons in the course of their sentence as they moved between classes , which were linked to the nature of crime , the associated punishment and its severity , or the risk of escape , equating loosely to modern day this degree of fluidity resulted in an intense scrutiny of the criminal body and a meticulous recording of physical deviance from the ideal physical norm . alias usage was so common that prison officials were careful to describe every visible mole , missing tooth , tattoo and scar on the prisoner s form . the power of the pmo extended far beyond the prison sentence , since a key function of the gpb medical sheet descriptors was to map the distinguishing marks which enabled the authorities to track and trace recidivists . age discrepancies also posed a problem , which prompted one official to annotate in the small space allocated for a two digit age entry that david graham , aged 58 , looks older. several other cases were investigated . although the science of physiognomy was not as fully applied to the convict irish body as elsewhere thus , one male convict was described as having a low forehead. in this highly unusual case the convict who was a vagrant in the garb of a christian or lay brother , refused to give his name before and during his five - year sentence . he served four years and his early release was due to ill - health . in the annual returns to parliament few outbreaks of disease are recorded in the convict prisons and this may be due to the fact that most appear to have entered the prison in a relatively healthy state . only nine of the 1885 dataset were women , while 113 were men , and two of the male convict files had no medical sheets . of the total of 122 prisoners twenty - three lost weight , eighty - six gained weight , and thirteen were not counted because their weights were not ascertained on arrival or their sheets were missing . as the sample has so few women , table 1 focuses on men released in 1885 and 1895 and for whom the bmi on entry and on departure could be determined . as table 1 shows , the average age of 102 male convicts released in 1885 was 28.4 , while the 111 convicts released in 1895 had an average age of 34.5 . strictly speaking this might be considered an arbitrary calculation as all have different entry years but it serves to highlight that most were mid - career criminals . of the 1885 dataset , 102 could be factored for bmi , which averaged 24.59 on entry , and 25.3 at discharge . this is at the upper reach of a modern healthy range and almost in the overweight category ( the majority would have been imprisoned between 1880 and 1882 and so would have served a minimum of three years ) . the comparative figures for the 1895 dataset were 111 at a slightly lower average entry bmi of 23.38 on entry and 24.67 on leaving . it is worth bearing in mind that all prisoners were measured according to instruction , without boots , which gives a higher accuracy in height data . it is unclear if convicts were weighed in their clothes or if an adjustment for clothing was already made by the physician to the recorded weights , and for that reason i have elected to leave the figures as they were recorded and not employ the standard methods suggested by roderick floud . convicts were required to undertake a thorough washing before being divested of all worldly possessions and being forced to wear a uniform . it is not clearly stipulated that the medical examination should occur in a state of nudity . jeremiah odonovan rossa , a fenian prisoner , recounted a variety of procedures in his experience of irish and english gaols . he wrote how he was examined in a nude state at mountjoy in 1865 to ensure he was not concealing anything on his person ; it does not mention if the search was conducted by the pmo . judging from the photographs ( taken on entry and on departure ) , clothing for ordinary convicts was made of tweed or woollen materials and would have included trousers , shirts , a waistcoat and jacket for men , while women s attire comprised skirts , blouses and shawls , which would have added a conservative estimate of 5lbs weight to each individual . this is an important consideration , which alters any assessment of prisoner bmi by modern standards . tall , and weighing 149lbs on arrival and 187lbs on departure , he had a bmi of 20.2 and 25.1 respectively . however , adjusted for a 5 lb disparity , connors would have a bmi of 19.5 on arrival and 24.7 on departure , placing him just outside the modern range for obesity . table 1:male convict weight fluctuation.yeartotalaverage age on entryentry bmiexit bmino . the case of john connors is especially interesting , as his weight gain of 48lbs ( over eight years ) was the largest recorded . doubtful of mind and as having a delicate chest on first reception . spare and weak , he suffered from recurrent coughs and was regularly prescribed the this weight gain was , however , not unusual ; owen martin , for example , incarcerated aged 28 and described as stout and strong at a height of 5 10.5 and a weight of 190lbs , left weighing 224lbs having made eighty - seven trips to the infirmary . his weight gain per annum ( if evenly spread ) averaged 8.5lbs over four years which was higher than connors of 6lbs per year over eight . in 1895 of the 129 convicts released , none had initially been described as fat . however , sixty - six were returned as stout and sixty as spare or sparse , 33 or 25.5% had lost weight and in five cases no change in weight occurred . three medical sheets were incomplete or missing , ( 6.2% ) , and are therefore cases that could not be factored in terms of weight gain or loss . interestingly , weight loss in both sample years was invariably linked to bronchial disease , suggesting that in its absence weight gain amongst all prisoners might have been the norm . such was the case of william diskin , who in 1882 entered mountjoy to serve 20 years for manslaughter . he was described as strong and stout but his health gradually deteriorated to such a degree that in 1889 he was deemed unfit for any kind of labour . he appeared to be suffering from a bronchial condition and some form of muscular atrophy as well as being lame and under - weight . the authorities were clearly concerned about his decline ; notes taken in september 1889 described him as having a persistent cough and recorded that he was losing flesh and requiring a dietary altogether different from the ordinary diet , he is also becoming so weak as to be unfit for every light prison labour as the whole state is now chronic. despite this alarming report he remained in prison for another six years and was eventually released on medical grounds in 1895 . indicative of his delicate state from july 1890 to may 1891 he was weighed sixteen times during which time his weight fluctuated between 106 and 116lbs . diskin lost a total of 42lbs , his bmi was 24.5 on arrival and 18.05 , or in the underweight range , on leaving . his case was not unusual : two others john casey who was imprisoned for life for his role in the controversial maamtrasna massacre ( in which an entire family was slain over a longstanding land feud ) had a remarkably similar profile . also described as stout and strong on entry to mountjoy in 1882 , john casey had suffered many coughs and colds and his medical notes also documented an ulcer and enlarged glands . during his prison sentence casey received various medical treatments including purging , poulticing , and the administration of castor and cod liver oils . although he was transferred to maryborough as an invalid , he was returned to mountjoy in may 1898 and subsequently diagnosed with phthisis for which he received cod liver oil , expectorants , chicken broth , chicken , brandy and even champagne . he finally died on 27 february 1900 and an inquiry was held as to why an inmate so gravely ill was not released or sent to maryborough . it is unclear from the cases above - cited if under - nutrition caused debility and susceptibility to infectious diseases or if it was sequentially the opposite cause and effect . but what is clear is that within the system the pmo had to negotiate the fine lines of serious illness and potential malingerers . another of those convicted for the maamtransna murders , michael casey , aged sixty in 1882 , was classified as stout and strong with a bmi of 28 . regardless of his stature , which altered little during incarceration he died in 1895 , his passing recorded as caused by apoplexy or stroke . he had four pages of various diagnoses from 1883 to 1895 that included lumps and bumps , rheumatism , coughs , bronchitis , and finally febrility . although the actual documents are missing the register of correspondence highlights that he was attended to by an irish - speaking roman catholic priest . reflecting the geo - spatial and denominational profile of the convict population ( most were dublin - based , where policing was better ) , there were few west of ireland , and therefore monoglot irish - speaking convicts . nonetheless the need for irish - speaking priests to attend to some prisoners was expressed by fr phelan , roman catholic chaplain of maryborough , in 1890 . efforts to teach them sufficient english to enable them to make their confession a crucial component of the sacrament of the dying failed owing to one being too old and the other being unwilling. regarding weight gain what is more important to consider than diet is that , irrespective of gender , the impact of calorific intakes on sedentary versus highly active bodies is divergent . j. barlow , in his first report to the gpb as director of mountjoy bemoaned the difficulties in finding gainful employment for convict labour beyond making the prison self - sufficient in tailoring terms . that year the average number of prisoners employed over 301 days was 192.04 ( despite the fact that 750 males were in custody in january 1878 ) and the value of work performed by shoemakers , tailors , mat makers , oakum pickers , carpenters , masons , smiths and labourers was 2,884 6s 3d . by 1885 more comprehensive tables accounted for the value of convict labour to individual prison finances with 2,629 profit being earned by mountjoy alone through the external sale of goods . the difficulty associated with monetising prison labour was also a source of concern in britain where it was noted that previous attempts of gauging income were based on variously obtained figures. it gave the example of one prison categorising payments for manufactured goods under expenditures for new buildings and alterations. in the intermediary prison at spike island employment involved public works outside the confines of the prison , for example , the construction of coastal defences at the nearby forts carlisle and camden . although labour was hard it was outdoors , and contemporary observers noted that as compared with mountjoy , spike island may fairly be considered by the prisoners as a great alleviation of punishment and a step in advance. public works were however , difficult to orchestrate and sporadic as a result . the inevitable frustration due to inactivity troubled one david morrison , a 47-year - old amputee ( lower extremity ) who was convicted in 1878 for manslaughter , and who had been described as spare but muscular at and 148lbs on admission at spike island . morrison had many complaints about the system , from stale bread to insufficient exercise . by 1883 , at the age of 52 , the pmo documented that he exhibited loss of flesh due to old age , and again in 1885 old age and infirmity was noted although his weight had in fact remained stable at 146lbs . it is possible that he may have sustained muscular wastage due to inactivity . in real terms the level of employment at mountjoy , extraneous to cellular employment , could not expand due to lack of space and the security problems associated with managing convict employment on public works beyond the prison walls . meanwhile in english and welsh prisons convicts could spend several hours a day operating treadmill and cranks essentially conducting useless labour , on diets that were insufficient to maintain such calorific outputs . for such reasons a cohort of convicts at dartmoor chose the punishment diet of bread and water in 1880 in order to be exempt from hard labour . convicts in ireland by contrast were requesting more exercise to counteract ennui , such as 60-year - old alexander elliott , whose requests for exercise , more food and a beard were not granted . in an article claiming luxurious standards in english prisons in the 1820s mcrorie - higgins quotes the mp george halford who asserted that the luxury of the penitentiary was a standing joke . house. he jested that he was more concerned with people breaking in than those planning escape . by the 1830s there was a hyper - awareness among those who governed institutional diets of the importance of maintaining barely minimum standards of nutrition . predicated on a notion of lesser eligibility that underpinned the emergent poor law system in ireland contrary to hardy s findings in 1860s chatham , where convicts doing hard labour on public works suffered serious weight loss and exhibited obscure scorbutic symptoms , most of the irish convicts discussed here gained weight . what is also quite striking is that their initial bmi was in the normal range , again presenting a contrast with the findings of an 1869 the lancet article , cited in hardy , that recommended convicts should be provided with more meat because their constitutions were deteriorated by vice and privation. following the implementation of a new dietary the commissioners of prisons noted a dramatic improvement in prisoner welfare and a decrease in the death rate in 1880 . the penal servitude acts commission in 1879 found that irish diets continued to surpass their english counterparts and was far more generous relative to the labour type conducted . it instanced the dietary allowance at lusk exceeding the hard labour diet in england by having a much larger quantity of milk and an additional 146 oz of food , as well as additional milk : the equivalent excess of food at mountjoy was 48 oz . a scottish commission of inquiry found in 1899 that the irish prison dietary was much more varied and had a higher protein content , with meat being served up to five times a week . it noted in fact so good is it that it can safely be asserted that such prisoners are much better treated in ireland than in either of the sister kingdoms. there was a significant variety in irish prison diets , which included coffee , tea , bread , potatoes , rice , vegetables , beef three evenings a week and milk served up to three times a day . breakfast comprised oatmeal or rice stirabout , while the other ingredients were combined to make various soups as follows : breakfast 12 oz bread and one pint of coffee , made from 1/6 oz coffee , 1/9 oz of chicory , 1 oz of molasses , and 1/8 pint milk , or at the choice of the prisoner 6 oz of oatmeal in stirabout , 1 pint milk;dinner four days : 2lbs potatoes , 9 of beef , 1 pint soup with 1 oz vegetables and 1 oz of oatmeal;dinner for two days wednesday and friday: 12 oz bread and 1 pint coffee;dinner for one day : 12 oz of bread and 3/4 pint of milk;supper for every day in the week : 12 oz bread and 1 pint tea or cocoa . breakfast 12 oz bread and one pint of coffee , made from 1/6 oz coffee , 1/9 oz of chicory , 1 oz of molasses , and 1/8 pint milk , or at the choice of the prisoner 6 oz of oatmeal in stirabout , 1 pint milk ; dinner four days : 2lbs potatoes , 9 of beef , 1 pint soup with 1 oz vegetables and 1 oz of oatmeal ; dinner for two days wednesday and friday: 12 oz bread and 1 pint coffee ; dinner for one day : 12 oz of bread and 3/4 pint of milk ; supper for every day in the week : 12 oz bread and 1 pint tea or cocoa . this list of nutrient rich foodstuffs could combine to provide a varied and balanced diet . it parallels the asylum diet recently described by e. margaret crawford , who found one notable exception . she attributes an outbreak of beriberi in the richmond asylum in the 1890s to the gradual decline in thiamine intake due to the omission of oatmeal in the dietary . regardless of the availability of comprehensive lists , crawford warns that retrospective dietary analyses are fraught with pitfalls not least because of the ways in which modern foodstuffs are fortified with vitamins but more importantly because of the dearth of recorded recipes . in stark contrast with the irish convict prison diet the no 3 scale diet in england was limited to oatmeal , bread , potatoes , indian meal and salt , used to make stirabout and administered whole . insufficient calorific intakes , coupled with the dearth in protein had obvious impacts on the health status of english convicts . perhaps as a reflection of the relatively poor diet the death rate in english prisons was far higher than that in irish prisons ( see table 2 ) , for example , the rate at wormwood scrubs was 5.93 per thousand in 188586 . despite the obvious disparities in dietary regimes one english pmo thought the diet was he further commented that : table 2:aggregate medical reports 1 april 1885 to 31 march 1886.maryborough malegrangegorman femalelusk malemountjoy maledownpatrick maletotalno . daily no . sick50.611.110.3914.550.7277.37no . of deaths2226% of deaths per 1,0002.31.90.270.55source : eighth report of the general prisons board , ireland , 188586 , 1886 [ c.4817 ] , 160 . the man employed at ordinary labour , as , for instance bricklaying , & c. , neither gains nor loses materially from the average standard , whilst at hard labour , e.g. navvy work , he loses , and at sedentary labour gains , in weight . in point of fact , the question resolves itself , within certain limits , more into the amount of work than that of food : for men on second probation generally in condition , and i have known men on no . 3 penal diet ( without crank labour ) get fat . aggregate medical reports 1 april 1885 to 31 march 1886 . source : eighth report of the general prisons board , ireland , 188586 , 1886 [ c.4817 ] , 160 . the man employed at ordinary labour , as , for instance bricklaying , & c. , neither gains nor loses materially from the average standard , whilst at hard labour , e.g. navvy work , he loses , and at sedentary labour gains , in weight . in point of fact , the question resolves itself , within certain limits , more into the amount of work than that of food : for men on second probation generally in condition , and i have known men on no . while it is possible to gauge total calorific values of various recommended diets , it is not possible to evaluate individual calorific intakes particularly because diet was used to punish or reward as appropriate and there is evidence to suggest that some prisoners abstained from food . this does not mean that convicts did not experience hunger , in fact there are numerous pms entries documenting how convicts regularly requested more diet. for example , patrick withers first presented himself to the infirmary in december 1892 , a month after his committal . from then until january 1893 he made consistent efforts to increase his food allowance , with nine attempts to use the pmo to gain more diet ( he lost 42lbs over three years ) . similarly james mcreynolds regularly patronised the medical centres in mountjoy , spike island , and maryborough asking for change of diet. although the samples used here are small , they indicate that medical behavioural patterns were heavily gendered . females were less likely than males to visit the infirmary , and these records align with the annual reports which indicate that only 10.7% of the female population used the infirmary daily as against nearly 59% of males at maryborough and 1.96% in mountjoy . the ethos of the prison and the approachability of the medical officer were critical factors . the physicians at mountjoy did not suffer blaggards and malingering incurred a penalty of additional time and a possible reduction in marks earned ( for industry and good behaviour ) . under the 1877 act , section 52 , the pmo could apply tests to detect malingering but special permission had to be sought from the visiting committee or a member of the gpb should they incorporate the infliction of pain . it is clear from the records that both prisoner and gaoler approached the issue with caution . dr james william young ( who was the pmo at mountjoy from 188084 ) , although obviously aware of inflated claims of illness and debility , was slow to accuse inmates of malingering . it was also the case that the inmates themselves regarded it as a calculated risk , as it carried the potential for extended periods of detention . at spike island matters were different and there were several ways opportunistic inmates could work the system. daniel downing [ a238 ] was a roman catholic labourer who was described as 19 years old , in good health at , and weighing 132lbs on admission to mountjoy in 1880 . he was convicted of larceny having had three previous incarcerations in grangegorman for using obscene language and generally making a nuisance of himself . downing is an interesting case because of his high levels of engagement with the pms . on arrival he claimed to have suffered from gonorrhoea implying his sexual prowess from a young age and having supposedly caught and been cured of the affliction by the time he reached 19 years of age . downing was admitted in december 1880 and by july 1882 while detained at spike island he became a regular attendee at the dispensary and proceeded , it appears , to manipulate the system to his best advantage . his 31 july 1882 visit cites a cough but he made daily visits to the dispensary from 7 july to 21 september , for pains in his left breast , a matter that could not be disputed by the attending physician . on 21 september it appears that the pmo was suspicious and subjected downing to a weigh - in on 11 september : at this juncture his weight was recorded as 10 stone 11.5lbs , which was an increase of a stone and a half since his reception . with the exception of the chronically ill , the appearance of weight in the body of medical notes was highly uncharacteristic . on 10 november sick stomach , the following day on release from hospital he asked for permission to work in the garden , which was not granted . however , two days later after two further visits from downing the pmo relented and permission for softer garden work was granted . in all from 25 july 1882 to 11 june 1883 while he was at spike island he made nearly 130 daily trips to the dispensary and spent a further fifty - one days in hospital . despite his heart affliction in cork he finally left mountjoy weighing 158lbs or 26lbs heavier than his starting weight and managed to grow an inch during his incarceration . this remarkable alteration represents what anthropometricians call biological gains consistent with catch - up on earlier deprivation. interestingly , medical personnel on spike island applied different criteria to their counterparts in mountjoy who had described him as stout on entry at 132lbs , while his start weight of 148lbs at spike island resulted in a designation of spare and weak. on his return to mountjoy at 149lbs he was again described as stout and was much less inclined to visit the infirmary , making a relatively modest thirty - five visits to the mountjoy infirmary during his last six months . dr okeefe , who succeeded young at mountjoy in august 1884 , was particularly adept at isolating malingerers probably because of his experience of opportunists at spike island . mountjoy had a very low daily average of sick ( see table 2 ) . hugh mccafferty , aged 21 in 1890 , was immured for five years and entered in good physical health . before long he was complaining of illness and the doctor suspected a variety of ailments . states he has rheumatic fever and accelerated action of the heart : neither condition was confirmed by the pmo . he was later treated for synovitis ( inflammation of the synovial membrane in the joints ) ; he also had cataplasmata ( poultices ) administered to his spinal region on a number of occasions and was observed for spinal disease . from 31 october 1891 to 12 july 1892 it was reported by dr okeefe that the prisoner was guilty of persistent malingering for which he was to forfeit 3 [ months ] and to go back to second probation class for nine months. mccafferty made five petitions to the lord lieutenant for remission of sentence but also made allegations regarding mistreatment by the pmo and mistreatment by other prison staff . his claims were refuted and prompted the governor of mountjoy to investigate the penal history of this career criminal , who was described by belfast prison authorities as a corner boy of the worst type who had also made false allegations against warders there in 1889 . the relationship between the pms and the convict was grounded in intense distrust on the part of the former and frequently influenced the perception and reaction to illnesses . however , in suspected cases of tuberculosis , that scourge of irish life , treatment and oversight was assiduous . a case in point is that of 35-year - old john kelleher , who was spare and muscular but prescribed hard labour , despite being tall and a mere 126lbs ; he was described as slender . discretionary justice kelleher s four previous convictions , including assault on a police officer and his current charge of malicious wounding cast him into the hard labour category . he spent from 2 march to 17 may 1882 in mountjoy infirmary with sinus issues , and was given an enhanced diet that included 2 oz of butter daily along with whiskey , eggs and porter for the first month . overall he made 206 visits to the infirmary over four years , and was described as looking phthisical when he was transferred to spike island in may 1882 at 140lbs . he returned to mountjoy where he spent his final two years and left weighing 170lbs , with an overall weight gain of 44lbs . others were not so favourably treated , david oshaughnessy , aged 61 on conviction , at was 131lbs and described as spare but muscular but still able for hard labour : his photograph shows a somewhat emaciated face . in 1884 , three years after arrival , he was admitted to mountjoy hospital with febrility . despite his age and relative debility the physician was generally unsympathetic to him and the extra ration of bread he had been prescribed on 9 november 1882 was stopped in april 1883 . he had had a tooth extracted at the age of 64 and was generally in poor health , especially in comparison with other , younger prisoners , who had a more sympathetic reception from the physician . he was not sent to intermediary prison on the grounds of ill - health . twice he petitioned the lord lieutenant for remission of sentence in july 1883 and again in september 1884 but to no avail the returned verdict in both instances being the law must take its course. the hard line may be explained by the nature of his offence : oshaughnessy was a wife - beater who had been twice convicted for assaulting her . despite a general support for masculine authority in the home , it is apparent from the actions of the pmo that spousal abuse was regarded with contempt , and the perpetrator could expect no leniency within the prison system . although few female convicts present in these datasets , a notable element of their medical sheets is the low level of willing engagement with medical services . the fact that medical officers were always male may have had an impact on how women engaged with the pms , particularly as most female convicts were prostitutes and subject to the regressive rigours of the contagious diseases acts . for instance , alice keogh , who had a violent outburst ( abusive and vile language to a matron ) on 1 january 1885 was placed under restraint for one day to one week in a punishment cell . in fact proportionately speaking punishment cell usage was higher in grangegorman than in mountjoy , for example , 37.7% of females were subjected to it in 1895 as against 8.3% of males ; 27.6% of males were subjected to dietary punishments as against 28.3% of females . of the surviving medical sheets only nine represent women who were released in 1885 and fourteen in 1895 but their treatment by the pms conveys a severity that was not as apparent in the male convict prisons . even those who were ill and unable for prison work appeared loath to engage with the pms : female convicts made far fewer visits to the pms than the males in this sample . nevertheless they could not avoid the watchful eye of the pmo whose job included controlling contagion . for example , catherine mcneill , a 32-year - old , roman catholic , who was incarcerated for larceny + , described as occupationally a prostitute , physically as spare at , entered grangegorman weighing 118lbs and left at 99lbs or just over seven stone . although diagnosed with haemoptysis ( coughing blood ) in 1884 , she was deemed fit for ordinary labour throughout : her record showed that she was indecently behaved prior to conviction . mcneill s twenty - eight priors ( twelve counts of drunkenness , five drunk and disorderly , six disorderly , four larceny , and one assault ) seemed to have had an impact on how she was treated by the pmo . when it was clear that she was very sick she was prescribed chicken , beef , bacon , tea and milk to cure her condition , which was probably a prelude to , or manifestation of , phthisis . when ellen shea was convicted for stealing from the person and sent to waterford jail , she was described as spare and not strong , and a prostitute with no children . on arrival at grangegorman in march 1893 , she was subjected to an internal medical exam by pmo hinchin and was found to have a relaxation of uterus : at she weighed 114lbs . her starting bmi was 22.5 , she left weighing 105lbs with a bmi of 20.3 . she had thirty - three prior convictions and throughout her two - year stay she was regularly sent to the punishment cells during which time she was observed by the pmo , raymond granville dowdall , who wrote comments like fit , fit for prayers , exercise and fit for punishment. according to a letter from assistant matron ruth , dated 24 august 1893 , she had broken six panes of glass the previous day . ellen shea had a penchant for smashing glass during her violent episodes ; in all she broke a total of twenty - seven panes of glass in a waterford prison and all the glass in the padded cell , in three different outbursts in the period 1890 to 1893 . she also managed to attract the ire of the roman catholic chaplain by exercising her right to change religion , which she did in 1893 , seven months into her sentence . it moved the roman catholic chaplain j. anderson , to write to the gpb to dissolve the rules that permitted change . much to his chagrin she reconverted to roman catholicism , in november 1895 when it transpired that she had originally changed religion in a fit of temper. she was accused in december 1895 of excessively availing of the chaplain s services ; he commented that i look on these cases pretty much as a medical officer would regard a case of malingering. all this while ellen shea suffered from persistent diarrhoea and bleeding from the rectum. the pmo visited her punishment cell every day in august 1895 ; by the end of the month she was admitted to hospital . clearly exhausted in september she was subjected to purges and fed through an oesophageal tube , an experience james vernon describes as akin to being raped : the experience of being physically over - powered and held down , of phallic tubes being forced into their mouths , noses and throat by male doctors. by 11 december her health had deteriorated to such an extent that she was fed via oesophageal tube following two days rectal alimentation. she was eventually released on the grounds of ill - health after what can only be described as aggressive and relentless treatment . this paper applied canning s method of using bodies as sites of historical investigation to irish penal records and found that male convict weight gain was a result of two things : primarily , it was an overall expression of the failure to implement full employment within the prison but , in some instances , it was symptomatic of opportunism and exploitable weaknesses in the pms . it also found that the application of canning s hypothesis , centring on individual experience to irish records offers an alternative discourse to foucault s universalised convict body . this research has shown that even convict bodies subjected to institutional power , and strict regimes of work and diet were not without agency and some men challenged power through the mechanism of the pms . a primary purpose of this article was to highlight the rich medical data and the extent to which male convicts engaged with and relied on the pms to cope with the everyday of the of carceral archipelago. there are several other ways in which the medical sheets could be interpreted . from a methodological perspective the matter of individual experience could be further broken down by number of months and days of stay . this could also be cross - referenced with place of incarceration , work conducted , marks earned and the dietary records . these data could in turn be used to calculate basal metabolic rate and further calculations could be conducted to determine individual calorific outputs to more accurately pinpoint when weight gain / loss occurred . the actions of convicts in trying to manipulate the system for the purposes of more food , less work or indeed more exercise shaped how the pmo treated symptoms and ailments . the minutiae of everyday interaction in individual cases highlight how discretionary justice was exercised by the pms but , as evidenced by high levels of individual male convict engagement , they were not always unkind and only in extreme cases were regular patrons accused of malingering . the cases described demonstrate that while pmos were very powerful , they were not entirely rigid , especially in cases of suspected tb . the level of accountability pmos had to adhere to increased after the 1877 act and in fact their individual powers were eroded by increased levels of external oversight . prisoners had the right of appeal and many exercised it , with several memorials and petitions being sent to the lord lieutenant s office throughout the whole period . what is also clear from this study is that women in the sample datasets were far less likely to engage with the infirmary and there are cases of those who never frequented the infirmary apart from the initial and final weigh - ins . although some of the individual cases recounted here convey a grim approach to corporeal care , the aggregate reports to parliament illustrate that overall levels of health and welfare were high . irish convicts appear to have had a better standard of diet and , by association health , than their counterparts in british and scottish jails . the overall relationship between the convict and the pms was predicated on power but as this article argues the balance was not always tilted in the pmos favour .
this article focuses on the function of the convict prison infirmary and views it as a site of arbitration , resistance and contested power. in accordance with the rules and regulations periods of incarceration in convict prisons began and ended with an obligatory medical examination . while the primary function of the initial test was to measure the convict body in order ascertain physical ability to conduct hard labour it also provided a thorough bio - metrical description for future identification purposes . the final examination was not as comprehensively undertaken but also concerned itself with anthropometrical observations . it would be reasonable to assume that the balance of power was weighted in the authority s favour but this research has found evidence to the contrary . for instance , that there was a fair degree of physiological knowledge within the convict population and that some convicts used the infirmary for dietary gains and reprieve from hard labour . using body mass index ( bmi ) as an instrument to measure physical wellbeing this article views the doctor convict interface as a crucial component of the penal experience . it analyses 251 convict medical records to show that the balance of diet and work led to what might be considered a counterintuitive outcome a preponderance of weight gain , particularly for males in irish prisons .
isolated iliac artery aneurysms are extremely rare , representing only 0.03% of a series of 26 251 autopsy patients , mostly associated with atherosclerosis and with other aetiological factors including trauma and infection . presentation is variable including incidental findings during surgery , abdominal or rectal examination , acute rupture , ureteric obstruction , sciatic nerve compressive neuropathy or pelvic vein compression . gluteal artery aneurysms are also rare , more commonly affecting the superior gluteal artery in association with penetrating trauma , with those of the inferior gluteal artery usually associated with pelvic fractures [ 3 , 4 ] . although often asymptomatic , presentations may include progressive gluteal swelling , a mass mimicking a gluteal abscess , a tumour or be associated with sciatic nerve compression symptoms . a 67-year - old , non - communicative man was referred to plastic surgery with a right - sided subcutaneous gluteal haematoma and low haemoglobin after a minor fall 28 days previously . despite there being no obvious bleeding points after two surgical haematoma evacuation procedures , interspersed with days of haemodynamic stability , the patient required repeat blood transfusions . on saturday ( day 2 ) , a 500 ml haematoma was evacuated at our institution under general anaesthesia via a 4 cm incision . there were no identifiable bleeding points and he was transfused 2u of packed red cells peri - operatively , increasing his hb to 8.7 g / dl . the patient was haemodynamically stable , throughout sunday ( day 3 ) , with no clinical features of recurrence . on monday ( day 4 ) , the haematoma recurred and his hb dropped from 8.7 g / dl to 4.9 g / dl , prompting a second transfusion of 4 units of packed red cells , increasing his hb back to 8.7 g / dl . on tuesday ( day 5 ) , a further hb drop to 6.4 g / dl prompted transfusion of 2u of fresh frozen plasma 3u of red cells and surgical haematoma evacuation ; however , there was no identifiable active haemorrhage . gastroscopy and colonoscopy were performed due to a past medical history of haematemesis ; however , no recent / active bleeding was identified . the patient continued to be haemodynamically stable throughout thursday ( day 7 ) , abdomen and pelvis contrast ct indicated two bleeding sites arising from the internal iliac artery region . one was identified arising from the posterior division of the right internal iliac artery , at the inferior gluteal artery ( fig . less prominent bleeding point was noted at the division level of the internal iliac artery into its anterior and posterior branches , anterior to the sacroiliac joint ( fig . selective angiography was also performed , identifying a large pseudoaneurysm arising from the inferior gluteal artery and endovascular repair was undertaken ( fig . the right common iliac artery was accessed via a left common femoral artery puncture and a combination of five 2 5.0 mm figure 818 pushable coils and two vortx-18 pushable coils of 3 2.5 mm and 4 4.0 mm respectively ( boston scientific , massachusetts , usa ) were deployed to embolize the inflow and outflow vessels ( fig . a further 200 mls of blood were evacuated from the right buttock wound post - embolization . haemostasis was achieved successfully and wound closure undertaken on the following monday ( day 11 ) . ( b ) second site of haemorrhage at the level of division of the internal iliac artery into its anterior and posterior branches , anterior to the sacroiliac joint . figure 2:interventional angiogram : deployment of seven coils to embolize the inflow and outflow vessels of the inferior gluteal artery pseudoaneurysm . ( b ) second site of haemorrhage at the level of division of the internal iliac artery into its anterior and posterior branches , anterior to the sacroiliac joint . interventional angiogram : deployment of seven coils to embolize the inflow and outflow vessels of the inferior gluteal artery pseudoaneurysm . we present a diagnostically challenging case of recurrent subcutaneous gluteal haematoma , uniquely associated with 2 bleeding points relating to the internal iliac system . at surgery internal iliac and gluteal artery aneurysms are extremely rare , often traumatic in origin and predominantly classified as pseudoaneurysms [ 1 , 3 , 4 ] . they may be slow - growing and present late either as an incidental finding or with gluteal swelling and bruising , compressive neuropathy or compression of surrounding structures . radiological investigations including duplex , ct and mri may facilitate bleeding course identification , shape , size and position relative to surrounding structures . angiography however is diagnostically invaluable in delineating the anatomy of the arterial branches involved and in facilitating intervention [ 5 , 8 ] . aneurysms of the internal iliac artery and branches have a poor prognosis if left untreated . estimated mortality ranges between 50% and 75% , when in isolation , due to rupture and fatal haemorrhage [ 1 , 5 ] . traditional treatment includes open surgical artery ligation both proximal and distal to the aneurysm to minimize recurrence risk due to collateral circulation . due to the potential difficulty in identifying sites of haemorrhage , such as in our reported case , endovascular angiographic repair using embolization although this carries the incontestable advantage of being minimally invasive over surgery , embolization alone may be insufficient for pseudoaneurysm treatment as it is less likely to relieve exerted pressure on surrounding structures , while coils and stents may dislodge and migrate . this case uniquely reports recurrent gluteal haematoma in a non - communicative patient which manifested 28 days following minor , non - penetrating and non - fracture - associated trauma . furthermore , although the rare internal iliac artery system pseudoaneurysm has been reported , no similar report exists in the literature with two bleeding sources and with this mechanism of injury . despite repeated requirements for low hb associated blood transfusions , albeit interspersed with days of haemodynamic stability , exclusion of relevant history - related bleeding sources , and by endoscopy and two surgical explorations , it was only until contrast ct scanning was requested that two separate bleeding sources were identified and successfully treated by endovascular coil embolization . this report provides an important variant and lesson to supplement current literature and understanding of more diagnostically challenging cases of an extremely rare presentation ; it highlights the importance of maintaining a high index of suspicion and investigating the possibility of multiple bleeding points in cases of subcutaneous gluteal haematoma , even when the presentation is several weeks following minor non - penetrating and non - fracture - associated trauma . this research received no specific grant from any funding agency in the public , commercial or not - for - profit sectors .
isolated iliac artery aneurysms are extremely rare . gluteal artery aneurysms are also rare , more commonly affecting the superior gluteal artery in association with penetrating trauma , with those of the inferior gluteal artery usually associated with pelvic fractures . we discuss a diagnostically challenging presentation of recurrent subcutaneous gluteal haematoma due to two separate internal iliac artery - associated bleeding points . a 67-year - old man was referred , from a peripheral hospital , with a right - sided subcutaneous gluteal haematoma . this manifested 28 days following minor non - penetrating , non - fracture - associated trauma . despite repeat blood transfusions , albeit interspersed with days of haemodynamic stability , and despite exclusion of relevant bleeding sources at endoscopy and two surgical explorations , it was only until contrast ct scanning was requested that both bleeding sources were identified and successfully treated by endovascular coil embolization . this provides an important variant and lesson to supplement current literature and understanding of more diagnostically challenging cases of an extremely rare presentation .
patients and ethics - this study enrolled 200 patients with chronic hcv infection ( 72 males , aged 54.2 11.1 years ) and 100 healthy individuals ( 34 males , aged 51.1 9.7 years ) living in rj between 2013 - 2014 . healthy individuals and patients with chronic hcv infection on antiviral therapy were prospectively evaluated on an outpatient basis at gaffre & guinle university hospital , clementino fraga filho university hospital and antnio pedro university hospital . a total of 97/200 patients who concluded antiviral therapy were investigated in relation to an association of itpa polymorphisms with the development of anaemia . patients were treated with peg - ifn- 2b , administered subcutaneously at a dose of 1.0 - 1.5 g / kg weekly plus full - dose rbv ( 1,000 - 1,250 mg / day ) for 24 ( genotype 2 and 3 ) or 48 weeks ( genotype 1 ) . haematological , biochemical and virological parameters at pretreatment ( baseline ) and at weeks 4 , 8 and 12 were collected for comparative analysis . drug dose reductions as a consequence of adverse effects were managed according to the severity of anaemia . anaemia was considered as hb levels < 10 g / dl and/or a reduction > 2 g / dl in comparison to baseline . a sustained virologic response ( svr ) was defined as undetectable hcv - rna in serum samples 24 weeks after the end of therapy . this study was approved by the local ethics committee and conforms to the ethical guidelines of the 1975 declaration of helsinki . data collection and laboratory parameters - information on demographics ( gender and age ) and hcv genotype were obtained at study entry . biochemical markers of liver injury [ alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , gamma - glutamyl transpeptidase ( -gt ) ] , hb , platelet count ( plt ) , leukocytes count ( leuc ) and viral load were obtained at baseline and at weeks 4 , 8 and 12 . serum aminotransferases ( alt and ast ) and -gt were measured with an automatic analyser ( labmax plenno ; labtest , brazil ) . haematological parameters ( hb , plt and leuc ) were assessed with an automated cell counter ( abx pentra 120 ; abx diagnostics , france ) . quantification of the hcv - rna load and determinations of hcv genotypes were performed using the abbott real - time hcv assay ( abbott laboratories , usa ) , which has a dynamic range of detection between 12 iu / ml ( 1.08 log iu / ml ) and 100 million iu / ml ( 8.0 log iu / ml ) , according to the manufacturer s instructions . itpa genotyping - blood samples were collected into ethylenediamine tetraacetic acid tubes and human genomic dna was extracted from 200 l whole blood using a qiaamp dna blood kit ( qiagen , germany ) according to the manufacturer s directions . itpas variants ( rs7270101 and rs1127354 ) were determined using direct sequencing after polymerase chain reaction ( pcr ) amplification . specific primers used to target the two snps were : forward , 5cgtgctcacatggagaatca3 and reverse , 5cctggaagctacctggacaa3 ( cao & hegele 2002 ) . the pcr products were purified using a qiaquick gel extraction kit ( qiagen ) and submitted to nucleotide sequencing reactions in both directions using a bigdye terminator kit 3.1 ( applied biosystems , usa ) according to the manufacturer s instructions and then analysed on an abi 3730 dna automated sequencer ( applied biosystems ) . classification of predicted itpase activity - itpa deficiency phenotypes were classified according to the degree of predicted itpa deficiency based on the compound genotype of rs1127354 and rs7270101 , as previously determined by biochemical analyses : 100% ( aars7270101 ccrs1127354 ) , 60% ( acrs7270101 ccrs1127354 ) , 30% ( ccrs7270101ccrs1127354 ) , 25% ( aars7270101acrs1127354 ) , 10% ( acrs7270101acrs1127354 ) and < 5% ( aars7270101aars1127354 ) ( sumi et al . statistical analysis - data are expressed as frequencies and means standard deviation for continuous variables with a normal distribution or median and ranges for those that did not pass the normality test ( kolmogorov - smirnov test ) . bivariate analysis was performed using the pearson s chi - square test for independence to compare categorical variables . for continuous variables with a normal distribution , homoscedasticity was tested by the levene s test and we used the unpaired student s t test to compare means ( between 2 groups ) or anova with the bonferroni posttest ( for more than 2 groups ) . continuous variables assumed not to follow a normal distribution were compared using the nonparametric mann - whitney u test ( between 2 groups ) or the friedman with dunn posttest ( for more than 2 groups ) statistics to compare medians . differences between groups were considered to be statistically significant at p < 0.05 ( 2-tailed ) . all calculations were performed using graphpad instat 1998 , v.3.01 for windows 95 ( graphpad software , usa ) . itpa allele frequencies - both healthy and hcv - infected patients groups did not differ significantly in relation to gender distribution ( males , 34% vs. 38% ) or mean age ( 51.0 9.7 vs. 57.5 9.4 ) . the itpa allele frequencies of the 300 patients included in this study are shown in table i. it was possible to observe that the allelic distribution of itpa snps in both groups were similar ( rs7270101 , p = 0.3614 ; rs1127354 , p = 0.6589 ) . table iinosine triphosphatase ( itpa ) alleles frequency in healthy patients ( n = 100 ) and patients infected with hepatitis c virus ( hcv ) ( n = 200)itpa n ( % ) total ( n = 300)snphealthy group ( n = 100)infected with hcv ( n = 200)rs7270101 [ n ( % ) ] aa87 ( 87)165 ( 82.5)252 ( 84)ac11 ( 11)33 ( 16.5)44 ( 14.7)cc2 ( 2)2 ( 1)4 ( 1.3)rs1127354 [ n ( % ) ] cc93 ( 93)190 ( 95)283 ( 94.3)ac7 ( 7)10 ( 5)17 ( 5.7)aa0 ( 0)0 ( 0)0 ( 0 ) a : p value was considered not significant ( < 0.05 ) ; snp : single nucleotide polymorphism . a : p value was considered not significant ( < 0.05 ) ; snp : single nucleotide polymorphism . in healthy individuals , aa and cc were the most prevalent genotypes at rs7270101 and rs1127354 snps ( 87% and 93% , respectively ) . similarly , in patients infected with hcv , these genotypes were also the most prevalent ( 82.5% and 95% , respectively ) . clinical and laboratory findings in treated patients with chronic hcv infection - the clinical and demographic characteristics of hcv - infected patients treated with ifn / peg - ifn plus rbv ( n = 97 ) in this study are shown in table ii . most patients were female ( 62% ) , with a mean age of 57.5 9.4 years ( range 28 - 73 years ) . genotype determination in serum samples revealed that hcv genotypes 1 , 1a , 1b and 3 were found in 16 ( 16.5% ) , 30 ( 31% ) , 42 ( 43.3% ) and nine ( 9.2% ) patients , respectively . the median serum viral load measured was 825,046.0 iu / ml ( range 3,732.0 - 9,110,000.0 iu / ml ) . table iiclinical and demographic characteristics of hepatitis c virus ( hcv)-infected patients treated with pegylated interferon plus ribavirin ( rbv ) ( n = 97)characteristicsbaseline valuesage ( years ) ( mean sd)57.5 9.4gender [ n ( % ) ] male37 ( 38)female60 ( 62)hb ( g / dl ) ( mean sd)13.98 1.57platelet count ( x 10/l ) ( mean sd)168.5 67.5leukocytes ( x 10/l ) [ median ( range)]5.5 ( 5.6 - 14.1)ast ( u / l ) [ median ( range)]61.0 ( 15.0 - 276.0)alt ( u / l ) [ median ( range)]75.0 ( 12.0 - 281.0)-gt ( u / l ) [ median ( range)]80.0 ( 14.0 - 290.0)hcv genotype [ n ( % ) ] 116 ( 16.5)1a30 ( 31)1b42 ( 43.3)39 ( 9.2)serum viral load ui / ml [ median ( range)]825,046.0 ( 3,732.0 - 9,110,000.0)log - transformed ( mean sd)5.8 0.7rbv dose reduction [ n ( % ) ] yes17 ( 17.5)no31 ( 32)svr [ n ( % ) ] yes31 ( 32)no35 ( 36 ) a : aspartate aminotransferase ( ast ) normal values up to 37 u / l ; b : alanine aminotransferase ( alt ) normal values up to 41 u / l ; c : gamma glutamyl transpeptidase ( -gt ) normal values between 11 - 50 u / l;d : abbott real - time hcv assay ( abbott laboratories , usa ) ( lower detection limit : 12 iu / ml);e : at least 20% of rbv dose and therapy for 20% of the scheduled treatment period ( data available from 48 patients);f : data available from 66 patients ; hb : haemoglobin ; sd : standard deviation ; svr : sustained virological response ( undetectable serum hcv - rna 24 weeks after completion of antiviral therapy ) . a : aspartate aminotransferase ( ast ) normal values up to 37 u / l ; b : alanine aminotransferase ( alt ) normal values up to 41 u / l ; c : gamma glutamyl transpeptidase ( -gt ) normal values between 11 - 50 u / l;d : abbott real - time hcv assay ( abbott laboratories , usa ) ( lower detection limit : 12 iu / ml);e : at least 20% of rbv dose and therapy for 20% of the scheduled treatment period ( data available from 48 patients);f : data available from 66 patients ; hb : haemoglobin ; sd : standard deviation ; svr : sustained virological response ( undetectable serum hcv - rna 24 weeks after completion of antiviral therapy ) . biochemical and haematological data were analysed at baseline and after four , eight and 12 weeks of treatment . a significant and progressive reduction during antiviral treatment was observed for haematological ( hb , plt and leuc ) and biochemical ( ast , alt and -gt ) parameters . the mean value of pretreatment hb was 13.98 1.57 g / dl , with a significant reduction at week 4 ( 12.46 1.56 g / dl ) , week 8 ( 11.00 1.38 g / dl ) and week 12 ( 10.65 1.54 g / dl ) after the start of antiviral treatment ( p < 0.0001 ) ( fig . mean values of plt counts were 168.5 67.5 10/l , 139.6 55.2 10/l , 135.8 65.1 10/l and 133.9 60.7 10/l at baseline and after four , eight and 12 weeks of treatment , respectively ( p < 0.0001 ) ( fig . median values of leuc were 5.5 10/l ( range 5.6 - 14.1 10/l ) , 4.1 10/l ( range 3.6 - 13.0 10/l ) , 3.3 10/l ( range 1.1 - 7.5 10/l ) and 3.0 10/l ( range 1.0 - 11.0 10/l ) at baseline and after four , eight and 12 weeks , respectively 1:biochemical and haematological data at baseline and at four , eight and 12 weeks of treatment . a progressive decline during antiviral treatment was observed in haematological parameters . a : haemoglobin ( hb ) ; b : platelet ( plt ) ; c : leukocytes count ( leuc ) ; d : values for biochemical parameters . aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) and gamma - glutamyl transpeptidase ( -gt ) showed a progressive decrease at baseline and throughout antiviral treatment . in relation to biochemical parameters , median ast values were 61.0 u / l ( range 15.0 - 276.0 ( range 23.0 - 190.0 u / l ) , 38.0 u / l ( range 20.0 - 158.0 u / l ) at baseline and at week 4 , 8 and 12 , respectively ( p < 0.0001 ) . 19.0 - 209.0 u / l ) , 44.5 u / l ( range 9.0 - 240.0 u / l ) at baseline and at week 4 , 8 and 12 , respectively ( p < 0.0001 ) . median -gt values at baseline and at week 4 , 8 and 12 were as follows : 80.0 u / l ( range 14.0 - 290.0 u / l ) , 96.0 u / l ( range 19.3 - 252.0 itpa alleles and development of anaemia in hcv - treated patients - in treated patients with chronic hcv infection ( n = 97 ) , the aa genotype of rs7270101 snp was observed in 80 ( 83% ) of patients whereas the ac / cc genotype was detected in 17 ( 17% ) patients . at rs1127354 , the cc genotype was found in 94 ( 97% ) patients and the ac genotype occurred in three ( 3% ) patients . table iii shows the itpa allele frequencies in relation to demographics and hb levels at baseline and at week 4 , 8 and 12 after starting antiviral treatment . of the 80 patients with the aa genotype at rs7270101 , anaemia was observed in 70 ( 87.5% ) patients and 12 ( 70.6% ) of the 17 patients with genotype ac / cc developed anaemia . at rs1127354 the allelic distributions of both snps were categorised according to gender and we observed that from the 26 males who developed anaemia , genotype aa at rs7270101 was detected in 21 ( 80.7% ) individuals . table iiiinosine triphosphatase ( itpa ) alleles frequencies in relation to demographics and haemoglobin ( hb ) levels during treatment in hepatitis c virus ( hcv ) patients ( n = 97 ) itpa snps rs7270101 rs1127354 aaac / ccccacanemia [ n ( % ) ] yes70 ( 87.5)12 ( 70.6)81 ( 86.2)1 ( 33.3)no10 ( 12.5)5 ( 29.4)13 ( 13.8)2 ( 66.7)gender [ n ( % ) ] male with anaemia21 ( 80.7)5 ( 19.3)26 ( 100)0 ( 0)female with anaemia49 ( 87.5)7 ( 12.5)55 ( 98.2)1 ( 1.8)hb at baseline ( mean sd)male14.4 2.314.9 1.014.5 2.114.9 0.9female13.6 1.013.5 0,713.6 0.912.9 0.0hb at week 4 ( mean sd)male12.8 1.413.6 0.912.6 1.516.0 0.0female12.0 1.612.5 0.912.0 1.513.0 0.0hb at week 8 ( mean sd ) male11.4 1.411.9 1.011.3 1.115.0 0.7female10.6 1.210.8 1.710.7 1.29.0 0.0hb at week 12 ( mean sd ) male10.9 1.912.0 1.610.9 1.814.2 0.9female10.3 1.110.5 1.310.3 1.07.0 0.0 a : defined as hb levels < 10 g / dl and/or decline > 2 g / dl ; b : male = 37 , female = 60 ; sd : standard deviation ; snp : single nucleotide polymorphisms . a : defined as hb levels < 10 g / dl and/or decline > 2 g / dl ; b : male = 37 , female = 60 ; sd : standard deviation ; snp : single nucleotide polymorphisms . a progressive reduction in hb levels was observed at baseline and throughout antiviral treatment ( at week 4 , 8 and 12 ) , but the hb reduction at week 12 was relatively higher in individuals with an aa genotype ( rs7270101 ) and/or a cc genotype ( rs1127354 ) . the distribution of itpa genotypes according to gender revealed that men who carried the aa genotype ( rs7270101 ) had a slightly greater reduction in hb than women . 2 shows the reduction in hb values compared with baseline at week 12 of treatment according to the itpa genotypes . the distribution of the predicted itpase activity according to compound genotype of rs7270101 and rs1127354 , as previously determined by biochemical analyses , is shown in table iv . ccrs1127354 that yields 100% predicted itpase activity was observed in 236/300 individuals ( 78.7% ) of the present study cohort and the genotype combination that presented predicted itpase activity equal to or below 30% was observed in only 21 individuals . 2:haemoglobin ( hb ) declines at variant rs7270101 single nucleotide polymorphisms ( snp ) according to gender . a : comparison of hb levels between week 12 of antiviral treatment and baseline for both genders . sizable declines are observed ; b : gender differences of hb levels at week 12 . men who carried the aa genotype are seen to exhibit a slightly greater hb decline than women . table ivdistribution of predicted itpase activity according to compound genotype of rs7270101 and rs1127354 as previously determined by biochemical analyses and in our study population ( n = 300)rs7270101rs1127354predicted itpase activity ( % ) present study population n ( % ) aacc100236 ( 78.7)accc6043 ( 14.3)cccc304 ( 1.3)aaac2516 ( 5.3)acac101 ( 0.3)aaaa < 50 ( 0)a : sumi et al . ( 2005 ) , shipkova et al . ( 2006 ) and rembeck et al . the relationship between itpa genotypes and svr demonstrated that svr could be observed in 49% ( 27/55 ) of patients with the aa genotype and in 36% ( 4/11 ) of patients with the ac genotype ( rs7270101 ) . for rs1127354 , differences between the distributions of genotypes in relation to svr were not possible to analyse because almost all treated patients ( 94/97 ) with chronic hcv infection carried the cc genotype . recently , genome - wide association studies identified polymorphisms in the itpa gene in patients with chronic hepatitis c who received peg - ifn / rbv . these studies have demonstrated a strong association with snps rs7270101 and rs1127354 and rbv - induced haemolytic anaemia , which have led to a better understanding of the effects of rbv - induced anaemia ( fellay et al . the itpa gene encodes the enzyme itpa ( itpase ) which catalyses the conversion of inosine triphosphate ( itp ) to inosine monophosphate and pyrophosphate so that itp does not accumulate in normal cells . itp is used to maintain the red blood cell ( rbc ) adenosine triphosphate pool , thus preventing oxidative stress , which is thought to be a critical mediator of rbv - induced haemolysis ( hitomi et al . deficiency of itpase disrupts this cycle , resulting in an accumulation of itp ( maeda et al . 2005 ) . rbv ( 1--d - ribofuranosyl-1h-1,2,4-triazole-3-carboxamide ) is a synthetic nucleoside analogue that has actions in vitro against a broad range of viruses ( patterson & fernandez - larsson 1990 ) and has been used in combination with ifn during antiviral treatment . rbv can be incorporated into erythrocytes , where it undergoes phosphorylation to its pharmacologically active forms through adenosine kinase . the rbv triphosphate conjugates can not cross the erythrocyte cell membrane and accumulate in the intracellular compartment , causing oxidative damage and leading to haemolysis ( kowdley 2005 ) . itpase deficiency causes an accumulation of itp in rbcs and may compete with rbv triphosphate , thereby protecting from rbv - induced haemolysis ( fraser et al . this is the first report of the frequency of itpa gene polymorphisms in a cohort of brazilian healthy individuals and patients infected with hcv . the overall frequency ( n = 300 ) of allelic distribution at rs7270101 and rs1127354 shows high rates of the genotypes aa ( 84% ) and cc ( 94.3% ) , respectively . ( 2010 ) who showed that 48.4% of american individuals carried the aa genotype ( rs7270101 ) and 47.6% had the cc genotype ( rs1127354 ) . by contrast , european studies demonstrate that the majority of individuals carry aa and cc genotypes for rs7270101 and rs1127354 , respectively ( domingo et al . 2012 , the cc genotype is also more prevalent at rs1127354 , but they are monoallelic for the rs7270101 aa genotype ( ochi et al . 2010 , tanaka et al . 2011 , kim et al . 2013 ) . although the brazilian population is known to have a strong miscegenation as a consequence of different migration flows , the allelic distribution of both snps in our population showed greater similarity to caucasian populations , although the proportion of alleles associated with anaemia was slightly higher in the brazilian population . in this present study , anaemia was more often observed in patients presenting itpa genotypes that were recognised as predictors of rbv - haemolytic anaemia , in accordance with studies conducted in the usa ( fellay et al . nevertheless , the frequency of the allelic distribution of both snps was slightly higher than that reported in the studies mentioned above , suggesting that our population is more prone to develop anaemia . a progressive reduction in hb , particularly at week 12 of dual therapy with peg - ifn / rbv , was observed in this study . anaemia , defined as hb levels < 10 g / dl and/or a reduction greater than 2 g / dl compared to baseline , was higher in genotypes aa ( rs7270101 ) and cc ( rs1127354 ) in both genders . we could observe a significant difference in the reduction in hb up to week 12 associated with gender . for rs7270101 , males who had an aa genotype showed an evident , but not statistically significant reduction ( p = 0.1475 ) in hb at week 12 compared to those who had the ac / cc genotype . by contrast , there was no influence of the itpa genotype on hb levels among female patients because the reduction was similar to that of patients who had an aa or ac / cc genotype ( p = 0.5295 ) ( fig . , males who had a cc genotype also showed a more evident reduction in hb when compared to those who had the ac genotype . this present study is the first to explore gender differences as possible protective cofactors from rbv - haemolytic anaemia in relation to itpa allele distributions and hb reductions during treatment . ( 2013)detected gender differences in the incidence of rbv - haemolytic anaemia at week 4 in austrian patients treated with peg - ifn / rbv . according to those authors , hb reductions were smaller in females than in males and among premenopausal females compared with postmenopausal patients . however , these differences not considered to be related to itpa alleles at rs1127354 or rs7270101 ( scherzer et al . the distribution of predicted itpase activity according to the genotype at rs7270101 and rs1127354 indicated that most ( 78.7% ) of our population exhibited 100% of predicted itpase activity . only a small number of patients ( 7% ) presented itpase activity equal to or below 30% . additionally , most patients in our cohort exhibited the worst combination for both snps ( aars7270101 ccrs1127354and acrs7270101 ccrs1127354 ) , which could explain why so many brazilian patients developed rbv - induced anaemia . concerning itpa polymorphisms studied in this present work and in response to antiviral treatment , no association was detected between the svr and itpa genotypes . therefore , our findings are in accord with several other studies ( thompson et al . moreover , almost all treated patients with chronic hcv infection were monoallelic for the rs1127354 cc genotype . the main limitation of this present study was the relatively small sample size , although we included all patients ( n = 97 ) who presented complete data on biochemical and haematological parameters ( at baseline and weeks 4 , 8 and 12 ) and had completed peg - ifn / rbv antiviral therapy during the study period . in conclusion , the allelic distribution frequency of snps in rs7270101 and rs1127354 showed high rates of the genotypes aa and cc , respectively , suggesting that the study population had a great propensity for developing rbv - induced anaemia . a progressive reduction in hb during the weeks of hcv treatment based on peg - ifn / rbv was observed in this study , however , the reduction in hb levels at week 12 in male patients was greater than that observed among females .
inosine triphosphatase ( itpa ) single nucleotide polymorphisms ( snps ) are strongly associated with protection against ribavirin ( rbv)-induced anaemia in european , american and asian patients ; however , there is a paucity of data for brazilian patients . the aim of this study was to evaluate the itpa snp ( rs7270101/rs1127354 ) frequency in healthy and hepatitis c virus ( hcv)-infected patients from brazil and the association with the development of severe anaemia during antiviral therapy . itpa snps were determined in 200 hcv infected patients and 100 healthy individuals by sequencing . biochemical parameters and haemoglobin ( hb ) levels were analysed in 97 patients who underwent antiviral therapy . a combination of aars7270101+ccrs1127354 ( 100% itpase activity ) was observed in 236/300 individuals . anaemia was observed in 87.5% and 86.2% of treated patients with aa ( rs7270101 ) and cc genotypes ( rs1127354 ) , respectively . men with aa ( rs7270101 ) showed a considerable reduction in hb at week 12 compared to those with ac / cc ( p = 0.1475 ) . in women , there was no influence of genotype ( p = 0.5295 ) . for rs1127354 , men with the cc genotype also showed a sudden reduction in hb compared to those with ac . allelic distribution of rs7270101 and rs1127354 shows high rates of the genotypes aa and cc , respectively , suggesting that the study population had a great propensity for developing rbv - induced anaemia . a progressive hb reduction during treatment was observed ; however , this reduction was greater in men at week 12 than in women .
drug delivery systems ( ddss ) are useful for reducing drug side effects and maximizing drug action . the design of drug carriers for dds is the most important activity in this area . the advent of molecular biology studies has enabled the identification of many disease - causing proteins . because some of these are effective as drugs , a variety of nanoparticles such as liposomes , micelles , and polymers have been adopted as drug carriers [ 14 ] . because polymers are similar in size to proteins , they are not suitable as protein carriers . whereas liposomes and micelles are larger than polymers and proteins , they can be used as protein carriers . however , because these are self - assembled nanoparticles , some treatments are necessary for their preparation as carriers . since most proteins are sensitive to temperature , ph , and organic solvents , it is possible that such treatments induce protein denaturation . hydroxyapatite ( ha ) , ca10(po4)6(oh)2 , is a major component of hard tissues such as bones and teeth and has been used as a biomaterial [ 5 , 6 ] . because it has been reported that some proteins , such as bovine serum albumin ( bsa ) and lysozyme , can bind to ha just by mixing , it is a good candidate for a protein carrier [ 79 ] . in this study , we investigated the association and dissociation behavior of two bioactive proteins , cytochrome c and insulin , to ha . it is known that the release of cytochrome c from mitochondria to the cytosol induces apoptosis . therefore , the delivery of cytochrome c into the cytosol of cancer cells should induce apoptosis , which may be useful for cancer therapy . insulin , a key protein of diabetes , is commonly injected into diabetic patients to suppress blood sugar levels , and its controlled release can markedly improve their quality of life . because the delivery of these two proteins is important , we attempted to use ha for a delivery system . the absorption and desorption on ha were affected by the surface conditions dependent on the preparation procedure of ha . considering universal use of ha for protein delivery , commercially available ha was used as a carrier in this study . ha nanoparticles were purchased from sigma - aldrich ( mo , usa ) . according to the material data sheet ( no . 677418 ) , the size and surface area were smaller than 200 nm and larger than 9.4 m / g , respectively . cytochrome c is cationic , and insulin is anionic at physiological ph , and the molecular weight of cytochrome c is larger than that of insulin . adsorption experiments with cytochrome c were performed by mixing ha ( 0 , 10 , 20 , and 30 mg ) with an aqueous solution ( 2.5 mg / ml , 200 l ) . after 4 h mixing with a rotator , centrifugation ( 15,000 g , 20c , 60 min ) was performed to collect the supernatants . these were analyzed by reversed phase high performance liquid chromatography ( hplc ) to estimate the residual concentration of cytochrome c. the hplc system was equipped with a cosmosil 5c18-ms - ii column ( nacalai tesque , inc . , kyoto , japan ) and a uv detector ( 220 nm ; uv-2075plus , jasco inc . , tokyo , japan ) . samples ( 5 l ) were injected with an autosampler ( as-2057plus , jasco inc . , tokyo , japan ) and eluted with acetonitrile/0.05% trifluoroacetic acid = 20/80 ( a ) and acetonitrile/0.05% trifluoroacetic acid = 60/40 ( b ) at 1.0 mlmin by pu-2089plus ( jasco inc . , a linear gradient elution was performed over 20 min from an initial state ( a ) 100% to the final state ( b ) 100% . in the case of insulin adsorption , the same experimental procedures were performed except the insulin solution was prepared by dissolving it in 0.01 n hcl and adjusting to ph 3 . association ratio ( % ) was calculated as [ ( c0c)/c0 ] 100 , at which c0 and c are the initial concentration and the supernatant concentration of proteins , respectively . during desorption experiments , ha ( 10 and 20 mg ) absorbing cytochrome c and insulin was transferred into 400 l of phosphate buffer saline ( pbs ; 8 mm na2hpo4 , 2 mm kh2po4 , 137 mm nacl , 3 mm kcl ) , and rotated . after predetermined incubation times , centrifugation ( 15,000 g , 20c , 60 min ) was performed to collect the supernatants . the residual concentrations of cytochrome c and insulin were estimated by hplc . in the case of insulin , dissociation ratio ( % ) was calculated as [ c / c0 ] 100 , at which c0 and c are the total concentration of the associated proteins and the supernatant concentration , respectively . therefore , insulin was dissolved in an acidic solution ( ph 3 ) . after the incubation and subsequent centrifugation , the residual cytochrome c and insulin in the solution were estimated from the hplc analysis . cytochrome c and insulin were eluted after 10 min and 13 min , respectively , under the running conditions ( figure 1(a ) ) , and the peak areas were proportional to the protein concentrations ( figure 1(b ) ) . thus , the protein concentrations in the supernatants were evaluated by hplc analysis and the adsorbed amounts were calculated by subtracting the concentrations in the supernatant from the initial ones . the adsorption efficiency of insulin was higher than that of cytochrome c. as less as 10 mg ha was sufficient to load almost 0.5 mg insulin , but 30 mg ha is necessary to load the same amount of cytochrome c under this condition . this may be because cytochrome c is larger than insulin . from the surface area of the ha ( > 9.4 m / g ) and the protein diameters ( d ) of insulin ( 3 nm ) and cytochrome c ( 4 nm ) , the percent of occupied area can be estimated . in the experiment , 0.5 mg of proteins , that is 9 10mol ( 5 10 molecules ) of insulin and 4 10mol ( 2 10 molecules ) of cytochrome c , were used . the projected area of proteins may be approximated as (d/2 ) , assuming the protein to be spherical . given that all molecules were absorbed , the occupied areas of insulin and cytochrome c were 0.4 m and 0.3 m , respectively . the surface area of ha ( 10 mg , 20 mg , and 30 mg ) can be calculated as > 0.094 m , > 0.19 m , and > 0.28 m , respectively . even though the absorption amount of cytochrome c could be correlated to the total surface area of ha , that of insulin could not . long - term incubation contributed to the efficient loading of cytochrome c even with a small amount of ha . the initial absorption occurred in less than 1 h , and the subsequent absorption occurred more slowly , in the range of an hour . the first absorption phase might be attributed to surface absorption and the latter by penetration into the pores . the release profiles also occurred over two phases , in less than 1 h and over the hour range ( figure 3 ) , similar to the adsorption profile . this result suggests that absorbed proteins at the surface were released very fast and those within the pores were released more slowly . thus , regulation of release can be achieved by the control of protein size and the pore size of ha . it is possible that step - by - step protein release can be performed in an ha - based delivery system . less than 40% of the bound insulin was released from ha , even though 70% of cytochrome c was released after 24 h. insulin is smaller than cytochrome c and readily bound to ha ( table 1 and figure 2 ) , but the release of insulin is slower than that of cytochrome c ( figure 4 ) . it is likely that the slow release may be caused by its poor solubility in pbs , compared to cytochrome c. the release of insulin was next examined at ph 3 , because insulin is easily soluble in acidic solution , which is a condition of the association . however , the release at ph 3 was slower than that at ph 7.4 and was perhaps affected by the charge of insulin . insulin has an isoelectric point ( pi ) of 5.3 so is positively charged at ph 3 and negatively at ph 7.4 . a decrease in insulin release was observed , especially at ph 7.4 after more than 5 h. the readsorption of the released insulin to ha might have occurred , because the desorption conditions differed from the absorption condition . our results suggest that the association and dissociation properties to ha were affected by both the charge and size of proteins . ha has a hexagonal structure , in which the c ( ca - rich ) site is arranged in the a c and b c planes and the p ( ca - deficient ) site is in the a it was reported that anionic molecules bind to the c site and cationic ones to the p site . therefore , ha - based protein delivery is suitable for ph - dependent controlled release . cationic cytochrome c and anionic insulin at the physiological ph were absorbed and desorbed in different manners . because the charge of insulin was changed with decreasing ph , it markedly influenced the adsorption and desorption behaviors . the absorption behavior may be very complex , because large protein molecules bind to ha at multiple points . therefore , the regulation of controlled release of protein is still to be investigated ( for further information , see supplementary material available online at doi:10.1155/2012/932461 . ) . in conclusion , we prepared protein - associated ha and characterized its association and dissociation properties . . however , their association and dissociation behaviors differed , depending on the size and charge of the proteins .
hydroxyapatite ( ha ) is a precursor of bone and has been studied as a biomaterial . we attempted ha to apply to protein delivery systems . in this study , the association and dissociation properties of two types of bioactive proteins , cytochrom c and insulin , to ha were investigated . cytochrom c was less associated with ha than insulin , which was easily released from it . however , the release of insulin from ha was slow . insulin was released from ha at ph 7.4 more rapidly than at ph 3 . the association and dissociation properties might be influenced by the size , solubility and net charge of protein . ha is a potential protein carrier with controlled release .
a 53 years - old male visited to our clinic because of cognitive impairment for two years ago . the patient graduated from university , had worked as an office worker and recently retired . his wife described that , the patient s memory and ability of judgment had been impaired for 2 years , and his verbal output had been decreased . the patient was not taking any medicines previously . because of forgetting his medication schedule , he attached his medicine on his calendar . although he had never lost his ways , he had trouble with driving and made some car accidents because of misperception . he had turned much introversive instead of sociable previously , and showed indifference towards household matters or works related with their offspring . inappropriate laughing was observed in serious situations . without a caregiver , he could not care of his own hygiene or eating . on the first visit , there was no remarkable finding in examination of motor and cerebellar function . the results were interpreted using 1.0 standard deviation ( 16 percentile ) of normal korean population aged 55 , as a cut - off value . he showed time disorientation , and impairments in encoding , retention and retrieval of verbal memory , and retrieval of visual memory . considering the progressive decline in intellectual function affecting memory and other cognitive domain , and interference of activities of daily , he was diagnosed with dementia . at the time , the patient was regarded as early frontotemporal dementia . six months later , he complained about gait disturbance with a feeling of right leg dragging . in addition , he had suffered from the postural imbalance , and difficulties in swallowing and articulation . he developed the orthostatic dizziness and urinary difficulties , including frequency , nocturia and residual urine sense , had also developed . on neurological examination , he was alert . deep tendon reflexes were increased in all extremities , hoffman s signs were positive , bilaterally . gene tests for spinocerebellar ataxia type 1 , 2 , 3 , 6 , 7 , and 17 , and dentatorubropallidoluysian atrophy were all negative . the head up tilt test revealed orthostatic hypotension ; systolic blood pressure was decreased 31 mm hg 3 minutes after standing . verbal and visual memories and frontal lobe functions , including inhibitory function and semantic word fluency , were significantly deteriorated compared with previous test 6 months ago ( table 1 ) . the follow - up brain mri has showed newly developed atrophy of cerebellum , pons and middle cerebellar peduncle ( figure 1 ) . positron emission tomography ( pet ) was performed using f - fluorodeoxyglucose ( fdg ) , and showed decreased cerebral glucose metabolism on the bilateral bagal ganglia , cerebellum , both parietal lobes , and left posterior cingulate gyrus in visual analysis ( figure 2 ) . finally , based on the features of cerebellar ataxia , autonomic dysfunction and pyramidal dysfunction , he was diagnosed with msa - cerebellar type ( msa - c).2 he was prescribed with rivastig - mine for dementia and other medications for urinary problems . this patient had shown rapid progressions of memory impairment , behavioral changes and impairment in executive functions , and been diagnosed with dementia initially . thereafter , cerebellar ataxia with dysautonomia and pyramidal dysfunction had occurred , and finally he was diagnosed with msa - c . msa is a neuro - degenerative disease , which usually occurs sporadically in adults , older than 30 years.2 typically it is presented with parkinsonism , cerebellar ataxia , dysautonomia and pyramidal dysfunction . pathologically , neuronal cell loss , gliosis and syn - immunopositive gci are observed in structures of striato - nigral pathway and olivo - ponto - cerebellar pathway . according to the second consensus statement on the diagnosis of msa,2 msa possible msa by their certainty of diagnosis , and as msa with predominant parkinsonism ; msa - p or however , some findings of so - called red flags which do not support msa are also described . these red flags include dementia on diagnostic and statistical manual of mental disorders , fourth edition . therefore , the presence of dementia can exclude the diagnosis of msa according to these criteria . however , some recent studies have reported 2040% prevalence of cognitive impairment in msa.3 the cognitive impairment in msa is usually characterized by predominant impairment of frontal lobe functions , such as executive functions , than memory impairment.1,4 patients with msa - p showed more severe and diffuse cognitive impairments than patients with msa - c.5 comparing msa with other -synucleinopathies,6 the severity of cognitive decline was more than pd , but milder than dlb . compared to patients with dlb , patients with msa have a lesser impairment in the memory function . however , the visuospatial function and executive function were more damaged in patients with msa . patients with msa and dementia demonstrated frontal lobe atrophy in mri and decreased perfusion in the frontal and posterior parietal lobes in single photon emission computed tomography.3,4 with regard to temporal relationship of onset between motor symptoms and cognitive impairment in msa with dementia , patients with msa preceding dementia showed alzheimer s disease ( ad)-like pattern of cognitive impairment , severe memory deficits and more confusion than msa preceding motor symptoms.3 moreover , imaging studies revealed more diffuse cortical atrophy and severe white matter changes in patients with msa preceding dementia . unlike the previous studies , our patient showed severe cognitive impairments in msa - c and the pattern of cognitive deficit was different from ad despite of preceding dementia . the pathogenic mechanisms of cognitive impairment , especially frontal lobe dysfunction in msa are unclear . the clinical presentation and the frequency of cognitive impairment in msa may differ from that of other synucleinopathies such as dlb and pd with dememtia ( pdd ) , so it is possible to presume that the mechanisms of cognitive impairment in msa might be different with dlb and pdd . given that the various involvements of cortico - subcortical pathways in msa,7 aberrant circuits projecting from striato - nigral system to frontal lobe may be related . although frontal lobe dysfunction was prominent in this patient , metabolism in both parietal lobe and posterior cingulate gyrus was lower than that of frontal lobe . given that the [ f]-fdg pet findings are similar to the pattern of ad,8 the pathology of ad such as amyloid plaque or tau - positive neurofibrillary tangle may contribute to cognitive impairment related with msa . decreased level of beta amyloid peptide 42 in csf and tau protein observed from autopsy in msa patients may support this hypothesis.9,10 we report a msa patient who has developed cerebellar ataxia after diagnosed with dementia . this case may suggest that the clinical diagnosis of msa could not be excluded by the presence of dementia .
multiple system atrophy ( msa ) is a sporadic , adult - onset disease characterized by progressive degeneration of nervous systems including cerebellar , pyramidal , extrapyramidal , and autonomic system . although a few recent studies reported that cognitive impairments could occur in patients with msa , prominent dementia with progressive decline is not a typical clinical manifestation of msa . in particular , dementia with msa - cerebellar type is very rare . we have experienced a patient with 2-year history of severe cognitive impairment , who was finally diagnosed as msa - cerebellar type .
in our simulations we use the mnpbem toolbox , which is based on a boundary element method approach for the solution of maxwell s equations , and its eels extension . we start with a triangle with rounded edges , as shown at the left top of figure 1b and extract the triangle contour rtri( ) in polar coordinates . the contour r( ) = ( 1 )rtri( ) + rdisk is then gradually morphed from the triangle into a disk with radius rdisk , using a scaling parameter . the diameter of the disk is 300 nm , and the circumference is kept constant for all nanoparticles , in accordance to the nominal values used in experiment , and we discretize the particle boundaries ( height 30 nm ) using the mnpbem toolbox routines . as for the dielectric function of silver we use tabulated values extracted from optical experiments . the 15 nm thick sin membrane is modeled as an additional disk with a radius of 400 nm , using a dielectric constant of sin = 4 . in our computational approach we use during morphing the same particle discretization but only deform the boundary elements , in order to evaluate the matrix elements fkk of eq 3 as a simple sum over boundary elements . for too small scaling parameters and for the triangular geometry , some of the boundary elements become too strongly distorted , leading to erroneous results . for this reason we have restricted in figure 3 the range of scaling parameters to 0.2 . as for the nanotriangle and nanoellipse shown in figure 4 , the scaling parameter is defined in an analogous way to the triangle .
we morph a silver nanodisk into a nanotriangle by producing a series of nanoparticles with electron beam lithography . using electron energy loss spectroscopy ( eels ) , we map out the plasmonic eigenmodes and trace the evolution of edge and film modes during morphing . our results suggest that disk modes , characterized by angular order , can serve as a suitable basis for other nanoparticle geometries and are subject to resonance energy shifts and splittings , as well as to hybridization upon morphing . similar to the linear combination of atomic orbitals ( lcao ) in quantum chemistry , we introduce a linear combination of plasmonic eigenmodes to describe plasmon modes in different geometries , hereby extending the successful hybridization model of plasmonics .
observational studies and clinical trials have shown that adherence to the dietary approaches to stop hypertension ( dash ) diet is associated with improved cardiovascular health and cardiovascular disease ( cvd ) risk in adults and youth . youth with diabetes are at an increased risk of developing cvd . in a cross - sectional analysis , the search for diabetes in youth study ( search ) previously reported that consumption of a more dash - like diet was inversely related to cvd risk factors including hypertension , total cholesterol , low - density lipoprotein , low - density lipoprotein / high - density lipoprotein ratio and hemoglobin a1c ( hba1c ) . the dash diet emphasizes fruits , vegetables , low - fat milk products , whole grains , fish / poultry / nuts , lean red meats and limited intake of sugar and sweets , resulting in low - saturated fat , cholesterol , total fat and sodium intake . a few studies have examined the association of a dash - like diet and hypertension in youth and adolescents ; however , no study has examined several cvd risk factors and dash prospectively in youth with or without diabetes . this study investigated whether change in a dash diet score was associated with change in cvd risk over multiple time points . search is an ongoing multicenter study of physician - diagnosed diabetes mellitus in youth aged < 20 years at diagnosis beginning in 2001 . the sample included data from an initial ( baseline ) visit and two subsequent follow - up visits targeting 12 and 60 months . follow - up visits were , on average , 14.7 months after the initial visit ( s.d.=3.1 months ; range=626 months ) and 62.9 months ( 6.3 months ; range=2987 months ) , respectively . cardiovascular risk measures included diastolic blood pressure ( bp ) , systolic bp , hdl , low - density lipoprotein , total cholesterol , triglycerides , hba1c , waist circumference and body mass index calculated as weight per height ( kg m ) and converted to body mass index - z score . dash adherence was assessed with an index score ranging from 0 to 80 comprised of the sum of meeting recommendations on eight food groups ( grains , vegetables , fruits , dairy , meat , nuts / seeds / legumes , fats / oils and sweets ) based on the search 85-item food frequency questionnaire . a maximum score of 10 could be achieved for each food group when the intake met the recommendation and lower intakes were scored proportionally . previous reports describe diet intake according to dash food groups and illustrate the scoring algorithm . food groups were created by either collapsing food items on the basis of their major components or by disaggregating composite foods into constituent foods . duration of diabetes , age , gender , race / ethnicity , income , study site , height , weight , waist circumference and physical activity was also obtained for each participant based on search protocols . this analysis was restricted to youth whose diabetes was first diagnosed in 20022005 , were 10 years of age ( n=1386 ) , had diabetes for at least 6 months at their initial visit ( n=1014 ) and had completed a baseline food frequency questionnaire . of the 969 participants who met these criteria , youth were also excluded sequentially for missing cvd - related measures ( n=130 ) and those fasting < 8 h at any visit ( n=42 ) . the final sample consisted of 797 participants . of the 617 youth with type 1 diabetes , 278 had a complete 12-month follow - up visit ( i.e. including diet information ) and 231 had a complete 60-month follow - up visit . a total of 65 and 53 participants , respectively , had complete follow - up visits of the 180 youth with type 2 diabetes . statistical analyses were conducted using sas 9.2 ( sas institute , cary , nc , usa ) stratified by diabetes type . longitudinal mixed - models with a random intercept to account for within - subject dependence were used to assess the relationship between the dash diet score and cvd risk factors . available cvd risk factor measurements were modeled as a function of baseline dash score and change in dash from baseline ; these two captured the relationship between dash score at baseline and the outcome as well as whether a change in dash score was associated with the outcome longitudinally . each model also adjusted for age , disease duration , race / ethnicity , sex , study site , income , height , body mass index - z score and waist circumference . statistical analyses were conducted using sas 9.2 ( sas institute , cary , nc , usa ) stratified by diabetes type . longitudinal mixed - models with a random intercept to account for within - subject dependence were used to assess the relationship between the dash diet score and cvd risk factors . available cvd risk factor measurements were modeled as a function of baseline dash score and change in dash from baseline ; these two captured the relationship between dash score at baseline and the outcome as well as whether a change in dash score was associated with the outcome longitudinally . each model also adjusted for age , disease duration , race / ethnicity , sex , study site , income , height , body mass index - z score and waist circumference . mean values of cvd risk factors and change in dash diet score are shown by visit and diabetes type in table 1 . dietary quality at baseline was poor with a mean of 39.8 ( s.d.=9.0 ) for youth with type 1 diabetes and 36.4 ( s.d.=9.6 ) for youth with type 2 diabetes . additionally , dash score did not appear to change systematically over time , with a mean change of -0.18 ( s.d.=10.1 ) , for follow - up visit 1 and 0.41 ( s.d.=11.2 ) for follow - up visit 2 in youth with type 1 diabetes . in youth with type 2 diabetes , the overall mean change in dash score was also small , with -0.36 ( s.d.=10.7 ) at follow - up visit 1 and 1.99 ( s.d.=11.4 ) at follow - up visit 2 . several cvd risk factors increased over time in youth with type 1 diabetes , including bp , total cholesterol , triglycerides and hba1c levels . hdl and hba1c also significantly increased over time in youth with type 2 diabetes . for each risk factor , table 2 displays the results of the longitudinal mixed - models which separate the effect of diet at baseline from the effect of change in diet and included time - varying covariates . in youth with type 1 diabetes , thus , a 10-point positive change ( increase ) in dash score resulted in a 0.20% decrease in hba1c levels . in youth with type 2 diabetes , change in dash score a 10-point increase in dash score resulted in a 2.02-mm hg decrease in systolic bp . additionally , a significant cross - sectional relationship was observed between dash score at baseline and low - density lipoprotein / high - density lipoprotein ratio ( 1=0.14 , p - value=0.0443 ) and dash score at baseline and total cholesterol ( 1=7.78 , p - value=0.0093 ) . to the best of our knowledge , the effects of dietary changes characterized by a dash diet score on cvd risk factors in youth with diabetes have not been evaluated in observational studies . in adults , greater adherence to a dash diet has been associated with significantly reduced risk of heart failure , cvd and stroke in longitudinal studies . however , these studies focused on the occurrence of an event rather than change in cvd risk factors over time . in adolescents , one study has shown that a dash - style diet can help curb gains in body mass index and in two others , a dash - style diet was associated with improved bp . in general , a high - quality diet has been shown to positively affect energy intake , vascular flow and glucose control . this study found that a positive change in diet was associated with improvements in hba1c levels among youth with type 1 diabetes and systolic bp in youth with type 2 diabetes . strengths of this study include the longitudinal modeling to examine the change in dash diet and the cross - sectional effect of baseline diet . limitations include a small sample size ; however , the modeling approach accounted for loss of follow - up by the inclusion of multiple time points . conclusions were the same when restricting analyses to only those individuals with both baseline and follow - up 1 or follow - up 2 data . lastly , this study did not provide information on specific changes in macro- or micronutrients . given the results and nutritional components of the dash diet plan , sustaining good quality dietary intake as characterized by a dash diet may serve as a benefit especially in youth with type 1 and type 2 diabetes .
youth with diabetes are at an increased risk of cardiovascular disease ( cvd ) . adherence to the dietary approaches to stop hypertension ( dash ) diet has been shown to improve cvd risk . in this study , we evaluated whether changes in diet quality as characterized by dash are associated with changes in cvd risk factors in youth with diabetes over time . longitudinal mixed models were applied to data from 797 participants in the search for diabetes in youth study representing three time points : baseline , 12- and 60-month follow - up . data were restricted to youth whose diabetes was first diagnosed in 20022005 . dash - related adherence was poor and changed very little over time . however , an increase in dash diet score was significantly associated with a decrease in hba1c levels in youth with type 1 diabetes ( =0.20 , p - value=0.0063 ) and a decrease in systolic blood pressure among youth with type 2 diabetes ( =2.02 , p - value=0.0406 ) . improvements in dietary quality may be beneficial in youth with type 1 or type 2 diabetes . however , further work in larger groups of youth with type 1 and 2 diabetes is desirable .
the international agency for cancer research ( iarc ) has shown a low incidence of prostate cancer in east asian countries as compared to western counterparts although its incidence in india is rising as well . comprehensive search for risk factors that contribute in the initiation and progression of prostate cancer remains a challenge . emerging literature has implicated that central obesity , hyperinsulinemia , dyslipidemia , westernization , and changes in lifestyle may play potential risk factors for progression of prostate cancer , although not yet clearly established . central obesity is an excess accumulation of fat in the abdominal area and is associated with development of , glucose intolerance , high blood pressure , atherosclerosis , cardiovascular disease , insulin resistance , altered metabolic profile , metabolic syndrome , and obesity - related lipid disorders . central obesity is practically assuming epidemic proportions in indian subcontinent with a study in urban metropolitan city of chennai reporting a prevalence of 35.1% . newly diagnosed prostate cancer and 471 healthy controls found that high levels of waist hip ratio ( whr ) ( a standard measure of abdominal obesity ) related to excess risk for pca . whereas there are other studies that showed no association . insulin has also been shown to play a role in the etiology of colon , prostate , pancreas , and breast cancer . gleason grading is the most widely used grading method for prostate cancer with higher grades ( 8 - 10 ) predicting poorer outcomes in comparison to low or intermediate grade ( 2 - 7 ) . some studies in western literature have shown an association of high - grade prostate cancer with central obesity , hyperinsulinemia , and dyslipidemia . as there could be different genetic and environmental factors affecting indian males , we evaluated whether central obesity and obesity - related biochemical alterations in terms of hyperinsulinemia and dyslipidemia are associated with poorer presentation of prostate cancer in terms of high gleason score . a cross - sectional study was conducted to test the association of central obesity , hyperinsulinemia , and dyslipidemia with histological gleason grade in patients of prostate cancer . between august 2008 and september 2009 , whr was calculated from waist circumference at umbilicus divided by hip circumference at greater trochanter and a cut off of 0.9 was taken to categorize central obesity . biochemical assessment . serum samples of men with suspicion of prostate cancer on the basis of high prostate - specific antigen ( psa ) and/or abnormal dre were withdrawn before biopsy between 8 a.m. and 11 a.m. serum psa , testosterone , and insulin levels were estimated using elisa on the same day . serum levels of high - density lipoprotein ( hdl ) , triglycerides ( tg ) , cholesterol , low - density lipoprotein ( ldl ) , and very low density lipoprotein ( vldl ) were measured by semiautomated instrument . standard staging procedures were followed and for histopathological evaluation of prostate cancer , gleason grading was done on core biopsy tissue and on the basis of score the patients were divided in two groups patients suffering from diabetes , chronic liver , kidney , heart disease , those taking lipid - lowering drugs or 5-alpha reductase inhibitors were excluded from the study leaving only 50 patients who were included . software used for statistics is strata 10.1 ( college station , tx , usa ) , two - sample t test used , if data met normally assumption otherwise , mann - whitney u test is used data were presented as mean sd , median ( iqr ) , and p value . the mean age of 50 patients was 67.54 years ( range 50 - 80 ) , mean psa ( 113.6 ng / ml ) range ( 25 - 630 ng / ml ) . all the patients were in either stage iii ( n = 21 ) or stage iv ( n = 29 ) disease . group 1 ( gleason score 8) had ( n = 30 ) patients in comparison to ( n = 20 ) in group 2 . group 1 patients had statistically higher mean [ table 2 ] whr ( 0.96 vs 0.90 ; p 0.001 ) , higher mean tg level ( 201.34 vs 150.52 mg / dl ; p = 0.0006 ) , higher mean vldl ( 40.27 vs 30.10 mg / dl ; p = 0.0006 ) , higher mean insulin ( 19.49 vs 15.04 iu / ml ; p = 0.0024 ) , and lower hdl levels ( 32.39 36.82 mg / dl ; p = 0.034 ) than patients in group 2 . serum levels of cholesterol , ldl , and testosterone did not show statistically significant differences between the two groups . baseline parameters ( age , psa , and stage ) are shown in table 1 . obesity has long been associated with increased risk of prostate cancer , although studies have been inconsistent.[1012 ] body mass index ( bmi ) may not fully reflect the disease - related dimensions of obesity since it does not differentiate muscle mass from fat mass . central obesity , which is best diagnosed by measuring the whr correlates much stronger with hormonal and metabolic alterations in comparison to bmi . in our study , high gleason score was statistically associated with higher whr raising the suspicion that central obesity may predispose to high - grade prostate cancer ( p<0.001 ) . except for a few prospective studies , there is less support for the hypothesis that central adiposity ( measured as waist circumference or whr ) is a risk factor for prostate cancer . there are data to suggest that waist circumference and/or whr may predict health problems independently of bmi , as in diabetes mellitus and cardiovascular disease . furthermore , there is accumulating evidence for a role of waist circumference and whr in predicting mortality independently of bmi in men . in 1997 , by analyzing about 135,000 men , andersson et al . found that the risk of death from prostate cancer was statistically significant above the reference category in all bmi categories . in a swedish study , whr was associated with increased risk of prostate cancer , particularly before age 65 and independent of bmi . a case - control study in china by hsing et al . showed that higher whr was related to increased risk of prostate cancer with men in higher quartile ( whr > 0.92 ) having an almost threefold elevated risk ( or , 2.71 , 95% ci = 1.66 - 4.41 , p = 0.001 ) compared with men in lowest quartile ( whr<0.86 ) . men of less than 55 years found that risk of high - grade disease increased with increasing bmi ( p = 0.02 ) indicating that bmi in younger men correlates with lean body mass rather than fatty mass , which increases with age . literature suggests that obesity lowers the risk of indolent , less aggressive tumors , whereas it increases the risk of aggressive cancer . most of these studies have used bmi as a marker of general obesity . keeping in mind that central obesity is more common in indian subcontinent and is associated with metabolic alterations in the body , we tried to evaluate its effect on gleason score . central obesity is associated with insulin resistance , hyperinsulinemia , and dyslipidemia . in our study , high gleason score was statistically associated with higher insulin levels ( p = 0.027 ) . insulin is known to be a direct mitogen for in vitro prostate growth and is necessary for the growth of prostate cancer cells in culture . a case - control study in china found a statistically significant positive association between fasting insulin and prostate cancer risk indicating that insulin could be a mediator that promotes prostate cancer development . . showed higher insulin levels ( p = 0.033 ) to be present in patients with high - risk prostate cancer , which was defined as gleason score > 7 , tumor in seminal vesicle on biopsy , psa > 15 , or stage t2c or t3 . it is known that prostate cancer cells migrate to adipocytes within red bone marrow where metastases are very common and an experiment showed that attractiveness of human bone marrow to prostate cancer cells decreased when bone marrow stroma was depleted of lipid cells . they are also known to take up lipid directly as a source of energy for the process of tumor maintenance , proliferation , and migration . platz et al . demonstrated lesser chances of advanced and metastatic prostate cancer ( rr=0.51 ci 95% and rr 0.39 95% ci , respectively ) and not decreased risk of overall prostate cancer in patients taking statins , which are lipid - lowering drugs . reported that prostate cancer patients with a higher grade tumor were more dyslipidemic , as shown by a higher tg level ( p = 0.019 ) and a lower hdl - cholesterol level ( p = 0.005 ) and higher plasma insulin level ( p = 0.019 ) than those with a lower grade tumor . however no association was found in the levels of raised tg and low hdl on comparing high - grade to low - grade tumors on american prostate cancer patients . reported that men with low cholesterol < 200 mg / dl ) had a lower risk of gleason 8 to 10 prostate cancer [ or , 0.41 ; 95% ci , 0.22 - 0.77 ] than men with high cholesterol ( 200 mg / dl ) . our study has shown a significant relationship with high gleason score and tg , vldl , and low hdl levels ; however no relation was found with cholesterol and ldl levels . testosterone is a key prostate growth factor although prostate cancer presents at an age when testosterone levels are declining . it is known that aromatase present in adipose tissue leads to decreased testosterone levels due to peripheral conversion of testosterone to estradiol . studies have suggested that testosterone may exert a differentiating effect on prostate cancer and decreased serum testosterone and increased estradiol levels may be associated with more advanced and poorly differentiated prostate cancer . lower testosterone levels may also be due to insulin resistance leading to decreased testosterone production by leydig cells , or due to negative feedback effect of inhibitory proteins present in patients with prostate cancer on hypothalamic - pituitary -gonadal axis . in our study , there was a trend of decreased testosterone levels in patients with high gleason score , which however was not statistically significant ( p = 0.065 ) . to date , few studies have investigated the relationship between central obesity hyperinsulinemia and dyslipidemia with higher grade prostate cancer majority of which are in western literature . the genetic and environmental factors affecting men of indian population can not be ignored and there is always a possibility that factors that affect the western males might not be the same in india . small sample size was a drawback in our study , also all our patients had advanced or metastatic prostate cancer on account of center bias as our center is located in a poor province . similarly the lipid levels seen in our patients might not reflect that seen in the general population . our study indicates that central obesity , dyslipidemia , and hyperinsulinemia independent of diabetes may be involved in higher grade prostate cancer and raises the potential that control of central obesity in these men or targeted treatment strategies may provide a means of reducing poor outcome in this high - risk group .
aims : the association of central obesity , hyperinsulinemia , and dyslipidemia with higher grade advanced prostate cancer as determined by gleason grading is not well understood . we evaluated the effect of central obesity waist hip ratio ( whr 0.9 ) and biochemical parameters associated with central obesity on gleason grading in north indian patients of prostate cancer presenting at advanced stages.materials and methods : a cross - sectional study was conducted among 50 nondiabetic patients having clinical stages iii and iv prostate cancer . gleason grading on core biopsy samples by histopathology was done and patients were divided in two groups group1 , gleason score 8 ; group 2 , gleason score < 8 . whr along with serum levels of prostate - specific antigen ( psa ) , testosterone , insulin , and lipid profile was done in each patient.results:the two groups are similar in age ( 67.54 years ) ; range ( 50 - 80 years ) . group 1 men had statistically higher mean whr ( 0.96 vs 0.90 ; p 0.001 ) , higher mean triglyceride level ( 201.34 vs 150.52 mg / dl ; p=0.0006 ) , higher mean very low - density lipoprotein ( vldl ) ( 40.27 vs 30.10 mg / dl ; p = 0.0006 ) , higher mean insulin ( 19.49 vs 15.04 iu / ml ; p = 0.0024 ) , and lower mean high - density lipoprotein ( hdl ) levels ( 32.39 vs 36.82 mg / dl ; p = 0.034 ) than men in group 2 . serum levels of cholesterol , ldl , and testosterone did not show statistically significant differences between the two groups.conclusions:this pilot study involving small number of patients indicates that central obesity , dyslipidemia , and hyperinsulinemia could be associated with high - grade prostate cancer .
type 2 diabetes mellitus ( t2 dm ) is a chronic , progressive disease that requires continuing and demanding medical care in the attempt to reduce the risk of long - term complications.1 genetic and environmental factors concur in sustaining the core pathogenetic mechanisms of diabetes , ie , insulin resistance and pancreatic beta - cell dysfunction.2 although multiple metabolic alterations contribute to the risk of complications in diabetic patients , appropriate management of hyperglycemia remains a main goal of treatment . however , conventional oral anti - diabetic drugs ( oads ) have limited impact on glycemic control and can be associated with side effects such as risk of hypoglycemia and/or bodyweight gain.3,4 in contrast , therapies such as metformin and those based on the incretin system have the potential to improve glycemic control , minimizing the risk of hypoglycemia and the weight gain.5 use of oads can also be limited because of comorbidities . for instance , chronic kidney disease ( ckd ) is very common in t2 dm patients because of diabetes itself and because of the large proportion of the t2 dm population with advanced age . for the purpose of this review , unless otherwise specified , estimated glomerular filtration rate ( egfr ) and ckd have been defined based on the national kidney foundation kidney disease outcomes quality initiative ( nkf kdoqi ) classification as normal egfr 90 ml / min/1.73 m ( stage 1 ckd if albuminuria is increased ) ; mildly reduced egfr 6089 ml / min/1.73 m ( stage 2 ckd if albuminuria is increased ) ; moderately reduced egfr 3059 ml / min/1.73 m ( stage 3 ckd ) ; severely reduced egfr > 1529 ml / min/1.73 m ( stage 4 ckd ) ; and end stage renal failure or stage 5 ckd if egfr < 15 ml / min/1.73 m. egfr has been calculated by the modification of diet in renal disease formula , unless otherwise specified.6 up to 40% of hypertensive t2 dm patients have some degree of ckd.7 australian data from 3893 patients with t2 dm participating in the national evaluation of the frequency of renal impairment co - existing with noninsulin dependent diabetes mellitus ( nefron ) study show that about 23% had egfr 60 ml / min/1.73 m , 35% had elevated urinary albumin to creatinine ratio , and approximately 10% had both conditions , for a total of 47% of the diabetic population with ckd.8 similar data have been found among 15,773 adult italian t2 dm patients participating in the renal insufficiency and cardiovascular events ( riace ) trial . in this patient cohort , 18.7% had stages 12 ckd , 10.6% stage 3 nonalbuminuric ckd , and 8.2% stage 3 albuminuric ckd , ie , 18.8% with an egfr 60 ml / min/1.73 m ( figure 1).9 renal impairment is a well recognized predisposing factor to hypoglycemia due to accumulation of hypoglycemic agents including insulin.10 in t2 dm patients with egfr 60 ml / min/1.73 m , insulin requirement is often reduced.11 therefore , hypoglycemia limits the ability to achieve and maintain glycemic control . nonetheless , maintenance of good glycemic control is essential in t2 dm patients with mild - to - moderate ckd in the attempt , together with effective control of other contributing factors , to slow down loss of kidney function ( table 1).12 in summary , with the decline of kidney function , careful selection of oads and appropriate dose adjustment become critical . therefore , its maintenance even in the face of ckd has been advocated , though its dose should be reduced for egfr < 45 ml / min/1.73 m and withdrawn for egfr < 30 ml / min/1.73 m much caution is needed for sulfonylureas , especially glyburide , and glinides ; and a dose reduction is appropriate for an egfr < 60 ml / min/1.73 m. there is no need of dose adjustment for pioglitazone , though its propensity to cause fluid retention should be kept in mind . alpha - glucosidase inhibitors are not recommended mainly because of lack of safety data . finally , insulin therapy is difficult to manage because of the mentioned increased risk of hypoglycemia ( table 2 ) . because of all the above limitations , interest has grown with respect to the potential use of the incretin - based therapy : the glucagon - like peptide 1 ( glp-1 ) receptor agonists and the dipeptidyl peptidase-4 ( dpp-4 ) inhibitors . for glp-1 receptor agonists , information is scanty . exenatide should be used with caution in subjects with egfr 3050 ml / min/1.73 m , and it is not recommended for egfr < 30 ml / min/1.73 m or in patients with end - stage renal disease ( esrd ) . similarly , liraglutide is not recommended in patients with moderate - to - severe renal function impairment , including esrd patients . the dpp-4 inhibitors enhance glucose - dependent insulin secretion by preventing dpp-4-mediated degradation of endogenously released incretin hormones . these agents are rapidly becoming a common choice for combination therapy with metformin.5 sitagliptin was approved in 2006 , followed by vildagliptin ( available in the eu and other countries since 2007 , still pending for approval in the us ) , saxagliptin in 2009 , alogliptin in 2010 in japan , and linagliptin in 2011 in the us and a year later in the eu . despite their common mechanism of action , dpp-4 inhibitors differ in terms of half - life , systemic exposure , bioavailability , protein binding , metabolism , presence of active metabolites , and excretion routes . these differences may become of interest when considered for patients with renal failure . while sitagliptin , vildagliptin , and saxagliptin have prominent renal elimination , linagliptin all dpp-4 inhibitors can be used in mild ( stages 1 and 2 ) ckd , with no need for dose adjustment . however , for egfr < 50 ml / min/1.73 m , a dose reduction is required for all dpp-4 inhibitors , with the exception of linagliptin ( table 3 ) . accumulation in plasma of dpp-4 inhibitors is considered a potential risk not because of hypoglycemia but , possibly , because of unknown adverse events ( aes).14 the dose of sitagliptin must be halved ( to 50 mg / day ) in patients with moderate ( egfr 30 ml / min/1.73 m to 60 ml / min/1.73 m ) and to a quarter ( 25 mg / day ) for those with severe ckd ( egfr < 30 ml / min/1.73 m ) . both saxagliptin and vildagliptin have to be halved for moderate - to - severe and severe ckd.14 kidney function should be checked on a regular basis and metformin discontinued if egfr falls to < 30 ml / min/1.73 m. to this regard , it is of interest to observe that the study of treatment and prevalence of renal disease in uk diabetes mellitus type 2 patients ( stardust ) found that 23% of patients with egfr between 30 and 45 ml / min/1.73 m and 32% of those with egfr < 30 ml / min/1.73 m were prescribed with metformin.15 vildagliptin is a rapidly absorbed , orally active , potent , selective and reversible dpp-4 inhibitor , effective and well tolerated in t2 dm patients , either as monotherapy or in combination with other oads.16 dpp-4 inhibition results in increased glp-1 concentrations , which reduce glucose by suppressing glucagon and stimulating insulin release in a glucose - dependent manner . at 10 , 25 , and 100 mg twice daily , with or without foods , vildagliptin deeply inhibits dpp-4 ( > 90% ) , with linear pharmacokinetics and a dose - dependent duration of inhibition . plasma protein binding is low ( 9.3% ) , and absolute bioavailability is high ( 85% ) , with extensive distribution into the extravascular spaces . the elimination half - life of vildagliptin is 23 hours , with steady - state kinetics reached in about 2 days . eighty - five percent of the administered vildagliptin or its metabolites are excreted with the urine , and the rest is eliminated via the feces . vildagliptin has no significant p450-related metabolism , so that risk of drug - to - drug interaction is unlikely . in particular , there is no pharmacokinetic interaction between vildagliptin and metformin , pioglitazone or glyburide , allowing safe combination with other oads . the main route of elimination of vildagliptin is hydrolysis by multiple tissues or organs , with only approximately 25% of the drug excreted unchanged by the kidneys . the dpp-4 enzyme contributes to formation of the major metabolite ( lay151 ) , suggesting that vildagliptin is a substrate of dpp-4 . in t2 dm patients with various degrees of renal failure , vildagliptin exposure increases in a manner that does not strictly correlate with the severity of renal impairment since the kidney contributes to both excretion and hydrolysis of drug . therefore , the kidneys play only a partial role in vildagliptin elimination.16 there is no significant alteration in vildagliptin pharmacokinetics in patients with mild renal impairment ( egfr 80 and > 50 ml / min/1.73 m ) , so that dose adjustment is not required.17 in patients with moderate - to - severe renal impairment , both vildagliptin and lay151 eliminations are affected and their plasma concentrations increased.18 a single dose of 10400 mg of vildagliptin induces a > 90% inhibition of dpp-4 activity between 0.5 and 4.5 hours post - dose . with doses of 50 and 100 mg , the dpp-4 inhibition persists up to 8.5 hours and 12.5 hours post - administration , respectively . the dpp-4 inhibition is reduced to 35% at 24 hours for the 100 mg dose and up to 70% for doses is needed to ensure a clinically relevant elevation of glp-1 and glucose - dependent insulinotropic polypeptide ( gip ) serum levels , vildagliptin must be administered twice a day , rendering the combination with metformin advantageous , as the two drugs have a similar time schedule of administration.19 vildagliptin increases the concentration of active glp-1 approximately two- to threefold and those of gip approximately fivefold . vildagliptin significantly reduces both fasting and postprandial glucose levels over a dose range of 50100 mg daily , and there are no substantial additional benefits of doses greater than 50 mg twice daily as monotherapy or in combination with metformin . vildagliptin has been shown to improve beta - cell function , an improvement that has been confirmed after chronic treatment for up to 2 years . reduction of the endogenous glucose production contributes to the glucose - lowering effects . unlike glp-1 receptor agonists , vildagliptin does not affect gastric emptying , and this accounts for gastrointestinal tolerability . vildagliptin improves alpha - cell sensitivity to glucose by enhancing suppressive effect of hyperglycemia and stimulatory effect of hypoglycemia . consistently , a low incidence of hypoglycemic events is recorded when vildagliptin is used both in monotherapy and in combination with other oads . potency of dpp-4 inhibition by vildagliptin has been found to be similar in different ethnic groups . hepatic impairment , gender , duration of diabetes , insulin resistance , body mass index ( bmi ) , and duration of prior metformin use do not modify pharmacokinetic and efficacy of the drug.20 in the elderly ( > 70 years ) , vildagliptin exposure is increased by approximately 30% , mainly due to impaired renal function , though this is unlikely to have any clinical relevance . rather , vildagliptin has been shown to be efficacious , safe , and well tolerated in elderly patients , with no need of dose adjustment.16 the glucose - lowering effects of vildagliptin have been investigated in more than 20 randomized , controlled clinical trials , with durations ranging from 12 to 104 weeks , involving > 20,000 patients . overall , vildagliptin at the therapeutic dose of 50 mg bid ( twice daily ) lowered gly - cated hemoglobin ( hba1c ) levels from baseline by ~1% in monotherapy and by ~0.8% when administered as add - on to metformin , thiazolidinediones , sulfonylureas , or insulin.18 improvements in markers of beta - cell function have been consistently reported . in particular , islet function has been shown to improve following administration of vildagliptin in subjects with drug - nave type 2 diabetes and mild hyperglycemia and in patients with impaired glucose tolerance.21 however , whether vildagliptin may prevent progression to diabetes has not been yet determined . finally , studies have suggested that vildagliptin may improve glucose utilization in peripheral tissues.18 specific studies on the effects of dpp-4 inhibitors on lipid profile and blood pressure remain scanty . in the registration studies , vildagliptin treatment has been associated with mild reduction of total cholesterol and low - density lipoprotein cholesterol , fasting and post - prandial triglycerides , and a slight increase in high - density lipoprotein cholesterol.22 a trend for reduction in systolic and diastolic blood pressure has been also reported.18 in a recent meta - analysis of 30 randomized controlled trials , vildagliptin was not associated with the increase of the risk of any aes as compared with placebo or thiazolidinediones ( tzds ) , with a more favorable safety profile than sulfonylureas . overall , vildagliptin is well tolerated , with no increase risk of nausea , hypertension , cough , naso - enterohepatic pharyngitis , flu , and upper respiratory tract infection as compared with comparators . similarly , the incidence of fatigue , sinusitis , peripheral edema , tremor , and diarrhea was similar compared with placebo and significantly lower than the one reported with all other active comparators.23 data concerning the use of dpp-4 inhibitors in patients with moderate - to - severe renal impairment are mainly derived by post - hoc analysis of the population recruited in the registration trials , but a few ad - hoc studies are available . arjona ferreira et al compared the efficacy and safety of sitagliptin versus glipizide in 426 t2 dm patients with inadequate glycemic control ( hba1c 7.0%9.0% ) and moderate - to - severe chronic renal insufficiency . after 54 weeks of treatment with sitagliptin ( 50 mg qd for moderate [ egfr 30 to < 50 ml / min/1.73 m ] and 25 mg qd ( once daily ) for severe [ egfr < 30 ml / min/1.73 m ] ckd ) , hba1c reduction from baseline ( 0.8% ) was noninferior to that obtained with glipizide ( 0.6% ) , with a lower incidence of symptomatic hypoglycemia ( 6.2% versus 17.0% ) and a decrease in bodyweight.24 nowicki et al recruited 170 t2 dm patients with renal impairment ( crcl < 50 ml / min estimated by the cockcroft - gault equation ) to be randomized to saxagliptin 2.5 mg once daily or placebo as add - on to any other anti - diabetic drugs in use , including insulin . patients were stratified as with moderate ( crcl 30 and < 50 ml / min ) , severe ( crcl < 30 ml / min and not receiving dialysis ) , or esrd on hemodialysis . at week 52 , adjusted mean decrease in hba1c was greater with saxagliptin than with placebo in patients with moderate and severe renal impairment , but not in the subgroup with esrd on hemodialysis . saxagliptin was generally well tolerated with similar proportions of patients per group reporting hypoglycemic events irrespective of renal impairment severity.25 more information is available for vildagliptin . in a retrospective analysis of the galvus in addition to metformin versus tzd / metformin in t2 dm ( galiant ) study , banerji et al showed that the safety profile and tolerability of the combination of vildagliptin 100 mg once daily ( or tzd ) as add - on to metformin in t2 dm patients with mild renal impairment ( n = 695 , egfr > 50 and 80 ml / min/1.73 m ) was similar to that observed in patients with normal renal function ( n = 1918 , egfr > 80 ml / min/1.73 m).26 in this 12-week study , the overall incidence of aes in patients with mild renal impairment ( vildagliptin + metformin , n = 464 : aes 37.8% ) was comparable to those reported in subjects with normal renal function ( vildagliptin + metformin , n = 1279 : aes 40.1% ) . discontinuations due to aes were comparable for patients with normal renal function and those with mild renal impairment . there was no notable change in transaminase levels from baseline to study - end in both patients with mild renal impairment and normal renal function between vildagliptin and tzd . serious aes were more frequent in tzd groups ( normal renal function , 2.4% ; mild renal failure , 3.0% ) compared with the vildagliptin groups ( normal renal function , 1.6% ; mild renal failure , 2.4% ) . findings from schweizer et al showed that vildagliptin monotherapy ( compared with metformin ) was an effective and well tolerated treatment option in 169 drug - nave elderly patients with t2 dm , 50% of whom had at least mild renal impairment ( egfr 50 to 80 ml / min/1.73 m).27 a recent meta - analysis has pooled data from 38 phase ii and iii clinical trials in which vildagliptin was given for 12104 weeks in t2 dm patients . the aim was to assess the safety of vildagliptin versus comparators with respect to organs , systems , and tissues of particular interest.28 this meta - analysis ( > 7000 subject - years of exposure to vildagliptin 50 mg bid and > 6500 subject - years exposed to comparators ) showed that vildagliptin was not associated with increased risk of hepatic events or hepatic enzyme elevations , pancreatitis , infections , or skin - related toxicity . although the incidence of aes across treatments was slightly higher in patients with mild renal impairment ( egfr 50 to 80 ml / min/1.73 m ) compared with patients with normal renal function , the presence of mild renal impairment ( more than 30% of patients exposed to vildagliptin 50 mg qd or bid ) did not adversely affect the drug safety.28 incidence of aes was lower in patients receiving vildagliptin than comparators , irrespective of renal function ( mildly impaired versus normal ) and age ( 75 versus < 75 years).29 however , the number of patients with moderate or severe renal impairment ( egfr < 50 ml / min/1.73 m ) was inadequate to draw final conclusions for these patients . in summary , at the present time , there is no evidence of a dose - related increase in aes in t2 dm with mild renal impairment treated with vildagliptin . a dose of 50 mg once daily was chosen by lukashevich et al in a much larger , multicenter , randomized , double - blind , placebo - controlled study undertaken to assess safety , tolerability , and efficacy of vildagliptin added to current anti - diabetic therapy in 515 t2 dm patients with moderate ( egfr 30 to < 50 ml / min/1.73 m ) or severe ( egfr < 30 ml / min/1.73 m ) renal impairment . most patients were already on insulin treatment.30 the study population consisted of 165 and 129 patients with moderate and 124 and 97 patients with severe renal failure randomized to vildagliptin versus placebo , respectively . after 24 weeks of treatment , the between - treatment difference in adjusted change in hba1c was 0.5% 0.1% ( p < 0.0001 ) in subjects with moderately impaired ( baseline hba1c 7.9% ) and 0.6% 0.1% ( p < 0.0001 ) in patients with severely impaired renal function ( baseline hba1c 7.7% ) . thus , relative to placebo , vildagliptin , added to ongoing anti - diabetic drugs , elicited a robust reduction in hba1c in patients with moderate or severe ckd , with a safety profile comparable to placebo in both subgroups . this study is unprecedented in terms of number of patients with moderate or severe renal failure exposed to a dpp-4 inhibitor . in particular , with regard to events that are of special interest for dpp-4 inhibitors , there was no signal for hepatic- , skin- or pancreatic - related safety . in patients with severe renal failure , there were more aes with vildagliptin , largely accounted for by a higher rate of flu . this observation , however , is not confirmed in patients with moderate renal failure and in the recent pooled meta - analyses.28,29 hypoglycemia is a matter of concern in patients with renal failure . a slightly higher rate of hypoglycemia was seen in vildagliptin - treated patients with moderate renal impairment , whereas in t2 dm with severe renal failure , hypoglycemia rates were similar for vildagliptin and placebo . more importantly , given that vildagliptin - treated patients had better glycemic control as indicated by the lower hba1c levels , the risk of severe hypoglycemia was very low and similar to placebo in both patients with moderate and severe renal failure . the low risk of hypoglycemia is likely due to improved glucose - dependent insulin secretion and maintenance of glucagon secretion in the occurrence of plasma glucose drop , possibly mediated by the glucagonotropic effect of gip.31 finally , despite the well known increased cv vulnerability of t2 dm patients with renal impairment , there was no increased frequency of cardiac events , in keeping with data from patients with normal renal function or mild renal impairment.32 the initial observations by lukashevich et al have been reevaluated after a 52 week extension of the study.33 the efficacy of the drug was maintained throughout this period of observation with hba1c reductions that remained by and large unchanged from week 24 to week 52 . this long - term extension study supports a sufficient degree of durability of treatment effect in t2 dm patients with impaired kidney function . of value , a larger proportion of vildagliptin - treated patients achieved a target hba1c < 7.0% . the overall rate of hypoglycemia in patients with severe renal impairment also remained low , with no difference between vildagliptin and placebo , with actually a lower risk of severe hypoglycemia in vildagliptin - treated patients in spite of common use of insulin . the incidence of hypoglycemia with vildagliptin in this study ( 26% in patients with moderate renal impairment and 18% in those with severe renal failure ) appears to be lower than the one expected ( 50% ) in patients with long - standing t2 dm and low baseline hba1c receiving insulin with or without oads . again , the putative mechanistic explanation for such a protective effect of vildagliptin most likely relies on increased gip - mediated stimulation of glucagon release in response to initial plasma glucose reduction.34 in summary , this large long - term intervention trial in t2 dm patients with moderate or severe renal failure supports the efficacious and safe use of vildagliptin in this vulnerable patient population.30,33 the effect of vildagliptin in t2 dm patients with esrd on hemodialysis has been directly assessed in a 24-week , prospective , open - label , controlled study.35 vildagliptin , given to 30 patients at 50100 mg / day , decreased hba1c levels from 6.7% to 6.1% . consensually , postprandial plasma glucose decreased from 186 to 140 mg / dl in the absence of serious aes such as severe hypoglycemia or liver impairment . although long - term follow - up of these patients is necessary to confirm this efficacy , vildagliptin could be considered as an alternative to insulin in patients on hemodialysis . very recently , two cases of pancreatitis associated with incretin - based therapies in esrd patients undergoing dialysis have been reported : a 75-year - old woman with a history of liraglutide use and a 68-year - old man on vildagliptin.36 whether , esrd may represent a condition at high risk for pancreatitis remains to be elucidated . in a meta - analysis of the data from 38 phase ii and iii clinical trials , vildagliptin use was not associated with any increase in the incidence of acute pancreatitis over a treatment period ranging from 12 weeks to 2 years.28,29 more recently , a randomized , double - blind study enrolling 129 t2 dm patients reported that treatment with sitagliptin or glipizide monotherapy was effective and well tolerated over 54 weeks in patients with esrd on dialysis.37 more information is available for vildagliptin . in a retrospective analysis of the galvus in addition to metformin versus tzd / metformin in t2 dm ( galiant ) study , banerji et al showed that the safety profile and tolerability of the combination of vildagliptin 100 mg once daily ( or tzd ) as add - on to metformin in t2 dm patients with mild renal impairment ( n = 695 , egfr > 50 and 80 ml / min/1.73 m ) was similar to that observed in patients with normal renal function ( n = 1918 , egfr > 80 ml / min/1.73 m).26 in this 12-week study , the overall incidence of aes in patients with mild renal impairment ( vildagliptin + metformin , n = 464 : aes 37.8% ) was comparable to those reported in subjects with normal renal function ( vildagliptin + metformin , n = 1279 : aes 40.1% ) . discontinuations due to aes were comparable for patients with normal renal function and those with mild renal impairment . there was no notable change in transaminase levels from baseline to study - end in both patients with mild renal impairment and normal renal function between vildagliptin and tzd . serious aes were more frequent in tzd groups ( normal renal function , 2.4% ; mild renal failure , 3.0% ) compared with the vildagliptin groups ( normal renal function , 1.6% ; mild renal failure , 2.4% ) . findings from schweizer et al showed that vildagliptin monotherapy ( compared with metformin ) was an effective and well tolerated treatment option in 169 drug - nave elderly patients with t2 dm , 50% of whom had at least mild renal impairment ( egfr 50 to 80 ml / min/1.73 m).27 a recent meta - analysis has pooled data from 38 phase ii and iii clinical trials in which vildagliptin was given for 12104 weeks in t2 dm patients . the aim was to assess the safety of vildagliptin versus comparators with respect to organs , systems , and tissues of particular interest.28 this meta - analysis ( > 7000 subject - years of exposure to vildagliptin 50 mg bid and > 6500 subject - years exposed to comparators ) showed that vildagliptin was not associated with increased risk of hepatic events or hepatic enzyme elevations , pancreatitis , infections , or skin - related toxicity . although the incidence of aes across treatments was slightly higher in patients with mild renal impairment ( egfr 50 to 80 ml / min/1.73 m ) compared with patients with normal renal function , the presence of mild renal impairment ( more than 30% of patients exposed to vildagliptin 50 mg qd or bid ) did not adversely affect the drug safety.28 incidence of aes was lower in patients receiving vildagliptin than comparators , irrespective of renal function ( mildly impaired versus normal ) and age ( 75 versus < 75 years).29 however , the number of patients with moderate or severe renal impairment ( egfr < 50 ml / min/1.73 m ) was inadequate to draw final conclusions for these patients . in summary , at the present time , there is no evidence of a dose - related increase in aes in t2 dm with mild renal impairment treated with vildagliptin . a dose of 50 mg once daily was chosen by lukashevich et al in a much larger , multicenter , randomized , double - blind , placebo - controlled study undertaken to assess safety , tolerability , and efficacy of vildagliptin added to current anti - diabetic therapy in 515 t2 dm patients with moderate ( egfr 30 to < 50 ml / min/1.73 m ) or severe ( egfr < 30 ml / min/1.73 m ) renal impairment . most patients were already on insulin treatment.30 the study population consisted of 165 and 129 patients with moderate and 124 and 97 patients with severe renal failure randomized to vildagliptin versus placebo , respectively . after 24 weeks of treatment , the between - treatment difference in adjusted change in hba1c was 0.5% 0.1% ( p < 0.0001 ) in subjects with moderately impaired ( baseline hba1c 7.9% ) and 0.6% 0.1% ( p < 0.0001 ) in patients with severely impaired renal function ( baseline hba1c 7.7% ) . thus , relative to placebo , vildagliptin , added to ongoing anti - diabetic drugs , elicited a robust reduction in hba1c in patients with moderate or severe ckd , with a safety profile comparable to placebo in both subgroups . this study is unprecedented in terms of number of patients with moderate or severe renal failure exposed to a dpp-4 inhibitor . in particular , with regard to events that are of special interest for dpp-4 inhibitors , there was no signal for hepatic- , skin- or pancreatic - related safety . in patients with severe renal failure , there were more aes with vildagliptin , largely accounted for by a higher rate of flu . this observation , however , is not confirmed in patients with moderate renal failure and in the recent pooled meta - analyses.28,29 hypoglycemia is a matter of concern in patients with renal failure . a slightly higher rate of hypoglycemia was seen in vildagliptin - treated patients with moderate renal impairment , whereas in t2 dm with severe renal failure , hypoglycemia rates were similar for vildagliptin and placebo . more importantly , given that vildagliptin - treated patients had better glycemic control as indicated by the lower hba1c levels , the risk of severe hypoglycemia was very low and similar to placebo in both patients with moderate and severe renal failure . the low risk of hypoglycemia is likely due to improved glucose - dependent insulin secretion and maintenance of glucagon secretion in the occurrence of plasma glucose drop , possibly mediated by the glucagonotropic effect of gip.31 finally , despite the well known increased cv vulnerability of t2 dm patients with renal impairment , there was no increased frequency of cardiac events , in keeping with data from patients with normal renal function or mild renal impairment.32 the initial observations by lukashevich et al have been reevaluated after a 52 week extension of the study.33 the efficacy of the drug was maintained throughout this period of observation with hba1c reductions that remained by and large unchanged from week 24 to week 52 . this long - term extension study supports a sufficient degree of durability of treatment effect in t2 dm patients with impaired kidney function . of value , a larger proportion of vildagliptin - treated patients achieved a target hba1c < 7.0% . the overall rate of hypoglycemia in patients with severe renal impairment also remained low , with no difference between vildagliptin and placebo , with actually a lower risk of severe hypoglycemia in vildagliptin - treated patients in spite of common use of insulin . the incidence of hypoglycemia with vildagliptin in this study ( 26% in patients with moderate renal impairment and 18% in those with severe renal failure ) appears to be lower than the one expected ( 50% ) in patients with long - standing t2 dm and low baseline hba1c receiving insulin with or without oads . again , the putative mechanistic explanation for such a protective effect of vildagliptin most likely relies on increased gip - mediated stimulation of glucagon release in response to initial plasma glucose reduction.34 in summary , this large long - term intervention trial in t2 dm patients with moderate or severe renal failure supports the efficacious and safe use of vildagliptin in this vulnerable patient population.30,33 the effect of vildagliptin in t2 dm patients with esrd on hemodialysis has been directly assessed in a 24-week , prospective , open - label , controlled study.35 vildagliptin , given to 30 patients at 50100 mg / day , decreased hba1c levels from 6.7% to 6.1% . consensually , postprandial plasma glucose decreased from 186 to 140 mg / dl in the absence of serious aes such as severe hypoglycemia or liver impairment . although long - term follow - up of these patients is necessary to confirm this efficacy , vildagliptin could be considered as an alternative to insulin in patients on hemodialysis . very recently , two cases of pancreatitis associated with incretin - based therapies in esrd patients undergoing dialysis have been reported : a 75-year - old woman with a history of liraglutide use and a 68-year - old man on vildagliptin.36 whether , esrd may represent a condition at high risk for pancreatitis remains to be elucidated . in a meta - analysis of the data from 38 phase ii and iii clinical trials , vildagliptin use was not associated with any increase in the incidence of acute pancreatitis over a treatment period ranging from 12 weeks to 2 years.28,29 more recently , a randomized , double - blind study enrolling 129 t2 dm patients reported that treatment with sitagliptin or glipizide monotherapy was effective and well tolerated over 54 weeks in patients with esrd on dialysis.37 incretin - based agents may exert a beneficial effect in preventing diabetic complications beyond their metabolic effects . preclinical data have shown that vildagliptin can prevent peripheral nerve degeneration in a diabetes - induced animal model.38 sitagliptin possesses anti - inflammatory and anti - apoptotic effects in retinal cells and exerts beneficial effects on the blood - retinal barrier integrity in the retinas of zucker diabetic fatty rats.39 dpp-4 inhibitors increase availability of glp-1 in a range of tissues . glp-1 receptors are expressed in the proximal tubules , in the renal glomerulus , and on podocytes . moreover , renal inflammation can upregulate dpp-4 expression in renal glomeruli , while dpp-4 inhibition can upregulate glp-1 receptor expression . in human proximal tubular cells , glp-1 receptor agonist may inhibit the advanced glycation end product ( age)-receptor for age ( rage)-mediated asymmetric dimethylarginine generation via inhibition of reactive oxygen species generation , thereby providing protection against the development and progression of diabetic kidney damage.40 in human mesangial cells , exendin-4 , a glp-1 receptor agonist , inhibits cell proliferation and downregulates the expression of transforming growth factor ( tgf)-1 ) and connective tissue growth factor ( ctgf ) induced by high glucose.41 tgf - 1 and ctgf induce extracellular matrix accumulation and persistent fibrosis in the glomerular mesangium . moreover , dpp-4 substrates other than incretins , such as brain natriuretic peptide , atrial natriuretic peptide , and stromal - derived factor-1 alpha have proven renal ( and cardiovascular ) effects.42 in summary , a plausible mechanism can be invoked for a role of dpp-4 inhibition in protecting the kidney independently and beyond glycemic control . in keeping with the potential mechanisms through which dpp-4 inhibition may exert a protective effect on the diabetic kidney , liu et al have recently reported that vildagliptin attenuates kidney injury in streptozotocin - induced diabetic rats.43 in this animal model , vildagliptin significantly decreased proteinuria , albuminuria , and urinary albumin to creatinine ratio . moreover , a dose - dependent delay in glomerular basement membrane thickening , tubule - interstitial fibrosis , and glomerulosclerosis was observed . the study also reported improvements in gfr over the 24 weeks of the study . chronic treatment with sitagliptin has been shown to attenuate renal ischemia - reperfusion injury ( iri ) in diabetic rats.44 sitagliptin - treated diabetic rats that underwent renal iri showed a significant decrease in serum creatinine levels compared with renal iri in untreated diabetic rats . concomitantly , a decreased lipid peroxidation , xanthine oxidase and myeloperoxidase activities , and nitric oxide level in renal tissue were observed along with an increase in antioxidant enzymes like glutathione , glutathione peroxidase , superoxide dismutase , and catalase , and reduced dna fragmentation and apoptosis . consistently , acute dpp-4 inhibition with vildagliptin was found to exert a dose - dependent protective effect on kidney function after iri in a nondiabetic rat model , as indicated by a decrease of tubular necrosis and inhibition of the apoptotic pathway in the renal proximal epithelial cells . these protective effects were associated with antiapoptotic , immunological , and antioxidative changes.45 a potential protective effect of vildagliptin can be derived from the results reported by wang et al.46 these authors studied the effect of nwt-03 , an egg protein hydrolysate with dpp-4 and angiotensin - converting - enzyme inhibitory activity , on renovascular damage in zucker diabetic fatty rats developing signs of kidney damage , such as albuminuria and glomerulosclerosis . long - term supplementation with nwt-03 attenuated renovascular damage , and the comparison with vildagliptin led to the conclusion that the seffects of nwt-03 were mediated , at least in part , through dpp-4 inhibition since vildagliptin elicited favorable effects on renal proinflammatory cytokines independently of systemic improvement of metabolic parameters . the molecular and preclinical studies lend support to the hypothesis that dpp-4 inhibition may exert a direct nephro - protective effect , providing the basis for exploratory evaluation in the human setting . with respect to this , it is worth recalling the experience of kothny et al.33 these authors have assessed the safety and efficacy of vildagliptin versus placebo , added to ongoing stable antidiabetic treatment over a 52-week randomized follow - up . egfr was determined to show a slight decline over the 1-year follow - up in both treatment groups . in patients with moderate renal function impairment , the mean egfr change from baseline was 1.62 and 1.80 ml / min/1.73 m in patients on vildagliptin and placebo , respectively . in patients with severe renal failure , the mean change from baseline was 1.98 and 2.44 ml / min/1.73 m in patients on vildagliptin and placebo , respectively . in the study by arjona ferreira et al , sitagliptin was compared with glipizide.24 with both treatments , a similar decline in egfr was observed ( week 54 , sitagliptin , 3.9 ml / min/1.73 m ; glipizide , 3.3 ml / min/1.73 m ) . of the randomized patients with moderate renal insufficiency at baseline , 28 out of 149 ( 18.8% ) on sitagliptin and 17 out of 154 ( 11.0% ) on glipizide progressed to severe renal insufficiency during the study . the changes from baseline in urine albumin / creatinine ratio at week 54 did not differ between treatments . interestingly , a pooled analysis of phase iii , placebo - controlled , registration studies showed a significant reduction in urinary albumin excretion after 24 weeks of treatment with linagliptin in subjects with increased albuminuria.47 altogether , the observations suggest a potential direct nephro - protective effect of dpp-4 inhibitors that goes beyond their glucose - lowering effects . with these benefits confirmed , dpp-4 inhibitors may provide an added benefit with respect to renal protection , which may become relevant on the light of the data generated by the national veterans health administration databases study comparing the effectiveness of oads on kidney function.48 this is a retrospective cohort analysis including 93,577 diabetic patients who filled an incident oad prescription for metformin , sulfonylurea , or rosiglitazone . the primary composite outcome consisted of a persistent decline in egfr from baseline 25% or a diagnosis of esrd , and the secondary outcome included an egfr event , esrd , or death . as compared with metformin , use of sulfonylureas was associated with a greater risk of death as well of a decline in egfr and of esrd . in keeping with the potential mechanisms through which dpp-4 inhibition may exert a protective effect on the diabetic kidney , liu et al have recently reported that vildagliptin attenuates kidney injury in streptozotocin - induced diabetic rats.43 in this animal model , vildagliptin significantly decreased proteinuria , albuminuria , and urinary albumin to creatinine ratio . moreover , a dose - dependent delay in glomerular basement membrane thickening , tubule - interstitial fibrosis , and glomerulosclerosis was observed . the study also reported improvements in gfr over the 24 weeks of the study . chronic treatment with sitagliptin has been shown to attenuate renal ischemia - reperfusion injury ( iri ) in diabetic rats.44 sitagliptin - treated diabetic rats that underwent renal iri showed a significant decrease in serum creatinine levels compared with renal iri in untreated diabetic rats . concomitantly , a decreased lipid peroxidation , xanthine oxidase and myeloperoxidase activities , and nitric oxide level in renal tissue were observed along with an increase in antioxidant enzymes like glutathione , glutathione peroxidase , superoxide dismutase , and catalase , and reduced dna fragmentation and apoptosis . consistently , acute dpp-4 inhibition with vildagliptin was found to exert a dose - dependent protective effect on kidney function after iri in a nondiabetic rat model , as indicated by a decrease of tubular necrosis and inhibition of the apoptotic pathway in the renal proximal epithelial cells . these protective effects were associated with antiapoptotic , immunological , and antioxidative changes.45 a potential protective effect of vildagliptin can be derived from the results reported by wang et al.46 these authors studied the effect of nwt-03 , an egg protein hydrolysate with dpp-4 and angiotensin - converting - enzyme inhibitory activity , on renovascular damage in zucker diabetic fatty rats developing signs of kidney damage , such as albuminuria and glomerulosclerosis . long - term supplementation with nwt-03 attenuated renovascular damage , and the comparison with vildagliptin led to the conclusion that the seffects of nwt-03 were mediated , at least in part , through dpp-4 inhibition since vildagliptin elicited favorable effects on renal proinflammatory cytokines independently of systemic improvement of metabolic parameters . the molecular and preclinical studies lend support to the hypothesis that dpp-4 inhibition may exert a direct nephro - protective effect , providing the basis for exploratory evaluation in the human setting . with respect to this , it is worth recalling the experience of kothny et al.33 these authors have assessed the safety and efficacy of vildagliptin versus placebo , added to ongoing stable antidiabetic treatment over a 52-week randomized follow - up . egfr was determined to show a slight decline over the 1-year follow - up in both treatment groups . in patients with moderate renal function impairment , the mean egfr change from baseline was 1.62 and 1.80 ml / min/1.73 m in patients on vildagliptin and placebo , respectively . in patients with severe renal failure , the mean change from baseline was 1.98 and 2.44 ml / min/1.73 m in patients on vildagliptin and placebo , respectively . in the study by arjona ferreira et al , sitagliptin was compared with glipizide.24 with both treatments , a similar decline in egfr was observed ( week 54 , sitagliptin , 3.9 ml / min/1.73 m ; glipizide , 3.3 ml / min/1.73 m ) . of the randomized patients with moderate renal insufficiency at baseline , 28 out of 149 ( 18.8% ) on sitagliptin and 17 out of 154 ( 11.0% ) on glipizide progressed to severe renal insufficiency during the study . the changes from baseline in urine albumin / creatinine ratio at week 54 did not differ between treatments . interestingly , a pooled analysis of phase iii , placebo - controlled , registration studies showed a significant reduction in urinary albumin excretion after 24 weeks of treatment with linagliptin in subjects with increased albuminuria.47 altogether , the observations suggest a potential direct nephro - protective effect of dpp-4 inhibitors that goes beyond their glucose - lowering effects . with these benefits confirmed , dpp-4 inhibitors may provide an added benefit with respect to renal protection , which may become relevant on the light of the data generated by the national veterans health administration databases study comparing the effectiveness of oads on kidney function.48 this is a retrospective cohort analysis including 93,577 diabetic patients who filled an incident oad prescription for metformin , sulfonylurea , or rosiglitazone . the primary composite outcome consisted of a persistent decline in egfr from baseline 25% or a diagnosis of esrd , and the secondary outcome included an egfr event , esrd , or death . as compared with metformin , use of sulfonylureas was associated with a greater risk of death as well of a decline in egfr and of esrd . in t2 dm patients with moderate or severe renal failure , vildagliptin , a member of the dpp-4 inhibitor family that increases availability of glp-1 and gip , maintains an antihyperglycemic efficacy that is not inferior to the one observed in subjects with normal renal function , with a long - lasting hba1c reduction of 0.6%0.8%.30,33 this efficacy is coupled with a favorable safety profile in term of bodyweight neutrality and low risk of hypoglycemia.34 thus , vildagliptin offers new , safe , and promising opportunities for assuring satisfactory glycemic control in t2 dm patients with impaired renal function . whether the favorable risk - to - benefit ratio of vildagliptin in this selected vulnerable population may also provide cardiovascular protection remains , at the present time , a speculation.22 ad hoc studies exploring cardiovascular risk profile and possibly hard cardiovascular endpoint would be more than welcome , as loss of kidney function carries an excess of risk for cardiovascular mortality.32,49 for the time being , vildagliptin can be considered a valid option for ensuring glycemic control while avoiding bodyweight gain and reducing the risk of hypoglycemia . obviously , in treating these patients , appropriate dose reduction of vildagliptin must be considered , given the fact that vildagliptin and its metabolite are largely excreted through the urinary tract . of interest , mechanisms have been pointed out in preclinical studies to support a potential nephro - protection effect that is independent of improvement in glucose control.43 these intriguing results provide the background for designing studies exploring such a possibility in human t2 dm .
backgrounddipeptidyl peptidase-4 ( dpp-4 ) inhibitors are novel classified oral anti - diabetic drugs for the treatment of type 2 diabetes mellitus ( t2 dm ) that provide important reduction in glycated hemoglobin , with a low risk for hypoglycemia and no weight gain . in t2 dm patients with reduced renal function , adequate glycemic control is essential to delay the progress of kidney dysfunction , but they are at a greater risk of experiencing hypoglycemic events , especially with longer - acting sulfonylureas and meglitinides.objectiveto evaluate vildagliptin as an option to achieve glycemic control in t2 dm patients with moderate or severe chronic kidney disease ( ckd).methodsa comprehensive search in the literature was performed using the term vildagliptin . original articles and reviews exploring our topic were carefully selected.resultsvildagliptin provides effective glycemic control in patients with t2 dm and ckd . dose reductions are required for vildagliptin and other dpp-4 inhibitors , except linagliptin , in t2 dm patients with moderate - to - severe ckd . dose of vildagliptin had to be reduced by half ( to 50 mg / day ) both for moderate ( estimated glomerular filtration rate [ egfr ] 30 to 50 ml / min ) and severe ckd ( egfr < 30 ml / min ) . available results support a favorable efficacy , safety , and tolerability profile for vildagliptin in t2 dm with moderate or severe renal failure . preliminary data may suggest additional benefits beyond improvement of glycemic control.conclusionvildagliptin can be safely used in t2 dm patients with varying degrees of renal impairment . dose adjustments for renal impairment are required . potential long - term renal benefit of vildagliptin needs to be further explored .
as spinal surgery techniques and instrumentation devices develop , the demand for minimally invasive spinal fixation ( misf ) grows . misf has many advantages , including less blood loss , shorter length of hospital stay , lower rates of infection , and better relief of postoperative pain than traditional open surgery.1 2 3 the percutaneous pedicle screw ( pps ) system is a basic and essential device for posterior misf . published research has demonstrated highly accurate pps placement with various imaging support systems , such as computer - assisted navigation.4 5 6 7 8 9 however , such navigation systems are exceedingly expensive , and only well - funded institutions can afford such specialized equipment . recent publications have reported the safe and accurate placement of the pps by surgeons with different levels of experience in human cadavers.10 however , the clinical results of patients with degenerative lumbar disease in different institutions and among surgeons are not well known . wiesner et al reported an accurate pedicle screw insertion technique using perfect anteroposterior ( ap ) and lateral radiograph image guidance.11 this classic and safe technique has been used widely by spine surgeons . according to a recent report,12 wiesner 's modified method with a guidewire and cannulated screw using dual conventional fluoroscopy units achieved good results for the screw placement without specialized equipment in trauma patients . we introduced misf using the modified pps insertion technique with dual fluoroscopy units in 2010 . dual imaging views of two planes can simply and easily show the entry point and screw trajectory to the surgeon . we hypothesized that even less - experienced surgeons could perform safe surgeries as described in a human cadaveric report,10 if they understood the correspondence between the anatomical landmarks of the spine and the intraoperative imaging views . published studies reported only the degree of the pps placement accuracy , but not the comparative clinical results among surgeons . in addition , there have been few reports about accuracy enhancement of the pps placement with dual fluoroscopy - based techniques for degenerative lumbar disease . the accuracy of the pps placement and the differences in the results between experienced and less - experienced surgeons in spinal surgery for degenerative lumbar spine disease were evaluated . this retrospective , comparative study investigated the accuracy of pps placement and the radiation time per pps insertion between two groups of patients who underwent surgery by surgeons with less than 5 years of experience versus surgeons with more than 5 years of experience in spinal surgery . an experienced surgeon was defined as a board - certified spine surgeon and a surgeon engaged in spine surgery for over 5 years . the study population was selected from consecutive patients who underwent misf with the pps system in fukuoka wajiro hospital and shinkomonji hospital from april 2010 to october 2013 . patients with degenerative lumbar disease were included ; cases with pedicle diameter less than 5 mm were excluded . the inclusion criterion for surgeons in both groups was based on whether they had practiced the pps method in more than five cases . a total of 231 consecutive patients with degenerative lumbar disease were treated by misf with the pps system in the two hospitals . the 161 patients satisfying the inclusion criteria were divided into two groups : group a , 74 patients ( 40 male and 34 female patients ; average age 63 years ) who were treated by four surgeons with more than 5 years of experience in lumbar surgery , and group b , 87 patients ( 58 male and 29 female patients ; average age 60 years ) who were treated by four surgeons with up to 5 years of experience . the lumbar degenerative diseases included 132 cases of lumbar canal stenosis diagnosed with reference to the international classification and 29 cases with lumbar disk herniation . the range of fixation was short segment in 156 cases , 2 segments in 3 cases , and 3 segments in 2 cases . the spinal implants used were the pedicle screw and rod systems ( cd horizon sextant , medtronic sofamor danek spine , memphis , tennessee , united states ; and viper , depuy synthes spine , raynham , massachusetts , united states ) . the diameters of the screws ranged from 5.2 to 6.5 mm and were chosen to be within the diameter of the pedicle based on preoperative computed tomography ( ct ) . abbreviations : asd , adjacent segmental disease ; dsa , destructive spondyloarthropathy ; lcs , lumbar canal stenosis ; ldh , lumbar disc herniation . the lateral fluoroscopic radiographic unit was set up at the left side of the jackson table , and the ap unit was set up at the opposite side . this setting of the dual fluoroscopy units allowed the surgeon to view biplane images at the same time . the c - arm that had the larger diameter was set as the ap view to allow a wider working space for the operation . subsequently , the position of the two fluoroscopy units was adjusted for the perfect ap and lateral radiographs of the target vertebra on the monitor . the following setting of the fluoroscopy units is the most important preparation for inserting ppss . the position of the c - arm should be fine - tuned in the craniocaudal direction to align the anterior end plate of the vertebra with the posterior end plate , and it must be turned around to allow visibility of the pedicle symmetrically toward the vertebral rotation angle on the perfect ap view . on the perfect lateral view , the shaded images of the two pedicles must correspond . after setting the two fluoroscopy units , the entry point and the insertion angle of the screws a jamshidi needle was positioned at the base of the transverse process corresponding to the lateral margin of the oval pedicle image in the perfect ap view . when the tip of the needle reached the posterior wall of the vertebra in the perfect lateral view , it was checked to be within the medial margin of the pedicle in the ap view.11 a guidewire was inserted through the cannula , and the needle was removed . the back muscles were split by a muscle dilator , a cannulated tap was inserted to make a pedicular hole , and then cannulated screws were placed into the pedicle over the guidewire . point a is the needle insertion point , and the tip is located on the lateral margin of the pedicle on the perfect anteroposterior view . point b shows that the tip of the needle has reached the vertebral body , and it should be within the medial margin of the pedicle on the anteroposterior view . pps misplacement was defined as breach of the pedicular wall with a grading scale of 2-mm steps ( grade i : no breach ; grade ii : breach less than 2 mm ; grade iii : breach 2 to 4 mm ; grade iv : breach 4 to 6 mm ; grade v : breach greater than 6 mm ) , as described by gertzbein and robbins.13 the direction of pedicular wall breach in the transverse , sagittal , and coronal planes using 2-mm slice - thickness ct ( aquilion 64 tsx101a and aquilion one tsx301a , toshiba , tokyo , japan ) was assessed by one radiologist and one spinal surgeon , and both were blinded to the patients ' classification . if the ct scan interpretations disagreed , the higher grade was given priority over the lower grade . to evaluate radiation exposure , we measured the total radiation time ( seconds ) required for the pps insertion in the series of operative procedures ranging from the setting of the jamshidi needle to completion of screw insertion . values are shown as medians ( range ) for the radiation time and averages standard deviation for the surgical time . statistical analyses were performed with the chi - square test for categorical data and the mann - whitney u test and student t test for surgical results to compare the two groups . the differences with p there were no significant differences in the characteristics of the patients between the two groups . 2 shows the distribution of the vertebral levels in which ppss were placed and the grading of pedicular perforation . the distribution of screw misplacement and the grading scale . the highest ratio of screw deviation is seen at l2 , and grade iii perforations are seen only at l5 and s1 . of the 658 screws , 637 were placed entirely in the pedicle , and only 21 screws ( 3.2% ) were misplaced from l2 to s1 . nineteen screws ( 2.9% ) perforated the cortex of the pedicle in grade ii and 2 ( 0.3% ) in grade iii misplacement . the breach rate by lumbar level was 11% at l2 , 1.9% at l3 , 3.6% at l4 , 2.1% at l5 , and 4.5% at s1 ; the highest breach rate was at l2 . the breach rates of groups a and b were 3.3% ( 10/306 ) and 3.1% ( 11/352 ) , respectively , with no significant difference ( p = 0.91 ) . in group a , 10 screws were in grade ii misplacement , with no screws in grade iii misplacement . in group b , 9 screws were in grade ii misplacement , and 2 screws were in grade iii misplacement ( table 2 ) . these misplacements occurred in the fourth and twelfth cases performed by different surgeons in group b. the direction of the pedicular breach was lateral in 12 , medial in 4 , superior in 3 , and inferior wall in 2 . malposition screws of grade iii misplacement had medial and inferior positions with respect to each other in group b. no significant differences were seen in the direction of perforation between the two groups ( p = 0.18 , fig . the numbers in parentheses in group b represent grade iii misplacements . despite the malposition of screws , all patients in grade ii misplacement had no neurologic symptoms . in grade iii misplacements , one group b patient ( medial wall breach ) had a transient symptom of nerve root irritation . as other surgical complications , the median fluoroscopy time for the pps insertion was 25 ( 5 to 92 ) seconds in group a and 51 ( 7 to 124 ) seconds in group b. the radiation exposure was significantly shorter in group a than in group b ( p < 0.01 , table 2 ) . the average operative time was 132 49 minutes in group a and 164 46 minutes in group b ( p < 0.01 ) . the present study shows that pps placement was highly accurate with the classic technique under dual fluoroscopy - based guidance , even when the surgeon lacked sufficient experience . the technique of pps insertion in the lumbar spine was initially introduced by magerl in 1977.14 he described the management of spinal trauma and spondylodiscitis as temporary external fixation . wiesner et al reported a safe technique to insert transpedicular noncannulated screws percutaneously with fluoroscopic guidance using a human cadaver model in 1999.11 the authors also reported that the results with this technique were better than those of the well - established magerl technique . the first clinical evaluation of the tracts and pps positions with ct scan analysis was followed by the report of an in vivo study by the same authors.15 the accuracy of fluoroscopy with computer - guided technology was assessed using cadavers by foley et al in 2001 , and computer - assisted technology has been adopted since.9 the current percutaneous insertion technique using cannulated screws with a guidewire , first described by holly and foley,16 has become the fundamental technique for misf . breach rates of 1.1 to 23% using a percutaneous procedure with two- or three - dimensional navigation systems have been reported.5 6 7 16 the published studies including scoliosis surgery emphasize the advantages of a higher accuracy in screw placement with a navigation - assisted technique than with the conventional fluoroscopy technique.6 8 17 however , the navigation systems are very expensive and require time - consuming preregistration of anatomical landmarks . additional ct scans are required when going beyond the imaging area for the target vertebra even with zero - preregistration mobile - type ct navigation.8 18 on the other hand , breach rates of 7.2 to 14.8% using the same procedure as ours ( wiesner 's modified technique ) under the assistance of fluoroscopy alone and using a postoperative grading scale of 2-mm steps on ct have been reported.4 7 18 19 heintel et al achieved a highly satisfactory breach rate of 2% for trauma patients using dual fluoroscopy - based technique.12 however , that study did not include screw misplacement with lateral wall perforation in those that were inserted medially . in the present study , if they had used the same grading scale of screw misplacement as in the present study , the breach rate should have been higher than the result they reported . in the present study , screw placement was better using the dual fluoroscopy - based technique than in reports of the single fluoroscopy - based technique , because the rotating single c - arm could not reflect the three - dimensional trajectory of the needle in real time during the procedure of transpedicular needle insertion into the vertebra . taking biplane imaging views simultaneously by dual fluoroscopy units makes it possible to identify the precise entry point and the trajectory of the pps in real time . in addition , the use of dual fluoroscopy units has the potential to reduce the incidence of surgical site infection by saving multiple troublesome and unclean steps of c - arm control . the cause of the high rate of lateral wall breaches at l2 is likely related to the anatomical features of the lumbar spine . the pedicle width of the lumbar vertebrae increases gradually from l1 to l5.20 when the base of the transverse process is located more on the outside than usual due to hypertrophy of a degenerative facet , an increased risk of developing a lateral wall breach is seen because the entry point of the screw is located on the outside.5 additionally , when there is a recess in the lateral pedicular wall , a lateral pedicular breach is unavoidable based on the anatomical features ( fig . the computed tomography shows lateral breach of screw due to the hypertrophy of facet and the recess in the lateral pedicular wall . screw deviation of less than 2 mm into the canal does not appear to cause adverse postoperative clinical results . in fact , the lumbar canal has a 4-mm epidural and subarachnoid space safe zone , and canal encroachment of the screw by less than 4 mm could be tolerated without neurologic symptoms.13 wiesner et al reported that a major factor related to the higher misplacement rate of s1 screws with medial wall breach was the presence of the iliac crest in the vicinity.15 ravi et al suggested that the direction of the medial or lateral breaches tended to depend on the location of the screw insertion point.5 briefly , the medial start point due to the vicinity of the ilium resulted in a medial breach . additionally , the ap view of the medial margin of the sacral pedicle is often poor compared with that of lumbar vertebrae . if the view is clear , a surgeon acquainted with the anatomy could anticipate the medial margin of the pedicle from the upper vertebra to some extent . the anatomical characteristics of the sacrum and a poor knowledge of anatomy resulted in the grade iii screw malposition in group b. yang et al reported that the pps insertion technique using the oblique visualization technique under computer - assisted fluoroscopic navigation reduced the fluoroscopy time per screw to an average of 6.6 seconds.6 with fluoroscopy guidance , raley and mobbs reported that of 88 cases , the first five and the last five required an average of 25.8 seconds and 6.6 seconds of fluoroscopy time per screw , respectively.19 the radiation exposure was greatly reduced by the use of computer navigation and the learning curve . a dual fluoroscopy technique similar to ours achieved a good result , with an average fluoroscopy time of 22.7 seconds per pps and a screw breach rate of 3.3%.21 however , the surgeon had been specialized in misf and was probably beyond the learning curve . the present study median fluoroscopy time in group a of 25 seconds was similar to a previous report . in group b , the radiation exposure was about twice as long as in group a. the fact that the surgeons in group a were masters with knowledge of local anatomy compared with group b contributed to the lack of grade iii breaches and less radiation exposure in group a. whereas the dual fluoroscopy technique contributed to the high accuracy of screw placement on the axial plane and the optimal location of the screw top within the vertebra on lateral imaging,12 it had a disadvantage of requiring more radiation exposure.22 without an expensive imaging support system , the technique of pps insertion using dual fluoroscopy units is fairly accurate . however , the higher radiation exposure when using this technique compared with a navigation system is one important limitation . a larger sample size would probably have shown a significant difference between the two groups in grade iii breaches . the present study showed high accuracy of pps placement by surgeons with a lack of experience , and experienced surgeons had shorter intraoperative radiation time . although there was a lack of novelty , there were significant results from the perspective of a first report : the accuracy of the pps placement for degenerative lumbar spine , not cadaveric spines , and the radiation exposure compared between surgeons with more versus less experience . an experience - dependent learning curve has the possibility of decreasing the absorbed doses of radiation . and less - experienced surgeons should insert the pps under the technical guidance of a senior surgeon in the first 10 or more cases . the present technique using dual fluoroscopy units simultaneously resulted in favorable results achieved by the relatively less - experienced surgeons . favorable pps placement was achieved using a conventional dual fluoroscopy - guided technique without depending on surgeon experience . the classic modified method of pps insertion in the dual fluoroscopy technique has a risk of greater radiation exposure but provides accurate placement in any institution and by any surgeon .
study design retrospective comparative study . objective to evaluate the accuracy of percutaneous pedicle screw ( pps ) placement and intraoperative imaging time using dual fluoroscopy units and their differences between surgeons with more versus less experience . methods one hundred sixty - one patients who underwent lumbar fusion surgery were divided into two groups , a ( n = 74 ) and b ( n = 87 ) , based on the performing surgeon 's experience . the accuracy of pps placement and radiation time for pps insertion were compared . ppss were inserted with classic technique under the assistance of dual fluoroscopy units placed in two planes . the breach definition of pps misplacement was based on postoperative computed tomography ( grade i : no breach ; grade ii : < 2 mm ; grade iii : 2 to < 4 mm ) . results of 658 ppss , only 21 screws were misplaced . the breach rates of groups a and b were 3.3% ( grade ii : 3.4% , grade iii : 0% ) and 3.1% ( grade ii : 2.6% , grade iii : 0.6% ; p = 0.91 ) . one patient in grade iii misplacement had a transient symptom of leg numbness . median radiation exposure time during pps insertion was 25 seconds and 51 seconds , respectively ( p < 0.01 ) . conclusions without using an expensive imaging support system , the classic technique of pps insertion using dual fluoroscopy units in the lumbar and sacral spine is fairly accurate and provides good clinical outcomes , even among surgeons lacking experience .
little is understood about this condition 's mechanism , exacerbating factor , and definite treatment . hyperhidrosis generally occurs in the axillae , the palms , plantar surface of the feet , and the face . it is estimated to affect 0.6 to 1.0% of the population , generally young adults . the principal characteristics of this condition include intense discomfort experienced by the patients , affecting their social , affective , and professional lives . primary hyperhidrosis generally manifests in childhood and early adolescence , does not occur during sleep , and can be exacerbated by emotional stress . excessive sweating of the palms and axillae can cause utmost embarrassment in professional and social interaction . the fact that such sweating is not socially accepted , and the discomfort , odor , and stained clothes caused by constant wetness significantly decrease quality of life ( qol ) . although various treatment options are available , including topical and systemic therapies , iontophoresis , regional nerve block , and botulinum toxin injection , have their limitations . video - assisted thoracoscopic sympathetic surgery has been accepted globally as a form of treatment for primary palmar hyperhidrosis . in the literature , different methods , including resection ( sympathectomy ) , transection ( sympathicotomy ) , and clipping much effort to reduce compensatory hyperhidrosis and determine its contributory factors has been attempted during surgical procedures . it has been used to reduce severe compensatory hyperhidrosis related to the procedural level of the sympathetic chain . procedures that involve r3 or / and r4 sympathetic ganglions are widely accepted in many treatment centers , and the results have been favorable . however , some patients still present with postoperative compensatory sweating or overly dry hands . the aim of this study was to compare two simplified methods for the treatment of palmar and axillary hyperhidrosis , in which the sympathetic chain was transected in merely one segment at the level of either the third or fourth rib , respectively referred to as r3 or r4 sympathicotomy . emphasis was placed on comparing the impact of sympathicotomy at r3 and r4 , and to evaluate the efficacy and adverse effects of palmar and axillary hyperhidrosis by surgery . between january of 1999 and april of 2009 , 133 patients with primary hyperhidrosis underwent video - assisted thoracic sympathicotomy . there were 62 males and 71 females , with a mean age of 22.56.5 years . the most common clinical manifestation of hyperhidrosis was palmer and axillary sweating ( in 39.9% ) , followed by palmer sweating alone ( in 33.8% ) , and axillary sweating alone ( in 26.3% ) . the severity of palmar sweating , sweating in other parts of the body , other concomitant symptoms and past medical history were recorded . chest radiography , electrocardiogram ( ecg ) and routine blood examination were performed before surgery . severe primary palmar hyperhidrosis that significantly interfered with daily life , including work , was the common primary indication for surgery . secondary hyperhidrosis caused by hyperthyroidism or neurotic anxiety , and patients with bradycardia ( heart rate < 60/min ) were excluded from surgery . patients were randomized into two therapeutic groups ( table 1 ) . patients were placed under single lumen intubation general anesthesia in the semi - fowler 's position ( dorsal decubitus position with back lifted 45 degrees from horizontal , and abduction of both arms ) . a 2 mm trocar was introduced into the pleural cavity through the fourth intercostals space of the mid - axillary line . after thoracoscope insertion , an initial panoramic view of the upper pleural cavity and mediastinal structures was obtained . another operating channel ( 2 mm ) was made through the fourth intercostal space of the anterior axillary line . after identification of the thoracic sympathetic ganglion , the t3 or t4 sympathetic chains were then destroyed by electric cautery . the anesthesiologist re - inflated the lung . following lung re - expansion by positive inflation with a 6 fr feeding catheter , the trocar was then removed . the patients were asked simple questions related to symptom resolution , surgical outcome satisfaction , and occurrence / intensity of reflex sweating . compensatory sweating in the other regions of the body was graded as " none " when compensatory sweating was not noticeable and did not interfere with daily activities , " mild " when it was tolerable but sometimes interfered with daily activities , " moderate " when it was barely tolerable and frequently interfered with daily activities , and " severe " when it was intolerable and always interfered with daily activities . the degree of satisfaction in each patient was recorded as " satisfied " or " dissatisfied " . self - reported satisfaction , recurrence , and improvement of sweating after intervention constituted the three recorded aspects of the patients ' subjective experience with sweat - triggering situations . recurrence was defined as severe discomfort experienced by patients similar to that experienced before surgery , despite improvement in sweating . statistical analysis of comparisons between the 2 groups was conducted using the student 's unpaired t test and chi - square test with spss 13.0 ( spss , inc , chicago , il ) . all operations were successfully performed using video - assisted thoracoscopy without associated severe morbidity and mortality . no life - threatening event or death occurred and other complications , such as horner syndrome , hemothorax , intercostal neuralgia , pulmonary edema and atelectasis were not observed . mild subcutaneous emphysema and residual pneumothorax on follow - up chest radiograph resolved spontaneously , and no further therapy was required . there was no significant difference between the 2 groups in terms of age , sex , and positive family history ( table 1 ) . in addition , there was no significant difference between the 2 groups in the rate of satisfaction and recurrence . the incidence of " moderate " to " severe " compensatory sweating was higher in the r3 ( 71.8% ) group than r4 ( 33% , p=0.02)(table 2 ) . no patient requested reoperation in either group , and no patient expressed regret after surgery . the dominating indication for sympathetic surgery is hyperhidrosis of the upper limb . when conservative and medical treatment fails , endoscopic thoracic surgery is performed . the first sympathectomy for the treatment of hyperhidrosis was performed in 1920 , in which anterior cervical access was used . in 1942 , great advance in surgical technique was made , which rendered it unnecessary to sacrifice the stellate ganglion in order to denervate the upper limb . as such , one of the most feared complications in thoracic sympathectomy - claude bernard - horner syndrome - was eliminated . in this study , patients were informed about the possible side effects of sympathicotomy , including compensatory sweating , prior to the procedure . chou et al . asserted that reflex response in the sweating center of the hypothalamus could cause the underlying mechanism of compensatory sweating . according to previous studies , various factors , such as the location of hyperhidrosis , sympathicotomy level , and surgical procedures including clamp , cut and resect can induce compensatory sweating . also , the severity of compensatory sweating is influenced by patient condition , such as obesity , primary complaint severity and t2 sympathetic ganglion resection . therefore , more selective sympathicotomy was proposed to minimize side effects , by lowering the level to preserve sympathetic tone in place of upper t2 sympathicotomy or multilevel sympathicotomy . selective sympathicotomy is an effective surgical method to eliminate compensatory sweating in the treatment of hyperhidrosis . although compensatory sweating remains the main secondary effect , numerous studies have reported that sympathicotomy is a safe and effective procedure for the management of hyperhidrosis and reduction of compensatory sweating . the frequency and severity of compensatory sweating were reduced , with less interruption of sympathetic trunk in group t4 compared to group t3 ( table 2 ) . this explains the differences at the other levels in sympathicotomy at palmar sweating and compensatory sweating are still controversial topic . lin et al . suggested that postoperative results including compensatory sweating is influenced by changes in the sympathetic tone and disturbance of the reflex arc in the hypothalamus secondary to the procedures of the upper thoracic sympathetic system . furthermore , anatomical variation , a mistake at the level of interruption , and incomplete resection of the sympathetic trunk may also cause compensatory sweating . the high personal expectations of patients could be the reason of dissatisfaction despite the development of minor complications . difference in surgical technique , such as sympathicotomy level and surgical procedure ( clamp , cut and resect ) , and classification of the extent of compensatory sweating could impact on the complication rate . many authors felt that the more sympathetic segments excised , particularly including t2 , the greater the incidence of severe compensatory symptoms . dewey et al . limited the extent of resection for hyperhidrosis to a single level , and found reduction in the incidence of severe compensatory symptoms . however , until now , no prospective study has been performed to compare r3 and r4 single level sympathicotomy for the treatment of palmar and axillary hyperhidrosis . in this study , patients did not experience discomfort in their daily activities . these results suggest that , compared to r3 sympathicotomy , r4 sympathicotomy decreases the extent of side effects but does not compromise efficacy . as such , it should be the method of choice for the treatment of palmar and axillary hyperhidrosis . r3 and r4 have similar success rates in the treatment of palmar and axillary hyperhidrosis .
backgroundvideo - assisted thoracic sympathicotomy plays an important for the treatment of essential hyperhidrosis . patients are usually satisfied with the surgical outcome at the early post - operative period , but suffer recurrence and compensatory sweating in the late post - operative period . there are many sympathicotomy methods to minimize recurrence and compensatory sweating . we compared the outcome of sympathicotomy methods above the third rib ( r3 ) and the fourth rib ( r4 ) with regards to symptoms , satisfaction , recurrence , and compensatory palmar and axillary hyperhydrosis.materials and methodsfrom january 1999 to april 2009 , 39 cases of thoracoscopic sympathicotomy at the third rib ( r3 ) , and 94 cases of thoracoscopic sympathicotomy at the fourth rib ( r4 ) for palmar and axillary hyperhidrosis were compared for early and late post - operative satisfaction , compensatory sweating and recurrence.resultsthere was no sex or age difference between groups . early satisfaction was 94.9% and 98.9% in the r3 group and r4 group , respectively . there was no difference in early satisfaction ( 94.9% in r3 and 98.9% in r4 ) , late satisfaction ( 84.6% in r3 and 89.4% in r4 ) , or recurrence ( 17.9% in r3 and 17.0% in r4 ) between groups . there was significant difference in compensatory sweating ( 71.8% in r3 and 33% in r4 , p=0.002).conclusionr4 sympathicotomy demonstrated superior efficacy in the treatment of compensatory sweating compared to r3 in palmar and/or axillary hyperhidrosis .
the generation of reactive oxygen species ( ros ) and subsequent oxidative modification of biomolecules , such as lipids , proteins , and nucleic acids , are inevitable in aerobic organisms . an excessive amount of ros has been implicated in a variety of pathological events such as atherosclerosis , ischemia - reperfusion injury , cardiovascular diseases , and neurodegenerative diseases . oxidative stress was defined as a disturbance in the prooxidant - antioxidant balance in favor of the former . above all , lipid peroxidation has received much attention and has been accepted to cause disturbance of fine structure and functional loss of biological membranes and to produce some toxic products . phosphatidylcholine hydroperoxide is the primary product of lipid peroxidation , which undergoes non - enzymatic reactions , leading to the formation of 4-hydroxynonenal ( hne ) and malondialdehyde , secondary products of lipid peroxidation [ 3 , 4 ] . alternatively , the lipid hydroperoxides , especially linoleic acid hydroperoxide , can be also oxidized enzymatically by some peroxygenases and reductases into hydroxyoctadecadienoic acids [ 5 , 6 ] . lysophosphatidylcholine ( lysopc ) is generated from phosphatidylcholine during oxidative modification of low density lipoprotein ( ldl ) , which is known as a key event in atherogenesis . oxysterols are defined as oxygenated derivatives of cholesterol that may be formed directly by autoxidation or by the action of a specific monooxygenase . it is widely accepted that all these lipid peroxidation products mentioned above could induce oxidative stress and be involved in the pathogenesis of a number of degenerative diseases [ 911 ] . however , recent studies have revealed that low levels of ros and lipid oxidation products may play essential roles in the cell signal transduction [ 12 , 13 ] and can induce adaptive response [ 1420 ] . in another word , the low level stress may stimulate defense network and acts as a good stress , eustress [ 2123 ] . in addition to these chemical or biochemical molecules , physical forces such as pressure and shear stress act as stress inducer ( oxidative stress inducer ) to cells . since cells respond to oxidative stress via expression of genes , the transcriptome analysis using dna microarray provides a useful data to determine a large spectrum of changes associated with stress in cells . atherosclerosis , leading to coronary heart disease and stroke is the most common cause of death in industrialized nations . it has been suggested that oxidative modification of ldl is a key initial event in the development of atherosclerosis . a wide variety of oxidized lipids and oxidized ldl ( oxldl ) itself have been detected in atherosclerotic lesions . the esterified fatty acids of phosphatidylcholine and cholesteryl ester are oxidized enzymatically and non - enzymatically in vitro to yield lipid hydroperoxides as primary products , followed by secondary reactions to form lipid hydroxides and aldehydes such as malondialdehyde , acrolein and hne . acrolein and hne are known to be highly reactive and to form adducts with proteins and nucleic acids . in particular , many studies have shown that hne regulates cell - signaling pathways through activation protein 1 ( ap-1 ) [ 2729 ] . hne is also known to act as an electrophile resulting in activation of transcription factor , nf - e2 related factor 2 ( nrf2 ) by releasing it from kelch - like ech - associated protein-1 ( keap-1 ) [ 30 , 31 ] . oxidized pc is more susceptible than pc itself for the reaction of phospholipase a2 to give lysopc which is present at high concentration in oxldl . lysopc is known to induce adhesion molecules expression in endothelial cell [ 3335 ] and cytokines by monocytic cells . cholesterol is also oxidized to give several classes of oxysterols : 7-ketocholesterol ( 7-keto ) , which induces monocyte differentiation and promote foam cell formation ; 22(r)-hydroxycholesterol ( 22-roh ) , which is a ligand for the liver x receptor and regulates the expression of genes involved in cholesterol and fatty acid homeostasis ; and 25-hydroxycholesterol ( 25-oh ) , which regulates cholesterol synthesis via the sterol regulatory element - binding protein ( srebp)/srebp cleavage activating protein regulatory pathway . the technology of dna microarray provides a useful tool to determine a large spectrum of responses of cells treated with each lipid peroxidation product and oxldl . we carried out large - scale gene expression analysis using human endothelial cell exposed to oxldl and lipid peroxidation products such as lysopc , hne , 7-keto , 22-roh and 25-oh . all results of clustering analysis are shown in figure 1 , which suggest the properties of oxldl - regulating gene expression in endothelial cell and lipid components responsible for oxldl - induced gene expression . human umbilical vein endothelial cells ( huvec ) were treated with 200 g / ml native ldl , 200 g / ml oxldl , 10 mol / l 7-keto , 10 mol / l 22-roh , 10 mol / l hne for 1(n = 1 ) , 4 ( n = 3 ) , and 8 h ( n = 3 only for oxldl ) . genes represented in red color and green color are up - regulated and down - regulated , respectively . the 270 genes were classified into 5 clusters basically , a : decreased by oxldl and/or lipid peroxidation products in oxldl ; b : increased by oxldl and lipid peroxidation products ; c : increased by oxldl and hne ; d : increased by lysopc ; e : increased by lysopc but decreased by oxldl and/or oxysterols . in this review , the cluster c containing genes up - regulated by oxldl and hne is focused on since this cluster provides a hint leading us to an idea of adaptive response of cells . more than 40 % genes in cluster c is regulated by nrf2 ( * in table 1 ) . hne acts as an electrophile with its carbonyl group and oxidizes keap-1 to release nrf2 resulting in expression of nrf-2 regulating genes . although the concentration of free hne in oxldl used in this study ( 0.5 m ) , was much smaller than that of hne added directly into medium ( 5 m ) , oxldl reproduced induction of all genes induced by hne . oxldl is capable of eliciting ros generation and enhance lipid peroxidation and the secondary oxidation products such as acrolein as well as hne and ros might oxidize keap-1 to release nrf2 . hne and oxldl activate cyclooxygenase resulting in production of 15-deoxy - delta12,14-prostaglandin j2 which is known to enhance release of nrf2 from keap-1 . hne is one of the major end products of lipid peroxidation , and has been found to induce oxidative stress , involving in the pathogenesis of a number of degenerative diseases such as alzheimer s disease , atherosclerosis , cataract , and cancer . however , increasing evidence has suggested that hne at low concentrations takes an important role in cell signal transduction and gene expression [ 4752 ] . hne can react in michael additions across its carbon - carbon double bond with a wide variety of cellular components , including dna and proteins . thus , it has been suggested that hne could act as a potential activator of nrf2 and induce the expression of phase ii detoxification enzymes [ 5354 ] . we have recently found that stimulation with sublethal concentrations of hne can induce adaptive response and protect neural pc12 cells against the subsequent oxidative stress [ 21 , 22 ] . there are mainly two cytoprotective systems against oxidative stress named glutathione system and thioredoxin system in cell ( fig . 2 ) . interestingly , both glutathione reductase ( gr ) and thioredoxin reductase ( tr ) which are a member of glutathione system and thioredoxin system , respectively , are listed in table 1 . we then attempted to seek for the underlying molecular mechanisms responsible for such an adaptive response in pc12 cells . the cellular antioxidative glutathione system , including cellular glutathione peroxidase , glutathione s - transferase , gr and total glutathione contents , did not show any considerable changes in cells treated with hne for 24 h. in contrast , mrna levels and activity of thioredoxin reductase-1 ( tr1 ) were significantly elevated by the treatment with sublethal concentrations of hne . furthermore , critical roles of tr1 in adaptive response in pc12 cells were confirmed by sirna transfection . in fact , the data provided by dna microarray analysis of gene expression induced by hne in huvec encouraged us to investigate roles of tr1 in pc12 ( table 1 ) . vascular endothelial cells are constantly subjected to the shear stress imposed upon them by blood flow . atherosclerotic lesions are likely to develop focally at bifurcations and branch points in the vessel [ 55 , 56 ] . it has been reported that the most vulnerable regions are exposed to non - unidirectional , disturbed or oscillatory flow and that atherosclerosis resistant regions are exposed to unidirectional laminar flow [ 55 , 57 ] . to investigate the response of endothelial cells upon exposure to shear stress , many studies have been performed under a variety of experimental conditions with various flow - exposing apparatus . many of these studies have focused on the expression of vascular cell adhesion molecule-1 ( vcam-1 ) , since vcam-1 has been accepted as a good marker for the endothelial phenotype in atherosclerosis - prone regions [ 5861 ] . endothelial cells express vcam-1 upon exposure to non - unidirectional flow , that is , oscillatory flow at a low shear stress ( + / 5 dyn / cm , mean time - averaged shear stress of 0.2 dyn / cm ) . in contrast , endothelial cells exposure to unidirectional steady flow at high shear stress ( > 10 dyn / cm ) do not express vcam-1 or even suppress it . to explore candidates responsible for anti - atherogenicity of laminar shear stress , we performed dna microarray analysis after exposure of huvec to laminar shear stress ( mean shear stress < 0.2 dyn / cm ) . in response to laminar shear stress , nrf-2- dependent genes such as heme oxygenase-1 ( ho-1 ) , sequestsome 1 ( sqstm1 ) , solute carrier family number 7 a 11 ( slc7a11 ) ( or xct ) , tr1 , glutamate cysteine ligase modifier ( gclm ) , nad(p)h dehydrogenase , quinone-1 ( nqo-1 ) , and tripartite motif - containing 16 ( trim16 ) were significantly induced ( * in table 2 ) . the high similarity of gene expression induced by laminar shear stress to that induced by hne give a rise of a hypothesis in which electrophiles such as hne might be generated in cells upon exposure to shear stress ( fig . further studies suggest that shear stress stabilizes nrf2 protein via the lipid peroxidation elicited by xanthine oxidase and flavoprotein ( nadph oxidase , etc . ) mediated generation of superoxide , resulting in lipid peroxidation and gene induction by the nrf2-are ( antioxidant response element ) signaling pathway .
although lipid peroxidation products have been implicated in oxidative stress - related diseases , pretreatment of cells with such compounds at sublethal concentrations shows significant cytoprotective effects against forthcoming oxidative stress . the adaptive response induced by 4-hydroxynonenal ( hne ) is critically mediated by gene expression of cytoprotective proteins via nf - e2-related factor 2/kelch - like - ech - associated protein 1 ( nrf2/keap-1 ) pathway . the physical or mechanical stimuli such as shear stress also impose adaptive responses by inducing gene expression . laminar shear stress , anti - atherogenic shear stress activates nrf2/keap-1 pathway . the transcriptome analysis using dna microarray reveal high similarity in gene expression profiles of cells treated with hne and laminar shear stress , providing insight into molecular mechanisms . these findings suggest a general hormetic effect of diverse stimuli in cell cultures and may lead to a reappraisal of the eventual role of reactive oxygen species and lipid peroxidation in organisms .
the us centers for disease control and prevention ( cdc ; atlanta , ga ) reported 1651 cases of human foodborne listeriosis from listeria monocytogenes ( lm ) which occurred from 2009 to 2011 , with a case - fatality rate of 21% . nevertheless , the us department of agriculture food safety and inspection service ( usda - fsis ) has reported a decline in the prevalence of lm in ready - to - eat ( rte ) meat and poultry products ( including deli products ) collected through its sampling program , from 4.61% in 1990 to 0.27% in 2011 . the usda has also recently provided guidance for the control of lm growth on rte meats , including the proper application of antimicrobial agents ( aas ) in the manufacturing of deli products . antimicrobial hurdles consist of a combination of several processes and/or interventions that result in a growth - limiting impact on pathogenic bacteria . commercial aas may contribute to the hurdles by reducing the water activity ( aw ) of foods , lowering product ph , redox potential modulation , or combination of these and other processes [ 35 ] . organic acids and their salts applied to rte deli products either in the product formula or to the product 's surface postlethality and are known to possess lm growth - inhibiting capabilities . islam et al . tested the ability of organic acid marinades applied to turkey frankfurters as postcook dips to reduce lm growth , reporting reductions of 1.0 to 2.0 log10-cycles compared to nontreated controls . evaluated the addition of organic acid marinades to turkey deli loaf formulae and found the lm lag phase was extended through 56 days on slices treated with a 3.0% sodium lactate and 0.25% sodium diacetate combination . porto et al . concluded that incorporation of potassium lactate ( pl ) into vacuum - sealed frankfurters stored at 4c and 10c provided listeriostatic effects , extending the lag phase for the duration of the study ( 90 and 60 days , resp . ) nuez de gonzalez et al . reported an overall growth inhibition of 2.0 log10 cfu / frank in lm counts on beef frankfurters formulated without or with 3.3% pl , and surface dip - treated with potassium lactate ( 3.3% ) or lactic acid ( 3.4% ) over 12 wk refrigerated storage . . found that growth was inhibited in frankfurters formulated with lactate and diacetate and then treated with lactic or acetic acid postcook dips . antilisterial properties of differing organic acids and their salts can be affected by processing methodology and product formulae . in addition , despite the establishment of the usda 's zero tolerance policy for lm on rte foods and consequent decline in the prevalence of the pathogen on rte products , l. monocytogenes remains a persistent contaminant on rte deli products with high severity [ 2 , 9 ] . the objective of this study was to evaluate the effect on an isolate of lm scott a growth caused by sodium lactate ( sl ) , potassium lactate ( pl ) , sodium citrate ( sc ) , and sodium diacetate ( sda ) , applied individually or in combination ( sl / sda , sl / pl / sda ) as postcook dips to inoculated turkey deli loaf slices . l. monocytogenes scott a , obtained from the auburn university ( auburn , al ) frozen culture collection , was stored in 1.5 ml microcentrifuge tubes ( vwr int . , west chester , pa , usa ) at 80c prior to revival . to revive the organism , 1.0 ml of frozen culture was pipetted into 9.0 ml sterile brain heart infusion ( bhi ) broth ( oxoid , basingstoke / hampshire , england ) and incubated overnight at 37c . turbid cultures were transferred to virgin bhi medium and subculturing was repeated in identical fashion . five 1 : 10 serial dilutions were prepared into tubes containing 9.0 ml sterile phosphate buffered saline ( pbs ) ( pierce perbio thermo scientific , bonn , germany ) . to determine the growth of lm scott a following subculturing , dilutions were plated in duplicate on 15 100 mm petri plates containing bhi agar ( difco , lawrence , ks , usa ) , followed by overnight incubation at 37c . the incubated plates were enumerated with photographic colorcount recognition technology using the q count instrument ( spiral biotech , norwood , ma , usa ) . streptomycin resistance ( strep ) was induced through exposure of the organism to antibiotic in medium . l. monocytogenes scott a cells were gradually exposed to increasing concentrations of streptomycin in bhi broth and bhi agar according to previous procedures . a stock solution was prepared by mixing streptomycin sulfate ( sigma - aldrich co. , st . louis , mo , usa ) in sterile distilled water with stirring and gentle heating when necessary . the solution was filter sterilized into 250 ml bottles ( pyrex , lowell , ma , usa ) using a 60 ml syringe filter ( 0.2 m pore diameter ) ( vwr int . ) . this then was added to sterilized medium in a laminar flow hood to the desired exposure concentration . pending survival at the initial exposure concentrations ( 0.2 , 1.6 , 6.4 , and 12.8 g / ml ) antibiotic concentration applied in broth and agar was systematically doubled to increase lm resistance , until a maximal resistance of 1,500 g / ml was obtained . desired cultures were subsequently frozen in sterile 1.5 ml microcentrifuge tubes and stored at 80c until required for use . the strains were initially incubated in 10 ml of bhi broth with 10% glycerol solution at 37c . from this , 300 l was added to a 700 l volume of glycerol in microcentrifuge tubes and vortexed prior to freezing . a sample of each strain was subsequently thawed and cultured to determine bacterial survival following the procedure . strep cultures were grown on bhi slants and submitted for identification by the usda - agricultural research service ( ars ; athens , ga , usa ) . cultures were streaked on modified oxford 's ( mox ) agar ( remel , lenexa , ks , usa ) for cultivation of characteristic small - black colonies . a sterile loop was used to collect 5 to 10 colonies for -hemolysis identification on horse blood overlay plates . at least two colonies were collected from hemolysis - positive plates for confirmatory testing including gram - stain , camp test , rhamnose utilization , catalase reaction , and tumbling motility under wet mount . turkey lobe meat ( patuxent farms , columbia , md , usa ) was ground ( 20% ) using a waring grinder ( waring products , inc . , torrington , ct , usa ) while the remaining meat ( 80% ) was hand - sectioned into 1.0 in cubes . deli product formulation incorporated noniodized refined salt ( 1.5% ; morton , chicago , il , usa ) and sodium tripolyphosphate ( stp ; 0.45% , innophos , cranbury , nj , usa ) in a 20% marinade ( 7 : 3 water : ice ratio ) of the final batch weight . marinade was prepared using a handheld biohomogenizer ( esge m13333 - 1281-o , bartlesville , ok , usa ) until all ingredients were dissolved and incorporated through vacuum tumbling ( hollymatic corp . , countryside , il , usa ) for 1 h at 25 mm hg , 14 rpm , at 4c . this was followed by equilibration at 4c for 3 h. all meat used was maintained at 4c through transport and processing . the marinated turkey batter was manually stuffed into 10.16 cm diameter fibrous cellulose casing ( ez peel fibrous casing , viskase companies , inc . , willowbrook , il , usa ) by hand crank manual stuffer ( koch , kansas city , mo , usa ) ; each loaf was approximately 63.5 cm in length . loaves were trucked into a single truck smokehouse ( alkar , lodi , wi , usa ) and cooked according to a stepped processing schedule ( table 1 ) . loaves were then removed and chilled overnight to an internal temperature of ~4c . a turkey loaf was hand peeled and sliced into ~2 mm slices ( 9512 12 max manual meat slicer , univex corp . , salem , nh ) ; the blade was calibrated by caliper and sanitized with 70% ( v / v ) ethanol before being used again ( marathon watch co. , ontario , canada ) . ten slices were individually weighed and averaged to obtain an approximate slice weight to be used in later calculations . slices were collected onto a table lined with sterile foil prior to inoculation and treatment with different postcook antimicrobial dips . the lm scott a culture was passed at least three times before inoculation to allow for revival as described above . the lm scott a stock was decimally diluted from inoculated bhi broth into the necessary sterile test tube containing 9.0 ml sterile pbs to generate countable plates ( 25250 cfu ) . each dilution was spread in duplicate on 15 100 mm petri plates containing bhi agar and incubated overnight at 37c . the incubated plates were enumerated with a photographic colorcount recognition technology using the q count instrument ( spiral biotech ) . each slice ( n = 3 ) was inoculated with 0.1 ml stock culture using 10 l aliquots . disposable , sterile 10 l volume inoculating loops ( vwr int . ) were used to spread inoculum across the surfaces of meat slices . transfer of slices to segregated stations was conducted using ethanol / flame - sterilized forceps . organic acid treatments applied individually and in combination to the lm scott a - inoculated slices were ( 1 ) sodium lactate ( sl ; 3.6% , fisher scientific , pittsburgh , pa ) ; ( 2 ) potassium lactate ( pl ; 3.6% , city chemicals , west haven , ct ) ; ( 3 ) sodium citrate ( sc ; 0.75% , fisher scientific ) ; ( 4 ) sodium lactate ( sl ; 3.6% ) + sodium diacetate ( sda ; 0.25% , spectrum chemical manufacturing corp . , gardena , ca ) ; ( 5 ) sl ( 3.6% ) + pl ( 3.6% ) + sda ( 0.25% ) ; ( 6 ) positive control ( lm - inoculated slices dipped in sterile distilled water ) ; and ( 7 ) negative control ( noninoculated slices dipped in sterile distilled water ) . slices were dipped in 100 ml freshly prepared solution for 1.0 min and removed with sterile forceps for drying on sterile foil - lined drying racks . excess dip fluid was allowed to dry for at least 10 min with intermediate flipping of the slices . dry slices were packaged in groups of three , by treatment , using 24 oz . whirlpak bags ( nasco , fort atkinson , wi ) and stored at ~4c until their appropriate sampling times were reached . slices were stored aerobically due to nonavailability of biosafety level 2 ( bsl2)-compliant vacuum sealing technology in the research pilot plant laboratory . three slices were allocated to each of 7 time points per each of the 5 treatments , totaling 105 slices per replicate ; two additional slices per time point were allotted for a positive and negative control , providing an additional 28 slices . packaged slices were removed from refrigerated storage for sampling on days 0 , 7 , 14 , 21 , 28 , 42 , and 56 . each bag was filled with 50 ml sterile pbs and homogenized using a stomacher 400 circulator ( seward , west sussex , uk ) for 2 min at 245 rpm . decimal dilutions were prepared prior to inoculation onto streptomycin - loaded ( 1,500 g / ml ) bhi agar - containing petri plates . the average slice weight was considered with 50 ml pbs added to create the first dilution . the log10/g average plate counts from each of three inoculated slices treated in identical fashion with one of the 7 treatments at each of the seven sample points ( 0 , 7 , 14 , 21 , 28 , 42 , and 56 days ) over three identically completed replicates ( n = 3 ) were subjected to statistical analysis using the proc glm procedure of sas v11.0 ( sas institute , inc . , separation of statistically differing means was carried out within a sampling period across treatments using duncan 's multiple ranges test at = 0.05 . the potential for lm scott a survival on food processing machinery , environmental niches , and fixtures from processing facilities is of great concern as cross - contamination of deli products can occur during postlethality handling . the use of postlethality antimicrobial dips could provide a barrier in the control for l. monocytogenes growth inhibition . the inhibition of lm scott a on uncured turkey loaf slices by postcook organic acid dips is depicted in figure 1 . combination treatments of sl / sda and sl / pl / sda suppressed lm scott a cell growth postprocessing ( 21 and 42 d , resp . ) on turkey deli loaf slices compared to the other treatments on those sampling days ( p < 0.05 ) . sl and pl treatments ( p < 0.05 ) inhibited growth at day 7 when compared to the pathogen - inoculated positive control and the sc - treated slices . however , at 28 days ' refrigerated storage no differences were observed between the control and the sc treatment . throughout the experimental period , lm scott a counts on sc - treated product did not differ from the inoculated positive control on any sampling day ( p 0.05 ) ( figure 1 ) . overall , combination of sl ( 3.6% ) plus sda ( 0.25% ) or sl ( 3.6% ) + pl ( 3.6% ) + sda ( 0.25% ) demonstrated inhibition of lm scott a growth on post - dipping refrigerated turkey deli slices over 56 days ' storage . antimicrobial activity of weak organic acids , including lactate , citrate , and acetate , is generally attributed to penetration of the undissociated acid molecule through the cell membrane , with resulting acidification of the cytoplasmic space and activation of active processes to reestablish internal ph homeostasis . weak organic acids such as lactic and citric acid are favored for intracellular permeability due to inherent hydrophobicity and the resulting interactions with the cellular lipid bilayer . this may result in cell damage , death , or exhaustion due to expenditure of energy and resources to exclude the acid . additionally , lactic acid has been reported to permeabilize the outer membrane of some gram - negative organisms , and multiple weak organic acids are reported to exert antimicrobial activity in the form of dna degradation or ribosomal attack via the dissociated acid anion once the cytoplasm is reached [ 15 , 16 ] . extensive published research supports organic acids and their salts as effective aas in poultry deli product formulae . however , knowledge of these aas as postcook dip solution ingredients and their effects on lm in poultry deli meat slices is not as extensive [ 8 , 13 , 1720 ] . simulated in - plant cross - contamination and found that combinations of commercial lactate ( 1.5% ) and diacetate ( 0.05% ) formulated into uncured turkey breast reduced lm growth rates compared to untreated turkey breast over 12 d of storage at 7c . carroll et al . found a combination treatment of 3% sl and 0.75% sda applied to inoculated , vacuum - packaged turkey deli slices extended the lag phase of lm through 63 d of storage at 4c . the combined application of 2.0% sl + 0.25% sda via edible coatings on fully cooked turkey breast stored at freezing resulted in enhanced reduction in lm numbers versus coatings formulated with sl or sda alone . collectively , combined application of lactate and diacetate solutions produces a greater antilisterial effect on fully cooked poultry deli products subject to alternatives 1 or 2a of title 9 of the us code of federal regulations ( cfr ) 430 . noted that combination treatments of 0.25% sl with 0.25% sa , sda , or glucono--lactone applied to frankfurters extended the lm lag phase throughout 120 d at refrigerated storage . similarly , palumbo and williams reported that inoculated , vacuum packaged frankfurters treated with a combination of 2.5% citric acid and 2.5% acetic acid dip suppressed lm growth over 85 d at refrigerated ( 5c ) storage . l. monocytogenes isolates are reported to vary in their sensitivity to antimicrobial exposure , including exposure to organic acids . brandt et al . reported lm scott a exhibited greatest sensitivity to nisin with a minimum inhibitory concentration approximately half that of other isolates tested . similarly , cheng et al . reported that lm m7 , an avirulent isolate , demonstrated significantly slower growth and in some instances failed to grow and replicate in liquid medium infused with acetate or lactate to ph 5.5 . authors hypothesized that deletion of a sigma factor in the avirulent m7 lm isolate was responsible for loss of ph homeostasis maintenance capacity and survival in acid - infused medium . the isolate used in the current study was not subjected to genome recombination procedures to weaken its capacity to tolerate tested organic acids , although its inhibition may not be identical to all lm isolates , particularly in situations where acid tolerance is increased via prior sublethal organic acid exposure . fsis regulations for processing facilities producing rte deli products require the development of interventions producing l. monocytogenes control measures in haccp , ssop , and/or other prerequisite programming systems . organic acid combinations ( sl + sda or sl + pl + sda ) applied in postlethality dips inhibited the growth of l. monocytogenes scott a on rte deli turkey slices and can be applied as part of a multihurdle food safety system to extend the inhibition the growth of l. monocytogenes scott a in sliced turkey deli products packed and held at refrigeration temperatures . these data can provide supporting information within a listeria control plan for products manufactured under alternatives 1 or 2b when developing postlethality interventions for processors of aerobically packed rte deli products .
this study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of listeria monocytogenes ( lm ) scott a. treatments consisted of sodium lactate ( sl ; 3.6% ) , potassium lactate ( pl ; 3.6% ) , sodium citrate ( sc ; 0.75% ) , a combination of sl and sodium diacetate ( sda ; 0.25% ) , and a combination of sl / pl / sda , alongside appropriate negative and positive controls . products were inoculated with 104105 cfu / ml streptomycin - resistant ( 1500 g / ml ) lm scott a prior to treatment . products were then stored at ~4c and sampled at 0 , 7 , 14 , 21 , 28 , 42 , and 56 d. the sl / sda combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage . numbers of lm scott a rose by 0.7 log10 cfu / g through the 56 d storage period . the application of the sl / pl / sda treatment to turkey product surfaces extended the lag phase through 42 d , with pathogen numbers declining after 21 d. combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for lm control on postlethality exposed sliced deli products .
since its invention in 1973 , x - ray computed tomography ( ct ) has revolutionized medical imaging and become a cornerstone of modern radiology . improving resolution and reducing dose are two critical factors in biomedical applications and remain the focuses of ct research . with the emergence of multislice spiral ct in 1998 , cone - beam scanning is recognized as a major mode for medical ct and widely used in numerous diagnostic and therapeutic procedures . moreover , the rapid development of small animal models , especially those with genetically engineered mice [ 24 ] , has generated the need for preclinical imaging , reaching image resolution in the micron range . these scanners , while producing high spatial resolution images , do not allow high contrast and low dose imaging in either patients or animal models . for example , many normal and diseased tissues such as cancers display poor image contrast in current x - ray images as they have very similar attenuation characteristics . x - ray mammography is currently the most prevalent imaging modality for screening and diagnosis of breast cancers . however , a multi - institutional trial funded by the american college of radiology imaging network ( acrin ) suggested that ~30% of cancers were not detected by screening mammography , and 70%90% of biopsies performed based on suspicious mammograms were negative [ 6 , 7 ] . some false negative and false positive diagnoses often led to missed cancers and inappropriate biopsies . the key factor that limits the success rate is the poor contrast between healthy and diseased tissues in the mammogram . although x - ray ct of the breast can potentially improve diagnostic accuracy over mammography [ 810 ] , the state - of - the - art breast ct scanner is still based on the attenuation mechanism . as a result , the use of breast ct requires an intravenous contrast medium and a high radiation dose , since elemental composition is almost uniform with little density variation in breast tissues . still , it is rather difficult for breast ct to discern early - stage breast cancers [ 1113 ] . driven by major practical needs for better x - ray imaging , exploration into contrast mechanisms other than attenuation has been active for decades , especially in terms of small - angle scattering ( essentially , rayleigh scattering ) [ 1417 ] and refraction of x - rays [ 1719 ] , which are also known as dark - field and phase - contrast imaging , respectively . up to now , x - ray rayleigh scattering - based imaging has been limited to in vitro studies , incapable of volumetric cone - beam scanning , lack of rigorous reconstruction theory , and made little progress into clinical practice . since 2006 , grating - based x - ray dark - field and phase - contrast tomography is being developed using a hospital - grade x - ray tube , instead of a synchrotron facility or microfocus tube . this technology utilizes the optical interference principles to yield high - quality dark - field images . the boundaries and interfaces in the biological tissues produce strong signals in dark - field images , indicating detailed structural contours . moreover , dark - field images have greater signal - to - noise ratios in soft tissues than bright - field counterparts acquired with the same incident x - ray dose . however , the major problems with this grating - based approach are small sample size , long imaging time , and high fabrication cost . in this paper , we present a varying collimation scheme to extract dark - field signals . the key idea is to acquire x - ray projection data multiple times with varying collimation . in the following section , we describe the principles of our dark - field detection method . in the third section , we present our initial simulation results to show the feasibility of our methodology . in the last section , the trick of the varying collimation scheme is to acquire each x - ray sum twice with different collimation aspect ratios . the projection data acquired with a collimator of a sufficiently large aspect ratio contain little scattering , while the corresponding data acquired with the collimator of an appropriately reduced aspect ratio include both small - angle scattering and primary signals . then , analysis of these paired datasets will produce desirable dark - field signals , in addition to traditional transmission measurement . conventionally , an antiscattering grid is coupled with an area detector to eliminate x - ray scattering photons . the intensity of scattered radiation into a detector cell is determined by the height of the antiscattering grid . the lower the height of the antiscattering grid is , the more the scattered photons enter the detector cell . the height of the antiscattering grid is typically selected to reject scattered photons as much as feasible subject to the cost associated with the fabrication process . in our approach , depending on a specific imaging application we can choose a height of the antiscattering grid appropriately so that only the primary and small - angle scattering signals are intercepted . then , we can increase the height of the antiscattering grid significantly so that small - angle scattering signals are also rejected to acquire essentially only the transmission data . hence , the difference between ps and pt should be closely correlated to the desirable small - angle scattering signals . it is underlined that our varying collimation approach does not necessarily require two pass scans with different collimation aspect ratios . for example , as shown in figure 1 , for a circular cone - beam full - scan we can use a dual - height collimator in front of a 2d detector array . in this setting , on the mid - plane each pixel on a given line is irradiated by two and only two x - rays along that same line but with two different collimation heights in the opposite directions respectively , sufficient for extraction of dark - field signals . the small - angel and large - angle scattering signals come essentially from the coherent scattering ( rayleigh scattering ) and incoherent scattering ( compton scattering ) mechanisms , respectively . compton scattering describes the interaction of a photon with an electron in an outer shell of an atom . while the electron is ejected , the x - ray photon is deflected from its original path . the probability for an incoming photon with energy e being scattered in an direction can be described by the klein - nishina formula ( 1)pc()=re22(1+cos 2+2(1cos )21+(1cos ))1(1+(1cos ))2 , where = e/mec , me is the electron mass , c the speed of light , and re the classical radius of electron . the differential cross - section of rayleigh scattering is as follows : ( 2)pr()=re22(1+cos 2)f2(,e,z ) , where f( , e , z ) is the atomic form factor . since the form factor is highly complex , most x - ray monte carlo simulators use a database to store the form factor data . it is desirable and feasible to use a simple function to approximate the form factor as f( , e , z ) = c1e . the combined differential cross - section per atom can be expressed as ( 3)p()=pr()+nepc( ) , where ne is the number of free electrons in the atom . let us define the scattering - induced linear attenuation coefficient as ( 4)s=2ns0dp()=nss , where ns indicates the number density of scatter atoms , and s = 20dp( ) the total scatter cross - section . the total rayleigh probability can be defined as = r/s , where r = 20dpr( ) . for a proof of concept , first we used a single scattering model in 3d to demonstrate our varying collimation technology . although the single scattering model represents the simplest x - ray scattering scenario , it is sufficient as the initial pilot study . as shown in figure 2 , the x - ray scattering intensity into a detector cell can be expressed as : ( 6)f(h)=12dzdydxi0win(x , y , z)wout(x , y , z)s(x , y , z ) 12d12d p( ) , where ( 1/2)1d1dp( ) is the probability that a scattered photon hits a target detector pixel , i0 the source intensity , win(x , y , z ) the source attenuation factor , wout(x , y , z ) the scattering signal attenuation factor which also depends on the location of the detector cell , and s(x , y , z ) the scattering coefficient . in figure 2 , p( ) represents a symmetry distribution around the incoming direction of a photon . hence , when computing the differential solid angle extended by an arbitrary detector cell we can always rotate the detector cell such that its center is on the x - z plane as an approximation ( which is equivalent to assuming the rotational invariance of each collimator unit ) . generally speaking , we can use the following limits to compute this probability approximately : ( 7 ) 1=arctan(rd/2rh ) , 2=arctan(r+d/2r),1=arctan(d/2r ) , 2=arctan(d/2r ) , where h is the grid height , d the aperture of the detector cell , and r the distance from a scattering location to the detector cell . note that the scattering behavior ( 1/2)1d1dp( ) can be analytically computed , numerically estimated , or statistically simulated . recently , we developed a tetrahedron - based inhomogeneous monte carlo optical simulator ( tim - os ) for optical light propagation in complex biological tissues . tim - os can move particles efficiently in a complex geometry represented by a tetrahedral mesh . since we achieved a great speedup in optical simulation , we migrated the tim - os framework for x - ray simulation as well . x - ray and matter interaction is very complex in general . in this prototype mc x - ray simulator , a simplified x - ray - matter interaction model was considered to cover the three major components in dark - field imaging : photoelectric effect ( absorption ) , rayleigh scattering , and compton scattering . we used three parameters to describe the x - ray - matter interaction : absorption coefficient ( t ) , scattering coefficient ( s ) , and rayleigh percentage ( ) . the definition of absorption coefficient is the probability of x - ray absorption per unit path length . the scattering coefficient is the probability of an x - ray photon involved in scattering ( rayleigh or compton scattering ) per unit path length . after an x - ray photon is launched , a routine will be followed to find out the entering point of the photon into the phantom . while the photon is in the phantom , a step size will be generated based on the local absorption and scattering coefficients as s = ln ( )/(t + s ) , where is a uniform random number from ( 0,1 ] . if this photon needs to go across several different regions , the total step size s = isi is governing by the following equation : i(t_i + s_i)si = ln ( ) . after the photon moves the free fly step , the photon will be absorbed or scattered based on the ratio of the absorption coefficient and scattering coefficient . if the photon is absorbed , the program will launch a new photon ; otherwise , the photon is scattered . according to , the photon scattering will be governed by either the rayleigh or compton mechanism . then , the photon will be assigned another step size based on the current local parameters . voxel - based and surface - based schemes are two popular techniques employed in x - ray simulation to deal with a complex geometry [ 25 , 26 ] . the surface - based scheme uses a triangle mesh to represent the interface between two regions and the surface . in this case , a simulation program needs to determine whether the involved photon moment will hit a triangle for each step . given a complex geometry , the computation of photon - triangle interaction could be very slow . this may introduce a huge computational overhead when a high - resolution volumetric image is used . the key idea underlying our tetrahedron - based scheme is that by modeling an object as a tetrahedron - based finite element mesh , tim - os can specify the photon - triangle interaction rapidly and recursively . in other words , since a photon starts its movement inside a tetrahedron , the ray - triangle interaction would only happen with one of the four triangles of that tetrahedron , reducing the searching space significantly . in this section , we will use monte carlo simulation to verify the varying collimation scheme and compare the single scatter method with monte carlo simulation result . a 10 10 5 cm phantom with four 1 cm cubic subregions was used in this study . furthermore , the four cubic subregions were made of the same attenuation coefficient as water but with different scattering behaviors . based on , at 50 kev water 's total attenuation coefficient is 0.21(cm ) . in the attenuation coefficient , the absorption is about 13.3% ( 0.028 cm ) , the rayleigh scattering ( s_r ) is 6.7% ( 0.014 cm ) , and compton scattering ( s_a ) is 80% ( 0.168 cm ) . two of the cubes had lower rayleigh scattering coefficients , and the other two had higher rayleigh scattering coefficients . table 1 lists the x - ray absorption and scattering coefficients at 50 kev of the phantom components . the pixel size of the detector was set to 0.2 0.2 mm and there were a total of 600 600 pixels to cover the whole phantom area . the distance between the phantom and the detector plane was 2.5 cm . in the simulation , we adjusted the form factor ( e ) for rayleigh scattering such that the average rayleigh scattering angle was 4.3. in each run , tim - os traced a total of 2 10 x - ray photons . figures 4(a ) and 4(b ) presents two images obtained with the varying collimation method : an image obtained with a collimator of a high collimation aspect ratio 50 ( ih ) , and a counterpart with a low collimation aspect ratio 10 ( il ) . by subtracting ih from il the varying collimation scheme correctly extracted the small angle scattering signals , and the signal intensities reflected the relative rayleigh scattering percentages . hence , it is indeed feasible to reconstruct not only attenuation but also rayleigh scattering parameters based on the varying collimation scheme . note that we can also extract the small angle scattering information by capturing two images at different object - detector distances without changing the detector collimator physically . by subtracting the longer distance image from the shorter distance image figure 4(c ) is an image captured with a longer distance ( 17.5 cm ) than figure 4(b ) ( 2.5 cm ) given the same collimation ratio ( 10 ) . while monte carlo simulation provides the gold standard for small scattering imaging , the single scattering method provides a faster way to estimate the small scattering signal . thus , we used ( 6 ) to predict the single scattering image for the phantom in figure 3 by assuming a low collimation ratio 10 and short detector - object distance 2.5 cm . here the computation of ( 1/2)1d1dp( ) was completed in a monte carlo simulation in advance for 250 ( = 5 cm/0.02 cm ) different depths and 5 different materials . figure 5 shows the numerical result according to the single scattering model ( 6)-(7 ) and the monte carlo simulated small - angle scattering image . quantitatively , the monte carlo simulated small scattering image is about 10% higher than the single scattering image , which shows the validity and utility of the single scattering model in this type of applications . actually , varying the collimator height gives us a new dimension to analyze scattering signals . we may use two or more collimator heights , depending on specific application requirements . also , it is possible to vary the x - ray tube voltage for more information . . accurate reconstruction algorithms should reflect the transport process , somehow between classic x - ray ct and diffuse optical tomography ( dot ) . we are actively working in this direction . in conclusion , we have proposed a varying collimation methodology for extraction of the dark - field signal for dark - field tomography . technically , it allows volumetric scanning such as in circular and spiral cone - beam geometries . potentially , it may be extended to probe other x - ray interactions with materials . the proposed approach has an implication for a wide range of applications including medical imaging , security screening , industrial nondestructive testing , and so on .
although x - ray imaging is widely used in biomedical applications , biological soft tissues have small density changes , leading to low contrast resolution for attenuation - based x - ray imaging . over the past years , x - ray small - angle scattering was studied as a new contrast mechanism to enhance subtle structural variation within the soft tissue . in this paper , we present a detection method to extract this type of x - ray scattering data , which are also referred to as dark - field signals . the key idea is to acquire an x - ray projection multiple times with varying collimation before an x - ray detector array . the projection data acquired with a collimator of a sufficiently high collimation aspect ratio contain mainly the primary beam with little scattering , while the data acquired with an appropriately reduced collimation aspect ratio include both the primary beam and small - angle scattering signals . then , analysis of these corresponding datasets will produce desirable dark - field signals ; for example , via digitally subtraction . in the numerical experiments , the feasibility of our dark - field detection technology is demonstrated in monte carlo simulation . the results show that the acquired dark field signals can clearly reveal the structural information of tissues in terms of rayleigh scattering characteristics .
pulmonary arterial hypertension ( pah ) is defined by a resting mean pulmonary arterial pressure over 25 mmhg , confirmed by right heart catheterization1 , 2 . pah is a rare and progressive disorder of the pulmonary circulation that leads to deterioration in cardiopulmonary function , and , ultimately , to right ventricular failure and death3 . patients with pah experience progressive dyspnea , fatigue , syncope , and chest pain . these symptoms lead to impaired exercise capacity , physical function , and quality of life4 , 5 . pah severity is classified according to a system originally developed for heart failure by the new york heart association ( nyha)6 , which was later modified for pah by the world health organization ( who)1 , 7 grades range from class i , in which the disease does not affect the patient s day - to - day activities , to class iv , in which the patient is severely functionally impaired , even at rest4 , 8 . the who functional classification system links symptoms with activity limitations , and is important for assessing disease progression or monitoring the disease , as well as highlighting the need for specific treatment regimens irrespective of the underlying etiology of pah4 , 9 , 10 . there have been no studies regarding the relationships between functional class ( fc ) and impairments in functional capacity , physical activity , and respiratory and peripheral muscle strength . therefore , this study was designed to compare these variables between healthy controls and patients with pah of different fcs according to disease severity . thirty - one patients with pah were included in the study ; 16 had class ii pah ( pah - ii ) and 15 had class iii pah ( pah - iii ) , based on the who classification system . all patients were clinically stable with no infection and no change in disease - targeted medications in the 3 months prior to the study . all patients had a negative acute reactivity test and were treated with endothelin receptor antagonists and phosphodiesterase type-5 inhibitors . patients with severe obstructive and restrictive lung disease , severe ischemic heart disease , left heart failure , cor pulmonale , cognitive disorders , or orthopedic problems were excluded . the control group comprised 15 healthy age- , sex- , and body mass index - matched subjects . the study protocol was approved by the ethics committee of hacettepe university , and was performed in accordance with the declaration of helsinki . the 6-minute walk test ( 6mwt ) was performed to assess functional capacity in all pah patients and healthy subjects following american thoracic society guidelines11 . participants walked along an enclosed 30-m corridor , and were instructed to walk at their own pace to cover as much distance as possible in 6 minutes . all pah patients and healthy controls performed the test twice to account for any learning effects . heart rate ( polar heart rate monitor , pf3000 ; polar electro , kempele , finland ) and oxygen saturation ( ktps-01 ; ktmed , seoul , korea ) also were recorded12 . the physical activity level was determined using the international physical activity questionnaire short form ( ipaq - sf)a 7-item questionnaire in which respondents estimate the frequency and duration of various activities engaged in during the previous 7 days . scores for moderate activities , vigorous activities , and walking were calculated as durations multiplied by known metabolic equivalents ( met ) per activity . met - min scores were converted to kilocalories using the following equation : met - min ( weight [ kg ] / 60 kg ) . the sitting question is a separate score , and was not included in the physical activity score . we also used the ipaq categorical score , which defines 3 levels of physical activity : inactive , minimally active , and sufficiently active13 , 14 . the ipaq is a valid and reliable questionnaire used for various conditions , such as chronic obstructive pulmonary disease and left heart failure . respiratory muscle strength was determined by measuring maximal inspiratory pressure ( mip ) and maximal expiratory pressure ( mep ) generated at the mouth using a mouth pressure device ( microrpm ; micromedical , kent , united kingdom)15 . mip was measured as residual volume after a maximal expiration , while mep was measured as total lung capacity after a maximal inspiration . tests were repeated until no further improvements were observed and there was no more than 5% difference between the 2 best values . normal values for respiratory muscle strength were calculated using regression equations according to age and sex17 . isometric muscle strength was measured bilaterally with subjects in a standard position using a handheld dynamometer ( medical commander powertrack ii ; jtech , salt lake city , ut , usa ) . measurements were taken for 3 peripheral muscle groups : shoulder abductors , hand grip , and knee extensors . each muscle group was tested 3 times , and the highest value was recorded18 . chicago , il , usa ) , and tested for normality using the shapiro - wilk test . quantitative variables were expressed as mean sd , while frequency was expressed as a percentage . one - way analysis of variance was used to compare mean values between pah - ii patients , pah - iii patients , and healthy controls . participants characteristics are shown in table 1table 1.characteristics of the study participantspah - ii(n = 16)pah - iii(n = 15)healthy controls(n = 15)age , y48.512.851.812.446.711.2gender , f / m , n14/211/48/7height , cm160.16.2160.28.5163.78.2weight , kg65.811.971.820.97513.8bmi , kg / m25.63.827.97.828.15.6ph etiology , n ( % ) idiopathic ph5 ( 31)4 ( 27)naassociated ph11 ( 69)11 ( 73)nampap , mmhg61.335.373.827.1nadisease duration , y5.44.56.16.1navalues are mean sd unless otherwise noted . bmi : body mass index ; f : female ; m : male ; mpap : mean pulmonary arterial pressure ; pah : pulmonary arterial hypertension ; ph : pulmonary hypertension ; na : not applicable . sixteen patients were classified as having who fc ii pah ( pah - ii group ) and 15 were classified as having who fc iii pah ( pah - iii group ) . pah patients and healthy controls were well matched for age , sex , height , weight , and body mass index . moreover , etiology and disease duration were similar between the pah - ii and pah - iii groups ( p > 0.05 ) . bmi : body mass index ; f : female ; m : male ; mpap : mean pulmonary arterial pressure ; pah : pulmonary arterial hypertension ; ph : pulmonary hypertension ; na : not applicable clinical features of pah patients and healthy controls are shown in table 2table 2.comparison of clinical features of pah patients and healthy controlspah - ii(n = 16)pah - iii(n = 15)healthy controls(n = 15)functional capacity6mwt distance , m438.5113.3338.4113.560461.3sao2 , % 8.210.112.613.20.40.7maximum heart rate , % 71.213.467.48.768.77.2dyspnea , borg3.92.74.63.20.10.3fatigue , borg3.72.24.32.80.20.4muscle strengthmip , cmh2o78.921.263.517.1108.721.9mip , % 83.427.972.214.3115.124.2mep , cmh2o108.828.989.426.6149.140.1mep , % 69.712.959.412.88415.1shoulder abductors , n101.718.692.529.9156.638.7hand grip , n137.338.7125.229.917041.2knee extensors , n225.184.9197.655.6279.952.5physical activityipaq total pa , kcal / d193.5146.8169.3155.9502.6542.6ipaq vigorous pa , kcal / d0000146.4397.8ipaq moderate pa , kcal / d91.4114.876.4144.7161.3162.9ipaq walking , kcal / d102.980.792.966.2194.9160.9ipaq sitting , min / d608.6107.5560118.2440139.2values are mean sd . * p < 0.05 , pah - ii vs. pah - iii . 6mwt : 6-minute walk test ; cmh2o : centimeter of water ; ipaq : international physical activity questionnaire ; mep : maximal expiratory pressure ; mip : maximal inspiratory pressure ; n : newton ; pa : physical activity ; sao2 : oxygen saturation . 6mwt distance was significantly lower in pah patients than in healthy controls ( p < 0.05 ) . the distance also significantly decreased in proportion to pah severity ( p < 0.05 ) . 6mwt distance values of 14 pah - ii patients ( 87.5% ) and 15 pah - iii patients ( 100% ) were lower than the 95% confidence interval ( ci ) of healthy subjects ( 570.1638 m ) . values are mean sd . * p < 0.05 , pah - ii vs. healthy controls . p < 0.05 , pah - ii vs. pah - iii . 6mwt : 6-minute walk test ; cmh2o : centimeter of water ; ipaq : international physical activity questionnaire ; mep : maximal expiratory pressure ; mip : maximal inspiratory pressure ; n : newton ; pa : physical activity ; sao2 : oxygen saturation differences in oxygen desaturation , dyspnea , and fatigue perception in the 6mwt were significantly higher in pah patients than in healthy controls ( p < 0.05 ) . mip , mep , and percentages of each were significantly lower in pah patients than in healthy subjects ( p < 0.05 ) . mip also significantly decreased between pah - ii and pah - iii groups ( p < 0.05 ) . mip values of 11 pah - ii patients ( 68.8% ) and 15 pah - iii patients ( 100% ) were lower than the 95% ci of healthy subjects ( 96.5120.8 cmh2o ) . mep values of 12 pah - ii patients ( 75% ) and 14 pah - iii patients ( 93.3% ) were lower than the 95% ci of healthy subjects ( 126.8171.3 cmh2o ) . peripheral muscle strength of the shoulder abductors , hand grip , and knee extensors was significantly lower in pah patients than in healthy subjects ( p < 0.05 ) . unsurprisingly , the greatest peripheral muscle weakness was observed in the pah - iii group ; however , there was no significant difference between the pah - ii and pah - iii groups ( p > 0.05 ) . shoulder abductor strength in 15 pah - ii patients ( 93.8% ) and 14 pah - iii patients ( 93.3% ) was lower than the 95% ci of healthy subjects ( 135.1178 n ) . knee extensor muscle strength in 10 pah - ii patients ( 62.5% ) and 13 pah - iii patients ( 85.7% ) was lower than the 95% ci of healthy subjects ( 250.8309 n ) . hand grip strength in 9 pah - ii patients ( 56.3% ) and 12 pah - iii patients ( 80% ) was lower than the 95% ci of healthy subjects ( 147.2192.8 n ) . total energy expenditure , estimated by using the ipaq - sf , was significantly lower , and total sitting time was significantly higher in pah patients than in healthy controls ( p < 0.05 ) . energy expenditure in walking was significantly different between pah - iii patients and healthy controls ( p < 0.05 ) . according to ipaq categorical classification , 10 pah - iii patients ( 66.7% ) were inactive and 5 ( 33.3% ) were minimally active . among pah - ii patients , 4 ( 25% ) were inactive and 12 ( 75% ) were minimally active . in the healthy control group , 4 subjects ( 26.7% ) were inactive , 7 ( 46.7% ) were minimally active , and 4 ( 26.7% ) were sufficiently active ( p < 0.05 ) . the present study investigated functional capacity , muscle strength , and physical activity in pah patients in relation to disease severity according to who fc . the major finding was that functional exercise capacity , physical activity level , and respiratory and peripheral muscle strength were significantly reduced in pah patients compared with healthy matched controls . functional exercise capacity , evaluated by using the 6mwt , was significantly decreased with increasing pah severity . a previous study of pah patients also demonstrated a decline in submaximal exercise capacity according to nyha classification system8 . the who fc system is able to distinguish between classes i and iv ; however , it is difficult to differentiate classes ii and iii . symptoms after the exercise test were worse in pah patients than in healthy subjects . however , the who classification system does not identify the differences between classes ii and iii . previous studies have demonstrated respiratory muscle weakness , especially loss of inspiratory muscle strength , in patients with pah19 , 20 . the present study provides evidence that inspiratory and expiratory muscle strength are reduced in patients with pah compared with healthy controls . in contrast , meyer et al . showed that respiratory muscle strength was independent of who fc19 . our findings indicate that who fc can effectively identify changes in mip . to our knowledge , this is the first study to examine proximal upper extremity muscle strength in pah patients in addition to the knee extensors and hand grip force21 , 22 . skeletal muscle strength was significantly reduced in pah patients compared with controls , but no significant difference could be detected between patients with who fcs ii and iii , indicating that reduction in peripheral muscle strength was independent of pah severity . moreover , frequency of sedentary lifestyle , determined by sitting time per day , was higher among pah patients . according to categorical classification two other studies also showed decline in physical activity and increase in sedentary time in pah patients according to nyha fc23 , 24 . physical activity measurement is an important outcome in patients with chronic obstructive pulmonary disease25 . like the 6mwt and fc , physical activity also should be routinely assessed and used as an endpoint when evaluating pulmonary rehabilitation programs , especially for patients with a sedentary lifestyle . the sample size was relatively small due to the low incidence of pah , and the sample of pah patients was heterogeneous . future studies are needed to compare functional capacity , physical activity , and respiratory and peripheral muscle strength in the other fcs ( i and iv ) in various forms of pah . in conclusion , the major finding of our study is that as pah progresses , inspiratory muscle strength , functional exercise capacity , and physical activity decline . the 6mwt , mip , and ipaq categorical classification can detect clinically significant changes when comparing patients with who fc ii and iii pah . functional capacity , physical activity , and peripheral and respiratory muscle strength are significantly reduced in pah patients compared with healthy controls . fc and disease severity should be taken into consideration when planning rehabilitation programs for patients with pah .
[ purpose ] this study investigated functional capacity , physical activity , and respiratory and peripheral muscle strength in different functional classes of pulmonary arterial hypertension ( pah ) compared with healthy subjects . [ subjects and methods ] this study included 31 patients with class ii ( n = 16 ) or class iii ( n = 15 ) pah , classified according to the world health organization . fifteen healthy subjects served as controls . functional capacity was assessed using the 6-minute walk test ( 6mwt ) . physical activity was determined using the international physical activity questionnaire short form ( ipaq - sf ) . respiratory muscle strength was measured using a mouth pressure device . peripheral muscle strength was evaluated using a dynamometer . [ results ] the 3 groups had similar demographic variables ( p > 0.05 ) . there were significant differences in 6mwt distance , maximal inspiratory pressure , and ipaq categorical classification between the 3 groups ( p < 0.05 ) . maximal expiratory pressure ; total ipaq score ; and knee extensor , shoulder abductor , and hand grip strength were significantly lower in pah patients ( classes ii and iii ) than in healthy subjects ( p < 0.05 ) . [ conclusion ] as pah progresses , respiratory muscle strength , functional exercise capacity , and physical activity decrease . functional class should be taken into consideration when planning rehabilitation programs for this patient group .
chronic kidney disease ( ckd ) is a worldwide public health problem that affects approximately 6% of the uk adult population and is associated with a high prevalence of cardiovascular disease and large economic burden . anaemia occurs early during the course of ckd and progressively increases as a result of iron and erythropoietin deficiencies . the incidence of pre - dialysis anaemia in patients attending the renal service has been estimated to be around 68% of all patients referred for the first time for assessment with 61% having either absolute ( depletion of both circulating and iron stores ) or functional ( depletion of circulating / available iron ) iron deficiency . the renal national service framework and best practice guidelines advocate correction of anaemia in patients with ckd not yet on renal replacement therapy . only 26% of these patients , however , receive replacement intravenous ( iv ) iron therapy . the increasing use of erythropoiesis - stimulating agents ( esas ) has also led to a rapid increase in the need for adequate iron replacement therapy to maintain sufficient iron stores . recent randomized clinical studies have raised safety concerns of using esa agents and their potential toxicity . indeed , the risks of pure red cell aplasia ( prca ) , thrombotic potential and possibly neoplasm make esas less attractive [ 810 ] . it is not clear from these recent publications whether the increased incidence of adverse cardiac and other events including stroke is due to the actual haemoglobin level achieved ( i.e. , a normal haemoglobin concentration of 13 g / dl or greater ) , the drug preparation itself ( esa ) , the dose of the drug used ( i.e. high doses used in patients with possible esa hyporesponsiveness ) or an unrecognized factor which may be impacting on patients morbidity and mortality . with these recent data concerning esa , correction of iron deficiency with iv iron may , perhaps , represent a safer option to optimize anaemia in ckd patients . the nice guidelines also suggest that iron replacement is required for ckd patients with low haemoglobin prior to esa use . by optimizing iron stores and iron bioavailability , esa efficiency can be maximized , its requirement potentially delayed and patient quality of life improved . in considering the potential ideal iron preparation , consideration must be given to the requirements of the clinician , health service and most importantly the patient in addition to the drug s pharmacological characteristics such as method of administration and flexibility of use . oral iron , although possibly more convenient , remains a poor substitute because of its poor bioavailability and compliance . the mechanism is unclear but putatively involves hepcidin , a 25-amino acid synthesized in the liver . hepcidin acts as a regulator of iron metabolism with effects on absorption , transportation and storage . hepcidin binds to the iron exporter channel ferroportin which causes internalization and degradation of iron . this subsequently leads to reduced red cell iron absorption and sequestration in the reticulo - endothelial system . to overcome this increased hepcidin synthesis and hence reduced iron absorption leading to anaemia , the most effective method is via the iv route of iron administration . used in isolation , iv iron leads to a significant rise in haemoglobin concentrations in the order of 062.7 g / dl . use of parenteral iron therapy for the treatment of anaemia dates back to 1932 when it was first administered by heath et al . however , it was found to have significant disagreeable symptoms , sometimes severe and possibly dangerous even with a modest dose of 4080 mg . subsequently , in 1946 , goetsch et al . examined ferric hydroxide but found that it also caused numerous adverse problems . then , in 1947 , nissim discovered that use of an iron saccharide preparation appeared to be much safer . finally , baird and podmore in 1954 developed an iron dextran preparation ( imferon ) , which showed some initial promise but was withdrawn in 1992 due to a high incidence of anaphylactic reactions . since then , there has been resurgence in developing a useful and clinically practical parenteral iron therapy that would overcome the issues regarding safety associated with traditional iron therapies , related to anaphylaxis / immunogenicity and release of free or labile iron . currently , several iron preparations have been in regular clinical use , but all possess various limitations to the more recently , several next generation iv iron preparations have become commercially available . for the clinician , the decision about the qualities of the perfect parenteral iron preparation remains to be confirmed , but the future potentially looks bright . ideal parenteral iron preparation , safety is critical and has been demonstrated in several studies for the current therapies [ 2325 ] . in particular , there should be a low anaphylactic or anaphylactoid potential , and the preparation should not have a significant detrimental effect on renal function . when iv iron is administrated , it passes to the reticulo - endothelial system ( res ) . the iron complex splits , and the iron is then combined to ferritin or transferrin which is used in haemoglobin production and storage . however hence , when considering the potential molecular structure of an ideal iron formulation , binding of the iron to the carbohydrate complex is critical to ensure that the complex allows tight binding of iron with minimal release of free iron that does not bind to transferrin . however , critical to iron s importance in biological processes is its ability to cycle reversibly between its ferrous and ferric oxidation states . this specific property , which is essential for its functions , also makes it hazardous because free iron can catalyze the formation of free radicals leading to cell damage . labile iron ( catalytic iron ) consists of chemical forms that can participate in redox cycling . this property enables it to generate powerful oxidant species such as hydroxyl radical and/or reactive iron oxygen complexes such as ferryl or perferryl ion . in addition , iron can directly catalyze lipid peroxidation , the oxidative reaction of polyunsaturated lipids , by removing hydrogen atoms from polyunsaturated fatty acids in the lipid bilayers of organelle membranes . several animal models have demonstrated the potential detrimental effects of free iron on glomerular function . this may be related to the putative toxic effect of iron to cells , in particular glomerular and mesangial cells via oxidative stress ( lipid peroxidation ) and cell cytotoxicity leading to endothelial dysfunction which leads to proteinuria , accelerated atherosclerosis and potentially an increase in serum creatinine . previously , zager et al . demonstrated in vitro in animal studies that the loosely bound parenteral iron formulations may cause direct cytopathic changes to renal cells ( particularly mesangial cells and endothelial cells ) and this , therefore , may potentially cause renal deterioration [ 2729 ] . there are a few human studies , but agarwal in a study of 20 ckd patients suggested that there was an increase in oxidative stress markers when iv sucrose was given , and this could , in part , be abrogated by n - acetyl cysteine . however , this intervention did not affect proteinuria , a strong surrogate marker of renal progression leading to the possibility of direct drug - induced toxicity. recently , shah et al . in preliminary studies carried out in india compared catalytic iron in subjects with either no renal disease or diabetes , with patients with diabetes and demonstrated that patients with overt diabetes have an increase in urinary catalytic iron which may be toxic to renal cells . more recent clinical data on the neutral effects of iv iron on renal function are encouraging . indeed , 1-year data demonstrate this trend for low - molecular - weight iron dextran ( cosmofer ) ( figure 1 ) . also , post hoc sub - analysis of the fair - hf study in a population of nyha class ii / iii heart failure patients with iron deficiency anaemia and a mean egfr ( mdrd ) of 64 21 ml / min/1.73 m demonstrated a modest improvement in egfr over a 24-week period after iron repletion in the order of 44 1.7 ml / min in comparison to placebo . again , short - term data on iron isomaltoside 1000 ( monofer ) are encouraging in relation to renal function . these next generation preparations will be subjected to future ongoing scrutiny in longer - term studies . b. egfr ( mdrd ) at baseline and after 1 year of intravenous iron therapy . the carbohydrate used in these next generation preparations mechanistically vary slightly but in essence assist in isolating the bioactive iron from plasma components until the iron carbohydrate complexes enter the res for subsequent entry into the intracellular storage iron pool ( ferritin ) or transfer to plasma transferrin for haemoglobin production . for iron carboxymaltose ( ferinject ) , the unique carboxymaltose shell leads to a highly stable , type i polynuclear iron ( iii)hydroxide carbohydrate complex that completely surrounds the iron core with the release of minimal amounts of iron into the circulation , while for iron isomaltoside 1000 , rather than surrounding the iron core , the iron is enmeshed within the carbohydrate complex forming a matrix which may allow a more gradual release of iron . these novel mechanisms ensure that only minimal quantities of ionic iron are released from their carbohydrate shell / matrix which seem to ensure that free iron adverse effects and subsequent tissue toxicity from reactive oxygen species are negated . currently , a number of other specialities are utilizing iv iron but often seek assistance from their colleagues within the renal department for its administration . these include cardiology ( heart failure ) , gastroenterology ( inflammatory bowel disease ) , haematology , oncology , gynaecology , post - partum anaemia , and both pre- and post - operative use . in oncology , with the continued controversies of esas and carcinoma , use of iron represents an ideal solution as mild to moderate anaemia occurs in up to 75% of cancer patients undergoing therapy . again , in inflammatory bowel disease , anaemia occurs in between 30% and 70% of patients . this may be due to a number of factors including chronic diarrhoea , vitamin b12 deficiency , folate deficiency and medication - induced bone marrow suppression , but the most common cause is iron deficiency from a combination of intestinal blood loss and reduced absorption from the gut as a result of hepcidin and chronic illness . indeed , there have been several studies of iron carboxymaltose use in these populations , and in all cases , the introduction of parenteral iron has allowed a reduction of transfusions and thus reduced the inherent risks associated with blood transfusions such as infection , antibody development and transfusion resistance . indeed , there is also a reduced risk of panel - reactive antibody development , critical in future transplantation success , which increases more than 2-fold with between one and five blood transfusions administered . hence , reversion back to giving blood transfusions , unless absolutely clinically imperative , should be avoided in the future . when examining the currently available iron preparations , several administration regimes are possible , including giving iron as a single total replacement dose , as repeat low doses or as a bolus . previously , only low - molecular - weight iron dextran could be given as a total dose infusion of 1000 mg in a single episode , thus sparing veins and time and being more ideal for a non - captive population such as a ckd group . for example , feraheme ( ferumoxytol ) , a semi - synthetic polysaccharide - coated iron oxide , can be administered over 17 s in doses of up to 510 mg and repeated within a week [ 4547 ] . iron carboxymaltose allows administration as a single dose of up to 1000 mg ( not exceeding 15 mg / body weight ) in at least 15 min . more recently , iron isomaltoside 1000 as a single dose of 1000 mg ( not exceeding 20 mg / kg bodyweight ) can be administered over 3060 min . modes and dosage regimes of administration accelerated dose infusion regime used by the author and several other units sinha s , chiu d , peebles g , fenwick s , bhandari s , kalra p. accelerated total dose infusion of low - molecular - weight iron dextran is safe and efficacious in chronic kidney disease patients . quarterly journal of medicine , advanced access published 18 october 2010 the removal of the need for a test dose for iron administration is an essential prerequisite of an ideal iron preparation to optimize efficiency of administration and cost . currently , there appears to be no detrimental effect of tdi iron apart from those recognized in its side effect profile . if we compare the properties of the iron preparations currently available in europe and the uk , the newer iron preparations tick the boxes in a clinician s wish list for the ideal iron preparation ( table 2 ) . the newer iron preparations in a clinician s wish list for the ideal iron preparation molecular weight for ferumoxytol is not comparable to the other iron values because of measurement to a different standard on the clinician s wish list , the flexibility of the iron preparation is one important factor in the choice of iron preparation , while other factors potentially influencing choice relate to convenience to patients and staff . we have previously shown that these have significant influences on choice in addition to cost . patients have found that the time saved for them as a result of more effective and efficient delivery of iron therapy has led , for them , to benefits including less disruption to their personal life , less time away from both their home environment and work , less time away from their family and friends , and a reduced amount of time spent travelling for therapy as a result of more local administration of treatment and less treatment episodes . these factors have all had a beneficial financial impact on patients and potentially to the wider community with less absence from work . development of local services where the newer preparations can be administered may enhance this further . the ability to administer flexibly a total repletion dose of parenteral iron and the future costs of the parent drug may determine future prescribing practices as the other added clinical beneficial properties or parenteral iron between iron preparations become nullified . for patients suffering from ckd or any other pathology linked to iron deficiency , quality of life is critical and can be objectively improved with parenteral iron therapy . indeed , iron therapy has reduced the risk to patients as a result of fewer blood transfusions , which carry their inherent risk of transmission of infection and creutzfeldt jakob disease , fewer side effects and importantly for those with progressive renal disease preservation of veins for future vascular access . more efficient use of the health service with a reduced treatment waiting time and total number of visits ( from less frequent iron administration ) all lead to savings in both nursing and medical time . it will allow an increased capacity to give treatment and have significant economic benefits which will allow more patients to receive treatment with a finite and often limited budget . this potential cost - effectiveness has already been demonstrated in several studies of iv iron use . there is a growing wealth of clinical data to reassure , but this remains the most critical element for the future use of newer iron preparations . clinical practice is normally not based on cost alone but includes medical and patient considerations . the clinical evaluation of the efficacy ( iv iron can work ) and effectiveness ( iv iron does work ) without any detriment to quality of life or increase in side effects is important , but maximizing convenience and cost - effectiveness are equally important . patient choice and more importantly the concept of providing a service for patients without compromising on quality of care given . therefore , in this new era of patient - directed therapy , the profile of the ideal iron preparation should be capable of delivering sufficient quantities of iv iron to correct iron deficiency rapidly , with minimal potential side effects including low catalytic / labile iron release and negligible immunogenicity ( risk of anaphylaxis ) . for preservation of veins , the iv preparations should have a neutral ph and have a wide dosing range to allow a single repletion dose , with no requirement for a test dose . finally , it should be convenient and cost - effective for the patient , doctor and staff with maximal time efficiency . has received honorarium for lecturing on behalf of pharmacosmos , pfizer , roche and bms . s.b . also has received funding for travel to conferences from amgen and novartis , and has acted as an investigator in multicentre studies designed and funded by amgen , astra - zeneca , novartis , roche , pharmacosmos and vifor .
the national service framework advocates correction of anaemia in patients with chronic kidney disease ( ckd ) . oral iron is insufficient , while intravenous ( iv ) supplementation replenishes and maintains iron stores . previously , effective delivery of iron therapy using available parenteral preparations has been hampered by dosing schedules and the need in some cases of a test dose . the introduction in europe of newer iron preparations , including iron isomaltoside 1000 ( monofer ) and iron carboxymaltose ( ferinject ) , now offers a potentially safe , effective and time - efficient method of outpatient iron repletion . this may potentially lead to better cost - effectiveness in a resource - limited service .
skeletal and dentofacial discrepancies may adversely influence the quality of life ( qol ) of patients through affecting their facial appearance , oral function or both [ 1 - 3 ] . patients with malocclusion , especially those severe cases that need surgical correction , are proved to have lower oral health - related quality of life ( ohrqol ) [ 2 - 4 ] . apart from problems with mastication and facial aesthetic , which are usually patients chief complaint , they come across other difficulties such as social interactions , interpersonal relationships , and even selection of partner and profession , that all affect their ohrqol . nowadays when planning an orthognathic surgery , improving the patients psychological health and correcting the patients ability to accept their appearance are as important as their aesthetic and functional improvement . much attention has been paid to the factors influencing postsurgical satisfaction and subsequently improving qol during the last decade [ 3,10 - 14 ] . despite equipment improvements and technical progress that have made the orthognathic surgeries much faster and simpler than they used to be , patients however , achieving the patients expectations of the orthognathic surgeries has been shown to be very complicated ; as not only the surgeon s skills but also the patient - surgeon communication well affects the patients satisfaction . even in the most successful cases , patients preoperative expectations of orthognathic surgery and postoperative outcome could offer discrepancies if they are not well informed and clarified about the outcomes and possible postsurgical discomforts . therefore , patients may experience physical or psychological dissatisfaction , and express such dissatisfaction through formal or informal complaints . orthodontic surgical treatments are planned and conducted based on objective criteria and normative values , these may differ from patients perception of improvement and qol which are affected by subjective parameters . determining and considering affective soft and hard tissue parameters on patients satisfaction and qol must be performed before treatment planning . there is a lack of information regarding the relationship of qol and postsurgical level of satisfaction with cephalometric changes following surgery . several questionnaires have been developed in order to assess the impact of dental conditions on the qol . 49-item oral health impact factor ( ohip ) is one of the mostly used questionnaires which could capture individuals perceptions of the social impact of oral disorders on their well - being . the ohip-14 questionnaire was developed by slade as a shorter version of the ohip-49 which focuses on oral health- specific aspects of functional limitation and physical disability , psychological , social aspects of disability , and handicaps . the ohip-14 evaluate negative impacts of oral disorder whereas some other instruments evaluate both positive and negative impacts . however , the ohip is the one of the best - documented instrument and most widely used questionnaire . hence , the aim of this study was to assess relationships between oral health - related quality of life and satisfaction with cephalometric changes in hard and soft tissues variables . the results of this study may help clinicians to improve patients quality of life and satisfaction following orthognathic surgery by considering effective soft and hard tissue variables . the research hypothesis was that there are soft and hard tissue variables which are more effective in patients level of satisfaction and quality of life . a cohort study of orthodontic patients whose treatment plan included an orthognathic surgery was designed . all patients who were referred to maxillofacial departments of any private or public hospitals of the city of shiraz for orthognathic surgery by their orthodontists during march 2010 - july 2011 were invited into the study . the 25 class ii and 30 class iii malocclusion patients who met the specific criteria were recruited . the inclusion criteria were : to have received presurgical orthodontic treatment with the same protocol ( 0.022 inch standard edge wise bracket ) , were scheduled for a combination of a standard one - piece le fort i osteotomy and bilateral sagittal split ramus osteotomy ( bssro ) with rigid fixation , condylar positioning devices were not used , inter - occlusal splint were applied for two weeks . for all patients , pre- and postsurgical those who did not go under surgery for any reason ( e.g. financial or general health issues ) , and who had cleft lip / palate , craniofacial syndrome , posttraumatic deformity , tempromandibular diseases , facial asymmetry , or mandibular border asymmetry were not recruited for the study . moreover , among recruited ones , those who had a postoperative infection , mal - union with poor occlusion , or nerve injury , and those who refused to fill the questionnaires in full were excluded from final analysis . pre- and postsurgical cephalograms were taken with head in natural position , teeth in centric occlusion , and lips in response . the distance between film and x - ray tube was 150 cm and the distance between the film and mid sagittal plane of the patient s head was 18 cm . the horizontal reference line used in this study was the line with 7 degrees of difference to the sella - nasion line . seven angular ( sna , snb , anb , nasolabial angle , facial angle , convexity angle , mentolabial angle ) , 5 linear ( upper lip length , lower lip length , upper lip protrusion , lower lip protrusion , wits appraisal ) and one ratio - related ( jaraback index ) measurements were used to assess dento - skeletal characteristics on pre- and postsurgical cephalograms of each patient ( figure 2 ) . pre- and postsurgical radiographs used in this study were taken when no orthodontic appliances were present on the teeth in order to avoid misinterpretations resulting from presence of brackets , especially in lips . n = nasion ; go = gonion ; me = menton ; po = pogonion ; g = glabella ; sn = subnasale ; ls = labralesuperius ; li = labraleinferius ; stms = stomionsuperius ; stmi = stomioninferius ; pg = soft tissue pogonion ; si = labiomental sulcus ; n = soft tissue nasion . soft and hard tissue measurement : 1 = nasolabial angle ; 2 = facial angle ; 3 = mentolabial angle ; 4 = convexity angle ; 5 = upper lip protrusion ; 6 = lower lip protrusion ; 7 = upper lip length ; 8 = lower lip length . the persian version of the short form ( 14 itemed ) of the oral health impact profile questionnaire ( ohip-14 ) was used to evaluate the qol of participants , ohip-14 has seven domains ( and two items per domain ) : functional limitation , physical pain , psychological discomfort , physical disability , psychological disability , social disability , and handicap . the response to each item was scored on a 5-point scale as never ( 0 ) to very often ( 4 ) . therefore , a higher score indicated poorer qol . a short six - item form of the rustemeyer s questionnaire was also used to assess the participants overall satisfaction , the relatives and friends opinions about the results of surgery , and aesthetic and masticatory improvements compared to before surgery via an 11-point scale based on a visual analog scale ( vas ; 0 = poor , 10 = excellent ) ( table 1 ) . as a persian version of the rustemeyer s questionnaire was not available , the shortened six - item form was translated into persian through a forward - backward practice . its content validity was approved by two experienced persian speaking orthodontists , and its reliability was checked through a pilot study of 20 patients who had previously gone under orthognathic surgery . these questionnaires were answered by the patients an average 1.1 years ( standard deviation 0.7 years ) after surgery , in order to minimize the impression of the postsurgical complications ( oedema , swelling and pain ) on their responses . rustemeyer 's questionnaire about patients ' satisfaction after surgery patients socio - demographic information was obtained when consented to participate . they were provided with the researchers phone number and were encouraged to ask any question they had at any point until the end of study . kolmogorov - smirnov normality test was used to determine whether the quantitative variables were normally distributed . paired t - test was used to evaluate the difference of qol / satisfaction outcomes in sexes and educational level . pearson correlation analysis was performed to determine the degree of correlation between qol and satisfaction scores with chephalometric changes . the reproducibility of the measurements was determined by randomly selecting 15 cephalograms and repeating the tracing by the same examiner , one month after the initial tracing . no significant difference was found when the t - test was performed to evaluate the repeated measurements . the intra examiner correlation ( pearson correlation ) of obtained data was 0.82 . the results and data were expressed as means and standard deviations ( m [ sd ] ) . data from 30 class iii ( 22.77 [ 3.78 ] years , 11 females and 19 males ) and 25 class ii malocclusion patients ( 25.12 [ 4.47 ] years , 14 females and 11 males ) were used in the final analysis . no significant relationship was found between ohrqol with gender ( p = 0.743 ) or educational levels ( p = 0.534 ) . patients responses to questions which evaluate their information about treatment are shown in table 2 . patients information about treatment changes in cephalometric variables after surgery in class iii malocclusion patients a significant decrease was detected post operatively in the soft tissue parameters : nasolabial angle ( p = 0.038 ) , facial angle ( p 0.001 ) , convexity angle ( p 0.001 ) , mentolabial angle ( p 0.001 ) , and lower lip protrusion ( p 0.001 ) ; in the hard tissue parameters : snb ( p = 0.002 ) . a significant increase was found in the soft tissue parameters : upper lip protrusion ( p 0.001 ) , upper lip length ( p 0.003 ) ; in the hard tissue parameters : jaraback index ( p = 0.028 ) , anb angle ( p 0.001 ) , sna angle ( p 0.003 ) and wits appraisal ( p 0.001 ) . on the other hand , no significant change was found in lower lip length ( p = 0.712 ) ( table 3 ) . cephalometric changes before and 1.6 ( 0.7 ) years after surgery statistically significant ( paired t - test , p < 0.05 ) . changes in cephalometric variables after surgery in class ii malocclusion patients a significant increase was shown post operatively in the soft tissue parameters : facial angle ( p 0.001 ) , convexity angle ( p 0.001 ) , and mentolabial angle ( p 0.001 ) ; in the hard tissue parameters : snb ( p 0.001 ) . a significant decrease was found in the soft tissue parameters : upper lip protrusion ( p 0.001 ) , upper lip length ( p 0.001 ) , lower lip protrusion ( p 0.004 ) , and lower lip length ( p 0.004 ) ; in the hard tissue parameters : anb ( p 0.001 ) , sna ( p = 0.008 ) and wits appraisal ( p 0.001 ) . nevertheless , no significant change was found in jaraback index ( p = 0.578 ) , nasolabial angle ( p = 0.559 ) ( table 3 ) . correlations between changes in cephalometric variables and questionnaires items several cephalometric variables were significantly correlated with ohrqol and satisfaction levels in class iii malocclusion patients . facial angle , convexity angle , mentolabial angle , nasolabial angle , and upper lip protrusion had the most significant correlations with questionnaires items . reduction in mentolabial angle , facial angle , and convexity angle was correlated positively with functional limitation ( oh-2 ) , psychological discomfort ( oh-5 ; oh-6 ) , psychological disability ( oh-9 ) , and handicap ( facial angle with oh-13 and oh-14 , mentolabial angle just with oh-13 , and convexity angle just with oh-14 ) . in contrast , reduction in nasolabial angle and increase in upper lip protrusion were correlated negatively with functional limitation ( oh-1 ) , psychological discomfort ( oh-5 ; oh-6 ) , psychological disability ( oh-9 ) , and handicap ( oh-13 , oh-14 ) . the changes in wits appraisal and anb angle revealed positive correlation with changes in scores of oh-3 ( functional limitation ) and oh-4 ( physical pain ) ( table 4 ) . correlations between changes in cephalometric variables and oral health impact profile questionnaire ( ohip ) items in class iii malocclusion patients statistically significant ( pearson correlations , p < 0.05 ) . statistically highly significant ( pearson correlations , p < 0.001 ) . n.s = statistically non significant ( pearson correlations , p > 0.05 ) . also , upper lip protrusion , facial angle , mentolabial angle , and nasolabial angle was significantly correlated with overall satisfaction ( q5 ) ( table 6 ) . in class ii malocclusion patients , convexity angle , facial angle , lower lip protrusion , and mentolabial angle were correlated negatively with the changes in ohip-14 scores involving psychological discomfort ( oh-5 ) , physical disability ( oh-7 ) , psychological disability ( oh-9 ) , and handicaps ( oh-13 ; oh-14 ) . the changes in wits appraisal revealed positive correlation with oh-3 ( functional limitation ) ( table 5 ) . changes in mentolabial angle , facial angle , and convexity angle were significantly correlated with overall satisfaction ( q5 ) , relatives opinions ( q6 ) , and the difference between facial aesthetic before and after surgery ( q2-q1 ) ( table 6 ) . correlations between cephalometricchanges and oral health impact profile questionnaire ( ohip ) items in class ii malocclusion patients statistically significant ( pearson correlations , p < 0.05 ) . statistically highly significant ( pearson correlations , p < 0.001 ) . n.s = statistically non significant ( pearson correlations , p > 0.05 ) . correlations between cephalometric changes and satisfaction questions in class iii and ii malocclusion patients statistically significant ( pearson correlations , p < 0.05 ) . statistically highly significant ( pearson correlations , p < 0.001 ) . n.s = statistically non significant ( pearson correlations , p > 0.05 ) ; q 2 - 1 = difference between q2 and q1 ; q 4 - 3 = difference between q4 and q3 . satisfactory results of an orthognathic surgery from clinician s point of view may not be as satisfactory from patient s aspect . facial disproportionate , in contrast with facial conformity ( symmetry ) , is unattractive , and unacceptable . differences between predicted and postsurgical outcomes could be measured with a range of 1 - 2 for sna , snb , and argome in cases of bimaxillary osteotomy , cephalometric prediction remains an accurate tool for treatment planning . but , treatments that are merely based on cephalometric evaluation lead to inadequate correction of facial beauty and therefore , patient dissatisfaction . various factors may affect postsurgical satisfaction in a positive direction [ 11 - 13 ] . patient s awareness about the procedures of orthodontic surgical treatment can improves patient s level of satisfaction . in the present study , as previously indicated , most of the patients have received adequate information about the treatment procedures , thus the effect of inadequate information on the reduction of the level of satisfaction and qol is negligible . in the present study , patients with postoperative infections , mal - union with poor occlusions and nerve injury were excluded . it has been shown that patients who experienced unexpected problems such as of postoperative infections , mal - union with poor occlusions and nerve injury following surgery were more likely to be dissatisfied with the treatment . a negative tendency on patients rating therefore we tried to reduce other affective factors on patients satisfaction and qol to clarify the effect of cephalometric variables changes on patients satisfaction and qol and eliminate differences between groups . no significant differences was observed in the result obtained from all approaches between two genders , this finding is consistent with those studies which did not find any association between gender and qol outcomes . however , nicodemo et al . reported that women showed improved self - esteem and diminished depressive symptom 6 months after orthognathic surgery , whereas men showed no improvement . as in many studies in this field , we observed significant changes in the hard and soft tissue parameters after orthodontic surgical treatment . however , lower lip length in class iii and nasolabial angle and jaraback index in class ii malocclusion showed no significant changes after surgery . . showed no significant changes in mentolabial fold thickness ( mm ) after orthognathic surgery in class iii malocclusion patients ; in the present study changes in mentolabial area was assessed by mantolabial angle instead of mentolabial fold thickness . in other hand , rustemeyer et al . showed significant changes in mentolabial angle only in class ii malocclusion patients following orthognathic surgery . this disagreement could be related to the high method error and variability in this area , which by reported by fernandez - riveiro et al . . findings from this study showed that some objective changes of cephalometric variable are effective in improving the patients qol and satisfaction . correction of sagittal aspect of deformity by improving facial angle and convexity angle compared with jaraback index which used to determine changes in vertical aspect of deformity , played an important role in increasing qol and patients satisfaction in both groups . this is in great agreement with other studies which have shown that the most important affecting factor on facial attractiveness is the anteroposterior dimension . a number of studies have shown that increase in lower facial height is more acceptable while other studies claim the opposite . in the current study , although pre- and postsurgical lower facial height had a significant difference in class iii malocclusion patients , no significant correlation were observed between changes in lower facial height and qol and satisfaction levels . it has been indicated that alteration of the appearance was related more to the sagittal snb angle than vertical argome angle , no correlation between vertical argome angle and level of patient satisfaction was reported in class iii malocclusion patients . as reported by rustemeyer et al . , mentolabial angle and nasion - pogonion have positive correlation with qol and postsurgical satisfaction in class iii malocclusion patients . unlike the present study , they found that the reduction in snb , facial convexity angle , and lower lip protrusion has negative effect on qol . this disagreement could be due to the shorter follow - up period of their study which was carried out only 8 months after surgery , while the mean range of follow - up period in the present study was 1.1 ( 0.7 ) years . it has been shown that in one third of patients , it takes 24 months to get used to their new facial appearance . present study showed that increasing the upper lip prominence had significant impact on qol of class iii malocclusion patients . also , changes in lower lip prominence , in class ii malocclusion patients , was significantly correlated with patients satisfaction and qol . chew et al . reported that lower lip prominence was the only cephalometric variable that significantly influenced clinicians evaluation of profile aesthetics ; although , lay persons found no difference between lower lip and upper lip attractiveness . as a good increase in the qol is expected from orthognathic surgeries , attention to the parameters affecting the patients satisfaction and their qol is essential , particularly in treatment planning . enhancing patients awareness about facial aesthetics which can improve facial appearance , as well as increasing patients information regarding surgery may be useful . in this study , but it is recommended that changes in profile and frontal views of the face could be evaluated in future studies . results of this study could be beneficial for determining affective factors in the improving of qol and patients satisfaction which can determine treatment effectiveness . in class iii malocclusion patients , changes in mentolabial angle , convexity angle , facial angle , and upper lip protrusion were significantly correlated with improvements in patient satisfaction and qol . in class ii malocclusion patients , changes in facial angle , convexity angle , lower lip protrusion , and mentolabial angle were significantly correlated with improvements in patient satisfaction and qol . although some variables had significant correlation with patients satisfaction and quality of life , it seemed that the associations were moderate . it is undeniable that considering the subjective and objective parameters during preparing the patients to their new appearance are necessary .
abstractobjectivesthis study was designed to assess the relationship between postsurgical cephalometric changes and quality of life and satisfaction after orthognathic surgery.material and methodssample size consisted of 30 patients with class iii and 25 patients with class ii malocclusion treated with bilateral sagittal split osteotomy and le fort i osteotomy . profile convexity , lower facial height proportion , lip position and length , nose , and chin position were measured on pre and post - treatment cephalograms . to assess the patients satisfaction and quality of life ( qol ) after surgery , the questionnaire of the rustemeyer s study and oral health impact profile ( ohip ) questionnaire were used , respectively . the paired - sample t - test , spearman correlation analysis and pearson correlation analysis was used in spss statistical software.resultsin class iii malocclusion patients , decrease in facial angle , convexity angle , mentolabial angle , and increase in upper lip protrusion had the most positive impact on qol . decrease in facial angle and increase in upper lip protrusion were correlated positively with satisfaction questionnaires . in class ii malocclusion patients , increase in convexity angle , facial angle and mentolabial angle had the most positive impact on satisfaction and qol.conclusionsconsideration both subjective and objective parameters affecting on the patients satisfaction and their quality of life is essential .
urinary retention ( ur ) defined as inability to achieve complete bladder emptying by voluntary micturition , resulting in a high postvoid urinary residual volume and categorized as acute ur or chronic ur . incidence of ur in women is estimated at 0.07 per 1,000 inhabitants each year and relatively uncommon compared to incidence of ur in men . although various factors can influence bladder outlet resistance and bladder contractility , benign prostatic hypertrophy plays a critical role in men . in contrast , various factors can influence bladder function and the development of ur in women including anatomical disease , medication use , history of surgery , neurologic problems , infection , as well as psychogenic factors . postoperative ur is a frequent complication of anesthesia and surgery of the lower urinary tract , perineum , anus , and general gynecological interventions , with an estimated incidence rate of 5% to 70% . by the way , in an analysis of inpatients referred to urology department , urination disorder was the most common problem ( 61.26% ) and ur was 25% among urination disorder . considering the characteristics of the inpatients , many patients with comorbid show acute aggravation of the chronic diseases or various complications because of the aggravation . thus , more medical cares are being administered . a number of pharmaceutical agents , which are routinely prescribed to patients by internal medicine services , are associated with ur or obstructive voiding symptoms ; these include anticholinergic agents , musculotropic relaxants , calcium channel blockers , antiparkinson agents , -adrenergic agonists , and antihistamines . accordingly , we aimed to analyze the characteristics of ur in female inpatients managed with medical cares and utilize these results for prevention of ur or proper management of ur at an early stage . a retrospective analysis based on the medical records of inpatients referred to the department of urology , from january 1 , 2009 , to december 31 , 2014 . ur was defined as those who had difficulties regardless of symptom duration or bladder pain in self - voiding despite enough volume of urine in the bladder or who had more than 300-ml postvoid residual urine volume checked by ultrasonography or urethral catheterization . the following clinical data were extracted from the medical records : patients ' age ; body mass index ; ambulatory status , noting the origin of the limitation ( e.g. , neurological , such as spinal cord injury and stroke , and nonneurological , such as arthritis and general weakness ) ; concurrent medical diseases ; medication use ; and history of surgery at three or more months ago from consultation date to the pelvic area , which carries the probability of affecting bladder function ( e.g. , neurological , gynecological , anorectal , and antiincontinence surgery ) ; pelvic bone fracture history . and , the patients having not experienced the surgery under general or spinal anesthesia within recent 3 months were considered to the patients managed with medical cares . we included the unevaluated patients having possible neurogenic bladder by patients ' history and neurologic status . in addition , administered drugs of retention group included medications or injections with known antimuscarinic effects such as antidepressants / antipsychotics , antiemetics , antihistamines , antimotility / antidiarrheal agents , antispasmodics / muscle relaxants , decongestants , dopaminergic agents . in addition , we included the drugs relating to awareness and storage function of bladder such as nonsteroidal antiinflammatory drugs , narcotics and diuretics for bladder filling velocity . statistical significance was determined by chi - square test . for the identification of the relationship between ur and patients ' characteristics , between january 1 , 2009 , and december 31 , 2014 , 6,522 patients were referred to our urology department , with 3,995 ( 61.3% ) presenting with complaints of lower urinary tract symptoms ( luts ) . among patients with luts , females were 1,593 patients ( 39.9% ) and of this group , 541 patients ( 34.0% ) had been undergoing nonsurgical management due to medical disorders . among these patients , 182 patients ( 33.6% ) were identified to ur and classified to retention group and the others to nonretention group . the descriptive characteristics of female patients complaining of luts managed nonsurgical treatments were : mean age of 70.9212.64 years ( retention group , 72.6412.94 ; nonretention group , 69.8912.29 ) , with 73.6% patients older than 65 years ; meanstandard deviation body mass index of 23.213.71 ( retention group , 22.943.10 ; nonretention group , 23.474.06 ) ; and limitation in ambulation in 28.5% ( retention group , 28.3% ; nonretention group , 30.0% ) with neurologic abnormalities affecting ambulation and the others in 18.2% ( retention group , 16.4% ; nonretention group , 19.3% ) ; and presence of comorbid conditions , with cardiovascular diseases ( hypertension , atherosclerosis , myocardial ischemia , and cardiomyopathy ) and diabetes mellitus being the most common in turn . the medical histories of patients in our study group is summarized in table 1 . among the patients in retention group , 118 ( 64.8% ) presented with multiple disorders , with 66 patients ( 36.3% ) having two disorders , 42 ( 23.1% ) having three disorders , and 10 ( 5.5% ) having four disorders . in addition , 42 patients ( 23.0% ) in retention group had a positive past history of surgeries , with 7.2% patients having undergone anti - incontinence surgery and 5.9% patients gynecological surgery . patients ' surgical history is summarized in table 1 . in univariate analysis , there were statistical significance in cardiovascular disorders , diabetes mellitus , metastatic malignancy , and chronic renal disorders ( table 1 ) . in multiple logistic regression analysis with these significant variables , cardiovascular disorders and metastatic malignancy were significantly associated with ur ( odd ratio , 0.491 ; p=0.002 and odd ratio , 2.616 ; p=0.013 , respectively ) ( table 2 ) . the patients with pelvic bone fracture were 2 patients in retention group , 1 patient in nonretention group . the patients with urinary tract infection were 43 patients ( 23.6% ) in retention group , 71 patients ( 19.8% ) in nonretention group . in the investigation of retention group about classes of taking drugs or injections , the most frequent prescribed agents were nonsteroidal anti - inflammatory drugs and the second agents were antidepressants / antipsychotics . the other prescribed agents were summarized in table 3 . among retention group , 48 patients ( 26.4% ) had been prescribed multiple drugs with known antimuscarinic effects , excluding the use of nonsteroidal anti - inflammatory drugs , narcotics , and diuretics . of these 48 patients , 32 ( 17.6% ) had been prescribed two different agents with antimuscarinic effect and 16 ( 8.8% ) three of these agents . ur is caused by impairment in bladder emptying and bladder outlet obstruction , resulting in a high residual postvoid urine volume . usually , -blockers and drainage procedures , such as intermittent catheterization or indwelling catheter , are used for the clinical management of ur . when properly treated , ur carries a low risk of morbidity . however , failure to identify and manage ur can result in serious clinical sequelae , including urinary tract infection , detrusor dysfunction and upper tract damage . the risk for postsurgical ramsey and palmer reported that common causes of female ur are anatomical , drugs , operative , neurological and infective components and elneil presented the etiologies of ur in women as dividing into mechanical or functional causes . detrusor underactivity is defined as a contraction of reduced strength and/or duration , resulting in prolonged bladder emptying within normal time span and patients with detrusor underactivity have urinary frequency , urgency , urge incontinence , weak stream , straining , residual urine sense and related to multifactorial etiopathogenesis . a review by jeong et al . of 1,817 patients with luts over the age of 65 years reported a prevalence of detrusor overactivity with impaired contractility in women , of 35.6% , with the prevalence increasing with age . in our study , patients with more than 65 years were 73.6% ( retention group , 66.4% ; nonretention group , 71.0% ; p=0.053 ) and we think that female inpatients with ur may be a little more related to their conditions needed for admission and more medical treatments . the association of luts with risk factors commonly linked to cardiovascular disease has previously been reported . reported an association between arterial occlusive disease and chronic bladder ischemia , while kupelian et al . identified an association between a history of heart disease and voiding symptoms , such as weak stream and straining , in women . a history of diabetes mellitus has also been associated to impairments in bladder function , including : paralysis of the detrusor muscle , leading to voiding difficulties ; impairments in detrusor muscle strength and function , structure of the urothelium ; and impairments in the innervation and/or central neurological control of bladder function . in our study , the most common medical conditions associated to ur were cardiovascular disorders and diabetes mellitus , noting that about 65% of patients had multiple medical comorbidities . in these patients , ur presented as either a chronic component of an ongoing medical condition or as an acute complication of the disease process . based on our results , we propose that evaluation of bladder function and bladder care should be included as a core component of the clinical management of patients with cardiovascular disorders , diabetes mellitus , metastatic malignancy , chronic renal disorders particularly . temporary postoperative urs were relatively frequent adverse event . in our study , the patients with surgical histories in retention group were 23.0% and the most common surgical history was anti - incontinence surgery with 7.2% . in our study , we could not find the significant surgical histories , thus surgical history may not be an important factor of ur . but , based on previous studies , prolonged retention lasting 4 weeks or longer after a transvaginal mesh sling is 2%-4% , higher rates in traditional pubovaginal facial slings and the burch urethropexy . therefore , we think that way of surgical operation may be more important than surgery itself for surgical indication in aspect to bladder dysfunction . in particular , use of antimuscarinics for the treatment of overactive bladder has been associated with an aggravation of voiding difficulty , which can result in acute or chronic ur in patients with detrusor overactivity or underactivity . in general , identified a variety of medications , which are commonly prescribed to patients with chronic medical diseases and for the management of pain and/or inflammation , to be associated with the development of chronic ur ; these include antidepressants , antiemetics , antihistamines , antispasmodics and dopaminergic agents , nonsteroidal anti - inflammatory drugs , anesthetics , -adrenoceptor agonist , benzodiazepines , and calcium channel antagonists . in retention group , nonsteroidal anti - inflammatory drugs were the most frequently prescribed medications , but with 26% of our patients taking multiple drugs with known antimuscarinic effects , excluding nonsteroidal anti - inflammatory drugs , narcotics and diuretics . although we could not compare with nonretention group about prescribed drugs , we propose that prescription of multiple medications may increase the risk for ur based on our results . further research is required to determine dose - effects of these medications on the risk for ur or compare between retention group and nonretention group . although infection and/or inflammatory disease of the urinary tract have been reported as causative factors of ur , it is unclear up to the present . in addition , urinary tract infection can be occurred as a complication of large postvoid residual urine volume and cause storage symptoms such as frequency , urgency rather than voiding symptoms . in our study groups , a urinary tract infection was identified in 24% of retention group and 19.8% of nonretention group . therefore , we think that female inpatients with urinary tract infections should be evaluated for bladder dysfunction having concept of complication by ur . first , our findings were derived f rom a single tertiary center using retrospective design . however , studies related to female ur were rare compared with postoperative ur or male ur . we think that a multicenter , prospective study with more detailed factors would be required to identify our result . in our study , ur in females managed with medical cares could be occurred occasionally and almost patients were elderly . if patients with ur were noticed at early state and managed with proper maneuvers , serious clinical sequelae from ur may be prevented . especially , we think that thorough attentions are needed for ur to patients with cardiovascular diseases , metastatic malignancy including diabetes mellitus , chronic renal disease , and urinary tract infection . in addition , we think that more careful interests are needed for luts when we manage patients using drugs with antimuscarinic effects .
purposewe aimed to analyze the characteristics of urinary retention ( ur ) in female inpatients managed with medical treatments.materials and methodswe retrospectively analyzed the medical records of female inpatients referred to the department of urology for ur at our institution from january 2009 , to december 2014 . ur was defined as a difficulty in self - voiding despite a sufficient urine volume or > 300-ml postvoid residual . the data included patients ' age , body mass index ( bmi ) , ambulatory status , medical and surgical history , classes of taking drugs , and urinary tract infection.resultsa total of 182 women were included as retention group , mean age of 72.6412.94 years and bmi of 22.943.10 kg / m2 . in the chi - square analysis , cardiovascular disorders ( p=0.000 ) , diabetes mellitus ( p=0.008 ) , metastatic malignancy ( p=0.008 ) , chronic renal disorders ( p=0.028 ) were found significantly . in the multiple logistic regression analysis , cardiovascular disorders ( p=0.002 ; odds ratio [ or ] , 0.491 ) , metastatic malignancy ( p=0.013 ; or , 2.616 ) were found to increase the risk of ur . the most common surgical history was anti - incontinence surgery ( 7.2% ) . in term of medication use , the most prescribed agents were nonsteroidal anti - inflammatory drugs ( nsaids ) ( 53.8% ) . the patients taking multiple drugs with antimuscarinic effects except of nsaids , narcotics and diuretics were 48 ( 26.4% ) . urinary tract infection was identified in 43 patients ( 23.6%).conclusionsur in females managed with medical treatments could be occurred occasionally . we think that thorough attentions are needed for ur to patients with cardiovascular disorders including diabetes mellitus , metastatic malignancy , chronic renal disorders urinary tract infection , and more careful interests when managing with drugs with antimuscarinic effects .
in malaria high - transmission areas , some population groups are at considerably higher risk of infection with plasmodium falciparum and development of malaria morbidity or mortality than others . malaria contributes significantly to perinatal disease burden in terms of pregnancy loss , prematurity due to preterm labor , and intrauterine growth retardation . malaria infection during pregnancy poses a substantial risk to the mother , her fetus , and the neonate . in areas of stable malaria transmission such as burkina faso , where adult women have considerable acquired immunity , plasmodium falciparum infection during pregnancy does not cause symptomatic malaria , but may lead to maternal anemia as well as placental and cord blood malaria infection , especially among primigravidae and secundigravida [ 24 ] . placental malaria is defined as the accumulation of plasmodium - infected erythrocytes in the intervillous space in the placenta , causing histologic changes including leukocyte - induced damage to the trophoblastic basement membrane . the placental infection does not reflect the existence of peripheral infection over a short period preceding the delivery or whether it is related to infection during pregnancy . susceptibility to this may be correlated to high exposure to malaria and repeated episodes of parasitemia during the pregnancy . vertical transmission of malaria from mother to foetus through the placenta and umbilical cord is defined as umbilical cord blood parasitemia . the transplacental transmission of plasmodium falciparum from mother to fetus has long been well - described [ 6 , 7 ] . the direct burden of neonatal malaria infection in terms of prevalence is not well - described in malaria endemic areas . in fact , the method used to identify congenital transmission is peripheral blood of newborns or umbilical cord blood . malaria parasites have been detected only rarely in the peripheral blood of newborns , whether the blood specimen is collected at the time of birth or hours later [ 8 , 9 ] . in studies in which both umbilical cord blood and infant peripheral blood were obtained at the time of birth , the parasite load in the babies ' peripheral blood has always been lower than that in the umbilical cord blood [ 911 ] . studies published so far have documented contradictory levels of this burden . in countries without endemic malaria , congenital malaria has occurred in children born to women who have immigrated from malarious areas . however , transplacental transmission of plasmodium falciparum has been found to be rare in malaria - endemic areas , ranging from about 1 to 5% [ 1215 ] . in contrast , data from recent studies on the burden of congenital and neonatal malaria , while scarce and contradictory , have indicated a high burden ( more than 15% ) in parts of sub - saharan africa [ 13 , 1518 ] . in burkina faso , the real prevalence of neonatal malaria is unknown but is estimated to be even higher . this assessment is based on presumptive malaria diagnosis . the present study was designed to determine the real burden of transplacental transmission , the risk factors associated with transplacental transmission , and the prevalence of cord blood and placental malaria parasitemia in malaria holoendemic area of burkina faso . these results represent a pooled analysis of studies on malaria prevention in pregnant women [ 4 , 19 , 20 ] examining umbilical cord blood to determine the frequency of transplacental transmission of plasmodium falciparum . the first study took place within six delivery units ( dus ) of the koupela health district , which is located around 120 km east of ouagadougou . both study sites have been extensively described elsewhere [ 4 , 19 , 20 ] . the study participants were pregnant women who voluntarily consented to participate in trials of malaria prophylaxis during pregnancy . they were encouraged to deliver at the health facility where the study samples were collected for processing . women delivering at the health facility , after giving informed consent , were asked a standard series of questions focused on sociodemographic characteristics , history of fever , antimalarial drug use , and the use of antimalarial chemoprophylaxis and bednets . placental blood films were prepared by identifying the maternal side of the placenta , wiping away excess blood , cutting into the surface , and placing pooled blood onto a slide . umbilical cord blood samples were obtained by wiping away excess blood from a clamped cord , piercing it with a lancet , and placing a drop of expressed blood on a slide . a detailed clinical examination was done on each newborn infant within 24 hours of delivery . neonates were weighted with an electronic digital scale ( 10 grams ) ( tanita corporation , tokyo , japan ) . the dubowitz scoring system was used to estimate gestational age , using findings from physical and neurologic examinations . scoring by apgar index was performed at delivery but was not recorded in this study . all blood films ( maternal , placental , and cord ) were stained with giemsa and examined for parasites at the centre national de recherche et de formation sur le paludisme immunoparasitology laboratory in ouagadougou . for thick films , parasites and leukocytes parasite densities were calculated according to the following formula : number of parasites counted 8000/number of leucocytes counted . if the ratio of densities from the first two readings was greater than 1.5 or less than 0.67 , or if fewer than 30 parasites were counted with a difference of more than 10 parasites between the two readings , the slide was evaluated a third time . the geometric mean of the parasite density of the two most concordant results of the three readings was taken as the final result . when the discordance was only in terms of positivity , the slide was also evaluated a third time and the definitive result was based on the majority verdict for positivity . blood film results were considered to be positive if any asexual - stage parasites were identified and negative if no parasites were seen in 100 high - power fields . prematurity was defined as a gestational age < 37 weeks as estimated by dubowitz examination . we defined low birth weight as a birth weight of < 2,500 g with a gestational age 37 weeks . data collected in the study questionnaire were verified , then double - entered , and validated with epiinfo , version 6.04 fr ( centers for diseases control and prevention , atlanta , usa ) . the analysis included data from births of all enrolled participants who delivered at the study centre clinic for whom data were available . continuous , normally distributed data were described by mean and standard deviation and nonnormally distributed data by the median or geometrical mean and range . proportions were compared using the chi - square test and normally distributed continuous variables were compared using student 's t - test . statistical results were considered significant , when the two - sided p value was < 0.05 . the study was discussed with health authorities and local leaders to obtain their assent . the study was reviewed and approved by the burkina faso ministry of health ethical committee . informed consent ( by signature or thumbprint ) was obtained after the consent document was read to the women in the local language . for illiterate mothers , in total , 1,374 women delivered at the health unit ; 1,309 women delivered singleton infants and provided data in the form of peripheral blood smear , placental blood , and umbilical cord blood . most of the women spoke moore , a language indigenous to this region of burkina faso . the mean age ( sd ) of the women was 23.90 5.89 years . the self - report indicated that ownership and use of insecticide - impregnated materials ( bed nets and/or curtains ) was reported by approximately one - third of the women . the rate of use of insecticide - impregnated materials ( bed nets and/or curtains ) was very low in the study population . all of the women used drug prophylaxis during their pregnancy ( iptp / sp or weekly prophylaxis with chloroquine ) . primigravidae comprised 35% of the total sample size , and primigravidae and secundigravida together made up 56% of the total sample size . other complications during the delivery included peripartum haemorrhage , placental retention , and retroplacental haemorrhage . fifty stillbirths ( 3.6% ) and 18 ( 1.3% ) miscarriages occurred at the dus . the weight range of babies was 700 g to 4,700 g with a mean weight of 2,875 450 g. sixteen percent of the babies presented low birth weight at delivery ( table 1 ) . indeed , of the 1,309 pregnant women , plasmodium falciparum was detected in peripheral blood from 369 ( 28.2% ) of the women at the time of delivery . overall , the geometric mean of the maternal peripheral parasite density was 1,106.47 ( 95% ci 871.581404.67 ) parasites/l . plasmodium falciparum was detected in the placentas of 255 ( 19.5% ) women ; 28.5% of these belonged to primigravidae and 11.4% to multigravidae . the difference in infection between the primigravidae and the multigravidae was statistically significant ( p < 0.0001 ) . umbilical cord blood parasitemia with plasmodium falciparum was detected in 18 ( 1.4% ) babies , and the geometric mean umbilical cord blood parasitemia was 315.69 ( 95% ci 87.021145.20 ) parasites/l . of these , 2.4% ( 11 ) belonged to primigravidae and 0.5% ( 3 ) to multigravidae . of the 18 babies with plasmodium - falciparum - positive umbilical cord blood parasitemia , 17 were positive for trophozoites and 1 was positive for schizonts only . both schizonts and trophozoites were present in seven babies , and one newborn had a triple - positive association ( trophozoite + schizont + gametocyte ) . five newborns ( 27.8% ) out of the 18 infected with plasmodium falciparum had low birth weight . out of 369 ( 28.2% ) women with peripheral positive parasitemia , 211 ( 57.2% ) had positive placental malaria and 14 ( 3.8% ) had malaria parasites in the umbilical cord blood . eleven ( 5.2% ) of the 211 ( 57.2% ) women with positive placental smears for malaria had malaria parasites in the umbilical cord blood . of the 18 babies infected with plasmodium falciparum , 14 ( 77.8% ) were born from mothers with positive peripheral parasitemia . for two newborns with plasmodium falciparum infection , no peripheral or placental infection was found in the mother . none of the babies with cord blood positive for malaria had fever within the first 24 h of life . the number of pregnant women with peripheral , placental , and umbilical infection and high peripheral parasitemia ( > 10,000 parasites/l ) decreased with increasing gravidity ( table 2 ) . the combination of being born to a mother with both peripheral and placental infection conferred a greater likelihood of infection of the baby ( 61% ) . being born with only maternal peripheral infection reduced the likelihood of having umbilical cord parasitemia ( 17% ) . there was an association between umbilical cord blood infection and maternal peripheral infection ( p < 0.001 ) . being born with only placental infection reduced the rate of umbilical cord parasitemia ( 11% ) . there was also an association between umbilical cord blood infection and placental infection ( p < 0.001 ) ( table 3 ) . being born to a mother with maternal peripheral parasite density 5,000 parasites/l or placental parasite density 10,000 parasites/l conferred a greater likelihood of umbilical cord parasitemia ( table 3 ) . we further examined the correlation between risk factors and the presence or absence of umbilical cord parasitemia to determine possible factors that might affect infection with malaria parasites in umbilical cord blood . univariate logistic regression analysis indicated that being born with maternal parasitemia , being born with maternal parasite density 5,000 parasites/l , being born with placental parasitemia , being born with placental parasite density between 1,0004,999 parasites/l , being born with placental parasite density 10,000 parasites/l , and being born in a first pregnancy were all associated with the presence of umbilical cord blood parasitemia . low birth weight was not associated with umbilical cord blood parasitemia ( table 3 ) . low maternal peripheral and placental parasitemia , prematurity , use of impregnated bednets , low birth weight , and female sex were independent risk factors for infection in the babies . on multivariate logistic regression , none of the seven factors that were significant on univariate logistic regression remained significant ( table 4 ) . this study shows the burden of malaria in pregnant women at the delivery unit in a malaria - endemic area of burkina faso . this is similar to the rate reported in other countries in sub - saharan africa [ 2 , 21 ] . previously reported prevalence rates of placental parasitemia in africa have been highly variable , ranging from 17.2% to 57% [ 11 , 2224 ] . many hypotheses , based on a systemic or local failure of the immunological response to malaria , have been proposed to explain the preference of the parasites for replication in the placenta . the malaria rate in umbilical cord blood was low in the study population , occurring in 1.4% of all newborns , in 5.2% of babies born from mothers with peripheral and placental malaria infection , and in 5.1% of babies born from women with placental malaria infection only . previously reported rates from different parts of africa are highly variable , ranging from 0% to 54% [ 11 , 22 , 24 , 26 , 27 ] . the low rate in the present study , which is comparable to rates reported in some previous manuscripts , could be explained by effective prevention of malaria during pregnancy . in fact , it has now been proven that malaria parasites identified in cord blood are acquired antenatally by transplacental transmission of infected erythrocytes . the mechanisms underlying congenital transmission , according to an earlier report , include maternal transfusion into the fetal circulation either at the time of delivery or during pregnancy , through direct penetration through the chorionic villi , or through premature separation of the placenta [ 28 , 29 ] . pregnant women , who have received antimalarial treatment , should be able to clear parasitemia to avoid umbilical cord transmission . transplacental transmission of malaria appears to occur infrequently ; it may be possible that after transplacental transmission , some elements of immunity , acquired from the mother , protect the infants from becoming infected . this resistance may reflect , among other things , the physical barrier of the placenta to infected red cells , the passive transfer of maternal antibodies , and/or the poor environment afforded by fetal erythrocytes for plasmodial replication , due to their fetal hemoglobin composition and low free - oxygen tension . first , the high efficacy of malaria prophylaxis during this study may have allowed the women to clear their parasitaemia and therefore prevent placental and transplacental transmission of the infection to their babies . second , our sole use of microscopy may have led to underdiagnosis , since this method has lower sensitivity than the newer molecular methods , such as real - time pcr , used in other studies [ 22 , 29 ] . finally , it might be that our numbers reflect the true prevalence of infection , as compared with data collected during routine services , in which lack of quality control of the reading of smears could lead to an overestimation of the infection rate . univariate analysis of the association of risk factors with the presence or absence of umbilical cord parasitemia revealed seven risk factors that was associated with plasmodium falciparum parasitemia in umbilical cord blood . the presence of maternal peripheral parasitemia , placental parasitemia , high - density peripheral parasitemia , high - density placental parasitemia , and primigravid status was associated with an increased risk of malaria parasitemia in cord blood . however , in multivariate analysis , these associations failed to reach statistical significance . maternal peripheral blood parasitemia was associated with umbilical cord blood parasitemia ( or = 9.24 , p < 0.001 ) . four cases of umbilical cord blood parasitemia occurred in pregnancies not complicated by maternal peripheral malaria infection . there were also associations between placental and cord blood parasitemia ( or = 10.74 , p < 0.001 ) , and between cord blood / placental and maternal peripheral parasitemia . five cases of umbilical cord blood parasitemia occurred in pregnancies not complicated by placental malaria infection . earlier studies of transplacental malaria reported these associations [ 11 , 18 , 24 , 30 ] . a strong association between placental malaria and umbilical cord blood parasitemia has been reported , and this was suggested to be responsible for congenital malaria . however , whether the presence of plasmodium falciparum malaria parasites in umbilical cord blood denotes infection acquired antenatally or contamination with infected maternal blood at delivery is not clear . these associations suggest that clearing maternal and placental parasitemia with effective antimalarial drugs before delivery could prevent transplacental transmission of parasitemia . the density of maternal peripheral parasitemia ( > 5,000 parasites/l ) was an important determinant of the likelihood of umbilical cord blood parasitemia ( or = 5.29 , p = 0.004 ) . the density of placental parasitemia ( > 10,000 parasites/l ) was also an important determinant of the likelihood of umbilical cord parasitemia ( or = 4.91 , p = 0.03 ) . conversely , previous reports , showing low rates of transplacental transmission of malaria , suggest that the placental barrier is very effective in the case of very low malaria parasite density . finally , univariate analysis showed that being born from a first pregnancy was also linked to umbilical cord blood parasitemia ( or = 2.96 , p = 0.02 ) . our data indicate that the rate of mother - to - child transmission of malaria , defined as positive umbilical cord blood parasitemia , appears to be low . the low level of parasitaemia in cord blood suggests that contamination probably occurs during the labour period . maternal , placental , and high density parasitemia were all associated with umbilical cord parasitemia . prevention of malaria during pregnancy with effective antimalarial drugs should reduce the risk of infection for newborns .
malaria congenital infection constitutes a major risk in malaria endemic areas . in this study , we report the prevalence of transplacental malaria in burkina faso . in labour and delivery units , thick and thin blood films were made from maternal , placental , and umbilical cord blood to determine malaria infection . a total of 1,309 mother / baby pairs were recruited . eighteen cord blood samples ( 1.4% ) contained malaria parasites ( plasmodium falciparum ) . out of the 369 ( 28.2% ) women with peripheral positive parasitemia , 211 ( 57.2% ) had placental malaria and 14 ( 3.8% ) had malaria parasites in their umbilical cord blood . the umbilical cord parasitemia levels were statistically associated with the presence of maternal peripheral parasitemia ( or = 9.24 , p 0.001 ) , placental parasitemia ( or = 10.74 , p 0.001 ) , high - density peripheral parasitemia ( or = 9.62 , p 0.001 ) , and high - density placental parasitemia ( or = 4.91 , p = 0.03 ) . in burkina faso , the mother - to - child transmission rate of malaria appears to be low .
adherens junctions ( ajs ) are cell - cell adhesion sites where calcium - dependent cadherin receptors bind with their extracellular domains to cadherins on opposing cells and with their cytoplasmic tails connect via adaptors to filamentous actin [ 1 , 2 ] . by essentially providing a physical link between the actin cytoskeleton of neighboring cells additionally , ajs are instrumental in setting up and maintaining the apicobasal polarity of epithelial cells [ 3 , 4 ] , they function as mechanosensors and serve as a nexus for signaling affecting important cell decisions , such as survival and differentiation . during the development and lifetime of an organism , cells frequently change shape and position relative to their neighbors . hence , the ability of cells to regulate their adhesive interactions plays a key role during tissue morphogenesis , repair , and renewal [ 3 , 7 , 8 ] . defects in the adhesive characteristics of epithelial cells are pathological signs and loss of cell - cell adhesion can generate dedifferentiation and invasiveness of human carcinoma cells . thus , there is great interest in understanding the factors that affect assembly and disassembly of cell - cell adhesion at the molecular level . when considering regulatory mechanisms controlling aj proteins , we distinguish between three subsequent steps of regulation : synthesis , localization , and activation . indeed , transcriptional regulation of e - cadherin , notably by the snail transcription factor , plays an important role in the breaking down of ajs accompanying epithelial to mesenchymal transition . once a protein is expressed the cell can determine its localization by controlling its transport . in fact , both exocytosis and endocytosis of e - cadherin are tightly controlled and the balance between the two processes has been shown to regulate aj turnover both in vitro and in vivo . finally , a cell can control the activity and interactions of a protein at a given location by posttranslational modifications . these modifications include glycosylation , lipidation , ubiquitination , acetylation , proteolysis , and phosphorylation . phosphorylation of tyrosine ( y ) , serine ( s ) , or threonine ( t ) residues , the topic of this review , is a rapid and reversible form of regulation affecting the majority of aj proteins [ 1216 ] . in some cases , posttranslational modifications have secondary effects on transcription and/or protein transport [ 17 , 18 ] . however , here we will focus on the more direct mechanisms in which ajs are regulated by phosphorylation . first , we will introduce the enzymes responsible for phosphorylation and dephosphorylation at ajs and discuss how they are recruited into aj and activated . next , we will describe the targets of phosphorylation within aj and by examining the consequences of specific phosphorylation events will show how phosphorylation is involved both in assembly and disassembly of aj , essentially driving the dynamics of this highly responsive structure . in the end , we will point out open questions and suggest methods to address them . so far , twelve s / t kinases and one s / t phosphatase have been implicated in regulating phosphorylation of aj proteins , and they are all cytoplasmic ( table 1 ) . prominent kinases in this group include pkc- , camp - dependent protein kinase , casein kinase 1 , pak1 , and rock1 . nine tyrosine kinases and twelve tyrosine phosphatases have been shown to be active in aj , roughly half of them cytoplasmic and half part of a transmembrane receptor ( table 1 ) . prominent tyrosine kinases include the cytoplasmic src , fyn , fer , and abl , and the receptors of epidermal and hepatocyte growth factors . major phosphatases involved are the cytoplasmic ptp-1b , ptp - pest , shp-1 , shp-2 , and receptor - type tyrosine - protein phosphatases mu , u , and kappa . some of these kinases and phosphatases have been localized to aj by immunofluorescence ( e.g. , [ 1921 ] ) and others have been shown to associate with aj by coimmunoprecipitation ( e.g. , [ 2123 ] ) , but the exact mechanism of recruitment into aj of most of them is largely unknown . a few were shown to bind directly with cadherin , such as csk with ve - cadherin and ptp-1b with e- and n - cadherin [ 19 , 24 , 25 ] ; others bind one of the catenins ( adaptor proteins linking cadherin with actin ) , such as met and ptprf with -catenin [ 26 , 27 ] and rock1 with p120-catenin ; some interact with other aj adaptor proteins , such as prkca with vinculin and rock1 with shroom3 [ 28 , 29 ] . while it is most likely every kinase and phosphatase can recognize at least one docking site within the aj , it is not currently known which of the kinases and phosphatases reside in aj permanently and which are transient components , homing in to phosphorylate or dephosphorylate aj proteins only under specific conditions . even permanent residents may not always be active , as most kinases and phosphatases need themselves to be activated . receptor tyrosine kinases are commonly activated by an external ligand , such as a growth factor or cytokine , which induces dimerization , cis - phosphorylation or autophosphorylation and activation of the catalytic domain [ 124 , 125 ] . receptor tyrosine phosphatases may be activated by homophilic association with their counterparts on neighboring cells , as well as by tyrosine phosphorylation . several s / t kinases are activated by binding of rho gtpases , for example rock1 is activated by rhoa and pak1 is activated by rac1 and cdc42 [ 128 , 129 ] . s / t kinases are also regulated by tyrosine phosphorylation and tyrosine kinases and phosphatases are regulated by s / t phosphorylation , in a complex web of feedback and feedforward loops that is poorly understood ( figure 1 ) . for example , src phosphorylates prkcd , which phosphorylates ptpn6 , which in turn dephosphorylates src ( feedback ) [ 130132 ] ; prkaca phosphorylates src and csk , and csk also phosphorylates src ( feedforward ) [ 133135 ] . as will be discussed further below , some of the phosphorylation events serve to activate the kinases or phosphatases and others are inhibitory . one well - understood example of kinase activation is the mechanism of activation of src . as reviewed in , the family of src tyrosine kinases can be found in a nonactive closed conformation or in an open active conformation , depending on the phosphorylation status of a tyrosine residue at the c - terminus . when this residue is phosphorylated , it interacts with an sh2 domain in the middle of src , blocking the catalytic site . upon dephosphorylation of this specific tyrosine , the sh2 domain is released , and the protein unfolds , allowing autophosphorylation of another tyrosine residue situated within the enzyme 's activation loop , rendering the kinase fully active . it is important to point out that cadherin ligation and clustering may act as an activation signal for some kinases . most notably , src and fer have been shown to be recruited to the membrane upon cadherin binding [ 138 , 139 ] , and egfr signaling was shown to be stimulated by aj formation independently of egf ligand . furthermore , cadherin clustering has been found to indirectly induce activation of rho gtpases , which in turn could activate s / t kinases . the first , in the plane of the membrane , is where cadherins and other transmembrane proteins , such as nectin and ajap1 , reside . the next layer consists of membrane - bound adaptors , such as erm proteins and magi1 , and adaptors that directly bind transmembrane proteins , such as p120- and -catenin ( bind cadherin ) and afadin ( binds nectin ) . the following layer is composed of adaptor proteins , such as -catenin and vinculin , which bind to the second layer adaptors and also bind f - actin . f - actin , along with actin - binding proteins , such as -actinin , and actin regulators , such as cortactin , would be considered the last layer . regulatory proteins , such as gaps , gefs , and gtpases , can be found throughout the aj as reviewed in [ 14 , 142 ] . there is evidence demonstrating both y and s / t phosphorylation of proteins in all layers of the aj ( table 2 ) . as illustrated in figure 1 , often the same kinase will phosphorylate proteins from different layers . for example , abl phosphorylates actin regulators wasp and vasp [ 143 , 144 ] , as well as cadherin - bound adaptor -catenin and second layer adaptors abi2 and vinexin ( sorbs3 ) [ 146 , 147 ] . some aj proteins have additional functions in the cell , and phosphorylation is also involved in regulating their non - aj roles . the most notable example is -catenin , which plays an important role in the wnt signaling pathway as a cotranscription factor of tcf / lef . whether nonjunctional -catenin will reach the nucleus or not depends on whether it is phosphorylated by gsk3 and casein kinse i in the destruction complex . however , such phosphorylation events taking place outside the context of aj are beyond the scope of this paper . for the phosphorylation events occurring within aj an important question a phosphorylated tyrosine , serine , or threonine residue can affect a protein in three major ways : it can increase the affinity for another protein , it can inhibit a protein - protein interaction , or it can activate enzymatic activity . in proteins with an intramolecular interaction , phosphorylation and dephosphorylation can elicit a conformational change in the protein . aj components provide examples of each type of these outcomes , as detailed henceforth . ( 1 ) turn on protein - protein interaction tyrosine phosphorylation can create a docking site for an sh2 or ptb domain of a partner protein . for example , tyrosine phosphorylation of cadherin creates docking sites for the sh2 domain of the adaptor shc1 and the ptb domain of the cell polarity protein numb . as mentioned earlier , src family kinases are inhibited by an intramolecular interaction between a central sh2 domain and a phosphorylated tyrosine at the c - terminus . tyrosine phosphorylation can create a docking site for an sh2 or ptb domain of a partner protein . for example , tyrosine phosphorylation of cadherin creates docking sites for the sh2 domain of the adaptor shc1 and the ptb domain of the cell polarity protein numb . as mentioned earlier , src family kinases are inhibited by an intramolecular interaction between a central sh2 domain and a phosphorylated tyrosine at the c - terminus . ( 2 ) turn off protein - protein interaction examples of interaction inhibition by phosphorylation are also found both between different proteins and intramolecularly : tyrosine phosphorylation of ve - cadherin at certain residues prevents the binding of p120-catenin and -catenin ; phosphorylation of a threonine residue in the c - terminal actin binding domain of erm proteins interferes with its interaction with the n - terminal ferm domain , helping to keep the protein in an active open conformation . examples of interaction inhibition by phosphorylation are also found both between different proteins and intramolecularly : tyrosine phosphorylation of ve - cadherin at certain residues prevents the binding of p120-catenin and -catenin ; phosphorylation of a threonine residue in the c - terminal actin binding domain of erm proteins interferes with its interaction with the n - terminal ferm domain , helping to keep the protein in an active open conformation . ( 3 ) turn on enzymatic activity activation of the catalytic activity of tyrosine kinases and phosphatases by tyrosine phosphorylation has already been mentioned above . another important example is the activation of the motor activity of myosin by the phosphorylation of serine and threonine residues of myosin light chain . activation of the catalytic activity of tyrosine kinases and phosphatases by tyrosine phosphorylation has already been mentioned above . another important example is the activation of the motor activity of myosin by the phosphorylation of serine and threonine residues of myosin light chain . we next address the question what are the ramifications of phosphorylation of aj proteins on aj structure and dynamics . numerous experiments have been carried out over the years to address the role of y and s / t phosphorylation in regulating aj . early experiments used broad - spectrum chemical inhibitors of kinases or phosphatases to conclude that phosphorylation negatively impacts cadherin function . for example , inhibition of s / t phosphatases by okadaic acid or calyculin - a was reported to lead to complete disassembly of aj within an hour , and this disruption was attributed to an increase in s / t phosphorylation of -catenin . however , calyculin - a has also been shown to increase actomyosin contractility in cells , suggesting that the disruption of aj in the above mentioned study may have been caused by mechanical tension at the junctions exceeding their adhesive strength . inhibition of tyrosine phosphatases with sodium orthovanadate was reported to lead within minutes to a dramatic increase in phosphotyrosine signals at aj , followed by the disassembly of aj . consistent with the notion that excessive tyrosine phosphorylation in aj causes their disassembly , cells expressing constitutively active src kinase lost their aj , and inhibition of tyrosine kinase activity by the drug tyrphostin was able to restore aj in the src - transformed cells . these and similar experiments have led researchers in the late 90s of the previous century to the general conclusion that phosphorylation is a negative regulator of aj . however , in more recent years , there is accumulating evidence for a positive role of phosphorylation in aj assembly , mainly coming out of loss - of - function experiments of specific kinases . for example , src and fyn were found to be essential for the formation of aj in mouse keratinocytes . moreover , src activity was shown in vitro to be important for the recruitment of pi3k to aj and the ability of cells to expand nascent cadherin - adhesive contacts . along the same lines , abl1 tyrosine kinase activity was shown to be important for the maintenance of adherens junctions in epithelial cells , and s / t phosphorylation of e - cadherin by protein kinase d1 ( prkd1 ) was found to be associated with increased cellular adhesion and decreased cellular motility in prostate cancer . hence , the emerging view is that it is not possible to generalize the effect of phosphorylation on aj . with some phosphorylation events leading to the switching on of a protein or interaction and other phosphorylation events , even on the same protein , serving as a switch off , the effect of phosphorylation on aj dynamics has to be examined on a residue - by - residue basis . after we delineate the effect of each individual phosphorylation event , we should be able to integrate this information into a single network of interconnected switches and perhaps then we can follow the global effects of a single phosphorylation switch , starting , for example , with hepatocyte growth factor stimulation . we close this paper by giving a few examples of cases in which the consequences of specific phosphorylation events are known . the phosphorylation events presented occur on proteins from each layer of the aj as well as one cell polarity protein . ( 1 ) cadherin serine phosphorylation of residues s840 , s851 and s853 in the c - terminus of human e - cadherin ( likely by csnk1e or prkd1 ) increases the binding affinity towards -catenin , whereas phosphorylation of s846 is said to inhibit the same interaction . stronger binding of -catenin to e - cadherin is conducive to a stronger aj structure . tyrosine phosphorylation of ve - cadherin at two critical tyrosines , y658 and y731 , is sufficient to prevent the binding of p120- and -catenin , respectively . phosphorylation by src of three tyrosines in position 753755 on human e - cadherin creates a docking site for the e3-ligase hakai . ubiquitination of e - cadherin by hakai leads to internalization of e - cadherin facilitating disassembly of the aj [ 162 , 163 ] . serine phosphorylation of residues s840 , s851 and s853 in the c - terminus of human e - cadherin ( likely by csnk1e or prkd1 ) increases the binding affinity towards -catenin , whereas phosphorylation of s846 is said to inhibit the same interaction . stronger binding of -catenin to e - cadherin is conducive to a stronger aj structure . tyrosine phosphorylation of ve - cadherin at two critical tyrosines , y658 and y731 , is sufficient to prevent the binding of p120- and -catenin , respectively . phosphorylation by src of three tyrosines in position 753755 on human e - cadherin creates a docking site for the e3-ligase hakai . ubiquitination of e - cadherin by hakai leads to internalization of e - cadherin facilitating disassembly of the aj [ 162 , 163 ] . ( 2 ) p120-catenin eight tyrosine residues in the n - terminus of p120-catenin can be phosphorylated by src . upon phosphorylation , these sites serve as docking sites for the recruitment of interacting proteins carrying sh2 domains , such as the tyrosine phosphatase shp-1 . under certain conditions tyrosine phosphorylation of p120-catenin was shown to increase its affinity to cadherin , while in other instances such an increase was not observed ( reviewed in ) . the affinity of p120-catenin to cadherin is significant for aj dynamics because p120-catenin protects cadherin from being internalized . eight tyrosine residues in the n - terminus of p120-catenin can be phosphorylated by src . upon phosphorylation , these sites serve as docking sites for the recruitment of interacting proteins carrying sh2 domains , such as the tyrosine phosphatase shp-1 . under certain conditions tyrosine phosphorylation of p120-catenin was shown to increase its affinity to cadherin , while in other instances such an increase was not observed ( reviewed in ) . the affinity of p120-catenin to cadherin is significant for aj dynamics because p120-catenin protects cadherin from being internalized . ( 3 ) zyxin phosphorylation of s142 of zyxin is thought to result in the release of an intramolecular head - tail interaction . opening of the protein expose its acta repeats that recruit vasp , whose actin polymerization activity ( see below ) is important for aj assembly and maintenance . since zyxin - mediated recruitment of vasp has a positive effect on aj [ 167 , 168 ] , it is not surprising that expression of a zyxin phosphomimetic mutant results in ultrastable aj . phosphorylation of s142 of zyxin is thought to result in the release of an intramolecular head - tail interaction . opening of the protein expose its acta repeats that recruit vasp , whose actin polymerization activity ( see below ) is important for aj assembly and maintenance . since zyxin - mediated recruitment of vasp has a positive effect on aj [ 167 , 168 ] , it is not surprising that expression of a zyxin phosphomimetic mutant results in ultrastable aj . ( 4 ) vasp ( vasodilator stimulated phosphoprotein)as its name suggests , vasp is often found phosphorylated in cells . three phosphorylation sites on residues s157 , s239 , and t274 are phosphorylated by pka and pkg , as well as pkc [ 169 , 170 ] and dephosphorylated by unknown phosphatase / s . the phosphorylation of vasp was shown to reduce its affinity towards actin and essentially turn off its actin bundling and anticapping / elongation activity [ 171 , 172 ] . vasp - mediated actin elongation is important for the formation of aj and for the maintenance of actin structures associated with aj [ 173 , 174 ] . thus , the consequence of vasp phosphorylation is to negatively regulate aj assembly and maintenance . three phosphorylation sites on residues s157 , s239 , and t274 are phosphorylated by pka and pkg , as well as pkc [ 169 , 170 ] and dephosphorylated by unknown phosphatase / s . the phosphorylation of vasp was shown to reduce its affinity towards actin and essentially turn off its actin bundling and anticapping / elongation activity [ 171 , 172 ] . vasp - mediated actin elongation is important for the formation of aj and for the maintenance of actin structures associated with aj [ 173 , 174 ] . thus , the consequence of vasp phosphorylation is to negatively regulate aj assembly and maintenance . ( 5 ) pard3 in drosophila epithelial cells the par-3 ortholog bazooka is confined to aj as a result of phosphorylation by either apical or basal polarity complexes . at the apical side of cells bazooka is phosphorylated by apkc , resulting in its release from the cortex [ 175 , 176 ] . in the basolateral membrane par1 kinase recently , it was shown that the ratio between par-1 and apkc determines the position of bazooka and aj along the lateral side and a reduction in par-1 kinase activity leads to a basal shift of aj followed by folding of the epithelial sheet . in drosophila epithelial cells the par-3 ortholog bazooka is confined to aj as a result of phosphorylation by either apical or basal polarity complexes . at the apical side of cells bazooka is phosphorylated by apkc , resulting in its release from the cortex [ 175 , 176 ] . in the basolateral membrane par1 kinase recently , it was shown that the ratio between par-1 and apkc determines the position of bazooka and aj along the lateral side and a reduction in par-1 kinase activity leads to a basal shift of aj followed by folding of the epithelial sheet . from the examples presented above , it is clear that phosphorylation switches play a pivotal role in regulating aj assembly and disassembly dynamics . at the same time it is also clear that our knowledge is only scratching the surface of the phosphorylation network regulating aj . for the majority of known phosphorylation events in aj , we know either of a kinase or of a phosphatase involved , but rarely do we know both . furthermore , while traditional biochemistry techniques have facilitated the characterization of a handful of phosphorylation events on aj proteins , phosphoproteomic data indicates that the majority of aj proteins are phosphorylated on multiple serine / threonine and tyrosine residues . phosphoproteomics , which utilizes a variety of techniques to label cells , enrich for phosphorylated peptides and identify them using mass - spectrometry ( reviewed in [ 179181 ] ) , not only highlights the hole in our knowledge but also offers the means to fill it . phospho - proteomics offers an unbiased and comprehensive snapshot of phosphorylation events , and several different approaches can be taken to elucidate phosphorylation switches in aj : during normal assembly and maturation , following a signal for disassembly , or when a certain kinase or phosphatase is activated or missing ( e.g. , [ 39 , 182184 ] ) . the phospho - proteomic data obtained , especially if it is dynamic , can be used for a systems level analysis of phosphorylation switches in aj [ 185 , 186 ] , but it seems likely to us that before the network can be modeled in a meaningful way more in depth characterization of specific phosphorylation events will be necessary , using cell biological techniques . while for the discovery and mapping of phosphorylation events in aj , one wants to be as comprehensive as possible , when it comes to characterizing a particular switch the more specific the tools , the better . one example of a specific tool is phosphorylation site - specific antibodies , such as those recognizing individual phosphorylation events on -catenin and p-120-catenin [ 187 , 188 ] . another example are site - specific phospho - mimetic or nonphosphorylatable mutations , such as those successfully applied to the study of the effects of phosphorylation on cortactin , vasp , ve - cadherin , zyxin , and paxillin [ 153 , 166 , 189191 ] . facing an ever - changing landscape of forces and signaling cues , a cell must respond rapidly by adjusting the strength of its ajs according to need . for this phosphorylation is particularly suitable for regulating the balance between assembly and disassembly as it is rapid and affects the aj proteins directly . feedback loops must guarantee a combination of phosphorylated residues at aj that matches the requirements for a given condition . experiments have shown that when it comes to phosphorylation both all on and all off the challenge now is to elucidate the mechanisms by which the cell maintains a just right level of phosphorylation in aj . while phosphorylation is probably the most prominent regulatory switch controlling cell adhesion , other switches , such as gtpases , lipids and proteases , do exist . a future challenge , therefore , will be to integrate the phosphorylation switch network with the other regulatory switches to facilitate a true understanding of how different signaling pathways and force regulate aj dynamics .
adherens junctions connect the actin cytoskeleton of neighboring cells through transmembrane cadherin receptors and a network of adaptor proteins . the interactions between these adaptors and cadherin as well as the activity of actin regulators localized to adherens junctions are tightly controlled to facilitate cell junction assembly or disassembly in response to changes in external or internal forces and/or signaling . phosphorylation of tyrosine , serine , or threonine residues acts as a switch on the majority of adherens junction proteins , turning on or off their interactions with other proteins and/or their enzymatic activity . here , we provide an overview of the kinases and phosphatases regulating phosphorylation of adherens junction proteins and bring examples of phosphorylation events leading to the assembly or disassembly of adherens junctions , highlighting the important role of phosphorylation switches in regulating their dynamics .
as a part of commonly known traditional chinese medicinal plants , radix polygalae ( rp ) can be obtained from polygala tenuifolia willd . and p. sibirica l. , which are listed in the chinese pharmacopoeia ( 2010 ) ; rp elicits sedative , antipsychotic , expectorant , and anti - inflammatory effects . high consumption and decreased regeneration of wild resources of rp have prompted researchers to domesticate and cultivate it and a large - scale planting has been performed since early 1980s . thus far , rp from p. tenuifolia has been the most commonly used variety , so p. tenuifolia was used in this study . p. tenuifolia is a perennial herb mainly distributed in northeast , north , and northwest of china . this herb contains various medicinal components , such as saponins , xanthones , and oligosaccharide esters , which exhibit tonic , sedative , antipsychotic , expectorant , and other pharmacological effects . in previous studies , chemical and pharmacological properties of triterpenoid saponins , one of the most important medicinal components of p. tenuifolia , however , studies on the biosynthetic pathway of triterpenoid saponins in p. tenuifolia have been rarely conducted compared with those in licorice , ginseng , notoginseng , quinquefolius , and salvia [ 37 ] . for instance , fourteen nucleotide sequences have been deposited in the ncbi genbank database until august 2015 ; among these sequences , six are related to the biosynthetic pathway of triterpenoid saponins in p. tenuifolia . the lack of sequence data has limited extensive and intensive studies on p. tenuifolia ; nevertheless , genomic research related to this medicinal plant is feasible . with the medicinal and economic importance of p. tenuifolia , genomic data sources of this plant species after years of improvement , next - generation sequencing ( ngs ) has been developed in terms of speed and accuracy with reduced cost and manpower . typical examples of ngs include solid / ion torrent pgm from life sciences , genome analyzer / hiseq 2000/miseq from illumina , and gs flx titanium / gs junior from roche . among these techniques , illumina hiseq 2000 yields the largest output and entails the lowest reagent cost ; this technique has been commonly used in deep sequencing of model and nonmodel organisms . for example , illumina hiseq 2000 has been successfully applied in a wide range of species , including model plants ( arabidopsis , rice , tomato ) [ 1012 ] , and crops with large genomes , including field pea , castor , and sorghum propinquum [ 1315 ] . this technique could promote studies on not only the genomics of these plants but also the biosynthetic pathways of the main active ingredients . triterpenoid saponins , xanthones , and oligosaccharide esters are currently considered as the main active ingredients of p. tenuifolia . however , small amounts of secondary metabolites , such as isoquinoline alkaloids , lignins , and flavonols , are present in p. tenuifolia . indeed , illumina sequencing should be applied to determine the number of enzymes implicated in the biosynthetic pathway of secondary metabolites in p. tenuifolia . to date , the biosynthetic pathway of triterpenoid saponins , particularly pentacyclic triterpenoid saponins in p. tenuifolia , has been extensively studied . the formation of a primary cucurbitane skeleton via the isoprenoid pathway is before the cyclization of 2,3-oxidosqualene of terpenoid biosynthesis in plant . mevalonate acid ( mva ) pathway located in cytoplasm and endoplasmic reticulum , and 2-c - methyl - d - erythritol-4-phosphate/1-deoxy - d - xylulose-5-phosphate ( mep / doxp ) pathway located in plasmid , which are likely to participate in the formation of a presenegenin skeleton in p. tenuifolia . these two pathways are present in the different cellular parts of green plants [ 17 , 18 ] . phenylalanine is an end product of the shikimate pathway , in which the aromatic amino acids tyrosine and tryptophan are also produced . with phenylalanine as a precursor , lignin biosynthesis proceeds via a series of side - chain modifications , ring hydroxylations , and o - methylations to yield lignin monomers . in this pathway , other small molecules , such as flavonoids , coumarins , hydroxycinnamic acid conjugates , and lignans , therefore , whole transcripts for complete gene expression profiling should be identified by transcriptome sequencing because of limited genomic sources and information regarding the biosynthetic pathways of secondary metabolites in p. tenuifolia . it will support further studies on these two metabolic pathways by using high - throughput illumina deep - sequencing techniques . in this study , a cdna library was constructed to obtain detailed and general data from p. tenuifolia by using a high - throughput illumina deep - sequencing technique . we could determine genes encoding the enzymes involved in whole biosynthetic pathways of triterpenoid saponins , phenylpropanoids , and other secondary metabolites , and results could promote further analysis . furthermore , our results could provide direct experimental data of p. tenuifolia not only for guiding genetic breeding but also for subsequent triterpenoid biosynthesis cloning and functional verification of key genes . therefore , this transcriptome sequencing may help improve future genetics and genomics studies on molecular mechanisms associated with the chemical compositions of p. tenuifolia . eventually , we can control the quality of p. tenuifolia from germplasm sources and thus provide important theoretical and practical significance . fresh roots of one- , two- , and three - year - old p. tenuifolia were sampled and collected in xinjiang county , shanxi province , china . another batch of two - year - old fresh roots of p. tenuifolia was collected in anguo city , hebei province . the samples were snap - frozen in liquid nitrogen and stored at 80c before use . according to the manufacturer 's protocol , a plant rna isolation kit ( autolab ) was used to extract the total rna from fresh tissues and then purified by an rneasy minielute cleanup kit ( qiagen ) . in brief , mrna was purified with the combination of oligo - dt - containing beads and poly - a - containing mrna and then used methods of chemicals and high temperature to fragmentate the mrna and get fragments of 150 bp . the next step was to synthesize the double - stranded cdna and repair the dna fragments with protruding terminal through the function of 3-5 exonuclease and polymerase . in order to guarantee dna fragments and adapters can combine with a and t complementary pair connection and prevent the inserted dna fragments connecting with each other , single - base a was imported to the 3 end of the blunt dna and single - base adapters of the tag - containing and the dna fragments were incubated and connected by the function of ligase . dna fragments with adapters were enriched selectively by pcr , and the pcr amplification with fewer number of cycles was operated in order to avoid errors in the library . the methods of quantitative of library were pico green and fluorescence spectrophotometer ( quantifluor - st fluorometer , promega , e6090 ; quant - it picogreen dsdna assay kit , invitrogen , p7589 ) , and the quality control of the enrichment of the pcr fragments and validation of the size and distribution of dna fragments in the library were conducted using agilent 2100 ( agilent 2100 bioanalyzer , agilent , 2100 ; agilent high sensitivity dna kit , agilent , 5067 - 4626 ) . the samples mixed after homogenization to 10 nm , then diluted gradually and quantitated to 4~5 pm for illumina sequencing to construct the multiplexed dna libraries . sequencing of the original data sequence through quality analysis after removal of low quality and subsequences gets the sequences available for subsequent analysis . a perl program was written to remove reads with adapters , the reads with the average quality of less than q20 for its 3 end to the 5 end , the reads with the final length of less sequence than 50 bp , and the reads with the uncertainty bases . high - quality reads were used for de novo assembly by the trinity software to construct unique consensus sequences . trimmed solexa transcriptome reads were mapped onto unique consensus sequences by using bowtie ( bowtie parameters : -v3 -all -best -strata ) . the functional annotation of unigenes was compared with national center for biotechnology information ( ncbi ) , nonredundant protein database ( nr ) , nonredundant nucleotide databases ( nt ) , uniprot / swiss - prot , kyoto encyclopedia of genes and genomes ( kegg ) , clusters of orthologous groups ( cog ) , gene ontology ( go ) , and interpro databases with basic local alignment search tool ( blast , http://www.ncbi.nlm.nih.gov/ ) . unigenes were identified by comparing sequence similarity against swiss - prot ( swiss - prot downloaded from european bioinformatics institute ; ftp://ftp.ebi.ac.uk/pub/databases/swissprot/ ) , cog [ 23 , 24 ] , and kegg database with blast at e values 1e 10 . the ko information retrieved from blast results by a perl script and the pathways between databases and unigenes were established . then , the functional assignments of interpro domains were mapped onto go and the go classification and tree were performed by wego . the rna extracted from all the samples was mixed for illmina sequencing in order to get the whole range of transcript diversity . in total , 58.88 million raw reads and 11.77 gigabase pairs were sequenced with an average gc content of 43.9% , q 20 , and no ambiguous n ( table s1 , in supplementary material available online at http://dx.doi.org/10.1155/2015/782635 ) . a total of 55,432,632 high - quality reads were assembled , and 316,703 contigs and 145,857 transcripts with the n50 values were 1,636 bp . all the transcripts were subjected to cluster and assembly analyses , yielding 39,625 unigenes with a mean length of 1,378 bp and the n50 values were 1,971 bp ( figure 1 ) . the assembly statistics of contigs , transcripts , and unigenes were shown in table s2 . in the present library , approximately 67.2% of the unigenes were annotated by blastx and blastn search with a threshold of 10 against seven public databases , including nr , nt , uniprot / swiss - prot , kegg , cog , go , and interpro databases ( table 1 ) . a total of 41,832 unigenes for go annotation were divided into three major categories , including cellular location , molecular function , and biological process . among 34 functional groups with go assignments , the dominant biochemistry , cell apoptosis , and metabolism were annotated ( figure 2 ) . in cellular location , eight classifications were clustered by the matched unique sequences and the larger subcategories were cell and cell part . in terms of molecular function , 11 classifications were categorized , including the represented cellular components , such as binding and catalytic activity . according to biological processes , 16 classifications were divided , including the represented biological processes , such as cellular process and metabolic process . however , few genes were assigned to the categories nutrient reservoir activity and viral reproduction , and no genes were found in the clusters of developmental process . unigenes for the cog classifications were annotated in order to further evaluate the effectiveness of the annotation process ( figure 3 ) . class definition , number , and percentage of this class were shown in figure 3 . the proteins in the cog categories were assumed to have the same ancestor protein , and these proteins were also assumed to be paralogs or orthologs . the largest category was general functional prediction only with 24.84% ; the second categories were posttranslational modification , protein turnover , and chaperon with 8.97% ; and the third category included translation , ribosomal structure , and biogenesis with 7.24% . cell motility ( 24 , 0.09% ) and nuclear structure ( 10 , 0.04% ) represented the smallest category . the kegg database can be used to categorize gene functions with an emphasis on biochemical pathways . the kegg database can also be used to systematically analyze inner cell metabolic pathways and functions of gene products . to gain further insights into the biological pathways in p. tenuifolia , we performed a blastx search against the kegg protein database on the assembled unigenes . a total of 72,636 ( 62.9% ) unigenes had blast hits and 42,702 unigenes were assigned to five kegg biochemical pathways ( table 2 ) including metabolism ( 17,217 unigenes ) , genetic information processing ( 14,593 unigenes ) , environmental information ( 2719 unigenes ) , cellular processes ( 3919 unigenes ) , and human diseases ( 4254 unigenes ) . the pathways with the highest unigene representation were spliceosome ( ko03041 , 1431 unigenes ) , chromosome ( ko03036 , 1232 unigenes ) , and ubiquitin system ( ko04121 , 1060 unigenes ) . as a chinese traditional medicinal plant , the higher expression of metabolism results in primary metabolite biosynthesis , such as carbohydrate metabolism ( 3702 unigenes ) , amino acid metabolism ( 2168 unigenes ) , and energy metabolism ( 1762 unigenes ) . however , the most active ingredients of p. tenuifolia were secondary metabolites . therefore , we listed the classifications of terpenoids , polyketides , and other secondary metabolites ( figure 4 ) with high expression levels . metabolic pathways were involved in the metabolism of terpenoids and polyketides ( 620 unigenes ; figure 4(a ) ) , including terpenoid backbone biosynthesis the large amount of transcriptomic information may enhance the study of terpenoid biosynthesis in p. tenuifolia . metabolic pathways were also involved in the biosynthesis of other secondary metabolites ( 522 unigenes ; figure 4(b ) ) , including ( 55 unigenes , 11% ) , tropane , piperidine , and pyridine alkaloid biosynthesis ( 45 unigenes , 9% ) , isoquinoline alkaloid biosynthesis ( 44 unigenes , 8% ) , stilbenoid , diarylheptanoid , and gingerol biosynthesis ( 35 unigenes , 7% ) , flavone and flavonol biosynthesis , a total of 176 unigenes were found to be potentially related to the biosynthesis of terpenoid biosynthesis including mep and mva pathways . in addition , 202 and 55 unigenes were related to the biosyntheses of phenylpropanoid and flavonoid , respectively . ( 1 ) characterization and expression analysis of the genes involved in the biosynthetic pathway of putative terpenoid backbone . dimethylallyl pyrophosphate ( dmapp ) and isopentenyl pyrophosphate ( ipp ) are recognized as a precursor of the biosynthesis of terpenoid saponins in green plants and the compounds of activity of isoprene in vivo . dmapp and ipp are alletic isomers , which are synthesized by mva and mep biosynthesis pathways mentioned above . the mva pathway starts with acetyl - coa which is synthesized through the triterpene derivatives captured co2 in cytoplasm and the mep pathway starts with pyruvate and glyceraldehydes-3-phosphate in plastid . in these databases , the biosynthetic pathways of mva and mep were identified ( figure 5(a ) ) . in most cases , two or more unique sequences were labeled as the same enzyme and these unique sequences could represent single gene or different fragments of gene . firstly , two molecules of acetyl - coa were catalyzed into acetoacetyl coa by aact ( ec 2.3.1.9 , 13 unigenes ) and then catalyzed into 3-hydroxy-3-methylglutaryl - coa ( hmg - coa ) by hmgs ( ec 2.3.3.10 , 18 unigenes ) . mva was formulated by hmgr ( ec 1.1.1.34 , 18 unigenes ) and then mvk ( ec 2.7.1.36 , 2 unigenes ) catalyzed mva into mva-5-phosphat . next , ipp was synthesized by pmk ( ec 2.7.4.2 , 4 unigenes ) and pmd ( ec 4.1.1.33 , 3 unigenes ) . firstly , pyruvate and glyceraldehydes-3-phosphate were converted to 1-deoxy - d - xylulose-5-phosphate ( dxop ) by dxs ( ec 2.2.1.7 , 17 unigenes ) and then catalyzed into mep by dxr ( ec 1.1.1.267 , 7 unigenes ) . next , mct ( ec 2.7.7.60 , 7 unigenes ) and cmk ( ec 2.7.1.148 , 4 unigenes ) catalyzed the mep to 4-dicytidine triphosphate-2-methyl - d - erythritol-2-phosphate ( cdp - mep ) . lastly , ipp was synthesized by mds ( ec 4.6.1.12 , 1 unigene ) , hds ( ec 1.17.7.1 , 9 unigenes ) , and hdr ( ec 1.17.1.2 , 12 unigenes ) . the next step was the synthesis of squalene ; a series of enzymes were involved , such as ippi ( ec 5.3.3.2 , 15 unigenes ) and sqs ( ec 2.5.1.21 , 7 unigenes ) . however , gpps ( ec 2.5.1.29 ) and fpps ( ec 2.5.1.10 ) involved in terpenoid biosynthesis were not found from the transcriptome results maybe because some assembly cdnas were not of full length . squalene was catalyzed into 2,3-oxidosqualene by se ( ec 1.14.99.7 , 19 unigenes ) . in many plants 2,3-oxisqualene cyclization was a very important step in the biosynthesis of terpenes , because it was a branch point of the synthesis of triterpenoid saponin , sterol , and other terpenes . we have found that two types of osc genes of p. tenuifolia are present in the dataset ; these types are cycloartenol synthase ( 16 unigenes ) and beta - amyrin synthase ( 54 unigenes ) , respectively . moreover , except for the fpps , another five nucleotide sequences ( sqs , se , cas ( 2 ) , cycloartenol synthase , and beta - amyrin ) related to the triterpenoid saponins biosynthesis and reported in ncbi were found in our sequencing data . ( 2 ) characterization and expression analysis of the genes involved in the putative phenylpropanoid biosynthesis pathway . approximately 814 unigenes , encoding 16 enzymes , were found in the phenylpropanoid biosynthesis pathway ( figure 5(b ) ) . but flavonoids and lignins were not main compound of phenylpropanoids and researchers were rarely mentioned in p. tenuifolia . phenylpropanoid biosynthesis pathway starts with converting phenylalanine to cinnamate by pal ( ec 4.3.1.24 , 11 unigenes ) and then cinnamate converts to p - coumaryol coa by the enzymes of c4h ( ec 1.14.13.11 , 10 unigenes ) and 4cl ( ec 6.2.1.12 , 25 unigenes ) . the flavonoid pathway began with the synthesis of chalcone which was catalyzed by chs ( ec 2.3.1.74 , 1 unigenes ) and then catalyzed to naringenin by chi ( ec 5.5.1.6 , 3 unigenes ) . the last step was dihydroflavonols converted to flavonols by fls ( ec 1.14.11.23 , 4 unigenes ) . the lignin pathway began with the synthesis of p - coumaroyl shikimate , which was catalyzed by hct ( ec 2.3.1.133 , 4 unigenes ) . then , c3h ( ec 1.14.13.36 ) catalyzed the conversion of p - coumaroyl shikimate into caffeoyl shikimate . then , ccr ( ec 1.2.1.44 , 6 unigenes ) catalyzed the feruloyl coa into coniferaldehyde . finally , coniferaldehyde was converted by cad ( ec 1.1.1.195 , 12 unigenes ) to produce coniferyl alcohol . similar to the biosynthesis of the terpenoid backbone , c3h was not found from the transcriptome results . a total of 6,655 ssrs and 5784 sequences were identified from 39,625 unigenes . among these sequences , ( table 3 ) . a / t ( 1539 ) was the most abundant repeat type , followed by at / ga ( 207 ) and gaa / tca ( 69 ) . however , the number of tetranucleotide , pentanucleotide , and hexanucleotide motifs was < 2% in the unigene sequences . in this transcriptome database , ssrs did not all exist in the unigenes and the complex ssr motifs were not detected . the advantages of high - throughput , accuracy , and reproducibility lead transcriptome sequencing to become a powerful technology . illmina sequencing 2000 has been widely used for deep sequencing for model and nonmodel plants recently with the biggest output and lowest reagent cost . in this study , the application of illumina hiseq 2000 resulted in a more comprehensive understanding of genomic information and promoted the study of secondary metabolites biosynthetic pathways of p. tenuifolia . triterpenoid saponins , especially pentacyclic triterpenoid saponins , are one of the main active ingredients of p. tenuifolia , whose biosynthetic pathways are becoming more and more important . the upstream and midstream biosynthetic pathways of triterpenoid saponins have been studied very clearly in the past few years . many researchers now mainly focus on the downstream biosynthetic pathways , which is also the difficult part of the studies . in the downstream of biosynthesis of natural plant products , hydroxylation of cyp450s and glycosylation of ugts play important roles in stabilizing the product and altering triterpenoid saponin bioactivity of dammarane - type and oleanane - type aglycones . in this study , 466 and 157 unigenes are annotated as cyp450s and ugts in the transcriptome of p. tenuifolia ( data not shown ) , respectively . however , because of the quantity and complexity of cyp450s and ugts , the enzymes of the downstream biosynthetic pathway of p. tenuifolia are still unknown , which can determine the specific steps in the accumulation of triterpenoid saponins . cyp450s is a family of enzymes involved in the biosynthesis of lignins , terpenoids , sterols , fatty acids , hormones , pigments , and defense - related phytoalexins . only two cyp450s involved in triterpene saponin biosynthesis are functionally characterized until now , including cyp88d6 from glycyrrhiza uralensis belonging to the cyp85 family and cyp93e1 from glycine max belonging to the cyp71 family . recently , several cyp450s and ugts were identified as candidate genes in many studies of medicinal and nonmedicinal plants . one cyp450 ( contig00248 ) was selected as a candidate gene , which is most likely to be involved in ginsenoside biosynthesis in panax quinquefolius by meja - inducible and tissue - specific expression patterns . moreover , pn02132 and pn00158 , closely related to cyp88d6 and cyp93e1 , were selected as candidate cyp450s involved in triterpene saponin biosynthesis in p. notoginseng . furthermore , ten unigene sequences were identified corresponding to the seven different genes with a high homology to cyp79s , and four unigenes were identified corresponding to the two cyp83 genes in core structure biosynthesis of the glucosinolate metabolism of radish . our previous study once suggested that a combination of ultraperformance liquid chromatography coupled with electrospray ionization quadrupole time - of - flight mass spectrometry based on metabolomics and gene expression analysis can effectively elucidate the mechanism of biosynthesis of triterpenoid saponin , and three genes of cyp450s ( cyp88d6 , cyp716b1 , and cyp72a1 ) putatively expressed in biosynthesis pathway of triterpenoid saponin in p. tenuifolia were identified by quantitative real - time pcr ( qrt - pcr ) analysis . the examples mentioned above clarified that most identified cyp450s belonging to the cyp71 and cyp 88 families , and few studies were documented about the other cyp450 families until now . ugts are another large multigene family in plants and play an important role in the last step of biosynthesis of triterpenoid saponin . glycosylation , the transfer of activated saccharides to an aglycone substrate , is the predominant modification in triterpenoid saponins biosynthesis . regarding cyp450s genes , the genes ugt74m1 and ugt73k1 from saponaria vaccaria and ugt71g1 from medicago truncatula have been previously identified . flavonoids related to ugts ( ugt78d1 , ugt78d2 , ugt73c6 , and ugt89c1 ) were also identified in previous studies [ 39 , 40 ] . furthermore , four ugts ( contig01001 , contig14976 , contig15451 , and contig16321 ) were selected as candidate genes in p. quinquefolius , which are most likely to be involved in ginsenoside biosynthesis by meja - inducible and tissue - specific expression patterns . pn13895 , closely related to ugt71g1 , was regarded as a lead candidate ugt , which is responsible for triterpene biosynthesis in p. notoginseng . thirteen unigenes were identified as ugt74s , including ugt74b1 , ugt74c1 , ugt74f1 , and ugt74f2 , in the core structure biosynthesis of the glucosinolate metabolism of radish . in our previous study mentioned above , three genes of ugts ( ugt74b1 , ugt73b2 , and ugt73c6 ) putatively expressed in triterpenoid saponin biosynthetic pathways were also identified by qrt - pcr in p. tenuifolia . the examples mentioned above clarified that most identified ugts belonged to the ugt74 and ugt73 families , and few studies have been documented about the other ugt families until now . in other words , the genes identified in cyp450s and ugts add little information to the knowledge of downstream triterpenoid saponin biosynthesis and thus we will continue with our in - depth studies . the large number of cyp450 and ugts candidates could provide not only a potential gene pool for the identification of special cyp450s and ugts involved in triterpenoid biosynthesis in p. tenuifolia but also a convenient method to characterize the roles in triterpenoid biosynthesis in future studies . rp , one of the predominant chinese medical plants , contains various medicinal ingredients with the elicits tonic , sedative , antipsychotic , expectorant , and other pharmacological effects . in this study , our results showed that many transcripts encoded by putative genes are involved in the biosynthesis of triterpene saponins and phenylpropanoid . the data we obtained presented the most abundant genomic resource and provided comprehensive information on gene discovery , transcriptome profiling , transcriptional regulation , and molecular markers of p. tenuifolia . this study will improve the production of active compounds through marker - assisted breeding or genetic engineering for p. tenuifolia , as well as other medicinal plants in the polygalaceae family . however , many candidate cyp450s and ugts are likely involved downstream of the biosynthetic pathway of triterpene saponins , but these candidates should be further investigated .
radix polygalae , the dried roots of polygala tenuifolia and p. sibirica , is one of the most well - known traditional chinese medicinal plants . radix polygalae contains various saponins , xanthones , and oligosaccharide esters and these compounds are responsible for several pharmacological properties . to provide basic breeding information , enhance molecular biological analysis , and determine secondary metabolite biosynthetic pathways of p. tenuifolia , we applied illumina sequencing technology and de novo assembly . we also applied this technique to gain an overview of p. tenuifolia transcriptome from samples with different years . using illumina sequencing , approximately 67.2% of unique sequences were annotated by basic local alignment search tool similarity searches against public sequence databases . we classified the annotated unigenes by using nr , nt , go , cog , and kegg databases compared with ncbi . we also obtained many candidates cyp450s and ugts by the analysis of genes in the secondary metabolite biosynthetic pathways , including putative terpenoid backbone and phenylpropanoid biosynthesis pathway . with this transcriptome sequencing , future genetic and genomics studies related to the molecular mechanisms associated with the chemical composition of p. tenuifolia may be improved . genes involved in the enrichment of secondary metabolite biosynthesis - related pathways could enhance the potential applications of p. tenuifolia in pharmaceutical industries .
histoplasmosis is caused by the dimorphic fungus histoplasma capsulatum ( h. capsulatum ) , the clinical spectrum of which ranges from transient pulmonary infections to disseminated disease . the infection is acquired with the inhalation of spores of h. capsulatum found in soils contaminated by bird and bat excreta . the disseminated histoplasmosis is uncommon and can present as acute , subacute , or chronic illness . the chronic form is characterized by an indolent course with an intact cell mediated immune response . the disseminated disease commonly involves lungs , lymph node , spleen , liver , bone marrow , gastrointestinal tract , adrenal gland , and mucous membrane of the oral cavity . the present case reveals the importance of fine needle aspiration ( fna ) being a simple technique for early diagnosis of infection with h. capsulatum . it highlights the occurrence of unusual skin lesions associated with histoplasmosis in an immunocompetent individual and asserts as well that the early clinical course of the same mimics tuberculosis causing a delay in diagnosis . a 26-year - old male presented to the fna clinic with complaints of episodic fever , dull abdominal pain , and weight loss for the past 1 year . the patient was previously investigated for tuberculosis and typhoid with no laboratory evidence of infection and was empirically started on antitubercular therapy ( att ) . after 4 months of att , he developed multiple skin lesions all over the face with no relief in initial symptoms . he had no significant occupational , past medical , and surgical history . on examination , the general condition of the patient was poor with the presence of pallor , pedal edema , bilateral cervical lymphadenopathy , and multiple molluscum contagiosum like skin lesions revealing umbilicated papules present all over the face [ figure 1a ] . blood and biochemical investigations revealed hemoglobin of 7.2 gm / dl , total leucocyte count 11 , 000 cells / mm , differential counts were n78 l8 m12 e2 , platelet count 78,000/mm , and serum glutamate - pyruvate transaminase ( sgpt ) was 78.91 test for malaria antigen and rapid test for typhoid immunoglobulin m ( igm ) ab was negative . smears revealed acute and chronic inflammatory cells along with many intracellular and extracellular small organisms surrounded by a clear halo in a hemorrhagic background . few showed biphasic - staining pattern with lighter and darker poles [ figure 1b ] . schiff ( pas ) stain showed positive staining of the organism [ figure 1c ] . the cytological impression was of infection with h. capsulatum and culture study was advised for confirmation . subsequent skin biopsy showed the presence of many histiocytes with intracellular h. capsulatum [ figure 1d ] . bone marrow examination revealed an increase in the number of histiocytes , the presence of toxic granules and cytoplasmic vacuoles in myeloid cells , and an occasional macrophage showing the h. capsulatum . ( a ) multiple molluscum contagiosum like skin papules present all over the face ( b ) fna smear revealing histoplasma capsulatum surrounded with clear halo and biphasic light and dark staining pattern ( giemsa stain , 1000 ) ( c ) pas positive staining of histoplasma capsulatum on fna smear ( pas stain , 1000 ) ( d ) skin biopsy with arrows showing histoplasma capsulatum ( h and e stain , 1000 ) computed tomography ( ct ) thorax and abdomen revealed multiple cavitatary nodules with feeding vessel sign in bilateral lungs , mediastinal , mesenteric and retroperitoneal lymphadenopathy , hepatomegaly with multiple granulomas , and splenomegaly with upper pole abscess . the patient was started on intravenous amphotericin b. on the 5th day of the treatment , the clinical condition of the patient worsened due to deranged coagulation profile leading to disseminated intravascular coagulation . in the following 48 h , disseminated histoplasmosis is an uncommon airborne disease caused by dimorphic fungus h. capsulatum from the soil infected with bird and bat excreta . the course of the illness may be acute , which is seen primarily in infants and immunocompromised patients with high - grade fever with anemia , leukocytopenia , thrombocytopenia , and hepatosplenomegaly . chronic disseminated histoplasmosis is associated with destructive lesions in the number of organs and occurs almost exclusively in adults . the early clinical manifestation are nonspecific , often leads to diagnostic difficulty , and is misdiagnosed as tuberculosis due to the high prevalence of tuberculosis in india . similar diagnostic dilemma in our case must have led to the early start of att and delay in diagnosis . the predisposing factors for histoplasmosis are extremes of age , immunosuppressed patients , acquired immunodeficiency disease syndrome , cancer , solid organ or bone marrow transplant , and corticosteroid therapy . however , the patient in this case was immunocompetent and did not show any clinical improvement . the sites most commonly involved in disseminated histoplasmosis are lungs , lymph nodes , spleen , liver , bone marrow , gastrointestinal tract , adrenal , and the mucus membrane of the oral cavity . the skin involvement is rare in disseminated disease and occurs in only 6% of patients in the form of hyperpigmented , erythematous nodule , papule , or ulcerative lesions . in our case , contrary to which , the index case describes these lesions in an immunocompetent individual and as a part of disseminated disease process . the common cytomorphological differential diagnosis includes , cryptococcus neoformans , blastomyces dermatitidis , coccidioides immitis and leishmania donovani , the size of the organism , localization ( intracellular or extracellular ) , and cytomorphology helps differentiate from h. capsulatum [ table 1 ] . cytomorphological features differentiating histoplasma capsulatum from other organisms the development of specific nucleic acid probes has facilitated the identification of h. capsulatum in cultures with atypical morphology . intravenous amphotericin b is the recommended treatment to reduce mortality in patients with disseminated histoplasmosis . in our case , amphotericin treatment could not limit the disease progression and the patient succumbed to shock due to respiratory failure and coagulopathy . in the index case the unusual finding that needs to be emphasized is the disseminated disease with uncommon skin lesions in an immunocompetent patient . fine needle aspiration cytology ( fnac ) of the lymph node was the only tool for rapid and early confirmatory diagnosis . fnac is a simple , safe , and quick technique to establish the initial diagnosis of h. capsulatum , thereby prompting early treatment . although , hyperpigmentation and erythematous papules and nodules are common skin manifestations , histoplasmosis may be suspected as well in cases with molluscum contagiosum like skin lesions in association with lymphadenopathy , fever , and weight loss . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
disseminated histoplasmosis is caused by the dimorphic fungus histoplasma capsulatum ( h. capsulatum ) . the early clinical manifestations are nonspecific , often lead to diagnostic difficulty , and is misdiagnosed as tuberculosis and seen usually in immunosuppressed states . fine needle aspiration cytology ( fnac ) is a simple , safe , and quick technique to establish the initial diagnosis of h. capsulatum , thereby prompting early treatment . the skin involvement is rare in disseminated disease and we describe a case of disseminated histoplasmosis in an immunocompetent patient with unusual molluscum contagiosum like umbilicated skin lesions and fnac of the cervical lymph node was the only tool for rapid and early confirmatory diagnosis .
topical -blocker solution is a useful treatment for glaucoma , but it may be an unrecognized and neglected reason for bradycardia for frail geriatric patients . levobunolol hydrochloride solution , a commonly prescribed medication for patients with glaucoma , contains 5 mg levobunolol hydrochloride / ml . rarely , the proarrhythmic adverse effect may occur in elderly frail patients or patients with cardiac disease . here , we report an interesting and thought - provoking case of symptomatic bradycardia following topical administration of levobunolol hydrochloride solution , in an old frail patient , symptoms , which resolved after discontinuation of this eyedrop . an 88-year - old man was admitted to the hospital with abdominal pain . his past history included coronary heart disease for which he underwent percutaneous coronary interventional treatment . he complained of fatigue , dizziness , and heart palpitations , and an electrocardiogram ( ecg ) demonstrated sinus bradycardia at a rate of 39 bpm ( the day of hospitalization ; figures 1a and 2a ) . holter was taken the second day after being admitted to our hospital , which showed sinus bradycardia , atrioventricular block ( first degree ) , and sinus arrest ( figure 1b ) . the average heart rate was 54 bpm and the range of heart rate varied from 25 bpm ( figure 3a ) to 79 bpm . there were 265 episodes of sinus arrest lasting longer than 2 seconds and six arrests longer than 3 seconds ( figure 3a ) . serum electrolyte test , complete blood count , thyroid function test , and cardiac marker panel were all within normal limits . after careful review of his history and medication list , the only medication that may be associated with bradycardia was levobunolol hydrochloride solution , which he had been using , one to two drops to each eye , two to three times per day for several years . the lowest heart rate was reached ( 25 bpm ) , approximately two hours after instillation of the eyedrops ( figure 1c ) . because of the clear relationship between onset of symptomatic bradycardia and the instillation of eyedrops , levobunolol hydrochloride solution was discontinued and replaced with latanoprost eyedrops . heart rhythm was re - evaluated after cessation of levobunolol hydrochloride solution by ecg and holter . ecg showed normal heart rhythm ( figure 2b ) and holter showed sinus rhythm , with an average heart rate of 67 bpm ( figure 3b ) . ten days later , the heart rate range recovered to 53 bpm to 100 bpm with an average heart rate of 73 bpm , and the sinus arrest disappeared as shown by holter . nearly half a century ago , phillips et al discovered fortuitously that propranolol reduced intraocular pressure ( iop).1 studies about -blockers had been carrying out subsequently as treatments of glaucoma . in 1978 , timolol was released for general use and many topical -blockers have dominated the treatment of glaucoma ever since.2 levobunolol , a nonselective -adrenergic blocking agent , has effective ocular antihypertensive effects . its mechanisms to decrease iop are probably associated with reducing the inflow of aqueous humor.3 after topical administration , the onset time of action is within 1 hour , peaking in 26 hours and lasting for 24 hours . although people seem to believe that the side effect profile of such topical medications may be insignificant because of this local application , and some studies found that the effects on heart rate were minimal,4,5 its side effect on heart rhythm should be emphasized and paid attention to , especially for the frail geriatric patients . topical -blockers , when systemically absorbed after topical administration , affect the sympathetic and parasympathetic nervous systems of patients and can cause cardiovascular toxicity , especially for elderly people with the long - term use of potentially toxic agents , as reported by frishman et al.6 in order to identify the exact effect of topical -blockers on pulse rate , tattersall et al investigated the resting pulse rates in patients attending a specialist glaucoma clinic . their study indicated that patients using topical -blockers had significantly lower resting pulse rates than those not using -blockers and concluded that topical -blockers should be used with caution , and routine pulse rate monitoring and review of ophthalmic medication were indicated.7 in a study about effects of topical levobunolol on intraocular pressure and heart rate in healthy dogs , levobunolol was found to induce bradycardia.8 similar results were confirmed by study on healthy elderly people . in a study named controlled comparison of cardiovascular effects of levobunolol 0.25% ophthalmic solution and betaxolol 0.25% ophthalmic suspension by samuel e lewis,9 it was found that the healthy elderly volunteers treated with levobunolol showed significantly lower average heart rates during exercise and the postexercise recovery period , compared with people treated with betaxolol or placebo . chun et al reported that topical instillation of levobunolol could cause syncope , first - degree atrio block , and bradycardia in patients.10 timolol , a nonselective -adrenoceptor antagonist , was one of the most frequently prescribed first - line topical therapies for the reduction of iop , and there were more case reports about topical timolol that caused bradycardia due to systemic absorption.11,12 in a study about atrioventricular block secondary to topical -blockers , 243 patients with atrioventricular block were included and 12 were treated with topical timolol . in seven cases , the sinus rhythm was recovered , and in five cases , a pacemaker was implanted . however , none of them recognized the eyedrops as a cause.13 review of the literature showed that the majority of the patients were the elderly.13 however , the reality is that the patients , especially the geriatric patients , may not associate their symptoms with the topical eye medications and consequently may not report the use of such drugs . patients will seldom inform their physicians about their glaucoma therapy unless they are specifically questioned about the use of eye medications.14 as a result , the symptoms may be mistakenly attributed to the aging process or pathologic coexisting disease . so it is important to ask about the use of eyedrops in patients with bradycardia or atrioventricular block and doctors should be particularly cautious when prescribing -blockers to old patients or patients with cardiac disease . in the elderly population or patients with heart disease , levobunolol hydrochloride solution may lead to significant bradycardia , which may be potentially dangerous . recognition of the possible side effect of topical -blocker solution in bradycardia is vital as bradycardia may be reversible after discontinuing the -blocker , thus avoiding the need for a permanent pacemaker.9 this drug should be administered with caution and its effect should be monitored by a physician . if there is any cardiac side effect , the -blocker should be discontinued and alternative anti - glaucoma medications should be considered .
an 88-year - old man was admitted with fatigue , dizziness , and heart palpitations . both the electrocardiogram and holter confirmed the existence of sinus bradycardia and sinus arrest . one hour prior to the onset of symptoms , he received levobunolol hydrochloride solution topically . the levobunolol hydrochloride solution was discontinued and the bradycardia resolved . he was diagnosed as having intermittent sinus bradycardia and sinus arrest , induced by topical -blocker therapy . levobunolol hydrochloride solution is an effective therapy for ocular hypertension , probably by reducing aqueous fluid production . however , it can induce cardiac side effects such as bradyarrhythmia and should be used with caution in elderly patients or patients with cardiac disease .
epstein barr virus ( ebv ) is the cause of mononucleosis that is generally benign disease in children with classical features of fatigue , pharyngitis , and lymphadenopathy . ebv infections have led to subclinical infection , infectious mononucleosis , and associations with malignancies and central nervous system ( cns ) disorders . many neurological manifestations have been described such as seizures , ataxia , meningitis , encephalitis , transverse myelitis , guillain barre syndrome , autonomic dysfunction , anxiety , and depression in this disease . although neurologic complications mostly emerge during acute ebv infection , the reactivated virus may also cause neurologic complications in children . herein , we describe a patient diagnosed by acute ebv encephalitis with magnetic resonance imaging ( mri ) lesion in substantia nigra and good recovery with antiviral and steroid treatment . a 8-year - old boy was referred to our hospital for with 8 days history of fever , decreased alertness , drowsiness , vomiting , tremor , and unresponsive to verbal command . he had a history of fever , sore throat , and for this reason penicillin treatment was prescribed at another hospital before 8 days . on admission , the pupillary light reflex was evident , no neck stiffness , deep tendon reflexes of the lower and upper extremities were normal . cerebrospinal fluid ( csf ) analysis showed : 2 lymphocytes / mm , 18 mg / dl protein , 61 mg / dl glucose ( simultaneous blood glucose : 85 mg / dl ) . encephalitis was diagnosed by clinical and radiological findings and empirical antibiotics and acyclovir were administered . herpes simplex virus , cytomegalovirus , anthyroid antibodies , antinuclear antibody , anti - dsdna antibody , venereal disease research laboratory , brucella serology were negative . serologic studies revealed that weakly positive for : viral capsid antigen ( vca ) igm , vca igg , epstein magnetic resonance imaging revealed bilateral symmetrical hyperintensities in the substantia nigra normal magnetic resonance imaging finding after treatment the boy was diagnosed with acute ebv - related encephalitis based on the clinical , radiological findings , and the serological results for ebv . clinically , ebv can present with meningitis , encephalitis , acute demyelinating encephalomyelitis , cranial nerve palsies , cerebellitis , myelitis , seizures , and polyradiculitis . primary inflammation due to direct viral invasion , secondary autoimmune reaction has been postulated mechanisms of ebv encephalitis . shoji et al . speculated that the neurologic abnormalities were most likely secondary to immune - mediated mechanism . our patient 's sera sample was weakly positive for ebv antibodies but csf pcr was negative for ebv . this imaging finding together with the negative csf pcr result for ebv in our patient suggests that an autoimmune mechanism also may be involved in the pathogenesis but we could n't study autoimmune antibody for technical inadequacy . ebv can also present with a wide spectrum of imaging abnormalities . in 40% of cases with ebv encephalitis , t2-weighted or fluid - attenuated inversion recovery imaging reveals multiple focus hyperintensity in the hemispheric cortex , brainstem , bilateral thalami , basal ganglia , and/or splenium . rarely , extensive white matter lesions have been reported in patients with acute disseminated encephalomyelitis associated with chronic ebv infection . most children have a benign clinical course without neurologic sequelae like our patient , but 10% have residual persistent deficits and a mortality rate of up to 10% has been reported . prognosis was reported to be better for patients with isolated hemispheric grey or white matter involvement . sequel remains in half of patients with thalamus involvement and mortality rate is highest among patients with brainstem involvement . angelini et al . reported that permanent anomalies in the imaging may be related to glial reactions emerging after the recovery of neurological findings . substantia nigra , is an important area for the movement . in recent years , literature reported cases of ebv related substantia nigra involvement in children and adult patients . guan et al . reported a 28-year - old patient presenting to hospital with akinetic rigid syndrome . reported a 20-year - old pregnant women who who presented to hospital with acute parkinsonism with postural and kinetic limb tremor , bradykinesia , nystagmus , saccadic eye movement , and axial dystonia . the patient was diagnosed with encephalitis lethargica . in our patients , lesions were seen in substantia nigra . bilateral substantia nigra lesions are characteristic of some encephalopathies including the japanese and west nile encephalitis . use of corticosteroid can improve clinical prognosis by reducing inflammation and cranial pressure in encephalitis . acyclovir has been recommended for cns involvement with ebv but white matter lesions have been noted with acyclovir treatment in some cases . a pediatric study comprising 11 patients , reported that 40% had residual neurologic sequelae such as global impairment , autistic like behavior , and focal paresis was seen in primary infection . this case demonstrates that ebv - related brainstem encephalitis can be considered as an infectious neurological disease in children .
infectious mononucleosis due to epstein barr virus ( ebv ) is a usually benign systemic viral illness common in children . many studies described nervous system manifestations of infectious mononucleosis with a wide spectrum of neurologic deficits . neurologic complications of ebv are seen in both acute and reactivate infection . herein , we describe a patient diagnosed by acute ebv encephalitis with substantia nigra involvement and excellent clinical recovery .
hepatitis e virus ( hev ) , the sole member of the family hepeviridae , is an under - recognized cause of acute hepatitis . in resource - poor areas of developing countries , where the virus is endemic , hev is responsible for large water - borne outbreaks of significant morbidity . in non - endemic areas , where sanitary standards are optimal studies over the past three decades , have substantially transformed our understanding of the pathogen and its true burden . the hev is now believed to be the most common etiologic agent in acute hepatitis around the world ( 2 ) . the hev induced hepatitis is usually a self - limiting disease , with manifestations that are often subclinical . it is not distinguishable from other causes of acute hepatitis , and most of the times , the symptoms tend to resolve spontaneously . the disease associated with low morbidity and mortality ( 1 ) . since the clinical picture and alterations in laboratory parameters are not specific in the hepatitis caused by hev , diagnosis should be confirmed by documenting elevated titers of immunoglobulin m ( igm ) in the serum , the rise of which coincide with the onset of clinical symptoms ( 2 ) . about 6 weeks after the exposure , igm titers start to fall , whereas immunoglobulin g ( igg ) levels continually increase and remain detectable long after the recovery from the acute infection ( 2 ) . immunocompromised patients are at an increased risk for severe infection , protracted viremia , and disease chronicity , which can ultimately lead to cirrhosis and end - stage liver failure ( 3 ) . in patients with end - stage renal disease ( esrd ) , several immune functions , especially those relating to the innate , as well as the adaptive immunity , are markedly impaired ( 4 ) . fecal - oral transmission ( contamination of water sources with fecal material ) has been described as the main route of hev transmission . in patients undergoing hemodialysis ( hd ) , the possibility of a person - to - person nosocomial transmission via infected blood or contamination of devices / intravenous sets has been raised , further highlighting that the epidemiology and clinical features of hev among hd patients may be different from the general population . despite these considerations , studies investigating the epidemiology of hev seropositivity among hd patients are sparse and the findings are often conflicting . to address the knowledge gap in the seroprevalence of hev among hd patients in iran , an endemic country for hev , the present study was designed and conducted . here , we delineate the prevalence rate of anti - hev antibody in hd patients and compare our findings with the rates observed in the general population and also , hd units across the country . between march and september 2010 , all patients with esrd undergoing maintenance hd in two dialysis units in the city ( besat hospital and shahid beheshti hospital , hamadan , iran ) , were consecutively recruited . recruited patients were interviewed and data regarding age , sex , education , duration and frequency of dialysis were recorded in pre - designed questionnaires . data regarding previous infection with hepatitis b , hepatitis c , and human immunodeficiency virus ( hiv ) were retrieved from patients hospital records and were recorded in the questionnaires . all procedures dealing with human subjects were conducted in accordance with the guidelines and standards laid down in the declaration of helsinki . the ethics committee of the hamadan university of medical sciences read and approved the study protocol . written informed consent was obtained from each patient , prior to enrollment . immediately before a hd session , a sample of 3 ml of venous blood was obtained from each participant . specimens were then sent to hospital laboratory , where they were centrifuged and stored in 18c , until assessment . serum igg concentrations against hev were determined using the enzyme linked immunosorbent assay ( elisa ) method , with commercial kits ( diagnostic bioprobes s.r.l . , the distinction between positive and negative cases was done according to the manufacturer s instructions and using the provided cut - off in the product brochure . all statistical analyses were performed using the statistical package for social sciences ( spss ) version 17 ( spss inc . , the prevalence rate for hev seropositivity was calculated by direct counting and the 95% confidence interval ( 95%ci ) for the prevalence were calculated by the modified wald method , developed by agresti and coull ( 5 ) . to investigate the distribution of variables between seropositive and seronegative groups , contingency tables were drawn and the statistical significance of the difference was assessed using chi square of fisher s exact tests , where appropriate . in all tests , a p between march and september 2010 , all patients with esrd undergoing maintenance hd in two dialysis units in the city ( besat hospital and shahid beheshti hospital , hamadan , iran ) , were consecutively recruited . recruited patients were interviewed and data regarding age , sex , education , duration and frequency of dialysis were recorded in pre - designed questionnaires . data regarding previous infection with hepatitis b , hepatitis c , and human immunodeficiency virus ( hiv ) were retrieved from patients hospital records and were recorded in the questionnaires . all procedures dealing with human subjects were conducted in accordance with the guidelines and standards laid down in the declaration of helsinki . the ethics committee of the hamadan university of medical sciences read and approved the study protocol . immediately before a hd session , a sample of 3 ml of venous blood was obtained from each participant . specimens were then sent to hospital laboratory , where they were centrifuged and stored in 18c , until assessment . serum igg concentrations against hev were determined using the enzyme linked immunosorbent assay ( elisa ) method , with commercial kits ( diagnostic bioprobes s.r.l . , the distinction between positive and negative cases was done according to the manufacturer s instructions and using the provided cut - off in the product brochure . all statistical analyses were performed using the statistical package for social sciences ( spss ) version 17 ( spss inc . , the prevalence rate for hev seropositivity was calculated by direct counting and the 95% confidence interval ( 95%ci ) for the prevalence were calculated by the modified wald method , developed by agresti and coull ( 5 ) . to investigate the distribution of variables between seropositive and seronegative groups , contingency tables were drawn and the statistical significance of the difference was assessed using chi square of fisher s exact tests , where appropriate . in all tests , a p the baseline characteristics of 153 patients included in the present study are presented in table 1 . eighty - three patients were male ( 54.2% ) and female - to - male ratio was 1:1.2 . patients were on dialysis for an average of 33 months and received filtration for an average of nine hours per week . the majority of participants ( 73.9% ) had access to tap water for drinking and other purposes . overall , 30 patients had positive results for hev igg antibody , giving rise to a prevalence rate of 19.2% ( 95%ci : 14.0 - 26.6 ) . comparisons of the distribution of independent variable between seropositive and seronegative patients are presented in table 1 . age , sex , the highest level of education achieved , and rate of access to filtered water were comparable between the two groups . seropositive patients were not significantly different from their seronegative counterparts , in terms of duration of hd and also , the average time spent on hd per week . with regard to major blood - borne pathogens , four patients ( one in the seropositive group and three in the seronegative group ) had been diagnosed with hepatitis c infection in the past . the proportions of patients positive for viral blood - borne pathogens were not significantly different between the two groups ( table 1 ) . in the present study , the seroprevalence of hev igg was assessed in a sample of 153 patients on maintenance hd in hamadan , iran . based on our observations , the proportion of hd patients with positive hev igg was 19.2% , which is approximately two - fold higher than the proportion documented in the general population of nahavand [ 9.3% ( 95%ci : 8.2 - 10.9 ) ] . nahavand , which is a city in hamadan province , is located 70 miles southwest of hamadan . sera of patients were collected and anti - hev igg titers were determined by the same commercial kit used herein . a total of 170 individuals tested positive for hev antibody ( 6 ) . in the keramat et al . 2012 study , in hamadan , the anti - hev igg titers were positive only in 1.5% of 131 healthy and non - addict persons ( 7 ) . the question is why a significantly higher proportion of individuals on hd are positive for hev antibodies , in comparison to the general population ? the hev was once believed to be transmitted solely fecal - orally due to contamination of water sources and transmission by blood did not seem to play a role in disease spread ( 1 ) . studies in the past two decades , however , have frequently raised the possibility of intravenous passage , as a route of infection , similar to that observed with hepatitis b or c ( 7 ) . several lines of evidence , in support of a possible blood - borne transmission of hev have been accumulated ( 2 ) . cases of acute hepatitis e following transfusion with infected blood products have been documented ( 8) . in other cases , igg positive patients were found to have been transfused with contaminated blood in the past ( 9 ) . in one neurosurgery ward in a hospital in pakistan , an outbreak of hepatitis e has been traced back to a possible use of shared contaminated intravenous sets for administering mannitol and dexamethasone ( 10 ) . these findings are suggestive of a parenteral route for hev transmission and raise the possibility of presenting hev infection , nosocomially . on the other hand , in a retrospective cohort of individuals undergoing hd in japan , mitsui et al . determined serum igg titers to hev at baseline and after a mean of the 416 patients followed , only four new cases of positive hev infection were identified , indicating that acquiring hev , while being on maintenance hd , is a rare occurrence ( 9 ) . of note , one patient was transfused with two units of blood , approximately three weeks before the emergence of viremia ( 9 ) . the results from seroepidemiological surveys at zanjan , jahrom and ahvaz showed various results like 26.9% , 7% , and 10.6% , respectively ( 11 - 13 ) . our findings are higher than the rate observed in jahrom and lower than that of zanjan . collectively , the current report , along with previous observations , indicates a high degree of variability in different hd centers across the country . whether the intervariability between different studies could be ascribed to a real discrepancy in the epidemiology of hev among iranian hd patients or it is merely a consequence of enrollment of samples , with distinct characteristics ( e.g. age , sex ) , or alternatively , the use of different commercial kits used , remains to be elucidated . in the present study , no variables conferred susceptibility to or provided protection against hev seropositivity this is in line with the majority of previous observations , where no significant variable has emerged as a risk factor for being hev - antibody positive ( 13 ) . moreover , we found no link between hev seropositivity and infection with viral blood - borne infections with hepatitis b , c , or hiv . the cross - sectional nature of the study precludes us from drawing inferences of causality from the observed associations . moreover , it is worthwhile to note that no anti - hev assay to date has been approved by the food and drug administration and the available commercial assays vary widely , in terms of precision ( 15 ) . in spite of the aforementioned limitations , in the present study , we documented a high rate of hev seropositivity in a sample of patients on maintenance hd , in an endemic region . the prevalence rate appears to be higher than that of the general population living in the same region . in conclusion this can lead to the possible parenteral transmission of hepatitis e in hd patients and other high - risk individuals . we need further studies to confirm this and the obtained insights may lead to cautionary measures required for high - risk groups .
background : previous studies have documented a high prevalence of hepatitis e among patients undergoing maintenance hemodialysis . available studies reporting on the seroprevalence of hepatitis e in hemodialysis patients in iran , an endemic region for the disease , are sparse.objectives:the present study aimed to determine the prevalence rate of anti - hepatitis e antibody in hemodialysis patients in hamadan , iran.patients and methods : in this cross - sectional study , all 153 consecutive patients undergoing hemodialysis in two centers were enrolled . patients demographic and clinical data were collected , using a standard questionnaire and from medical records . serum immunoglobulin g concentrations against hepatitis e were determined using the enzyme linked immunosorbent assay method.results:thirty patients ( 19.2% ) , were seropositive . seropositive patients were not significantly different from seronegative patients , with regard to age , sex , level of education , access to filtered water , and duration and frequency of hemodialysis . the proportions of patients with hepatitis b , c , and hiv infection were comparable between the two groups.conclusions:one in five patients undergoing maintenance dialysis in hamadan is seropositive for hepatitis e immunoglobulin g antibody . future studies are needed to investigate the factors contributing to the observed high prevalence rate and the possibility of parenteral transmission of hepatitis e.
a 35-year - old female reported with complaints of painful ulcers in the mouth , bleeding lips , rashes throughout the body , and high fever ( 39c ) of 4 days duration . her past medical history revealed that she was suffering from seizures for past 4 years and was on medication ( valproate 600 mg / day ) for the same . one week back , before reporting to us she was started on lamotrigine 25 mg / day along with valproate , since the seizure was not under the control only with valproate . subsequently , she developed high grade fever with watering of eyes , followed by painful ulcers in the oral cavity , encrustations on the lips , diffuse erythematous rashes over the face , neck , trunk , arms , and legs . history revealed that no such lesions occurred earlier and that was the first time such rashes have occurred . physical examination showed multiple round erythematous plaques on the face , neck , trunk , and extremities , some of which were tender . some of them showed diffuse atypical target lesions such as purpuric macules and papules especially on the hands . skin lesions on the face and neck on extra oral examination , there was limited mouth opening and erythematous crusted areas on both the lips with a rough surface . on intraoral examination , there was generalized inflammation and ulceration , which was progressive and caused functional difficulty . since the presumptive cause was lamotrigine , the drug was discontinued immediately ; the patient was hospitalized and treated symptomatically with cyclosporine and methyl prednisolone . her condition improved during the next 2 weeks , and she eventually recovered with continued follow - up on an outpatient basis . stevens johnson syndrome is a rare , life - threatening , and severe blistering mucocutaneous disease , most commonly caused by drugs . physicians , when they prescribe , must make the patients aware of the possible adverse effects . one such potential complication of drugs is sjs , a potentially life - threatening condition that manifests mainly on the skin and mucosal surfaces and also affects other vital organs . stevens johnson syndrome is a less severe variant of ten and separates clinically from erythema multiforme ( em ) . em is characterized by mucosal erosions of raised atypical target lesions usually located on the extremities and/or the face . the characteristic findings of sjs are mucosal erosions plus widespread distribution of flat atypical targets or purpuric macules . the lesions may be present on the trunk , face , and on the extremities . compared to em , sjs is more closely associated with medication use and mycoplasma pneumonia infection . the incidence of sjs is estimated to be between 1.1 and 7.7 cases per million , with 16% of cases showing a past history of short - term use of the anti - epileptic drug . lamotrigine is an analog of phenyltriazine class , a potential anti - epileptic drug , which is known to cause sjs , strengthening the probable association between lamotrigine and sjs . the risk of skin reactions is increased when the starting dose of lamotrigine is high when the dose is increased rapidly and when used in combination with valproate . the scenario suggested by today 's literature points toward drug - specific cd8 cytotoxic t - cells utilizing perforin / granzyme b triggered apoptosis of epithelial cells . following this , an expansion of apoptosis occurs involving the interaction of either membrane - bound or soluble fas ligand with its receptor fas . a widely accepted hypothesis regarding sjs has been that patients suffering from severe drug reactions are exposed to increased amounts of oxidative metabolites because of a lowered ability to detoxify reactive metabolites , either on a genetic basis or on a functional basis . individuals with antigens human leukocyte antigen bw44 , hla - b12 , hla - b*502 , and hladqb1 * 0601 appear to be more susceptible to developing sjs . drug - induced sjs could be diagnosed according to following criteria such as mucosal erosions plus widespread distribution of atypical targets or purpuric macules and epithelial detachment involving < 10% body surface area on the trunk , face , and extremities . the same criteria were used in the present case for the diagnosis of sjs . a recent study by oflaz et al . , in 2011 reported a case of lamotrigine induced sjs , especially with concomitant use of valproic acid . this holds well in our case where the patient was on lamotrigine for a week . this results in a reduced total clearance and therefore to an increased elimination half - life of lamotrigine , resulting in higher serum concentrations . johnson syndrome should be differentiated from other immunobullous lesions such as pemphigus vulgaris and bullous pemphigoid , acute generalized exanthematous pustulosis , linear iga dermatosis , paraneoplastic pemphigus , disseminated fixed bullous drug eruption , and staphylococcal scalded skin syndrome . treatment of sjs is primarily supportive and symptomatic which includes strict isolation , increasing caloric intake , preventing superinfection and sepsis , and correcting electrolyte disturbance . even though the role of systemic corticosteroids is still controversial , they have been the mainstay therapy for sjs in most cases , as in our case . complications include skin lesions secondary to the infection , organ dysfunction , mucocutaneous fibrosis , and ocular and esophageal strictures . in our case , pharmacovigilance is the pharmacological science relating to the detection , assessment , understanding and prevention of adverse effects , and the duty of this sector is to perform clinical trials to check the action of drugs . patient and their first - degree relatives should be alerted to their elevated risk of reaction to the same drug . genotyping should be undertaken as a screening measure for the particular population to know for which drug they are more prone for . the incidence of reports about drug - induced sjs and ten made through the central reporting system ( the database of the indian pharmacovigilance centre ) is less which may be due to negligence in documentation and publishing . stevens johnson syndrome a potentially life - threatening condition with an elevated morbidity and mortality requires immediate intervention and adequate management . in addition , we would like to alert that the use of lamotrigine should be supervised .
lamotrigine and valproic acid are well - tolerated anticonvulsants , but frequently associated with severe cutaneous reactions , such as the stevens johnson syndrome ( sjs ) and toxic epidermal necrolysis , when used in combination . we report a case of sjs likely induced by the use of a lamotrigine and valproic acid regimen and as a dental surgeon it is important to identify such lesion and report to pharmacovigilance .
although immuno - modulating type-1 interferons and glatiramer acetate reduce active cns inflammatory lesions , clinical severity and attack frequency in relapsing remitting ms , they are less efficacious in progressive disease . the immunosuppressive agent , mitoxantrone is presently approved for treating progressive ms but is limited because of severe adverse side - effects especially cardiotoxicity . the insulin - sensitizing anti - diabetic thiazolidinediones ( tzds ) are high affinity activators of the nuclear transcription factor peroxisome proliferator - activated receptor - gamma ( ppar ) . tzds inhibit t lymphocyte proliferation and activation , reduce expression and production of inflammatory molecules including interleukin-1 , tumor necrosis factor- and inducible nitric oxide synthase , increase astrocyte metabolism and resistance to cytotoxicity , and reduce clinical symptoms in experimental autoimmune encephalomyelitis ( eae ) , an autoimmune - mediated , demyelinating disease which provides a model for ms . in view of these effects and the established safety profile of tzds , we investigated the therapeutic potential of the fda - approved anti - diabetic tzd pioglitazone in a patient with secondary progressive ms . a 44-year - old woman with secondary progressive ms was diagnosed at age 20 yr , per lublin and reingold . during the next 15 years she had 8 documented relapses which resolved with intravenous glucocorticoid therapy . the relapses decreased in frequency during this time , after which her clinical status deteriorated , with progressive development of quadriparesis , ataxia , fatigue and cognitive decline . in 1994 , a trial of interferon -1b was discontinued because of increased spasticity , and she was not a candidate for glatiramer . when seen in 1999 her weight was 29.5 kg , down from 54.5 kg in 1976 . she was paraplegic , wheelchair - bound , and exhibited paresis of the upper extremities with oms ( oxford muscle strength ) score of 23 out of 5 ( table 1 ) and an edss score of 8.0 . neurological presentation included paraplegia , bilateral central scotomata with visual - field loss , dysphagia , chronic fatigue , cognitive impairment similar to mild dementia , and depressed mood . in june 2000 , having explained the rationale and risks , she consented to a trial of pioglitazone , which was initiated at 15 mg daily and increased by 15 mg biweekly to 45 mg . her weight increased from 27.3 to 35.9 kg ( 32% ) after 12 months treatment , which was maintained between 34.6 to 36.2 kg throughout an additional 18 months . weight gain was evident as increased muscle mass and peripheral fat , mainly in the hips , gluteal area , and limbs . improved fine coordination was noted unilaterally after 8 months ( left finger - to - nose execution ) , and bilaterally after 15 months . before pioglitazone , repetitive statements and forgetfulness , reminiscent of dementia , were problematic . after 8 months therapy , cognitive assessment demonstrated improvement in orientation , short - term memory ( recall increased from 0/3 to 2/3 objects ) , attention span , registration and insight , and is consistent with clinical improvement . according to dsm iv criteria , her depression also improved significantly , along with the progressive gain in weight and improvement in neurological function as a whole . she was progressively able to tolerate outdoor social activities for several hours at a time , with improved stamina and well - being . upper extremity muscle strength before and after 52 weeks on pioglitazone muscle strength determined using the oxford muscle strength grading scale ( grade 0 = no movement ; grade 3 = completely moves body part against gravity ; grade 5 = normal ) during the study , two mri studies with gadolinium ( gd ) were performed , one 18 months after initiation of pioglitazone and the second 10 months later ( figure 1 ) . there was no perceptible change in overall brain atrophy , extent of demyelination , or in gd - enhancement indicating that at least over the 10 months between the mri studies , the disease was quiescent . this also suggests that the beneficial effects of pioglitazone treatment were not associated with any overt improvement in pathology . there have been no adverse events , and her metabolic profile has remained normal throughout the study . axial t1-weighted fluid - attenuated inversion recovery ( flair ) mri images showing confluent demyelination . mris were taken at 10 months ( left ) and at 18 months ( right ) after initiation of treatment with pioglitazone . the limited efficacy and safety of immuno - modulatory and immuno - suppressive agents available for treating progressive ms warrants development of improved and safer therapies . ms is an autoimmune disease associated with inappropriate t lymphocyte activation , cns inflammation and demyelination , resulting in axonal and neuronal damage . the thiazolidinedione class of drugs were developed for the treatment of type 2 diabetes and act by improving insulin resistance without causing hypoglycemia , even in euglycemic individuals . they were later found to activate ppar and shown to promote anti - inflammatory and immunosuppressive effects by suppressing t lymphocyte activation , proliferation , and inhibiting cellular production of inflammatory molecules associated with ms . the beneficial effects of pioglitazone observed in this patient are somewhat unexpected as inflammation is less prominent in secondary progressive ms compared to relapsing remitting disease . however , improvements in upper body strength , coordination , dysphagia , and cognitive function , suggest neurological benefit associated with pioglitazone treatment . in addition to their anti - inflammatory actions , tzds can also influence cell physiology in a receptor - independent manner , and we recently demonstrated that tzds increase astrocyte glucose metabolism and lactate production . it is therefore feasible that effects on brain metabolism , for example increased capacity of astrocytes to provide lactate to surrounding neurons , accounts in part for improved cognitive and motor function . however , the persistence of lower extremity paralysis appears a likely consequence of irreversible spinal cord atrophy . the 30% gain in weight markedly exceeds the approximately 24% weight gain seen with diabetics [ see prescribing information : actos(pioglitazone hydrochloride ) , takeda chemical co. ] . while this may reflect decreased depression , there are as yet no reports that pioglitazone or any other thiazolidinedione , influence mood disorders . in eae mice pioglitazone decreased disease incidence , reduced maximum disease severity , and induced remission in already - ill animals . these drugs have also been shown to clinically ameliorate other inflammatory diseases including psoriasis and ulcerative colitis . described adverse effects for pioglitazone are confined to the diabetic population , and include mild edema , and limited weight gain , and pioglitazone has not been causally linked to hepatic failure , as has troglitazone . these findings imply that pioglitazone , and perhaps other insulin - sensitizing tzds may provide therapeutic benefit in ms . dsm , diagnostic and statistical manual of mental disorders ; flair , fluid attenuation inversion recovery ; gd , gadolinium ; mri , magnetic resonance imaging ; ms , multiple sclerosis ; pio , pioglitazone ; ppar , peroxisome proliferator - activated receptor gamma ; tzd , thiazolidinedione . hap was the primary physician , conceived of the original study , and prepared first draft of the manuscript . mth was a consulting neurologist , evaluated mri data , assisted with manuscript editing , and contributed to the original idea of treating ms patients with tzds . dlf organized and analyzed data , contributed to the original idea to treat ms patients with tzds , helped write and edit , and wrote the final draft of the manuscript . we thank monica menendez for secretarial assistance . supported by grants from the national multiple sclerosis society ( dlf ) , takeda pharmaceuticals ( dlf ) and bethesda pharmaceuticals ,
backgroundligands of the peroxisome proliferator - activated receptor - gamma ( ppar ) induce apoptosis in activated t - lymphocytes and exert anti - inflammatory effects in glial cells . preclinical studies have shown that the thiazolidinedione pioglitazone , an fda - approved ppar agonist used to treat type 2 diabetes , delays the onset and reduces the severity of clinical symptoms in experimental autoimmune encephalomyelitis , an animal model of multiple sclerosis ( ms ) . we therefore tested the safety and therapeutic potential of oral pioglitazone in a patient with secondary ms.case presentationthe rationale and risks of taking pioglitazone were carefully explained to the patient , consent was obtained , and treatment was initiated at 15 mg per day p.o . and then increased by 15 mg biweekly to 45 mg per day p.o . for the duration of the treatment . safety was assessed by measurements of metabolic profiles , blood pressure , and edema ; effects on clinical symptoms were assessed by measurement of cognition , motor function and strength , and mri . within 4 weeks the patient exhibited increased appetite , cognition and attention span . after 12 months treatment , body weight increased from 27.3 to 35.9 kg ( 32% ) and maintained throughout the duration of the study . upper extremity strength and coordination improved , and increased fine coordination was noted unilaterally after 8 months and bilaterally after 15 months . after 8 months therapy , the patient demonstrated improvement in orientation , short - term memory , and attention span . mris carried out after 10 and 18 months of treatment showed no perceptible change in overall brain atrophy , extent of demyelination , or in gd - enhancement . after 3.0 years on pioglitazone , the patient continues to be clinically stable , with no adverse events.conclusionsin a patient with secondary progressive ms , daily treatment with 45 mg p.o . pioglitazone for 3 years induced apparent clinical improvement without adverse events . pioglitazone should therefore be considered for further testing of therapeutic potential in ms patients .
evidence - based clinical practice requires that practitioners consider the best available evidence in support of potential clinical decisions . the highest category of evidence includes randomized controlled trials . with the increasing emphasis on evidence - based medicine , the urology literature has seen a rapid growth in the number of high - quality randomized controlled trials along with increased statistical rigor in the reporting of study results . statistical measures including p - values , confidence intervals ( ci ) , and number needed to treat ( nnt ) are becoming increasingly common in the urological literature . the meaning and appropriate interpretation of such measures are reviewed through the use of a clinical scenario . a 60-year - old otherwise healthy man has just undergone a transrectal ultrasound - guided prostate biopsy for a persistently elevated prostate - specific antigen ( psa ) of 6.2 ng / ml . his biopsy pathology was negative for prostate cancer . he now inquires whether there is any medication that he can take to decrease his risk of developing prostate cancer in the future . you are aware that 5-a - reductase inhibitors have been investigated for the chemoprevention of prostate cancer and decide to examine the literature for the current best evidence on this topic . you define the clinical question using the pico mnemonic . in men with negative prostate biopsies ( population ) , how effective are 5-a - reductase inhibitors ( intervention ) when compared to no treatment ( comparison ) for the prevention of prostate cancer ( outcome ) ? you decide to examine the literature on this clinical question by using pubmed . a search for all articles on 5-alpha - reductase inhibitors yields 1596 articles . a separate search for prostate cancer yields 85,759 articles when these two search terms are combined with the and function , 350 articles are found . by applying one article in this list that addresses your clinical question is a randomized controlled trial entitled , effect of dutasteride on the risk of prostate cancer . in this study 's final analysis , 6729 men between the ages of 50 and 75 years of age with an elevated psa and negative baseline prostate biopsies were randomized to treatment with dutasteride 0.5 mg or placebo daily . these patients then underwent transrectal ultrasound - guided prostate biopsies at 2 and 4 years , and the number of patients who developed prostate cancer on biopsy was recorded . before looking at the results of the study , you first examine its methodology to determine if the study results would be valid . using the consolidated standards of reporting trials ( consort ) statement as a guide the study 's primary endpoint was prostate cancer detection on biopsy at 2 and 4 years . over the entire 4-year study period , 659 of the 3305 men in the dutasteride group and 858 of the 3424 men in the placebo group were found to have prostate cancer . this study reports this result as a relative risk reduction for the development of prostate cancer of 22.8% ( 95% ci : 15.2 - 29.8 ; p < 0.001 ) for patients taking dutasteride compared to patients taking placebo . p -values were introduced in the first - half of the 20 century as the probability of rejecting the null hypothesis that a treatment has no effect when , in actuality , the null hypothesis is true . stated another way , a p - value is the probability that an observed difference is due to random chance when the null hypothesis is true . statisticians jerzy neyman and egon pearson later described this as a type i error in contrast to a type ii error where the null hypothesis is accepted when , in actuality , the null hypothesis is false . as statistician ronald a. fisher suggested , a p - value is an index for the strength of the evidence for the tested hypothesis against the null hypothesis . although a p - value is appropriately considered a statistic interpretable across a range of values , in contemporary experimental studies , statistical significance this means that the null hypothesis is appropriately rejected if the probability of a type i error is < 5% . in our study example , the hypothesis being tested is whether dutasteride decreases the risk of prostate cancer as detected by biopsy among men at increased risk for prostate cancer . the null hypothesis is therefore that dutasteride does not decrease the risk of prostate cancer . in this particular study , a p - value of 0.01 or less was used as the predetermined criterion for statistical significance . this means that the null hypothesis in which dutasteride does not decrease the risk of prostate cancer is appropriately rejected if the probability that the null hypothesis is rejected when it is in fact true is < 1% . in this study , a relative risk reduction for the development of prostate cancer of 22.8% therefore , the probability of rejecting the null hypothesis when it was in fact true was < 0.1% , and the result is statistically significant by the study 's predetermined criterion . we can therefore have confidence that dutasteride does reduce the risk of prostate cancer in this patient population by 22.8% . although a p - value is helpful in determining the reliability with which the null hypothesis can be rejected and therefore the strength of the observed result , it does not provide information regarding the precision of the result . to address this issue , ci can be calculated around the point estimate of the result to provide a range of values within which the true value is certain to exist with a given level of confidence . a wide ci suggests an imprecise result and indicates that the results should be interpreted with caution regardless of statistical significance . in accordance with the conventional acceptance of statistical significance at a p - value of 0.05 or 5% , if an observed result is statistically significant at a p - value of 0.05 , then the null hypothesis should not fall within the 95% ci . in our study example , the result is expressed as a relative risk reduction percentage . the null hypothesis would therefore be a relative risk reduction of 0% . in this study , the relative risk reduction over four years in men treated with dutasteride was 22.8% and the 95% ci was 15.2 - 29.8% . the null hypothesis of no risk reduction with dutasteride does not fall within the 95% ci , and the result is therefore statistically significant at a p - value of < 0.05 . furthermore , the 95% ci is relatively narrow and suggests that the true relative risk reduction with dutasteride is between 15.2% and 29.8% . the fact that there is a reasonably large relative risk reduction even at the low end of the confidence interval suggests that the result is not only statistically meaningful , but also clinically meaningful . although measures such as relative and absolute risk provide discrete statistical estimates of treatment effect , the magnitude of a treatment 's clinical effect is often difficult to determine through these statistics . the nnt , however , is a straightforward measure that conveys an estimate of a treatment 's clinical effect . for a study of treatment effect , the nnt is defined as the number of patients that must be treated in order to prevent one additional adverse outcome . it is easily calculated as the inverse of the absolute risk difference between treatment groups . in general , a large treatment effect is associated with a small nnt while a small treatment effect is associated with a large nnt . in our study example , after 4 years of treatment , 659 of the 3305 men in the dutasteride group and 858 of the 3424 men in the placebo group were found to have prostate cancer . in this study , the absolute risk of developing prostate cancer in the treatment group was 659/3305 = 19.9% . the nnt is then the inverse of the absolute risk difference , which was 1/0.052 = 19.2 . therefore , approximately 19 men need to be treated with dutasteride to prevent one additional case of prostate cancer at 4 years . it is important to note that nnt does not incorporate the time to the observed effect . in many cases , a longer duration of treatment will increase the reduction in risk . in our sample study , , the nnt would therefore have been 26.3 patients . because timing may change the result , it is important to report the timing of the observed effect along with the nnt . furthermore , just as ci can be calculated to provide a more complete picture of point estimates of effect such as relative risk reduction , so too can confidence intervals be calculated for nnt . if the observed effect is statistically significant , this can be accomplished by taking the inverse of the upper and lower limits of the ci of the absolute risk difference . the calculation of ci for a nonsignificant result has been described previously and is beyond the scope of this paper . according to our sample study , the use of dutasteride in men with an elevated psa between 2.5 and 10 ng / ml and a negative baseline prostate biopsy confers a significant relative risk reduction for the development of prostate cancer of 22.8% ( 95% ci : 15.2 - 29.8 ; p<0.001 ) at 4 years compared to patients who received placebo . the number of men that need to be treated with dutasteride to prevent one additional diagnosis of prostate cancer in 4 years is 19 . this result appears to be not only statistically significant , but also robust with a narrow confidence interval that is relatively far from the null hypothesis . a distinction should be made , however , between statistical significance and clinical significance . in general , a larger sample size will reduce the probability of a type i error and therefore decrease the p - value . this raises the possibility that a clinically insignificant difference may be found to be statistically significant . the actual magnitude of the treatment effect should always be considered separately from considerations of statistical significance . in particular , nnt places study results in a context that allows discussion of broader issues such as the cost of treatment to society and the exposure of patients to potential adverse reactions . in this study , the nnt is relatively low at 19 and provided additional benefits with regard to outcomes related to benign prostatic hyperplasia with a low side effect profile . based upon the results of this study , treatment of your patient with dutasteride may be appropriate as a means to decrease his risk of developing prostate cancer in the future . as the quality of the evidence in the urological literature improves , urologists are increasingly faced with statistical measures such as p - values , ci , and nnt . together , these statistical measures allow a more complete picture of the true effect observed in any given study . an understanding of these measures is therefore essential to the critical appraisal of the study literature in evidence - based medicine .
objectives : with the increasing emphasis on evidence - based medicine , the urology literature has seen a rapid growth in the number of high - quality randomized controlled trials along with increased statistical rigor in the reporting of study results . p - values , ci , and number needed to treat ( nnt ) are becoming increasingly common in the literature . this paper seeks to familiarize the reader with statistical measures commonly used in the evidence - based literature.materials and methods : the meaning and appropriate interpretation of these statistical measures is reviewed through the use of a clinical scenario.results:the reader will be better able to understand such statistical measures and apply them to the critical appraisal of the literature.conclusions:p-values , ci , and nnt each provide a slightly different estimate of statistical truth . together , they provide a more complete picture of the true effect observed in a study . an understanding of these measures is essential to the critical appraisal of study results in evidence - based medicine .
on july 2004 , a previously healthy 44-year - old man who lived in gabon was admitted to the outpatient clinic of the university hospital in udine , italy , with a 6-month history of recurrent fever , headache , fatigue , weight loss , leg paresthesias , gait difficulties , and daytime somnolence . he had been living in libreville , gabon , since 1961 , made yearly visits to italy , and had never visited other african countries . he reported frequent tsetse fly bites while sailing on the como river or walking in the forests in gabon . he recalled several febrile episodes that had been presumptively treated as malaria ; the last occurred in february 2004 . he subsequently had bilateral peripheral edema of the leg and progressive weakness , reversal of his sleep pattern with daytime somnolence and insomnia at night , loss of appetite , and a marked weight loss ( 20 kg ) . one month before admission to the hospital , he was examined in an emergency room and by a general practitioner , but a diagnosis was not made . laboratory findings at that time were an erythrocyte sedimentation rate ( esr ) of 122 mm / h and hypergammaglobulinemia ( 4.5 g / dl ) . upon examination , he was oriented but irritable and apyretic . he had a blood pressure of 110/70 mm hg and a pulse rate of 104/min . enlarged lymph nodes were found in the axillae , groin , supraclavicular region , and posterior neck triangle . the liver and spleen were enlarged ( spleen diameter 20 cm by ultrasound ) . neurologic examination showed walking ataxia , decreased sensitivity to light touch in both legs , and no deep tendon reflexes . laboratory tests showed pancytopenia , an increased esr , and hypergammaglobulinemia with increased levels of immunoglobulin m ( igm ) ( table ) . lumbar puncture showed clear cerebrospinal fluid ( csf ) with increased leukocyte counts , protein and igm levels , and a low glucose level ( table ) . an indirect hemagglutination ( iha ) test result was positive for t. brucei ( titer 1:64 ) . second - stage sleeping sickness ( stage 2 hat ) was diagnosed , but treatment with eflornithine ( obtained from the world health organization [ who ] ) could not be initiated until 9 days after the diagnosis because of getting medication through customs . in this 9-day period , the patient was then given a standard dose of eflornithine ( 100 mg / kg intravenously 4/day for 14 days ) , and his condition improved rapidly , lymphadenopathy resolved , and neurologic status normalized within 2 weeks . lumbar puncture on day 14 of treatment did not show any trypanosomes , and all csf parameters improved . he was advised to remain in italy for further follow - up , but he went back to gabon and has not provided any subsequent medical information . * esr , erythrocyte sedimentation rate ; crp , c - reactive protein ; igm , immunoglobulin m. trypomastigote ( arrow ) in a giemsa - stained cerebrospinal fluid smear of patient 1 ( original magnification 1,000 ) . a 54-year - old woman was admitted to the centre for tropical diseases of sacro cuore hospital of negrar in verona , italy , in late september 2004 with a 3-month history of recurrent fever , headache , insomnia , and increased fatigue . she had lived for 30 years in the central african republic and had not visited any other african countries during that time . at admission , she was afebrile , and physical examination showed diffuse cutaneous hyperesthesia and splenomegaly ( main spleen diameter 19.5 cm by ultrasound ) . blood cell counts and biochemical tests showed anemia ( hemoglobin level 8.3 g / dl ) and leukopenia ( leukocyte count 2,700/l ) . a quantitative buffy coat test result for a quantitative buffy coat test result was negative for malaria , but this test showed viable trypomastigotes . serologic results for t. brucei ( iha test ) were positive ( titer 1:128 ) . results of csf examination were normal . since we could not treat this patient with eflornithine ( who provides this drug only for stage 2 hat ) , intramuscular pentamidine was administered at the dose of 4 mg / kg for 10 days . tests to detect trypanosomes in blood were conducted daily for 8 days after treatment was initiated , but no trypomastigotes were found . her clinical course was uneventful , except for a sterile abscess at the injection site . she was afebrile and was discharged on day 25 in good condition , although she still had insomnia and headaches . trypomastigotes in a giemsa - stained thin blood film of patient 2 ( original magnification 1,000 ) . in february 2005 , she returned for a follow - up examination . the headaches and insomnia continued ( she did not sleep > 2 hours per night ) . total protein levels in csf increased to 570 mg / dl , but cells in csf were within normal ranges . based on these findings , treatment with intravenous eflornithine ( 100 mg / kg 4/day for 14 days ) was initiated . the patient had generalized tremors ( without fever ) during the third infusion ( no electroencephalographic signs of convulsions ) , but subsequent findings were uneventful . she was discharged after completion of treatment . at a follow - up visit in april 2005 , she reported a nearly normal sleeping pattern . eighty - four imported cases of trypanosomiasis caused by t. b. gambiense were reported in europe before 1963 . from 1966 to 1979 , 12 cases were reported in france , which reported the most cases in europe ( 4 ) . during this period , incidence in trypanosomiasis - endemic countries decreased after intensive control activities . eight imported cases of infection with t. b. gambiense in persons from europe have been reported since 1985 ( 411 ) , and 2 additional cases were recorded in france by the centre national de rfrence de lepidmiologie du paludisme dimportation et autochtone ( f. legros , pers . t. b. gambiense infection has not been reported in italy ( c. mauro , ministry of health , pers . a sporadic case of infection with t. b. gambiense in an italian expatriate in zaire ( now the democratic republic of congo ) was reported in belgium in 1996 ( 12 ) . the simultaneous occurrence of 2 cases in italy suggests an increased risk for infection with t. b. gambiense in expatriates working in disease - endemic areas . this increased risk is not surprising if one considers the increased incidence of this infection in african countries ( 1 ) . in countries not endemic for this infection , diagnosis of imported cases of infection with t. b. gambiense is challenging because of variations in clinical signs and symptoms and low sensitivities of diagnostic tests ( 13 ) . the first patient in our study was misdiagnosed and not treated for several weeks because he had no fever and clinical manifestations were limited to neurologic symptoms . high levels of igm in blood and an enlarged spleen should suggest the possibility of trypanosomiasis ( the main differential diagnosis is hyperreactive malarial splenomegaly ) . techniques for concentrating parasites should be used , and blood films should be examined daily in patients with these symptoms . involvement of the central nervous system in trypanosomiasis has been confirmed by increased lymphocyte counts ( > 5 cells/l ) or trypanosomes in csf ( 14 ) . however , as in the second patient , neurologic involvement can not be ruled out even in those in whom csf is normal . leukocyte counts > 20 cells/l in csf and intrathecal igm synthesis independent of trypanosomes in csf have been proposed as modified criteria for diagnosis of stage 2 hat ( 14,15 ) . eflornithine , the preferred treatment for stage 2 hat , was obtained from who to treat 1 of the patients . custom formalities in italy , which resulted in a delay in receiving this drug , are inappropriate for emergency drug treatment . thus , our experience with the 2 patients and recent outbreaks of infection with t. b. rhodesiense emphasize the need for readily available trypanocidal drugs .
african trypanosomiasis caused by trypanosoma brucei gambiense has not been reported in italy . we report 2 cases diagnosed in the summer of 2004 . theses cases suggest an increased risk for expatriates working in trypanosomiasis - endemic countries . travel medicine clinics should be increasingly aware of this potentially fatal disease .
woscops randomized 6,595 men ages 45 to 64 years with moderate hypercholesterolemia ( ldl cholesterol concentrations 152 to 228 mg / dl ) and no prior history of myocardial infarction to receive placebo or pravastatin 40 mg / day . plasma was obtained before randomization and at 1 year , and was stored at 80c . for the present analysis , we identified all participants with sufficient stored plasma at both time points . as a result , the research ethics committee of the university of glasgow and all participating centers approved the trial design , and the participants provided written informed consent . cardiac troponin i concentrations in stored plasma were determined at baseline and at 1 year using the architectstat high - sensitive troponin i assay ( abbott laboratories , abbott park , illinois ) . the limit of detection is 1.2 ng / l , and the interassay coefficient of variation is < 10% at 4.7 ng / l . the upper reference limit or 99th - centile value is 34 ng / l in men ( 16 ) . all samples underwent centrifugation twice ( 3,000 relative centrifugal force for 10 min ) to ensure samples were visibly homogeneous according to the manufacturer s instructions . the primary outcome of the trial was a composite of nonfatal myocardial infarction ( including nonhospitalized silent myocardial infarction ) and death from coronary heart disease . during the formal trial period , patients were followed for an average of 4.9 years to determine the occurrence of the primary endpoint and other events , which were adjudicated by an endpoints committee 1 , 15 . additional follow - up for up to 15 years after randomization was available through the interrogation of records held by the national health service for scotland ( 2 ) . myocardial infarction events during the trial period included silent infarction , whereas those over the 15-year period were based only on hospitalization . the distribution of troponin i was skewed , and values were log - transformed before analysis . comparisons of baseline characteristics between groups were made using chi - square test for categorical variables and 1-way analysis of variance or the kruskal - wallis test for continuous variables . multivariable cox proportional hazards regression analyses were used to evaluate the associations between baseline and change in troponin concentration at 1 year with risk of coronary events over 5 and 15 years in the study population and a subgroup with no symptoms or signs of coronary heart disease at enrollment . treatment effects ( pravastatin vs. placebo ) are expressed as hazard ratio ( hr ) with 95% confidence interval ( ci ) . percent change in troponin was determined from the concentration at 1 year relative to the concentration at baseline , and the association with percent change in ldl cholesterol over the same period was assessed using the pearson correlation coefficient . an independent - samples student t test was used to compare the mean change between treatment groups . participants who had a coronary event before the 1-year visit were excluded for the purpose of this analysis . the effect of change in troponin on coronary events at 5 years was explored further by splitting both treatments into 5 groups based on quintile cutpoints in the placebo group . determinants of log - transformed baseline troponin i were investigated using stepwise linear regression at p - to - enter of 0.10 and p - to - stay of 0.05 . analyses were performed using spss version 20.0.0 ( ibm corp . , armonk , new york ) , sas enterprise guide 5.1 ( sas institute inc . , cary , north carolina ) , and r version 3.0.0 ( r project for statistical computing , vienna , austria ) . woscops randomized 6,595 men ages 45 to 64 years with moderate hypercholesterolemia ( ldl cholesterol concentrations 152 to 228 mg / dl ) and no prior history of myocardial infarction to receive placebo or pravastatin 40 mg / day . plasma was obtained before randomization and at 1 year , and was stored at 80c . for the present analysis , we identified all participants with sufficient stored plasma at both time points . as a result , the research ethics committee of the university of glasgow and all participating centers approved the trial design , and the participants provided written informed consent . cardiac troponin i concentrations in stored plasma were determined at baseline and at 1 year using the architectstat high - sensitive troponin i assay ( abbott laboratories , abbott park , illinois ) . the limit of detection is 1.2 ng / l , and the interassay coefficient of variation is < 10% at 4.7 ng / l . the upper reference limit or 99th - centile value is 34 ng / l in men ( 16 ) . all samples underwent centrifugation twice ( 3,000 relative centrifugal force for 10 min ) to ensure samples were visibly homogeneous according to the manufacturer s instructions . the primary outcome of the trial was a composite of nonfatal myocardial infarction ( including nonhospitalized silent myocardial infarction ) and death from coronary heart disease . during the formal trial period , patients were followed for an average of 4.9 years to determine the occurrence of the primary endpoint and other events , which were adjudicated by an endpoints committee 1 , 15 . additional follow - up for up to 15 years after randomization was available through the interrogation of records held by the national health service for scotland ( 2 ) . myocardial infarction events during the trial period included silent infarction , whereas those over the 15-year period were based only on hospitalization . the distribution of troponin i was skewed , and values were log - transformed before analysis . comparisons of baseline characteristics between groups were made using chi - square test for categorical variables and 1-way analysis of variance or the kruskal - wallis test for continuous variables . multivariable cox proportional hazards regression analyses were used to evaluate the associations between baseline and change in troponin concentration at 1 year with risk of coronary events over 5 and 15 years in the study population and a subgroup with no symptoms or signs of coronary heart disease at enrollment . treatment effects ( pravastatin vs. placebo ) are expressed as hazard ratio ( hr ) with 95% confidence interval ( ci ) . percent change in troponin was determined from the concentration at 1 year relative to the concentration at baseline , and the association with percent change in ldl cholesterol over the same period was assessed using the pearson correlation coefficient . an independent - samples student t test was used to compare the mean change between treatment groups . participants who had a coronary event before the 1-year visit were excluded for the purpose of this analysis . the effect of change in troponin on coronary events at 5 years was explored further by splitting both treatments into 5 groups based on quintile cutpoints in the placebo group . determinants of log - transformed baseline troponin i were investigated using stepwise linear regression at p - to - enter of 0.10 and p - to - stay of 0.05 . , armonk , new york ) , sas enterprise guide 5.1 ( sas institute inc . , cary , north carolina ) , and r version 3.0.0 ( r project for statistical computing , vienna , austria ) . baseline characteristics of the 3,318 participants in this analysis were similar to the full study population ( online table 1 ) . ng / l , with an interquartile range of 3.1 to 5.2 ng / l . values were above the limit of detection ( 1.2 ng / l ) in 3,311 participants ( 99.8% ) and above the 99th - centile ( 34 ng / l ) in 48 participants ( 1.5% ) . for the purpose of this analysis , 7 participants with undetectable troponin concentrations were assigned a value of 1.2 ng / l . participants were stratified into quarters of the baseline troponin concentration ( table 1 ) . compared to the lowest quarter , participants in the upper quarters were older and were more likely to have a history of hypertension , symptoms of angina , and minor abnormalities on the electrocardiogram ( p < 0.001 for all ) . those in the highest quarter had higher systolic and diastolic blood pressures ( 139 18 mm hg vs. 133 17 mm hg and 85 11 mm hg vs. 83 11 mm hg , respectively ) , and there were small differences in total and ldl cholesterol concentrations across the quarters ( 4 and 5 mg / dl , respectively ) . in contrast , there were no significant differences in high - density lipoprotein cholesterol and triglyceride concentrations or the prevalence of diabetes mellitus . in a stepwise linear regression model , higher baseline troponin concentrations were associated with increased age , body mass index , systolic blood pressure , and ldl cholesterol concentrations , and a higher prevalence of anginal symptoms and minor echocardiographic abnormalities ( minor st - segment and t - wave abnormalities ) ( online table 2 ) . higher troponin concentrations at baseline were associated with increased risk of coronary heart disease at both 5- and 15-year follow - up ( figure 1 , online table 3 ) . compared to the lowest quarter ( 3.1 ng / l ) were at the highest risk for nonfatal myocardial infarction or death from coronary heart disease at 5 and 15 years ( hr : 2.27 ; 95% ci : 1.42 to 3.65 and hr : 1.54 ; 95% ci : 1.16 to 2.05 , respectively ; p < 0.001 for both ) . all - cause mortality and cardiovascular death were also associated with baseline troponin concentration , but noncardiovascular death was not . in a sensitivity analysis , similar relationships were observed for the primary endpoint in 2,882 men without symptoms or signs of coronary heart disease at enrollment ( online figure 1 ) . in this subset of the original study , the hr for the overall relative treatment effect for the primary endpoint at 5 years was 0.45 ( 95% ci : 0.32 to 0.65 ; p < 0.001 ) and for the outcome of coronary death or hospitalized myocardial infarction at 15 years was 0.68 ( 95% ci : 0.56 to 0.83 ; p < 0.001 ) . there was no evidence of an interaction between treatment effect and quarters of baseline troponin concentration ( p = 0.67 and p = 0.19 , respectively , for the 5- and 15-year outcomes ) ( online table 4 ) . at 15 years , the absolute risk reduction in nonfatal myocardial infarction or death from coronary heart disease was greatest in the highest quarter ( 9.0% ) compared to the lower three quarters ( 2.6% to 3.0% ) ( online figure 2 ) . at 1 year , participants taking pravastatin had a greater reduction in troponin concentration ( 19% ) ( 95% ci : 17% to 20% ) than those receiving placebo ( 6% ) ( 95% ci : 4% to 8% ; p < 0.001 ) ( figure 2 ) . ng / l ( interquartile range : 1.2 to 2.8 ng / l ; p < 0.001 ) . change in troponin concentration on treatment correlated weakly with change in ldl cholesterol ( r = 0.20 ; p < 0.001 ) . after adjustment for multiple variables ( including baseline troponin concentration , and baseline and change in ldl cholesterol ) , change in troponin concentration at 1 year was an independent predictor of nonfatal myocardial infarction or death from coronary heart disease at both 5 and 15 years in both treatment arms ( table 2 ) . to explore this relationship further , participants were divided into fifths based on the change in troponin concentration in the placebo group . there was a clear gradient of risk across change in troponin . in the placebo group , relative to the referent ( middle ) fifth , those in the top fifth ( > 26% increase ) had a higher risk of the primary endpoint over 5 years , and those in the bottom fifth ( > 27% decrease ) had a lower risk ( p < 0.001 for trend ) ( figure 3 ) . in those taking pravastatin , a similar trend was observed , but twice as many men were in the lowest - risk group , with > 27% reductions in troponin concentration ( 645 vs. 320 on placebo ; p < 0.001 ) , and 30% fewer were in the highest risk group , with > 26% increase in troponin concentration ( 223 vs. 320 on placebo ; p < 0.001 ) . the risk of the primary endpoint in participants on pravastatin was 5-fold lower in those with the greatest reduction in troponin concentration ( hr 0.23 ; 95% ci : 0.10 to 0.53 ) compared to those with the greatest increase in troponin concentration ( hr 1.08 ; 95% ci : 0.53 to 2.21 ; p < 0.001 for trend ) despite similar reductions in ldl cholesterol concentration ( 22% to 28% ) . compared to placebo , participants taking pravastatin with the greatest reduction in troponin at 1 year ( highest quarter : 38% reduction vs. lowest quarter : > 3% increase ) had the largest reduction in cardiovascular events ( hr : 0.21 . 95% ci : 0.08 to 0.52 vs. hr : 0.82 ; 95% ci : 0.51 to 1.32 , respectively ; p = 0.002 ) , whereas the reduction in events was similar across quarters of change in ldl cholesterol ( p = 0.823 ) ( online figure 3 ) . ng / l , with an interquartile range of 3.1 to 5.2 ng / l . values were above the limit of detection ( 1.2 ng / l ) in 3,311 participants ( 99.8% ) and above the 99th - centile ( 34 ng / l ) in 48 participants ( 1.5% ) . for the purpose of this analysis , 7 participants with undetectable troponin concentrations were assigned a value of 1.2 ng / l . participants were stratified into quarters of the baseline troponin concentration ( table 1 ) . compared to the lowest quarter , participants in the upper quarters were older and were more likely to have a history of hypertension , symptoms of angina , and minor abnormalities on the electrocardiogram ( p < 0.001 for all ) . those in the highest quarter had higher systolic and diastolic blood pressures ( 139 18 mm hg vs. 133 17 mm hg and 85 11 mm hg vs. 83 11 mm hg , respectively ) , and there were small differences in total and ldl cholesterol concentrations across the quarters ( 4 and 5 mg / dl , respectively ) . in contrast , there were no significant differences in high - density lipoprotein cholesterol and triglyceride concentrations or the prevalence of diabetes mellitus . in a stepwise linear regression model , higher baseline troponin concentrations were associated with increased age , body mass index , systolic blood pressure , and ldl cholesterol concentrations , and a higher prevalence of anginal symptoms and minor echocardiographic abnormalities ( minor st - segment and t - wave abnormalities ) ( online table 2 ) . higher troponin concentrations at baseline were associated with increased risk of coronary heart disease at both 5- and 15-year follow - up ( figure 1 , online table 3 ) . compared to the lowest quarter ( 3.1 ng / l ) , patients in the highest quarter ( 5.2 ng / l ) were at the highest risk for nonfatal myocardial infarction or death from coronary heart disease at 5 and 15 years ( hr : 2.27 ; 95% ci : 1.42 to 3.65 and hr : 1.54 ; 95% ci : 1.16 to 2.05 , respectively ; p < 0.001 for both ) . all - cause mortality and cardiovascular death were also associated with baseline troponin concentration , but noncardiovascular death was not . in a sensitivity analysis , similar relationships were observed for the primary endpoint in 2,882 men without symptoms or signs of coronary heart disease at enrollment ( online figure 1 ) . in this subset of the original study , the hr for the overall relative treatment effect for the primary endpoint at 5 years was 0.45 ( 95% ci : 0.32 to 0.65 ; p < 0.001 ) and for the outcome of coronary death or hospitalized myocardial infarction at 15 years was 0.68 ( 95% ci : 0.56 to 0.83 ; p < 0.001 ) . there was no evidence of an interaction between treatment effect and quarters of baseline troponin concentration ( p = 0.67 and p = 0.19 , respectively , for the 5- and 15-year outcomes ) ( online table 4 ) . at 15 years , the absolute risk reduction in nonfatal myocardial infarction or death from coronary heart disease was greatest in the highest quarter ( 9.0% ) compared to the lower three quarters ( 2.6% to 3.0% ) ( online figure 2 ) . at 1 year , participants taking pravastatin had a greater reduction in troponin concentration ( 19% ) ( 95% ci : 17% to 20% ) than those receiving placebo ( 6% ) ( 95% ci : 4% to 8% ; p < 0.001 ) ( figure 2 ) . ng / l ( interquartile range : 1.2 to 2.8 ng / l ; p < 0.001 ) . change in troponin concentration on treatment correlated weakly with change in ldl cholesterol ( r = 0.20 ; p < 0.001 ) . after adjustment for multiple variables ( including baseline troponin concentration , and baseline and change in ldl cholesterol ) , change in troponin concentration at 1 year was an independent predictor of nonfatal myocardial infarction or death from coronary heart disease at both 5 and 15 years in both treatment arms ( table 2 ) . to explore this relationship further , participants were divided into fifths based on the change in troponin concentration in the placebo group . there was a clear gradient of risk across change in troponin . in the placebo group , relative to the referent ( middle ) fifth , those in the top fifth ( > 26% increase ) had a higher risk of the primary endpoint over 5 years , and those in the bottom fifth ( > 27% decrease ) had a lower risk ( p < 0.001 for trend ) ( figure 3 ) . in those taking pravastatin , a similar trend was observed , but twice as many men were in the lowest - risk group , with > 27% reductions in troponin concentration ( 645 vs. 320 on placebo ; p < 0.001 ) , and 30% fewer were in the highest risk group , with > 26% increase in troponin concentration ( 223 vs. 320 on placebo ; p < 0.001 ) . the risk of the primary endpoint in participants on pravastatin was 5-fold lower in those with the greatest reduction in troponin concentration ( hr 0.23 ; 95% ci : 0.10 to 0.53 ) compared to those with the greatest increase in troponin concentration ( hr 1.08 ; 95% ci : 0.53 to 2.21 ; p < 0.001 for trend ) despite similar reductions in ldl cholesterol concentration ( 22% to 28% ) . compared to placebo , participants taking pravastatin with the greatest reduction in troponin at 1 year ( highest quarter : 38% reduction vs. lowest quarter : > 3% increase ) had the largest reduction in cardiovascular events ( hr : 0.21 . 95% ci : 0.08 to 0.52 vs. hr : 0.82 ; 95% ci : 0.51 to 1.32 , respectively ; p = 0.002 ) , whereas the reduction in events was similar across quarters of change in ldl cholesterol ( p = 0.823 ) ( online figure 3 ) . we observed a strong , specific , and independent association between baseline and 1-year change in plasma troponin i concentration and the onset of coronary heart disease over 5 and 15 years in woscops . troponin concentrations were reduced by pravastatin therapy , which doubled the number of men whose troponin fell by more than a quarter and were at the lowest risk for future coronary events . thus , pravastatin treatment caused similar relative risk reductions in each category of troponin change and increased the propensity for troponin concentrations to fall , leading to additive decrements in future risk that appeared to be independent of ldl cholesterol lowering . we conclude that high - sensitivity cardiac troponin assays can be used to predict future risk of coronary heart disease and to assess response to statin therapy ( central illustration ) . therefore , serial troponin measurements appear to have major potential to monitor risk and assess the impact of established or novel therapeutic interventions on future coronary heart disease risk . our analysis has a number of important and distinctive strengths that distinguish it from previous studies of troponin in coronary heart disease risk prediction . first , we evaluated plasma troponin concentration in a primary prevention setting rather than in populations that included patients with established coronary heart disease . second , we had access to prolonged robust clinical follow - up of well - characterized participants over a 15-year period . third , we used the latest - generation high - sensitivity cardiac troponin i assay , which detected troponin in 99.8% of the study population . finally , in addition to exploring associations with baseline troponin concentration , we were able to critically assess dynamic changes in troponin concentrations as part of a major randomized placebo - controlled trial of statin therapy . in woscops , a number of biomarkers have been assessed for cardiovascular risk stratification 17 , 18 , 19 . in previous analyses , c - reactive protein predicted both cardiovascular and noncardiovascular events ( 19 ) , whereas troponin is a specific biomarker for the prediction of coronary heart disease outcomes . interestingly , in contrast to recent studies of patients with established coronary heart disease ( 8) , we found that troponin predicted fatal and nonfatal myocardial infarction rather than heart failure events . similar associations were recently reported in individuals without cardiovascular disease who participated in the jupiter ( justification for the use of statins in primary prevention ) trial ( 20 ) . this finding likely reflects differences in the extent of coronary heart disease at enrollment , the use of concomitant therapies , and the low prevalence of heart failure events . the association between troponin and coronary heart disease risk is nonlinear , with an apparent threshold at 5.2 ng / l that identifies those 2 to 3 times more likely to have a coronary event over 15 years . this is consistent with findings from other cohorts using the same assay ( 21 ) , in which receiver - operating curve analysis identified a threshold of 6 ng / l in a randomized trial population with established coronary heart disease ( 14 ) and 7 ng / l in men who participated in the scottish heart health study ( 12 ) . interestingly , troponin concentrations < 5 ng / l also identify patients as low risk in the emergency department ( 21 ) , and increasingly this approach is being used to rule out myocardial infarction in clinical practice . primary prevention guidelines recommend statins for the prevention of cardiovascular disease in any individual with a 10-year estimated risk of a cardiovascular event > 7.5% ( 22 ) . this approach has been widely debated , with the benefits and risks for the individual more evenly balanced 5 , 6 , 7 . we believe cardiac troponin may help to better stratify those healthy individuals at risk for coronary heart disease who would benefit most from statin therapies and that this approach should be formally addressed in prospective trials . however , the observations that a large majority of participants on pravastatin had lower troponin concentrations at 1 year and that this reduction correlated with the decrease in ldl cholesterol were unexpected . ( 23 ) reported that cardiac troponin concentrations were reduced with pravastatin in patients with coronary heart disease . however , troponin concentrations were measured by a contemporary sensitive assay and were undetectable in more than one - third of patients and were below the limit of analytical precision in the majority . as such , the assay had insufficient sensitivity to evaluate the relationship among pravastatin therapy , troponin concentration , and ldl cholesterol . in contrast , we used a novel high - sensitivity assay that was able to measure cardiac troponin in > 99% of our study population . this allowed us to explore associations among change in troponin , ldl cholesterol , and coronary events . we observed that change in troponin predicted risk with an approximately 5-fold range in hrs when comparing men with the greatest increases and decreases in troponin concentration . we observed the lowest rate of coronary heart disease events ( 1.4% over 5 years ) in men treated with pravastatin whose troponin concentration fell by more than a quarter and the highest in those taking placebo with an increase in troponin of more than a quarter ( 11.6% over 5 years ) . although ldl cholesterol level is currently used to select patients for statin therapy and to monitor treatment response , it was notable that neither baseline nor change in ldl cholesterol predicted future coronary events . importantly , pravastatin more than doubled the likelihood of a reduction in troponin concentration and this appeared to be independent of ldl cholesterol lowering . in addition to reducing serum cholesterol concentrations , statins reduce the levels of other oxidized proteins , improve endothelial nitric oxide bioavailability , and slow progression of atherosclerosis ( 24 ) . our observations suggest the preventative effects of statin therapy are mediated in part by these other mechanisms . it was surprising that change in troponin concentration at 1 year was an independent predictor of risk in the placebo group , in which ldl cholesterol concentrations were unchanged . it is possible that cardiac troponin concentrations are modulated by a minor fraction , such as oxidized ldl , that is not reflected when measuring total ldl concentration . such oxidized lipoproteins may influence troponin concentration directly through a toxic effect on cardiomyocytes or indirectly through their effects on nitric oxide bioavailability and myocardial perfusion . we speculate that recruitment to woscops may have increased awareness of cardiovascular risk in some trial participants , thereby inducing lifestyle modifications that both lower cardiac troponin concentration and improve outcomes . a biomarker that can dynamically track the risk of coronary heart disease over time would be a major step forward . indeed , previous studies have failed to demonstrate that changes in inflammatory , hemostatic , or lipid biomarkers can predict future cardiovascular risk 17 , 18 , 19 . this unique property of change of troponin with time has major ramifications and suggests that serial high - sensitivity troponin measurements could represent a major surrogate biomarker to help manage our patients and evaluate coronary heart disease risk with established or novel cardiovascular and noncardiovascular therapies . the trial was conducted in middle - aged men with raised cholesterol levels , and the findings may not be applicable to the wider population including women . / l that identified men at increased risk in our study population may not apply to women or to other groups ( 16 ) . we were able to obtain results from only 3,318 participants , and the requirement for a 1-year sample restricted the study population to those who were compliant with the protocol . this is the most likely explanation for the apparently greater treatment effect in this study compared to the intention - to - treat risk reduction reported previously ( 8) . our analysis was performed on samples stored for 20 years , and it is possible we underestimated the association between troponin and coronary heart disease events because of interference from the formation of fibrin microparticulates during storage . although the effect of pravastatin on troponin concentrations was highly consistent across the study population , the absolute and relative reductions were modest at 2 ng / l and 19% , respectively . although assay precision is very good at concentrations below our median concentration of 4.1 ng / l ( 10% coefficient of variation ) ( 25 ) and even smaller changes in cardiac troponin concentration were strongly associated with coronary heart disease events across the study population , we acknowledge it will be more challenging to monitor changes accurately in individual patients . changes in troponin concentration of 2 ng / l after initiation of statin therapy may be masked by other aspects of biological or analytical variability ( 26 ) . however , there are methodological approaches to reduce the former , for example , performing duplicate measurements 2 weeks apart , and novel technologies that enhance assay precision through single molecular counting that will minimize the latter ( 27 ) . before this approach can be applied in clinical practice , prospective studies are needed to determine whether we can consistently quantify small changes in cardiac troponin i concentration in response to treatment in individuals . the trial was conducted in middle - aged men with raised cholesterol levels , and the findings may not be applicable to the wider population including women . this is an important point , as the threshold of 5.2 ng / l that identified men at increased risk in our study population may not apply to women or to other groups ( 16 ) . we were able to obtain results from only 3,318 participants , and the requirement for a 1-year sample restricted the study population to those who were compliant with the protocol . this is the most likely explanation for the apparently greater treatment effect in this study compared to the intention - to - treat risk reduction reported previously ( 8) . our analysis was performed on samples stored for 20 years , and it is possible we underestimated the association between troponin and coronary heart disease events because of interference from the formation of fibrin microparticulates during storage . although the effect of pravastatin on troponin concentrations was highly consistent across the study population , the absolute and relative reductions were modest at 2 ng / l and 19% , respectively . although assay precision is very good at concentrations below our median concentration of 4.1 ng / l ( 10% coefficient of variation ) ( 25 ) and even smaller changes in cardiac troponin concentration were strongly associated with coronary heart disease events across the study population , we acknowledge it will be more challenging to monitor changes accurately in individual patients . changes in troponin concentration of 2 ng / l after initiation of statin therapy may be masked by other aspects of biological or analytical variability ( 26 ) . however , there are methodological approaches to reduce the former , for example , performing duplicate measurements 2 weeks apart , and novel technologies that enhance assay precision through single molecular counting that will minimize the latter ( 27 ) . before this approach can be applied in clinical practice , prospective studies are needed to determine whether we can consistently quantify small changes in cardiac troponin i concentration in response to treatment in individuals . cardiac troponin i is an independent predictor of coronary heart disease events in middle - aged hypercholesterolemic men without prior myocardial infarction . troponin concentrations are reduced by statin therapy , and reductions in troponin concentrations are associated with better outcomes independent of ldl cholesterol lowering . these findings suggest that high - sensitivity cardiac troponin has major potential to identify those at greatest risk and to assess their response to interventions for the prevention of coronary heart disease . finally , serial high - sensitivity troponin concentrations may represent a new paradigm in the assessment of the efficacy and safety of novel cardiovascular and noncardiovascular therapies.perspectivescompetency in medical knowledge : in hypercholesterolemic men , plasma cardiac troponin i concentrations correlate with the onset of coronary heart disease over 5 and 15 years and are reduced by statin therapy . reductions in troponin concentrations are associated with better outcomes independent of ldl cholesterol lowering.translational outlook : further studies are needed to clarify the predictive value of high - sensitivity cardiac troponin i assays to identify persons at increased risk and assess whether other interventions that lower plasma troponin levels reduce the risk of coronary heart disease . competency in medical knowledge : in hypercholesterolemic men , plasma cardiac troponin i concentrations correlate with the onset of coronary heart disease over 5 and 15 years and are reduced by statin therapy . translational outlook : further studies are needed to clarify the predictive value of high - sensitivity cardiac troponin i assays to identify persons at increased risk and assess whether other interventions that lower plasma troponin levels reduce the risk of coronary heart disease .
backgroundcardiac troponin is an independent predictor of cardiovascular mortality in individuals without symptoms or signs of cardiovascular disease . the mechanisms for this association are uncertain , and a role for troponin testing in the prevention of coronary heart disease has yet to be established.objectivesthis study sought to determine whether troponin concentration could predict coronary events , be modified by statins , and reflect response to therapy in a primary prevention population.methodswoscops ( west of scotland coronary prevention study ) randomized men with raised low - density lipoprotein cholesterol and no history of myocardial infarction to pravastatin 40 mg once daily or placebo for 5 years . plasma cardiac troponin i concentration was measured with a high - sensitivity assay at baseline and at 1 year in 3,318 participants.resultsbaseline troponin was an independent predictor of myocardial infarction or death from coronary heart disease ( hazard ratio [ hr ] : 2.3 ; 95% confidence interval [ ci ] : 1.4 to 3.7 ) for the highest ( 5.2 ng / l ) versus lowest ( 3.1 ng / l ) quarter of troponin ( p < 0.001 ) . there was a 5-fold greater reduction in coronary events when troponin concentrations decreased by more than a quarter , rather than increased by more than a quarter , for both placebo ( hr : 0.29 ; 95% ci : 0.12 to 0.72 vs. hr : 1.95 ; 95% ci : 1.09 to 3.49 ; p < 0.001 for trend ) and pravastatin ( hr : 0.23 ; 95% ci : 0.10 to 0.53 vs. hr : 1.08 ; 95% ci : 0.53 to 2.21 ; p < 0.001 for trend ) . pravastatin reduced troponin concentration by 13% ( 10% to 15% ; placebo adjusted , p < 0.001 ) and doubled the number of men whose troponin fell more than a quarter ( p < 0.001 ) , which identified them as having the lowest risk for future coronary events ( 1.4% over 5 years).conclusionstroponin concentration predicts coronary events , is reduced by statin therapy , and change at 1 year is associated with future coronary risk independent of cholesterol lowering . serial troponin measurements have major potential to assess cardiovascular risk and monitor the impact of therapeutic interventions .
with improved outcomes of postliver transplantation , a large number of pediatric liver transplant recipients are reaching adulthood . the posttransplantation five - year graft / survival rate for pediatric liver transplant recipients currently ranges from 67% to 82% [ 2 , 3 ] . therefore , the need to prepare pediatric liver transplant recipients for the transfer to adult - centered transplant care has increasingly become an important area of investigation . according to the american society for adolescent medicine , the transfer process should include a planned movement of adolescents with chronic medical conditions that addresses their medical as well as psychological needs as they shift from pediatric to adult - oriented healthcare systems [ 4 , 5 ] . there are a number of barriers that a young adult transplant patient faces , with the most important one being the development of a sense of autonomy and independence . the suggested level of autonomy before transferring to adult care includes the patient 's adequate demonstration of knowledge of the disease and transplant as well as a thorough understanding of the impact on his or her overall health . in addition , the patient should be able to complete his or her medication regimen , refill medications independently , make and attend appointments , and recognize how and when to seek medical attention . furthermore , avoiding risky behaviors such as poor diet , unsafe sexual activity , drug and alcohol abuse , and bad hygiene is essential to the success of a patient . a fully independent , self - governing , and autonomous adult patient at the time of transfer is a common goal of pediatric healthcare providers . patients who have undergone liver transplantation in their childhood are more likely to display a delayed sense of independence and are at risk for medication nonadherence . a recent study revealed that nonadherence ranged from 17% to 53% [ 9 , 10 ] . nonadherence can have severe consequences including poor graft survival rates , increased need for clinical visits , and rejection episodes . as pediatric patients approach the age for the transfer to adult care , it is increasingly important for healthcare professionals to effectively equip their adolescent patients with the knowledge and support to cope with the transfer . this study is aimed at assessing the patient / parent perspectives of the transfer process 13 years after their transfer to adult care in order to develop a more effective transition program . in addition , the survey asked for suggestions for the improvement of facilities and the changes pediatric caregivers can make to facilitate the above . this information can help caregivers and healthcare providers shape their services to better target patient needs and ultimately encourage independence and autonomy amongst adult patients . transplant patients , who have previously been transferred from pediatric care at children 's healthcare of atlanta to adult care at various different facilities , completed a survey designed to assess the issues they faced during the transition and their suggestions regarding the transfer process . this study was conducted prior to the establishment of a formal transition program at children 's healthcare of atlanta and was aimed at patients who had undergone a simple transfer process from children 's healthcare of atlanta to adult services in the past 3 years . it was reviewed and approved for an exemption by the institutional review board of emory university . all patients who were between 1 and 3 years after transfer to the adult facility were contacted for a survey over the phone . if the patients were unavailable , the survey was conducted with the parents , only if the parents were involved with the care of the child and accompanied them to clinic visits at the children 's hospital . patients who had been diagnosed with chronic liver disease but had not undergone a transplant were included in this study because they were followed by the same medical team hence facing a similar transfer process . additionally , the challenges faced during the transfer to adult care were very similar to the challenges faced by transplant patients . a nurse navigator who was familiar with the patients and had been closely involved with their care while in the pediatric facility conducted the survey . the survey was designed to assess the effectiveness of each patient 's transfer via certain key markers of health outcome such as ( i ) er visits ; ( ii ) time until the patient 's first labs are drawn in the adult care ; ( iii ) liver function tests ; ( iv ) number of rejection episodes ; and ( v ) the evaluation for a new transplant . in addition , the survey asked for any suggestions these patients or parents may have had regarding the transition process such as ( vi ) additional education on the part of healthcare professionals , ( vii ) parent involvement and management of their children , and ( viii ) changes that could be implemented to evolve the current transition process . phone survey respondents were primarily given questions with multiple choice answers assessing the basics of their transfer process including , for example , how much medication they were given at the time of transfer as well as the number of emergency room episodes that occurred in the interim period . the respondent additionally had the option of submitting an alternate , free - form answer that was not listed for each question . there were three questions which assessed the patient 's transfer experience and any suggestions that respondents may have regarding the transfer process ( tables 13 ) . the suggestion part of the survey gave several different options for each question so that each person surveyed was able to choose the answer(s ) that best reflected their perspective on the transition . the patient or parent surveyed additionally had the option of inputting their own suggestion if it was not listed . the survey included questions about the patient 's medication access and availability for refill because they are important indications of the effectiveness of the transfer . adherence to immunosuppressant medications is a critical factor in the transfer process as poor medication adherence is associated with an increased risk of poor long - term health outcomes , including increased graft loss and rejection [ 10 , 12 ] . all patients were within the range of 1823 years ( median age : 20 ) . majority of them were caucasians ( 57% ) , with 33% being african american and 10% being hispanic . of the 31 survey respondents , 39% were patients , and the remaining 61% were parents of patients . there were 4 patients ( or parents ) who did not have a working phone number and were unable to be contacted . the primary diagnosis for liver transplant and chronic liver disease was reported by the patients and parents and is detailed in figure 1(a ) . the largest percentage of surveyed patients had autoimmune hepatitis with the second largest group being biliary atresia . the majority of the patients surveyed had received a liver transplant ( 67% ) with two ( 6% ) receiving both a liver and kidney transplant . the rest of the patients had chronic liver disease of varying etiology ( 27% ) and had not been evaluated for a transplant at the time of transfer ( figure 1(b ) ) . the time elapsed between the last visit at the children 's hospital and the first visit at the adult facility is an important predictor of nonadherence with clinic visits and the possibility of being lost to follow - up [ 10 , 12 ] . at the time of the survey , it was our center 's practice to recommend follow - up with the adult practice within 3 months of transfer from children 's healthcare of atlanta . a small number of young adults ( 17% ) were seen within one month of leaving the children 's hospital facilities . the majority of patients ( 47% ) were seen at the new facility 26 months after their last scheduled appointment with the children 's hospital . furthermore , about 20% of the young adults were not seen until between 6 and 12 months and 13% were not seen until after a year ( figure 2(a ) ) . we also assessed the time until the new facility was first contacted to make / confirm an initial appointment after transfer because this is reflective of the efficiency of the transfer , with 26% of patients contacting between 2 and 4 weeks , 13% between 2 and 3 months , 22% of patients between 4 and 6 months , and 25% not contacting until after six months . some patients ( 13% ) , we wanted to gain insight regarding the patients ' adherence to their prescribed medication regimen . in order to accomplish this , we asked direct questions relating to the amount of medication they had at the time of transfer ( figure 3(a ) ) . interestingly , most patients ( 68% ) had more than 4 months ' supply of medication at the time of transfer , with 6.4% having just under 4 months ' worth and 9.7% having 2 - 3 months ' supply of medications ( figure 3(a ) ) . this , however , could possibly be a reflection of the pediatric transplant center 's prescribing practices rather than the patients themselves . prior to seeing the adult caregivers , 68% of patients did not run out of medications . the remaining 13% were unable to answer questions or were unsure of the amount of medication in their possession at the time of transfer ( figure 3(b ) ) . a patient 's ability to refill their medication as needed is highly indicative of their autonomy . a majority of the patients ( 81% ) reported that they did not need to refill their medication ( figure 3(c ) ) . the majority of the patients did not run out of their medications ( figure 3(d ) ) . of the patients who did run out of medication , 67% were able to refill their prescription at some location ( 50% at the children 's hospital pharmacy , 25% at er , and 25% other ) within 17 days . the remaining 33% , representing 6% of the total patients , were not taking their medication . having assessed the medication supply of the patients at the time of transfer and the time lag before they were seen at the adult facility , we wanted to evaluate the health status during the transition prior to first contact with the adult care providers . interestingly , we found that 23% of the patients had a visit to the emergency room prior to seeing the adult care providers in the outpatient setting . out of these , the majority ( 5/7 ; 77% ) had 1 - 2 visits and 2/7 ( 29% ) had 35 visits to the emergency room ( figure 4(a ) ) . after leaving the children 's hospital , almost half of the patients ( 47% ) did not get labs done until more than 3 months after transfer . only a quarter of the patients reported labs being done within 14 weeks after transfer . the remaining 28% had their labs done between 2 and 3 months ( figure 4(b ) ) . while the timing of getting labs drawn was an important indicator of patient compliance or responsibility , it was also critical to assess the actual status of the disease or disease severity . at the time of the survey , more than one - third of the patients ( 39% ) reported having abnormal liver function tests ( figure 5(a ) ) , with 10% being diagnosed with acute rejection soon after being transferred from the pediatric facility . most however had normal liver function and had not had a rejection episode ( figures 5(a ) and 5(b ) ) . none of the patients with chronic liver disease were undergoing a transplant evaluation at the time of transfer ( figure 5(c ) ) . at the time of this survey , the liver transplant service did not have a formal transition process . in order to establish an effective transition clinic , we wanted to assess patient needs and perspectives . we asked the patients who had transferred from the children 's hospital to the adult services what they felt were the important components to make the transition to adult services smoother and of higher utility . education about the disease , transition process , insurance , and medications were all deemed extremely important by the parents but by only about quarter of the patients . about half of the patients did feel they needed to be educated about their disease with emphasis on the total body care ( table 1 ) . when asked about how parents and patients could be better prepared to ensure a smooth transition , a majority of the patients and the parents agreed on one thing : patients needed to be let go and empowered in order to assume self - care and independence . less involved in the care of the patients and very few of the parents and patients ( 10% and 16% , resp . ) about 50% of the patients felt that they should receive fewer reminders about their healthcare regimen and that the parent should trust them to be capable of self - care ( table 2 ) . most parents felt that a parent support group would help them in learning how to empower their children and let them assume independent care , which can be incredibly difficult after several years of taking care of a child with a chronic illness ( table 2 ) . the parents also reported that they would have preferred earlier education about the adult facilities , rather than information at the time of transfer . it was interesting to note that one - third of the patients / parents felt that repeated reminders should not be given and were actually counterproductive to a good outcome . of concern was the fact that there was a lack of interest reported from both the patients and parents with regard to education about insurance and what to do in the face of loss of insurance ( table 3 ) . the survival rate of patients with pediatric transplantation is at an all - time high as the posttransplantation five - year graft / survival rate for pediatric liver transplant recipients currently ranges from 67% to 82% [ 2 , 3 , 13 , 14 ] . however , it is also clear by unos data that graft loss increases dramatically from ages of 1630 years [ 1517 ] . since most pediatric and adult centers operate in their own freestanding hospitals , the process of transfer from pediatric to adult services has been deemed as one of the primary reasons for this graft loss [ 9 , 10 , 17 ] . adolescents have not been prepared for or are unable to maneuver the demands of the adult healthcare system and hence find themselves lost in the maze leading to increased noncompliance , nonadherence , and eventual graft loss . our study set out to evaluate patient and parent perspectives of the transfer process in order to determine the key factors , which were critical to the establishment of a successful transition program . we wanted to assess this process from the patients ' and parents ' viewpoint , instead of exclusively basing it on what was deemed important by caregivers . this study provided us with some interesting perspectives , which enabled us to institute key components in the structure of our transition clinics , details of which are discussed below . these insights have applicability to all transition clinics catering to children with a wide variety of chronic diseases . most care providers worldwide attempt to provide enough medication refills to the patients prior to transfer . in this study , we found that there was still a significant number who ran out of their medications and did not attempt to refill their prescription , which can be detrimental to the overall health outcomes . similarly , since graft loss is high during this stressful time of transition , at the time of transfer , it was best to conduct more frequent labs , with the first labs and clinic visit being within one month of transfer , at the adult center . most of our patients did not make the first contact with the adult services until after 3 months of transfer , with a quarter of patients waiting more than 612 months , during which they had emergency room visits . limbo period in which the patients were technically not owned by any service and were not under the care of any provider , as is evident by the rejection episodes and graft dysfunction . this is a critical period and underlines the importance of instituting measures to bridge this gap . in addition , clinic appointments for the adult care facility are best scheduled prior to transfer since a percentage of patients are likely to show up in the emergency room in critical condition . however , this does not always solve the problem , as it has been reported that patients do not show up for appointments even if they are scheduled beforehand [ 6 , 9 , 10 , 20 ] . in order to alleviate some of the anxiety associated with the first visit , we have instituted joint clinics with the adult care providers with the goal that this will alleviate anxiety associated with the first visit and hence encourage the patient to be compliant and work towards building a relationship new care team . changes in medication prescription and scheduling of appointments and joint clinics with the adult care providers are structural issues that can be resolved by the medical providers . more difficult are the conceptual and ideological issues associated with pediatric medical teams , who have not only provided care to the children from sometimes as early as infancy and neonatal period , but have also bonded with them to the extent of being part of the enabling team along with their parents . the parents and patients both felt that there should be earlier teaching towards independent care and ownership . one example of that was the repeated phone calls and reminders made by the pediatric care team for missed clinic and laboratory appointments . based on these recommendations , we changed the structure of a visit within our transition clinics to have a greater focus on self - empowerment and education about adult facilities . instead of an entire care team seeing the patients during clinic , after the patient is 18 years old , the physician and the nurse saw patients exclusively , as occurs in adult clinics , without the parents being present . they were given the opportunity to voice their concerns and ask for any other care provider who they felt was necessary for them to see , such as the nutritionist , pharmacist , psychologist , and social worker . 1416 years of age , the parents were asked to step out of the room for personal questions only . between the ages of 16 and 18 years , the physician first saw the patients individually , and the appointment was concluded with the parent in the room . all patients were expected to make their own future appointments and given training to call in their own refills . i own it ( ap 101 ) , which emphasized self - care , empowerment , education , and independence . we also instituted parent support groups , which included sessions on insurance , college courses , and jobs with benefits . this education was also provided to the patients , since it was concerning to see that very few felt education about their insurance was an important issue in the united states , where healthcare is not government provided . as with any retrospective data collection markers of health outcomes ( lfts , rejection episodes , new transplant evaluation , etc . ) as well as indicators of adherence , such as medication supply at the time of transfer and the first visit at the adult facility , were based on the responses of patients or parents . this method of data collection is subject to such limitations as lapses in memory or recall bias , which may have resulted in relatively inaccurate responses . while ideally a patient 's health outcomes could be drawn from medical records , in this case it was extremely difficult to obtain access to those records considering that this study included patients who had been transferred to a number of different healthcare facilities both within and outside of the state of georgia . as a result , we chose to rely on the responses given by the patient or parent . furthermore , there could be a difference in the accuracy of information provided by a parent or a patient . however , we felt that this gave us a different perspective which also added valuable information . the study group we chose was limited by its size of 31 survey subjects composed of 12 patients and 18 parents of patients , none of which were patient / parent dyads . we chose a cut - off of 13 years since the time of transfer in order to limit the amount of recall bias in the responses . furthermore , we limited the study to liver transplant recipients and chronic liver disease patients since the same care team managed both , and the education provided to each patient was similar . we could have increased our sample size by introducing kidney and heart transplant patients but chose not to do so to avoid introduction of individual provider and care team practice styles , which may have skewed the data . additionally , since the outcomes and longevity of the grafts between the solid organs are different , we wanted to ensure a uniform study group . hence , though the study group is small , its strength is that it is homogenous in terms of the disease process and the medical team practices and hence provides valuable information , which was utilized in the organization of the transition services . this study provided us with valuable input from the patients who had experienced both the pediatric and adult care in the recent past and were in a unique position to provide genuine and workable solutions towards the establishment of a successful transition process . implementation of these simple strategies has a global application for children with chronic disease transitioning to the adult services and will go a long way in ensuring safety and good outcomes for young adults .
the transition from pediatric to adult care is a critical time when children with chronic illness sustain high morbidity and mortality . transition services need to be focused on the adolescents ' needs , which may differ from those perceived by healthcare providers . in this study , a survey of 31 patients with chronic liver disease and/or liver transplant who were transferred to adult services within the last 3 years was conducted . patients were asked about their current health status and their perceptions of the overall transfer process . the mean age at transfer was 19.81 ( 1821 ) years . almost half the patients ( 47% ) were not seen at the adult facility until 26 months after leaving the children 's hospital and 20% were not seen until 612 months . about 20% had their first contact with adult services through an emergency room visit . about 19% reported being out of medication during transition . of the transplanted patients , 19% were being evaluated for a retransplant . the majority ( 82% ) felt that an increased emphasis on promoting independence and letting go both by parents and by pediatric care providers was critical in their transition to independence and adult care services . this study provides thought - provoking insights , which are critical in designing the ideal transition program for children with chronic diseases .
glaucoma is an optic neuropathy characterized by progressive degeneration of retinal ganglion cells ( rgcs ) and their axons , resulting in changes in the appearance of the optic disc and visual field loss . although glaucoma is a multifactorial disease , elevated intraocular pressure ( iop ) remains its major known risk factor [ 2 , 3 ] . several large randomized clinical trials underscored the relationship between iop and glaucoma development and progression [ 26 ] . therefore , adequate determination of an individual iop value is of utmost importance in the management of the disease . the iop can be influenced by different systemic factors such as hypertension [ 79 ] , atherosclerotic diseases , body mass index , and diabetes [ 7 , 11 , 12 ] . for instance , lee and colleagues studying the relationship between iop and systemic disorders found that increased mean blood pressure is strongly correlated with risk of increased iop . although diabetes is associated with higher iop values in most population studies , the underlying mechanisms are still unclear [ 7 , 11 , 12 ] . recent studies have suggested that changes in corneal biomechanics ( increased corneal hysteresis ) in diabetic eyes would lead to overestimated iop measurements [ 1315 ] . however , it is not known whether variations in glucose levels could lead to iop changes in diabetic and nondiabetic individuals . as diabetes and glaucoma ( or ocular hypertension ) coexist in many patients , a better understanding about how variations in glucose levels can affect iop changes would give additional information to the iop assessment . therefore , we sought to determine the relationship between glucose levels variation and iop fluctuation in diabetic and nondiabetic patients . this prospective observational study adhered to the tenets of the declaration of helsinki and was approved by the institutional review board of the federal university of so paulo . in addition , written informed consent was obtained from all participants . all participants underwent a complete ophthalmological examination including review of medical history , best - corrected visual acuity , slit - lamp biomicroscopy , iop measurement , gonioscopy , dilated funduscopic examination , and refraction . exclusion criteria were glaucoma diagnosis or ocular hypertension , corneal opacity or irregularities that could alter the ophthalmological examination , refractive error greater than 5 d spherical or cylindrical greater than 3 d , and central corneal thickness ( based on ultrasound pachymetry ) above 600 microns or below 450 microns . diabetes was defined according to self - reported physician diagnosis , and all diabetic patients were under medical treatment . healthy subjects were recruited from the general population or from spouses and relatives of diabetic patients . they were defined as self - reported history of normal glucose level in the past two years . all participants underwent capillary glucose testing in two distinct situations : first , baseline measurements ( fasting for exactly 8 hours , i.e. , after overnight fasting ) and , second , postprandial measurements ( exactly 2 hours after the meal , i.e. , after lunch time ) . the same examiner performed all measurements in a masked fashion . the measurement of capillary glucose was performed by collecting blood from the patient 's finger , pierced through the skin by a lancet and checked with an automated device ( onetouch lifescan , johnson & johnson , ca , usa ) . immediately after the capillary glucose testing , iop was measured in both eyes ( i.e. , fasting for exactly 8 hours and exactly 2 hours after lunch time ) of each patient by goldmann tonometry applanation ( haag - streit , kniz , switzerland ) . the calibration of each instrument was checked at the beginning of each session , according to the manufacturers ' instructions . the same examiner performed all iop measurements in a masked fashion and a different examiner performed the glucose levels measurements . paired t - test was used for comparison of iop values between each time point ( baseline and postprandial ) . for variables whose distribution rejected normality , the association between changes in glucose levels and iop variation was investigated using univariable and multivariable regression analyses ( including age and baseline iop ) . the baseline glucose level was not included in the multivariable model to avoid collinearity between glucose level variations and baseline glucose level . whenever both eyes were eligible , the right eye was arbitrarily chosen for this analysis . all statistical analyses were performed with commercially available software ( stata , version 13 ; statacorp lp , college station , tx , usa ) . the level ( type i error ) a total of 37 patients ( 17 nondiabetic and 20 diabetic ) were included . among those diabetics , 5 had type 1 ( all of them were insulin dependent ) and 15 had type 2 diabetes ( all of them were not insulin dependent ) . age and iop did not differ significantly between the two groups ( p = 0.182 ) . baseline glucose levels were higher in the group of diabetic patients ( p < 0.001 ) . demographic and clinical data of each group are provided in detail in table 1 . postprandial iop was significantly higher than baseline iop in diabetic ( 17.8 0.80 versus 15.5 0.55 mmhg ; p < 0.001 ) and nondiabetic patients ( 15.9 0.77 versus 14.3 0.72 mmhg ; p = 0.006 ) . postprandial glucose levels were significantly higher than baseline measurements in both diabetic ( mean increase of 62 mg / dl ; p = 0.005 ) and nondiabetic patients ( mean increase of 31.5 mg / dl ; p = 0.015 ) . in the univariable analysis , there is a significant ( positive ) association between glucose levels variation and iop change in both diabetic ( r = 0.540 ; p < 0.001 ) and nondiabetic patients ( r = 0.291 ; p = 0.025 ) . there is also a significant ( positive ) association between the baseline glucose levels ( fasting glucose levels ) and iop change in diabetic group ( r = 0.445 ; p = 0.001 ) ; however this association was not found in nondiabetic group ( r = 0.142 ; p = 0.136 ) . in the multivariable analysis , the magnitude of glucose level change remained significantly associated with iop variation ( p < 0.001 ) even including age , baseline iop , ancestry , and gender as confounding factors . figure 2 shows the association between glucose levels variation and iop change in each group . in addition , there was a strong correlation between the iop variation in right eye and iop variation in the left eye ( r = 0.826 ) . figure 3 illustrates the relationship between iop variations in the right and in the left eye . although many patients referred for an ophthalmological examination have diabetes , until now it was not known whether blood glucose levels could influence or not an individual iop variation . to the best of our knowledge , this is the first report that provides evidence that glucose levels are significantly associated with iop changes not only in diabetic patients but in healthy individuals as well . we found a significant increase in postprandial iop values in both groups , which seem to be explained in part by the magnitude of glucose levels variation in these patients . , their results reveal a positive association between diabetes and iop [ 12 , 1721 ] . evaluating factors possibly associated with iop in a black population , the barbados eye study documented that the presence of diabetes , among other factors such as systolic blood pressure and age , was positively correlated with higher iop values . moreover , in the blue mountain eye study , by exploring the relationship between diabetes and open - angle glaucoma , the authors found that glaucoma prevalence was higher in diabetic patients compared to those without diabetes ( 5.5% versus 2.8% , or = 2.12 ) . although the above - mentioned studies did not evaluate the association between blood glucose levels variation and iop changes specifically , we believe that our findings indirectly corroborate their results . regarding the association between glucose levels and iop , there are scant data in the literature . in addition , traisman et al . and associates , while assessing iop in patients with blood glucose values under and above 200 mg / dl , observed higher iop values in those with glucose levels above 200 mg / dl ( mean difference of 1.3 mmhg ) . unfortunately , none of these studies sought to determine the association between the magnitude of glucose levels variation and iop change in diabetic and nondiabetic patients , which hinders a straight comparison with our findings . nevertheless , we believe that our data are in agreement with these two latter studies , as we found a mean iop increase of 2.3 and 1.6 mmhg in diabetic and nondiabetic patients , respectively , during the postprandial period . finally , the discrepancy in the literature results could be explained in part by the differences in studies designs and populations and possibly by the influence of other systemic associations such as hypertension , obesity , and other conditions that were not evaluated . several hypotheses have been created to explain the association between high glucose levels and iop . other researchers agree with the idea that a diabetic person could have an autonomic dysfunction which would lead to an iop increase . however some authors believe that elevated blood glucose results in the induction of an osmotic gradient which leads to fluid shifts into the intraocular space . at this point , we believe that it is important to discuss the main clinical implications of our findings . many of these diabetic patients already have glaucoma ( or ocular hypertension ) or are glaucoma suspects . although most attention is given to each 1 mmhg variation in iop , the glycemic control is rarely taken into account . based on our findings , glycemic levels variation may influence iop change and is therefore relevant for diagnosis and treatment management , especially in diabetic patients , whose average iop variation ( between baseline and postprandial measurements ) was approximately 15% ( for an average glycemic variation of 40% ) . the fact that we also documented a significant association in nondiabetic individuals makes the influence of glycemic levels on iop even more relevant . as such , we believe that clinicians should consider the patient 's glycemic status and glucose level variations concurrently with iop values assessment in certain cases , especially in diabetic patients using , for example , peripheral capillary blood as a screening for glucose level variations . it is important to stress and discuss some specific characteristics and limitations of the present study . first , it is limited by its small sample size ; however , even with a small sample we found a significant association between blood glucose levels and iop variation , especially in diabetic patients ( 20 patients ) . multiple measurements would have provided additional data and possibly allowed a more detailed analysis about the association between glucose variation and iop change . third , the investigation of other systemic comorbidities by means of questionnaire may have been insufficient . however , it is important to emphasize that previously published data indicate that whereas the duration of the diabetic disease is an important parameter for the incidence and severity of retinopathy , there is no such influence when it comes to iop [ 26 , 27 ] . however , different studies showed evidences that peripheral capillary blood and venous ( antecubital fossa ) blood samples could be comparable and can have similar influence after meal . in addition , further studies should be done to evaluate the causative relationship between glucose levels and iop variation . our findings suggest that there is an association between blood glucose levels and iop values ; however , iop variation could have been affected by different factors other than glucose levels . therefore , longitudinal studies should help us to better understand the connection between these two variations . furthermore , another relevant factor that could be addressed in future studies is the corneal hysteresis that could be measured by ocular response analyzer ( reichert ophthalmic instruments , depew , ny , usa ) . different studies have reported that corneal hysteresis is affected by hba1c , intraocular pressure , and central corneal thickness . in conclusion , our results suggest that there is a significant association between blood glucose levels and iop values , especially in diabetic patients . postprandial iop seems to be significantly higher in these patients compared to baseline values , revealing a strong association with the magnitude of glucose level increase . this fact should be considered while assessing iop values and fluctuation especially in diabetic patients .
the aim of this study was to evaluate the relationship between glucose levels and intraocular pressure ( iop ) fluctuation in diabetic and nondiabetic patients . seventeen nondiabetic and 20 diabetic subjects underwent a complete ophthalmic examination , capillary glucose testing , and applanation tonometry in two distinct situations : first , fasting for at least 8 hours and , second , postprandial measurements . baseline glucose levels were higher in diabetic patients ( p < 0.001 ) . postprandial iop was significantly higher than baseline iop in diabetic ( p < 0.001 ) and nondiabetic patients ( p = 0.006 ) . postprandial glucose levels were significantly higher than baseline measurements in both diabetic ( p = 0.005 ) and nondiabetic patients ( p = 0.015 ) . there was a significant association between glucose levels variation and iop change in both diabetic patients ( r2 = 0.540 ; p < 0.001 ) and nondiabetic individuals ( r2 = 0.291 ; p = 0.025 ) . there is also a significant association between the baseline glucose levels and iop change in diabetic group ( r2 = 0.445 ; p = 0.001 ) . in a multivariable model , the magnitude of glucose level change remained significantly associated with iop variation even including age , baseline iop , ancestry , and gender as a confounding factor ( p < 0.001 ) . we concluded that there is a significant association between blood glucose levels and iop variation , especially in diabetic patients .
breast cancer is one of the most common cancers among females worldwide and the first malignancy affecting iranian women ( 1 - 4 ) . it is assumed that behavior , prognosis , and treatment response are very different in this non - homogenous disease ( 5 ) . despite all efforts in early diagnosis , treatment and biomarker identification , about 30% of patients with early - stage breast cancer would experience recurrence ( 6 ) . one reason could be drug resistance leading to treatment failure and finally responsible for breast cancer mortality ( 7 ) . it is believed that breast cancer in the middle east ( where iran is located in ) may be unusually aggressive with an unfavorable prognosis ( 8 , 9 ) . adjuvant chemotherapy , accepted as the main treatment including anthracyclins - based regimens , has been used widely to prevent relapse ( 10 ) , prolong progression free survival ( pfs ) and overall survival ( os ) in patients with early - stage breast cancer ( 11 ) , but sometimes these drugs have serious toxic effects ( 12 ) . amplification of human epidermal growth factor receptor 2 ( her2/neu ) oncogene has been identified in 20 - 30% of invasive breast cancer tumors ( 13 , 14 ) . prognosis and responsiveness to anthracyclins - based therapy could be affected by her2/neu receptor protein overexpression and gene amplification ( 15 , 16 ) . some investigators believed that the relation between her2/neu amplification and responsiveness to anthracyclines might be relevant to topoisomerase ii. anthracyclines are topoisomerase inhibitors , and top2a is located closely to the her2/neu gene on chromosome ( 17 ) . generally , several investigators concluded that her2/neu abnormalities , ( either gene amplification or protein overexpression ) are associated with a worse prognosis ( 18 ) . in addition to systemic treatment development , many investigators have a desire to know and classify tumors with poor prognosis , to administer appropriate therapy , and improve patients ' outcome . research has almost focused on comparing anthracyclins to non - anthracyclins based regimens related to her2/neu over expression ( 19 , 20 ) . in this study , we evaluated her2/neu prognostic value and outcome of patients with her2/neu protein overexpression or gene amplification compared to those without such abnormalities when using anthracyclins - based regimens . it may be possible to find a way to characterize prognostic value of her2/neu , which can identify tumors with more aggressive behavior in iranian patients . this survey was a retrospective single institute study on 50 patients with early stage breast cancer from august 1997 to january 2011 referred to iranmehr hospital , tehran , iran . informed written consent was obtained prior to enrolling patients in the study according to shahid beheshti university of medical sciences ethics and scientific committees and was conducted in compliance with the helsinki declaration . all patients underwent modified radical mastectomy ( mrm ) and were treated with postoperative anthracyclins - based chemotherapy . two anthracyclins containing regimens were administered ; caf ( n = 28 ) versus tac ( n = 22 ) regimens . administration dosages were : 5-fu 500 mg / m , doxorubicin 50 mg / m , cyclophosphamide 500 mg / m in caf ( 21 ) and docetaxel 75 mg / m , doxorubicin 50 mg / m , cyclophosphamide 500 mg / m for tac ( 22 ) , repeated every three weeks . two hundred files of patients with breast cancer were reviewed and 50 cases were included . inclusion criteria were mrm ( marketing resource management ) surgery , primary early stage breast cancer who had one to three nodes involvement or had high risk node negative disease ( which was defined as primary tumor greater than 2 cm in size or greater than 1 cm for tumors both estrogen [ er ] and progesterone receptors [ pr ] negative ) . formalin paraffin embedded tissue blocks of breast tumors removed during modified radical mastectomy were obtained from archived files of the pathology department at iranmehr hospital . for hormone receptors and her2/neu status determining , immunohistochemical methods ( ihc ) alone ( for er and pr ) , or ihc and fluorescent in situ hybridization test ( fish ) was used . antibodies were obtained from dako company ( glostrup , denmark ) . as recommended asco / cap ( 23 ) consensus panel and esmo guideline ( 24 ) , first we assessed her2/neu gene status by immunohistochemistry ( ihc ) . if ihc was 2 + , tumors block underwent confirmatory fish test . positivity was defined as samples with more than 10% cells staining 3 + by ihc or 2 + by ihc confirmed by fish ( a ratio of her-2/neu gene / chromosome 17 2.0 ) . breast cancer was classified according to who classification of breast tumors . in post - treatment follow - up , patients underwent physical examination at least once every four months for the first three years and every six months thereafter . annual mammograms , bone scans and chest x - rays were performed if necessary . to examine differences in ordinal variables ( tumor size , lymph node involvement , age , and stage ) between the two groups ( her2/neu overexpressed in compare with the other ) , non - parametric mann - whitney test was used . chi - square or fisher 's exact tests were used to compare nominal variables between the two groups when appropriate . cox proportional hazard model was used to assess adjusted parameters regarding progression free survival ( pfs ) in uni / multivariate analysis and their 95% cis ( confidence intervals ) . for all statistical tests , 5% level was used as the cutoff for statistical significance . as most patients were alive and much exclusion data we did not perform analysis for overall survival . mean of kaplan meier 's survival estimates and curves were obtained and the log - rank test was used to assess the significance of differences of pfs between the two study groups . pfs was calculated from date of registration to date of progression or death ( figures 1 and 2 ) . to examine differences in ordinal variables ( tumor size , lymph node involvement , age , and stage ) between the two groups ( her2/neu overexpressed in compare with the other ) , non - parametric mann - whitney test was used . chi - square or fisher 's exact tests were used to compare nominal variables between the two groups when appropriate . cox proportional hazard model was used to assess adjusted parameters regarding progression free survival ( pfs ) in uni / multivariate analysis and their 95% cis ( confidence intervals ) . for all statistical tests , as most patients were alive and much exclusion data we did not perform analysis for overall survival . mean of kaplan meier 's survival estimates and curves were obtained and the log - rank test was used to assess the significance of differences of pfs between the two study groups . pfs was calculated from date of registration to date of progression or death ( figures 1 and 2 ) . among 50 patients included in this study , 42 ( 84% ) invasive ductal carcinomas , 6 ( 12% ) invasive lobular carcinomas and 3 ( 6% ) other pathologies were diagnosed ( figure 3 ) . slightly more cases received adjuvant chemotherapy with caf regimen ( n = 28 ) than tac regimen ( n = 22 ) . no patient developed symptomatic cardiac dysfunction or irreversible asymptomatic decreases in left ventricular ejection fraction to 50% or lower . during analysis of postoperative staging of studied cases , the largest group of patients was found in group with stage iia ( table 1 ) . lymph node status was assessed during the study , which 46% of them were involved ( n = 23 ) . there was no significant difference in any of patients ' characteristics between the two groups including tumor size , lymph node involvement , chemotherapy protocol , age , er / pr status , post - menopausal status , stage and pathology . number of patients without lymphadenopathy involvement was higher in non - over expressed group , but it was not statistically significant ( table 1 ) . in her2/neu overexpressed tumors , mean of pfs in her2 overexpressed group and the other group were 31.6 3.2 and 80.9 17.4 months , respectively ( hr of relapse = 0.977[0272 - 0.351 ] , p = 0.602 , figure 4 ) . we also evaluated the correlation of relapse and pfs with some parameters ( listed in table 2 ) ( for some parameters , multivariate analysis was not possible because model coefficients and hazard ratio ( hr ) were not calculated . these parameters were used simple in multivariate analysis ) . in uni / multivariate analysis , neither of them remained significant for pfs means ( table 2 ) . abbreviations : her-2/ neu , human epidermal growth factor receptor 2 ; er , estrogen receptor ; pr , progesterone receptor ; tac ; tac regimen including ( docetaxel , doxorubicin , cyclophosphamide ) ; caf regimen including ( docetaxel , doxorubicin , cyclophosphamide ) . number of nodes involved : 0 , node negative ; 1,1 positive node ; 2 , 2 positive nods ; 3 , 3 positive nodes . 1 cm , tumors less than 1 cm in size ; 1.99 cm , tumors between 2 and 4.99 cm in maximum diameter ; > 5 cm , tumors > 5 cm in maximum diameter . non - significant shortened pfs was observed in her2/neu overexpressed group ( p = 0.602 ) . abbreviations : her-2 , human epidermal growth factor receptor 2 ; er , estrogen receptor ; pr , progesterone receptor . tac ; tac regimen including ( docetaxel , doxorubicin , cyclophosphamide ) ; caf : caf regimen including ( docetaxel , doxorubicin , cyclophosphamide ) ; er + : er positive . lymph nodes involvement ( for some parameters , multivariate analysis was not possible because model coefficients and hazard ratio ( hr ) were not calculated . 1 cm , tumors less than 1 cm in size ; 1.99 cm , tumors between 2 and 4.99 cm in maximum diameter ; > 5 cm , tumors > 5 cm in maximum diameter . in this retrospective study , we found no correlation between her2/neu amplification and prognosis of early stage breast cancer treated by anthracyclins - based regimens in iranian women . most studies performed to evaluate the her2/neu status were conducted in western countries and compared prognostic value of her2/neu in anthracyclins - based to non anthracyclins - based regimens . in different studies performed in other countries , her2/neu amplification was found in 20 - 30% of breast malignancies ( 13 , 14 ) , but in some countries such as lebanon the higher percentage was reported ( 25 ) . her2/neu overexpression in this study is accordance with data from egypt ( 25 ) . in patients aged 50 years , her2/neu overexpression was found in 39.2% , whereas in women over 50 it was detected in 36.2% . it was shown in other studies that in a group of younger female breast cancer , worse prognosis was associated with overexpression of her2/neu , which leads to more aggressive tumor behavior ( 26 ) . tumor size , hormone receptor status , her2 overexpression and expression of p53 have been identified previously as indicators in breast cancer ( 27 , 28 ) and correlation of her2 gene overexpression with other parameters indicative of disease relapse has been shown ( 29 , 30 ) . we designed this study in a her2-unselected population to examine whether above findings could be repeated . although er / pr negative status and tumor size > 5 cm were more prevalent in her2/neu amplified group , it was not statistically significant . neither of tumor characteristics remained significant regarding her2/neu status in both uni and multivariate analyses . pfs in her2/neu non - over expressed group was very much , but not statistically significant in our study . some researchers showed that in early breast cancer her2/neu overexpression is a major and potentially risk of relapse ( 3 , 33 - 38 ) , while others did not ( 31 , 39 ) . although our results are not robust but it seems consistent with the report of tubbs et al . nevertheless , high levels of her2/neu amplification had a correlation with worse disease free survival , but some studies suggested that anthracycline - based therapy improved the outcome of patients with her2 amplification profile ( 24 ) . thus in our population of patients who all received anthracyclins - based regimens , the overall outcome would be worse in absence of treatment but with anthracyclins - based therapy more benefit was obtained . paradoxical results between our results and others could be explained by several factors such as technical and methodological differences or different dosages of drugs and small sample size . however , evaluation of predictive and/or prognostic relevance of this biomarker supposed to perform prospective randomized clinical trial . finally , this article suggested that distinguishing patients at high risk of recurrence must be based on combination of her2 status and other clinical factors . our data does not provide additional information how to improve management of patients with early stages breast cancer and high risk of recurrence . if it is supposed that they would receive standard anthracyclins - based regimens , higher percentage of her2/neu overexpression in iranian breast tumors
background : patients with early stage breast cancer with same treatment strategy can have markedly different outcomes . human epidermal growth factor receptor 2 ( her2/nue ) gene amplification or the subsequent overexpression of protein has been proved to be associated with patient 's outcome and response to anthracyclins - based regimens.objectives:this study assessed prognostic value of her2/nue marker in patients with early stage breast cancer who received adjuvant chemotherapy with anthracyclins - based regimens.materials and methods : fifty tissue samples from patients with primary breast cancer of moderate risk receiving sequential adjuvant chemotherapy with anthracyclins - based regimens were assessed to evaluate her2/nue gene status ( quantified by immunohistochemistry and fluorescence in situ hybridization ) retrospectively . besides , correlation of her2/neu with patients ' characteristics and outcome was studied.results:her2/neu amplification was identified in 19 ( 38% ) of 50 patients . no significant difference regarding her2/neu status was seen in clinic pathological characteristics of patients . although progression free survival ( pfs ) was shorter in her2 overexpressed group , but uni / multivariate analysis adjusted for her2 overexpression , nodal involvement , hormone receptor status , age and tumor size revealed no significant predictive and/or prognostic value for her2 regarding pfs.conclusions:this study on a limited number of patients treated with adjutant anthracyclins - based regimens , revealed that her2/neu is not a unique strong predictor for outcome , thus according to combination of her2/neu status and other clinical factors , it is necessary to distinguish patients at high risk of recurrence .
the economic impact depressive symptoms have on work is significant in most countries , including japan1 , 2 . okumura and higuchi estimated that the annual cost of workplace absenteeism and presenteeism in japan due to depression2 amounted to us$6.9 billion . in the united states , depression costs $ 44 billion per year in absences from work and reduced performance while at work1 . alleviating both presenteeism , which is the condition whereby workers performance is reduced owing to health conditions , and absenteeism , taken in this study to mean those staying away from work because of ill health , are issues of concern for occupational health practices3 , 4 . to build a strategy for allocating future funding and resources to deal with depressive symptoms , the total burden of those symptoms on presenteeism and absenteeism in the workplace has to be examined . a small sample study in japan on presenteeism showed that depression , anxiety , or emotional disorders affected individual work performance5 and that the prevalence of allergies and back or neck disorders was high . since wages vary by age and gender , the burden of health conditions needs to be converted into economic indicators , such as wage losses , to clarify the situation for employers . depressive symptoms include comorbid conditions such as depression , anxiety , or emotional disorders , back or neck disorders6 , migraines or chronic headaches7 , stomach or bowel disorders8 , and insomnia9 . to determine the total burden of depressive symptoms , it is necessary to take these comorbid conditions into account . the aim of this study was to determine the economic impact due to absenteeism and presenteeism in terms of five conditions that are potentially comorbid with depressive symptoms back or neck disorders , depression , anxiety , or emotional disorders , chronic headaches , stomach or bowel disorders , and insomnia among japanese workers in the 1859 yr age bracket . for the purpose of this study , we calculated the economic impact on wages , not only for individuals but for the entire population , by assuming 100 workers for each 10-yr age band . we recruited participants from 19 workplaces and asked them to complete an anonymous questionnaire featuring the stanford presenteeism scale10 . six research projects ( a to f ) were conducted during the course of the study . research a was carried out at five manufacturing companies among 3,014 workers from october to december 2006 ; the response rate was 89.0% ( 2,682 responses ) . research b was conducted among 2,397 nurses in three hospitals from october to december 2007 ; the response rate was 63.2% ( 1,515 responses ) . research c was performed among 950 workers at a manufacturing company in march 2008 ; the response rate was 74.2% ( 705 responses ) . research d was a web survey and was carried out in june 2008 ; of the 1,133 responses , 1,100 participants were recruited . research e was conducted at a health seminar among 428 employees of three taxi companies ; the response rate was 98.8% ( 423 responses ) . research f was performed at training seminars among all 403 solvent - handling workers who participated from january to june 2009 ; the response rate was 84.3% ( 340 responses ) . from the 6,777 participants ( male , 3,819 ; female , 2,958 ) we analyzed 5,000 individuals ( male , 2,535 ; female , 2,465 ) who were aged between 1859 , and for whom there were no missing values . the stanford presenteeism scale aims to determine the effect of presenteeism and absenteeism due to primary health conditions over the previous 4-wk period10 , 11 . the participants then estimated the performance loss ( 0100% ) as a result of the primary health condition for the previous 4-wk period and the number of resultant absent days . of the 5,000 participants we analyzed the data for those who chose one of the following as the primary health condition : depression , anxiety or emotional disorders ; migraines or chronic headaches ; back or neck disorders ; stomach or bowel disorders ; and insomnia ( male , 1,393 ; female , 1,427 ) . we calculated the wage loss caused by absenteeism as the number of days absent multiplied by the average hourly wage by age multiplied by 8 ( assumed as the number of working hours in a day ) . we calculated the wage loss caused by presenteeism as follows : ( 20 [ assumed as the number of working days in 4 wk ] minus the number of absent days ) multiplied by 8 multiplied by 100 ( % ) ( the proportion of the work performance with presenteeism as the primary health condition compared with the ideal condition ) multiplied by the average hourly wage by age . then , we added the wage loss caused by absenteeism and presenteeism for each person . we also assumed that there were 100 workers for each 10-yr age band and calculated the total wage loss of presenteeism and absenteeism of the primary health condition by multiplying individual wage losses by the prevalence ( the proportion of people who chose primary health condition ) . finally , we calculated the proportion of the total wage loss due to absenteeism and presenteeism and divided it by the total wages of 100 persons for 4 wk in each 10-yr age band . we set the wage per hour for the 10-yr age groups for males and females using the basic survey on wage structure conducted by the ministry of health , labour and welfare , japan12 . the hourly wage was calculated by the mean monthly wage divided by 160 ( 20 days with 8 working hours per day ) . the hourly wage by age for men was $ 11.9 ( 2029 yr ) , $ 16.6 ( 3039 yr ) , $ 21.3 ( 4049 yr ) , and $ 21.8 ( 5059 yr ) . the hourly wage by age for women was $ 10.8 ( 2029 yr old ) , $ 12.7 ( 3039 yr ) , $ 13.2 ( 4049 yr ) , and $ 12.5 ( 5059 yr ) . the data collection was approved by ethical committees : research a , b , and c by osaka university , japan ; research d and e by the international university of health and welfare , japan ; and research f by kitasato university school of medicine , japan . table 1table 1 . prevalence of primary health condition of participantsmalefemaleprimary healthcondition chosenprimary healthcondition chosenn%n%age 1829 ( yr)(n=340)(n=749)back or neck disorders6719.720727.6depression , anxiety , or emotional disorders5716.88411.2migraine or chronic headaches257.47610.1stomach or bowel disorders319.1709.3insomnia205.9324.3age 3039 ( yr)(n=763)(n=737)back or neck disorders22429.419025.8depression , anxiety , or emotional disorders10213.411415.5migraine or chronic headaches445.8567.6stomach or bowel disorders516.7466.2insomnia395.1293.9age 4049 ( yr)(n=867)(n=513)back or neck disorders21224.516532.2depression , anxiety , or emotional disorders11513.36011.7migraine or chronic headaches445.1305.8stomach or bowel disorders748.5244.7insomnia455.2224.3age 5059 ( yr)(n=565)(n=466)back or neck disorders12021.214330.7depression , anxiety , or emotional disorders437.6234.9migraine or chronic headaches173194.1stomach or bowel disorders447.8286insomnia193.491.9 shows the prevalence of conditions . the leading primary health condition was back or neck disorders in all age groups . the prevalence of depression , anxiety , or emotional disorders was 13.316.8% ( males ) and 11.215.5% ( females ) among those aged 1849 , the prevalence of depression , anxiety , or emotional disorders among those in their 50s was 7.6% ( males ) and 4.9% ( females ) . days of absenteeism and lost hours due to presenteeism , with the estimated wage loss for male workers over the previous 4-wk period ( n=1,393)days absent due toprimary healthcondition ( d)wage loss due toabsenteeism over4 wk per person throughthe primaryhealth condition ( us$)loss of workinghours due topresenteeism ( h)wage loss dueto presenteeismper person throughthe primaryhealth condition ( us$)wage loss dueto absenteeism and presenteeismthrough the primaryhealth condition ( us$)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)age 1829 ( yr)back or neck disorders1.6 ( 0.52.6)150 ( 50249)35.6 ( 29.042.2)426 ( 347504)575 ( 465686)depression , anxiety , or emotional disorders2.4 ( 0.93.9)228 ( 83373)43.5 ( 35.052.0)520 ( 419622)748 ( 610887)migraine or chronic headaches1.2 ( 0.12.3)115 ( 8222)49.5 ( 38.260.9)592 ( 456728)707 ( 582831)stomach or bowel disorders2.2 ( 0.3 - 4.2)213 ( 28397)39.4 ( 28.850.0)471 ( 345597)684 ( 498869)insomnia0.6 ( 0.01.9)57 ( 0177)43.8 ( 32.455.2)524 ( 388660)581 ( 429733)age 3039 ( yr)back or neck disorders2.2 ( 1.52.9)289 ( 199380)35.9 ( 32.339.6)596 ( 535657)885 ( 794976)depression , anxiety , or emotional disorders4.8 ( 3.46.3)641 ( 447835)50 ( 42.857.1)828 ( 710946)1469 ( 1,3161,621)migraine or chronic headaches2.4 ( 0.74.1)316 ( 93540)52 ( 39.964.1)862 ( 6621,063)1179 ( 9471,410)stomach or bowel disorders2.1 ( 0.83.3)273 ( 107439)45.1 ( 36.953.4)748 ( 611885)1021 ( 8421,200)insomnia1.8 ( 0.43.2)238 ( 58418)44 ( 37.051.0)729 ( 613846)967 ( 8041,130)age 4049 ( yr)back or neck disorders2.3 ( 1.63.0)392 ( 268516)34.2 ( 30.637.9)731 ( 652809)1123 ( 1,0011,244)depression , anxiety , or emotional disorders3.6 ( 2.44.7)607 ( 410804)45.2 ( 39.650.7)965 ( 8461,083)1572 ( 1,4081,736)migraine or chronic headaches2.4 ( 0.64.2)411 ( 110713)40.2 ( 29.051.3)858 ( 6191,096)1269 ( 9491,589)stomach or bowel disorders4.5 ( 2.96.1)771 ( 4921,049)33.4 ( 25.840.9)712 ( 551873)1483 ( 1,2391,726)insomnia3.3 ( 1.35.3)565 ( 224907)35.9 ( 28.443.4)766 ( 605927)1331 ( 1,0471,616)age 5059 ( yr)back or neck disorders2.0 ( 1.22.8)344 ( 202487)30.9 ( 26.934.9)674 ( 587761)1019 ( 8741163)depression , anxiety , or emotional disorders5.2 ( 2.97.5)912 ( 5101,315)40.1 ( 30.050.2)874 ( 6541,094)1787 ( 1,4462,127)migraine or chronic headaches5.2 ( 1.39.1)913(2311,595)31.6 ( 17.845.4)690 ( 388991)1603 ( 1,0462,159)stomach or bowel disorders4.4 ( 2.56.3)769(4331,105)26.4 ( 21.031.9)577 ( 457696)1346 ( 1,0561,635)insomnia5.8 ( 1.69.9)1010 ( 2861,734)31.5 ( 19.943.0)687 ( 435938)1697 ( 1,1272,266)ci : confidence interval , 1 us$=117 yen . ( males ) and table 3table 3 . days of absenteeism and lost hours due to presenteeism with the estimated wage loss for female workers over the previous 4-wk period ( n=1,427)days absent due to primary health condition ( days)wage loss due to absenteeism over 4 wk per person through the primary health condition ( us$)loss of working hours due to presenteeism ( h)wage loss due to presenteeism per person through the primary health condition ( us$)wage loss due to absenteeism and presenteeism through the primary health condition ( us$)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)mean ( 95% ci)age1829 ( yr)back or neck disorders1.8 ( 1.22.5)159 ( 104215)35 ( 31.638.3)379 ( 343415)538 ( 483594)depression , anxiety , or emotional disorders2.4 ( 1.33.6)211 ( 112309)52.5 ( 45.959.1)569 ( 498640)780 ( 695864)migraine or chronic headaches2 ( 0.93.0)172 ( 80264)40.4 ( 35.145.7)438 ( 380496)610 ( 528693)stomach or bowel disorders3.4 ( 1.75.0)292 ( 149434)32.2 ( 26.737.6)349 ( 290408)641 ( 518763)insomnia0.8 ( 0.02.0)73 ( 0178)43.6 ( 36.151.0)472 ( 391553)545 ( 433657 ) age 3039 ( yr)back or neck disorders1 ( 0.61.4)101 ( 57145)32.2 ( 29.734.8)409 ( 376441)510 ( 459560)depression , anxiety , or emotional disorders2.2 ( 1.13.2)221 ( 116325)45.4 ( 21.259.5)576 ( 514638)797 ( 706888)migraine or chronic headaches1.2 ( 0.32.2)123 ( 27219)37.3 ( 40.650.3)473 ( 392554)596 ( 491701)stomach or bowel disorders3.3 ( 1.35.2)331 ( 131531)29.9 ( 30.943.6)379 ( 312446)710 ( 547873)insomnia2.5 ( 0.34.7)255 ( 33478)36.3 ( 24.635.1)461 ( 345576)716 ( 514919 ) age 4049 ( yr)back or neck disorders2 ( 1.22.8)210 ( 125295)33.1 ( 29.336.9)438 ( 388488)648 ( 569726)depression , anxiety , or emotional disorders2.6 ( 1.34.0)279 ( 139418)51.3 ( 42.260.5)679 ( 559800)958 ( 8241,092)migraine or chronic headaches0.9 ( 0.01.8)95 ( 0193)43.7 ( 32.455.0)578 ( 428728)674 ( 494853)stomach or bowel disorders1.2 ( 0.03.0)123 ( 0317)42.5 ( 29.156.0)563 ( 385741)686 ( 457915)insomnia0.9 ( 0.02.0)96 ( 0208)49.1 ( 40.358.0)650 ( 533767)746 ( 589903)age 5059 ( yr)back or neck disorders3.1 ( 2.14.1)308 ( 207408)23.6 ( 20.426.7)296 ( 256335)603 ( 509697)depression , anxiety , or emotional disorders3.7 ( 0.96.4)366 ( 95638)47.5 ( 34.760.4)596 ( 435757)962 ( 7381,186)migraine or chronic headaches6.2 ( 2.69.8)623 ( 258988)25.6 ( 16.834.5)322 ( 210433)944 ( 6591,230)stomach or bowel disorders2.7 ( 0.45.0)269 ( 38499)29.8 ( 16.842.8)374 ( 211537)643 ( 393892)insomnia0.9 ( 0.02.9)89 ( 0295)49.8 ( 21.578.1)624 ( 269979)713 ( 3531,074)ci , confidence interval ; 1 us$=117 yen . ( females ) show the days absent , the wage loss due to absenteeism , the loss of working hours due to presenteeism , and the wage loss due to presenteeism over the previous 4-wk period . the leading cause of absenteeism and presenteeism due to the primary health condition varied by gender and by age . for men aged 1839 yr , the leading cause of absenteeism was depression , anxiety , or emotional disorders , and the leading cause of presenteeism was migraines or chronic headaches . for men in their 40s , the leading cause of absenteeism was stomach or bowel disorders , while the leading cause of presenteeism was depression , anxiety , or emotional disorders . for men in their 50s , the leading cause of absenteeism was insomnia , while the leading cause of presenteeism was depression , anxiety , or emotional disorders . in all age groups , the leading cause of wage loss due to absenteeism and presenteeism was depression , anxiety , or emotional disorders . for women , the leading cause of absenteeism was stomach or bowel disorders , while the leading cause of presenteeism was depression , anxiety , or emotional disorders for those aged between 1839 yr . for women in their 40s , the leading cause of absenteeism and presenteeism was depression , anxiety , or emotional disorders . for women in their 50s , the leading cause of absenteeism was migraines or chronic headaches , while the leading cause of presenteeism was insomnia . as with males , the leading cause of wage loss due to absenteeism and presenteeism for females in all age groups was depression , anxiety , or emotional disorders . wage loss due to presenteeism and absenteeism and its proportion of the total wage assuming 100 workers per 10-yr age group for male workers over the previous 4-wk periodtotal wage loss due to absenteeismand presenteeism per 100 workers ( us$)proportion of total wage loss due to absenteeismand presenteeism in the total wage of 100 workers ( % ) mean ( 95% ci)mean ( 95% ci)age 1829 ( yr)back or neck disorders11,340 ( 9,17013,510)5.9 ( 4.87.1)depression , anxiety , or emotional disorders12,543 ( 10,22014,866)6.6 ( 5.37.8)migraine or chronic headaches5,196 ( 4,2826,109)2.7 ( 2.23.2)stomach or bowel disorders6,234 ( 4,5427,927)3.3 ( 2.44.1)insomnia3,419 ( 2,5244,313)1.8 ( 1.32.3)age 3039 ( yr)back or neck disorders25,986 ( 23,31228,660)9.8 ( 8.810.8)depression , anxiety , or emotional disorders19,634 ( 17,59221,676)7.4 ( 6.68.2)migraine or chronic headaches6,797 ( 5,4638,131)2.6 ( 2.13.1)stomach or bowel disorders6,823 ( 5,6288,018)2.6 ( 2.13.0)insomnia4,944 ( 4,1095,778)1.9 ( 1.52.2)age 4049 ( yr)back or neck disorders27,456 ( 24,48630,427)8.0 ( 7.28.9)depression , anxiety , or emotional disorders20,849 ( 18,67623,022)6.1 ( 5.56.7)migraine or chronic headaches6,439 ( 4,8178,062)1.9 ( 1.42.4)stomach or bowel disorders12,654 ( 10,57814,731)3.7 ( 3.14.3)insomnia6,910 ( 5,4348,387)2.0 ( 1.62.5)age 5059 ( yr)back or neck disorders21,637 ( 18,56424,709)6.2 ( 5.37.1)depression , anxiety , or emotional disorders13,599 ( 11,00716,191)3.9 ( 3.24.6)migraine or chronic headaches4,822 ( 3,1486,497)1.4 ( 0.91.9)stomach or bowel disorders10,480 ( 8,22612,733)3.0 ( 2.43.7)insomnia5,705 ( 3,7897,621)1.6 ( 1.12.2)ci , confidence interval ; 1 us$=117 yen . wage loss due to presenteeism and absenteeism and its proportion of the total wage assuming 100 workers per 10-yr age group over the previous 4-wk period for female workerstotal wage loss due to absenteeismand presenteeism per 100 workers ( us$)proportion of total wage loss due to absenteeismand presenteeism in the total wage of 100 workers ( % ) mean ( 95% ci)mean ( 95% ci)age 1829 ( yr)back or neck disorders14,880 ( 13,34216,419)8.6 ( 7.79.5)depression , anxiety , or emotional disorders8,744 ( 7,7969,691)5.0 ( 4.55.6)migraine or chronic headaches6,192 ( 5,3567,029)3.6 ( 3.14.1)stomach or bowel disorders5,987 ( 4,8447,130)3.5 ( 2.84.1)insomnia2,329 ( 1,8502,808)1.3 ( 1.11.6)age 3039 ( yr)back or neck disorders13,137 ( 11,84214,433)6.5 ( 5.87.1)depression , anxiety , or emotional disorders12,331 ( 10,92513,736)6.1 ( 5.46.8)migraine or chronic headaches4,530 ( 3,7315,329)2.2 ( 1.82.6)stomach or bowel disorders4,430 ( 3,4135,446)2.2 ( 1.72.7)insomnia2,818 ( 2,0213,615)1.4 ( 1.01.8)age 4049 ( yr)back or neck disorders20,841 ( 18,31723,365)9.8 ( 8.711.0)depression , anxiety , or emotional disorders11,206 ( 9,64312,769)5.3 ( 4.66.0)migraine or chronic headaches3,939 ( 2,8874,991)1.9 ( 1.42.4)stomach or bowel disorders3,210 ( 2,1394,281)1.5 ( 1.02.0)insomnia3,200 ( 2,5263,874)1.5 ( 1.21.8)age 5059 ( yr)back or neck disorders18,512 ( 15,63021,394)9.2 ( 7.810.7)depression , anxiety , or emotional disorders4,748 ( 3,6435,854)2.4 ( 1.82.9)migraine or chronic headaches3,851 ( 2,6865,016)1.9 ( 1.32.5)stomach or bowel disorders3,862 ( 2,3635,361)1.9 ( 1.22.7)insomnia1,378 ( 6812,074)0.7 ( 0.31.0)ci , confidence interval ; 1 us$=117 yen . ( females ) show the wage loss assuming 100 workers per 10-yr age group over the previous 4-wk period . assuming 100 workers in each age band and considering the prevalence and wage structure differences by age , the total wage loss due to absenteeism and presenteeism through the primary health condition was high for back or neck disorders . the exception to this was males in their 20s , whose highest mean wage loss was for depression , anxiety , or emotional disorders . the mean total wage loss due to absenteeism and presenteeism through depression , anxiety , or emotional disorders was high among men in their 40s and women in their 30s . assuming 100 workers per 10-yr age band , the proportion of wage loss of the total wage owing to back or neck disorder was 5.99.8% for men and 6.59.8% for women ; the proportion of wage loss of the total wage as a result of depression , anxiety , or emotional disorders was 3.97.4% for men and 2.46.1% for women . this study aimed to determine the wage loss in work performance due to absenteeism and presenteeism using five chronic conditions that are potentially comorbid with depressive symptoms among working populations in japan : back or neck disorders ; depression , anxiety , or emotional disorders ; migraines or chronic headaches ; stomach or bowel disorders ; and insomnia . this is the largest study to date determining the economic impact of presenteeism and absenteeism using individual data for workers in japan . the leading cause of absenteeism and presenteeism varied by gender and by age . for males and females of all ages , the greatest economic impact due to the primary health condition was caused by depression , anxiety , or emotional disorders ; among the 100 people in each age band , the highest loss of wage through presenteeism and absenteeism was caused by back or neck disorders with the exception of males aged 1829 . depression , anxiety , or emotional disorders are the major cause of absenteeism and presenteeism5 , 13 , 14 . in the present study , the total economic loss due to depression , anxiety , or emotional disorders was lower than for back or neck disorders ; however , we were unable to include workers with long - term absence due to depression . based on a survey by the japan productivity center in 2008 , 0.4% of workers took more than one month working absence in japan15 . hence , our assessment of absenteeism and its wage loss due to depression , anxiety , or emotional disorders could be an underestimation . symptoms of depression , anxiety , or emotional disorders include feelings of sadness , a lack of interest , difficulty in making decisions , and at worst thoughts of death and suicide16 . those symptoms could severely affect an individual s core work performance as well as making them unable to respond to our questionnaire . the most chosen primary health condition was back or neck disorder , which resulted in the greatest wage loss through presenteeism and absenteeism among 100 workers in the 10-yr age bands . the prevalence of back or neck disorders in this study was similar to a survey finding on the state of employees health by the ministry of health , labour and welfare , japan17 . according to that survey ( carried out in 2007 and used multiple - choice questions ) , the proportion of people with back pain was 25.6% for males and 21.4% for females . in our study , the prevalence of back or neck disorders was 19.729.4% for men and however , the prevalence could vary depending on the type of work : some types of occupation are more likely to cause work - related back or neck disorders18 , 19 . migraines or chronic headaches ( primarily tension - type headaches ) , cause intensive work loss by presenteeism among men aged 1839 yr and by absenteeism among men in their 50s . in the united states , the prevalence of migraine was highest for both men and women aged between 3545 yr21 . our study found the prevalence of migraine has been found to be higher in women than in men21 , 22 . in the present study , we were unable to determine the proportion of wage loss due to migraines and tension - type headaches ; however , based on the epidemiological characteristics of headaches , occupational health practitioners should intervene and provide better access to treatment for those suffering from these conditions23 . stomach or bowel disorders , which include a variety of conditions , such as gastritis , gastroesophageal reflux , and irritable bowel syndrome , can also lead to work impairment . dean et al.24 reported that the symptom severity of gastroesophageal reflux and nocturnal heartburn disturbed work performance . in addition , such working conditions as shift and night work can promote the development of stomach disorders , e.g. , chronic gastritis , gastroduodenitis , and peptic ulcers25 , 26 . with regard to bowel disorders , impairment due to irritable bowel syndrome , whose prevalence is high in japan as a result of perceived stress , was estimated to amount to 9.714 h of lost productivity per week among sufferers27 , 28 . stomach or bowel disorders are the leading cause of absenteeism among men in their 40s and women aged 1839 , and those populations need to receive information about controlling their symptoms and treatment . insomnia is often caused by depressive symptoms , visual display terminal workload , over - involvement in work , and frequent alcohol consumption29 , 30 . in japan , the prevalence of insomnia , including mid - sleep awakenings and early morning awakening insomnia , is high among people aged 5064 yr30 . as the present study shows , for men in their 50s insomnia can lead to absenteeism among those severely affected . first , workers tend to develop multiple chronic health conditions ; however , we only examined the primary health condition . thus could lead to an underestimation of the burden of each chronic health condition . in addition , the health conditions identified by individual workers are not necessarily based on clinical diagnosis . second , the prevalence of health conditions could vary according to occupation and other work - related factors . finally , although the response rate was relatively high , the generalizability of our study is limited . further studies should address the effect of working conditions on absenteeism and presenteeism . in conclusion , the wage loss due to presenteeism and absenteeism per 100 workers in the 10-yr age bands was high for back or neck disorders , as these were identified by a large number of participants . however , the wage loss per person was relatively high among those choosing depression , anxiety , or emotional disorders . these values offer insight into forming strategies for workplace interventions toward increasing work performance .
we aimed to determine the economic impact of absenteeism and presenteeism from five conditions potentially comorbid with depressive symptoms back or neck disorders , depression , anxiety , or emotional disorders , chronic headaches , stomach or bowel disorders , and insomnia among japanese workers aged 1859 yr . participants from 19 workplaces anonymously completed stanford presenteeism scale questionnaires . participants identified one primary health condition and determined the resultant performance loss ( 0100% ) over the previous 4-wk period . we estimated the wage loss by gender , using 10-yr age bands . a total of 6,777 participants undertook the study . of these , we extracted the data for those in the 1859 yr age band who chose targeted primary health conditions ( males , 2,535 ; females 2,465 ) . the primary health condition identified was back or neck disorders . we found that wage loss due to presenteeism and absenteeism per 100 workers across all 10-yr age bands was high for back or neck disorders . wage loss per person was relatively high among those identifying depression , anxiety , or emotional disorders . these findings offer insight into developing strategies for workplace interventions on increasing work performance .
to achieve effective muscle hypertrophy with less exercise , a training method involving application of pressure to the target muscle , named kaatsu training , was developed , and is now used in rehabilitation programs for heart disease patients in some hospitals . in this method , the muscles are tightly wrapped during exercise , thereby restricting blood flow , and the resultant hypoxia causes hypertrophy and a gain in strength . several societies , including the american college of sports medicine , have published guidelines for the kaatsu training program to effectively obtain efficient muscle hypertrophy and strength . however , there are presently no medical guidelines or published risk factors for its use . kaatsu training is a low - intensity resistant training method that is combined with restricted venous blood flow from the working muscle achieved by compressing the vasculature proximal to the exercising muscles using a dedicated device . this pressure has been suggested to restrict venous blood flow and cause pooling of the blood in the capacitance vessels distal to the belt , while simultaneously restricting arterial blood flow . under this condition , the muscle - bone cross - sectional area measured in magnetic resonance imaging was found to be increased compared with control training without applying pressure to the target muscle . however , at the same time , the heart rate was significantly increased immediately after starting the kaatsu training compared with the control training . thus , kaatsu training may cause unexpected adverse events in organs and/or tissues other than the target muscle . to highlight the potential risks of the application of kaatsu training in some specific cases , we here report a case of central retinal vein occlusion ( crvo ) , a vision - threatening retinal disease , that occurred following kaatsu training . crvo often occurs in patients with hypertension and is associated with an increased risk of cardiovascular diseases . the main findings associated with crvo are widespread retinal hemorrhage , resulting in edema in the central part of the retina ( macular edema ) , and retinal ischemia . the ischemic change may cause abnormal vessel proliferation , which often subsequently causes intraocular massive hemorrhage and/or neovascular glaucoma as the most severe complications of crvo . a 45-year - old man , who had been seen by us previously for diabetic retinopathy follow - up ( figure 1a ) , presented with sudden impairment of best - corrected visual acuity ( bcva ) in his left eye due to crvo ( figure 1b ) . severe edema and ischemic changes , as well as hemorrhage in the macula , induced a sudden loss in vision from 20/20 to 20/200 . the patient was given a local steroid injection to reduce the macular edema and pan - retinal photocoagulation to prevent neovascularization and related eye complications . he gradually recovered his visual acuity as the macular edema decreased ; however , 2 months later , he complained of further visual impairment ( bcva , 6/200 ) due to a recurrence of crvo ( figure 1c ) . at this point , the hemorrhage was more severe than the first event , and he subsequently suffered from severe vitreous hemorrhage . pars plana vitrectomy and additional extensive pan - retinal photocoagulation were administered ; however , in spite of the treatment , the intraocular pressure elevated to 45 mmhg due to secondary neovascular glaucoma to crvo , which was uncontrollable both with medications and surgery for glaucoma ( trabeculectomy ) . simple diabetic retinopathy indicated by a small retinal hemorrhage and hard exudates ( arrowhead ) was observed . the patient had asymptomatic simple diabetic retinopathy , although his blood glucose level was moderately controlled at his first visit ( hba1c , 6.4% ) , as well as high blood pressure ( 145 mmhg [ systolic]/105 mmhg [ diastolic ] ) , although he had not received a diagnosis of hypertension or any medicine for this condition . we eventually learned that the patient had taken up the habit of kaatsu training , and had undergone a training session on the day before both his first onset and the recurrence . this study followed the tenets of the declaration of helsinki and was approved by the ethics committee of keio university school of medicine . both of the events in this case were preceded by a session of kaatsu training . this training regimen tends to drastically increase the heart rate and blood pressure at the peak of exercise . this may be at least partly due to the fact that kaatsu training immediately causes an increased serum level of growth hormone , which is a pressure - raising hormone . thus , substantial changes to the systemic condition occur during kaatsu training , although compression is only applied to a specific target muscle . even under resting conditions , the patient 's blood pressure met the criteria for hypertension , and it may have been elevated further during kaatsu training . the patient also had diabetes , which causes hyperviscosity induced by high glucose and diabetic microangiopathy , and can easily induce abnormal turbulent flow , thereby increasing the risk factor for endoluminal thrombus formation . in fact , the major risk factors for retinal vein occlusion are a high hematocrit level as well as hypertension . in addition , various inflammatory cytokines that induce the abnormal adhesion of leukocytes and/or platelets may have been upregulated owing to the patient 's diabetes and hypertension . under these conditions , the repeated circulatory changes caused by kaatsu training may have exacerbated deep vein thrombosis , and ultimately triggered serious vein occlusions . kaatsu training is now used as a rehabilitative program for heart disease patients or as a general training program . the risk of injury related to the high - intensity resistance training required for achieving muscle hypertrophy and strength gain may be reduced by using kaatsu training , which involves low - intensity resistance training . however , as the present case demonstrates , kaatsu training may also cause side effects in distant tissues and/or organs by inducing circulatory changes . this case illustrates that underlying medical conditions such as hypertension , diabetes , and the inflammation associated with these diseases could be risk factors for vascular side effects during kaatsu training . we propose that people who practice kaatsu training should carefully monitor their general condition , including their blood pressure , during and after training , and that a person with a chronic underlying disease should carefully consider whether or not to use kaatsu . this case clearly demonstrates that the influence of kaatsu training should be further studied from various medical viewpoints before its medical and recreational use becomes more widespread .
abstractkaatsu training is an exercise method involving the application of pressure to the target muscle , and is being increasingly used in rehabilitation programs for heart disease patients in some hospitals . this method restricts blood flow to the muscles during exercise , and the resultant hypoxia effectively causes muscle hypertrophy and strengthening . however , no medical guidelines or risk factors for its use have been established.we report a case involving a 45-year - old man who suffered from 2 episodes of central retinal vein occlusion ( crvo ) , both occurring on the day following a kaatsu training session.as a characteristic of the crvo and its subsequent complications , the affected eye lost vision despite treatment . the patient had a history of hypertension and diabetes , and thus was at an increased risk of crvo . kaatsu training , which changes the heart rate and serum growth hormone levels , may have triggered the onset of crvo.this case highlights that underlying medical conditions such as hypertension , diabetes , and the consequent inflammation , could be risk factors for vascular side effects resulting from kaatsu training . further studies are required before the medical and recreational use of kaatsu training become widespread .
as energy demand of these muscle tissues varies by several orders of magnitude , energy metabolism has to be tightly regulated in order to meet varying energy requirement . in this review , we shall first describe the physiology of energy metabolism in muscle , and then deal with different myopathies caused by inborn errors of energy metabolism . glucose , fatty acids , and , to a lesser extent , amino acids serve as energy substrates for skeletal muscle cells . during quiescence , however , glucose and 6 amino acids ( leucine , isoleucine , valine , asparagine , aspartate , glutamate ) may also be used by the resting muscle [ 1 , 2 ] . only leucine and isoleucine the other amino acids are used solely for de novo synthesis of citric acid cycle - intermediates . in contrast to liver glycogen , muscle glycogen does not serve glucose homeostasis in the body but is almost exclusively used for energy metabolism in muscle itself . in the initial phase of exercise , blood supply to skeletal muscle is not yet adequate ; hence oxygen and blood - born energy substrates ( i.e. , fatty acids ) are lacking . in this early phase , muscle relies on its own energy reserves , that is , muscle glycogen , and generates energy via anaerobic pathways . after a few minutes , blood vessels dilate , blood flow rises , and muscle cells are provided with oxygen and blood - born substrates . during this phase of exercise , muscle relies on aerobic energy generation via oxidative phosphorylation , mainly from fatty acids , but also ( to a lesser extent ) glucose and amino acids . fatty acids are metabolized in the mitochondrial matrix to acetyl - coa via beta - oxidation ( figures 1 and 2 ) . most tissues are able to oxidize fatty acids to co2 and water . in addition , liver has the capacity to synthesize ketone bodies ( acetoacetate and 3-hydroxybutyrate from acetyl - coa ) , which serve as an important fuel for extrahepatic organs , especially the brain , during catabolism . a rate - limiting step in mitochondrial fatty acid oxidation is the carnitine - palmitoyltransferase 1 ( cpt1 ) reaction . adequate glucose supply , conversion of acetyl - coa to malonyl - coa by acetyl - coa carboxylase , and the concomitant inhibition of cpt1 reduce long - chain fatty acid uptake and oxidation ( figure 2 ) . although these effects have primarily been shown in liver and heart , there is also evidence for a regulatory function of malonyl - coa in skeletal muscle . malonyl - coa levels decrease when the muscle is fuel - deprived or energy consumption is increased during contraction . long - chain fatty acids can not freely cross the inner mitochondrial membrane and are shuttled via the carnitine system ; acyl - coa molecules are first coupled to carnitine , catalysed by carnitine - palmitoyltransferase i ( cpt 1 ) , and the acylcarnitine complex then crosses the highly impermeable inner mitochondrial membrane . in the mitochondrial matrix space , acylcarnitines are reconverted to acyl - coa via carnitine - palmitoyltransferase 2 ( cpt2 ) ( figure 1 ) and subsequently enter beta - oxidation . acetyl - coa derived from beta - oxidation , amino acid- , or glucose - metabolism is channelled into the citric acid cycle . in the citric acid cycle , redox equivalents ( fadh2 , nadh ) are produced which are substrates of the mitochondrial respiratory chain ( figures 1 and 2 ) . electrons released from these redox equivalents enter the respiratory chain and are finally transferred to oxygen . electron transport is linked to the build - up of an electrochemical proton gradient across the inner mitochondrial membrane . the electrochemical gradient can be used to synthesize atp via the mitochondrial atpsynthase ( complex v ) or drive transmembrane transport processes directly . creatine is phosphorylated by creatinekinase to creatinephosphate ( cp ) which can be used as an energy buffer and is split to atp via reversal of the creatinekinase - reaction . cp - stores in muscle are only a short - term energy buffer and are used - up within the first 30 seconds of exercise . as mentioned above , energy demand is highly variable in muscle . energy supply has to be commensurated with energy demand ; therefore energy demand is highly regulated . calcium ( which mediates mechanical muscle contraction ) serves as an important regulatory element of metabolism . the key enzyme in aerobic mitochondrial energy production via oxidative phosphorylation is atpsynthase ( complex v ) . classically , it was believed that atpsynthase is regulated passively by its substrate adp ; mechanical activation of muscle results in breakdown of atp to adp , hence higher substrate saturation of the atpsynthase and increased flux . we and others have shown in various tissues that the atpsynthase is actively regulated [ 711 ] , probably via the calcium binding inhibitor protein ( cabi ) . this regulatory protein dissociates from the atpsynthase in response to elevated intramitochondrial calcium concentration during contraction , thus leading to desinhibition of the atpsynthase , hence higher flux . in animal models , we have previously shown that this regulation breaks down under different pathophysiological conditions [ 7 , 8 , 1316 ] . similarly to atpsynthase , enzymes of the citric acid cycle have been shown to be upregulated in response to increased intramitochondrial calcium levels [ 17 , 18 ] . thus , intramitochondrial concentrations of redox equivalents ( nadh , fadh2 ) as substrates of the mitochondrial respiratory chain rise in concert with the activity of mitochondrial atpsynthase ( cf . pyruvatedehyrogenase occurs in a nonphosphorylated ( active ) and a phosphorylated ( inactive ) form . it is regulated by calcium : muscle contraction is accompanied by increased muscle calcium concentrations which favours the nonphosphorylated form of pyruvatedehydrogenase by activating pyruvatedehydrogenase - phosphorylase and inhibiting kinase . during exercise pyruvate as the substrate of pyruvatedehydrogenase may subsequently lead to higher substrate saturation , hence higher flux . however , this mechanism is only of minor importance in human skeletal muscle in vivo . nitric oxide ( no ) and its derivatives inhibit mitochondrial respiration by a variety of means . no can inhibit mitochondrial cytochrome c - oxidase ( complex iv ) of the respiratory chain by reversibly competing with oxygen for the binding site . higher concentrations of no have been shown to uncouple mitochondria , inhibit complex i , and lead to permeability transition [ 21 , 22 ] . mitochondrial no synthase may be of particular importance in this context as it is regulated by the mitochondrial membrane potential with reduced membrane potential leading to no synthase inhibition [ 23 , 24 ] . specialized skeletal muscle fibres exist : red muscle fibres are rich in mitochondria and are used for slow and long - lasting contractions ( endurance ) while white muscle fibres predominantly rely on anaerobic glycolysis and can be found in fast and short twitch ' muscle . in contrast to skeletal muscle , energy metabolism in heart muscle is almost exclusively aerobic under physiological circumstances . fatty acids are the main source of energy in the heart : under normal conditions up to 70% of the energy requirement of the heart is provided by fatty acid oxidation , which may be even higher under certain conditions . the regulatory elements described above for skeletal muscle are operative in cardiac muscle as well . here we give a general overview of diagnostic procedures which may be useful in the workup of metabolic myopathies . for more specific methods the reader is referred to the special disease section . at the metabolite level , elevated lactate concentrations in blood and/or urine may be a clue to impaired aerobic energy metabolism ( oxidative phosphorylation ) and ( compensatorily ) increased rates of anaerobic glycolysis with lactate as the end product ( pasteur - effect ) . the lactate / pyruvate ratio in blood reflects the cytosolic nadh / nad - ratio and may therefore be elevated when aerobic energy metabolism is compromised ( e.g. , defects of respiratory chain enzymes ) . the ketone - body ratio ( -hydroxybutyrate / acetoacetate , hob / acac ) reflects the intramitochondrial nadh / nad - ratio and may be elevated under certain conditions of compromised aerobic energy production ( e.g. , respiratory chain defects ) as well . impaired oxidative phosphorylation may also be accompanied by elevated excretion of citric acid cycle intermediates ( e.g. , aconitate , succinate ) which can be determined by analysing organic acids in spot - urine . dicarboxylic acid excretion in urine is a metabolic hallmark both of defects in mitochondrial fatty acid oxidation and respiratory chain enzymes ( leading to secondary inhibition of fatty acid oxidation ) . this finding might also be the result of a diet rich in medium chain triglycerides ( mct enriched diet as used in preterm infants and cholestatic hepatopathy ) . acylcarnitine profiles measured from dried blood spots using the tandem - mass spectrometry technique ( tandem - ms ) may be indicative of fatty acid oxidation disorders . they are now integrative part of the routine newborn screening programme in many countries as a strategy of primary prevention . a lactate - ischaemia test may be indicated when glycogen storage diseases of muscle are suspected . in healthy individuals , forearm exercise leads to a rapid increase in lactate levels , paralleled by an increase in blood ammonia concentrations . in glycogen storage disease type v there is no or only attenuated lactate elevation in response to testing , while ammonia production is increased . the nonischaemic forearm exercise test has been found to be less specific and sensitive and is therefore not recommended . for morphological studies of muscle , ultrasound scans , mri , and biopsy with subsequent histological work - up ( including staining ) as well as electron microscopy can be used . traditionally , freeze clamping of percutaneous needle biopsy material has been used to biochemically study muscle energy metabolism . this method has limitations as far as stability of biochemical compounds and repetitive sampling in order to calculate kinetics are concerned . 31-phosphorous ( p ) magnetic resonance spectroscopy ( mrs ) is an elegant , noninvasive method to judge energy metabolism in vivo . several peaks corresponding to creatinephosphate ( cp ) , inorganic phosphate , the 3 phosphate groups of atp , and phosphomonesters can be observed . kinetic studies using this technique may reveal delayed recovery of phosphocreatine [ 28 , 29 ] . recently , the use of c - labeled substrates has been advocated to assess mitochondrial metabolism . another noninvasive technique to assess metabolic function in muscle is positron emission tomography ( pet ) with glucose as substrate . f - deoxyglucose is commonly used as a marker of glucose metabolism . by comparing glucose metabolism after exercise with reference values glycogen storage disease type ii also known as pompe disease can lead to dysfunction of skeletal and cardiac muscle . as this disease involves lysosomal storage of glycogen but no abnormality in the biochemical pathways leading to energy generation , we shall not deal with this disease in detail . on the other hand , glycogen storage disease type vii is caused by a defect in the glycolytic pathway , with secondary storage of glycogen . as energy metabolism pathogenesisglycogen storage disease type iii ( gsd iii ; omim 232400 ) is also known as cori disease , forbes disease , and limit dextrinosis . the symptoms associated with gsd iii were first described in 1952 by illingworth and cori and were studied clinically by forbes , hence the eponyms for this disorder . the overall incidence of this disease is approximately 1 : 100,000 live births in the usa . however , in other populations gsd iii may occur with a higher frequency ; for example , in the faroe islands a prevalence of 1 : 3,600 has been estimated .gsd iii is caused by deficiency of the glycogen debranching enzyme amylo-1,6-glucosidase , 4-alpha - glucanotransferase ( agl ) . debranching enzyme has two independent catalytic activities : oligo-1,4 - 1,4-glucantransferase and amylo-1,6-glucosidase , localised in two distinct protein regions . patients with debrancher deficiency are classified into four types : iiia : lack of both glucosidase and transferase activity in liver and muscle ; iiib : lack of both activities in liver only ; iiic : selective loss of glucosidase activity ; and iiid : selective loss of transferase activity [ 3335].most gsd iii patients ( about 85% ) have agl deficiency , expressed in both liver and muscle ( type iiia ) , but some only in liver but not muscle ( type iiib ) . differences in tissue expression of the deficient enzyme have been described ( immunoreactive material and enzyme activity ) .debranching enzyme is encoded by the 85-kb agl gene on chromosome 1p21 . genetic screening led to the observation that gsd iiib patients had mutations in exon 3 , whereas gsd iiia patients had downstream mutations . to date , no common mutation has been described among gsd iii patients , except for three alleles , two linked specifically with gsd iiib , and the third found only in north african jews with gsd iiia . glycogen storage disease type iii ( gsd iii ; omim 232400 ) is also known as cori disease , forbes disease , and limit dextrinosis . the symptoms associated with gsd iii were first described in 1952 by illingworth and cori and were studied clinically by forbes , hence the eponyms for this disorder . the overall incidence of this disease is approximately 1 : 100,000 live births in the usa . however , in other populations gsd iii may occur with a higher frequency ; for example , in the faroe islands a prevalence of 1 : 3,600 has been estimated . gsd iii is caused by deficiency of the glycogen debranching enzyme amylo-1,6-glucosidase , 4-alpha - glucanotransferase ( agl ) . debranching enzyme has two independent catalytic activities : oligo-1,4 - 1,4-glucantransferase and amylo-1,6-glucosidase , localised in two distinct protein regions . patients with debrancher deficiency are classified into four types : iiia : lack of both glucosidase and transferase activity in liver and muscle ; iiib : lack of both activities in liver only ; iiic : selective loss of glucosidase activity ; and iiid : selective loss of transferase activity [ 3335 ] . most gsd iii patients ( about 85% ) have agl deficiency , expressed in both liver and muscle ( type iiia ) , but some only in liver but not muscle ( type iiib ) . differences in tissue expression of the deficient enzyme have been described ( immunoreactive material and enzyme activity ) . genetic screening led to the observation that gsd iiib patients had mutations in exon 3 , whereas gsd iiia patients had downstream mutations . to date , no common mutation has been described among gsd iii patients , except for three alleles , two linked specifically with gsd iiib , and the third found only in north african jews with gsd iiia . clinical featuresclinically , patients with gsd iii present in infancy or early childhood with hepatomegaly , hypoglycaemia , and growth retardation . initially , the clinical picture may be quite similar to gsd i , however biochemically lactate and uric acid concentrations are usually normal in gsd iii , and ketone bodies can be found in hypoglycaemia . during puberty and early adulthood , symptoms seem to regress and most patients have only minimal signs of hepatopathy [ 36 , 37 ] . there is , however , a risk for cirrhosis and in rare cases even hepatocellular carcinoma may develop in the long run . muscle weakness in those with gsd iiia is usually minimal in childhood but can become more severe in adulthood ; however the clinical course of myopathy is highly variable [ 39 , 40 ] . lactate which could be used as an alternative fuel during exercise does not increase in gsd iiia patients ( david weinstein , personal communication ) which may explain muscle damage.the predominant myopathic symptoms in adults are distal weakness ( affecting mostly calves and peroneal muscles ) and proximal weakness of variable degree with a slow disease progression . back neuropathy may occur due to glycogen storage in schwann cells and axons which clinically manifests as polyneuropathy .osteoporosis is another common symptom in gsd iiia affecting nearly all patients . its etiology is multifactorial .some patients have severe cardiac hypertrophy leading to compromised heart function and even death . clinically , patients with gsd iii present in infancy or early childhood with hepatomegaly , hypoglycaemia , and growth retardation . initially , the clinical picture may be quite similar to gsd i , however biochemically lactate and uric acid concentrations are usually normal in gsd iii , and ketone bodies can be found in hypoglycaemia . during puberty and early adulthood , symptoms seem to regress and most patients have only minimal signs of hepatopathy [ 36 , 37 ] . there is , however , a risk for cirrhosis and in rare cases even hepatocellular carcinoma may develop in the long run . muscle weakness in those with gsd iiia is usually minimal in childhood but can become more severe in adulthood ; however the clinical course of myopathy is highly variable [ 39 , 40 ] . lactate which could be used as an alternative fuel during exercise does not increase in gsd iiia patients ( david weinstein , personal communication ) which may explain muscle damage . the predominant myopathic symptoms in adults are distal weakness ( affecting mostly calves and peroneal muscles ) and proximal weakness of variable degree with a slow disease progression . back pain and fatigue may be present . neuropathy may occur due to glycogen storage in schwann cells and axons which clinically manifests as polyneuropathy . diagnosisfor an accurate diagnosis , biochemical tests with glycogen quantitation and determination of amylo-1,6-glucosidase activity in a liver biopsy specimen or erythrocytes are required . mutation analysis of the agl gene may be helpful in some cases [ 46 , 47 ] and has been advocated as a screening test using a commercially available test kit . in our opinion , most of the mutations ( more than 30 are known ) are nonsense mutations caused by a nucleotide substitution or small insertion or deletion . a specific correlation of exon 3 mutations ( 17delag and q6x ) with gsd iiib has been observed . prenatal diagnosis is possible at enzymatic and genetic level . for an accurate diagnosis , biochemical tests with glycogen quantitation and determination of amylo-1,6-glucosidase activity in a liver biopsy specimen or erythrocytes are required . mutation analysis of the agl gene may be helpful in some cases [ 46 , 47 ] and has been advocated as a screening test using a commercially available test kit . in our opinion , most of the mutations ( more than 30 are known ) are nonsense mutations caused by a nucleotide substitution or small insertion or deletion . in particular a specific correlation of exon 3 mutations ( 17delag and q6x ) with gsd iiib has been observed . therapycurative therapy is not available for debranching enzyme deficiency . in order to avoid fasting hypoglycaemia in infancy , frequent daytime high protein feedings ( 45% carbohydrate , 25% protein , 30% fat ) and supplementation of uncooked corn starch before sleep proved to be effective in young patients with regard to metabolic control ( hypoglycaemia ) and growth retardation . effects of dietary measures on myopathic symptoms in adults are less well established even though there are reports of improvement in patients following a high - protein diet . in gsd iii , gluconeogenesis is intact and protein may be used as a precursor for glucose . over - treatment with cornstarch can cause deposition of glycogen , which can not be broken down , leading to accumulation.in patients with cardiomyopathy , symptomatic pharmacological treatment is mostly used . a diet providing 30% of energy from protein and avoidance of over - treatment with carbohydrate curative therapy is not available for debranching enzyme deficiency . in order to avoid fasting hypoglycaemia in infancy , frequent daytime high protein feedings ( 45% carbohydrate , 25% protein , 30% fat ) and supplementation of uncooked corn starch before sleep proved to be effective in young patients with regard to metabolic control ( hypoglycaemia ) and growth retardation . effects of dietary measures on myopathic symptoms in adults are less well established even though there are reports of improvement in patients following a high - protein diet . in gsd iii , gluconeogenesis is intact and protein may be used as a precursor for glucose . over - treatment with cornstarch can cause deposition of glycogen , which can not be broken down , leading to accumulation . in patients with cardiomyopathy , symptomatic pharmacological treatment is mostly used . a diet providing 30% of energy from protein and avoidance of over - treatment with carbohydrate pathophysiologymyophosphorylase activity is deficient in mcardle disease ( omim 232600 ) ; the disorder is inherited as an autosomal recessive trait . the most common mutation in northern europe and north america is the nonsense mutation at r50x , previously referred to as r49x [ 51 , 52 ] . genotype - phenotype correlation is poor , modifying genes as angiotensin converting enzyme or actin 3 genes may play a role [ 5355].as a consequence of myophosphorylase deficiency , the contracting muscle is not able to mobilize adequate amounts of muscle glycogen during the initial anaerobic phase of exercise . this leads to an energy deficit which can not be covered by creatinephosphate stores . during the aerobic phase of exercise , blood - born substrates like fatty acids and amino acids as well as glucose can be used as energy substrates . however , the capacity of the tricarboxylic acid cycle ( tca- or krebs - cycle ) is compromised as well . this is due to the lack of pyruvate which is normally generated from glucose via glycolysis and has an anaplerotic effect on the tca - cycle via oxaloacetate . we could show adaptive processes at the level of mitochondrial atpsynthase in a patient with mcardle disease ( poster presentation at the 4th world muscle society congress 1999 : das am , kohlschtter a ; upregulation of mitochondrial respiratory chain enzymes in gsd v ) . myophosphorylase activity is deficient in mcardle disease ( omim 232600 ) ; the disorder is inherited as an autosomal recessive trait . the most common mutation in northern europe and north america is the nonsense mutation at r50x , previously referred to as r49x [ 51 , 52 ] . genotype - phenotype correlation is poor , modifying genes as angiotensin converting enzyme or actin 3 genes may play a role [ 5355 ] . as a consequence of myophosphorylase deficiency , the contracting muscle is not able to mobilize adequate amounts of muscle glycogen during the initial anaerobic phase of exercise . this leads to an energy deficit which can not be covered by creatinephosphate stores . during the aerobic phase of exercise , blood - born substrates like fatty acids and amino acids as well as glucose can be used as energy substrates . however , the capacity of the tricarboxylic acid cycle ( tca- or krebs - cycle ) is compromised as well . this is due to the lack of pyruvate which is normally generated from glucose via glycolysis and has an anaplerotic effect on the tca - cycle via oxaloacetate . we could show adaptive processes at the level of mitochondrial atpsynthase in a patient with mcardle disease ( poster presentation at the 4th world muscle society congress 1999 : das am , kohlschtter a ; upregulation of mitochondrial respiratory chain enzymes in gsd v ) . clinical featuressymptoms typically begin in the second to third decade of life . as first reported by mcardle in 1951 , patients typically suffer from exercise - induced muscle pain , cramps , and fatigue . these symptoms are most pronounced during the first few minutes of exercise ( anaerobic phase ) and may be accompanied by rhabdomyolysis leading to myoglobinuria with burgundy discoloration of urine . after blood supply to the exercising muscle has increased , symptoms disappear as energy supply is reinstored ; this phenomenon is known as second wind . most patients with mcardle disease learn to cope with their problems by resting until muscle pain subsides and resuming activity as soon as the aerobic phase sets in ( oxidizing fatty acids and other blood - born substrates).a less common manifestation of mcardle disease is permanent muscle weakness . some patients may have proximal and symmetric weakness while others have asymmetric weakness mimicking facio - scapulohumeral dystrophy ( fshd ) . symptoms typically begin in the second to third decade of life . as first reported by mcardle in 1951 , patients typically suffer from exercise - induced muscle pain , cramps , and fatigue . these symptoms are most pronounced during the first few minutes of exercise ( anaerobic phase ) and may be accompanied by rhabdomyolysis leading to myoglobinuria with burgundy discoloration of urine . after blood supply to the exercising muscle has increased , symptoms disappear as energy supply is reinstored ; this phenomenon is known as second wind . most patients with mcardle disease learn to cope with their problems by resting until muscle pain subsides and resuming activity as soon as the aerobic phase sets in ( oxidizing fatty acids and other blood - born substrates ) . some patients may have proximal and symmetric weakness while others have asymmetric weakness mimicking facio - scapulohumeral dystrophy ( fshd ) . diagnosisplasma creatinekinase activity is usually elevated at rest and rises in response to muscular activity . inosine , hypoxanthine , and uric acid also increase reflecting accelerated recycling of purine nucleotides in the face of insufficient atp-production.muscle biopsy specimen usually shows subsarcolemmal and intermyofibrillar vacuoles filled with glycogen . ultrastructurally , there are deposits of normal - looking free glycogen particles and occasional alterations of sarcoplasmic reticulum and mitochondria . staining for phosphorylase is negative in muscle fibres whereas smooth muscle of blood vessels stains normally.biochemically , reduced activity of phosphorylase may be found by enzymatic assays . this allows definitive prenatal testing where appropriate.lack of lactate formation may lead to absent acidification of myoplasm as judged by p - mrs . the phosphocreatine / atp - ratio is usually elevated at rest , phosphocreatine depletion during exercise is larger than normal , and recovery rate of phosphocreatine after exercise is slower [ 58 , 59 ] . plasma creatinekinase activity is usually elevated at rest and rises in response to muscular activity . inosine , hypoxanthine , and uric acid also increase reflecting accelerated recycling of purine nucleotides in the face of insufficient atp - production . ultrastructurally , there are deposits of normal - looking free glycogen particles and occasional alterations of sarcoplasmic reticulum and mitochondria . staining for phosphorylase is negative in muscle fibres whereas smooth muscle of blood vessels stains normally . lack of lactate formation may lead to absent acidification of myoplasm as judged by p - mrs . the phosphocreatine / atp - ratio is usually elevated at rest , phosphocreatine depletion during exercise is larger than normal , and recovery rate of phosphocreatine after exercise is slower [ 58 , 59 ] . high protein , high carbohydrate , and high fat diets as well as ketogenic diet have been tried without significant effects . furthermore , glucagon administration , verapamil , ace - inhibitors , sodium dantrolene , gentamicin , vitamin b6 , and creatine have been tested . low - dose creatine may have a modest benefit in some patients while higher - doses may lead to deterioration . the cochrane review concludes that none of the tested pharmacological or dietary interventions can be recommended . high protein , high carbohydrate , and high fat diets as well as ketogenic diet have been tried without significant effects . furthermore , glucagon administration , verapamil , ace - inhibitors , sodium dantrolene , gentamicin , vitamin b6 , and creatine have been tested . low - dose creatine may have a modest benefit in some patients while higher - doses may lead to deterioration . the cochrane review concludes that none of the tested pharmacological or dietary interventions can be recommended . pathophysiologytarui disease ( gsd vii ; omim 232800 ) is caused by deficiency of muscle phosphofructokinase . it is inherited as an autosomal - recessive trait ( gene map locus of muscle phosphofructokinase pfkm 12q13.3 ) . phosphofructokinase is a tetrameric enzyme derived from 3 distinct genetic loci that code for muscle , liver , and platelet isoforms . mammalian pfk is a tetramer made up of various combinations of 3 subunits : muscle ( pfkm ) , liver ( pfkl ) , and platelet ( pfkp ) , the genes for which are located on chromosomes 12q13 , 21q22 , and 10p , respectively . the composition of the tetramers differs according to the tissue type . muscle and liver pfk are homotetramers of 4 m and 4 l subunits , respectively . erythrocytes contain both l and m subunits.the muscle phosphofructokinase gene is located on chromosome 12 and about 20 mutations have been described [ 64 , 65 ] . the pfkm gene encodes the muscle isoform of phosphofructokinase ( pfk ) ( atp : d - fructose-6-phosphate-1-phosphotransferase ) . pfk catalyzes the irreversible conversion of fructose-6-phosphate to fructose-1,6-bisphosphate and is a key regulatory enzyme in glycolysis.tarui disease has a relatively high prevalence in japanese people ; in the western hemisphere it is prevalent in patients of jewish - russian extraction.if the muscle isoenzyme of phosphofructokinase ( pfkm ) is deficient , not only is glycolysis in muscle affected but also glycolysis in erythrocytes is reduced to about 50% ( as the liver isoenzyme is fully active ) . as erythrocytes have no mitochondria , this relatively mild reduction of glycolytic flux can critically reduce energy supply resulting in haemolysis . tarui disease ( gsd vii ; omim 232800 ) it is inherited as an autosomal - recessive trait ( gene map locus of muscle phosphofructokinase pfkm 12q13.3 ) . phosphofructokinase is a tetrameric enzyme derived from 3 distinct genetic loci that code for muscle , liver , and platelet isoforms . mammalian pfk is a tetramer made up of various combinations of 3 subunits : muscle ( pfkm ) , liver ( pfkl ) , and platelet ( pfkp ) , the genes for which are located on chromosomes 12q13 , 21q22 , and 10p , respectively . the composition of the tetramers differs according to the tissue type . muscle and liver pfk are homotetramers of 4 m and 4 l subunits , respectively . the muscle phosphofructokinase gene is located on chromosome 12 and about 20 mutations have been described [ 64 , 65 ] . the pfkm gene encodes the muscle isoform of phosphofructokinase ( pfk ) ( atp : d - fructose-6-phosphate-1-phosphotransferase ) . pfk catalyzes the irreversible conversion of fructose-6-phosphate to fructose-1,6-bisphosphate and is a key regulatory enzyme in glycolysis . tarui disease has a relatively high prevalence in japanese people ; in the western hemisphere it is prevalent in patients of jewish - russian extraction . if the muscle isoenzyme of phosphofructokinase ( pfkm ) is deficient , not only is glycolysis in muscle affected but also glycolysis in erythrocytes is reduced to about 50% ( as the liver isoenzyme is fully active ) . as erythrocytes have no mitochondria , this relatively mild reduction of glycolytic flux can critically reduce energy supply resulting in haemolysis . clinical featuresclinical symptoms are very similar to mcardle disease with exercise - induced pain , muscle cramps , and fatigue . as in mcardle disease the initial anaerobic phase of exercise is affected when the muscle has to rely on anaerobic glycolysis which is defective in tarui disease . the resulting energy shortage leads to the clinical symptoms as first described by tarui et al . in 1965 there are some features which may differentiate mcardle disease from tarui disease : in tarui disease , symptoms are more severe and often already present during childhood , often accompanied by nausea and vomiting as well as compensated haemolytic anaemia , hyperuricaemia , and an abnormal polysaccharide which is periodic acid - schiff positive . the pathophysiological basis for this observation is probably the inability of muscle to use glucose ( anaerobically and aerobically ) on one hand and hyperinsulinism caused by hyperglycaemia with subsequent lowering of fatty acids as energy substrates for muscle on the other hand.as in mcardle disease , there are variant forms of the disease . one variant leads to muscle weakness in later adult life while the other leads to hypotonia during infancy with subsequent progressive myopathy leading to early death in younger children . clinical symptoms are very similar to mcardle disease with exercise - induced pain , muscle cramps , and fatigue . as in mcardle disease the initial anaerobic phase of exercise is affected when the muscle has to rely on anaerobic glycolysis which is defective in tarui disease . the resulting energy shortage leads to the clinical symptoms as first described by tarui et al . in 1965 there are some features which may differentiate mcardle disease from tarui disease : in tarui disease , symptoms are more severe and often already present during childhood , often accompanied by nausea and vomiting as well as compensated haemolytic anaemia , hyperuricaemia , and an abnormal polysaccharide which is periodic acid - schiff positive . the pathophysiological basis for this observation is probably the inability of muscle to use glucose ( anaerobically and aerobically ) on one hand and hyperinsulinism caused by hyperglycaemia with subsequent lowering of fatty acids as energy substrates for muscle on the other hand . as in mcardle disease , there are variant forms of the disease . one variant leads to muscle weakness in later adult life while the other leads to hypotonia during infancy with subsequent progressive myopathy leading to early death in younger children . diagnosisas in glycogen storage disease type v the ischaemic forearm test has a pathologic result with insufficient lactate production accompanied by a rise in ammonia levels.histochemical and biochemical demonstration of the enzyme defect proves the suspected diagnosis p - mrs shows increased phosphocreatine / atp ratio in resting muscle , atp depletion , larger than normal phosphocreatine depletion during exercise with slow recovery rate and absence of myoplasmic acidification [ 67 , 68 ] . as in glycogen storage disease type v the ischaemic forearm test has a pathologic result with insufficient lactate production accompanied by a rise in ammonia levels . p - mrs shows increased phosphocreatine / atp ratio in resting muscle , atp depletion , larger than normal phosphocreatine depletion during exercise with slow recovery rate and absence of myoplasmic acidification [ 67 , 68 ] . most patients try to avoid strenuous exercise , by slowing down speed or pausing after onset of symptoms . pain and fatigue can be reduced , after adequate blood ( and fatty acid ) supply sets in . most patients try to avoid strenuous exercise , by slowing down speed or pausing after onset of symptoms . pain and fatigue can be reduced , after adequate blood ( and fatty acid ) supply sets in . general aspects of pathophysiology in fao disorders ( faods)mitochondrial fatty acid oxidation represents an important pathway for energy supply in skeletal muscle during both quiescence and periods of physical exercise . cardiac muscle preferentially oxidizes fatty acids for energy generation and may have a limited ability to rely completely on glucose during periods of stress [ 4 , 69].among metabolic myopathies , long - chain mitochondrial fatty acid oxidation defects ( faods ) are probably the most difficult to identify due to the episodic character of clinical and biochemical abnormalities which may completely disappear during anabolism . the pathway of fatty acid beta - oxidation includes at least 25 enzymes and specific transport proteins . deficiencies in more than 50 percent of these enzymes are known to cause disease in humans . apart from overall energy deficit in the muscle toxic ( lipophilic ) compounds resulting from compromised fatty acid oxidation , such as long - chain - acylcarnitines , coa - esters , or their free long - chain fatty acids may play a role in the pathogenesis of clinical manifestations.in this section we will focus on the following more common disorders : carnitinepalmitoyltransferase 2 ( cpt2 ) , mitochondrial trifunctional protein ( mtp ) , very - long - chain - acyl - coa dehydrogenase ( vlcad ) , multiple acyl - coa ( mad ) , as well as primary carnitine / carnitine transporter - deficiency ( ctd ) . mitochondrial fatty acid oxidation represents an important pathway for energy supply in skeletal muscle during both quiescence and periods of physical exercise . cardiac muscle preferentially oxidizes fatty acids for energy generation and may have a limited ability to rely completely on glucose during periods of stress [ 4 , 69 ] . among metabolic myopathies , long - chain mitochondrial fatty acid oxidation defects ( faods ) are probably the most difficult to identify due to the episodic character of clinical and biochemical abnormalities which may completely disappear during anabolism . the pathway of fatty acid beta - oxidation includes at least 25 enzymes and specific transport proteins . deficiencies in more than 50 percent of these enzymes are known to cause disease in humans . apart from overall energy deficit in the muscle toxic ( lipophilic ) compounds resulting from compromised fatty acid oxidation , such as long - chain - acylcarnitines , coa - esters , or their free long - chain fatty acids may play a role in the pathogenesis of clinical manifestations . in this section we will focus on the following more common disorders : carnitinepalmitoyltransferase 2 ( cpt2 ) , mitochondrial trifunctional protein ( mtp ) , very - long - chain - acyl - coa dehydrogenase ( vlcad ) , multiple acyl - coa ( mad ) , as well as primary carnitine / carnitine transporter - deficiency ( ctd ) . general clinical aspects of long - chain faodin disorders of long - chain fatty acid oxidation , clinical symptoms are usually triggered by common infections , prolonged exercise , and exposure to cold and prolonged fasting ( catabolism ) . in long - chain faod , the phenotype ranges from benign forms with isolated skeletal muscle involvement to severe phenotypes leading to early death as has been initially described in patients with carnitine palmitoyltransferase 2 ( cpt2 ) deficiency [ 7072].newborns and infants commonly present with a multisystemic manifestation ( including liver , muscle , and brain involvement ) often triggered by physiological catabolism soon after birth , whereas onset later in life usually presents with exercise intolerance , muscle weakness , and sometimes myoglobinuria during metabolic decompensation . long - chain faod - associated myopathies of the more chronic type manifest predominately during aerobic endurance - type activity or under metabolically stressful conditions . in contrast to patients with glycogen storage diseases of muscle , patients suffering from faod do not experience a second - wind phenomenon . in disorders of long - chain fatty acid oxidation , clinical symptoms are usually triggered by common infections , prolonged exercise , and exposure to cold and prolonged fasting ( catabolism ) . in long - chain faod , the phenotype ranges from benign forms with isolated skeletal muscle involvement to severe phenotypes leading to early death as has been initially described in patients with carnitine palmitoyltransferase 2 ( cpt2 ) deficiency [ 7072 ] . newborns and infants commonly present with a multisystemic manifestation ( including liver , muscle , and brain involvement ) often triggered by physiological catabolism soon after birth , whereas onset later in life usually presents with exercise intolerance , muscle weakness , and sometimes myoglobinuria during metabolic decompensation . long - chain faod - associated myopathies of the more chronic type manifest predominately during aerobic endurance - type activity or under metabolically stressful conditions . in contrast to patients with glycogen storage diseases of muscle , patients suffering from faod do not experience a general diagnostic procedures in faodthe diagnosis is based on detecting the accumulation of specific biochemical markers such as acylcarnitine metabolites in blood , dicarboxylic acids , and acylglycines in urine by routine newborn- or selective screening . medium- and long - chain fatty acid oxidation defects have been included in the routine neonatal screening program , for example , by the german screening commission . newborn screening for faod promises to identify many affected patients before the onset of symptoms or in the early phase of metabolic decompensation . physiological catabolism in the first days of life confirmation of suspected mitochondrial fatty acid oxidation defects based on an initial abnormal newborn- or selective metabolic - screening by tandem mass spectrometry should include enzyme and whenever possible molecular analyses . patients who are not aware of their defect could be easily at risk of decompensation when exposed to different triggers , that is , prolonged fasting , fever , or strenuous physical exercise . therefore , neonates ( and older patients ) suspected to suffer from an faod should receive special monitoring and follow an emergency regime until the metabolic defect is excluded.pathologic findings in muscle biopsies are most often nonspecific . moderate lipid storage is present in only some cases.of particular importance is the possibility of secondary respiratory chain dysfunction in patients with fao defects or vice versa .diagnostic procedures in long - chain fao disorders have recently been summarized based on the results of a consensus workshop .specific the diagnosis is based on detecting the accumulation of specific biochemical markers such as acylcarnitine metabolites in blood , dicarboxylic acids , and acylglycines in urine by routine newborn- or selective screening . medium- and long - chain fatty acid oxidation defects have been included in the routine neonatal screening program , for example , by the german screening commission . newborn screening for faod promises to identify many affected patients before the onset of symptoms or in the early phase of metabolic decompensation . physiological catabolism in the first days of life confirmation of suspected mitochondrial fatty acid oxidation defects based on an initial abnormal newborn- or selective metabolic - screening by tandem mass spectrometry should include enzyme and whenever possible molecular analyses . patients who are not aware of their defect could be easily at risk of decompensation when exposed to different triggers , that is , prolonged fasting , fever , or strenuous physical exercise . therefore , neonates ( and older patients ) suspected to suffer from an faod should receive special monitoring and follow an emergency regime until the metabolic defect is excluded . of particular importance is the possibility of secondary respiratory chain dysfunction in patients with fao defects or vice versa . diagnostic procedures in long - chain fao disorders have recently been summarized based on the results of a consensus workshop . general treatment principles of faodevidence - based treatment recommendations for long - chain fao defects are not available . however , at national / multinational levels consensus protocols exist . current management of patients with long chain fatty acid oxidation defects includes long - term dietary therapy including avoidance of fasting , low fat diet with the restriction of long - chain fatty acid intake , and substitution with medium chain fatty acids . the long - term outcome of patients treated by dietary modification remains unknown [ 74 , 76 ] . dietary long - chain fat restriction depends on the severity of the underlying enzyme defect.episodic muscular symptoms such as rhabdomyolysis are pathogenetically attributed to energy deficiency , and symptoms are reversed or may be prevented by sufficient energy supply in the form of carbohydrates or mct . the incidence of overweight and obesity is increasing among children with long - chain faod . a diet higher in protein and lower in carbohydrate may help to lower total energy intake while maintaining good metabolic control .in the past , supplementation with carnitine was proposed in fatty acid oxidation defects for detoxification of accumulating long - chain acyl - coa esters . actually , carnitine supplementation in long - chain faod is not recommended .further therapeutic options have anecdotally been described in single cases : triheptanoin ( seven - carbon medium chain fatty acid ) supplementation could show an improvement of cardiac and muscular symptoms in patients suffering from long - chain fatty acid oxidation disorders . ppar - alpha agonists ( like fibrates ) stimulated mitochondrial fatty acid oxidation in vivo in both liver and muscle and might be a therapeutic option in inborn errors of fao [ 8082].d , l-3-hydroxybutyrate could be a therapeutic option for cerebral and cardiac complications in severe fao .disease - specific therapeutic options are discussed below . evidence - based treatment recommendations for long - chain fao defects are not available . however , at national / multinational levels consensus protocols exist . current management of patients with long chain fatty acid oxidation defects includes long - term dietary therapy including avoidance of fasting , low fat diet with the restriction of long - chain fatty acid intake , and substitution with medium chain fatty acids . the long - term outcome of patients treated by dietary modification remains unknown [ 74 , 76 ] . dietary long - chain fat restriction depends on the severity of the underlying enzyme defect . episodic muscular symptoms such as rhabdomyolysis are pathogenetically attributed to energy deficiency , and symptoms are reversed or may be prevented by sufficient energy supply in the form of carbohydrates or mct . the incidence of overweight and obesity is increasing among children with long - chain faod . a diet higher in protein and lower in carbohydrate may help to lower total energy intake while maintaining good metabolic control . in the past , supplementation with carnitine was proposed in fatty acid oxidation defects for detoxification of accumulating long - chain acyl - coa esters . actually , carnitine supplementation in long - chain faod is not recommended . further therapeutic options have anecdotally been described in single cases : triheptanoin ( seven - carbon medium chain fatty acid ) supplementation could show an improvement of cardiac and muscular symptoms in patients suffering from long - chain fatty acid oxidation disorders . ppar - alpha agonists ( like fibrates ) stimulated mitochondrial fatty acid oxidation in vivo in both liver and muscle and might be a therapeutic option in inborn errors of fao [ 8082 ] . d , l-3-hydroxybutyrate could be a therapeutic option for cerebral and cardiac complications in severe fao . pathophysiology cpt2 is located at the inner aspect of the inner mitochondrial membrane catalyzing the conversion of long - chain acyl - carnitines to acyl - coa esters . cpt2 deficiency ( omim 600650 ) is inherited as an autosomal recessive trait resulting in the accumulation of long - chain acylcarnitines . ( omim 255110 ) is most frequent and shows onset in childhood or adulthood with exercise - induced muscle weakness and rhabdomyolysis . ck levels are found to be elevated during symptomatic periods , and carnitine levels are usually normal . the prevalent c.338c > t ( p.ser113leu ) mutation is found in about 60%75% of mutant alleles . this cpt2 mutation is thermolabile resulting in the degradation of the protein during fever or muscular exercise accompanied by elevated body temperature . cpt2 is located at the inner aspect of the inner mitochondrial membrane catalyzing the conversion of long - chain acyl - carnitines to acyl - coa esters . cpt2 deficiency ( omim 600650 ) is inherited as an autosomal recessive trait resulting in the accumulation of long - chain acylcarnitines . ( omim 255110 ) is most frequent and shows onset in childhood or adulthood with exercise - induced muscle weakness and rhabdomyolysis . ck levels are found to be elevated during symptomatic periods , and carnitine levels are usually normal . the prevalent c.338c > t ( p.ser113leu ) mutation is found in about 60%75% of mutant alleles . this cpt2 mutation is thermolabile resulting in the degradation of the protein during fever or muscular exercise accompanied by elevated body temperature . ( omim 608836 ) presents in the newborn period with nonketotic hypoglycemia , cardiomyopathy , muscle weakness , and renal dysgenesis in some patients . ( omim 600649 ) is often fatal in the period from 3 to 18 months of age . it presents with seizures , hepatomegaly , nonketotic hypoglycemia , cardiomyopathy , and muscle weakness . these different clinical presentations appear to be correlated with different residual cpt2- and overall long - chain fao - capacity . compound heterozygosity for a mild and a severe mutation can be associated with either the mild muscle or the severe multisystemic infantile form . several homozygous mutations have been reported , associated with either a prominent skeletal muscle involvement or with a severe generalized phenotype [ 93 , 94 ] . milder phenotypes suggest little evidence for genotype - phenotype correlation .the presence of only one severe mutation ( the other being a milder one ) in a cpt2 deficient patient might be sufficient to lead to life - threatening events . severely compromised long - chain fatty acid oxidation may point to a more severe course [ 90 , 95 ] . a severe neonatal form ( omim 608836 ) presents in the newborn period with nonketotic hypoglycemia , cardiomyopathy , muscle weakness , and renal dysgenesis in some patients . ( omim 600649 ) is often fatal in the period from 3 to 18 months of age . it presents with seizures , hepatomegaly , nonketotic hypoglycemia , cardiomyopathy , and muscle weakness . these different clinical presentations appear to be correlated with different residual cpt2- and overall long - chain fao - capacity . compound heterozygosity for a mild and a severe mutation can be associated with either the mild muscle or the severe multisystemic infantile form . several homozygous mutations have been reported , associated with either a prominent skeletal muscle involvement or with a severe generalized phenotype [ 93 , 94 ] . the presence of only one severe mutation ( the other being a milder one ) in a cpt2 deficient patient might be sufficient to lead to life - threatening events . severely compromised long - chain fatty acid oxidation may point to a more severe course [ 90 , 95 ] . pathophysiologymtp is an enzyme complex involved in the beta - oxidation of fatty acids with chain lengths of c12 to c18 . it catalyzes three reactions in the oxidation of long chain fatty acids and consists of the following enzymes : 3-hydroxyacyl - coa dehydrogenase ( lchad ) , 2-enoyl - coa hydratase , and 3-ketoacyl - coa thiolase . mtp is a hetero - octamer of 4 alpha- ( omim 600890 ; with lchad and 2-enoyl - coa hydratase activities ) and 4 beta - subunits ( omim 143450 ; with 3-ketoacyl - coa thiolase activity ) . the alpha- and beta - subunits are encoded by different nuclear genes , consisting of 20 and 16 exons , respectively . both are located on chromosome 2p23 .a deficiency in this heteromeric complex ( omim 609015 ) was first described in 1992 . in contrast to the large number of isolated lchad - deficient patients ( omim 609016 ) , only few mtp alpha- and beta - subunit - deficient patients were published . molecular studies in mtp - deficient patients show a wide range of private mutations in both the alpha- and beta - subunit , in contrast to the common 1528 g > c mutation ( e474q ) in lchad deficiency . thiolase expression levels and the different rates of thiolase degradation as a result of either alpha- or beta - subunit mutations were found to correlate well with the severity of clinical manifestations .the biochemical hallmarks of this disorder are the accumulation of long - chain 3-hydroxyacylcarnitines and free fatty acids in blood as well as dicarboxylic acids in urine . mtp is an enzyme complex involved in the beta - oxidation of fatty acids with chain lengths of c12 to c18 . it catalyzes three reactions in the oxidation of long chain fatty acids and consists of the following enzymes : 3-hydroxyacyl - coa dehydrogenase ( lchad ) , 2-enoyl - coa hydratase , and 3-ketoacyl - coa thiolase . mtp is a hetero - octamer of 4 alpha- ( omim 600890 ; with lchad and 2-enoyl - coa hydratase activities ) and 4 beta - subunits ( omim 143450 ; with 3-ketoacyl - coa thiolase activity ) . the alpha- and beta - subunits are encoded by different nuclear genes , consisting of 20 and 16 exons , respectively . a deficiency in this heteromeric complex ( omim 609015 ) was first described in 1992 . in contrast to the large number of isolated lchad - deficient patients ( omim 609016 ) , only few mtp alpha- and beta - subunit - deficient patients were published . molecular studies in mtp - deficient patients show a wide range of private mutations in both the alpha- and beta - subunit , in contrast to the common 1528 g > c mutation ( e474q ) in lchad deficiency . thiolase expression levels and the different rates of thiolase degradation as a result of either alpha- or beta - subunit mutations were found to correlate well with the severity of clinical manifestations . the biochemical hallmarks of this disorder are the accumulation of long - chain 3-hydroxyacylcarnitines and free fatty acids in blood as well as dicarboxylic acids in urine . they may present in the neonate or infant with sudden death , hepatopathy ( reye - like disease ) , hypoketotic hypoglycaemia , rhabdomyolysis , myopathy , cardiomyopathy , and capillary leak syndrome often associated with lung oedema . late complications such as peripheral neuropathy , pigmentary retinopathy , retinal degeneration , and progressive visual loss occur [ 97100 ] . the clinical spectrum in mtp - deficiency seems to be broader than in isolated lchad - deficiency , usually with a first manifestation earlier in life with a lethal outcome . three phenotypes have been reported in patients with alpha- or beta - subunit mutations : a lethal form with predominating cardiac involvement , an infancy - onset hepatic presentation , and a milder late - onset neuromyopathic form . the main features of the neuromyopathic form with late - onset are progressive peripheral neuropathy and episodic , often exercise - induced myoglobinuria . they may present in the neonate or infant with sudden death , hepatopathy ( reye - like disease ) , hypoketotic hypoglycaemia , rhabdomyolysis , myopathy , cardiomyopathy , and capillary leak syndrome often associated with lung oedema . late complications such as peripheral neuropathy , pigmentary retinopathy , retinal degeneration , and progressive visual loss occur [ 97100 ] . the clinical spectrum in mtp - deficiency seems to be broader than in isolated lchad - deficiency , usually with a first manifestation earlier in life with a lethal outcome . three phenotypes have been reported in patients with alpha- or beta - subunit mutations : a lethal form with predominating cardiac involvement , an infancy - onset hepatic presentation , and a milder late - onset neuromyopathic form . the main features of the neuromyopathic form with late - onset are progressive peripheral neuropathy and episodic , often exercise - induced myoglobinuria . pathophysiology vlcad is bound to the inner mitochondrial membrane and catalyses the first step of the long - chain fatty acid beta oxidation spiral . vlcad deficiency ( omim 201475 ) is inherited as an autosomal recessive trait ( gene map locus 17p13 ) . vlcad is bound to the inner mitochondrial membrane and catalyses the first step of the long - chain fatty acid beta oxidation spiral . vlcad deficiency ( omim 201475 ) is inherited as an autosomal recessive trait ( gene map locus 17p13 ) . clinical featuresaccording to the age of onset , three phenotypes have been described [ 102105 ] : a severe infantile form presenting in the neonatal period with hypertrophic cardiomyopathy and liver failure , a childhood - onset type with hypoketotic hypoglycaemia , and a juvenile or adult - onset muscular form characterized by recurrent episodes of rhabdomyolysis triggered by prolonged exercise or fasting ( similar to cpt2 deficiency ) . a clear genotype - phenotype correlation could be found : patients with the severe childhood phenotype have mutations that result in absence of enzyme activity , whereas patients with the milder childhood and adult ( myopathic ) phenotypes have mutations that result in residual enzyme activity . however , a recent report of life - threatening disease with cardiomyopathy and hypoketotic hypoglycaemia in a previously healthy 32-year - old woman underscores the potential risk of severe complications , even in adults .the milder form of vlcad deficiency is increasingly recognised due to the more wide - spread use of tandem mass spectrometry , allowing the ( presymptomatic ) detection of abnormal long - chain acylcarnitines in blood samples during neonatal screening . some neonates show biochemical abnormalities in routine screening but do not suffer from clinical disease . for this ( which is poorly defined as a condition where late - onset disease is possible ) has been coined . clinical observation of patients with late - onset presentation of vlcad deficiency is scarce [ 106 , 108117 ] . according to the age of onset , three phenotypes have been described [ 102105 ] : a severe infantile form presenting in the neonatal period with hypertrophic cardiomyopathy and liver failure , a childhood - onset type with hypoketotic hypoglycaemia , and a juvenile or adult - onset muscular form characterized by recurrent episodes of rhabdomyolysis triggered by prolonged exercise or fasting ( similar to cpt2 deficiency ) . a clear genotype - phenotype correlation could be found : patients with the severe childhood phenotype have mutations that result in absence of enzyme activity , whereas patients with the milder childhood and adult ( myopathic ) phenotypes have mutations that result in residual enzyme activity . however , a recent report of life - threatening disease with cardiomyopathy and hypoketotic hypoglycaemia in a previously healthy 32-year - old woman underscores the potential risk of severe complications , even in adults . the milder form of vlcad deficiency is increasingly recognised due to the more wide - spread use of tandem mass spectrometry , allowing the ( presymptomatic ) detection of abnormal long - chain acylcarnitines in blood samples during neonatal screening . some neonates show biochemical abnormalities in routine screening but do not suffer from clinical disease . for this ( which is poorly defined as a condition where late - onset disease is possible ) has been coined . clinical observation of patients with late - onset presentation of vlcad deficiency is scarce [ 106 , 108117 ] . pathophysiologythis is an autosomal recessively inherited disorder of fatty acid , amino acid , and choline metabolism . in multiple acyl - coa dehydrogenase deficiency ( madd , omim 231680 ) large excretion not only of glutaric acid but also of lactic , ethylmalonic , butyric , isobutyric , 2-methyl - butyric , and isovaleric acids in urine occurs . madd results from deficiency of one of three molecules : the alpha ( etfa ) and beta ( etfb ) subunits of electron transfer flavoprotein ( etf ) , and electron transfer flavoprotein dehydrogenase ( etfdh ) , gene map locus 15q23-q25 , 19q13.3 , and 4q32-qter . this is an autosomal recessively inherited disorder of fatty acid , amino acid , and choline metabolism . in multiple acyl - coa dehydrogenase deficiency ( madd , omim 231680 ) large excretion not only of glutaric acid but also of lactic , ethylmalonic , butyric , isobutyric , 2-methyl - butyric , and isovaleric acids in urine occurs . madd results from deficiency of one of three molecules : the alpha ( etfa ) and beta ( etfb ) subunits of electron transfer flavoprotein ( etf ) , and electron transfer flavoprotein dehydrogenase ( etfdh ) , gene map locus 15q23-q25 , 19q13.3 , and 4q32-qter . clinical featuresthe clinical picture of madd due to the different defects appears to be similar . the most severely affected patients have congenital anomalies and die in the newborn period ; other patients have hypoglycaemia , encephalopathy , muscle weakness , or cardiomyopathy . each of the single enzyme defects can lead to a mild or severe course , depending presumably on the location and nature of the intragenic lesion . therefore , mutations can result in dysfunction of electron transfer flavoprotein ( etf ) or etf - ubiquinone oxidoreductase ( etf - qo ) . it results in secondary deficiencies of a variety of fad - dependent enzymes , including glutaryl - coa dehydrogenase , as well as acyl - coa dehydrogenases from fao and branched - chain amino acid metabolism . mutations in etfdh , encoding etf - qo , have been associated with both riboflavin - responsive and nonresponsive madd as well as a myopathic form of coq 10 deficiency . pathomechanisms responsible for these different phenotypes are not well defined [ 122 , 123 ] . as with vlcad deficiency , there is a relationship between etf / etfdh genotype and phenotype in patients with madd.in madd early diagnosis is essential as some patients respond to pharmacological doses of riboflavin . it has recently been shown that rapid diagnosis of madd via newborn screening using tandem - ms is possible . only in some of these children , disease causing mutations could be found ; some were responsive to riboflavin even without a mutation ( presented as an abstract at 11th iciem - congress in san diego , 2009 : olsen et al . furthermore , coenzyme q10 concentrations should be determined in patients suffering from riboflavin responsive madd . the most severely affected patients have congenital anomalies and die in the newborn period ; other patients have hypoglycaemia , encephalopathy , muscle weakness , or cardiomyopathy . each of the single enzyme defects can lead to a mild or severe course , depending presumably on the location and nature of the intragenic lesion . therefore , mutations can result in dysfunction of electron transfer flavoprotein ( etf ) or etf - ubiquinone oxidoreductase ( etf - qo ) . it results in secondary deficiencies of a variety of fad - dependent enzymes , including glutaryl - coa dehydrogenase , as well as acyl - coa dehydrogenases from fao and branched - chain amino acid metabolism . mutations in etfdh , encoding etf - qo , have been associated with both riboflavin - responsive and nonresponsive madd as well as a myopathic form of coq 10 deficiency . pathomechanisms responsible for these different phenotypes are not well defined [ 122 , 123 ] . as with vlcad deficiency , there is a relationship between etf / etfdh genotype and phenotype in patients with madd . in madd early diagnosis it has recently been shown that rapid diagnosis of madd via newborn screening using tandem - ms is possible . only in some of these children , disease causing mutations could be found ; some were responsive to riboflavin even without a mutation ( presented as an abstract at 11th iciem - congress in san diego , 2009 : olsen et al . furthermore , coenzyme q10 concentrations should be determined in patients suffering from riboflavin responsive madd . pathophysiology of ctdcarnitine is ubiquitous in nature , especially high in muscle tissue of higher organisms , but low in vegetables . in humans , biosynthesis takes place in liver and kidney . to fulfil its function , intracellular carnitine concentrations have to be rather high , especially in skeletal muscle cells translocation is mediated by the carnitine transporter , a special protein , which is located in cell membranes . the active transport of carnitine into tissue takes place against a concentration gradient , permitting tissue carnitine concentrations to be 20- to 50-fold higher than plasma levels . the sequence of the 557 amino acids of the carnitine transporter is encoded on chromosome 5q31.2-32.in case of carnitine transporter deficiency ( omim 212120)inherited as an autosomal recessive trait carnitine is lost in considerable amounts via urine ; the body becomes depleted of carnitine . as a consequence , impaired oxidation of long chain fatty acids leads to deficient energy generation as well as reduced ketogenesis during fasting , and accumulation of lipids in liver and muscle . carnitine is ubiquitous in nature , especially high in muscle tissue of higher organisms , but low in vegetables . in humans , biosynthesis takes place in liver and kidney . to fulfil its function , intracellular carnitine concentrations have to be rather high , especially in skeletal muscle cells translocation is mediated by the carnitine transporter , a special protein , which is located in cell membranes . the active transport of carnitine into tissue takes place against a concentration gradient , permitting tissue carnitine concentrations to be 20- to 50-fold higher than plasma levels . the sequence of the 557 amino acids of the carnitine transporter is encoded on chromosome 5q31.2 - 32 . in case of carnitine transporter deficiency ( omim 212120)inherited as an autosomal recessive trait carnitine is lost in considerable amounts via urine ; the body becomes depleted of carnitine . as a consequence , impaired oxidation of long chain fatty acids leads to deficient energy generation as well as reduced ketogenesis during fasting , and accumulation of lipids in liver and muscle . the most severe presentation can lead to sudden infant death syndrome ( sids ) already in the neonatal period . mean age of presentation with reye - like manifestations as hypoketotic hypoglycemic encephalopathy is between one month and a maximum of 5 years with an estimated median of 1.5 years . the metabolic deterioration is usually triggered by prolonged fasting , reduced oral intake , or vomiting during viral illness . those who survive critical illness suffer from recurrent episodes of encephalopathy if the defect is not diagnosed and no carnitine supplementation is given . later in life , the disorder can present with skeletal muscle disease causing muscular hypotonia with mild motor delay.progressive cardiomyopathy in late infancy or early childhood ( usually between 1 and 7 years of age , median 3 years ) leads to dilatative cardiomyopathy with greatly reduced left ventricular ejection fraction , abnormal t - waves , and signs of ventricular hypertrophy [ 128 , 129 ] . sometimes no overt cardiomyopathy , but only mild interventricular septum hypertrophy , does occur . if no carnitine replacement is given , progressive congestive heart failure may lead to death . a 15-year - old girl was diagnosed with cardiac arrest due to ventricular fibrillation without overt cardiomyopathy . ecg showed nonsustained ventricular tachycardia with periods of sinus rhythm and ventricular premature beats , while echocardiography revealed normal left ventricular dimensions and a borderline left ventricular hypertrophy with good contractility .nicola longo ( personal communication ) stated that many of the patients who die suddenly with primary carnitine deficiency do not have cardiomyopathy ( beyond childhood ) , but only sudden arrhythmias . adult - onset lipid storage myopathy presenting with myalgia and muscular fatigue during prolonged exercise could be shown to be caused by primary carnitine deficiency . symptoms and abnormalities in muscle biopsy improved tremendously after four months of oral therapy with carnitine supplementation .asymptomatic courses are known as well : spiekerkoetter et al . reported a 28-year - old man diagnosed with ctd , based on a positive family history with disease manifestation in one of his sons . four asymptomatic mothers were discovered to have ctd when being examined for low carnitine found by neonatal screening in blood spots of their offspring .patients with identical mutations can have different age of onset and different type of clinical presentation . we are aware of at least 4 young adults from the faroe islands who showed this course ( unpublished data ) . the most severe presentation can lead to sudden infant death syndrome ( sids ) already in the neonatal period . mean age of presentation with reye - like manifestations as hypoketotic hypoglycemic encephalopathy is between one month and a maximum of 5 years with an estimated median of 1.5 years . the metabolic deterioration is usually triggered by prolonged fasting , reduced oral intake , or vomiting during viral illness . those who survive critical illness suffer from recurrent episodes of encephalopathy if the defect is not diagnosed and no carnitine supplementation is given . later in life , the disorder can present with skeletal muscle disease causing muscular hypotonia with mild motor delay . progressive cardiomyopathy in late infancy or early childhood ( usually between 1 and 7 years of age , median 3 years ) leads to dilatative cardiomyopathy with greatly reduced left ventricular ejection fraction , abnormal t - waves , and signs of ventricular hypertrophy [ 128 , 129 ] . sometimes no overt cardiomyopathy , but only mild interventricular septum hypertrophy , does occur . if no carnitine replacement is given , progressive congestive heart failure may lead to death . a 15-year - old girl was diagnosed with cardiac arrest due to ventricular fibrillation without overt cardiomyopathy . ecg showed nonsustained ventricular tachycardia with periods of sinus rhythm and ventricular premature beats , while echocardiography revealed normal left ventricular dimensions and a borderline left ventricular hypertrophy with good contractility . nicola longo ( personal communication ) stated that many of the patients who die suddenly with primary carnitine deficiency do not have cardiomyopathy ( beyond childhood ) , but only sudden arrhythmias . adult - onset lipid storage myopathy presenting with myalgia and muscular fatigue during prolonged exercise could be shown to be caused by primary carnitine deficiency . symptoms and abnormalities in muscle biopsy improved tremendously after four months of oral therapy with carnitine supplementation . reported a 28-year - old man diagnosed with ctd , based on a positive family history with disease manifestation in one of his sons . four asymptomatic mothers were discovered to have ctd when being examined for low carnitine found by neonatal screening in blood spots of their offspring . patients with identical mutations can have different age of onset and different type of clinical presentation . we are aware of at least 4 young adults from the faroe islands who showed this course ( unpublished data ) . diagnostic options in ctdlaboratory hallmarks of ctd are very low free plasma carnitine concentrations ( lower than 10 mol / l ) and increased fractional excretion of carnitine in urine . during decompensation , transaminases and ammonia may be moderately elevated , and metabolic acidosis , prolonged prothrombin time , and elevated ck do occur.final confirmation of the diagnosis can be done by showing low activity of the transporter with decreased carnitine uptake in fibroblasts . laboratory hallmarks of ctd are very low free plasma carnitine concentrations ( lower than 10 mol / l ) and increased fractional excretion of carnitine in urine . during decompensation , transaminases and ammonia may be moderately elevated , and metabolic acidosis , prolonged prothrombin time , and elevated ck do occur . final confirmation of the diagnosis can be done by showing low activity of the transporter with decreased carnitine uptake in fibroblasts . therapeutic options in ctdthe treatment of ctd is easy and without severe adverse reaction apart from a strange fish - like body odour . carnitine is supplemented in a dose of 50200 mg per kg body weight and day given in at least three portions . the treatment of ctd is easy and without severe adverse reaction apart from a strange fish - like body odour . carnitine is supplemented in a dose of 50200 mg per kg body weight and day given in at least three portions . pathophysiologythe respiratory chain is responsible for the aerobic energy generation from different substrates like fatty acids , glucose , and amino acids . electrons from the reduction equivalents nadh and fadh2 enter the respiratory chain via complex i and complex ii , respectively . flow of electrons leads to the generation of an electrochemical proton gradient across the inner mitochondrial membrane as protons are pumped out of the mitochondrial matrix . this gradient can be directly used , for example , for the transport of charged substances ( e.g. , atp - adp exchange ) . on the other hand it can be used to drive the atpsynthase ( complex v ) reaction which dissipates the proton gradient across the inner mitochondrial membrane . the mitochondrial atpsynthase has been shown to be actively regulated both in heart and in skeletal muscle . some 80 mitochondrial proteins are present in the mitochondrium , 13 of these are encoded on the mitochondrial dna . some subunits from complexes i , iii , iv , and v are encoded on the mitochondrial dna while other subunits from complexes i v are nuclear - encoded . as mitochondrial dna is inherited from the mother , respiratory chain defects due to mutations in the mitochondrial dna follow a maternal pattern of inheritance . mitochondrial dna encodes both trna involved in protein synthesis and genes responsible for the generation of subunits of respiratory chain complexes . nuclear - encoded mutations are inherited as an autosomal - recessive trait.most of the cells contain several mitochondria ; each mitochondrium harbours up to 10 copies of mitochondrial dna . mutations in mitochondrial dna normally do not affect all dna of one cell and not all cells of one organ but there is a mixture of healthy and diseased cells ( heteroplasmy ) . the relative distribution between both subsets can vary during life ; the course of changes is unpredictable . deleted dna may replicate faster due to shortened dna , leading to a shift towards mutated dna . once a threshold is reached , clinical symptoms develop ( depending on the organ involved ) . this also explains the high variability of clinical symptoms and lack of genotype - phenotype correlation . highly specialized cells , like mature erythrocytes , do not contain mitochondria and are therefore spared from mitochondrial dysfunction ; however immature forms of these cells may be affected.mitochondrial dysfunction leads to a lack of energy in aerobic tissues and production of possibly toxic free radicals which finally may induce apoptosis [ 138 , 139 ] . mitochondria are not only responsible for energy generation , but are able to take up and release calcium , thus regulating calcium homeostasis . the respiratory chain is responsible for the aerobic energy generation from different substrates like fatty acids , glucose , and amino acids . electrons from the reduction equivalents nadh and fadh2 enter the respiratory chain via complex i and complex ii , respectively . flow of electrons leads to the generation of an electrochemical proton gradient across the inner mitochondrial membrane as protons are pumped out of the mitochondrial matrix . this gradient can be directly used , for example , for the transport of charged substances ( e.g. , atp - adp exchange ) . on the other hand it can be used to drive the atpsynthase ( complex v ) reaction which dissipates the proton gradient across the inner mitochondrial membrane . the mitochondrial atpsynthase has been shown to be actively regulated both in heart and in skeletal muscle . some 80 mitochondrial proteins are present in the mitochondrium , 13 of these are encoded on the mitochondrial dna . some subunits from complexes i , iii , iv , and v are encoded on the mitochondrial dna while other subunits from complexes i v are nuclear - encoded . as mitochondrial dna is inherited from the mother , respiratory chain defects due to mutations in the mitochondrial dna follow a maternal pattern of inheritance . mitochondrial dna encodes both trna involved in protein synthesis and genes responsible for the generation of subunits of respiratory chain complexes . most of the cells contain several mitochondria ; each mitochondrium harbours up to 10 copies of mitochondrial dna . mutations in mitochondrial dna normally do not affect all dna of one cell and not all cells of one organ but there is a mixture of healthy and diseased cells ( heteroplasmy ) . the relative distribution between both subsets can vary during life ; the course of changes is unpredictable . deleted dna may replicate faster due to shortened dna , leading to a shift towards mutated dna . once a threshold is reached , clinical symptoms develop ( depending on the organ involved ) . this also explains the high variability of clinical symptoms and lack of genotype - phenotype correlation . highly specialized cells , like mature erythrocytes , do not contain mitochondria and are therefore spared from mitochondrial dysfunction ; however immature forms of these cells may be affected . mitochondrial dysfunction leads to a lack of energy in aerobic tissues and production of possibly toxic free radicals which finally may induce apoptosis [ 138 , 139 ] . mitochondria are not only responsible for energy generation , but are able to take up and release calcium , thus regulating calcium homeostasis . clinical featuresbased on the central role of energy generation within cells , almost all organs may be affected by respiratory chain disorders . organs showing a high rate of aerobic energy metabolism are often compromised first by respiratory chain disorders . skeletal and heart muscle are frequently affected . the first description of a mitochondrial myopathy was by luft et al . , in a patient with increased thermogenesis in response to muscle exercise and ultrastructural abnormalities of mitochondria . this patient presumably had loose coupling between mitochondrial atp production on one hand and flux of electrons across the respiratory chain on the other hand . in the late 1980s and early 1990s , more and more patients with mitochondriopathies due to mitochondrial dysfunction were reported.skeletal muscle dysfunction mostly presents as exercise intolerance ; rarely pain is reported . there may be either isolated myopathy or a more complex disease with multisystemic manifestations.cardiac manifestations are limited exercise capacity , overt heart failure in later stages accompanied by lung oedema and hypertrophic cardiomyopathy ; sometimes arrhythmias are the dominating feature . echocardiography shows heart hypertrophy , sometimes dilatative cardiomyopathy , decreased shortening fraction , and often diastolic dysfunction . the latter is caused by incomplete ( energy - dependent ) uptake of calcium from the cytosol to the sarcoplasmic reticulum and mitochondria . the ecg may occasionally resemble infarction as this is also accompanied by energy depletion ( in the case of infarction due to lack of oxygen).frequently , other organs are compromised by mitochondriopathy and nonmuscular features like epilepsy , stroke , and so forth , may predominate . the terms kearns - sayre syndrome , mitochondrial encephalopathy , lactic acidosis , and stroke - like episodes ( melass ) , as well as leber 's hereditary optic neuropathy ( lhon ) were coined and shown to be due to mutations in the mitochondrial dna . however , this is rarely helpful in the diagnosis or treatment due to the large variability of clinical symptoms in one single mutation . based on the central role of energy generation within cells , almost all organs may be affected by respiratory chain disorders . organs showing a high rate of aerobic energy metabolism are often compromised first by respiratory chain disorders . skeletal and heart muscle are frequently affected . the first description of a mitochondrial myopathy was by luft et al . , in a patient with increased thermogenesis in response to muscle exercise and ultrastructural abnormalities of mitochondria . this patient presumably had loose coupling between mitochondrial atp production on one hand and flux of electrons across the respiratory chain on the other hand . in the late 1980s and early 1990s , . there may be either isolated myopathy or a more complex disease with multisystemic manifestations . cardiac manifestations are limited exercise capacity , overt heart failure in later stages accompanied by lung oedema and hypertrophic cardiomyopathy ; sometimes arrhythmias are the dominating feature . echocardiography shows heart hypertrophy , sometimes dilatative cardiomyopathy , decreased shortening fraction , and often diastolic dysfunction . the latter is caused by incomplete ( energy - dependent ) uptake of calcium from the cytosol to the sarcoplasmic reticulum and mitochondria . the ecg may occasionally resemble infarction as this is also accompanied by energy depletion ( in the case of infarction due to lack of oxygen ) . frequently , other organs are compromised by mitochondriopathy and nonmuscular features like epilepsy , stroke , and so forth , may predominate . the terms kearns - sayre syndrome , mitochondrial encephalopathy , lactic acidosis , and stroke - like episodes ( melass ) , as well as leber 's hereditary optic neuropathy ( lhon ) were coined and shown to be due to mutations in the mitochondrial dna . however , this is rarely helpful in the diagnosis or treatment due to the large variability of clinical symptoms in one single mutation . diagnosiscreatinekinase ( ck ) activity may often be elevated in plasma as an unspecific finding . lactate concentration in blood reflecting a compensatory increase in flux of anaerobic glycolysis may be elevated ( normal : lactate / pyruvate ratio reflects cytoplasmic nadh / nad ratio and may be increased ( normal : less than 20 ) in defects of respiratory chain complexes i v . however , if only single organs are affected , lactate levels as well as lactate / pyruvate ratio in blood may be normal . diagnostic accuracy of the lactate / pyruvate ratio in blood has been shown to increase with higher lactate concentrations . in response to oral carbohydrates , if cytosolic nadh / nad levels remain normal as in pyruvatedehydrogenase deficiency , lactate / pyruvate ratio in blood is normal . as many metabolic pathways have an effect on lactate and pyruvate metabolism , lactate / pyruvate ratios may easily fluctuate and may be unreliable . if determined in tissue cultures the reliability of the lactate / pyruvate ratio increases [ 143 , 144 ] ) . the ketone body ratio ( -hydroxybutyrate / acetoacetate ) reflects the intramitochondrial nadh / nad ratio and may be increased in respiratory chain defects . dicarboxylic aciduria reflecting secondary inhibition of fatty acid oxidation ( by accumulating nadh and fadh ) may be observed . ethylmalonic acid and 3-methylglutaconic acid excretion provide indirect evidence for mitochondrial dysfunction.muscle biopsy is an important diagnostic tool . the number of type i muscle fibres ( red ) may be compensatorily elevated . ragged red fibres seen on a modified gomorri trichrome stain are the hallmark of mitochondrial disease , however these are not obligatory . the classic electron microscopic findings are paracrystalline inclusions , crystals consisting of mitochondrial creatinekinase.muscle enzymology is the next biochemical step in the diagnostic work - up . activities of respiratory chain complexes can be assayed either in a group of 2 enzymes or as single enzyme activities . we have shown that the mitochondrial atpsynthase ( complex v ) is regulated both in rat heart and in human skeletal muscle in response to energy demand . we therefore advocate measurement of respiratory chain enzymes in fresh muscle preparations , as freezing leads to the disruption of the inner mitochondrial membrane . using this technique , we have shown that secondary downregulation of atpsynthase ( complex v ) occurs in response to reduced electron flow across complexes i iv . for example , limb immobilisation has been shown to lead to downregulation of mitochondrial pathways .the heteroplasmic nature of most pathogenic mitochondrial dna mutations makes genetic diagnosis difficult . mitochondrial depletion syndromes may be identified which are characterized by a reduction in mitochondrial dna copy number . some of these show myopathy , together with other organ manifestations.in fresh , permeabilized muscle , respirometry can be performed using a clark - type electrode . by using different inhibitors of the respiratory chain - enzymes and uncouplers , the rate - limiting step of respiration can be pinpointed [ 150 , 151].using p mrs , reduction of the ratio of phosphocreatine / inorganic phosphate can be detected , while atp - levels are normal , phosphocreatine depletion during exercise is larger than normal , and the recovery rate of phosphocreatine after exercise is typically reduced .mutation analysis may be performed . both mutations of the nuclear gene and the mitochondrial gene have been reported ( see above ) . creatinekinase ( ck ) activity may often be elevated in plasma as an unspecific finding . lactate concentration in blood reflecting a compensatory increase in flux of anaerobic glycolysis may be elevated ( normal : lactate / pyruvate ratio reflects cytoplasmic nadh / nad ratio and may be increased ( normal : less than 20 ) in defects of respiratory chain complexes i v . however , if only single organs are affected , lactate levels as well as lactate / pyruvate ratio in blood may be normal . diagnostic accuracy of the lactate / pyruvate ratio in blood has been shown to increase with higher lactate concentrations . in response to oral carbohydrates , if cytosolic nadh / nad levels remain normal as in pyruvatedehydrogenase deficiency , lactate / pyruvate ratio in blood is normal . as many metabolic pathways have an effect on lactate and pyruvate metabolism , lactate / pyruvate ratios may easily fluctuate and may be unreliable . if determined in tissue cultures the reliability of the lactate / pyruvate ratio increases [ 143 , 144 ] ) . the ketone body ratio ( -hydroxybutyrate / acetoacetate ) reflects the intramitochondrial nadh / nad ratio and may be increased in respiratory chain defects . dicarboxylic aciduria reflecting secondary inhibition of fatty acid oxidation ( by accumulating nadh and fadh ) may be observed . . the number of type i muscle fibres ( red ) may be compensatorily elevated . ragged red fibres seen on a modified gomorri trichrome stain are the hallmark of mitochondrial disease , however these are not obligatory . activities of respiratory chain complexes can be assayed either in a group of 2 enzymes or as single enzyme activities . we have shown that the mitochondrial atpsynthase ( complex v ) is regulated both in rat heart and in human skeletal muscle in response to energy demand . we therefore advocate measurement of respiratory chain enzymes in fresh muscle preparations , as freezing leads to the disruption of the inner mitochondrial membrane . using this technique , we have shown that secondary downregulation of atpsynthase ( complex v ) occurs in response to reduced electron flow across complexes i iv . for example , limb immobilisation has been shown to lead to downregulation of mitochondrial pathways . mitochondrial depletion syndromes may be identified which are characterized by a reduction in mitochondrial dna copy number . some of these show myopathy , together with other organ manifestations . in fresh , permeabilized muscle , respirometry can be performed using a clark - type electrode . by using different inhibitors of the respiratory chain - enzymes and uncouplers , the rate - limiting step of respiration can be pinpointed [ 150 , 151 ] . using p mrs , reduction of the ratio of phosphocreatine / inorganic phosphate can be detected , while atp - levels are normal , phosphocreatine depletion during exercise is larger than normal , and the recovery rate of phosphocreatine after exercise is typically reduced . both mutations of the nuclear gene and the mitochondrial gene have been reported ( see above ) . treatmentmanagement and support in a multidisciplinary team should be offered to patients and their families . seizure - control by antiepileptic drugs ( valproic acid should be generally avoided , phenobarbital should be avoided in complex i deficiency ) and control of diabetes by insulin are only few examples . a positive energetic balance is desirable ; fast carbohydrates should be avoided as this may lead to excessive lactic acidosis.many single substances have been tried with the rationale of bypassing defective pathways , increasing residual enzyme activities , or having an antioxidant function . for example , succinate has been used to bypass deficient complex i activity , vitamin c and vitamin k may bypass deficient complex iii , while vitamin e , alphalipoic acid , and coenzyme q10 have been advocated as antioxidants . however , a recent cochrane review has stated that none of these as well as other forms of cofactor therapy have been shown to be of any benefit . only coenzyme q10 had a positive effect in patients presumably suffering from a disorder in coenzyme q10 metabolism . relatively high doses of 2.3 mg / kg per day are required.ketogenic diet has a remarkable effect on cns - symptoms in pdh - deficiency but has also been tried in complex i deficiency.certain drugs inhibiting mitochondrial protein synthesis , like tetracyclines and chloramphenicol , should be avoided . management and support in a multidisciplinary team should be offered to patients and their families . seizure - control by antiepileptic drugs ( valproic acid should be generally avoided , phenobarbital should be avoided in complex i deficiency ) and control of diabetes by insulin are only few examples . a positive energetic balance is desirable ; fast carbohydrates should be avoided as this may lead to excessive lactic acidosis . many single substances have been tried with the rationale of bypassing defective pathways , increasing residual enzyme activities , or having an antioxidant function . for example , succinate has been used to bypass deficient complex i activity , vitamin c and vitamin k may bypass deficient complex iii , while vitamin e , alphalipoic acid , and coenzyme q10 have been advocated as antioxidants . however , a recent cochrane review has stated that none of these as well as other forms of cofactor therapy have been shown to be of any benefit . only coenzyme q10 had a positive effect in patients presumably suffering from a disorder in coenzyme q10 metabolism . ketogenic diet has a remarkable effect on cns - symptoms in pdh - deficiency but has also been tried in complex i deficiency . certain drugs inhibiting mitochondrial protein synthesis , like tetracyclines and chloramphenicol , should be avoided . recently , sudden cardiac death has been reported in a child with muscle - specific glycogen synthase deficiency . in horses , but so far not in humans gain of function mutations of glycogen synthase leading to myopathy has been found . reduced activity of the phosphorylase kinase , which is needed for glycogen breakdown , has been reported to lead to mild myopathy [ 154 , 155 ] . inhibition of the glycolytic pathway at the level of triosephosphate isomerase , phosphoglycerate kinase , phosphoglycerate mutase , and enolase has been described to lead to myopathy with exercise - induced muscle cramps and myoglobinuria . malignant hyperthermia is due to mutations in the ryanodine receptor leading to defects in calcium homeostasis triggered by certain anaesthetic compounds [ 160162 ] . some neuromuscular diseases are known to be associated with an increased risk of malignant hyperthermia if triggering substances are used for anaesthesia . testing for malignant hyperthermia may be performed by the caffeine halothane contracture test or by looking for mutations of the ryanodine receptor gene . as the gene is large and many different mutations are found , it is often safer , faster , and less expensive to perform the caffeine halothane contracture test . it is often more practical to simply avoid anaesthetic compounds that trigger malignant hyperthermia , rather than doing the contracture test . an increased risk for malignant hyperthermia has been discussed in several disorders of energy metabolism like cpt2 deficiency , respiratory chain defects [ 164 , 165 ] , and mcardle disease . though no firm correlation between inborn errors of energy metabolism and malignant hyperthermia has been established , it is probably wise to avoid triggering substances in these patients . furthermore , inhalative anaesthetic agents have been reported to interfere with nadh - linked respiratory chain function . inhibition of the respiratory chain could lead to free radical generation which may mediate lipid peroxidation in cellular membranes , thus inducing calcium efflux from cell organelles which results in malignant hyperthermia . psychosocial problems may be another feature in myopathies due to defects in energy metabolism , as more and more patients with inborn errors of metabolism reach adulthood . inherited neuromuscular disorders affect about one in 3,500 children , with duchenne muscular dystrophy being the most common disease . to our knowledge , there are no studies on quality of life , and psychosocial problems in patients with myopathies based on compromised energy metabolism . however , studies on the special needs , quality of life and psychosocial problems in boys / men with duchenne muscular dystrophy have been published [ 169 , 170 ] . obviously , inborn errors of energy metabolism are different from duchenne muscular dystrophy where the physical handicap is enormous . however , it has been shown that quality of life is not correlated with physical handicap in duchenne muscular dystrophy . further studies are required but may be difficult due to the rarity and high clinical variability of metabolic myopathies . fatty acids are the main fuel for energy metabolism in heart and skeletal muscle . in the initial anaerobic phase of skeletal muscle contraction , there are many inborn errors of energy metabolism leading to myopathies which have to be taken into account in the diagnostic work - up . these concern fatty acid oxidation , glycogen metabolism , as well as the final common pathway , the mitochondrial respiratory chain . for most of the different metabolic disorders , therefore , a metabolic work - up is mandatory in myopathies ( skeletal myopathy as well as cardiomyopathy ) of unknown origin .
inherited neuromuscular disorders affect approximately one in 3,500 children . structural muscular defects are most common ; however functional impairment of skeletal and cardiac muscle in both children and adults may be caused by inborn errors of energy metabolism as well . patients suffering from metabolic myopathies due to compromised energy metabolism may present with exercise intolerance , muscle pain , reversible or progressive muscle weakness , and myoglobinuria . in this review , the physiology of energy metabolism in muscle is described , followed by the presentation of distinct disorders affecting skeletal and cardiac muscle : glycogen storage diseases types iii , v , vii , fatty acid oxidation defects , and respiratory chain defects ( i.e. , mitochondriopathies ) . the diagnostic work - up and therapeutic options in these disorders are discussed .
a or 1 raw milk is an spc value less than 1.0 10cfu / ml . cooling of raw milk to less than 6c ( typically 3 to 4c in the farm tank following milking ) , followed by storage at temperatures below 6c during transportation to the dairy plant , ensures the quality of raw milk . because milk is a highly suitable growth medium , many bacterial genera have adapted to this cold - temperature environment by producing exoenzymes ( such as proteases or lipases ) that can withstand the typical heat treatments milk is subjected to , and they consequently cause significant economic loss to the dairy industry [ 25 ] . psychrotrophic bacteria ( able to grow at temperatures ranging from 0c to 7c ) are well known for their ability to degrade both raw and processed milk components which may explain why raw milk psychrotrophs are mainly considered for their spoilage features , with some exceptions like the human pathogens bacillus cereus ( toxin - producing strains ) , or listeria monocytogenes . most genera in psychrotrophic communities are gram - negative and are generally considered to be benign bacteria . recently , gram - negative bacteria have come under higher scrutiny worldwide because many genera host species considered as human opportunistic pathogens , which may have antibiotic multiresistant - traits , and infections due to those species may eventually be untreatable [ 9 , 10 ] . antibiotic resistance ( ar ) is a consequence of antibiotic ( ab ) use , overuse , and misuse ; ab administered to animals used for food products is an important source of antimicrobial - resistant bacteria that can spread to humans through the food supply [ 1114 ] . the distribution spectrum and magnitude of the ar gene pool in food - borne pathogens is alarming . recent studies have concluded that large ar gene pools are present in commensal bacteria in many ready - to - eat products and implicated food production and processing environments in the evolution and dissemination of ar [ 15 , 16 ] . the demonstration of the presence of transmissible ar genes in the human food chain was earlier made ; thus , food can be considered to be a direct source of ar genes that is consumed daily . many studies have determined the prevalence of ar among mastitis pathogens [ 18 , 19 ] , several compared the ar of conventional and organic dairy farming practices [ 20 , 21 ] , and others have determined the prevalence of ar among gram - negative enteric bacteria in bulk milk tanks , or mastitis milk samples . however , little is known regarding the ar of raw milk - spoiling psychrotrophs . a phenotypic - based study indicated representatives of pseudomonas , acinetobacter , and stenotrophomonas , and the 16srdna gene sequences confirmed the identity of some isolates categorized in more risky genera ( unpublished data ) . we investigated the ar of some isolates and observed that multiple ar was rather common , and its incidence increased during the cold chain of raw milk storage and transportation : moreover , a constant increase in ar for isolates originating from farms , lorries , or silos was observed for the following abs : ticarcillin , aztreonam , cefepime , ofloxacin , and trimethoprim - sulfamethoxazole ; bacterial isolates from milk stored in silos more frequently exhibited resistance to clavulonic ticarcillin - clavulanic acid , ceftazidim , imipenem , colistin , gentamicin , and ofloxacin compared with farm isolates ; unfortunately this study considered independent samples . to further investigate whether the cold storage of raw milk promotes an increase in ar traits , we evaluated the ar of total mesophilic and psychrotrophic populations of raw milk stored at 4 or 6c as function of time and examined the effects of temperature and time upon the ar . to account for low initial bacterial counts ( a typical characteristic of high quality farm milk ) and variations between milk from different farms more likely to be reflecting individual farm management practices , we studied commingled milk samples withdrawn from lorry tanks that constitute somehow an intermediate stage of the cold chain of raw milk storage and transportation . all raw bovine milk samples were obtained from lorry tanks of the valio ltd dairy company ( helsinki , finland ) . representative samples of the lorry contents were collected in sterile bottles , by licensed milk haulers shortly after the lorries arrived at the dairy . the samples were then kept on ice until arrival at helsinki university , at which time 100 ml aliquots were added to sterile 250 ml bottles . six bottles were placed on a multiplace magnetic stirrer ( variomag ) and partially immersed in a refrigerated water bath ( mgw lauda ms/2 ) , which allowed a constant temperature ( monitored by an immersion thermostat ) to be maintained ( modified from ) . the raw milk was continuously mixed at 220 rpm and kept at 4 0.1c or 6 0.1c for 4 days . all bacterial counts were determined from triplicate or quadruplicate agar cultures at days 0 ( shortly after receiving the samples ) and 4 for experiments i ( 4c ) and ii ( 6c ) , and at days 2 and 4 for experiment iii ( 4c ) , ( table 1 ) by aseptically removing 500 l of raw milk , serially diluting the sample in a saline solution ( 0.85% nacl ) , and spreading 50 l on mueller - hinton ( labm ) agar . four antimicrobial agents ( gentamicin ( g ) , ceftazidim ( c ) , levofloxacin ( l ) , and trimethoprim - sulfamethoxazole ( ts at a ratio of 1/19 ) ( sigma ) ) were prepared according to the eucast guidelines . the ab solutions were freshly prepared by dissolving powders in the following solvents : water for g , 0.1 m phosphate buffer ( ph 7 ) for c , 0.1 m naoh for l , 0.1 m lactic acid for t , and 95% ethanol for s ( eucast 2000 ) . with the exception of s , all ab solutions were filter sterilized , prior to the addition to adequately cooled agar . the ab concentrations were 16 mg / l for gi , 4 mg / l for gii , 32 mg / l for ci , 8 mg / l for cii , 8 mg / l for li , 2 mg / l for lii , 8 mg / l trimethoprim with 152 mg / l sulfomethoxazole for tsi , and 4 mg / l trimethoprim with 76 mg / l sulfomethoxazole for tsii , which correspond to the mics ( gii , cii , lii , and tsii ) to 4-fold the mic ( gi , ci , li ) , or 2-fold the mic ( tsi ) as indicated by eucast for pseudomonads . agar plates were stored overnight at 4c and protected from light . following initial analysis , the plates were incubated for 2 - 3 days at 30c or for 10 days at 7c to enumerate the the first was ar prevalence , which is generally defined as the percentage of resistant bacteria considering the corresponding total bacteria enumerated in the same conditions , and the second was rapd which was used to overcome perturbations due to excessive low versus high bacterial counts and variation among plates . rapd is defined for a particular condition x and characterized by a combination of factors including population type ( psychrotrophs ( p ) or mesophiles ( m ) ) , sampling day ( d = 0 , 2 or 4 ) , storage temperature , ab type , and ab concentration . rapd corresponds to the number of bacterial colonies ( cfu / ml ) in a certain condition ( determined by a combination of the previous listed factors ) divided by the total number of bacteria on the corresponding control plates ( in the absence of the ab ) . to overcome variation between raw milk samples , which was mainly due to the initial microflora , statistical analyses were based on the rank of the rapd instead of the rapd itself . the use of the ranking enabled a more robust quantification of the ar regardless of the variation among the four considered factors ( milk storage temperature and time , as well as ab type and concentration ) . the reliability of the results was determined by robust anova and nonparametric statistics which are suited for analyses of heterogeneous data such as microbiological data . ( 1 ) in a view of a simple description of data , usual statistical tools ( usts ) for mean , standard deviation , median , and box - and - whiskers - plots were generally used to represent bacterial enumeration ( expressed as cfu / ml or in decimal log - units ) . ( 2 ) in a view to improve the robustness of the conclusions on ranked data , analysis of variance ( anova ) on rapd ranks as a function of the studied factors ( milk storage temperature and time as well as ab type and concentration ) was used to detect significantly influential factors ( main effects or interaction effects ) . in the anova framework , it is common to make multiple comparisons of means . here , the ryan - einot - gabriel - welsch ( regw ) test for multiple comparisons of ratio means was used . ( 3 ) nonparametric statistics ( npss ) , including wilcoxon , kruskal - wallis , median two - sample , and van der waerden tests , were used . these analyses were performed using the npar1way procedure of the sas / stat statistical software ( version 8.1 ) of the sas institute ( nc , usa ) . the objective of these tests was to confirm or infirm statistically significant change of the rap4 versus rap0 means ( rapd , defined for one condition considering a combination of factors set at a particular level ) . for ust , the ar percentages were used to compare the number of mesophiles ( or total counts ) with psychrotrophs , respectively . the microbiological quality of the 18 analyzed raw milk samples was excellent : 17 of 18 samples had initial bacterial counts less than 5.0 10 cfu / ml ( 4.7 in decimal log - units ) ( table 1 ) . at day 0 , the psychrotrophs/total counts ratios were lower than 0.9 in eight samples and higher than 0.9 in ten samples ( table 1 ) . no correlation between the initial total bacterial load and the fraction of psychrotrophs present in raw milk samples was detected . assuming that a higher ratio value corresponds to milk that spent more time in cold storage conditions , we estimate that the raw milk samples were subjected to the ar for each ab and population type is summarized in figures 1 and 2 . for the majority of the samples analyzed shortly after reception , higher ar percentages with larger box boundaries were observed with lower ab concentrations regardless of the ab type , which is indicative of an ab - concentration - dependent response ( figures 1 and 2 ) . with some exceptions , mesophilic populations ( m ) had ar percentages with gentamycin ( g ) of 0%3% ( gim ) and 1.1%9% ( giim ) ( figure 1(a ) ) . the psychrotrophic populations ( p ) were more heterogeneous and exhibited slightly lower resistance to gip ( 0%2% ) than giip ( 0%30% ) . the ar prevalence to ceftazidim was higher than for the other tested abs and was highest for the psychrotrophic populations on cii ( figure 1(b ) ) ; although the median values of cip and cim , and of ciip and ciim , showed only minor differences , the psychrotrophic populations had more heterogeneity in ar prevalence , especially for the lower ceftazidim concentration ( cii ) . approximately one - fourth of the samples had ar percentages of 50%100% , and 38%50% for ciip and ciim , respectively . ar to levofloxacin ( l , figure 1(c ) ) was the least prevalent among the considered antibiotics at both concentrations but was moderately higher for mesophiles than for psychrotrophs . the prevalence of ar to trimethoprim - sulfamethoxazole ( ts , figure 1(d ) ) was higher for the psychrotrophs ( p ) than mesophiles ( m ) as indicated by the median values and boundaries of the box plots . the percentages of ar observed with high ab concentrations were less than those observed at low ab concentrations for all mesophilic populations and for 13 of 18 psychrotrophic populations . ab - concentration - dependent responses were apparent when considering the boundaries of the box - and - whiskers plots depicting the total ar percentages , comparing i m and iim with ip and iip ( mesophiles ( m ) or psychrotrophs ( p ) , present on plates with high ( i ) or low ( ii ) antibiotic concentrations ) ( figure 2 ) . the median value observed for the psychrotrophs ( ip ) exceeded by 10% the value of the mesophiles ( i m ) with the highest ab concentrations ; the 75th percentiles had ar maximums of 70% ( ip ) and 52% ( i m ) ; the top quartiles were comprised between 45% and 70% , 40% , and 50% for the psychrotrophs ( ip ) and mesophiles ( i m ) , respectively . the distribution of ar in the mesophiles was more homogeneous than in the psychrotrophs : half of the samples had total resistance percentages ranging from 50% through 100% ( i m ) and 30% through 130% ( ip ) . although the median value was slightly greater than 40% for both types of populations , with the low antibiotic concentrations half of the samples had total ar of 20% to 90% ( iip ) and 30% to 60% ( iim ) ( figure 2 ) . the 75th interquartile had ar of 90%135% ( psychrotrophs ) and 60%90% ( mesophiles ) , respectively . the total percentages of ar ( evaluated using four abs , regardless of concentration ) never exceeded 100% for the mesophilic populations , contrarily to psychrotrophic populations present in four milk samples . this result could be indicative of a higher prevalence of multiresistant bacteria among psychrotrophs than mesophiles . a link between total initial counts , the psychrotrophs/total counts ratios , and the number of encountered ar fractions among psychrotrophs versus mesophiles in a given raw milk sample is not apparent . for example , sample 8 had low initial counts and a low psychrotrophs / mesophiles ratio but revealed the highest ar for the psychrotrophs , which greatly exceeded the ar of the corresponding mesophiles . ( the time that elapsed between milking and the time of analyses which could be somehow estimated from ratios of psychrotrophs / mesophiles ) but rather more dependent on the initial bacterial microflora . the mean values of the rap0 ratios determined at day 0 were 0.2396 and 0.3448 ( c ) , 0.0544 and 0.0676 ( g ) , 0.0485 and 0.0939 ( ts ) , and 0.0171 and 0.0086 ( l ) for the mesophiles and psychrotrophs , respectively . regardless of the bacterial population type , ar was most prevalent for c and least for l. with the exception of l , all mean rap0 values analyzed with the regw test for psychrotrophs were superior to those observed for mesophiles which confirmed previous observations ( section 2.1 ) . anova performed on rap0 and on rap0 rank ( see rap0 definition in section 2 ) revealed significant main effects for the mesophiles . 0.0001 ) were 82.73 , 176.95 , and 40.27 for storage temperature , ab type , and ab concentration , respectively . the effects due to ab type and the interaction between storage temperature and ab type were partially sample dependent . the regw range test for rap0 considered the four abs distinct , but the effects of l and ts were similar . to overcome perturbations due to sample 1 , which was considered different ( highest rap0 mean value ) , a second regw range test was performed for rap0 after eliminating the sample 1 ; the test confirmed the importance of the considered factors . 0.0001 ) were 20.22 , 108.96 , and 20.14 for storage temperature , ab type , and concentration , respectively , for samples 26 . both approaches confirmed the ranking of the abs according to their decreasing prevalence : c , g , ts , and l. the ar for psychrotrophs was more sample dependent ( f value of 18.35 , p < 0.0001 ) . a significant difference was observed for the four abs ( f value of 68.84 , p < 0.0001 ) , and significant interactions between storage temperature and sample ( f value of 15.31 ) were detected . unlike the mesophiles , the encountered variability relied on a high sample / temperature interaction . the regw multiple range test ranked c and l in the 1st and 4th positions , respectively , in ar prevalence for both mesophiles and psychrotrophs . g and ts were ranked in 2nd and 3rd position , respectively , for the mesophiles ; the rankings were reversed for the psychrotrophs where the ar to ts was the second most prevalent . the analyses considered the four abs distinct , although ts and l induced similar ar levels for the mesophiles , whereas ts and g induced similar ar levels for the psychrotrophs . figure 3(a ) depicts the trend of ceftazidim - resistant psychrotrophs ( ci ) which nearly parallels the total psychrotrophic population in raw milk sample ( 13 ) ; the differences were approximately 0.7 , 1 , and up to 2 log - units at days 0 , 2 , and 4 , respectively . while no resistant isolates were detected on day 0 on trimethoprim - sulfamethoxazole ( tsi ) plates , the ar reached the level of c - resistant isolates ( about 3.5 log - units ) at day 2 . the growth kinetics between days 2 and 4 were almost undistinguishable between isolates recovered from ci and tsi plates . a similar trend ( when compared to tsi ) was observed for gentamicin ( gi ) , where the counts were approximately 2 and 3 log - units at days 2 and 4 , respectively , which followed the trend of the control but were 2.5 and 3 log - units lower than the counts on control plates . although not detected at day 0 , levofloxacin - resistant ( li ) isolates were present on day 2 at a level of 3 log - units but declined to approximately 2 log - units at day 4 . no differences were observed between isolates grown on cii and tsii plates , compared to the trends observed for ci and tsi , respectively ( figure 3(b ) ) . the ar levels detected on gii and lii were in the same range ( approximately 2 - 3 log - units ) but inverted compared to gi and li ; these differences may be due to low bacterial counts on l plates . sample 16 showed similar trend to sample 13 , at day 2 for c and ts at the high ab concentrations ( figure 3(c ) ) , but the initial counts with ci were 2 log - units higher than those from tsi plates . the initial psychrotrophic population had a high level of c - resistance ( ci ) ; a second wave of psychrotrophs , ts - resistant , was established after 48 h. as with sample 13 , the counts on ts plates at day 4 were higher than those from c , suggesting that ts- and c - resistant psychrotrophs may not be the same isolates over time . if after 2 days of storage at 4c bacterial isolates were resistant at levels of approximately 3 , 3.5 , and 4 log - units ( of a total of 4.5 ) to g , c , or ts , respectively ( for the lower ab concentration ii , e.g. , figure 3(d ) ) , we would assume that most had multiresistant features . together , the lower prevalence of ts - resistance compared to c - resistance at day 0 and the higher prevalence of ts - resistance than c - resistance at day 4 suggest that a first wave of psychrotrophs which is more c - resistant is replaced by a second population that is more ts - resistant . the second wave also frequently had g - resistant features ; the resistance was after 2-day storage for 5 of 6 samples , about 23.5 log units lower compared to the corresponding controls . for most of these samples , no isolates grew on g - containing plates at day 0 or were present at low numbers ( 1 out of 100 ) . figures 3(a)3(d ) suggest a succession of psychrotrophic communities distinguishable by the prevalence of ar to the four abs ( representatives of four different ab classes ) considered in this study , although a detailed analysis of the kinetics of the psychrotrophs that expressed ar features revealed a sample - dependent dynamic . descriptive statistics the effect of cold storage on the ar of psychrotrophs ( p ) and mesophiles ( m ) was investigated at 4c and 6c for samples the total counts and psychrotrophs , enumerated on mueller - hinton plates without antibiotics , from samples stored at 6c for 4 d , exceeded initial counts by 3.54 log - unit , and 4 - 5 log - units for the mesophiles and psychrotrophs , respectively ( table 1 ) . increases of 23.5 log - unit , and 2 - 3 log - unit for the mesophiles and psychrotrophs , respectively , were recorded when milk samples were stored at 4c for 4 days , with the exception of sample 4 in which both populations types increased by approximately 1.5 log - units ( table 1 ) . samples 712 ( table 1 ) which were stored at 6c exhibited the highest resistance at day 0 to ceftazidim ( c ) : the ar levels ranged between 0 ( sample 12 ) and 100% ( sample 8) for both cip and ciip . with the exception of sample 8 , in which psychrotrophs exhibited the highest ar to c , l , and ts , the ar for the mesophiles and psychrotrophs was low . after 4 days of storage , the ar generally decreased for all samples.samples 16 ( table 1 ) , which were stored at 4c , had the highest initial resistance levels to cii ( 31.4%50% ciim ; 7.3%56.7% ciip ) and to ci ( 20.5%38.2% cim ; 7.3%100% cip ) but also had higher ar to the other abs in samples 1 and 2 ( e.g. , 27.2% for giip and 56.1% for tsiip in sample 1 ) and to a lesser extent for samples 4 and 5 . the effect of cold storage on the ar of psychrotrophs ( p ) and mesophiles ( m ) was investigated at 4c and 6c for samples the total counts and psychrotrophs , enumerated on mueller - hinton plates without antibiotics , from samples stored at 6c for 4 d , exceeded initial counts by 3.54 log - unit , and 4 - 5 log - units for the mesophiles and psychrotrophs , respectively ( table 1 ) . increases of 23.5 log - unit , and 2 - 3 log - unit for the mesophiles and psychrotrophs , respectively , were recorded when milk samples were stored at 4c for 4 days , with the exception of sample 4 in which both populations types increased by approximately 1.5 log - units ( table 1 ) . samples 712 ( table 1 ) which were stored at 6c exhibited the highest resistance at day 0 to ceftazidim ( c ) : the ar levels ranged between 0 ( sample 12 ) and 100% ( sample 8) for both cip and ciip . with the exception of sample 8 , in which psychrotrophs exhibited the highest ar to c , l , and ts , the ar for the mesophiles and psychrotrophs was low . samples 16 ( table 1 ) , which were stored at 4c , had the highest initial resistance levels to cii ( 31.4%50% ciim ; 7.3%56.7% ciip ) and to ci ( 20.5%38.2% cim ; 7.3%100% cip ) but also had higher ar to the other abs in samples 1 and 2 ( e.g. , 27.2% for giip and 56.1% for tsiip in sample 1 ) and to a lesser extent for samples 4 and 5 . anova resultsthe statistical analyses that distinguished the following factors ( storage temperature of the milk , ab type , ab concentration , and bacterial population type ) are detailed in table 2 . the determination of rapd values as superior , inferior , or equal was based on the results of the mean comparisons of the rapd values that were significantly superior , inferior or equal by the nps tests . for the mesophiles ( m ) , cold storage ( 4c or 6c ) decreased the prevalence of ar to ceftazidim ( c ) , regardless of storage temperatures , or ab concentration . rap4 was lower than rap0 for gi or gii at 4c or 6c , with the exception of gim in which rap4 was equal to rap0 . for trimethoprim - sulfamethoxazole ( ts ) , rap4 values were equal to rap0 , with the exception of tsiim , where rap4 was superior to rap0 . although levofloxacin - resistant isolates were the most rare , rap4 was equal to or greater than rap0 when milk samples were stored at 4c or 6c , respectively.the trends for gentamicin - resistant psychrotrophs ( p ) were similar at 4c and 6c ( table 2 ) . ceftazidim - resistance diminished after 4 days of storage at 4c at both concentrations ( ci , cii ) , but rap4 values remained at the initial level in milk samples stored at 6c . the observations with levofloxacin ( l ) and trimethoprim - sulfamethoxazole ( ts ) ( table 2 ) suggest that the milk storage temperature ( 4c or 6c ) affected the ar trend , because at 6c , all rap4 exceeded the rap0 values.bacterial growth is temperature dependent ; even at low temperatures , a rise of 2c enables the growth of more bacterial psychrotrophic species or genera which was also verified in this study as total counts at 6c were usually higher than those at 4c ( table 1 ) . although , the study could not consider identical samples in both storage temperature conditions simultaneously , the ar trends obtained with four different abs types ( table 2 ) suggest that the lowest storage temperature was most appropriate to contain ar at the minimal level . the statistical analyses that distinguished the following factors ( storage temperature of the milk , ab type , ab concentration , and bacterial population type ) are detailed in table 2 . the determination of rapd values as superior , inferior , or equal was based on the results of the mean comparisons of the rapd values that were significantly superior , inferior or equal by the nps tests . for the mesophiles ( m ) , cold storage ( 4c or 6c ) decreased the prevalence of ar to ceftazidim ( c ) , regardless of storage temperatures , or ab concentration . rap4 was lower than rap0 for gi or gii at 4c or 6c , with the exception of gim in which rap4 was equal to rap0 . for trimethoprim - sulfamethoxazole ( ts ) , rap4 values were equal to rap0 , with the exception of tsiim , where rap4 was superior to rap0 . although levofloxacin - resistant isolates were the most rare , rap4 was equal to or greater than rap0 when milk samples were stored at 4c or 6c , respectively . the trends for gentamicin - resistant psychrotrophs ( p ) were similar at 4c and 6c ( table 2 ) . ceftazidim - resistance diminished after 4 days of storage at 4c at both concentrations ( ci , cii ) , but rap4 values remained at the initial level in milk samples stored at 6c . the observations with levofloxacin ( l ) and trimethoprim - sulfamethoxazole ( ts ) ( table 2 ) suggest that the milk storage temperature ( 4c or 6c ) affected the ar trend , because at 6c , all rap4 exceeded the rap0 values . bacterial growth is temperature dependent ; even at low temperatures , a rise of 2c enables the growth of more bacterial psychrotrophic species or genera which was also verified in this study as total counts at 6c were usually higher than those at 4c ( table 1 ) . although , the study could not consider identical samples in both storage temperature conditions simultaneously , the ar trends obtained with four different abs types ( table 2 ) suggest that the lowest storage temperature was most appropriate to contain ar at the minimal level . descriptive statisticsthe counts from samples 1318 at day 2 ( table 1 ) revealed a moderate increase compared with the initial bacterial load ; at day 4 , all counts exceeded 6 log - units on mueller hinton plates . at day 0 , the ar prevalence was highest for ceftazidim whether considering the mesophiles ( 6.7%39.5% and 13.8%40% for cim and ciim , resp . ) or psychrotrophs ( 4.4%68% and 9.6%50.9% for cip and ciip , resp . ) ( figure 4(a ) ) . samples 14 and 17 had an ar prevalence of 16% and 28.6% , respectively , to gentamicin considering the psychrotrophs ( giip ) . the highest ar prevalence for trimethoprim - sulfamethoxazole ( ts ) was observed for psychrotrophs in sample 17 and for mesophiles in sample 13 . the lowest ar prevalence recorded was for levofloxacin ( l ) in both populations types ( figure 4(a ) ) . altogether the highest percentages of resistance were observed at day 2 , and a sample - dependent shift was noticeable between days 0 and 2 ( figure 4(b ) ) . an increase of ar was observed for sample 15 between days 0 and 2 for both mesophiles and psychrotrophs , whereas the trend was opposite in sample 17 . mesophiles from sample 16 and psychrotrophs from sample 18 exhibited up to 100% ts - resistance ( figure 4(b ) ) . in terms of total counts , day 2 was an important sampling time point because the threshold level of 10 cfu / ml was crossed in many samples.at day 4 , resistance to ts was the most prevalent , followed by resistance to c. the g- and l - resistant isolates were more rare but present at similar levels for both mesophiles and psychrotrophs ( figure 4(c ) ) . when every ab is examined individually , the observation was made in a previous study that ts - resistance was more prevalent among isolates that spent a longer time in cold storage conditions , which was also noticed to some extent for some -lactams antibiotics . the counts from samples 1318 at day 2 ( table 1 ) revealed a moderate increase compared with the initial bacterial load ; at day 4 , all counts exceeded 6 log - units on mueller hinton plates . at day 0 , the ar prevalence was highest for ceftazidim whether considering the mesophiles ( 6.7%39.5% and 13.8%40% for cim and ciim , resp . ) or psychrotrophs ( 4.4%68% and 9.6%50.9% for cip and ciip , resp . ) ( figure 4(a ) ) . samples 14 and 17 had an ar prevalence of 16% and 28.6% , respectively , to gentamicin considering the psychrotrophs ( giip ) . the highest ar prevalence for trimethoprim - sulfamethoxazole ( ts ) was observed for psychrotrophs in sample 17 and for mesophiles in sample 13 . the lowest ar prevalence recorded was for levofloxacin ( l ) in both populations types ( figure 4(a ) ) . altogether the highest percentages of resistance were observed at day 2 , and a sample - dependent shift was noticeable between days 0 and 2 ( figure 4(b ) ) . an increase of ar was observed for sample 15 between days 0 and 2 for both mesophiles and psychrotrophs , whereas the trend was opposite in sample 17 . mesophiles from sample 16 and psychrotrophs from sample 18 exhibited up to 100% ts - resistance ( figure 4(b ) ) . in terms of total counts , day 2 was an important sampling time point because the threshold level of 10 cfu / ml was crossed in many samples . at day 4 , resistance to ts was the most prevalent , followed by resistance to c. the g- and l - resistant isolates were more rare but present at similar levels for both mesophiles and psychrotrophs ( figure 4(c ) ) . when every ab is examined individually , the observation was made in a previous study that ts - resistance was more prevalent among isolates that spent a longer time in cold storage conditions , which was also noticed to some extent for some -lactams antibiotics . anova resultsthe statistical analyses revealed the same ranking of the four abs for the mesophiles or the psychrotrophs regardless of the sampling day . c - resistance was the most prevalent at day 0 , followed by ts , g , and l. at days 2 and 4 , ts supplanted c without affecting the order of the two other abs . the ar estimated through rap0 , rap2 , and rap4 values for both types of populations was always the highest for psychrotrophs ( table 3 ) . the range of variation of the rap values , which were higher for psychrotrophs , confirmed higher heterogeneity among psychrotrophic communities . most importantly , all rap values were at their maximum for mesophiles and psychrotrophic populations at day 2 , which corresponded to 48 hours storage at 4c ( table 3 ) . the statistical analyses revealed the same ranking of the four abs for the mesophiles or the psychrotrophs regardless of the sampling day . c - resistance was the most prevalent at day 0 , followed by ts , g , and l. at days 2 and 4 , ts supplanted c without affecting the order of the two other abs . the ar estimated through rap0 , rap2 , and rap4 values for both types of populations was always the highest for psychrotrophs ( table 3 ) . the range of variation of the rap values , which were higher for psychrotrophs , confirmed higher heterogeneity among psychrotrophic communities . most importantly , all rap values were at their maximum for mesophiles and psychrotrophic populations at day 2 , which corresponded to 48 hours storage at 4c ( table 3 ) . finnish raw milk is considered as excellent , with regard to both microbial loads and ab residues [ 30 , 31 ] . the ar levels reported here and the trend of ar during cold storage raise the questions regarding the origin of ar and multiple ar in raw milk psychrotrophs . a direct link between the frequency of ab use and ar , which has been described worldwide , may be part of the explanation . in finland , the prudent use of antimicrobials recommends that streptococci and -lactamase - negative - staphylococci causing mastitis should be treated with systemically administered benzyl penicillin ( -lactams ) or intramammarily administered -lactams combined with aminoglycosides . the use of 3rd and 4th generation cephalosporins ( like ceftazidim ) in cattle is not permitted . acute clinical mastitis caused by gram - negative bacteria may be treated systemically with trimethoprim - sulphonamide or enrofloxacin ( fluoroquinolone ) and severe coliform mastitis cases ( approximately 12% of the cases in finland ) are treated with fluoroquinolones [ 32 , 33 ] . considering the ab classes considered here ( ceftazidim--lactams , gentamicin - aminoglycosides , levofloxacin - quinolones , trimethoprim - sulfamethoxazole - folate pathway inhibitors ) , the differences in ar prevalences somehow reflect the ab usage frequencies with the exception of ceftazidim which is a third - generation cephalosporin for which coselection by other antimicrobials seems to influence resistance prevalence . although many agents can cause bovine mastitis ( mammary gland infection ) , pathogens that induce clinical symptoms are mainly gram - positive bacteria , whereas psychrotrophs are widely distributed among gram - negative and less so among gram - positive species . several studies that investigated the spoilage potential of raw milk psychrotrophs indicated that at the time of the spoilage , gram - negative bacteria dominate the microflora ; however , the gram status does not limit the transfer of ar traits [ 36 , 37 ] . since , apart from the cold storage , no other stress was applied to raw milk samples , the dominant factor that conducts the successional dynamics of the bacterial communities was resource availability over time . considering the ar prevalence ( figures 3 and 4 ) , three categories of bacteria ( 1 ) the first stage starts from the milking step and lasts until the dominance of psychrotrophs , in which the bacterial diversity ( considering the numerous contamination sources ) could be rather high . these bacteria are not yet so well adapted to cold storage , and nutrients are limited . this stage could correspond to the domination of oligotrophs , depicted in figure 3 ( day 0 ) and figure 4(a ) . ( 2 ) in the second stage , a pioneering group of psychrotrophs that produce exoenzymes ( proteases , lipases , phospholipases ) that degrade milk components ( fats , proteins , carbohydrates , etc . ) this stage could constitute a transitory step between oligotrophs and copiotrophs [ 38 , 39 ] and could correspond to communities plotted in figure 4(b ) , for which the ar was highest . ( 3 ) in the third stage , four days of cold storage selected for authentic psychrotrophs that grow in a richer media and could be psychrotrophic copiotrophs ( figure 4(c ) ) . ar is at its minimum in terms of relative amounts , which could suggest that carrying ar features may not be advantageous anymore . this hypothesis would be in line with the thought that bacteria produce abs to kill or inhibit neighbouring bacteria when nutrients are limited [ 40 , 41 ] . considering that antimicrobial resistance mechanisms are associated with a fitness cost ( which noticeably affects the bacterial growth rate ) , we assume that the psychrotrophic enzyme producers that dominated at day 2 ( figure 4(b ) ) are outcompeted by a following psychrotrophic wave established at the cost of the enzyme producers . this wave multiplies quickly and carries fewer ar features ( figure 4(c ) ) . considering the ar load , milk at day 4 could have a lower risk ( lower ar percentages ) though this milk is spoiled and inappropriate for consumption . noteworthy figures 4(a)4(c ) indicate a considerable drop of the relative ar rates while the number of isolates that carry ar features continuously increased ( figures 3(a)3(d ) ) . many genera constitute the rather highly diverse psychrotrophic raw milk microflora that enters the milk via numerous sources of contaminations [ 2 , 5 ] ; if many are considered benign and only regarded as spoiling agents , the presence of others , such as stenotrophomonas or acinetobacter , should be seriously considered due to their innate resistance to many abs . bacteria resistant to multiple abs , known as superbugs , constitute one of the most challenging problems faced by modern medicine . one class is comprised of opportunistic pathogens , often of environmental origin that infect sick and immunocompromised patients [ 10 , 14 ] . still , little is known about the antibiotic resistomes of the majority of environmental bacteria . this study revealed that no direct correlation can be made between cfu / ml values and ar prevalence . this addresses the question of whether the 10 cfu / ml threshold standard is sufficient to ensure the quality and safety of raw milk . indeed , heat treatments ( pasteurization , uht , etc . ) , to which raw milk is subjected , kill most or all bacteria ; however , the results presented in this communication raise the question about the fate of all ars genes loaded in mesophiles and psychrotrophs that may be released following heat treatment of raw milk . some psychrotrophs isolated from 4 days - stored milk were subjected to rapid phenotypic characterization . according to the api 20ne database , some of the multiresistant isolates belonged to the species sphingomonas paucimobilis , sphingobacterium spiritivorum , chryseobacterium meningosepticum , and stenotrophomonas maltophilia ( data not shown ) . additional studies are necessary to accurately identify the bacterial species or genera that constitute the different communities and determine the link if any between ar load and ecological attributes ( appartenance to copiotrophic or oligotrophic communities ) . the diversity of the different bacterial populations and their dynamics should be investigated by both culture - dependent and molecular methods . ar trends determined from the farm until the dairy silo would enable further evaluation of the present observations , further explanation on the impact of the cold chain on ar , and discussion of eventual connection between animal and human health . strategies to limit the bacterial load of mesophiles and psychrotrophs in raw milk should be designed to dispel technological risks and simultaneously consider human health aspects . the cold chain of raw milk storage and transportation may be still seen as an amplification of benign bacteria , in their majority ; however , the interplay between many benign and some risky bacteria should not be overlooked in a world that struggles with superbugs . the storage temperature and the antibiotic type influenced the ar prevalence , despite sample variations . during cold storage , different psychrotrophic communities that carry different ar levels seem to succeed to each other over time . when evaluated from relative amounts whether for psychrotrophs or mesophiles , the ar was most prevalent transiently at the investigated intermediate sampling point ( 48 h storage ) , at a stage where total counts are below or around 10 cfu / ml where the milk is still acceptable for industrial dairy processes .
psychrotrophic bacteria in raw milk are most well known for their spoilage potential and cause significant economic losses in the dairy industry . despite their ability to produce several exoenzyme types at low temperatures , psychrotrophs that dominate the microflora at the time of spoilage are generally considered benign bacteria . it was recently reported that raw milk - spoiling gram - negative - psychrotrophs frequently carried antibiotic resistance ( ar ) features . the present study evaluated ar to four antibiotics ( abs ) ( gentamicin , ceftazidime , levofloxacin , and trimethoprim - sulfamethoxazole ) in mesophilic and psychrotrophic bacterial populations recovered from 18 raw milk samples , after four days storage at 4c or 6c . robust analysis of variance and non parametric statistics ( e.g. , regw and nps ) revealed that ar prevalence among psychrotrophs , for milk samples stored at 4c , often equalled the initial levels and equalled or increased during the cold storage at 6c , depending on the ab . the study performed at 4c with an intermediate sampling point at day 2 suggested that ( 1 ) different psychrotrophic communities with varying ar levels dominate over time and ( 2 ) that ar ( determined from relative amounts ) was most prevalent , transiently , after 2-day storage in psychrotrophic or mesophilic populations , most importantly at a stage where total counts were below or around 105 cfu / ml , at levels at which the milk is acceptable for industrial dairy industrial processes .
an abnormal extraosseous tracer uptake may be encountered in many organs during the technetium-99 m methylene diphosphonate ( tc-99 m mdp ) bone scan . though such extraosseous uptake in the brain is rare , it may occur due to malignancy , calcification or infarct . few instances of diagnosis of acute infarcts in the brain in tc-99 m bone scan have been documented in the literature . however , the presented case is unique in that the diagnosis of acute brain infarct was not clinically suspected initially during the referral considering the chronic debilitated status of the patient and the area of involvement in the brain was also significantly large . a 77-year - old woman was referred for tc-99 m mdp whole body nuclear bone scan to rule out metastases . she underwent bilateral mastectomy 3 years ago for bilateral breast carcinoma and received chemotherapy also . she had multiple comorbidities including diabetes mellitus , hypertension and hypercholesterolemia and was bed - ridden , due to her chronic debilitated status . in the anterior and posterior images of the whole body bone scan , a normal physiological pattern of tracer uptake was observed in the bones and degenerative changes were observed in bilateral shoulders , left knee and left ankle . no focus of intense uptake of tracer in bones suspicious of metastases was identified in axial and appendicular skeleton [ figure 1 ] . however , a heterogeneous and diffuse tracer uptake was noted in the right hemicranium and following which spot films of skull lateral views were obtained . the distribution of tracer uptake in the right lateral view of skull corresponded with the anterior circulation territory of the brain , sparing the posterior circulation territory of posterior fossa with a sharp demarcation [ figure 2 ] . since the finding raised a strong suspicion of right anterior circulation territorial infarct of brain , patient was subjected to clinical examination , which revealed that the power of the left lower and upper limbs were reduced when compared to the right side . whole body bone scan shows an abnormal , diffuse and a heterogeneous tracer uptake in the right half of the skull , having straight margins in the midline ( left arrow ) and in the skull base ( up arrow ) suggesting tracer localization in a large area of the brain lateral spot views of skull shows tracer localization in the right anterior circulation territory of the brain with a clearly defined inferior margin ( up sloping arrows ) representing the border between anterior and posterior circulation magnetic resonance imaging of brain ( a ) fluid attenuated inversion recovery , ( b ) t2 weighted , ( c ) diffusion - weighted image , ( d ) apparent diffusion coefficient sequences show a large area of right anterior cerebral circulation territory having restricted diffusion , confirming an acute infarct patient was referred to the intensive care unit immediately for acute medical care . later , patient was further investigated with magnetic resonance imaging ( mri ) , which confirmed the presence of an acute cerebral infarct confined to the right internal carotid arterial territory [ figure 3a d ] . tc-99 m mdp bone scan is the most commonly done nuclear scan in many nuclear medicine departments across the world . in this type of scan , usually 50 - 60% of tracer is localized in the bones and the remainder is cleared by the kidneys in 2 - 3 h. the benign and pathological lesions of the bones are diagnosed by increased uptake of the tracer by the lesions due to various reasons such as increased blood flow , increased osteoid formation or increased mineralization . this may be due to neoplastic , inflammatory , infective , traumatic , hormonal or ischemic lesions and artifacts . enhanced regional vascularity and permeability , extracellular fluid expansion , elevated tissue calcium concentration , presence of tracer avid other metallic ions , adsorption onto immature collagen and binding to denatured proteins are some of the mechanisms , which lead to extraosseous uptake . such extraosseous uptake in the brain is rare , occurring in less than 0.2% of patients undergoing bone scintigraphy . acute infarcts of the brain show increased tracer uptake because of the following pathophysiology : ( i ) the ischemic damage to cellular membranes result in rapid intracellular influx of calcium leading to calcium precipitation within the mitochondria and ( ii ) denatured proteins also act as substrates for calcium deposition . established territorial infarcts of the brain show uptake of tracer in a well - defined pattern in the skull region depending upon the blocked artery . if the ischemic changes are widespread and bilateral , for example in hypoxic ischemic encephalopathy , tc-99 m mdp is seen in laminar distribution and watershed territories matching the vascular insult . it can also be seen in other conditions , which produce damage to the blood brain barrier such as primary neoplasm , metastases or inflammation . sometimes tracer is localized in extra axial locations also such as hematomas , meningiomas , metastases and dural calcifications . one rare instance of primary cerebral amyloidoma having increased bone tracer accumulation has been documented in the literature . tc-99 m mdp bone scan is often requested to rule out skeletal metastases in elderly patients having known or suspected cancer . the real challenge lies in diagnosing clinically unsuspected lesions amidst the primary concern of detecting metastases . even a solitary focus of tracer uptake in the brain region can be due to causes other than metastases . as shown in this case report , brain infarction remains important differential diagnoses of the brain or skull metastases because silent brain infarction comprises 22% of all strokes . careful clinical evaluation , additional single photon emission computed tomography imaging and further evaluation with computed tomography or mri would be helpful for confirmation of diagnoses . in conclusion , it is important for the attending physician and the nuclear physician to be aware of the abnormal extraosseous uptake of tc-99 m mdp during bone scan , in order to make a sound diagnosis .
technetium-99 m methylene diphosphonate scintigraphy is usually performed to assess bone lesions , especially skeletal metastases in patients with a history of malignancy . however , it is important to recognize some specific conditions with a unique pattern of tracer uptake , especially in extraosseous locations as they are not related to primary neoplasm or metastases . diagnosing such unusual presentation is essential as it significantly influences the clinical management . this case report describes an unusual presentation detected in a bone scan of an elderly female patient , who was a treated case of breast cancer and was referred for a bone scan to rule out bone metastases . incidentally , a large acute territorial cerebral infarct was diagnosed , which was later confirmed by magnetic resonance imaging on diffusion - weighted images . diagnosis of the typical presentation and timely management saved the patient life .
it has been previously thought that dementia occurred in 20%30% of parkinson disease ( pd ) patients , usually at the later stage of their illness . however , recent long term epidemiological studies reported the prevalence rate of dementia in pd closer to 50% ( hely et al 2005 ) . others have reported that some form of cognitive decline affects nearly 80% of pd patients ( aarsland et al 2003 ) . the relative risk for the development of dementia in pd has been reported as being between 1.7 to 5.9 ( marder et al 1995 ; aarsland et al 2001 ; hobson et al 2004 ) . we hypothesize that cognitive dysfunction in pd is progressive , actually begins early in the course , affects most patients , and tracks their motor impairment . moreover , because of the variability of pd severity among affected individuals , we further hypothesize that cognitive measures are less likely to be correlated with disease duration : a patient with mild disease may have had pd for several years with minimal motor and , therefore , cognitive impairment ; while a patient with an aggressive disease course may be significantly impaired ( physically and cognitively ) sooner . all patients diagnosed with probable pd at a single movement disorders center were offered to undergo a comprehensive neuropsychological testing , regardless of their cognitive status . the results were correlated to the total motor score of the unified parkinson disease rating scale ( updrs ) . the diagnosis of probable pd , made by either of 3 fellowship - trained movement disorders specialists ( hhf , mso , rlr ) , was determined by : ( 1 ) the presence of two out of three motor features of pd ( tremor , rigidity , and bradykinesia ) , ( 2 ) and the absence of any features that would suggest other forms of parkinsonism including lack of a substantial response to levadopa therapy . for all medicated patients , the updrs was performed in the off state ( ie , at least 12 hours off all pd medications ) . the neuropsychological battery ( performed in the on state , if medicated ) included : the mini - mental status exam ( mmse ) ; dementia rating scale ( drs ) ; and tests on the following domains : general intelligence ( wechsler adult intelligence scale 3 ) ; academic performance ( wide range achievement test-3 [ wrat-3 ] ) ; attention and concentration ( digit span ) ; memory ( hopkins verbal learning test [ hvlt ] and weschler memory scale - iii ) ; language ( boston naming , controlled oral word association test ) ; visual - spatial skills ( judgment of line orientation [ jolo ] , benton facial recognition test ) ; and executive function ( stroop , trail making test ) . the correlation of the updrs motor scores to neuropsychological performance ( both raw scores and corrected scores for age and education ) was then determined . because some of the variables were found to deviate substantially from normality , nonparametric correlations ( spearman s ) were computed to examine the relationship between all variables . since our study is exploratory , we did not apply a correction for multiple comparisons to determine significance in our primary analyses . however , we indicated which correlations remained significant after a bonferroni correction as a secondary analysis . to make sure that observed relationships were not solely due to the effects of intervening variables , multiple regressions were conducted to examine the unique relationship between motor and cognitive functioning after controlling for demographic characteristics and disease duration . all analyses were conducted with spss 13.0 . the collection and utilization of data in this study is irb approved . one hundred and six pd patients , 30 females and 76 males , were included in this study . two participants were excluded based on very poor cognitive functioning ( mmse of 7 and 14 ) . the participants had an average : age of 67.1-years ( sd : 10.52 ) ; education of 14.75-years ( sd : 3.38 ) ; disease duration of 110.41-months ( sd : 74.43 ) ; mmse score of 27.58 ( range : 1830 , sd : 2.45 ) ; and updrs motor the tests that significantly correlated with the updrs motor score were : mmse , drs , digit span , hvlt , wms - iii , boston naming test , letter fluency , animal fluency , stroop color naming and trail making test b , representing at least one component in the neuropsychological domains of attention and concentration , memory , language , and executive function ( see table 1 ) . however , some tests under these cognitive domains did not correlate with the updrs motor score , including the stroop word reading , stroop color - word naming , and trail making test a. tests of general intelligence ( wais - iii ) , academic performance ( wrat-3 ) , and visuospatial skills ( jolo and face recognition ) showed no significant relationship with the updrs motor score . age , gender , and education were not significantly associated with the updrs motor score . disease duration , however , was significantly and positively correlated with updrs motor score ( see table 1 ) . a multiple regression including updrs motor score and disease duration as independent predictors yielded updrs motor score as the sole unique predictor of mmse ( r = 0.09 , f(2 , 76 ) = 3.69 , p < 0.05 , ( updrs ) = 0.33 , t ( 76 ) = 2.71 , p < 0.01 ) . even as a single predictor , disease duration was not significantly correlated with mmse ( r = 0.01 , p > 0.1 , or drs , r = 0.13 , p > 0.1 ) . our results showed a significant correlation between the degree of motor impairment and most of the neuropsychological tests in all cognitive domains except for general intelligence and visuospatial function . this implies that the cognitive decline seen with pd is near global rather than primarily being a moreover , although our study is cross - sectional , it suggests that cognitive decline tracks motor progression in pd although longitudinal studies are needed to confirm this observation . although studies have found significant visuospatial disturbances associated with pd ( huber et al 1989 ; stern et al 1993 ) , ours did not show a correlation between motor score and visuospatial abilities . possible explanations include : stronger influence of external factors ( eg , testing environment , medications ) in visuospatial tests compared to measures of other cognitive domains ; insensitivity of visuospatial tests used in this study ; or , a difference or divergence in the etiopathogenesis of visual - spatial dysfunction in pd compared with the motor and other cognitive dysfunction . also , it has been thought by some that visuospatial disturbances experienced by pd patients may be secondary to or at least influenced by executive dysfunction and inattention ( ogden et al 1990 ; bondi et al 1993 ) . the visuospatial tests used in our study were not associated with the motor updrs scores , but representative tests of both executive function and attention were . the correlation between the mmse , representing the overall cognitive status , and the updrs motor score remained significant even after controlling for disease duration . on the contrary we did not take note of the total number of subjects offered to undergo testing . it is therefore possible that patients with signs of dementia more likely agreed to undergo the neuropsychiatric evaluation , contributing to a population bias . also , patients with severe cognitive deficits who were unable to complete the comprehensive neuropsychological examination ( n = 2 ) were excluded . nonetheless , we believe that this cohort represented a good spectrum of pd . the small number of excluded patients due to severe dementia ( 2/108 ) was not likely to influence overall results . although our convenience sample could be subject to population bias , the range in age ( 4189 ) , mmse scores ( 1830 ) , disease duration ( 12 to 318-months ) , updrs scores ( 881 ) , represented a wide pd spectrum . thus , it is less likely that motor fluctuations significantly contributed to their performance during cognitive testing . the motor updrs was obtained in the off state to ensure uniformity , assess the true / baseline motor deficits , without medication effect or the variability of its optimization . only 2 patients in our cohort finally , this is a cross - sectional study so our data should be interpreted with caution . in summary , the results of this study indicate that impairment in most cognitive domains correlate with motor symptoms in pd . cognitive impairment may start early in the disease process but may be very mild and often undetected . while most clinicians are able to appreciate mild tremor or rigidity in one limb thereby easily defining the onset of motor dysfunction , the first sign of cognitive impairment is more difficult to identify . longitudinal studies are needed to confirm our results as our cross - sectional study can indicate correlation of cognitive impairment and motor symptoms , but is insufficient to detect true parallel progression of cognitive and motor impairment . if proven correct , then ( 1 ) better and practical cognitive tests sensitive to pd that mark the onset and track the progression of cognitive dysfunction are needed ; and , ( 2 ) cognition enhancing or modifying ( pharmacologic and non - pharmacologic ) interventions , as they become available , should be considered early in the course of pd . finally , this study does not support previous reports regarding visuospatial impairment in pd . controlled longitudinal studies with the use of more sensitive measures may be needed to define the etiopathogenesis of visuospatial dysfunction in pd .
we performed an analysis of prospectively - acquired cross sectional data on 106 parkinson disease ( pd ) patients who underwent comprehensive neuropsychological testing and the unified parkinson disease rating scale ( updrs ) motor scale . a significant correlation between the updrs motor and neuropsychological tests in all cognitive domains except for general intelligence and visuo - spatial function was seen . in this study , cognitive decline within this pd cohort correlated with motor impairment but not disease duration . our findings suggest that overall cognitive impairment ( except visuospatial dysfunction ) may track motor progression in pd more than duration of disease . longitudinal studies are needed to confirm our results .
we describe the facile synthesis of several two - dimensional covalent organic frameworks ( 2d cofs ) as films by vapor - assisted conversion at room temperature . high - quality films of benzodithiophene - containing bdt - cof and cof-5 with tunable thickness were synthesized under different conditions on various substrates . bdt - cof films of several micrometer thickness exhibit mesoporosity as well as textural porosity , whereas thinner bdt - cof films materialize as a cohesive dense layer . in addition , we studied the formation of cof-5 films with different solvent mixture compositions serving as vapor source . room temperature vapor - assisted conversion is an excellent method to form cof films of fragile precursors and on sensitive substrates .
locally recurrent prostate cancer following external beam radiotherapy ( ebrt ) is a therapeutic dilemma . viable residual carcinoma has been estimated to occur in 10 - 54% of patients two or more years following ebrt [ 13 ] . patients diagnosed with locally persistent disease often seek a second local treatment to the prostate with the goal of cure . brachytherapy ( bt ) is an attractive option for these patients due to its ability to deliver a high radiation dose to the prostate with a high degree of conformity [ 47 ] . however , there is a risk of genitourinary toxicity , specifically incontinence , which approaches 31% [ 8 , 9 ] , and gastrointestinal toxicity , associated with injury to the rectum , ranging from 3 to 35% [ 710 ] . further complicating the risk - to - benefit balance of salvage bt higher doses of ebrt have been shown to reduce the risk of prostate cancer recurrence in several clinical trials [ 1115 ] . presently , the national comprehensive cancer network ( nccn ) guidelines recommend ebrt doses ranging from 75.6 - 81 gy depending on risk categorization . the current understanding of the potential toxicity associated with salvage bt is derived from literature based on ebrt doses of 63 - 68 gy [ 47 ] . it is well - established that radiation toxicity is directly related to dose and patients treated with dose - escalated ebrt may be at higher risk of toxicity . at fox chase cancer center ( fccc ) , dose - escalated ebrt of 76 gy has been prescribed for over two decades . furthermore , in a recent trial of hypofractionation , a prescription of 70.2 gy in 26 fractions was used , which is the equivalent of 84.4 gy in 2.0 gy fractions assuming an / ratio of 1.5 . with the goal of mitigating risk of additional toxicity for carefully selected patients with unilateral recurrence , a salvage low - dose - rate ( ldr ) partial prostate implant approach has been implemented . the primary objective of this paper is to report the feasibility , preliminary toxicity , and biochemical outcomes for patients treated with salvage permanent ldr i seed partial prostate bt in the era of dose - escalated ebrt . to our knowledge , this is the first report of salvage ldr prostate bt following either dose - escalated or hypofractionated ebrt . the fccc prostate cancer database was queried to identify patients who had received primary definitive ebrt and subsequent ldr salvage bt for prostate cancer . t - stage was reported as per the american joint cancer commission ( ajcc ) 7 edition based on palpation only . all patients received primary ebrt with 3-dimensional conformal radiation therapy ( 3dcrt ) or intensity - modulated radiation therapy ( imrt ) . the 3dcrt [ 19 , 20 ] and imrt techniques have been previously described . in 3dcrt , a small pelvic four - field plan was treated to a dose of 46 gy in 23 daily fractions with three subsequent field reductions to block the rectum and bladder , and achieve a total dose to the prostate of 78 gy in 39 daily fractions . intensity - modulated radiation therapy was delivered using the step - and - shoot technique with an 8 to 9 beam arrangement . on the irb 02 - 602 clinical trial , patients were randomized to receive conventionally fractionated imrt to 76 gy in 38 fractions ( 2.0 gy per day ) versus hypofractionated imrt to 70.2 gy in 26 fractions ( 2.7 gy per day ) to the prostate . assuming an / of 1.5 , the latter dose - fractionation scheme would be biologically equivalent to 84.4 gy in 2.0 gy daily fractions . post - treatment biopsies were performed for one of the following indications : as a two - year endpoint as indicated by the fccc irb # 02 - 602 protocol , for a suspicious rising psa , biochemical failure or for a suspicious palpable abnormality on digital rectal exam ( dre ) . all patients received extended core biopsies of both lobes of the prostate with at least 12 cores obtained . a four - tier classification scheme was used : benign , atypical , carcinoma with treatment effect , carcinoma without treatment effect . patients were eligible for salvage partial prostate bt if they had suspicious findings on their planned 2-year biopsy and subsequent re - biopsy showing persistent or progressive disease . patients with a rising psa or abnormal dre with biopsy - proven unilateral adenocarcinoma were also eligible . androgen deprivation therapy ( adt ) , with luteinizing - hormone - releasing - hormone ( lhrh ) agonist was prescribed at the discretion of the treating oncologist , generally for gs 7 and/or high bulk disease . androgen deprivation therapy was implemented on the day of the implant and continued for a 6-month duration . all patients underwent a pre - implant mri - based volume study , to estimate the treatment volume and prostate length . the activity and number of seeds required were determined by the physician - contoured target volume . on the day of the procedure , patients were brought to the operating room , given general anesthesia and placed in extended dorsal lithotomy position . a foley catheter was inserted and 50 ml of contrast and 100 ml of water was instilled into the bladder then clamped . a trans - rectal ultrasound ( trus ) volume study at 5 mm intervals from the prostate base to apex was performed by the radiation oncologist . the clinical target volume ( ctv ) was defined as the right or left half of the prostate and contoured by a single radiation oncologist ( mkb ) , and transferred to the variseed ( varian medical systems , inc . , palo alto , ca , usa ) planning system . a 3-mm to 5-mm expansion was used to create a planning target volume ( ptv ) , to account for contouring inaccuracies , except posteriorly where no margin was used . a real - time plan with proposed needle and seed - spacer sequences was produced manually to provide optimal coverage with sparing of the urethra . a typical plan consisted of 5 to 9 needles ( fig . 1 ) . the intraoperative real - time sleeved seed technique has been previously described . using a fccc modified best i seed loader ( best medical international , inc . , springfield , va , usa ) , the seeds and spacers were positioned according to plan and inserted into the sleeve ( hollow suture material ) , which were loaded into the applicator needles . the needles were inserted through a transperineal approach under ultrasound guidance , using the axial and sagittal views to confirm accurate needle and seed placement prior to deployment . once all the seeds were placed , cystoscopy was performed by the urologist to ensure the absence of seeds from the bladder and urethra . day 0 ct - based axial dosimetry from base ( a ) to apex ( f ) of a typical partial permanent prostate seed implant . isodose lines : pink 200% ( 220 gy ) , orange 150% ( 165 gy ) , blue 90% ( 99 gy ) the median radioactive seed activity for i was 0.33 mci . post - implant ct and mri scans for day 0 dosimetry was used to contour the ctv , which again was the appropriate right or left half of the prostate . further dosimetric calculations were performed 30 days post - implant to ensure coverage and seed stability . given the prior external beam radiation dose , all attempts were made at the time of implant to spare the rectum and urethra , with the goal of limiting rectal v100% to less than 1 cc and urethral v150% to 0 cc . patients returned for follow - up at 1 and 3 months following bt , and every 6 to 12 months thereafter . this generally consisted of a focused history , dre ( except 1 and 3 month visits ) , and psa ( except 1 month visit ) . biochemical failure was determined using the phoenix definition ( i.e. psa nadir + 2 ng / ml ) . toxicity , including gastrointestinal ( gi ) , genitourinary ( gu ) , and erectile dysfunction ( ed ) was defined according to the common terminology criteria for adverse events ( ctcae ) version 3.0 . all patients received primary ebrt with 3-dimensional conformal radiation therapy ( 3dcrt ) or intensity - modulated radiation therapy ( imrt ) . the 3dcrt [ 19 , 20 ] and imrt techniques have been previously described . in 3dcrt , a small pelvic four - field plan was treated to a dose of 46 gy in 23 daily fractions with three subsequent field reductions to block the rectum and bladder , and achieve a total dose to the prostate of 78 gy in 39 daily fractions . intensity - modulated radiation therapy was delivered using the step - and - shoot technique with an 8 to 9 beam arrangement . on the irb 02 - 602 clinical trial , patients were randomized to receive conventionally fractionated imrt to 76 gy in 38 fractions ( 2.0 gy per day ) versus hypofractionated imrt to 70.2 gy in 26 fractions ( 2.7 gy per day ) to the prostate . assuming an / of 1.5 , the latter dose - fractionation scheme would be biologically equivalent to 84.4 gy in 2.0 gy daily fractions . post - treatment biopsies were performed for one of the following indications : as a two - year endpoint as indicated by the fccc irb # 02 - 602 protocol , for a suspicious rising psa , biochemical failure or for a suspicious palpable abnormality on digital rectal exam ( dre ) . all patients received extended core biopsies of both lobes of the prostate with at least 12 cores obtained . a four - tier classification scheme was used : benign , atypical , carcinoma with treatment effect , carcinoma without treatment effect . patients were eligible for salvage partial prostate bt if they had suspicious findings on their planned 2-year biopsy and subsequent re - biopsy showing persistent or progressive disease . patients with a rising psa or abnormal dre with biopsy - proven unilateral adenocarcinoma were also eligible . androgen deprivation therapy ( adt ) , with luteinizing - hormone - releasing - hormone ( lhrh ) agonist was prescribed at the discretion of the treating oncologist , generally for gs 7 and/or high bulk disease . androgen deprivation therapy was implemented on the day of the implant and continued for a 6-month duration . all patients underwent a pre - implant mri - based volume study , to estimate the treatment volume and prostate length . the activity and number of seeds required were determined by the physician - contoured target volume . on the day of the procedure , patients were brought to the operating room , given general anesthesia and placed in extended dorsal lithotomy position . a foley catheter was inserted and 50 ml of contrast and 100 ml of water was instilled into the bladder then clamped . a trans - rectal ultrasound ( trus ) volume study at 5 mm intervals from the prostate base to apex was performed by the radiation oncologist . the clinical target volume ( ctv ) was defined as the right or left half of the prostate and contoured by a single radiation oncologist ( mkb ) , and transferred to the variseed ( varian medical systems , inc . , a 3-mm to 5-mm expansion was used to create a planning target volume ( ptv ) , to account for contouring inaccuracies , except posteriorly where no margin was used . a real - time plan with proposed needle and seed - spacer sequences was produced manually to provide optimal coverage with sparing of the urethra . a typical plan consisted of 5 to 9 needles ( fig . 1 ) . the intraoperative real - time sleeved seed technique has been previously described . using a fccc modified best i seed loader ( best medical international , inc . , springfield , va , usa ) , the seeds and spacers were positioned according to plan and inserted into the sleeve ( hollow suture material ) , which were loaded into the applicator needles . the needles were inserted through a transperineal approach under ultrasound guidance , using the axial and sagittal views to confirm accurate needle and seed placement prior to deployment . once all the seeds were placed , cystoscopy was performed by the urologist to ensure the absence of seeds from the bladder and urethra . day 0 ct - based axial dosimetry from base ( a ) to apex ( f ) of a typical partial permanent prostate seed implant . isodose lines : pink 200% ( 220 gy ) , orange 150% ( 165 gy ) , blue 100% ( 110 gy ) , green 90% ( 99 gy ) the median radioactive seed activity for i was 0.33 mci . post - implant ct and mri scans for day 0 dosimetry was used to contour the ctv , which again was the appropriate right or left half of the prostate . further dosimetric calculations were performed 30 days post - implant to ensure coverage and seed stability . given the prior external beam radiation dose , all attempts were made at the time of implant to spare the rectum and urethra , with the goal of limiting rectal v100% to less than 1 cc and urethral v150% to 0 cc . patients returned for follow - up at 1 and 3 months following bt , and every 6 to 12 months thereafter . this generally consisted of a focused history , dre ( except 1 and 3 month visits ) , and psa ( except 1 month visit ) . biochemical failure was determined using the phoenix definition ( i.e. psa nadir + 2 ng / ml ) . toxicity , including gastrointestinal ( gi ) , genitourinary ( gu ) , and erectile dysfunction ( ed ) was defined according to the common terminology criteria for adverse events ( ctcae ) version 3.0 . descriptions of the five cases from the time of initial diagnosis to last follow - up are described below and summarized in table 1 . there was some progression of ed in three patients , evidenced by a decline in their sexual health inventory for men ( shim ) scores . figure 2 shows the american urologic association ( aua ) prostate symptom scores over time and no trends were observed . all patients had a decline in serum psa following salvage bt without evidence of biochemical failure . patient - reported american urologic association ( aua ) scores as a function of time patient characteristics psa prostate specific antigen , t stage tumor stage , ebrt external beam radiotherapy , rt radiotherapy , gs gleason score , bt grade , ed erectile dysfunction met psa definition for biochemical failure per phoenix criteria ( psa nadir + 2 ng / ml ) grade 2 or higher gastrointestinal ( gi ) , genitourinary ( gu ) , or erectile dysfunction ( ed ) according to ctcae v.3 brachytherapy characteristics and 30 day post - implant prostate dosimetry cc millicuries , d90% dose delivered to 90% of the post - implant volume , v110 gy post - implant volume receiving 110 gy , v140 gy post - implant volume receiving 140 gy , v145 gy post - implant volume receiving 145 gy a 66 year old caucasian male with presenting psa of 5.2 ng / ml , gs 6 ( 3 + 3 ) disease in the right base , mid and apex , and clinical t2a disease on dre . he was randomized to the hypofractionated arm of fccc irb # 02 - 602 , receiving 70.2 gy in 26 fractions using imrt . he had two post - treatment biopsies , the first at two years showing gs 6 ( 3 + 3 ) adenocarcinoma with radiation effect . a second biopsy at three years failed to show regression , with gs 6 ( 3 + 3 ) disease with treatment effect on the right . at the time of salvage bt , 3.4 years after ebrt , his psa was 0.3 ng / ml . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , five years post - salvage bt , his dre was within normal limits and psa was 0.1 ng / ml . he had no acute or late grade 2 or higher gi or gu toxicities throughout . there was evidence of grade 2 ed after ebrt , which was unchanged after salvage bt with shim scores ranging from 8 - 11 without interventions . a 66 year - old caucasian male with presenting psa of 5.0 ng / ml , gs 7 ( 3 + 4 ) adenocarcinoma in the right base , mid and lateral margin and apex , and clinical t2a disease on dre . his psa nadir five years post - treatment was 0.7 ng / ml . a repeat biopsy at nine years post - treatment , at which time his psa was 2.1 ng / ml and his dre showed firmness on the right , demonstrated gs 7 ( 4 + 3 ) and 6 ( 3 + 3 ) disease in 3 cores on the right . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , 4.4 years after salvage treatment , his psa was 0.5 ng / ml and dre was within normal limits . he had late grade 2 ed following primary ebrt , which declined further after salvage bt with shim scores ranging from 5 - 10 , for which he used a vacuum - assisted device with success . a 52 year old caucasian male with presenting psa of 8.3 ng / ml , gs 6 ( 3 + 3 ) disease in the left apex , mid , base and lateral mid and base , and clinical t2a disease on dre . he was randomized on fccc irb # 02 - 602 to the conventional fractionation arm and received imrt to 76 gy in 38 fractions . the first biopsy at two years ( per # 02 - 602 protocol ) and second biopsy at four years , both showed prostatic adenocarcinoma with treatment effect . a final biopsy , five years post - treatment showed adenocarcinoma ( unable to be graded ) in 3 cores on the left . he underwent salvage bt , 5.3 years after ebrt , at which time his psa was 2.6 ng / ml . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , 3.4 years post - salvage treatment , after primary ebrt , he experienced grade 2 ed with shim scores of 20 with phosphodiesterase-5 enzyme ( pde-5 ) inhibitors . following salvage bt , his erectile function declined further with shim scores of 5 - 12 , and was subsequently referred to the ed clinic . a 46 year - old caucasian male with presenting psa of 10.4 ng / ml , gs 6 ( 3 + 3 ) adenocarcinoma in the left base and right base , mid and apex , and clinical t1c disease on dre . his psa nadir was 0.76 ng / ml , 5.5 years after completion of treatment . a repeat biopsy at 10.4 years post - treatment , at which time his psa was 2.46 ng / ml and there was firmness on dre , showed gs 7 ( 3 + 4 ) adenocarcinoma in 6 cores on the right . he also received 6 months of adt , beginning the day of his implant due to his gs 7 and high bulk disease . at his last follow - up 2 years after salvage treatment , his dre was within normal limits , psa was 0.4 ng / ml , and testosterone was 180 ng / dl . following primary ebrt , he had mild ed with a shim score of 19 , not requiring interventions . after salvage bt , his shim scores dropped to 5 on adt , but increased to 10 without medications by his last follow - up . a 57 year - old african american male with presenting psa of 4.7 ng / ml , gs 7 ( 3 + 4 ) and 6 ( 3 + 3 ) disease in the right mid , base , lateral apex and base , and clinical t2a disease on dre . he was randomized on fccc irb # 02 - 602 to standard fractionation , and received 76 gy in 38 fractions using imrt . his psa nadir at 2.3 years after completion of therapy was 0.4 ng / ml . he had two post - treatment biopsies , the first at two years ( per # 02 - 602 protocol ) , showing atypical small acinar proliferation . a repeat biopsy 6.7 years post - treatment showed gs 7 ( 3 + 4 ) and 6 ( 3 + 3 ) adenocarcinoma in 5 cores on the right . he underwent salvage bt 6.8 years post - treatment , at which time his psa was 3.09 ng / ml and his dre demonstrated a palpable abnormality . he received short - term adt for 6 months beginning the day of his implant due to gs 7 and high bulk disease . at his last follow - up 2 years post - salvage bt , his psa was 0.19 ng / ml and testosterone was 153 ng / ml , and dre was within normal limits . he experienced some acute grade 2 toxicities during primary ebrt , but no acute or late grade 2 or higher gi or gu toxicities following salvage bt . he had evidence of ed following primary ebrt with shim scores of 16 - 17 with use of a pde-5 inhibitor . after salvage bt , his erectile function was unchanged , with shim scores of 11 without and 16 with medications . a 66 year old caucasian male with presenting psa of 5.2 ng / ml , gs 6 ( 3 + 3 ) disease in the right base , mid and apex , and clinical t2a disease on dre . he was randomized to the hypofractionated arm of fccc irb # 02 - 602 , receiving 70.2 gy in 26 fractions using imrt . he had two post - treatment biopsies , the first at two years showing gs 6 ( 3 + 3 ) adenocarcinoma with radiation effect . a second biopsy at three years failed to show regression , with gs 6 ( 3 + 3 ) disease with treatment effect on the right . at the time of salvage bt , 3.4 years after ebrt , his psa was 0.3 ng / ml . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , five years post - salvage bt , his dre was within normal limits and psa was 0.1 ng / ml . he had no acute or late grade 2 or higher gi or gu toxicities throughout . there was evidence of grade 2 ed after ebrt , which was unchanged after salvage bt with shim scores ranging from 8 - 11 without interventions . a 66 year - old caucasian male with presenting psa of 5.0 ng / ml , gs 7 ( 3 + 4 ) adenocarcinoma in the right base , mid and lateral margin and apex , and clinical t2a disease on dre . his psa nadir five years post - treatment was 0.7 ng / ml . a repeat biopsy at nine years post - treatment , at which time his psa was 2.1 ng / ml and his dre showed firmness on the right , demonstrated gs 7 ( 4 + 3 ) and 6 ( 3 + 3 ) disease in 3 cores on the right . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , 4.4 years after salvage treatment , his psa was 0.5 ng / ml and dre was within normal limits . he had late grade 2 ed following primary ebrt , which declined further after salvage bt with shim scores ranging from 5 - 10 , for which he used a vacuum - assisted device with success . a 52 year old caucasian male with presenting psa of 8.3 ng / ml , gs 6 ( 3 + 3 ) disease in the left apex , mid , base and lateral mid and base , and clinical t2a disease on dre . he was randomized on fccc irb # 02 - 602 to the conventional fractionation arm and received imrt to 76 gy in 38 fractions . the first biopsy at two years ( per # 02 - 602 protocol ) and second biopsy at four years , both showed prostatic adenocarcinoma with treatment effect . a final biopsy , five years post - treatment showed adenocarcinoma ( unable to be graded ) in 3 cores on the left . he underwent salvage bt , 5.3 years after ebrt , at which time his psa was 2.6 ng / ml . brachytherapy and dosimetry details are shown in table 2 . at his last follow - up , 3.4 years post - salvage treatment , after primary ebrt , he experienced grade 2 ed with shim scores of 20 with phosphodiesterase-5 enzyme ( pde-5 ) inhibitors . following salvage bt , his erectile function declined further with shim scores of 5 - 12 , and was subsequently referred to the ed clinic . a 46 year - old caucasian male with presenting psa of 10.4 ng / ml , gs 6 ( 3 + 3 ) adenocarcinoma in the left base and right base , mid and apex , and clinical t1c disease on dre . his psa nadir was 0.76 ng / ml , 5.5 years after completion of treatment . a repeat biopsy at 10.4 years post - treatment , at which time his psa was 2.46 ng / ml and there was firmness on dre , showed gs 7 ( 3 + 4 ) adenocarcinoma in 6 cores on the right . he also received 6 months of adt , beginning the day of his implant due to his gs 7 and high bulk disease . at his last follow - up 2 years after salvage treatment , his dre was within normal limits , psa was 0.4 ng / ml , and testosterone was 180 ng / dl . following primary ebrt , he had mild ed with a shim score of 19 , not requiring interventions . after salvage bt , his shim scores dropped to 5 on adt , but increased to 10 without medications by his last follow - up . a 57 year - old african american male with presenting psa of 4.7 ng / ml , gs 7 ( 3 + 4 ) and 6 ( 3 + 3 ) disease in the right mid , base , lateral apex and base , and clinical t2a disease on dre . he was randomized on fccc irb # 02 - 602 to standard fractionation , and received 76 gy in 38 fractions using imrt . his psa nadir at 2.3 years after completion of therapy was 0.4 ng / ml . he had two post - treatment biopsies , the first at two years ( per # 02 - 602 protocol ) , showing atypical small acinar proliferation . a repeat biopsy 6.7 years post - treatment showed gs 7 ( 3 + 4 ) and 6 ( 3 + 3 ) adenocarcinoma in 5 cores on the right . he underwent salvage bt 6.8 years post - treatment , at which time his psa was 3.09 ng / ml and his dre demonstrated a palpable abnormality . he received short - term adt for 6 months beginning the day of his implant due to gs 7 and high bulk disease . at his last follow - up 2 years post - salvage bt , his psa was 0.19 ng / ml and testosterone was 153 ng / ml , and dre was within normal limits . he experienced some acute grade 2 toxicities during primary ebrt , but no acute or late grade 2 or higher gi or gu toxicities following salvage bt . he had evidence of ed following primary ebrt with shim scores of 16 - 17 with use of a pde-5 inhibitor . after salvage bt , his erectile function was unchanged , with shim scores of 11 without and 16 with medications . as evidence that local persistence of prostate cancer translates to the development of distant metastasis and disease - specific death mounts , the need for an effective salvage therapy is emphasized . local salvage therapy is potentially curative and advisable in healthy patients with local recurrence without metastases . re - irradiation with ebrt , however , is generally not advised due to concerns of insufficient conformity to spare surrounding normal tissues that have previously received tolerance dose . furthermore , the mechanism of radioresistance that resulted in persistent disease can prevail if a similar ebrt approach is used for salvage . few men undergo salvage radical prostatectomy with even the most experienced centers performing on average five or six cases per year . patient selection and preference are most likely the predominant factors , heavily influenced by a narrow risk - to - benefit ratio . common complications of salvage radical prostatectomy include urinary incontinence ( 30 - 73% ) , urethral strictures ( 0 - 30% ) , erectile dysfunction ( 29 - 72% ) , and rectal injury ( 0 - 35% ) , success rates are 50% [ 26 , 27 ] . utilization of cryosurgery is scarcer , with a comparable risk - to - benefit profile , but availability and expertise appears to be limited [ 28 , 29 ] . in general , bt provides at least a similar if not better risk - to - benefit ratio , because of reduced toxicity to the urinary tract . urinary incontinence rates following salvage prostatectomy and cryotherapy have been reported to be as high as 73 - 79% [ 26 , 27 , 3032 ] compared to 6 - 31% with salvage ldr bt [ 4 , 8 ] . several centers have reported their experience with salvage whole prostate ldr bt following ebrt to doses of 63 - 68 gy . in the early series by grado et al . and beyer et al . , . showed an 8-year actuarial freedom from relapse of 61.5% , whereas aaronson et al . reported a biochemical disease - free survival rate of 88% at 30 months . unfortunately , there are no reports of salvage ldr bt for patients treated in the era of ebrt dose - escalation . the goal of this technique was to provide a minimally - invasive procedure that would both limit the risk of toxicity in men treated to ebrt doses 76 gy in 2 gy fractions and provide equal efficacy to whole prostate salvage bt . central to this goal was selecting patients with limited post - ebrt toxicity , and who are most likely to have unilaterally recurrent disease . all the men reported here had little or no late gu toxicity following ebrt , and thus were ideal candidates . prior to salvage therapy , all patients had good rectal function , none required alpha - blockers , and the aua scores were low ( median 3 , range : 2 - 20 ) . patients in the series had either no evidence of bilateral disease upon initial diagnosis or a microfocus of low grade gs 3 + 3 disease , which definitive doses of ebrt of 76 gy should eradicate . the ideal bt dose for salvage therapy is undefined . in previous studies , the median prescribed salvage bt doses for ranged from 100 to 160 gy [ 47 ] . these salvage bt doses were used prior to the era of dose - escalated ebrt , and thus could only be applied to our patient population with caution . in addition , these series reported on whole prostate salvage bt , with no data to suggest appropriate doses for partial or unilateral salvage bt . given these considerations , a prescription dose of 110 gy was selected based upon extrapolation from the available literature , while being conservative as day 30 dosimetry is often higher . since higher salvage bt doses can lead to worse toxicity , we limited both the volume and dose . despite the smaller volume and lower dose in the current study , the coverage of the target volume was excellent with a median d90 of 118% . none of the patients experienced grade 2 or higher gi or gu toxicity and all had good biochemical response with no evidence of bf to date . high - dose - rate ( hdr ) bt may be a safer and more effective way of delivering partial salvage bt . the advantages of hdr are : 1 ) less dependence on the accuracy of needle placement compared to ldr ; 2 ) inverse treatment planning can allow the plan to be optimized on a case by case basis ; 3 ) the implant is temporary ; therefore , there is no concern over seed migration or need to repeat post - implant dosimetry several weeks later ; 4 ) radiation safety advantages compared to ldr , with less radiation exposure to personnel due to the remote afterloading technique , and 5 ) it also lends itself to fractionation , which may allow for even superior tumor control due to delivery of higher biologically effective doses . possible disadvantages of hdr bt are that it is a relatively newer technique with overall less experience and long - term toxicity data ; it produces more dose inhomogeneities within the treatment volume , and it often requires fractionation , which is less convenient for the patient . recently published the results of their phase ii study of salvage hdr alone after high dose ebrt . the biochemical relapse - free survival was 68.5% at 5 years with late grade 2 gi and gu toxicities of 8% and 48% , respectively , with minimal late grade 3 gu toxicity . as such , salvage hdr bt may become a more favorable option for local salvage therapy following dose - escalated ebrt in the future . preliminary follow - up suggests that partial salvage permanent prostate bt with i may be a safe and effective local salvage therapy following dose - escalated ebrt . to our knowledge , this is the first report of permanent ldr partial prostate bt . although short - term follow - up is encouraging , further study is needed to determine the long - term toxicity and effectiveness of this approach .
purposeto report outcomes on 5 patients treated with salvage partial low - dose - rate ( ldr ) 125-iodine ( 125i ) permanent prostate seed brachytherapy ( bt ) for biopsy - proven locally persistent prostate cancer , following failure of dose - escalated external beam radiotherapy ( ebrt).material and methodsa retrospective review of the fox chase cancer center prostate cancer database identified five patients treated with salvage partial ldr 125i seed implant for locally persistent disease following dose - escalated ebrt to 76 - 84 gy in 2 gy per fraction equivalent . all patients had post - ebrt biopsies confirming unilateral locally persistent prostate cancer . pre - treatment , ebrt and bt details , as well as post - treatment characteristics were documented and assessed.resultsthe median follow - up post - implant was 41 months . all five patients exhibited low acute genitourinary and gastrointestinal toxicities . increased erectile dysfunction was noted in three patients . there were no biochemical failures following salvage ldr 125i seed bt to date , with a median post - salvage psa of 0.4 ng / ml.conclusionsin carefully selected patients with local persistence of disease , partial ldr 125i permanent prostate seed implant appears to be a feasible option for salvage local therapy with an acceptable toxicity profile . further study is needed to determine long - term results of this approach .
fabry disease ( fd ) is a x chromosome - linked inherited lysosomal storage disorder , due to partial or complete deficient activity of the enzyme -galactosidase a caused by different x - chromosomal recessive mutations in the galactosidase gene . the decrease or absence of enzyme activity results in progressive accumulation of neutral glycosphingolipids in various organ systems , preferentially in the vascular endothelium and in smooth muscle cells , leading to microangiopathy , vessel occlusion , and ischemic tissue damage . in the first two decades , neuropathic pain , hypohydrosis , gastrointestinal symptoms and angiokeratoma are the clinical hallmarks . lifespan is shortened by late complications in adulthood , mainly caused by heart failure , renal dysfunction and cerebrovascular involvement ( premature strokes and white matter lesions ; wml ) . clinical symptoms of fd are associated with significant impact on quality of life ( qol ) . the reduction in qol in fd patients chronic fatigue is a frequent and early finding in fd patients with a significant impact on qol . although a common symptom in patients with chronic renal or cardiac dysfunction , chronic fatigue also appears in fd patients in whom renal or cardiac involvement has not been manifested . despite much research recent studies have demonstrated an association between cerebral white matter changes and sleep - disordered breathing , which may contribute to excessive daytime sleepiness ( eds ) and subjective measures of daytime fatigue . severe progressive cerebral wml are frequent findings in fd and occur from an early age . it may therefore be speculated that eds is a frequent and under - diagnosed feature of fd , often falsely regarded as chronic fatigue . we present an instructive case of eds in a fd patient from our sleep laboratory with severe leukoaraiosis . to better determine the frequency of daytime sleepiness and its impact on qol in fd , we consecutively evaluated the prevalence of eds in a biochemically and genetically proven group of fabry patients and assessed possible associations with multiple organ involvement . a 56-year - old caucasian female fd patient was admitted to our sleep laboratory because of eds . the diagnosis of fd was confirmed 4 years ago ( by measurement of enzyme activity and molecular genotyping ) , but she had suffered from neuropathic pain and hypohidrosis since she was 15 . echocardiograhy , kidney function tests , and routine biochemistry showed normal results , excluding severe cardiac or renal involvement twenty - four - hour blood pressure levels were unrevealing ( mean systolic / diastolic pressure 109/78 mm / hg ) , with a mean arterial pressure of 99 mm hg and preserved nocturnal dipping . an eeg was normal , nerve - conduction velocities and extra- and transcranial duplex - ultrasonography showed no pathological findings . the patient had a pathological epworth sleepiness scale ( ess ) score of 20 ( normal < 10 ) and a decreased multiple sleep latency test ( mslt ) score of 4.6 min ( normal > 10 min ) . qol was measured using the sf-36 health - related quality of life survey ( http://www.sf36.org ) . two summary scores are computed to reflect the physical or mental domains of health - related qol : physical component summary ( pcs ) and mental component summary ( mcs ) . polysomnography ( overnight recording of sleep - wake cycles , electrocardiogram , electroencephalogram , electromyogram , oronasal air flow , chest wall and abdominal wall effort , and pulse oximetry ) showed a cheyne - stokes respiration pattern characterized by periodic breathing with recurrent episodes of central apneas and hypopneas , alternating with hyperpneas and characteristic crescendo - decrescendo pattern of tidal volume ( fig . 1 , upper row ) . the central apnea / hypopnea index was 64/h ( pathologic : > 10/h ) and respiratory arousal index was 46/h ( pathologic : = 5 arousals per total sleep time ) , with repeated oxyhemoglobin desaturations up to 65% . subsequently , an mri showed confluent hyperintense regions on flair- and t2-weighted mri sequences , and corresponding decreases of signal on t1-weighted images bilaterally in the cerebral white matter , with substantial brainstem involvement ( fig . after a comprehensive history by interview and searching of patients documents , recording of clinical data of 49 fd patients ( 27 males ; mean age 43 years ; range 16 - 72 years ) were assessed by a standardized questionnaire . to determine severity , patients were classified according to the previously described mainz severity score index ( mssi ) . the mssi is then divided into severity bands of mild ( < 20 ) , moderate ( 20 - 40 ) and severe ( > 40 ) affliction . furthermore , sleepiness , fatigue and qol were measured using the ess , fatigue severity scale , and the sf-36 . we compared the sf-36 scores of the present study with those of a large ( n = 2911 ) german general population group . for between - group comparisons , correlations between the findings were tested by calculation of pearson 's correlation coefficient . to evaluate predictors of qol , multiple stepwise regression analyses were conducted using the pcs and the mcs of the sf-36-survey as dependent variables . demographic ( age , gender , years of ert , age of diagnosis ) and clinical data ( number of affected organs , mssi - scores , and fss- and ess - values ) were tested as independent variables . the average clinical stage of patients was mild to moderate , and male and female patients were comparably affected . neurological features were also the earliest to develop , beginning at an average age of 18 years . abnormal renal function ( proteinuria ) was present in 29% , but end - stage renal failure with the need of hemodialysis was present in only 6% of patients . dermatological and gastrointestinal symptoms of fd were also common and reported by 61 and 41% , respectively . pathological ess ( = 10 ) and fss ( = 5 ) scores were established in 68 and 48% of fd patients , respectively . patients with pathological daytime sleepiness ( mean ess 14 3 ) were slightly younger ( 42 12 vs. 45 13 years , p < 0.007 ) than patients without daytime sleepiness ( mean ess 7 3 ) , reported a longer total sleep time ( 7.35 1.08 vs. 6.95 0.85 h / night , p < 0.03 ) , and had more difficulties in maintaining sleep ( 19.3 4.8% vs. 14.4 3.9% , p < 0.005 ) . the mean body mass index ( bmi ) was 27.6 kg / m ( 6.0 ; normal < 25 kg / m ) and did not differ between patients with or without pathological daytime sleepiness . thirty - one percent of patients had a history of recurrent snoring , which was within the reported range of habitual snorers in the normal population , and 41% of fd patients reported recurrent napping during the day . sixty - two percent of fd patients reported pathological fatigue without overlap of sleepiness , and only 11% reported pathological sleepiness without overlap of fatigue . pearson 's correlation analysis indicated a weak association ( r = 0.18 ) between subjective fatigue and sleepiness in the total sample . no significant correlations were found between clinical ( mssi and subscores , number of affected organs ) or demographic ( age , gender , years of ert , age of diagnosis ) data and ess or fss scores . there were no significant differences among patients with or without renal or cardiac involvement or stroke with regard to ess and fss scores . compared to the general population , both females and males with fd showed consistently impaired qol , as assessed using the sf-36 data ( table 1 ) . the only mean sf-36 scores above 67 were the role emotional score and the mental health score . in summary , the pcs and mcs were significantly decreased ( p < 0.01 and p < 0.05 , respectively ) , compared to a german reference population ( n = 2,911 ) . the pcs correlated inversely with the number of affected organs ( r = 0.23 ; p < 0.05 ) , the renal ( r = 0.34 ; p < 0.05 ) , neurological ( r = 0.32 ; p < 0.05 ) and total ( r = 0.39 ; p < 0.05 ) mssi scores , and with ess ( r = 0.42 ; p < 0.001 ) and fss ( r = 0.38 ; p < 0.01 ) values . the mcs correlated significantly with fss ( r = 0.44 ; p < 0.05 ) and ess ( r = 0.42 ; p < 0.01 ) values and with age ( r = 0.31 ; p < 0.05 ) . on multiple stepwise regression analyses ( table 2 ) ess , age and the total mssi values were independently associated with the pcs of the sf-36 data ( corrected r = 0.323 ; p < 0.001 ) , and ess and age explained a quarter of variance in mcs ( corrected r = 0.253 ; p < 0.001 ) . the largest group of disorders causing daytime sleepiness consists of sleep - related disturbances of breathing , where neuroregulatory mechanisms play a major role in pathophysiology . recent studies demonstrated an association between change in white matter grade and measures of central sleep apnea that was consistent with a causal pathway in which central sleep apnea contributes to the progression of white matter disease . as a structural basis , an affection of brain regions associated with autonomic and respiratory control - as they are classically represented in the brain stem - has been suggested . in patients with fd , cerebral vasculopathy as a result of progressive sphingolipid deposits in the vascular endothelium and vascular smooth muscle has been confirmed by neuropathologic , neuroradiologic and functional studies , and occurs frequently at a rather early age . accordingly , cerebral wml are frequent findings in cranial mri of fd patients . in a brain - imaging study of 50 fd patients , who had a mean age of 33 years additionally , early and widespread ultrastructural cerebral changes in fd patients have been detected using advanced mri techniques such as diffusion tensor imaging [ 2 , 10 ] . central sleep apnea due to cerebral vasculopathy might be the underlying pathomechanism of eds in fd . although one can only draw limited conclusions from one case report , our findings of a fd patient with severe eds and confluent wml including the brain stem , but without renal or cardiac involvement , support this hypothesis and suggest that not only are cerebral white matter changes present in fd patients , but also that these may be relevant for the initiation of clinical symptoms . with a frequency of 68% , eds exceeds the prevalence of other common symptoms of fd in our consecutively investigated patient group . moreover , eds significantly impairs qol , independently of cardiac , renal or neurological involvement . even though recurrent acroparesthesia , cerebrovascular events , hemodialysis or cardiac dysfunction could lead to some sleep disturbance , this would not explain the high prevalence rate of eds . although chronic fatigue is a frequently reported symptom of patients with fd , this is the first study showing a high prevalence of eds in this patient group . one reason for this might be that sleepiness and fatigue are conceptually distinct but pervasively confounded in research , clinical settings , and everyday spoken language . the pathophysiology of chronic fatigue remains unknown and many of the postulated etiologies of chronic fatigue syndrome affect sleep . thus , eds and fatigue have overlapping features , which can lead to imprecise diagnostic formulations and subsequent suboptimal intervention and management decisions . for example , it has long been known that fatigue , rather than sleepiness , is correlated with the experience of insomnia . even patients with obstructive sleep apnea complain of fatigue , tiredness , and lack of energy . due to the relative dichotomy between sleepiness and fatigue and the underemphasis of fatigue as an independent consequence of sleep disorders by many health professionals , the specific daytime sleepiness features of sleep apnea this may result in an underdiagnosis of sleep disorders , especially when fatigue rather than sleepiness is emphasized as the chief complaint . recent studies have indicated that patients with chronic fatigue had a very high incidence of previously undiagnosed primary sleep disorder such as sleep apnea / hypopnea syndrome [ 12 , 13 ] . additionally , narcolepsy and chronic fatigue patients were found to be similar on psychological adjustment . these data support the hypothesis that primary sleep disorders in individuals with chronic fatigue are underdiagnosed in primary care settings . although a significant portion of patients in this study reported pathological fatigue without overlap of sleepiness , only 9% reported pathological sleepiness without overlap of fatigue . thus , it is tempting to speculate that a substantial part of fd patients suffers from undiagnosed eds , potentially caused by a treatable primary sleep disorder , which confounded the explicit fatigue questionnaire . however , this is the first report addressing an association of eds and fd and , therefore , we believe that this symptom may have been considerably underestimated in fd patients . since chronic fatigue syndrome is reported as a common symptom in various chronic diseases , such as malignant , infectious , neuromuscular , or rheumatologic disease , and since most studies have not explicitly considered a treatable primary sleep disorder when evaluating their patients , many of them may suffer from eds rather than from chronic fatigue . particularly patients with an involvement of the central nervous system , which is a frequent finding in many chronic diseases [ 14 , 15 ] , have an increased risk for sleep - related breathing disorders . however , this assumption remains hypothetic , and formal polysomnographic sleep studies are required to examine this issue . in conclusion , our results stress that eds is a common and - in the present literature - underdiagnosed symptom in fd patients , accompanied by a significant impact on qol . further studies with a larger number of patients are needed to verify the frequency of eds in patients with fd . therefore , continuous polysomnographic recordings of fd patients are required , preferably in combination with cerebral mri . with a view to the existing effective therapies of eds due to nocturnal breathing disorders , and its enormous impact on qol , clinicians should be aware of this symptom as an additional characteristic feature in fd patients .
fabry disease ( fd ) is an x - linked lysosomal storage disorder characterized by a deficient activity of the enzyme -galactosidase a , resulting in a vasculopathic involvement of various organ systems , e.g. cerebral structures . marked cerebral vasculopathy with subsequent white matter lesions ( wml ) are a frequent finding in fd patients . recent studies discussed an association between cerebral white matter changes and sleep - related disturbances of breathing , which may lead to excessive daytime sleepiness ( eds ) . a 56-year - old caucasian female fd patient with eds was admitted to our sleep laboratory . overnight polysomnography showed a cheyne - stokes respiration pattern with significant o2 desaturation . mr imaging revealed confluent wml including the brain stem , but no renal or cardiac involvement . we then evaluated the clinical data of 49 genetically proven fd patients ( 27 males ; mean age 43 years ) from our fd centre . with a frequency of 68% , eds exceeds the prevalence of other common symptoms of fd ( angiokeratomas 61% ; acroparaesthesia 51% ; renal involvement 29% ; cardiac involvement 27% ) , and the prevalence of chronic fatigue ( 48% ) . eds was independently associated with the physical component summary of the sf-36 data ( corrected r2 = 0.323 , p < 0.001 ) . eds and age explained a quarter of variance in mental component summary ( corrected r2 = 0.253 , p < 0.001 ) . we conclude that eds is a common and underdiagnosed symptom in fd patients , accompanied by a significant impact on quality of life . eds might be caused by central breathing disorders due to an affection of brain regions associated with respiratory control in fd .
the current west africa epidemic of ebola virus disease ( evd ) , which began from guinea in december 2013 , has been the longest and deadliest ebola outbreak to date . ebola 's method of transmission makes it amenable to containment by coordinated efforts from the public health community worldwide . those efforts include measures to keep citizens informed to prevent further spread and undue panic . however , with the propagation of the internet , public health officials must now compete with other official and unofficial sources of information to get their message out . in view of these concerns , we attempted to critically appraise videos available on one popular internet video site ( youtube ) as a source of information for evd . ebola outbreak from inception to november 1 , 2014 using the default relevance filter . ebola outbreak was selected as the search term after sampling around 50 youtube videos related to the ebola outbreak . we included english language videos with primary content related to evd with 10 min duration and restricted the search results to the first 10 pages [ figure 1 ] . two independent reviewers classified videos as useful ( containing scientifically correct information about any aspect of the disease : epidemiology , symptoms , treatment , prevention ) or misleading ( containing at least one scientifically unproven information , e. g. , evd as man - made conspiracy or depopulation strategy ) using a previously validated method . we extracted the title , length , number of views , number of likes / dislikes , author and date uploaded for the videos . cdc , who , red cross , ngo / ingos , academic health institutions / hospitals , news agencies and independent users ) . continuous and categorical variables were analyzed using the student t - test and chi - squared test , respectively . ibm spss statistics for windows , version 21.0 ( armonk , ny : ibm corp ) was used for the data analyses . flow chart showing systematic video search and selection process of the 198 videos screened , 118 videos met the inclusion criteria . 31 ( 26.27% ) videos were classified as misleading and 87 ( 73.73% ) videos were classified as useful . the kappa coefficient of agreement regarding the usefulness of the videos was 0.68 ( p < 0.001 ) . there were no statistically significant differences in the mean number of views , mean number of likes , mean number of days on youtube between the two groups [ table 1 ] . the mean length of videos classified as misleading was longer than those classified as useful ( 6.44 vs 4.11 minutes , p < 0.001 ) . independent users were more likely to post misleading videos ( 93.55% vs 29.89% , or = 34.02 , 95% ci = 7.55 - 153.12 , p < 0.001 ) whereas news agencies were most likely to post useful videos ( 65.52% vs 3.23% , or = 57.00 , 95% ci = 7.40 - 438.74 , p < 0.001 ) [ table 1 ] . examples of fallacious statements recorded from the misleading videos are given in supplementary table 1 . detailed characteristics of the misleading and useful youtube videos analyzed statements recorded from the youtube videos classified as misleading click here for additional data file . our study shows that majority of the internet videos about ebola on youtube were characterized as useful . the popularity of the videos ( as measured by number of views and likes / day ) between misleading and useful videos was similar . studies in the past on the role of youtube as a source of information for h1n1 influenza and immunization have found similar results . most videos uploaded from news agencies contained correct scientific information . the who and cdc were under - represented in the identified video collection ( although often quoted in news agency videos ) suggesting that those groups do not have immediate primary access to a majority of internet users who use youtube as a source of information . although youtube seems to generally be a useful source of information on the current outbreak , official health agencies should redouble their efforts to disseminate scientifically correct information on ebola on sites such as youtube and prevent unnecessary panic among the general population .
background : the current west africa epidemic of ebola virus disease ( evd ) , which began from guinea in december 2013 , has been the longest and deadliest ebola outbreak to date . with the propagation of the internet , public health officials must now compete with other official and unofficial sources of information to get their message out.aims:this study aimed at critically appraising videos available on one popular internet video site ( youtube ) as a source of information for ebola virus disease ( evd).materials and methods : videos were searched in youtube ( http://www.youtube.com ) using the keyword ebola outbreak from inception to november 1 , 2014 with the default relevance filter . only videos in english language under 10 min duration within first 10 pages of search were included . duplicates were removed and the rest were classified as useful or misleading by two independent reviewers . video sources were categorized by source . inter - observer agreement was evaluated with kappa coefficient . continuous and categorical variables were analyzed using the student t - test and chi - squared test , respectively.results:one hundred and eighteen out of 198 videos were evaluated . thirty - one ( 26.27% ) videos were classified as misleading and 87 ( 73.73% ) videos were classified as useful . the kappa coefficient of agreement regarding the usefulness of the videos was 0.68 ( p < 0.001 ) . independent users were more likely to post misleading videos ( 93.55% vs 29.89% , or = 34.02 , 95% ci = 7.55 - 153.12 , p < 0.001 ) whereas news agencies were most likely to post useful videos ( 65.52% vs 3.23% , or = 57.00 , 95% ci = 7.40 - 438.74 , p < 0.001).conclusions : this study demonstrates that majority of the internet videos about ebola on youtube were characterized as useful . although youtube seems to generally be a useful source of information on the current outbreak , increased efforts to disseminate scientifically correct information is desired to prevent unnecessary panic among the among the general population .
dental implants are used widely in clinical dentistry today to restore partial or complete edentulism . the longevity of the implants and the supported restoration depend on a great degree of the careful evaluation of clinical parameters , the proper design of the treatment plan and its precise execution . modern techniques and new protocols offer predictable solutions in almost any therapeutic intervention by solving functional problems and achieving at the same time an aesthetic result . the interdisciplinary approach of the described clinical report emphasizes the need for " restoration guided " implant rehabilitation through the preoperative establishment of the final therapeutic goal on the diagnostic casts . the planned restoration must be tested and either accepted or modified in the clinical environment in order to guide the correct position of the dental implants which in turn allow their proper restoration . in the described clinical case the following problems could be identified : the disturbance of the occlusal plane , the lack of anterior guidance , the reduced vertical dimension , the reverse smile line , the missing teeth and the unaesthetic appearance . both the presence of severe anatomical deficits and a faulty prosthesis were acting in synergy to create a major problem for the patient who was complaining for limited function , aesthetics and phonetics . american college of prosthodontists ( acp ) has developed a classification system ( i - iv ) for the partial edentulism based on diagnostic criteria and according to that the patient described herein presents a class iv edentulism which is characterized by severely compromised location and extent of edentulous areas . the diagnosis of the aforementioned clinical findings necessitates the re - establishment of the missing guidelines through the diagnostic arrangement of artificial teeth and the clinical testing of provisional restorations that set the framework for the next clinical level . the hard and soft tissue deficiency is a limiting factor for the prosthetic restoration and any surgical attempt to correct the anatomic foundation needs to be precisely executed for optimal results . the purpose of this paper is to describe the clinical steps that are needed to confirm the treatment plan and allow its proper execution . team - work and basic principles are emphasized in a step - by - step description of clinical methods and techniques . the patient was a 40 year old caucasian male who had lost his maxillary teeth from the right canine ( tooth # 13 ) to left first molar ( tooth # 26 ) at the age of 19 due to an accident . he wore a removable partial denture in the maxilla since that age and sought treatment to improve function and aesthetics . the existing fixed partial denture in the mandible was extending from the right first premolar ( tooth # 44 ) to the right third molar ( tooth # 48 ) and the mandibular left first and second molars were missing ( figure 1 ) . the patient 's past medical history was negative , he has never been hospitalized , not currently under any medication and smoking habits were absent . a record base with a wax rim was initially used to record the centric relation and along with a face - bow transfer of the maxillary cast they were used to ensure the accurate mounting on the articulator ( figure 2 ) . the conventional methods and techniques employed in the removable prosthodontics were used to shape the wax rim and determine the occlusal plane and the vertical dimension of occlusion ( vdo ) . the clinical trial of the maxillary missing teeth at the determined vdo revealed their dramatic effect on the improvement of the facial aesthetics but the patient had to go through a transitional period to assess the proposed treatment plan . for this reason a maxillary splint in the form of a provisional removable partial denture ( rpd ) was delivered to the patient for a period of two months and was accompanied with a metal reinforced provisional acrylic fixed partial denture extending from mandibular right first premolar to third molar ( figure 3 ) . no clinical signs and symptoms for the patient were recorded at the end of the trial period and the validity of the therapeutic goal was initially confirmed . the treatment options involved the fabrication of a maxillary rpd or an implant supported fixed prosthesis . the patient expressed the wish for a fixed metal ceramic restoration and the treatment plan of implant insertion was initiated . the patient should go through a surgical phase to augment the maxillary ridge and render it suitable for implant insertion . computed tomography assessment revealed bone deficiency in height and width ( figure 4 ) . in order to better evaluate the amount of bone and the shape that it had to be given , a presurgical evaluation was performed in the following way : the arrangement of the denture teeth was duplicated and stabilized on the cast with wax without any base plate . removal of the denture teeth and processing of the remaining stabilizing wax " ridge " in clear acrylic provided a solid duplicate of the bony graft ( figures 5678 ) . this solid duplicate allowed for the exact dimensions of the bone graft which was harvested from the area of mandibular symphysis . a cortical bone graft was removed from the donor site between the mental foramina and divided in two uneven pieces . all the cancellous bone up to the lingual cortical plate was removed using osteotomes and surgical curettes . the donor side was refilled with a xenograft ( bio - oss , geistlich , wolhusen , switzerland ) and was covered with a collagen type resorbable membrane ( bio - gide , geistlich , wolhusen , switzerland ) . the flaps over the donor side were sutured in a two layer fashion using resorbable sutures . the recipient deficient areas of the maxilla were properly prepared and the two cortical bone grafts were stabilized using bone screws . the larger cortical block was placed on the left side and the smaller one on the right side . all the empty spaces around the grafts were filled with a mixture of autogenous bone graft and a xenograft ( bio - oss geistlich , wolhusen , switzerland ) , in an effort to shape the reconstructed maxilla according to the solid duplicate of the " wax " ridge . elkton md , usa ) covered the grafted sites and were stabilized with pins , 1.2 mm in diameter . at the same time a maxillary sinus augmentation operation using lateral window approach was performed and the area was filled using a mixture of autogenous bone graft and xenogenic grafting material ( bio - oss , geistlich , wolhusen , switzerland ) . therefore after the proper wound margins adaptation the surgical area was sutured using 4 - 0 vicryl resorbable sutures ( ethicon , w. somerville , nj , usa ) . the procedure was performed under local anaesthesia with intravenous sedation and the postoperative period was uneventful . the rpd was relined with a tissue conditioning material visco - gel ( dentsply , konstanz , germany ) every 2 weeks for the entire healing period , to reduce pressure effects on the grafted site . removable partial denture teeth arrangement is transferred with a silicone key on a duplicate of the maxillary working cast and stabilized with wax only . after 5 months , the non - resorbable membrane on the right side was exposed . since there were no signs of infection and this happened almost at the end of the sixth month healing period , it was decided not to remove the membrane at that time , but to wait for an additional month while evaluating the grafting procedure with a new computed tomography and the clear duplicate of diagnostic teeth arrangement ( figures 9,10 ) . at that time , there were no signs of numbness of the lower anterior teeth or the lip . the patient was instructed in proper oral hygiene and when the healing period of 6 months was completed , a new impression of the augmented maxilla was made and the previously used diagnostic arrangement of denture teeth was adapted to the new tissue surface with wax and stabilized with a palatal base plate . clinical trial in the patient 's mouth ( figure 11 ) confirmed the correct position of the teeth and its duplication in heat cured clear acrylic provided a radiographic template ( figure 12 ) . radiopaque markers were inserted in the palatal or occlusal surfaces of all missing teeth and a computed tomography was performed . the analysis of the tomograms , the evaluation of the grafted ridge and the consideration of the final prosthesis design , set the guidelines for implant position modifications and led to the fabrication of the surgical guide for implant placement . upon completion of the preoperative work up the patient underwent the second surgical procedure . the screws , the pins and the non - resorbable membranes were removed from the grafted sites and five brnemark system implants ( nobel biocare ab , gteborg , sweden ) were inserted in the maxillary edentulous segment and four implants bilaterally in the mandible ( figure 13 ) . all implants were submerged and the surgery was performed under local anaesthesia with intravenous sedation . the second stage surgery was performed five months later and all implants were osseointegrated . removable partial denture teeth arrangement is transferred to the augmented maxilla with a record base for the evaluation of teeth position and soft tissue deficiency . implant impression was followed by fabrication and mounting of the working casts which allowed the final evaluation of implant inclination , interocclusal space and amount of soft tissue deficiency that had to be built into the final prosthesis . two modified temporary cylinders were attached to the implants and allowed the clinical try - in of the initial teeth set - up ( figure 14 ) . the correct teeth position was confirmed again and a silicon key was then fabricated to guarantee the exact reproduction in porcelain . metal framework was tried in for passivity , followed by bisque bake check and the final glazed prosthesis was made in two segments : 1 ) a primary base with built - in metal abutments veneered with pink composite ( gc gradia gum , gc , tokyo , japan ) and 2 ) a secondary pfm prosthesis apically covered with pink porcelain that was cemented to the primary base with temporary cement and secured with a small occlusal screw ( figures 15 - 17 ) . restoration of the mandible with fixed prostheses , in conjunction with maxillary restoration allowed for correction of occlusal plane and improvement of function and aesthetics . this clinical report emphasizes the importance of presurgical planning for the complex implant rehabilitation , presenting the correct application of clinical methods usually employed in the treatment of complete edentulism . analysis of teeth and base of the transitional removable prosthesis gave the opportunity to evaluate separately the position of the teeth and the hard and soft tissue deficiency . the surgical guide presented herein allowed the exact harvesting and the correct shaping of the grafting material generating the bone substrate for the implant placement at a later time . autologous bone grafts are the gold standard for the restoration of atrophic mandible and maxilla and implant placement is more predictable when it takes place secondarily after 6 - 9 months . there are various extraoral or intraoral donor sites for the bone graft . in this clinical case , the amount of necessary bone graft dictated by the ridge wax duplicate could be adequately replaced using an intraoral block graft instead of necessitating extraoral graft harvesting . besides the area of the mandibular symphysis another possible intraoral donor site is the ramus and the external oblique line of the mandible . we decided not to operate and intervene in an area that implants were planned to be inserted later . although resorption of onlay grafts occurs at various rates depending on the donor site and the technique employed , the success rate of the implants inserted secondarily is not affected ; and vice versa implant failure does not imply failure of the bone graft . according to the literature , if there is an exposure of a non - resorbable membrane , various amounts of bone loss are expected in the reconstructed area . in this clinical report , exposure of the membrane happened at the end of the healing period and was not an influencing factor . rather , the atrophy of the maxilla was so extreme initially and difficult to be compensated precisely and predictably , that ended in a small hard and soft tissue deficiency at the initiation of the prosthetic restoration phase . such clinical situations can be restored with a removable or fixed prosthesis . however , in augmented bone , fixed restorations present higher success rates compared to removable prostheses . the advantages of a two segment fixed prosthesis have been described in the past with various designs and retention configurations [ 13 - 15 ] . dividing the prosthesis into two pieces allows for better control of metal distortion during porcelain application and almost eliminates the occlusal disturbance of the screws ' exit . the palatal set screw incorporated into the prosthesis further enhances the confidence of cement retention yet allowing retrievability . with the two piece framework design the primary base acts as a splint for the maxillary implants dissipating the functional loading in a more favourable and protective pattern into the grafted bone . the veneering of the primary base with pink resin allows easier modification and repair of the emergence profile of the prosthesis in the event of tissue resorption . restoration of the mandibular edentulous spaces that was performed at the same time , allowed the occlusal plane correction , posterior support and improved function and aesthetics . clinical approach and prosthesis design described above offers a predictable way to restore partial edentulism with a fixed yet retrievable prosthesis , restoring soft tissue and teeth and avoiding an implant supported overdenture .
abstractbackgroundthe hard and soft tissue deficiency is a limiting factor for the prosthetic restoration and any surgical attempt to correct the anatomic foundation needs to be precisely executed for optimal results . the purpose of this paper is to describe the clinical steps that are needed to confirm the treatment plan and allow its proper execution.methodsteam work and basic principles are emphasized in a step - by - step description of clinical methods and techniques . this clinical report describes the interdisciplinary approach in the rehabilitation of a partially edentulous patient . the importance of the transitional restoration which sets the guidelines for the proper execution of the treatment plan is especially emphasized along with all the steps that have to be followed.resultsthe clinical report describes the diagnostic arrangement of teeth , the ridge augmentation based on the diagnostic evaluation of the removable prosthesis , the implant placement with a surgical guide in the form of the removable partial denture duplicate and finally the special 2-piece design of the final fixed prosthesis.conclusionsclinical approach and prosthesis design described above offers a predictable way to restore partial edentulism with a fixed yet retrievable prosthesis , restoring soft tissue and teeth and avoiding an implant supported overdenture .
globally , oral cancer has emerged as an important cause of global public health concern . world health organization ( who ) has estimated that the incidence of oral cancer varies from1 to 10 cases per 100,000 people in most of the countries . further , it has been realized that more than 50% of oral cancer patients access services in the advanced stages of disease . however , an inequitable distribution of the oral cancer has been observed due to the prevalence of disease - specific risk factors , socioeconomic factors , regional differences in demographic parameters of the population , and accessibility & availability of cost - effective screening and diagnostic measures . although both dentists and medical doctors can diagnose oral cancer in the early stages , dentists have usually more opportunities in these cases , as most of the people have frequent dental examinations . according to the study performed by vazquez - mayoral et al in mexico , 52% of dentists paid attention to find cancerous lesions in their oral examination . early diagnosis of precancerous and dysplastic oral lesions is a perennial goal and the preliminary steps to reach this goal are finding the risk factors and complete evaluation of head and neck region [ 5 - 7 ] . some of the known risk factors of the oral cancers include different kinds of tobacco such as cigar , cigarette , pipe and smokeless tobacco , alcohol , oxidative injuries caused by inappropriate life style and nutritional habits , viruses such as hsv and hpv and the sunlight . if the lesions are diagnosed and treated in early stages , higher survival rate is anticipated . some of the most common precancerous lesions in the oral cavity are leukoplakia , nicotinic stomatitis , erythroplakia , erythroleukoplakia and smokeless tobacco keratosis . if a cancerous lesion is diagnosed in primary stages , the survival rate would be higher . thus , the aim of this study was to evaluate knowledge , attitude and practice of dentist regarding oral cancer in sari , iran . the first part included the demographic characteristics of the dentists such as sex and age and the second part consisted of 13 , 7 and 9 questions about knowledge , attitude and practice regarding oral cancer , respectively . to ensure confidentiality , validity of the questionnaire was assessed by an oral pathologist , a specialist of oral disease and an oral and maxillofacial surgeon . reliability was determined by cronbach s alpha test ( =0.79 for knowledge , =0.84 for attitude , =0.72 for practice ) . regarding the knowledge , three positive scores were assigned for each correct answer and a negative score for each incorrect one . quantitative data were reported as mean ( sd ) and qualitative data were shown as percent . kolmogorov- smirnoff sample test was used to show normal distribution and in the case of normality , t - test was used to compare the groups ( p<0.07 was considered statistically significant ) . otherwise , an equivalent nonparametric test was used . to evaluate the relation of qualitative and quantitative variables , spearman s rho test was used . mean age of the dentists was 40.687.2 at the range of 27 to 63 years . among the respondents , 38(30.6% ) tables 1 , 2 and 3 show the answers to the questions regarding knowledge , attitude and practice . regarding knowledge , the lowest scores were -1 and -3 and the highest were + 39 and 35 in females and males groups , respectively . total mean score of knowledge , mean score of females and mean score of males was 20.888.53 , 20.967.62 and 20.7110.43 , respectively . t - test have shown that the difference between males and females was not statistically significant ( p>0.07 ) . spearman s rho test has shown that there was no correlation between the age of the respondents and the achieved score in the questions of knowledge . the results of this study have shown that the overall level of knowledge of the dentists is low . this is in agreement with the studies of clovis and motallebnejad [ 10 , 11 ] . probably , the importance of oral cancer is not well understood in the undergraduate period and dentists self - study after graduation is not sufficient . in this study , 81.2% of the dentists introduced squamous cell carcinoma ( scc ) as the most common cancer of the oral cavity . the similar question was answered correctly by 78% of the dentists in the study of motallebnejad et al and 50% in the study of guiseppe et al [ 11 , 12 ] . in current study , 59.6% selected the tongue as the most common site of oral cancer and 58.8% pointed the floor of the mouth as the second common site . correct answer was pointed by 56.5% of respondents in the study of motallebnejad et al.and 50% in the study of canto et al . [ 11 , 13 ] . according to the respondents of the current study , several sessions of retraining were helpful in increasing their knowledge about the most common cancer and site of cancer in oral cavity . normally , by increase in age and time passed after graduation , knowledge should decrease ; but it was not true in our study . again , this can be contributed to attending to retraining courses about oral cancer . in these courses , another probable reason for this finding can be relatively low mean age of the dentists which was about 40 years . among the respondents , 84% formed a file for their patients while 31.6% sometimes recorded the family history of cancer and 38.8% never did this . also , 46% of the respondents always recorded the history of smoking and addiction while 26.6% never did this . these together mean that the dentists do not have enough information about risk factors of cancer . fifty percent of the respondents always examined all parts of the oral cavity while 9.6% never did this . in the study performed by seoane et al . 87% of the dentists examined all parts of the oral cavity and the figure was 85% and 52% in the studies of gajendra et al and vazquez - mayoral et al . in the current study , 60.4% of the respondents believed that diagnosis of premalignant and malignant oral lesions are in the field of a dentist while just 25% mentioned that it is in the field of an ear , nose and throat specialist . comparing the figures to the study of vazquez - mayoral et al , in which 83% of the dentists thought themselves responsible for diagnosis of malignant lesions , shows inadequate training in the field of diagnosis of oral cancer . collectively , the results of current study show inadequate knowledge of dentists regarding oral cancer . a useful tool to improve their knowledge can be holding continuous seminars about oral cancer and assigning a kind of privilege for the participants can be a motivating factor . the dentists role in diagnosis of oral cancer should be mentioned in these seminars and the dentists should be encouraged to seek more information in this field . media can play an important role by giving more information to the society . by this way people based on the results of this study , dentists of sari do not have enough knowledge about oral cancer . based on the results of this study , dentists of sari do not have enough knowledge about oral cancer .
backgroundoral cancer has emerged as a significant cause of global public health concern . if a cancerous lesion is diagnosed in primary stages , the survival rate would be higher . thus , the aim of this study was to evaluate knowledge , attitude and practice of general dentist regarding oral cancer in sari , iran.methodsthis cross sectional analytical study was performed on general dentists of sari , iran . the dentists were given a questionnaire including demographic characteristics of the dentists and questions about knowledge , attitude and practice regarding oral cancer . data were subjected to spss 18.0 . quantitative data were reported as mean ( sd ) and qualitative data were shown as percent . kolmogorov- smirnoff sample test , t - test ( p<0.07 was considered statistically significant) equivalent nonparametric test and spearman s rho test was used for statistical analysis.resultstotal mean score of knowledge , mean score of females and mean score of males was 20.888.53 , 20.967.62 and 20.7110.43 , respectively . age and sex had no correlation with score of knowledge.conclusiondentists of sari do not have enough knowledge about oral cancer .
a normal parathyroid gland ( pg ) is not visualized on ultrasonography ; an enlarged one , however , appears as hypoechoic ( compared to that of the normal thyroid tissue ) tear - drop shaped nodule separated from thyroid gland by an intervening echogenic posterior capsule of thyroid . the uniform echostructure of the gland is a function of uniform arrangement of chief cells with intervening sparse adipocytes . the homogeneity is lost due to hemorrhage , edema , acinar dilation , and fibrosis . in the present case , we discuss the histologic basis of differential sonomorphology of all the four enlarged glands in a 32-year - old male in the setting of tertiary hyperparathyroidism . a 32-year - old male , a known case of chronic renal failure induced secondary hyperparathyroidism on calcimimetics and maintenance dialysis , presented with bone pains , backache , and reduced activity since a few months . the clinical profile of the patient prompted serum biochemical investigations and ultrasonography of the neck . the serum profile revealed calcium 12 mg% ( normal : 8.511.5 mg% ) , phosphate 2.6 iu / l ( normal : 2.54.5 iu / l ) , vitamin d 19.08 ng / ml ( normal : 30100 ng / ml ) , parathormone 1721.6 pg / ml ( normal : 9.575 pg / ml ) , and alkaline phosphate 1586 iu / l ( normal : 80279 ultrasonography of the neck was performed which revealed enlarged and homogeneously hypoechoic right upper and lower [ figure 1 ] parathyroid glands . on the left , however , the upper gland had a central hypoechogenicity surrounded by peripheral hyperechoic rim [ figure 2a and b ] . the left lower parathyroid gland had two nodules ; the superior one was smaller and was homogeneously hypoechoic similar to the the right - sided glands whereas the inferior nodule revealed an echopattern reverse to that of the left upper , i.e. , a sonolucent halo around the central echogenic region [ figure 2c and d ] . tc-99 m sestamibi scan revealed increased uptake in all four glands [ figure 3 ] . based on the serum biochemistry and ultrasonography , the patient was diagnosed as a case of tertiary hyperparathyroidism . the findings on microscopy revealed differential arrangement of cells and vessels giving rise to atypical appearance of the enlarged gland on the left side on ultrasonography [ figures 4 and 5 ; table 1 ] . the left lower parathyroid gland consists of a homogenously hypoechoic superior nodule and an inferior nodule with peripheral hypoechogenicity ( vertical arrows ) longitudinal sonogram reveals the enlarged left upper parathyroid gland with peripheral echogenicity and a sonolucent core ( a ) . the left lower gland comprises a superior nodule which is homogenously hypoechoic and an inferior nodule with sonolucent periphery and echogenic centre ( c ) . doppler signals reveal prominent peripheral vascularity in the left upper and inferior nodule of the left lower gland ( b , d ) . ( t = trachea , ca = carotid artery ) tc-99 m sestamibi scan : images at 20 min ( a ) reveal uniform uptake in both lobes of thyroid with well - defined areas of increased tracer uptake in the lower part of the left lobe . delayed image at 2 h ( b ) shows multiple areas of abnormal tracer uptake , largest being the left lower pole followed by left upper pole and two small areas involving the right upper and lower pole after adequate washout from both thyroid lobes ( image courtesy : dr panda p ) right lower and superior nodule of left lower gland : histopathologic images reveal uniform arrangement of chief cells devoid of adipocytes in right lower ( a , low power ; b , high power ) and superior nodule of the left lower gland ( c , low power ; d , high power ) . compare the uniformity in arrangement of cells in both the glands the left upper gland ( a , b , c ) : photomicrograph reveals peripheral compressed parenchyma and a well - defined capsule ( arrow in a , low power ; asterisk in b , high power ) . the nodules at the centre contain numerous congested vessels ( c ; low power ) . the inferior nodule of left lower gland ( d , e , f ) : low ( d ) and high power ( e ) of the periphery of the nodules show nodules of chief cells with congested vessels . the core of this nodule is composed of oxyhil cells with edema ( f ) a summary of the major histopathological observations and their radiological correlation the classic ultrasonographic features of an enlarged pg is that of an oval , homogeneously hypoechoic gland . this texture is a consequence of the homogeneity of arrangement of sheets of chief cells . in the sonographic - pathologic correlation of homogenous pg adenomas , rastad et al . found solid arrangement of chief cells . a few adenomas , in their study , however , had small areas of oxyphil and transitional oxyphil cells , small acinar areas , and a few adipocytes . furthermore , the authors mentioned that both an adenomatous and a hyperplastic gland looked alike on ultrasonography ; although hyperplasia has a higher tendency to involve multiple glands . in addition , the hyperplastic glands may even be more sonolucent than their adenomatous counterparts . pathologically , hyperplastic glands have chief cells and multiple small nodules of oxyphil and transitional oxyphil cells and are devoid of fat . the homogeneity in hyperplastic glands is , however , due to uniform cellular arrangement and small size of nodules beyond the resolution of ultrasonography . the typical homogenously hypoechoic appearance of parathyroid gland helps to differentiate it from its mimics . a posteriorly placed thyroid nodule is usually inhomogenously hypoechoic and lacks the echogenic interface with the thyroid gland . yet another differential includes a lymph node , which , however , has a hyperechoic hilum with characteristic vascularity . the inferior nodule of the left lower gland in our case also looked like a lymph node , but the clinical context and absence of hilar vascularity ruled out the presence of a lymph node . a parathyroid carcinoma is more often heterogeneous ; this morphology , however , may be seen in larger adenomas as well . in addition , hemorrhage , fat , fibrosis , and acinar dilation gives rise to atypical appearances on ultrasonography . described 9 cases with differential central and peripheral echogenicity , which was an echopoor periphery surrounding an iso to hyperechoic central core . the authors attributed central echogenic areas to the presence of increased edema and ectatic vessels . in our case , the inferior nodule in the left lower gland also had a similar appearance [ figure 1 , 2c and d ] . however , on histopathology , the sonolucent periphery was found to be composed of nodules of chief cells with numerous ectatic vessels [ figure 5d f ; table 1 ] . because both uniformly arranged chief cells as well as congestion ( due to the ectatic vessels ) are known to cause hypoechogenicity , this possibly explains the hypoechoic peripheral rim . further , the echogenic core in our case was composed of oxyphil cells with some edema . an increase in echogenicity was reported due to the presence of edema by acar et al . hence , we propose that edema ( similar to the series of acar et al . ) with probable presence of oxyphil cells could have given rise to hyperechoic core of the inferior nodule of the left lower pg . the left upper pg in our case had a sonomorphology reverse to that of inferior nodule of left lower pg ; it had a hypoechoic centre surrounded by echogenic rim [ figure 2a and b ] . on microscopy , the gland was seen to comprise numerous nodules of chief cells with a well - defined capsule . the nodules in the centre had markedly dilated , congested vessels ; a reason for reduced echogenicity in the centre [ figure 5a c ; table 1 ] . the increase in echogenicity at the periphery was probably due to the presence of capsule , compressed normal parenchyma and nodules , and a few fibrous septae . further , both right - sided glands and the superior nodule of left lower gland were homogenously hypoechoic on ultrasonography and revealed a uniform arrangement of chief cells on microscopy . in conclusion , the homogenously hypoechoic sonomorphology reflects uniform arrangement of chief cells of pg . variable microscopic structure due to hemorrhage , fibrosis , and edema lead to heterogenous echostructure of the enlarged pg . our case highlights that hypoechogenicity of the pg may be attributed to chief cells and congested vessels whereas edema can give rise to an increase in echogeneicity .
the typical sonomorphology of homogeneously hypoechoic texture of an enlarged parathyroid gland ( pg ) is a reflection of uniform arrangement of the parathormone - producing chief cells . a variable cellular arrangement , hemorrhage , fibrosis , and adipocytes cause heterogeneous appearance . we describe a case of a 32-year - old male , a case of tertiary hyperparathyroidism , with increased serum parathormone levels , hypercalcemia , and enlargement of all four pgs , albeit with differing morphology . the left lower gland had two nodules , namely , superior and inferior . the inferior nodule of the left lower gland had an echogenic core surrounded by a sonolucent rim whereas the superior nodule was homogenously hyoechoic . the left upper gland had an echopattern exactly reverse of the inferior nodule of the left lower pg , i.e. , hypoechoic gland surrounded by hyperechoic periphery . the appearance of the right - sided glands was that of the superior nodule of the left lower pg . on histopathology , the hypoechoic areas corresponded to numerous chief cells and congested vessels whereas edema gave rise to an increase in echogenicity . this report exemplifies atypical sonographic appearances of pg and their histopathologic correlation .
vascular anomalies are congenital lesions of abnormal vascular development . previously referred to as vascular birthmarks , vascular anomalies are now classified based on a system developed in 1982 by mulliken and glowacki that considers histology , biological behavior , and clinical presentation of these entities . a primary distinction is made between a vascular tumor , which grows by cellular hyperplasia , and a vascular malformation , which represents a localized defect in vascular morphogenesis . due to the differences in biologic and radiographic behavior , malformations are further divided into slow - flow and fast - flow lesions ( table 1 ) . both vascular tumors and malformations may occur anywhere on the body . in brief , hemangiomas are vascular tumors that are rarely apparent at birth , grow rapidly during the first 6 months of life , involute with time and do not necessarily infiltrate but can sometimes be destructive . in contrast to hemangiomas , they are present at birth , slow growing , infiltrative , and destructive . thus , this paper offers pediatricians an update on recent developments in the diagnosis , management , and pathogenesis of vascular anomalies . due to their complexity , a multidisciplinary approach is frequently necessary in managing these lesions and includes a team of specialists in pediatric otolaryngology , dermatology , hematology , interventional radiology , surgery , orthopedics , and sometimes psychology . infantile hemangiomas are the most common tumor in infancy and occur in approximately 10% of the population . identifiable risk factors include female sex , prematurity , low birth weight , and fair skin . because their growth is attributed to hyperplasia of endothelial cells , they are classified as , and are the most common , vascular tumors . hemangiomas are further categorized into two types : infantile or congenital . congenital hemangiomas either rapidly involute ( rapidly involuting congenital hemangioma ( rich ) ) over a very brief period in infancy or never involute ( noninvoluting congenital hemangioma ; ( nich ) ) . the remaining sections will focus on the more common infantile the first theory suggests that hemangioma endothelial cells arise from disrupted placental tissue imbedded in fetal soft tissues during gestation or birth . this is further supported by the fact that they are found more commonly in infants following chorionic villus sampling , placenta previa , and preeclampsia . a second theory arose from the discovery of endothelial progenitor and stem cells in the circulation of patients with hemangiomas . the development of hemangiomas in animals from stem cells isolated from human specimens supports this theory . however , infantile hemangiomas most likely arise from hematopoietic progenitor cells ( from placenta or stem cell ) in the appropriate milieu of genetic alterations and cytokines . abnormal levels of matrix metalloproteinases ( mmp-9 ) and proangiogenic factors ( vegf , b - fgf , and tgf - beta 1 ) play a role in hemangioma pathogenesis . genetic errors in growth factor receptors have also been shown to affect development of hemangiomas . infantile hemangiomas present shortly after birth most often as well - demarcated , flat , and erythematous red patches . at this stage , hemangiomas may be confused with other red lesions of birth , but rapid proliferation and vertical growth will trigger the diagnosis ( figure 1(a ) ) . generally speaking , hemangiomas do not spread outside their original anatomical boundaries . hemangiomas follow a predictable course with three distinct developmental phases : proliferation , quiescence , and involution . in most hemangiomas , eighty percent of proliferation occurs by three months of life but may last longer . during proliferation , rapid growth can lead to exhaustion of blood supply with resulting ischemia , necrosis , ulceration , and bleeding . following proliferation , hemangiomas enter a slower or no growth phase , known as quiescence . this phase is marked by graying of the overlying skin and shrinking of the deeper components ( figure 1(b ) ) . historical reports suggest that involution of 50% , 70% , and 90% of the hemangioma occurs by 5 , 7 , and 9 years of age with some variability . at the final stages of involution focal hemangiomas are localized , unilocular lesions which adhere to the phases of growth and involution . multifocal hemangiomatosis also exists , and infants with greater than 5 lesions should undergo workup to rule out visceral involvement . segmental hemangiomas are more diffuse plaquelike and can lead to untoward functional and aesthetic outcomes . a beard - like distribution is associated with a subglottic hemangioma 60% of the time . regardless , a stridulous child with either a focal or segmental hemangioma should be presumed to have subglottic disease until proven otherwise . patients with segmental hemangiomas should also undergo investigation to rule out phaces syndrome ( posterior fossa brain malformations , hemangiomas of the face , arterial cerebrovascular anomalies , cardiovascular anomalies , eye anomalies , and sternal defects or supraumbilical raphe ) . the diagnosis of a hemangioma is best made by clinical history and physical exam . in cases of unclear diagnosis , the best radiographic modalities to use are either a doppler ultrasound or mri . however , research suggests that nearly 40% of children require further intervention because of bleeding , ulceration , visual axis obstruction , airway obstruction , high - output cardiac failure , or risk for permanent disfigurement . with novel therapeutic options as well as a better understanding of disease corticosteroids , interferon , and vincristine have been successful for massive and life - threatening disease [ 1315 ] . these agents have also been used for multifocal disease , visceral involvement , segmental distribution , airway obstruction , and periorbital lesions . however , significant side effects accompany systemic therapy and have even led to the rejection of some agents as a treatment option . intralesional steroid treatment is also an option for focal hemangiomas of the parotid , nasal tip , subglottis , and eyelid . excision is the appropriate for localized lesions the fibrofatty remnants ( residuum ) of involuted hemangiomas . elective subtotal excision of massive protuberant proliferating hemangiomas can be employed in order to maintain aesthetic facial boundaries . residual erythema and telangiectasias frequently remain in involuted hemangiomas and are best treated by selective photothermolysis using the flash pulse dye laser ( fpdl ) . similarly , ulcerative lesions during proliferation can be treated with fpdl to induce healing and new epidermal growth . a paradigm shift has occurred regarding the treatment of hemangiomas over the past few years . in 2008 , propranolol , a nonselective -adrenergic antagonist , was serendipitously discovered to cause regression of proliferating hemangiomas in newborns receiving treatment for cardiovascular disease . numerous studies demonstrating the success of propranolol for shrinking hemangiomas have followed suit [ 1719 ] . in fact , over ninety percent of patients have dramatic reduction in the size of their hemangiomas as early as 1 - 2 weeks following the first dose of propranolol ( figure 2(b ) ) . dosing for propranolol in treating hemangiomas is recommended to be 2 - 3 mg / kg separated into two or three - times - a - day regimens . these doses are dramatically below the concentration employed for cardiovascular conditions in children . thus , reported side effects of propranolol for hemangiomas have been minimal . nonetheless , serious concerns for hypoglycemia and lethargy that can occur with this medicine should not be brushed aside [ 21 , 22 ] . to address these concerns , parents are instructed to give propranolol with meals , report any unusual sleepiness , and not administer it during infections . early and frequent visits to assess vital signs are recommended in young infants while on therapy . exacerbation of gastroesophageal reflux may result due to beta - receptor blockade at the lower esophageal sphincter . monitoring the administration of propranolol varies among institutions and practitioners . cardiopulmonary conditions at risk for propranolol therapy such as heart block or reactive airway disease should draw careful consideration before administering . consensus on patient monitoring and best dose regimens remains to be determined , but prospective research is underway . propranolol is currently employed for problematic hemangiomas , those that would have received either surgical or some other systemic therapy to prevent untoward side effects . subglottic , periorbital , and massive hemangiomas seem to respond well . despite the success of propranolol in reducing hemangioma size propranolol 's mechanism on treating hemangiomas remains unclear but may involve the regulation of vascular growth factors and hemodynamic cytokines . any blood vessel type , or a combination thereof , can be affected in a vascular malformation . the most common vascular malformations include lymphatic malformations ( lms ) , capillary - venular malformations ( cm ) , venous malformations ( vms ) and arteriovenous malformations ( avms ) which have been selected to be covered in this paper ( table 1 ) . while different in their biologic and clinical profile , as a whole , vascular malformations do not regress and continue to expand with time . periods of rapid growth , infiltration , and soft tissue destruction will spur therapeutic approaches that depend upon the malformation involved . lymphatic malformations ( lms ) are composed of dilated lymphatic vessels with inappropriate communication , lined by endothelial cells and filled with lymphatic fluid . lesions are classified as macrocystic ( single or multiple cysts > 2 cm ) , microcystic ( < 2 cm ) , or mixed . although most are congenital , there have been reports of lm occurring after trauma or infection . receptors involved in the formation of lymphatic vascular channels , such as vegfr3 and prox-1 , may play a role in the development of this disease . lymphatic malformations may be macrocystic , microcystic , or mixed . gradual growth and expansion is typical . approximately half of the lesions are present at birth and 8090% by 2 years of age . local infections approximating the course of lymphatic drainage will cause lm to swell , protrude , and sometimes become painful . this is a hallmark of a lm versus other vascular anomalies that do not present in this fashion . macrocystic lms present as a soft , fluid - filled swelling beneath normal or slightly discolored skin ( figure 3(a ) ) . intracystic bleeding or a mixed lymphatic venous malformation may result in blue discoloration of the overlying skin . microcystic lms are soft and noncompressible masses with an overlying area of small vesicles involving the skin or mucosa . these vesicles can weep and at times cause pain or minor bleeding ( figure 3(b ) ) . lm can occur anywhere on the body , and symptoms are determined by the extent of disease . most lms are found in the cervicofacial region and extend to involve the oral cavity or airway , especially when mixed or microcystic . symptoms secondary to bulky disease often include pain , dysphagia , odynophagia , impaired speech , or in severe cases , airway obstruction . when involving the skeletal framework in this area , lms often cause osseous hypertrophy leading to dental or extremity abnormalities ( figure 3(c ) ) . although these malformations can usually be diagnosed by physical examination , mri is used to confirm diagnosis , identify cystic architecture , and determine extent of disease . an ideal option for treatment of lm does not exist . there have been rare cases of sporadic resolution of a lesion although the majority of these malformations continue to enlarge with age . macrocystic lesions are more amenable to treatment and have a better prognosis . swelling from acute infection is best controlled with a short course of systemic steroids and antibiotics . the exit ( ex utero intrapartum treatment ) procedure provides good airway control of the infant if compromise is suspected to occur at birth . sclerotherapy is frequently employed for lymphatic malformations , especially if deep seated and difficult to access surgically . it involves injection of a sclerosing agent directly into the lesion leading to fibrosis and ultimately regression of the cysts . macrocystic lesions are more easily treated in this fashion , but there have been reports of success in microcystic lesions . several agents have been utilized for lymphatic malformations including ethanol , bleomycin , ok-432 , and doxycycline [ 29 , 30 ] . severe swelling can at times occur and may lead to airway obstruction requiring intensive care . risks to local nerves are also real but usually result in only transient loss of function . carbon dioxide laser therapy may also be employed in limited disease of the airway and oral mucosa . surgical excision is also frequently employed for microcystic disease although it is more aggressive , invasive , and difficult to control [ 33 , 34 ] . infiltration of normal soft tissue and bone by extensive microcystic lm requires massive resections and local or free - flap reconstruction . surgery is also employed in the correction of secondary deformities caused by lm such as bony overgrowth of the facial skeleton . when this is not feasible , multiple treatment modalities are combined to control disease and provide satisfactory functional outcomes . capillary malformations ( cms ) are sporadic lesions consisting of dilated capillary - like channels . cms can present on any part of the body , but are mostly found in the cervicofacial region . colloquially they are referred to as stork bites on the nape of the neck and angel kisses on the forehead . lateral lesions , commonly referred to as port - wine stains , have a more protracted course ( figure 4 ) . a genomewide linkage analysis has identified a locus on chromosome 5q associated with familial disease . a rare autosomal dominant inherited disease consisting of a combination of cm and arteriovenous malformations ( avm ) this has spurred further research into the cause of the more common sporadic form of cm . cms present at birth as flat , red or purple , cutaneous patches with irregular borders . lateral cms , or port - wine stains , usually involve the face and present along the distribution of the trigeminal nerve . cms tend to progress with time as the vessel ectasia extends to involve deeper vessels to the level of the subcutaneous tissues . this causes the lesion to become darker in color , as well as more raised and nodular . although they are mostly solitary lesions , cm may exist as a part of a syndrome . the most common of these is the sturge - weber syndrome ( sws ) and is characterized by a cm in the region of the ophthalmic branch of the trigeminal nerve , leptomeningeal angiomatosis , and choroid angioma . symptoms of sws are variable among cases and include intractable seizures , mental retardation , and glaucoma . this syndrome consists of a combination of multiple lymphatic , venous , and capillary abnormalities . if here are findings inconsistent with cm exist , for example , pain or spontaneous bleeding , an mri may be performed . an mri of the brain as well as an annual ophthalmological exam is warranted when suspicion for sws is present . the laser slowly causes the redness of the lesion to fade ; therefore , many treatments are often necessary . early treatment of these lesions appears to slow the progression of the disease . the argon , potassium - titanyl - phosphate ( ktp ) lasers , and 755 nm laser have also been utilized in more advanced lesions with good outcomes . venous malformations ( vms ) are slow - flow vascular anomalies composed of ectatic venous channels . these aberrant venous connections lead to venous congestion , thrombosis , and gradual expansion of these lesions . as a result , vms more commonly occur sporadically , but research into multifocal disease and familial patterns has helped discover suspected genetic loci involved in their development . there are inherited forms of vms , the cause of which has been localized to chromosome 9p . recently a loss - of - function mutation was discovered on the angiopoetin receptor gene tie2/tek in many solitary and multiple sporadic venous malformations . in addition , upregulation of several factors including tissue growth factor beta ( tgf - beta ) and basic fibroblast growth factor ( beta - fgf ) has been discovered in patients with venous malformations . with more cutaneous involvement , the lesions appear darker blue or purple ( figure 5(a ) ) . upper aerodigestive involvement is common , and vm are particularly evident when mucosa is affected ( figure 5(b ) ) . vms are compressible and swell when the region is dependent or there is an increase in hydrostatic pressure such as during a valsalva maneuver . with time , pain and swelling will occur with the formation of phleboliths ( calcified thrombi ) , or small clots , secondary to trauma or venous stasis . for very large lesions with significant thrombosis the risk of distal emboli remains low but real . d - dimers may be elevated and a marker of disease . when isolated , vm are generally benign with slow growth . vm can occur anywhere in the body but often are found in the head and neck where they involve the oral cavity , airway , or cervical musculature . mri is the imaging modality of choice when diagnosing vm and offers superior delineation of disease for treatment planning . no single treatment modality is favored in the treatment of vms and often more than one modality is utilized . surgery , nd : yag laser therapy , and sclerotherapy ( directed vascular injury ) are all options for treating vm . conservative observation of small vm in children may be an option with the knowledge that growth is imminent . elevating the involved area can decrease hydrostatic pressure and vascular expansion and may impede growth . in large lesions , similarly , compression garments are the initial treatment of choice for advanced limb lesions allowing risks from other treatment options to be avoided surgical resection and sclerotherapy alone can , at times , be curative for smaller lesions . use of the nd : yag and ktp lasers has been described [ 47 , 49 ] . the nd : yag laser can be used via a fiber attached to an endoscope to treat intraoral and airway venous malformations . direct injury to deep venous malformations may also be performed by passing the laser directly into the lesion ( interstitial therapy ) . complications of sclerotherapy include skin and mucosal injury , swelling leading to airway compromise , infection , and nerve injury . cardiovascular shock can occur with ethanol , shock - like symptoms with ok-432 , interstitial pneumonia or pulmonary fibrosis with bleomycin , and tooth discoloration or electrolyte abnormalities with doxycycline . surgery remains one of the most superior treatment options and may offer a cure for localized vm . preoperative sclerosant can be used prior to excision ( 2448 hours ) to decrease surgical risk . arteriovenous malformations ( avms ) are congenital high - flow vascular malformations composed of anomalous capillary beds shunting blood from the arterial system to the venous system . they are often misdiagnosed at birth as other vascular lesions because of the delay in presentation of characteristic signs of the malformation . puberty and trauma trigger the growth of the lesion and manifestation of its troublesome symptoms . they are infiltrative causing destruction of local tissue and often life - threatening secondary to massive bleeding . extracranial avms are different from their intracranial counterpart and are found in several areas in the cervicofacial region . little is known about the origin and pathogenesis of avm . a defect in vascular stabilization is thought to cause avm , but it remains unclear whether these lesions are primarily congenital in origin . most avm , are present at birth , but there are several case reports of these lesions presenting after trauma in adults . defects in tgf - beta signaling and a genetic two - hit hypothesis are the prevailing theories to the pathogenesis [ 53 , 54 ] . . a growing hypervascular lesion may have been present as a slight blush at birth . the distinguishing characteristics of an avm will be palpable warmth , pulse , or thrill due to its high vascular flow . the overlying skin may have a well - demarcated blush with elevated temperature relative to adjacent skin ( figure 6 ) . the natural course of avm is early quiescence , late expansion , and ultimately infiltration and destruction of local soft tissue and bone . oral lesions can present early due to gingival involvement , disruption of deciduous teeth , and profuse periodontal bleeding . although both focal ( small vessel ) and diffuse lesions exist , avms are by far the most difficult vascular anomaly to manage due to the replacement of normal tissue by disease vessels and very high recurrence rates [ 55 , 56 ] . mri may be useful , but mra and cta can give a superior outline of these lesions . an arteriogram , the time - tested approach to diagnosing avm , will provide good definition of central nidus of affected vessels and provide access for intravascular treatment when necessary . treatment of avm consists of embolization , surgical extirpation , or a combination of these modalities . treatment and timing are often individualized to the patient and the extent of disease . for example , small - vessel avms are known to be localized and can be resected with good long - term outcomes . historically , young children were closely observed until disease expansion with the concept that the treatment should not be worse than the disease . however , this approach is currently being challenged due to the high recurrence rates experienced with avm . absolute ethanol , polyvinyl alcohol , and onyx have been employed as avm embolization materials . complications of this approach include local skin ulceration , soft tissue necrosis , mucosal sloughing , or nerve injury . this is theoretically due to collateralization and recruitment of new vessels to support an undetected portion of the nidus . in general , surgical management of avms requires preoperative supraselective embolization , judicious removal of tissue , and complex reconstructive techniques . in focal lesions , surgical excision has been shown to cure avm [ 56 , 63 ] . however , diffuse avms have recurrence rates as high as 93% . in essence , avms are debilitating vascular malformations that are often misdiagnosed early in life . despite successful initial therapy vascular anomalies embody a myriad of blood vessels abnormalities that are thought to occur perinatally . the most common vascular anomalies in order of presentation include hemangiomas , lymphatic malformations , capillary malformations ( port - wine stains ) , venous malformations , and arteriovenous malformations . referral to a vascular anomalies team is recommended when considering therapy for problematic hemangiomas and vascular malformations .
vascular anomalies are a heterogeneous group of congenital blood vessel disorders more typically referred to as birthmarks . subcategorized into vascular tumors and malformations , each anomaly is characterized by specific morphology , pathophysiology , clinical behavior , and management approach . hemangiomas are the most common vascular tumor . lymphatic , capillary , venous , and arteriovenous malformations make up the majority of vascular malformations . this paper reviews current theory and practice in the etiology , diagnosis , and treatment of these more common vascular anomalies .
they are completely unrelated in sequence to the known cation channels or to other known anion - conducting channels , including the cystic fibrosis transmembrane conductance regulator ( cftr ) chloride channels , porins , and -aminobutyric acid ( gaba ) receptors . the family is evolutionarily ancient , with members described in all living kingdoms ( figure 1 ) . broad sequence identity among clc homologs is limited to a few highly conserved stretches of amino acids , ' hot spots , ' distributed throughout the protein . overall sequence identity between family members from different kingdoms is 15 - 20% , but in the hot spots , sequence identity is much higher , with nearly identical amino - acid sequences even in widely divergent species ( figure 2 ) . overall patterns of hydrophobicity are also strongly conserved in all known clcs ( see below ) . prefixes : h , human ; r , rat ; ara , arabidopsis ; t , torpedo . note that the mammalian clcs fall into three subfamilies , and that all the higher plant clcs are closely related to one another . the tree was constructed with the program megalign ( dnastar ) ; the branch lengths are proportional to sequence distances . ( a ) transmembrane topology and ( b ) conserved sequences of the clc chloride channels . the topology of transmembrane helices 4 - 7 is currently unresolved ; two models , based on conflicting experimental results , are indicated . transmembrane helices 9 - 12 form an extensive , almost uninterrupted , hydrophobic region that crosses the membrane either three or five times . in ( b ) , identical residues are shaded gray , and colors are as in ( a ) . the clc genes in prokaryotes are known only from genome sequencing projects : their existence had not been anticipated from microbial physiology or biochemistry . roughly half of the sequenced prokaryotic genomes encode either one or two clc genes , and , with the exception of the escherichia coli clc , nothing is known about these beyond their predicted protein sequences . animals , including mammals , express three clc subfamilies ( figure 1 ) . the encoded channel proteins within each subfamily are quite closely related , with protein sequence identities in the range 50 - 80% . in contrast , sequence identity between subfamilies is almost as low as that between clcs from different kingdoms ( about 20% ) , suggesting that the subfamilies diverged early in the history of the animals . indeed , the caenorhabditis elegans genome contains sequences coding for members of each mammalian subfamily . in mammals , the human genes for these channels have been mapped and are distributed among six chromosomes . the members for which the intron / exon structure is known contain 10 - 23 exons . three of the genes , clcnka , clcnkb , and clcn6 , map to the same chromosomal region , 1p36 . bartter 's syndrome , an inherited disorder , has , in some cases , been shown to result from unequal crossing - over of clcnka and clcnkb . the clcs are -helical membrane proteins , predicted to traverse the membrane 10 - 12 times . both the amino- and carboxy - terminal domains ( which are approximately 50 - 130 and 170 - 420 amino - acid residues long , respectively , in the mammalian homologs ) are cytoplasmic . the transmembrane topology of the core sequence has been mapped using a variety of experimental techniques , which have identified 10 - 12 transmembrane crossings . the crossings do not correspond directly to the 10 - 12 transmembrane spanning helices initially identified by hydropathy analysis , however . moreover , experiments have yielded conflicting results , so the precise topology remains uncertain ; nevertheless , the original numbering of helices from hydropathy analysis has been maintained . transmembrane helices 9 - 12 contain a particularly hydrophobic stretch of sequence that must cross the membrane either three or five ( not four ) times . these hotspots are scattered across the transmembrane regions , a finding congruous with the idea of an ' active site ' composed of residues originating throughout the protein sequence ( see below ) . the carboxy - terminal cytoplasmic regions do not contain any hotspots ; in eukaryotes , however , these sequences are predicted to contain two ' cbs domains ' , small domains of unknown but probably regulatory function . these domains are found in a wide variety of proteins , including mg transporters , a protein kinase , and the domain 's namesake , cystathionine -synthase . the structure of the cbs domain from inosine monophosphate dehydrogenase ( impdh ) has been solved . this domain , which is not required for the catalytic activity , is a dimer that sprouts off the major domain , away from the center of activity . there are no known partner proteins associated with the clc channels , and it is clear that at least one family member acts alone . clc-0 chloride channels can be reconstituted from electric ray ( torpedo ) electric organ membranes into planar lipid bilayers . purified clc-0 , from either native membranes or heterologous expression systems , is a single polypeptide that forms chloride channels indistinguishable from those observed in native membrane preparations . other family members have not been studied as intensely as clc-0 , so it is possible that partner proteins remain to be discovered . structurally , the clc channels are unique : they are two - pore homodimers . although other models have been proposed , our recent direct structural data - a medium - resolution projection image from two - dimensional crystals of a bacterial clc homolog - support the two - pore homodimer model . in contrast , all other known -helical ion channel proteins form one - pore oligomers of four- , five- or six - fold symmetry , where the pore occurs at the axis of symmetry of the oligomer ( figure 3 ) . first , the pore - lining residues must necessarily arise from multiple regions in the primary sequence . in contrast to the one - pore oligomeric channels , therefore , the clc pore is not constrained to be perpendicular to the membrane . unfettered by the demands of symmetry , the clc pore is unlikely to take a straight path through the protein ; rather , it may bend or twist . features of the projection structure have been interpreted to support such a hypothesis ( figure 4 ) . a comparison between the molecular design of all known -helical ion channel proteins and that of the clc chloride channels , viewed from above the plane of the membrane . the conventional channels form pores between the symmetrically arranged subunits , along the axis of symmetry of the oligomer . although the clc channels have a two - fold axis of symmetry between the two clc subunits , the pore is not on this axis ; it is formed off - axis , within a single subunit , and hence with no symmetry . projection structure of a bacterial clc - type chloride channel , determined from cryoelectron microscopy of two - dimensional crystals . high density ( protein ) appears yellow or white , whereas low density ( water ) appears dark red or black . the two pairs of high - density regions in each dimer probably represent part or all of the two aqueous pores in each protein complex . reprinted with permission from . much of what we know about the physiological function of clc channels comes from human genetic diseases . clc-1 , which is largely expressed in skeletal muscle , is mutated in inherited myotonias in humans , goats , and mice ; this association was critical in establishing clc-1 as the major ion channel involved in setting and restoring the resting membrane voltage of skeletal muscle . similarly , identification of clc - kb mutations as a cause of bartter 's syndrome , an inherited salt - wasting nephropathy , demonstrated that this channel is a critical component of the urinary concentrating mechanism in the kidney . clc - ka has also been suggested to play an important role in urinary concentration , as mice with the gene ' knocked out ' have nephrogenic diabetes insipidus . recent work suggests that the abnormalities in patients with dent 's disease , a pleiomorphic disorder of renal solute re - uptake caused by inherited mutations in clc-5 , result from defective endocytosis in the renal proximal tubule . these observations support a hypothesis in which clc-5 serves as a ' cl - shunt ' in endocytic vesicles , allowing acidification without prohibitive charge separation across the vesicular membrane . indeed , gef1 shares more sequence identity with the mammalian subfamily containing clc-5 than with any other subfamily ( figure 1 ) . although the physiological function of many other clcs remains unknown , several do have proposed functions . clc-2 , which is expressed in all mammalian tissues , has been proposed to play a role in the cellular response to volume / osmotic stimuli . in addition , this channel has been co - opted in some neurons to modulate their electrical excitability . clc-3 is also apparently activated by osmotic changes in the environment , via phosphorylation dependent on protein kinase a ; recent experiments have suggested , however , that these volume - sensitive currents are due to endogenous , non - clc , chloride channels . regulatory mechanisms applying to other clcs remain obscure , as do the physiological roles of the other family members . all clcs that have been studied form pores that are selective for chloride ions over large organic anions and are not measurably permeant to cations . the molecular details of the clc channel pore are unknown . presumably , many of the pore - forming residues will be conserved , so a logical place to look for pore - lining residues is in the hotspots shown in figure 2 . have demonstrated that mutations in one of the hotspots ( the carboxy - terminal end of the d3 transmembrane domain , gkegpfvh ( in the single - letter amino - acid code ) in clc-1 ) have significant effects on channel selectivity . in addition , they used cysteine - scanning mutagenesis to argue that these regions are accessible through aqueous pathways extending from both sides of the membrane . they thus proposed that these residues form part of a ' selectivity filter ' lining the channel pore . given the asymmetric nature of the clc pore ( see above ) , such a selectivity filter would require residues from other parts of the protein . all of the studied clc pores are gated ( opened and closed ) by transmembrane voltage . this voltage - dependent gating , unlike that of the cation - selective channels , is an extremely malleable characteristic . the magnitude and even the direction of the effect varies strongly between homologs , even within the same subfamily . for example , clc-1 closes in response to hyperpolarizing ( negative ) membrane potentials , whereas clc-2 opens . clc-0 , which closes with hyperpolarization , adopts the opposite voltage - dependence when mutated at various seemingly unrelated regions of the protein . some clcs are gated by other factors in addition to voltage : ph ( clc-0 , -1 , -4 , and -5 ) , cell - swelling ( clc-2 and -3 ) , or phosphorylation ( clc-3 ) . single - channel analysis is the most powerful tool for scrutiny of ion - channel mechanisms . only one member of the clc family , clc-0 , has been studied in detail at the single - channel level . one of these , the ' slow gate , ' acts on both pores simultaneously , promotes opening of the pores at negative ( hyperpolarizing ) voltages , and occurs on the timescale of seconds ; the second , the ' fast gate , ' occurs independently in each pore , promotes closing of the pores at negative voltages , and occurs on the timescale of milliseconds . the voltage - dependence of the second mechanism arises from movement of the permeant chloride ion across the transmembrane voltage , another unique feature of the clc family . all clcs that have been studied form pores that are selective for chloride ions over large organic anions and are not measurably permeant to cations . presumably , many of the pore - forming residues will be conserved , so a logical place to look for pore - lining residues is in the hotspots shown in figure 2 . have demonstrated that mutations in one of the hotspots ( the carboxy - terminal end of the d3 transmembrane domain , gkegpfvh ( in the single - letter amino - acid code ) in clc-1 ) have significant effects on channel selectivity . in addition , they used cysteine - scanning mutagenesis to argue that these regions are accessible through aqueous pathways extending from both sides of the membrane . they thus proposed that these residues form part of a ' selectivity filter ' lining the channel pore . given the asymmetric nature of the clc pore ( see above ) , such a selectivity filter would require residues from other parts of the protein . all of the studied clc pores are gated ( opened and closed ) by transmembrane voltage . this voltage - dependent gating , unlike that of the cation - selective channels , is an extremely malleable characteristic . the magnitude and even the direction of the effect varies strongly between homologs , even within the same subfamily . for example , clc-1 closes in response to hyperpolarizing ( negative ) membrane potentials , whereas clc-2 opens . clc-0 , which closes with hyperpolarization , adopts the opposite voltage - dependence when mutated at various seemingly unrelated regions of the protein . some clcs are gated by other factors in addition to voltage : ph ( clc-0 , -1 , -4 , and -5 ) , cell - swelling ( clc-2 and -3 ) , or phosphorylation ( clc-3 ) . single - channel analysis is the most powerful tool for scrutiny of ion - channel mechanisms . only one member of the clc family , clc-0 , has been studied in detail at the single - channel level . one of these , the ' slow gate , ' acts on both pores simultaneously , promotes opening of the pores at negative ( hyperpolarizing ) voltages , and occurs on the timescale of seconds ; the second , the ' fast gate , ' occurs independently in each pore , promotes closing of the pores at negative voltages , and occurs on the timescale of milliseconds . the voltage - dependence of the second mechanism arises from movement of the permeant chloride ion across the transmembrane voltage , another unique feature of the clc family . details of the molecular mechanism of clc channel function will be best studied in the light of a high - resolution molecular structure . the two - dimensional crystals from the e. coli clc diffract to 4 resolution ( our unpublished observations ) , and so such a structure is imminent . although radioactive flux measurements demonstrate that the e. coli clc is a chloride channel , these types of measurements do not match the mechanistic detail provided by electrical recordings . ( two of the three eukaryotic subfamilies are ; the third has not been studied . ) are they gated by any of the other known mechanisms , or by a new mechanism ? what is their precise selectivity ? knowledge of these mechanistic details will , together with high - resolution structure , provide a foundation for understanding how these proteins work . gene knockouts ( in the form of human genetic diseases ) have been essential for determining the physiology of several clcs . similar knockouts in model systems promise to shed light on the functions of other family members . in fact , results published while this article was in press provide startling insight into the physiological function of the clcs . surprisingly , knocking out clc-3 had no effect on volume - regulated cl currents , but , even more surprisingly , the knockout mice suffered complete degeneration of their hippocampi . the clc-3 channel localizes to intracellular vesicles in this region of the brain , and its inactivation impairs acidification of synaptic vesicles . similarly , mutant mice ( and humans ) lacking the clc-7 gene display defects in ph regulation ; they suffer severe osteopetrosis , a disease that results in brittle , breakable bones , because of a defect in the cl shunt in osteoclasts - cells involved in bone remodeling . the clear theme emerging from the clc knockout mice is that clcs in the clc-3/4/5 and clc-6/7 subfamilies play important roles in regulating ph in intracellular compartments . it is still poorly understood why knockouts of these genes , whose products are broadly distributed , result in such specifically localized defects .
chloride - conducting ion channels of the clc family are emerging as critical contributors to a host of biological processes . these polytopic membrane proteins form aqueous pathways through which anions are selectively allowed to pass down their concentration gradients . the clcs are found in nearly all organisms , with members in every mammalian tissue , yet relatively little is known about their mechanism or regulation . it is clear , however , that they are fundamentally different in molecular construction and mechanism from the well - known potassium- , sodium- , and calcium - selective channels . the medical importance of clc channels - four inherited diseases have been blamed on familial clc dysfunction to date - highlights their diverse physiological functions and provides strong motivation for further study .
the participants of this study included 56 ( 21 men ) non- clinical participants , 30 ( 11 men ) patients with general anxiety disorder and 25 ( 4 men ) with obsessive compulsive disorder . the total sample consisted of 36 men and 75 women , with the mean age of 31.89 ( sd = 8.13 ) . all clinical participants were recruited from roozbeh hospital and psychiatric and psychological clinics all over tehran in 2012 . non - clinical participants were recruited from different regions of tehran . at first , clinical participants provided informed consent and were administered the scid - i . patient anonymity was preserved . in order to ensure the mental health of the non - clinical population , they were asked to fill out the ghq questionnaire , a well - known screening instrument for measuring current mental health ( 25 ) ( with cut off point , 23 ) . exclusion criteria for all groups were a diagnosis of psychotic disorder , substance abuse , attention deficit hyperactivity disorder , or central nervous system diseases . the comparison of clinical and non- clinical group for gender , marital status , work , socioeconomic status , religion ( table 1 ) and age ( sig ( 2- tailed ) ) = .296 , df = 109 ) showed no significant differences . the research instruments were as follows : 1- structured clinical interview for dsm - iv ( scid - i ) . scid - i , research version , patient edition ( 26 ) is a semi structured clinical interview used to diagnose mental disorders as delineated in the dsm - iv . inter - rater and test - retest reliability estimates the scid - i vary , but have generally been found to be in the fair to good range ( 27 ) . also , this instrument has shown high reliability and validity in iran ( 28 ) . in this study , the acs has the following two subscales : 1 ) focusing : the ability to maintain attention on a given task , 2 ) shifting : the ability to reallocate attention to a new task or to engage attention on multiple tasks . the acs total score had adequate internal consistency ( = .84 ) as did the focus and shifting subscales ( = .82 and = .68 , respectively , ( 6 ) ) . this instrument had adequate internal consistency in both clinical ( tot = .81 , focus = .78 , & shifting = .84 ) and non - clinical ( tot = .74 , focus = .73 , & shifting = .68 ) samples in iranian population ( 29 ) . the obsessive compulsive inventory - revised ( oci - r ) ; ( 30 ) is an 18-item questionnaire of ocd symptoms . the scale provides a total score and six factors ( washing , checking , obsessing , neutralizing , ordering and hoarding ) . the six factors appear consistent across samples and demonstrate good convergent and divergent validity with the ybocs in patients with ocd ( 30 ) . also internal consistency of this scale was good in iran ( = .85 ) ( 31 ) . penn state worry questionnaire ( pswq ) ; ( 32 ) . the pswq has good internal consistency in both undergraduate ( = .92 ) and clinical samples ( = .74 ) ( 32 ) . additionally , the pswq has demonstrated good test retest reliability over periods up to 10 weeks and is moderately to strongly correlate with the measures of anxiety and depression ( 32 ) . this instrument has adequate internal consistency ( = .88 ) and test - retest reliability ( r= .79 ) in iran ( 33 ) . beck depression inventory - ii ( bdi - ii ) ; ( 34 ) is a 21-item self - report measure with robust psychometric properties ( which assesses the severity of a range of affective , somatic and cognitive symptoms of depression . also , the persian version of this scale has good total validity ( = .91 ) and test - retest reliability ( r = .94 ) ( 35 ) . beck anxiety inventory ( bai ; ( 36 ) is a 21-item self - report measure which assesses the severity of a range of physiological and cognitive symptoms of anxiety over the preceding week . also , kaviany and mosavi validate this instrument in iran and indicated that it has a good internal consistency ( = .92 ) and test - retest reliability ( r = .83 ) ( 37 ) . rumination response scale ( rrs ) ; ( 38 ) is a self - report measure that assesses the tendency to ruminate in response to depressed mood . the rrs contains 22 items that are symptom - focused , self - focused , or focused on possible causes and consequences of the depressive mood . participants respond on these items on a 4-point likert - type scale ranging from 0 to 3 and yielding scores from 22 to 88 ( 38 ) . the rrs possesses good internal consistency ( = 0.89 ) ( 38 ) and 5-month retest reliability ( 39 ) . internal consistency of the persian version is reported 0.88 to 0.92 , using chronbach`s alpha which is good and reliable ( 40 ) . the general health questionnaire-28 ( ghq-28(41 ) is a 28- item self - report questionnaire with a 4 point likert scale . the ghq has demonstrated good psychometric properties ( = 0.89 , r = 0.83 ) ( 41 ) . also , total internal consistency ( = 0.90 ) and test - retest reliability ( r = .70 ) of the persian version was good ( 42 ) . the descriptive statistics and chi - square and t - test were used to analyze the demographic data . also , multivariate analysis of variance ( manova ) and multivariate analysis of covariance ( manova ) were employed to compare the groups . the participants of this study included 56 ( 21 men ) non- clinical participants , 30 ( 11 men ) patients with general anxiety disorder and 25 ( 4 men ) with obsessive compulsive disorder . the total sample consisted of 36 men and 75 women , with the mean age of 31.89 ( sd = 8.13 ) . all clinical participants were recruited from roozbeh hospital and psychiatric and psychological clinics all over tehran in 2012 . non - clinical participants were recruited from different regions of tehran . at first , clinical participants provided informed consent and were administered the scid - i . patient anonymity was preserved . in order to ensure the mental health of the non - clinical population , they were asked to fill out the ghq questionnaire , a well - known screening instrument for measuring current mental health ( 25 ) ( with cut off point , 23 ) . exclusion criteria for all groups were a diagnosis of psychotic disorder , substance abuse , attention deficit hyperactivity disorder , or central nervous system diseases . the comparison of clinical and non- clinical group for gender , marital status , work , socioeconomic status , religion ( table 1 ) and age ( sig ( 2- tailed ) ) = .296 , df = 109 ) showed no significant differences . the research instruments were as follows : 1- structured clinical interview for dsm - iv ( scid - i ) . 5- beck depresion inventory ( bdi ) . 6-beck anxiety inventory ( bai).7- general health questionnaire ( ghq-28 ) . scid - i , research version , patient edition ( 26 ) is a semi structured clinical interview used to diagnose mental disorders as delineated in the dsm - iv . inter - rater and test - retest reliability estimates the scid - i vary , but have generally been found to be in the fair to good range ( 27 ) . also , this instrument has shown high reliability and validity in iran ( 28 ) . in this study , the acs has the following two subscales : 1 ) focusing : the ability to maintain attention on a given task , 2 ) shifting : the ability to reallocate attention to a new task or to engage attention on multiple tasks . the acs total score had adequate internal consistency ( = .84 ) as did the focus and shifting subscales ( = .82 and = .68 , respectively , ( 6 ) ) . this instrument had adequate internal consistency in both clinical ( tot = .81 , focus = .78 , & shifting = .84 ) and non - clinical ( tot = .74 , focus = .73 , & shifting = .68 ) samples in iranian population ( 29 ) . the obsessive compulsive inventory - revised ( oci - r ) ; ( 30 ) is an 18-item questionnaire of ocd symptoms . the scale provides a total score and six factors ( washing , checking , obsessing , neutralizing , ordering and hoarding ) . the six factors appear consistent across samples and demonstrate good convergent and divergent validity with the ybocs in patients with ocd ( 30 ) . also internal consistency of this scale was good in iran ( = .85 ) ( 31 ) . penn state worry questionnaire ( pswq ) ; ( 32 ) . the pswq has good internal consistency in both undergraduate ( = .92 ) and clinical samples ( = .74 ) ( 32 ) . additionally , the pswq has demonstrated good test retest reliability over periods up to 10 weeks and is moderately to strongly correlate with the measures of anxiety and depression ( 32 ) . this instrument has adequate internal consistency ( = .88 ) and test - retest reliability ( r= .79 ) in iran ( 33 ) . beck depression inventory - ii ( bdi - ii ) ; ( 34 ) is a 21-item self - report measure with robust psychometric properties ( which assesses the severity of a range of affective , somatic and cognitive symptoms of depression . also , the persian version of this scale has good total validity ( = .91 ) and test - retest reliability ( r = .94 ) ( 35 ) . beck anxiety inventory ( bai ; ( 36 ) is a 21-item self - report measure which assesses the severity of a range of physiological and cognitive symptoms of anxiety over the preceding week . also , kaviany and mosavi validate this instrument in iran and indicated that it has a good internal consistency ( = .92 ) and test - retest reliability ( r = .83 ) ( 37 ) . rumination response scale ( rrs ) ; ( 38 ) is a self - report measure that assesses the tendency to ruminate in response to depressed mood . the rrs contains 22 items that are symptom - focused , self - focused , or focused on possible causes and consequences of the depressive mood . participants respond on these items on a 4-point likert - type scale ranging from 0 to 3 and yielding scores from 22 to 88 ( 38 ) . the rrs possesses good internal consistency ( = 0.89 ) ( 38 ) and 5-month retest reliability ( 39 ) . internal consistency of the persian version is reported 0.88 to 0.92 , using chronbach`s alpha which is good and reliable ( 40 ) . the general health questionnaire-28 ( ghq-28(41 ) is a 28- item self - report questionnaire with a 4 point likert scale . the ghq has demonstrated good psychometric properties ( = 0.89 , r = 0.83 ) ( 41 ) . also , total internal consistency ( = 0.90 ) and test - retest reliability ( r = .70 ) of the persian version was good ( 42 ) . the descriptive statistics and chi - square and t - test were used to analyze the demographic data . also , multivariate analysis of variance ( manova ) and multivariate analysis of covariance ( manova ) were employed to compare the groups . research findings are presented in two sections : the descriptive findings and the findings relevant to the hypotheses . descriptive findings consist of the means and standard deviations of the research variables ( attentional control and its subscales , obsessive compulsive symptoms and its six facets , worry , depression , anxiety and reflection , brooding and depression related rumination ) ( table 2 ) multivariate analysis of variance ( manova ) revealed a main effect of group for all variables . levene s test of equality of error variance was not significant in acs , reflection , brooding and depression related rumination , pswq and oci - r , indicating that variance was equal across groups in these variables . this analysis revealed that the three groups were significantly different in all variables except for attentional control and reflection rumination . the present study set out to compare intrusive thoughts and attentional control in obsessive - compulsive disorder , general anxiety disorder , and non clinical population . the results indicated that compared to the control group , ocd and gad groups reported greater deficits in attentional control , however , ocd and gad groups did not differ in attentional control . these findings suggest that attentional control might be a psycho pathologic factor and it does nt exist in non clinical population . many of studies indicated the role of attentional control in many disorders ( 1 - 8 ) . since , the current findings indicated that attentional control is a shared factor in ocd and gad ; we can conclude attentional techniques are general clinical skills that can be used by less experienced clinicians for treating ocd , gad and also in comorbid conditions . in the current study two clinical groups had higher obsessional thoughts and worry scores than nonclinical group and this finding is not congruent with traditional concepts that assumed worry is the specific factor for gad , and obsession is the specific factor for ocd ( 12 , 43 ) . however of course , there are some researches that disagree with this hypothesis and have reported that obsessional thoughts discriminate these two groups better than preservative worry ( 2 ) . the overlap between worry and obsession can be due to their nature ; however , it can also be related to poor discriminant validity of current measures and questionnaires in distinguishing worry and obsession . for example in oci - r subscales , washing was the only subscale with significantly different scores in ocd and gad groups . this finding suggests that washing / contamination is the factor that can differentiate these two groups at least in iran . since patients in iran often describe washing / contamination as their major intrusive thought , and they often seek treatment for their washing more than other ocd symptoms , participants of the current study might be more involved in contamination thoughts rater than other intrusive thoughts . mancova analysis indicated , when anxiety assumed as covariate the difference between group was not significant , this result confirmed previous results that attentional control has a high correlation with trait anxiety ( 8 , 9 ) . in this research depression is the only factor that differs between gad and ocd groups , but in brown , moras , zinbarg , & barlow s ( 43 ) study gad and ocd groups did nt differ in depression symptoms . one explanation for this contradiction is , ocd patients in our study had chronic course , and depression is due to their ocd symptoms . research findings indicate dysphoric mood amplifies severity of obsessions in ocd patients ( 45 ) . another explanation is that may be ocd symptoms that reported by patients are due to increase in severity of depression . in fact the relationship between obsession and depression has been argued , rachman described often the obsession cause a lowering in mood but in other instances a lowering of mood is followed by an increase in obsessional activity(46 ) . in summary , findings of present study support transdiagnostic model as a new approach for diagnosis , conceptualizing and treatment of comorbid disorders especially emotional disorders and their common features and also , they can be used for designing a unified treatment protocol that will target the attention . like every other study , there are several limitations in this research that should be considered . attentional control is a new concept that is under investigations in recent years ; however there are nt enough researches and support for this concept yet . psychology as a developing science needs more studies in this domain including studying other disorders to assess the differences between them in attentional control and other transdiagnostic factors .
objectiveattention is an important factor in information processing ; obsessive- compulsive disorder ( ocd ) and generalized anxiety disorder ( gad ) are two main emotional disorders with a chronic course . this research examined the relationship among attentional control and intrusive thoughts ( worry , rumination and obsession ) in these disorders . it was hypothesized that attentional control is a common factor in ocd and gad . in addition , we compared worry , rumination and obsession among ocd , gad and non- clinical participants.methodthe research sample included three groups : ocd ( n = 25 ) , gad ( n = 30 ) and non- clinical samples ( n = 56 ) . data were collected using the attentional control scale ( acs ) , rumination response scale ( rrs ) , pennsylvania state worry questionnaire ( pswq ) , beck depression inventory ( bdi ) , beck anxiety inventory ( bai ) , obsessive - compulsive inventory - revised ( oci - r ) and general health questionnaire ( ghq-28 ) . data were analyzed using manova and mancova by spss-17.resultmultivariate analysis of variance revealed that the ocd and gad groups reported greater deficits in attentional control , higher obsessive - compulsive symptoms , rumination , worry , anxiety and depression compared to the control group.conclusionthis research indicated a great attentional deficit in obsessive- compulsive disorder and generalized anxiety disorder . however , no significant difference was found between these two disorders .
the online version of this article ( doi:10.1007/s00125 - 010 - 1874-x ) contains supplementary material , which is available to authorised users . it is now commonly accepted that depressive symptoms and major depressive disorder ( mdd ) are twice as prevalent in individuals with type 2 diabetes [ 1 , 2 ] . moreover , psychological morbidity in people with diabetes poses huge challenges for clinical practice . in a recent who study , the greatest decrements in self - reported health were observed in those with both depression and diabetes , more so than in those with depression and other chronic conditions such as angina , arthritis or asthma . depression has been found to be associated with lower quality of life , poorer diabetes self - care , impaired glycaemic control , and an increased risk of developing diabetes - related complications . given the higher healthcare expenditure and increased mortality [ 9 , 10 ] associated with depression , it is therefore not surprising that clinical guidelines now recommend that all patients with diabetes undergo regular screening for depression [ 11 , 12 ] . it remains unclear , however , whether the presence of diabetes increases risk for depression , or whether depression increases risk for diabetes . the early studies in this area used mainly cross - sectional study designs , which preclude any causal inferences as to the direction of this relationship , thus making any recommendations for practice problematic [ 1 , 2 ] . more recently , the temporal relationship between depression and diabetes has been the focus of a number of longitudinal prospective population - based studies . three systematic reviews and meta - analyses [ 1315 ] found that depression was associated with an increased risk of incident diabetes . the reverse , that diabetes may be a risk factor for depression , has been the focus of one earlier systematic review and meta - analysis , which included seven studies . it was found that people with type 2 diabetes had a modest increased risk of developing depression . however , the authors did not distinguish between studies that used a diagnosis of a depressive disorder and those that measured depressive symptoms using self - report measures . this distinction is important , because high levels of depressive symptoms as measured through self - report questionnaires were found to be more reflective of general emotional and diabetes - specific distress than of clinical depression [ 16 , 17 ] . therefore , this report examines the relationship between diabetes and depression by conducting a meta - analysis of longitudinal studies published on this subject in the peer - reviewed literature . moreover , we examined separately studies that included a diagnosis of a depressive disorder and those using self - report measures of depression . retrieval of studies to identify the studies of interest , medline ( 1966 to september 2009 ) , psycinfo ( 1872 to september 2009 ) , and embase ( 1950 to september 2009 ) databases were searched . the search terms are shown in electronic supplementary material ( esm ) table 1 . titles and abstracts of the retrieved studies were scanned to exclude studies that were clearly irrelevant . the full text of the remaining studies was then read by three authors ( a. nouwen , k. winkley and f. pouwer ) , who independently determined whether the studies met the inclusion criteria . disagreements were solved by a fourth author ( mp ) , who independently examined the studies , and then consensus was reached . furthermore , the reference lists of articles that studied our topic of interest were scanned to check for additional publications . inclusion / exclusion criteria in this systematic review and meta - analysis , we included all studies that longitudinally examined the relationship between type 2 diabetes and onset of depression , irrespective of their study design . studies were excluded if the authors did not explicitly exclude patients with prevalent depression at baseline or did not control for this statistically , and if there were insufficient data to estimate a relative risk ( or , risk ratio or hr ) . when multiple publications from the same study population were available , we included the most recent publication . data extraction three authors ( a. nouwen , f. pouwer and c. e. lloyd ) independently extracted data from the studies , in particular regarding : ( 1 ) name of first author , ( 2 ) publication year , ( 3 ) study design , ( 4 ) follow - up time in years , ( 5 ) number of patients in the analysis , ( 6 ) sex of patients , ( 7 ) age of patients , ( 8) method of depression assessment , ( 9 ) method of diabetes assessment , ( 10 ) unadjusted and adjusted relative risks and 95% ci ( adjusted for the largest number of confounders ) , ( 11 ) confounders adjusted for , ( 12 ) method used for exclusion of depressed patients at baseline , ( 13 ) overall incidence of depression per year.in the included studies , method of depression assessment could be either ( 1 ) a diagnosis of depression assessed by a diagnostic psychiatric interview , ( 2 ) assessment of depressive symptoms by a self - reported questionnaire or ( 3 ) a diagnosis by a physician . studies identified depressed patients at baseline through either self - report measures or screening , the latter using a psychiatric diagnostic interview for depression . overall incidence per year was extracted as the crude incidence of depression in the whole study population , divided by follow - up duration . type of diabetes could be assessed through either self - report or screening , i.e. measuring blood glucose of all patients , or from patients medical records.the quality of the included studies was rated independently by two authors ( a. nouwen , k. winkley ) using criteria for cohort studies from the centre for reviews and dissemination , university of york , uk . these include adequacy of the description of groups ( type 2 diabetes mellitus , type 2 diabetes mellitus with depression , control without depression and control with depression ) , control for confounding variables ( age , sex , socioeconomic status , education ) , blinding of baseline assessment data ( diagnosis only ) , description of follow - up data , description of dropout rates , and comparison of dropout rates between groups on key variables . any disagreement was independently reviewed by a third author ( mp ) until consensus was reached . , in each study the relative risk of the model that most closely adjusted for demographic variables ( age , sex , socioeconomic status , marital status ) was used to estimate a pooled or . both the fixed effects model ( fem ) and the random effects model ( rem ) were used . the fixed effects model assumes that variability between studies is exclusively due to random variation and individual studies are simply weighted by their precision . the random effects model assumes a different underlying effect for each study and takes this into consideration as an additional source of variation . a random effects meta - analysis is more conservative than a fixed effects meta - analysis , as it gives wider cis around the point estimate , and is recommended when heterogeneity between studies exists . because of expected heterogeneity in the results , we report the results from only the rems . a forest plot was made to show the relative risk and 95% ci of each study and the pooled or and 95% ci . studies reporting hrs were also included . as the hr provides an underestimation of the or and the prevalence of depression is not very high , this underestimation would be small , resulting in a more conservative estimate of the pooled or.to provide visual assessment of publication bias a funnel plot was drawn , in which the or was plotted on a logarithmic scale on the vertical axis against its corresponding standard error for each study on the horizontal axis . publication bias was also assessed by means of the begg - adjusted rank correlation test . to check the influence of publication bias , a pooled or was calculated . finally , the influence of several aspects of study design on incidence rates was investigated with meta - regression analysis . because the number of studies in the meta - regression is small , we first conducted a set of bivariate regressions to identify significant correlates for inclusion in a multiple regression analysis . all statistical analyses were performed using stata 10.0 ( stata corporation , college station , tx , usa ) . the medline search identified 385 articles , of which 10 [ 2130 ] met our inclusion criteria and were subsequently included in the systematic review and meta - analysis ( esm fig . 1 ) . the search in embase ( total number of studies = 381 ) identified one additional study meeting the selection criteria , but no further studies were identified through the search in psycinfo ( total number of studies = 17 ) . thus , a total of 19 studies were retrieved for detailed evaluation , of which 11 studies were selected for inclusion in the meta - analysis . the extracted data of the 11 studies included are presented in esm table 2 . it should be noted that two studies [ 23 , 24 ] reported hrs rather than ors . qualitative analysis the results of the quality assessment of the included studies can be found in esm table 3 . only one study provided adequate description of the four groups ( diabetes depressed , diabetes non - depressed , non - diabetes depressed , non - diabetes non - depressed ) in terms of confounding variables such as age , sex , number and type of complications . as such , it was , in most cases , impossible to see whether the groups were comparable on important confounding variables . however , most studies ( n = 8) controlled statistically for a number of potentially confounding variables.four studies used diagnostic criteria to determine depression status [ 2426 , 30 ] , but none of these studies reported whether there was any blinding of the assessors to the status of diabetes . however , as brown et al . and oconnor et al . were retrospective studies and diagnosis of depression was made by general practitioners independent of the study rather than by trained assessors , lack of blinding was deemed less important . however , reliability of the diagnosis of depression in these two studies was not reported.the follow - up time varied between less than 2 years and 10 years . two studies [ 22 , 26 ] combined data from waves at different time points ( 2 and 5 years follow - up ) to calculate depression incidence . finally , while all but two studies [ 24 , 31 ] reported the proportion of the cohort that was followed up , only three studies [ 21 , 22 , 25 ] reported whether dropout rates and reasons for dropout were similar across groups . it should be noted that the criteria that were used for establishing diabetes differed among the studies , with most relying on doctor s diagnosis [ 24 , 31 ] or self - report of doctor s diagnosis [ 22 , 23 , 2527 ] . others also used medication use or blood tests such as ogtt or fasting plasma glucose [ 21 , 2730 ] or hba1c levels . meta - analysis based on all studies , including 48,808 cases of type 2 diabetes , the pooled or was 1.24 ( 95% ci 1.091.40 ) . the forest plot of the or and 95% ci of each study , and the pooled or of both the fem and the rem , are shown in fig . 1forest plots showing the or of depression in type 2 diabetes for individual studies using depression self - report questionnaires , diagnostic criteria , and all studies combined . the size of each square corresponds to the weight of the study in the meta - analysis . + l , random - effects estimate ( der simonian and laird method ) ; i v , fixed - effects estimate ( inverse variance method)the funnel plot suggested possible publication bias ( fig . 2 ) . this was also supported by begg s adjusted rank correlation test ( p = 0.70 ) and the egger test ( p = 0.81 ) . 2begg s funnel plot with pseudo 95% ci of all the studies included in the meta - analysisthe test for heterogeneity was significant ( q = 30.84 ; df = 10 ; p = 0.001 ) , with a moment - based estimate of between studies variance of 0.021 , indicating heterogeneity . we therefore stratified the studies by method of defining depression . among the six studies that relied on questionnaires to define depression , the pooled or was 1.19 ( 95% ci 1.031.39 ) and the test for heterogeneity was not significant ( q = 8.03 ; df = 5 ; p = 0.16 ) , with a moment - based estimate of between studies variance of 0.013 . in the five studies that defined depression using diagnostic criteria , the risk of depression was higher than for studies using questionnaires , with a pooled or of 1.29 ( 95% ci 1.051.59 ) . the test for heterogeneity was significant ( q = 22.42 ; df = 4 ; p < 0.001 ) , with a moment - based estimate of between studies variance of 0.032 . however , as one study relying on diagnostic criteria to define depression included incident ( new ) cases of diabetes , the analysis was rerun without this study . the pooled or for the four remaining studies was 1.47 ( 95% ci 1.341.60 ) and the test for heterogeneity was not significant ( q = 0.91 ; df = 3 ; p = 0.82 ) , with a moment - based estimate of between studies variance of 0.00 . forest plots showing the or of depression in type 2 diabetes for individual studies using depression self - report questionnaires , diagnostic criteria , and all studies combined . the size of each square corresponds to the weight of the study in the meta - analysis . d + l , random - effects estimate ( der simonian and laird method ) ; i v , fixed - effects estimate ( inverse variance method ) begg s funnel plot with pseudo 95% ci of all the studies included in the meta - analysis meta - regression because stratifying by ( controlling for ) method of depression measurement ( diagnosis or questionnaire ) reduced the significant overall study heterogeneity to non - significance , meta - regression analysis was performed to examine this further . the results showed that type of depression measurement ( = 0.25 ; p < 0.001 , 95% ci 0.37 , 0.14 ) was a significant predictor of depression incidence , with rates higher for studies using diagnostic criteria to define depression.additional meta - analyses were performed to determine whether other factors might account for the heterogeneity in study - specific incidence rates . for example , as can be seen in fig . 1 , the forest plot showed that the ors increase over time , suggesting that the incidence of depression is increased in more recent studies . therefore , a set of single - factor meta - regression analyses was performed with time since publication , follow - up time , number of follow - up depression measurements ( 1 vs > 1 or continuous assessment ) , sample size , and number of people with diabetes as separate predictors of depression incidence or . the results showed that year of publication ( = 0.09 ; p < 0.001 , 95% ci 0.050.12 ) was a significant predictor of depression incidence or , but time of follow - up , sample size , the number of people with diabetes , and number of follow - up depression measurements were not ( p > 0.09 ) . because type of depression measurement and year of publication may be confounded , we also examined these together in a single regression model . the results showed that year of publication remained significant ( = 0.09 , p < 0.02 , 95% ci 0.020.16 ) but type of depression measurement was no longer significant ( = 0.07 , p < 0.95 , 95% ci 0.240.22 ) the results of this systematic review and meta - analysis of 11 studies involving 172,521 participants , including 48,808 people with type 2 diabetes , show that overall people with type 2 diabetes have a 24% increased risk of incident depression compared with people without diabetes . the risk found in the current study including four more studies is slightly higher than the one found in an earlier meta - analysis ( or 1.15 , 95% ci 1.021.30 ) . when studies that used questionnaires to define depression were separated from those using diagnostic criteria , the odds of incident depressive symptoms were somewhat lower ( or 1.21 ) than the risk of developing incident depressive disorder ( or 1.29 ) . interestingly , this difference was accentuated when a study that included incident diabetes rather than prevalent diabetes was excluded from the analysis ; the increased chance of people with diabetes developing a depressive disorder was almost 50% . although the difference in incidence rates between diagnostic studies and questionnaire studies was significant , the meta - regression analysis showed that this effect may have been confounded by higher ors in more recent published studies . relative to the earlier meta - analysis , heterogeneity was larger in the present meta - analysis . this is primarily a function of the fact that later studies , those not included in the earlier analysis , reported higher levels of increased risk for persons with diabetes . we have no definitive explanation for the apparent increase in incident depression in more recent studies , although it is possible that both people with diabetes and healthcare professionals have become increasingly aware of symptoms of depression in diabetes , which may have led to higher scores at follow - up measurements . the results of this study should be interpreted cautiously with regard to whether diabetes is a risk for incident depression in the strictest sense , i.e. the initial episode of depression . with the exception of brown et al . , who excluded participants with depressive episodes within 3 years before the onset of the study , none of the other studies in this meta - analysis excluded people who had had depression at some point during a lengthy period before the onset of the study . because recurrence of depressive disorder is high , especially among people with diabetes , the increased incidence of depressive episodes may be due , in part , to diabetes or stressors related to diabetes triggering depression more frequently in people with vulnerability for depression , i.e. , people with a history of depression . it is possible that the incident depression was associated with the development of diabetes - related complications . study only included people with incident diabetes , and the likelihood of diabetes - related complications is likely to be lower in this sample . interestingly , in this study the risk of developing depression was increased in people with cerebrovascular disease and peripheral arterial disease but not in those with coronary artery disease . . found that the longitudinal association of diabetes and depression was reduced after controlling for other chronic somatic diseases and was no longer significant . these findings are consistent with the results of two large cross - sectional studies [ 33 , 34 ] showing that the prevalence of depressive disorder was higher in diabetes patients with diabetes - related complications , especially cardiovascular disease , than in those without complications . the increased incidence rate for depression in people with type 2 diabetes found in the current meta - analysis ( or 1.19 1.47 ) contrasts with a two - fold increase in the prevalence rate of depression ( or 2.0 ) found in a previous meta - analysis . first , because prevalence is a function of not only incidence but also duration , the prevalence of a chronic condition such as depression is higher than one might expect based on the incidence rate alone . this line of reasoning is supported by earlier reports that , among people with diabetes , episodes of mdd last longer and are more recurrent [ 32 , 35 ] . our finding that the risk in diabetes of developing depressive disorder is greater than that of developing depressive symptoms is consistent with this . in addition , because depression is a risk factor for the development of diabetes , relatively more people with diabetes would have a history of depression and as such an increased risk of developing a further episode . we were able to examine several aspects of this variation , finding that few factors were associated with study - specific levels of diabetes risk . however , there was substantial variation among studies using a particular form of depression measurement . among the studies that used diagnostic criteria for the assessment of depression , two relied on the clinical judgement of general practitioners to establish a diagnosis while the other two used formal diagnostic interview schedules with trained researchers . among studies using self - report questionnaires to assess depressive symptoms , different questionnaires and different cut - off values were used to define cases of depression . because self - reported depressive symptoms in people with diabetes have been found to be indicative of general emotional and diabetes - specific distress rather than depressive disorder , the questionnaire studies , especially those with lower cut - off values , may have resulted in an over - estimation of the incidence rate of clinically significant levels of depression in people with diabetes . in addition , some studies also included antidepressant medication use as a stand - alone proxy measure of depression [ 24 , 28 , 29 , 31 ] . however , because antidepressant medication is prescribed for other problems , such as neuropathic pain [ 36 , 37 ] or sedation , this also may have artificially increased the incidence rate , particularly among people with diabetes . finally , a number of studies [ 21 , 27 ] used different measures or cut - off values at baseline than at follow - up , which may have led to misclassification of cases of depression at baseline and therefore affected the incidence rates for depression . another limitation is that the majority of the studies analysed here limited the assessment of incident depression to a single follow - up at a distinct time point , and none assessed the onset and offset of depressive episodes ; thus these studies provide no insight into the temporal dynamics of the episodes . finally , the relatively small number of studies available for analysis limited our ability to examine the independent contribution of multiple methodological factors in accounting for the between - study variation in diabetes - related risk for depression . overall , the results from this meta - analysis suggest that the risk of a new depressive episode is higher among people with type 2 diabetes than in the general population . this increased risk may be greater among people who have suffered a previous depressive episode or who have diabetes - related complications . moreover , the risk of incident depression associated with diabetes appears to be increasing over time . because of the negative consequences of depression in diabetes , such as poorly controlled diabetes , an increased risk of complications , higher mortality and increased healthcare costs we would further suggest that such efforts should be incorporated into treatment programmes for depression . search terms used to identify relevant articles in embase , medline and psycinfo databases ( pdf 6 kb ) selected characteristics of studies examining the incidence of depression in type 2 diabetes mellitus ( pdf 120 kb ) quality assessment of included studies ( pdf 38 kb ) flow diagram of the selection of studies for the meta - analysis ( pdf 49.4 kb )
aims / hypothesisan earlier meta - analysis showed that diabetes is a risk factor for the development and/or recurrence of depression . yet whether this risk is different for studies using questionnaires than for those relying on diagnostic criteria for depression has not been examined . this study examined the association of diabetes and the onset of depression by reviewing the literature and conducting a meta - analysis of longitudinal studies on this topic.methodsembase , medline and psycinfo were searched for articles published up to september 2009 . all studies that examined the relationship between type 2 diabetes and the onset of depression were included . pooled relative risks were calculated using fixed and random effects models.resultseleven studies met our inclusion criteria for this meta - analysis . based on the pooled data , including 48,808 cases of type 2 diabetes without depression at baseline , the pooled relative risk was 1.24 ( 95% ci 1.091.40 ) for the random effects model . this risk was significantly higher for studies relying on diagnostic criteria of depression than for studies using questionnaires . however , this difference was no longer significant when controlled for year of publication.conclusions/interpretationcompared with non - diabetic controls , people with type 2 diabetes have a 24% increased risk of developing depression . the mechanisms underlying this relationship are still unclear and warrant further research.electronic supplementary materialthe online version of this article ( doi:10.1007/s00125 - 010 - 1874-x ) contains supplementary material , which is available to authorised users .
a 60-year - old hypertensive man with no history of head trauma presented with sudden headache and vomiting . he was admitted to our department 5 days after the on - set of the symptoms . his past neurological history was unrevealing and there was no history of head trauma , blood clot disturbances , or anticoagulant therapy . cranial computed tomography revealed subacute subdural hematoma in the left hemisphere , as well as interhemispheric subdural hemorrhage and minimal subarachnoid hemorrhage in the left perimesencephalic space ( figure 1 ) . computed tomography angiography ( cta ) showed a fusiform aneurysm at the p2 segment of the left posterior cerebral artery ( figure 2a ) . he underwent stent - assisted coil embolization and post - embolization angiogram of the left vertebral artery showed the aneurysm was successfully occluded ( figures 2b&2c ) . but 3 days after the embolization of the aneurysm , he developed a change in mental status accompanied by slurred speech and narcolepsy . emergency ct scan revealed enlargement of the left - sided subacute subdural hematoma with a new slight midline shift . the patient s neurological and functional status gradually improved and was transferred to local hospital for further rehabilitation 2 weeks after admission . computed tomography scans 1 month after admission showing no abnormalities ( figure 3 ) . computed tomography scans showing subacute subdural hematoma in the left hemisphere ( short arrow ) , as well as interhemispheric subdural hemorrhage ( long arrow ) and minimal subarachnoid hemorrhage in the left perimesencephalic space ( arrowhead ) . computed tomography angiogram showing a ) a fusiform aneurysm of the left posterior cerebral artery ( arrow ) . b ) unsubtracted image before embolization showing the aneurysm treated by stent assisted coiling ( arrows indicating the proximal and distal ends of the stent ) . c ) post - embolization angiogram of the left vertebral artery showing the occlusion of the aneurysm . intracranial aneurysm rupture is classically characterized by subarachnoid hemorrhage ( sah ) , and it is often complicated by intracerebral hematoma ( ich ) and intraventricular hematoma ( ivh ) . but the clinical incidence of sdh complication is very low , which was reported to be 0.5 - 7.9%.1,2 and the most frequently reported site of aneurysm location is the internal carotid artery ( ica)-posterior communicating artery , which is followed by aneurysms of middle cerebral artery and distal anterior cerebral artery.2,5 we described a case of ruptured pca aneurysm presenting as subdural hematoma , which is relatively rare . several mechanisms have been proposed to explain the occurrence of sdh after aneurysm rupture:1,2,5,6 1)successive minor bleedings case the developing of adhesions , resulting in final rupture into the subdural space ; 2 ) high - pressure hemorrhage may lead to rapid accumulation of blood from the leaking aneurysm , rupturing the arachnoid membrane ; 3 ) intracerebral hemorrhage may rupture through the cortex and cause a tear of the arachnoid membrane ; 4 ) a carotid artery aneurysm arising from the part of carotid artery within the subdural space may rupture and cause subdural hematoma directly ; and 5 ) the acute enlargement of the intracavernous aneurysm may erode the cavernous sinus wall . as in this case , the patient had suffered headache since 4 days before he was admitted to hospital , this warning sign may reflect the presence of successive small bleedings . whatever the cause , most cases of aneurysmal sdh show sah on the ct scans , and this will address the diagnosis upon a vascular cause of hemorrhage . in a small percentage of cases , however , aneurysmal rupture can cause a subdural blood collection without sah , a rare condition called pure sdh , which may lead to inappropriate diagnosis and management.1,7 since cranial ct can not reveal the cause of these pathologies , it is potential for such patients to undergo cta or digital subtraction angiography as soon as possible to reveal the source of bleeding . then appropriate therapy should be conducted depending on the location of the aneurysm and the clinical situation promptly . aneurysms of the pca are rare . because of the presence of complex perforating branches and adjacent to the cranial nerves , the surgical approach and exposure of the pca is technically challenging.8 so endovascular treatment is relatively a safe and effective approach with low mortality and morbidity for these aneurysms.8,9 in this case we performed stent - assisted coil embolization to treat the aneurysm in the p2 segment of the pca . compared with the parent artery occlusion , the advantage of stent - assisted techniques is not only that the tight aneurysm packing with coils is attainable with less risk of coil migration or coil bulging into the parent artery , but that can preserve the parent artery , avoiding ischemic neurological events.10 even though the patient did not undergo direct surgery , the subarachnoid hemorrhage in the left perimesencephalic space and the extravasation of the blood along the interhemispheric subdural space all suggest a causal association between the subdural bleeding and the aneurysm . in conclusion , spontaneous arterial sdh due to a p2 segment of pca has been rare reported earlier . we should be reminded that cerebral aneurysm rupture should be considered in spontaneous subdural hematoma , especially those with no evidence of subarachnoid hemorrhage , and the appropriate treatment should be planned with expediency
subdural hematoma ( sdh ) caused by rupture of a cerebral aneurysm is rare and is usually associated with delayed diagnosis and treatment . we present a patient of a posterior cerebral artery aneurysm presenting as subacute sdh . the incidence , mechanisms and treatment of this condition are discussed .
the advent of p2y12 inhibitors with antiplatelet effects has extended the use of the drug - eluting stent ( des ) for occlusive coronary artery disease . dual antiplatelet therapy ( dapt ) with aspirin and clopidogrel had been considered the standard treatment in patients with acute coronary syndromes ( acss ) undergoing percutaneous coronary intervention ( pci ) , because dapt has been shown to reduce the incidence of myocardial infarction ( mi ) or death from cardiovascular ( cv ) causes.1)2 ) nevertheless , the incidence of ischemic events remains high among patients with acs.3 ) clopidogrel is a pro - drug that is converted to its active metabolite principally by cytochrome ( cyp ) p4502c19 , at which time it inhibits platelet activation by irreversibly binding the p2y12 receptor . genetic polymorphisms in abcb1 and cyp2c19 may affect the absorption and metabolism , respectively , of clopidogrel , and consequently alter its pharmacodynamics . as a result , there exists high interindividual variability in the responsiveness to clopidogrel and on - treatment platelet reactivity ( opr ) . high opr ( hopr ) with clopidogrel use is associated with an increased risk of ischemic events in patients with acs undergoing pci.4 - 6 ) newer and more potent p2y12 inhibitors , such as prasugrel or ticagrelor , have been shown to be superior to clopidogrel in terms of their ability to decrease ischemic events in patients with acs . however , their benefits are limited because of increased episodes of bleeding.7)8 ) personalization of antiplatelet treatment for acs may be necessary to attain the maximum inhibition of platelet activation with a minimum risk of bleeding . the recent development of point - of - care assay kits , verifynow p2y129 - 11 ) and verigene clo assays,12 ) for the assessment of platelet function and cyp2c19 polymorphisms , respectively , has enabled the immediate assignment of individualized antiplatelet treatment . however , as yet , studies using high - dose clopidogrel or prasugrel have not conclusively demonstrated a clinical benefit of the phenotype-10)13 ) or genotype - directed personalization of antiplatelet therapy14 ) based on residual platelet reactivity , or the presence of cyp2c19 loss - of - function alleles . therefore , the aim of this study was to investigate the feasibility of point - of - care genotypic and phenotypic testing to guide individualized antiplatelet therapy using ticagrelor in korean patients with non - st elevation acs undergoing pci . we also compared the effectiveness of genotype- and phenotype - directed antiplatelet therapy in terms of decreasing the number of patients with hopr after 30 days . the present study was a single center , prospective , randomized , proof - of - concept trial . the study protocol was approved by the ethical review board of yonsei severance christian hospital ( wonju , korea ) . informed consent was obtained from all participants . between april 10 , 2012 and february 6 , 2013 , 65 patients aged 18 - 75 years were randomly assigned to genotype- or phenotype - directed treatment according to a random - number table . patients were eligible if they had undergone pci for non - st - elevation acs . patients presenting with st - segment elevation myocardial infarction and who had had severe left ventricular dysfunction ( ejection fraction , < 30% ) or cardiogenic shock were excluded from the study . other exclusion criteria were bradyarrhythmia , a history of transient ischemic or cerebrovascular attacks , a platelet count of < 150000/ml , hematocrit of < 30% , and a creatinine clearance rate of < 30 ml / min . patients who received a periprocedural thrombolytic agent or glycoprotein iib - iiia inhibitor , or who planned to use oral anticoagulants or other antiplatelet agents , such as cilostazol , were also excluded . on - treatment platelet reactivity was measured using the verifynow p2y12 assay ( accumetrics , san diego , ca , usa ) . blood samples were obtained 12 to 24 hours after pci and after a 30-day follow - up period . each sample was placed in a tube containing 3.2% citrate , and the p2y12 reaction unit ( pru ) value was assessed within 2 hours , as previously described.11 ) hopr was defined as pru value 230 based on previous studies involving caucasian subjects.9)15 ) although studies conducted among korean subjects revealed that hopr of an approximate pru value of 270 is necessary to predict future cardiovascular events,4)16)17 ) we selected a pru value of 230 as the cutoff , in order to include more patients who might benefit from phenotype - directed antiplatelet therapy . all patients were screened for the cyp2c192 , 3 , or 17 allele by using the verigene clo assay ( nanosphere , northbrook , il , usa ) . the verigene clo assay is an automated sample - to - result microarray - based assay in which deoxyribonucleic acid ( dna ) extracted from whole blood samples is hybridized to allele - specific probes immobilized on a glass slide . the detection of captured dna is achieved using nanoparticle - conjugated probes that have been demonstrated to provide excellent sensitivity and that eliminate the need for a target amplification step prior to array hybridization.18 ) the verigene clo assay accurately identified homozygous and heterozygous 2 and 3 phenotypes with a specificity of 100% and a final call rate of 99.7% . the assay is automated and can yield results in approximately 3.5 hours.19 ) regardless of their prior exposure to clopidogrel , all patients received 300 mg of aspirin and 300 mg of clopidogrel before arriving at the catheterization room . a bolus of unfractionated heparin ( 70 u / kg ) was administered immediately before coronary angiography through the introducer sheath . a second bolus of unfractionated heparin ( 70 u / kg ) was administered immediately before the pci . additional heparin was administered to achieve an activated clotting time of 250 - 300 seconds . pci was performed using balloon predilatation , followed by des deployment via the transradial or transfemoral artery . the choice regarding the specific type of des was left to be determined by the operator 's discretion . patients with hopr or who were cyp2c19 2 or 3 carriers were also given 90 mg of ticagrelor twice daily . patients without hopr or who were non - carriers were given 75 mg of clopidogrel daily ( fig . 1 ) . the primary endpoint was the percentage of patients with hopr after 30 days of dapt . the secondary endpoints were 1 ) pru , pru , percent inhibition of platelet aggregation ( % ipa ) , and %ipa , 2 ) the correlation between the presence of cyp2c19 2 or 3 carriers and hopr at the baseline , 3 ) the incidence of bleeding using the bleeding academic research consortium ( barc ) definition,20 ) and 4 ) major adverse cardiac events ( maces ) defined as the composite of death from cv causes , non - fatal myocardial infarction , ischemia - driven target lesion revascularization , or stent thrombosis . the proportion of patients with hopr after 1 month of dapt in the genotype - directed group was assumed to be 5%.14 ) on a ratio basis of 80% , we calculated that we needed 44 subjects per group to detect a 20% difference between the groups . the significance level of the test was targeted at 0.05 . assuming a dropout rate of 14% , we would therefore need 50 patients each in the genotype- and phenotype - directed groups , forming a total of 100 patients . enrollment was ceased at 65 patients because the number of verigene clo assay kits was insufficient . analysis was based on intent - to - treat or per - treatment where necessary . all continuous variables are presented as meansd and were analyzed using the student 's t - test . categorical variables are presented as frequencies ( percentage ) , and were analyzed using the chi - square test or fisher 's exact test . we compared platelet reactivity at the baseline and after 30 days in the genotype- and phenotype - directed groups by using the student 's t - test . all analyses were performed with statistical package for the social sciences ( spss ) 20.0 ( spss inc . , the present study was a single center , prospective , randomized , proof - of - concept trial . the study protocol was approved by the ethical review board of yonsei severance christian hospital ( wonju , korea ) . informed consent was obtained from all participants . between april 10 , 2012 and february 6 , 2013 , 65 patients aged 18 - 75 years were randomly assigned to genotype- or phenotype - directed treatment according to a random - number table . patients were eligible if they had undergone pci for non - st - elevation acs . patients presenting with st - segment elevation myocardial infarction and who had had severe left ventricular dysfunction ( ejection fraction , < 30% ) or cardiogenic shock were excluded from the study . other exclusion criteria were bradyarrhythmia , a history of transient ischemic or cerebrovascular attacks , a platelet count of < 150000/ml , hematocrit of < 30% , and a creatinine clearance rate of < 30 ml / min . patients who received a periprocedural thrombolytic agent or glycoprotein iib - iiia inhibitor , or who planned to use oral anticoagulants or other antiplatelet agents , such as cilostazol , were also excluded . on - treatment platelet reactivity was measured using the verifynow p2y12 assay ( accumetrics , san diego , ca , usa ) . blood samples were obtained 12 to 24 hours after pci and after a 30-day follow - up period . each sample was placed in a tube containing 3.2% citrate , and the p2y12 reaction unit ( pru ) value was assessed within 2 hours , as previously described.11 ) hopr was defined as pru value 230 based on previous studies involving caucasian subjects.9)15 ) although studies conducted among korean subjects revealed that hopr of an approximate pru value of 270 is necessary to predict future cardiovascular events,4)16)17 ) we selected a pru value of 230 as the cutoff , in order to include more patients who might benefit from phenotype - directed antiplatelet therapy . all patients were screened for the cyp2c192 , 3 , or 17 allele by using the verigene clo assay ( nanosphere , northbrook , il , usa ) . the verigene clo assay is an automated sample - to - result microarray - based assay in which deoxyribonucleic acid ( dna ) extracted from whole blood samples is hybridized to allele - specific probes immobilized on a glass slide . the detection of captured dna is achieved using nanoparticle - conjugated probes that have been demonstrated to provide excellent sensitivity and that eliminate the need for a target amplification step prior to array hybridization.18 ) the verigene clo assay accurately identified homozygous and heterozygous 2 and 3 phenotypes with a specificity of 100% and a final call rate of 99.7% . regardless of their prior exposure to clopidogrel , all patients received 300 mg of aspirin and 300 mg of clopidogrel before arriving at the catheterization room . a bolus of unfractionated heparin ( 70 u / kg ) was administered immediately before coronary angiography through the introducer sheath . a second bolus of unfractionated heparin ( 70 u / kg ) was administered immediately before the pci . additional heparin was administered to achieve an activated clotting time of 250 - 300 seconds . pci was performed using balloon predilatation , followed by des deployment via the transradial or transfemoral artery . the choice regarding the specific type of des was left to be determined by the operator 's discretion . patients with hopr or who were cyp2c19 2 or 3 carriers were also given 90 mg of ticagrelor twice daily . patients without hopr or who were non - carriers were given 75 mg of clopidogrel daily ( fig . the primary endpoint was the percentage of patients with hopr after 30 days of dapt . the secondary endpoints were 1 ) pru , pru , percent inhibition of platelet aggregation ( % ipa ) , and %ipa , 2 ) the correlation between the presence of cyp2c19 2 or 3 carriers and hopr at the baseline , 3 ) the incidence of bleeding using the bleeding academic research consortium ( barc ) definition,20 ) and 4 ) major adverse cardiac events ( maces ) defined as the composite of death from cv causes , non - fatal myocardial infarction , ischemia - driven target lesion revascularization , or stent thrombosis . the proportion of patients with hopr after 1 month of dapt in the genotype - directed group was assumed to be 5%.14 ) on a ratio basis of 80% , we calculated that we needed 44 subjects per group to detect a 20% difference between the groups . the significance level of the test was targeted at 0.05 . assuming a dropout rate of 14% , we would therefore need 50 patients each in the genotype- and phenotype - directed groups , forming a total of 100 patients . enrollment was ceased at 65 patients because the number of verigene clo assay kits was insufficient . analysis was based on intent - to - treat or per - treatment where necessary . all continuous variables are presented as meansd and were analyzed using the student 's t - test . categorical variables are presented as frequencies ( percentage ) , and were analyzed using the chi - square test or fisher 's exact test . we compared platelet reactivity at the baseline and after 30 days in the genotype- and phenotype - directed groups by using the student 's t - test . all analyses were performed with statistical package for the social sciences ( spss ) 20.0 ( spss inc . , of the 32 patients in the genotype - directed group , 21 cyp2c19 2 or 3 carriers ( 65.6% ) were administered ticagrelor and 11 cyp2c19 2 or 3 non - carriers ( 34.4% ) were administered clopidogrel . of the 33 patients in the phenotype - directed group , 11 patients with hopr ( 33.3% ) were administered ticagrelor and 22 patients without hopr ( 66.7% ) were administered clopidogrel . in the genotype - directed group , there were five crossover cases from ticagrelor to clopidogrel because of dyspnea ( 2 patients ) , nasal bleeding ( 1 patient ) , petechia on the whole body ( 1 patient ) , and generalized rash ( 1 patient ) . in the phenotype - directed group , sixty - one patients ( 95.3% ) had follow - up verifynow p2y12 assay , 31 and 30 in the genotype- and phenotype - directed groups , respectively ( fig . the two groups were balanced with respect to age , sex , and histories of diabetes mellitus , hypertension , hyperlipidemia , smoking , and myocardial infarction . the distribution of discharge medication use between the two groups was similar , except for the use of clopidogrel and ticagrelor . clopidogrel was taken more frequently and ticagrelor less frequently by patients in the phenotype - guided group ( clopidogrel : 34.4% vs. 66.7% , genotype vs. phenotype , p=0.009 ; ticagrelor : 65.6% vs. 33.3% , genotype vs. phenotype , p=0.009 ) . the indications for pci , left ventricular ejection fraction , and distribution of vessels stented did not differ between the groups . procedural variables including the extent of coronary artery disease , stent number , total stent length , and mean stent diameter were also similar . the comparison of opr according to the personalization strategy of dapt , there were no differences in opr , % ipa , and the percentage of patients with hopr between the groups . opr decreased following both genotype- and phenotype - directed therapies ( 24283 vs. 10990 , p<0.001 in the genotype - directed group ; 21674 vs. 10990 , p=0.001 in the phenotype - directed group ) . at day 30 , the percentage of patient with hopr tended to be higher in the genotype - directed group ( 16.2% vs. 3.3% , p=0.086 ) . at the 30-day follow - up , pru and % ipa were similar between the two groups . however , pru was higher in the genotype- versus the phenotype - directed group ( 156115 vs. 83124 , p=0.027 ) . this may be due to the fact that more patients were administered ticagrelor in the genotype - directed group ( 51.6% vs. 33.3% , p=0.009 ) . 23% were homozygous for cyp2c19 2 or were carriers of cyp2c19 2/3 ( table 3 ) . baseline opr was higher in patients expressing cyp2c19 2/2 or cyp2c19 2/3 compared to that in patients expressing wild - type cyp2c19 1/1 or cyp2c191/17 and in patients heterozygous for cyp2c19 2 or 3 ( 28050 vs. 21480 , p=0.004 ) . however , no difference was found in the baseline opr between cyp2c19 2 or 3 non - carriers and those heterozygous for cyp2c19 2 or 3 ( 21784 vs. 20978 , p=0.880 ) . after 30 days , opr from the baseline to follow - up was higher among patients expressing cyp2c19 2/2 or cyp2c19 2/3 , corresponding with a greater percentage of patients receiving ticagrelor . the number of patients with hopr at baseline was greater in those allocated ticagrelor ; however , none had hopr after 30 days of treatment . the number of patients with hopr did not change after 30 days of clopidogrel treatment ( table 4 ) . after 30 days of treatment , opr was lower ( 4930 vs. 17977 , p<0.001 ) in patients taking ticagrelor compared to clopidogrel ( fig . 2 ) ; accordingly , pru from baseline to follow - up was higher ( 849 vs. 3426 , p<0.001 ) in patients given ticagrelor . there were two nuisance barc type 2 bleeding events in the genotype - directed group related to ticagrelor use . the comparison of opr according to the personalization strategy of dapt is as shown in table 2 . at the baseline , there were no differences in opr , % ipa , and the percentage of patients with hopr between the groups . opr decreased following both genotype- and phenotype - directed therapies ( 24283 vs. 10990 , p<0.001 in the genotype - directed group ; 21674 vs. 10990 , p=0.001 in the phenotype - directed group ) . at day 30 , the percentage of patient with hopr tended to be higher in the genotype - directed group ( 16.2% vs. 3.3% , p=0.086 ) . at the 30-day follow - up , pru and % ipa were similar between the two groups . however , pru was higher in the genotype- versus the phenotype - directed group ( 156115 vs. 83124 , p=0.027 ) . this may be due to the fact that more patients were administered ticagrelor in the genotype - directed group ( 51.6% vs. 33.3% , p=0.009 ) . 23% were homozygous for cyp2c19 2 or were carriers of cyp2c19 2/3 ( table 3 ) . baseline opr was higher in patients expressing cyp2c19 2/2 or cyp2c19 2/3 compared to that in patients expressing wild - type cyp2c19 1/1 or cyp2c191/17 and in patients heterozygous for cyp2c19 2 or 3 ( 28050 vs. 21480 , p=0.004 ) . however , no difference was found in the baseline opr between cyp2c19 2 or 3 non - carriers and those heterozygous for cyp2c19 2 or 3 ( 21784 vs. 20978 , p=0.880 ) . after 30 days , opr from the baseline to follow - up was higher among patients expressing cyp2c19 2/2 or cyp2c19 2/3 , corresponding with a greater percentage of patients receiving ticagrelor . the number of patients with hopr at baseline was greater in those allocated ticagrelor ; however , none had hopr after 30 days of treatment . the number of patients with hopr did not change after 30 days of clopidogrel treatment ( table 4 ) . after 30 days of treatment , opr was lower ( 4930 vs. 17977 , p<0.001 ) in patients taking ticagrelor compared to clopidogrel ( fig . 2 ) ; accordingly , pru from baseline to follow - up was higher ( 849 vs. 3426 , p<0.001 ) in patients given ticagrelor . there were two nuisance barc type 2 bleeding events in the genotype - directed group related to ticagrelor use . this was the first study that demonstrated the feasibility and effectiveness of anti - platelet therapy tailored by point - of - care genetic or platelet function testing to decrease the opr in patients undergoing pci . the major findings in the present study were that opr was effectively decreased following both genotype- and phenotype - directed therapy and compared to clopidogrel , ticagrelor caused higher decrease in opr regardless of the cyp2c19 genotype . heightened platelet reactivity contributes to the occurrence of ischemic events especially in certain clinical subsets such as acs , chronic kidney disease , or diabetes mellitus . hopr with clopidogrel treatment has also been proposed to be a predictor of ischemic cv events in patients undergoing des implantation . to date studies examining the effect of high- versus standard - dose clopidogrel have yielded discrepant findings . mehta et al.21 ) noted a reduction in cv events and stent thrombosis in patients given double - dose clopidogrel , whereas price et al.10 ) found no effect on cv outcomes . price et al.10 ) attributed this difference to the selection only of patients with hopr in their study , whereas mehta et al.21 ) enrolled patients regardless of platelet reactivity . although the addition of cilostazol to dapt lowered pru levels more than dapt , the effect of triple versus double therapy on composite cv outcomes was inconsistent in patients undergoing pci.22)23 ) the more potent antiplatelet agents , prasugrel or ticagrelor , have been shown to be superior to clopidogrel in terms of reducing cv events , but with a higher occurrence of bleeding episodes,7)8 ) which is associated with a higher risk of cv events.24 ) in the present study , ticagrelor substantially reduced opr after 30 days . however , two patients ceased taking ticagrelor use because of nasal bleeding and the appearance of petechiae on the whole body . because of the concern of the increased risk of bleeding , the use of parasugrel or ticagrelor is not yet widespread in korea , even among the acs population after pci . further study is therefore warranted on the effects of reduced doses of prasugrel or ticagrelor on the clinical endpoints in korean acs patients . the use of point - of - care testing to tailor antiplatelet therapy according to risk stratification for bleeding and ischemia represents an ideal strategy for acs patients . among these tests , the verifynow p2y12 assay to measure opr is increasingly being used given the evidence suggesting an association between hopr and cv events.9)15 ) however , there are several shortcomings to measuring opr : 1 ) opr is a surrogate marker only representing the inhibition of p2y12 receptor mediated platelet activation , not whole platelet activity ; 2 ) opr can not be measured in patients treated with glycoprotein iib - iiia inhibitors or thrombolytics ; 3 ) pru value varies with elapsed time following acs or pci;25)26 ) 4 ) the cutoff for hopr varies according to patient ethnicity;4)16 ) and 5 ) the relationship between low opr and bleeding events has yet to be definitively established . moreover , trials in which antiplatelet therapy has been personalized according to the results of the verifynow p2y12 assay have failed to demonstrate any improvement in outcomes.10)13)27 ) by comparison , genotyping can be carried out under any clinical circumstances with no limitations with respect to timing . in previous studies , cyp2c19 2 or 3 carriers have been shown to have higher opr and poor clinical outcomes with clopidogrel use after pci , compared with cyp2c19 2 or 3 non - carriers.28 ) however , genotyping also has its drawbacks . clopidgrel is a pro - drug that is converted to an active metabolite in two hepatic steps involving cyp1a2 , 2c9 , 2c19 , 3a4/5 , not only by 2c19 . to date , point - of - care clopidogrel genetic testing is limited to cyp2c19 single nucleotide polymorphism;12)14 ) yet the cyp2c192 genotype only accounts for approximately 12% of the variation in the clopidogrel response.28 ) the feasibility of genotype - guided prasugrel use has been proven in a proof - of - concept trial,14 ) but the clinical benefits of genotype - guided antiplatelet therapy has yet to be demonstrated . although genetic testing and platelet function testing may provide additive information in selecting an antiplatelet regimen for patients undergoing pci , their routine use is not recommended in current practice guidelines.2 ) genotyping may be an improved guide for chronic antiplatelet therapy , while platelet function testing is more useful in acute settings . nevertheless , the benefits of genotype- and phenotype - directed individualization of antiplatelet therapy to improve clinical outcomes requires validation though further randomized , controlled trials . a potential limitation of the present study relates to the early termination of the trial due to the unavailability of the verigene clo assay during the study . furthermore , the crossover rate from ticagrelor to clopidogrel was higher in the genotype- versus the phenotype - directed group , possibly due to the higher number of patients allocated ticagrelor in the genotype - directed group . moreover , there was no standard care control group comparing genotype- versus phenotype - directed antiplatelet therapy . finally , our analyses were based on a single determination of the pru value , which is subject to random measurement error and may possibly have underestimated the strength of the associations . in summary , tailoring the use of p2y12 inhibitors based on point - of - care genetic and phenotypic testing may be effective in decreasing hopr after 30 days . a potential limitation of the present study relates to the early termination of the trial due to the unavailability of the verigene clo assay during the study . furthermore , the crossover rate from ticagrelor to clopidogrel was higher in the genotype- versus the phenotype - directed group , possibly due to the higher number of patients allocated ticagrelor in the genotype - directed group . moreover , there was no standard care control group comparing genotype- versus phenotype - directed antiplatelet therapy . finally , our analyses were based on a single determination of the pru value , which is subject to random measurement error and may possibly have underestimated the strength of the associations . in summary , tailoring the use of p2y12 inhibitors based on point - of - care genetic and phenotypic testing may be effective in decreasing hopr after 30 days .
background and objectiveswe evaluated the effectiveness of genotype- and phenotype - directed individualization of p2y12 inhibitors to decrease high on - treatment platelet reactivity ( hopr).subjects and methodssixty - five patients undergoing percutaneous coronary intervention for non - st elevation acute coronary syndromes were randomly assigned to genotype- or phenotype - directed treatment . all patients were screened for cyp2c19 * 2 , * 3 , or * 17 alleles by using the verigene clo assay ( nanosphere , northbrook , il , usa ) . the p2y12 reaction unit ( pru ) was measured using the verifynow p2y12 assay ( accumetrics , san diego , ca , usa ) . 21 cyp2c19 * 2 or * 3 carriers ( 65.6% ) and 11 patients with hopr ( 33.3% ) , defined as a pru value 230 , were given 90 mg ticagrelor twice daily ; non - carriers and patients without hopr were given 75 mg clopidogrel daily . the primary endpoint was the percentage of patients with hopr after 30 days of treatment.resultspru decreased following both genotype- and phenotype - directed therapies ( 24283 vs. 10990 , p<0.001 in the genotype - directed group ; 21674 vs. 10990 , p=0.001 in the phenotype - directed group ) . five subjects ( 16.2% ) in the genotype - directed group and one ( 3.3% ) in the phenotype - directed group had hopr at day 30 ( p=0.086 ) . all patients with hopr at the baseline who received ticagrelor had a pru value of < 230 after 30 days of treatment . conversely , clopidogrel did not lower the number of patients with hopr at the baseline.conclusiontailored antiplatelet therapy according to point - of - care genetic and phenotypic testing may be effective in decreasing hopr after 30 days .
an evaluation of the ovarian reserve is essential for the infertility work up and treatment . advanced female age is associated with diminished ovarian reserve , but the age by itself does not accurately predict the ovarian reserve ( 1 ) . the commonly used tests for ovarian reserve are basal follicle stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , estradiol ( e2 ) , inhibin b levels and antral follicle count ( afc ) by ultrasonography . however , these values are influenced by the menstrual cycle , i.e. , intraand inter - cycle variation and month - by - month variation and therefore are limited usable for the prediction of poor and high responders ( 2 ) . ultrasonographic markers , such as afc and ovarian volumes have also been shown to be affected by observer variation ( 3 , 4 , 5 , 6 ) . moreover , serologic test and ultrasonographic evaluation should be measured in the early menstrual period ( 3 , 4 , 5 , 6 ) . the serum anti - mllerian hormone ( amh ) amh is expressed in the growing pre - antral or small antral follicles in the ovary and reflects the recruited ovarian follicular pool . the advantages of amh test are its little inter- and intra - cycle variability and gradually decreased value according to the increasing age . yoo et al . reported the age - specific reference values of amh for korean women with normal menstruation patterns between 20 and 50 yr of age ( 7 ) . some studies presented that the serum amh levels are age - specific and readily available clinical marker of the ovarian reserve . therefore , amh is regarded as a useful ovarian reserve test nowadays ( 7 , 8 , 9 , 10 , 11 , 12 ) . despite the several limitations of conventional tests , physicians usually check the serum basal fsh , lh , e2 , and amh for the evaluation of infertility at the same time during menstruation recently , some researchers concerned over the serum lh / fsh ratio in case of polycystic ovary syndrome ( pcos ) patients ( 13 ) . they showed that patients with polycystic ovaries have statistically significant higher lh levels and lh / fsh ratios than patients with normal ovaries ( 13 ) . and some studies suggested that the lh / fsh ratio could be used as a marker of fertility or ovarian reserve ( 14 , 15 , 16 , 17 , 18 , 19 ) . however , only serum fsh and amh levels have been still focused and regarded as useful markers to predict the ovarian reserve in women of reproductive age . as the serum fsh levels are slightly elevated in the late period of reproduction and in poor responders , we could not precisely predict the decreased ovarian reserve in young women through serum fsh only . when we would evaluate the change of serum lh / fsh ratio , could we have more information ? in theory , the lh / fsh ratio may decrease as the ovarian reserve begins to fall off , because fsh is known to increase more significantly than lh as the ovarian reserve declines . therefore , we focused on the variation of lh / fsh ratio as a predictor of ovarian reserve . the purpose of the present study was to evaluate age - related reference values for the lh / fsh ratio in normo - ovulatory women of reproductive age and was to assess the correlation between serum lh / fsh ratio and amh levels . for these , we analyzed the change of lh / fsh ratio across a korean female population of different ages with regular menstrual cycle . we retrospectively analyzed day 3 lh , fsh , amh levels in 1,251 patients ( age range 20 - 50 yr ) between january 2010 and january 2011 in dongguk university ilsan hospital and cheil general hospital . this study population included a total of 1,251 women with regular menstrual cycles ( interval : 21 - 45 days ) undergoing in vitro fertilization ( ivf ) . exclusion criteria were as follows : 1 ) history of uterus or adnexal surgery ; 2 ) polycystic ovarian syndrome ( pcos ) ; 3 ) body mass index ( bmi ) 30 kg / m ; 4 ) serum prolactin levels > 50 ng / ml ; 5 ) irregular menstruation ( interval : less than 21 days , more than 45 days ) ; 6 ) other endocrine diseases ( thyroid disease , diabetes mellitus , cushing 's syndrome ) . because serum amh level is age - specific marker for the ovarian reserve , the patients were classified into 6 groups according to their age ( group 1=under 31 yr [ n=394 ] ; group 2=32 - 34 yr [ n=301 ] ; group 3=35 - 37 yr [ n=259 ] ; group 4= 38 - 40 yr [ n=173 ] ; group 5=41 - 43 yr [ n=85 ] ; group 6=over 44 yr [ n=39 ] ) . blood samples for amh , lh , fsh , tsh and prolactin were obtained by venipuncture on day 2 - 3 of the menstrual period . the serum amh levels were measured by enzyme immunoassay using an amh / mis eia kit , two - immunological step sandwich type assay ( immunotech version ; beckman coulter , marseille , france ) . all data analyses were performed using the statistical package for the social sciences software ( version 19.0 , ibm spss , armonk , ny , usa ) . comparisons of amh , lh / fsh ratio , bmi , menstruation interval , tsh and prolactin between age groups were performed using one - way analysis of variance ( anova ) . the partial correlation between amh and lh / fsh ratio the review board for human research of dongguk university ilsan hospital approved this study ( irb no . we retrospectively analyzed day 3 lh , fsh , amh levels in 1,251 patients ( age range 20 - 50 yr ) between january 2010 and january 2011 in dongguk university ilsan hospital and cheil general hospital . this study population included a total of 1,251 women with regular menstrual cycles ( interval : 21 - 45 days ) undergoing in vitro fertilization ( ivf ) . exclusion criteria were as follows : 1 ) history of uterus or adnexal surgery ; 2 ) polycystic ovarian syndrome ( pcos ) ; 3 ) body mass index ( bmi ) 30 kg / m ; 4 ) serum prolactin levels > 50 ng / ml ; 5 ) irregular menstruation ( interval : less than 21 days , more than 45 days ) ; 6 ) other endocrine diseases ( thyroid disease , diabetes mellitus , cushing 's syndrome ) . because serum amh level is age - specific marker for the ovarian reserve , the patients were classified into 6 groups according to their age ( group 1=under 31 yr [ n=394 ] ; group 2=32 - 34 yr [ n=301 ] ; group 3=35 - 37 yr [ n=259 ] ; group 4= 38 - 40 yr [ n=173 ] ; group 5=41 - 43 yr [ n=85 ] ; group 6=over 44 yr [ n=39 ] ) . blood samples for amh , lh , fsh , tsh and prolactin were obtained by venipuncture on day 2 - 3 of the menstrual period . the serum amh levels were measured by enzyme immunoassay using an amh / mis eia kit , two - immunological step sandwich type assay ( immunotech version ; beckman coulter , marseille , france ) . all data analyses were performed using the statistical package for the social sciences software ( version 19.0 , ibm spss , armonk , ny , usa ) . comparisons of amh , lh / fsh ratio , bmi , menstruation interval , tsh and prolactin between age groups were performed using one - way analysis of variance ( anova ) . the partial correlation between amh and lh / fsh ratio was analyzed after adjustment of age . the review board for human research of dongguk university ilsan hospital approved this study ( irb no . 2013 - 116 ) . the data used for this study do not include any identifiable personal information . as such the mean level for serum fsh was 8.875.95 miu / ml , for lh / fsh ratio 0.790.51 and for amh 3.533.02 ng / ml . the basal characteristics and the mean levels of serum amh , lh / fsh ratio according to the age groups are presented in table 1 . bmi and the basal fsh levels were significantly increased according to age , however , the serum lh levels are increased at the late reproductive age group ( 44 yr ) only . menstrual interval , the serum amh levels and the lh / fsh ratio were significantly decreased in patients with advanced age . 1 shows the distribution of amh , fsh , and lh / fsh ratio according to age . a significant negative correlation was demonstrated between the serum lh / fsh ratio and age ( r=-0.213 , p<0.001 ) . the age was also correlated with the serum amh level ( r=-0.4 , p<0.001 ) and serum fsh ( r=0.282 , p<0.001 ) . other variables , such as serum lh ( r=0.064 , p=0.024 ) , bmi ( r=0.198 , p<0.001 ) and menstrual interval ( r=-0.182 , p<0.001 ) showed weak correlation with age also ( data not shown ) . in accordance to our hypothesis , there was a significant partial correlation between the serum lh / fsh ratio and the amh when adjusted by age ( r=0.348 , p<0.001 ) . fsh and lh levels are commonly used for the prediction of the ovarian reserve in the early follicular phase even though they have a lower predictive value . recently , there was a report that elevated day 3 fsh / lh ratio 2 is associated with higher rates of cancellation in in vitro fertilization ( ivf)-embryo transfer cycles ( 14 ) and some studies have shown that the day 3 fsh to lh or lh to fsh ratio can be used as a predictor of the ovarian reserve ( 14 , 15 , 16 , 17 , 18 , 19 ) . the day 3 lh / fsh ratio is relatively easy to obtain and shows more predictive power as the day 3 fsh level alone . as the serum fsh increases early in reproductive aging and a rise in lh is observed at a later stage , the decreased basal lh / fsh ratio might be a sign of diminished ovarian reserve even with normal basal fsh . as the lh / fsh ratio may decrease as the ovarian reserve declines , the value of lh / fsh ratio could play a significant role in determining the appropriate status of ovarian reserve . in our data , a significant negative correlation was demonstrated between serum lh / fsh ratio and age ( r=-0.213 , p<0.001 ) , implying that the lh / fsh ratio is related to age . the present study also illustrates that powerful marker of ovarian reserve , namely amh levels are falling with age . as assumed , a significant partial correlation adjusted by age was observed between amh and lh / fsh ratio ( r=0.348 , p<0.001 ) . 1 shows that the serum amh levels and the lh / fsh ratio were inversely correlated with age . in table 1 , the lh / fsh was slightly elevated in groups 5 and 6 of late reproductive age contrary to the decreasing tendency . a possible explanation might be that the lh levels generally increase later than fsh , especially in peri - menopause woman where ovary ceases to function and the ratio increases therefore . the lh / fsh ratio is commonly used in the assessment of pcos although its sufficient utility has not been proven in this setting yet . however , the ratio has been little investigated as a marker of fertility or ovarian reserve . recently , the lh / fsh ratio was evaluated in the field of infertility , in which the lh / fsh ratio showed the highest correlation with clinical pregnancy over other measures of ovarian reserve ( 14 ) . and another study reported that a high fsh / lh ratio may be used as an early biomarker of poor ovarian response ( 15 ) . suggested that an elevated day 3 fsh / lh ratio is useful in the prediction of the ivf outcome in older women , but does not seem to be an accurate predictor in younger women ( 16 ) . kim et al . suggested that the best prediction of reproductive age could be obtained by using the combination of fsh and lh on day 1 of the menstrual cycle ( 17 ) . sixty six women were divided into two groups , the younger ( 20 - 25 yr ) and the older ( 40 - 45 yr ) group and were simply compared . however , we divided our patients into six groups on the basis of their ages to present the age - specific level and compared lh / fsh ratio with amh levels to confirm the predictability of this ratio . to the best of our knowledge , this is the first report on the correlation between the serum lh / fsh ratio and amh levels . there are few studies only about the lh / fsh ratio and no age - related reference values for lh / fsh ratio were provided based upon a large population . in a previous study , 178 patients were reviewed to assess the values of amh and day 3 fsh / lh ratio ( 18 ) . it was reported a higher pregnancy rate could be expected if the day 3 fsh / lh ratio < 2 and the amh 5 . however , they did not show direct age - related values for the lh / fsh ratio and did not analyze the relation between lh / fsh ratio and amh . the strength of the present study is that we compared the lh / fsh ratio with amh values in a larger sample size than previous studies . the limitation of our study is that we just evaluated the correlation between lh / fsh ratio and age . further investigations combined with the present correlation results are needed on the direct ovarian response to a controlled ovarian stimulation according to the lh / fsh ratio . the clinical usefulness of amh has been confirmed by numerous studies . in this study , we found that the clinically valuable meaning of basal lh / fsh ratio and this ratio as well as amh could be considered as useful marker for ovarian reserve . as the day 3 serum fsh and lh concentrations are already usually available markers , their ratio could be used without additional effort as an important predictor for the compromised ovarian reserve . the lh / fsh ratio instead of serum amh could be an age - related reference value for the ovarian reserve in women of reproductive age and also could be applied to the clinical evaluation for the infertility work up . most of all , we can predict the ovarian reserve using commonly checked tests with a higher accuracy in women of reproductive age . especially in infertile patients , the age - specific value of lh / fsh ratio may have a role in determining the appropriate stimulation protocol and assist in patient counseling . the lh / fsh ratio may allow physicians to stimulate patients in a more individualized treatment and will maximize the ivf outcome . although further active and prospective studies are necessary to confirm such a role of lh / fsh ratio in a clinical setting , our results will be helpful to evaluate the ovarian reserve of women . in summary , there was a significant negative correlation between the serum lh / fsh ratio and age and a significant partial correlation was found between the serum lh / fsh ratio and amh level . this suggests that the lh / fsh ratio could be considered as a useful marker for the ovarian reserve and could be applied to the clinical evaluation with amh .
serum anti - mllerian hormone ( amh ) levels are regarded as an age - specific marker for predicting the ovarian reserve in women of reproductive age . some studies have shown that the luteinizing hormone ( lh)/follicle stimulating hormone ( fsh ) ratio can be used as a predictor of ovarian reserve . the purpose of this study was to assess the variation of lh / fsh ratio with aging and to evaluate the correlation between serum lh / fsh ratio and amh levels as a predictor of the ovarian reserve in normo - ovulatory women . we retrospectively analyzed the day 3 serum hormone levels in 1,251 patients ( age range : 20 - 50 yr ) between january 2010 and january 2011 . we divided the patients into 6 groups according to their age . relation between serum amh level and lh / fsh ratio was analyzed statistically . the serum amh level was inversely correlated with age ( r = -0.400 , p < 0.001 ) . a significant negative correlation was found between serum lh / fsh ratio and age ( r = -0.213 , p < 0.001 ) . there was a significant partial correlation between serum lh / fsh ratio and amh level when adjusted by age ( r = 0.348 , p < 0.001 ) . the lh / fsh ratio could be considered as a useful marker for the ovarian reserve and could be applied to the clinical evaluation with amh .
breast cancer is the most common cancer affecting women as it accounts for over one - third of all cancers reported in this population . although the cure rate is high , the sheer number of new cases detected every year means that the mortality rate associated with this cancer remains high . advances in diagnostic methods and widespread screening campaigns have made that these tumours are now being detected at an earlier stage and are more frequently eligible for conservative treatment . however , numerous studies [ 13 ] have demonstrated the need for irradiation of the entire mammary gland combined with a boost delivered to the tumour bed after completing surgical treatment . the local recurrence rate at 10 years with this conventional approach is estimated to be between 5 and 10% . in 85% of cases , the recurrence is located in the original tumour bed ; in the remaining 15% , it is detected elsewhere in the breast and is probably a new tumour [ 57 ] . it should be pointed out that breast cancer cells should be more sensitive to short bursts of intense radiation than to small doses fractionated over several weeks . in order to try to enhance efficacy through increasingly targeted treatments , numerous studies have been performed exploring the outcomes of higher radiation doses delivered over shorter treatment periods [ 810 ] . several partial radiation techniques , targeting the at - risk portion of the breast only , have also emerged . the astro and estro have already published guidelines to help practitioners identify low - risk women who can be treated with these techniques outside clinical trials . intraoperative electron radiation therapy is a particularly suitable option since it permits delivery of the whole radiation dose directly to the target zone liable to contain residual cancer cells , clearly visible during surgery , from which all the healthy structures have been carefully separated . another advantage is efficiency : in 2 minutes a radiation dose with the same tumoricide potential as 6 weeks of conventional treatment can be given with the additional advantages of enhanced quality of life , and no irradiation of the skin , lungs , heart , and ribs . oncoplastic surgery can be performed if needed and if systemic treatment is indicated , it will not be delayed . between february 2010 and february 2012 , 200 patients ( median age : 61 y , range : 4085 y ) underwent partial intraoperative electron radiation therapy of the breast in our institute ( table 1 ) . inclusion criteria were unifocal ( demonstrated by preoperative mri ) invasive ductal carcinoma , age 40 years , histological tumour size 20 mm , and no lymph node involvement . all histologic grades ( i - ii - iii ) and all hormonal receptor types ( rh+ , rh ) invasive lobular carcinoma was excluded as were patients with lymphovascular involvement and extensive intraductal disease . conventional imaging as well as mri of the breast was used to rule out multifocal disease . all patients underwent a metastatic work - up including a chest x - ray , ultrasound of the liver , bone radionuclide scan , and a blood test . the surgical procedure began with removal of the sentinel lymph node(s ) ( sln ) , which were identified with a gamma probe . a lumpectomy was then performed , via an elliptical skin incision made directly over the tumour . this allows introducing the radiation applicator through the incision and offers optimal control of the anterior surgical margin . it also makes it possible to mobilize the target glandular tissues surrounding the lumpectomy bed for radiation . the tumour was removed in one piece with a 1 to 2 cm safety margin extending posteriorly , where possible , to the aponeurosis of the pectoralis major muscle . the surgical specimens inclusively sentinel node were sent to the pathology laboratory for intraoperative analysis of tumour size , surgical resection margins , and sln malignancy . if the histological criteria were met ( pt1 , safe margins 1 mm , pn0 ) , the target tissue was dissected from the underlying pectoralis major aponeurosis in order to be able to put a protective shield in place . the shield consisted of 3 mm of lead ( deep part of the breast ) and 4 mm of aluminium ( anterior part of the gland ) so that all the electrons were intercepted by the lead and the electrons back - scattered by the lead were blocked by the aluminium . the total thickness of the shield is equivalent to more than 45 mm of water for electron slowing down . this completely stops 9 mev electrons , independently of the treated thickness . for 12 mev electrons , which are only used if the thickness to be treated is bigger than 29 mm , the combined equivalent thickness of treated tissues and shield is large enough to completely stop the electrons . the gland was then dissected of the subcutaneous fat and skin and as much of the breast tissue potentially containing residual microscopic cancerous foci as possible brought into the tumour bed : these tissues were sutured over the shield . the shield generally used was 15 to 20 mm larger in diameter than the applicator whose diameter was already 40 mm larger than the tumour itself ( size of the breast permitting ) , in order to create a 20 mm safety margin around the tumour bed . although the sentinel lymph node ( sln ) operating pathology was always negative in frozen section and immunohistochemical analysis , the final pathology showed positive sln in 6.9% of the patients ( pn1mic : 3.9% , pn1a : 3% ) ( table 1 ) . the immunohistochemical analysis is an asset to keep the false negative rate low but it has not been possible to reach a lower rate in this first study . for the pn1a patients , we performed complete axillary node dissection ( cand ) except for one 80 y luminal a patient for whom 4 other lymph nodes were already removed during the sln procedure . the patients presenting with micro- or macroscopic spread to the sentinel node were not treated with external radiation therapy . all patients were treated with electrons generated by an intraop ( mobetron ) dedicated mobile accelerator . the diameter of the cylindrical applicators available varied from 3 to 10 cm , in 0.5 cm increments . the applicator most frequently used had a diameter of 50 mm ( in 36.8% of the cases ) ( range : 3565 mm ) . as mentioned before , our ioert ptv policy was adapted to the tumour size . as a general rule , the field diameter used was at least 40 mm bigger than the pathological tumour diameter . the dose delivered was 21 gy , prescribed over the 90% isodose line as described in the dose escalation studies conducted by the european institute of oncology in milan . the 90% isodose line diameter at dmax is slightly smaller than the nominal field diameter ( from 6 to 9 mm smaller , depending on field size and energy ) . taking that into account , we have around the tumour bed a risk - adapted treated volume whose diameter is at least 36 mm for pt1a tumours , 41 mm for pt1b , and 46 mm for pt1c tumours . electron energies of 4 , 6 , 9 , and 12 mev were available . the 9 mev was the energy the most frequently selected ( in 48% of the cases ) ( range 612 mev ) . a 5 or 10 mm bolus was used either to increase the entrance dose to at least 90% or to decrease the total electron range in the patient . energy was determined in function of the maximum thickness of the target tissue , in order to have the 90% isodose depth greater than the maximum target thickness . the maximum target thickness was simply measured by introducing a needle into the tissue down to the protective shield placed over the muscle . the position of the protective shield was controlled intraoperatively by inserting a needle into the gland at a tangent to the applicator and ensuring that it a digital radiograph was positioned on the mobetron beam - stopper to maintain an exact record of the shield 's position relative to the applicator . dosimeters were positioned on the contralateral breast , the thyroid gland , and ovaries to determine , under in vivo conditions , the exact dose received by these sensitive structures at a distance from the beam ( table 2 ) . these were determined by the molecular subtype of the tumours and the comorbidities presented by the patients . most of the tumours ( 181 or 88.7% ) were molecular subtype luminal a or luminal b ( 73.5% and 15.2% , resp . ) . in thirteen cases ( 6.4% ) the her2/neu oncogene was amplified and 9 ( 4.4% ) were of the triple negative subtype ( table 1 ) . hormone therapy alone was prescribed for 163 patients ( 81.5% ) and chemotherapy alone for 9 patients ( 4.5% ) . three patients ( 1.5% ) were not prescribed any adjuvant treatment in the view of their low risk and major comorbidities . one patient ( 0.5% ) did not receive any adjuvant treatment because her hormonal receptor status was unknown ( 3 mm tumour removed during microbiopsy ) . acute toxicity ( perioperative and up to 30 days ) was assessed as per nci common terminology criteria for adverse events version 3.0 and was acceptable ( grade 1 : 4.4% , grade 2 : 1% ) ( table 3 ) . grade 1 late toxicity according to the lent soma scale was reported in 13.7% of treatments and grade 2 in 3.4% ( table 4 ) . cosmetic outcome was assessed both by the doctor and the patient at last 7 months after treatment , based on the cosmetic scoring system proposed by beal et al . . the cosmetic criteria were breast symmetry , breast oedema , discoloration at site , dimpling / local contour change , and scar prominence . the cosmetic result was considered to be very good ( all grade 0 ) in 124 patients ( 62% ) , good ( any grade 1 ) in 61 patients ( 30.5% ) , fair ( any grade 2 ) in 11 patients , and poor ( any grade 3 ) in 4 patients ( 2% ) ( table 5 ) . two patients died due to another cancer . among the 198 patients alive , 2 presented with another cancer , none of them developed metastasis due to breast cancer . the crude and actuarial local recurrence rates after median follow - up were 0.5% and 0.9% , respectively . the actuarial rates after median observation time for dfs ( disease free survival ) , os ( overall survival ) , and dss ( disease specific survival ) were 97.6% , 98.9% , and 98.9% , respectively . we also know that the percentage of residual tumour cells decreases with increasing distance to the tumour bed . moreover , the risk of local recurrence and lymph node involvement is higher in patients with extensive intraductal disease [ 20 , 21 ] . it therefore follows that local control of the malignant disease and , secondarily , increasing survival rates are the primary objectives of any innovative technique . it is also important to reduce the risks of radiation - induced complications such as skin fibrosis , a poor cosmetic result , cardiac toxicity , pneumonia , and secondary cancers . at the present time for local dose augmentation to the tumour bed , delivered intra- or perioperatively , a numerous treatment techniques are available which show great differences in their respective dose homogeneities . the undeniable advantage of these nonintraoperative techniques is that they are implemented in full knowledge of the definitive anatomopathology results . the major inconveniences are the significant radiation dose delivered to healthy organs and the potential presence of hot spots . in view of the numerous existing techniques and as a result of the growing interest worldwide for this approach , the american ( astro , american society for radiation oncology ) and european learned societies ( gec - estro , groupe europen de curiethrapie european society for therapeutic radiology and oncology ) have issued guidelines defining low - risk patient groups ( age over 50 or 60 years old , size 20 or 30 mm , healthy sentinel node , ductal type , and unicentric tumour ) which could be treated outside clinical trials . the milan team recently presented their results for the randomised eliot trial in which they include 1305 patients ( 654 to external radiotherapy and 651 to intraoperative radiotherapy ) . their inclusion criteria were age 4875 years , early breast cancer , tumour diameter up to 25 mm , and suitable for breast conserving therapy . the 5-year event rate for ipsilateral breast tumour recurrences ( ibtr ) was 4.4% in the intraoperative radiotherapy group and 0.4% in the external radiotherapy group . the authors stated that the significant difference in local recurrence is probably attributable to the very low ibrt rate they achieved in their external radiotherapy arm . they identified subgroups with negative prognostic factors for ibtr : tumour diameter > 20 mm , four or more positive nodes , grade 3 tumour , and triple negative tumour . each of these factors is associated with a 5-year ibtr > 10% but the authors stated that these factors require further validation . for example , some consider that the local recurrence rate for patients with triple negative disease does not appear to be higher than for the other subtypes although recurrence is observed at an earlier date ( within two years ) . for the 452 patients ( 69.4% ) in the eliot trial , who had none of these factors , the 5-year ibtr in the ioert arm was only 1.5% . in our series , regarding these negative prognostic factors , 26 patients ( 13% ) presented one of them ( 24 grade 3 alone and 2 triple negative alone ) and 7 patients ( 3.5% ) had 2 of them ( both grade 3 and triple negative ) . none of them recurred but our follow - up is too short and the number of patients too limited to conclude . in order to decrease the ibtr , the milan team suggested considering giving additional external whole breast irradiation if a negative prognostic factor was found after final histological examination . our ibtr at 23 months is comparable with the eliot study ( 0.9% versus 1% ) or with the targit trial ( 0.72% at 29 months ) . the same conclusion applies for the overall survival ( 98.9% versus 99% for eliot or versus 99.1% for targit ) . our annual ibtr rate of 0.5% is in the range ( < 1% ) of what is commonly accepted according to european guidelines after breast conserving therapy . concerning our case of local recurrence , it was a 63-year - old patient presented initially with an upper internal quadrant primary invasive ductal carcinoma at 10 mm from the nipple - areolar complex , measuring 8 mm , sln negative , luminal a subtype ( grade i , rh+ , ki 67 less than 10% , her / neu ) for which she had been prescribed hormone therapy ( tamoxifen ) . the disease recurred in the upper external quadrant , close to the nipple - areolar complex . she underwent mastectomy and breast reconstruction ( diep - flap ) followed by second line hormone therapy with an aromatase inhibitor . the pathologic examination found a 6 mm invasive ductal carcinoma , molecular subtype luminal a ( grade ii , ki 67 10% , positive hormonal receptors ( ro 7/8 , rp 5/8 ) , her / neu ) with 5 negative lymph nodes . it should be noted that it turned out to be extremely superficial , subcutaneous , and diagnosed sonographically only . it could in fact have been progression of a microfocus which had not been detected during the initial work - up rather than a genuine recurrence . histological analysis shows that this recurrence was located at distance from the site of the earlier lumpectomy . it should also be noted that this particular patient had an important family history ( mother and daughter ) . our case of recurrence more closely resembles progression of a microfocus since it appeared 18 months after the diagnosis in a patient who , other than her family history , did not present any poor prognosis factors . pbi according to the eliot - concept which was performed in our institution is a feasible technique with good treatment tolerance resulting in a sufficient cosmetic outcome . however , our median follow - up is too short to reach any conclusions in terms of recurrence and survival .
objectives . the aim of this prospective phase ii study is to evaluate the treatment of early - stage breast cancer ( t1 n0 ) with intraoperative electron radiation therapy ( ioert ) in terms of local control , early complications , and cosmesis . patients and methods . from february 2010 to february 2012 , 200 patients underwent partial ioert of the breast . inclusion criteria were unifocal invasive ductal carcinoma , age 40 years , histological tumour size 20 mm , and no lymph node involvement . a 21 gy dose was prescribed over the 90% isodose line in the tumour bed . median follow - up is 23.3 months ( 737 ) . results . acute toxicity was not frequent ( grade 1 : 4.5% , grade 2 : 1% ) . the cosmetic result was considered to be very good or good in 92.5% . one ipsi lateral out - quadrant recurrence at 18 months was observed . the crude and actuarial local recurrence rates after median follow - up were 0.5% and 0.9% , respectively . conclusion . the preoperative diagnostic work - up must be comprehensive and the selection process must be rigorous for this therapeutic approach reserved for small ductal unifocal cancers . after a 23.3-month median follow - up time , the clinical results of ioert for selected patients are encouraging for the locoregional recurrence and the toxicity rates . the satisfaction of our patients in terms of quality of life was extremely high .
current data of the federal statistic office ( statistisches bundesamt ) indicate that 19 percent of the german population are considered having a migration background 15.3 million people ) , including both germans and foreign nationals . in some cities , like berlin , hamburg or frankfurt ( main ) , migrants constitute up to 40% or more of the local population , especially among young people . but also in rural areas , ethnic diversity is a social reality that can no longer be ignored . immigration and the political goal of integration have thus become priority issues of the federal government s policy . in the medical field , awareness for the particular needs and problems of , for example , foreign labour workers and refugees is not a novelty . already in the 1970s , physicians where concerned about the medical consequences of especially hard labour conditions , social exclusion , cultural isolation and the difficulties of physician - patient - communication across barriers of culture and language , , . however , systematic attention for ethnic diversity and health at large is a rather recent phenomenon in germany . only since the beginning of the broad public debates on immigration and the integration of migrants in the first years of the new millennium , these issues gained momentum also in the medical field . significant efforts were made , for example , in epidemiology , health monitoring and regarding problems of access to and quality of care , , , , , , . observations in this field are frequently framed by notions like culture , ethnicity or migration background , though without adequate consideration of the complex theoretical questions behind and of the pitfalls of an unreflecting use of these categories in the field of medicine and health . serious cooperation with social and cultural anthropology only two medical schools in germany are currently offering courses dedicated to ethnic diversity : the first was established at giessen university medical school in 2004 , and the initial focus on migrants health in germany has been expanded recently towards a global perspective , by starting a subject related partnership for teaching intercultural cooperation in health with two universities in ecuador and peru . a second initiative was launched at hamburg university medical school during the summer term 2009 . the present article is based on the giessen experience and gives special emphasis on the question of how to fix the ambiguous issue of culture appropriately in medical education . it is widely admitted that one of the main challenges for educational programs dedicated to ethnic diversity and healthcare is to translate the commonplace understanding of culture into a helpful tool for medical training and practice , , , , . one of the main problems is that a careless use of this notion yields stereotype images of , for instance , traditionally minded turks , who in contrast to the supposedly rational germans adhere to magical ideas of disease . from a theoretical perspective , the shortcomings of such a fairly simplistic concept of culture are obvious : the wide spread equation of culture and ethnicity is one of the popular fallacies disproved by anthropologists because the social and cultural reality especially of immigrants proved to be far more complex and dynamic , , . moreover , empirical evidence shows that despite common assumptions , the actual way migrants conduct their lives in germany including cultural values , religious orientation and identity is rather independent of ethnic categories and ancestry . more important are social and economic conditions as well as education , biographic factors ( including the individual migration history ) and social support . in times of hybrid identities and transnational social worlds becoming part of social normality , the assumption of ethnic groups as culturally static and homogeneous communities bound by a common ancestry , identity and language , is challenged heavily , , . medical studies and statements that are based on improperly defined ethnic or cultural categories , and fail to address social , economic , medical and other relevant aspects adequately , even contribute to the reification of false ethnic boundaries and the stereotype thinking in medicine and beyond . the complex dynamics between culture , ethnicity and healthcare have to be addressed in a far more differentiated way . how can theoretical critique be translated into positive action and especially into teaching modalities for future physicians ? a first step is to reflect seriously on the meaning of culture and the hidden assumptions behind : a core aspect of anthropological understandings of culture is that it is not a single factor but a multilayered set of potential modes to perceive , to understand and to evaluate all issues of everyday life including pain , disease , healing and medical devices , , . culture is acquired throughout lifetime and is constantly developing based on personal as well as collective experiences in the course of all perpetual social interactions . even ethnic identity is shaped only in the context of social relations , namely in the dynamics of belonging and differentiation , and can thus change depending on time , place and social context . young second generation migrants in germany , for example , are considered strangers ( russian , turks , etc . ) in their country of birth and germans when they visit the home of their parents and grandparents . the meaning of traditional orientations ( e.g. values , language , religion , etc . of the parent generation ) , finally , depends on the particular situation of the individual . not only in case of severe disease or near death , many people , independent of ethnicity , develop a renewed interest in religious and spiritual issues even after decades of a rather secular lifestyle . against this background , a second aspect of the anthropological understanding of culture , that outside of professional anthropology is often neglected , gains in importance : ethnography . ethnography is the key methodology of cultural and social anthropology and features huge potential for improving in - depth - understanding in health service research at large . characteristic is the combination of a holistic approach of observation and analysis with a critical attitude towards generalizing statements about ethnic groups or cultural traits . it includes a reflexive mindset regarding one s own perspective , priorities and possible prejudice in a given situation . since generalized statements about the culture of individuals or ethnic groups are impossible , the ethnographic approach is indispensable . it provides empirical insights into the social reality of patients and relatives beyond stereotypes and preconceived images of migrants and the members of particular ethnic groups . ethnography permits a closer look on the multilayered social reality and to understand the patient s perspective on health , disease and medical care . instead of reducing the situation of a sick person to an abstract disease category , it tries for a comprehensive view and for identifying as precisely as needed the different aspects involved ( social , economic , bureaucratic , etc . ) . moreover , ethnography includes a critical attitude towards all kind of supposedly natural and self - evident categories within and without biomedicine ( like disease classifications , concepts of body and illness , or ethnic boundaries ) and subjects them to analysis both historically and cross - culturally , , . there is no need for physicians and other health care providers to become anthropologists , yet the adoption of an ethnographic perspective is necessary for at least getting closer to the real needs and living conditions of the people concerned . and despite the huge gap that apparently separates medicine from anthropology and qualitative research methods , this kind of a clinically adapted ethnographic approach is not strange to medicine at all . instead , it is very similar to what is usually meant to be the most fundamental means of any physician s daily work : taking the individual patients medical history . in essence , ethnography applied within healthcare means communicating appropriately to understand the patient s problem and trying to grasp his or her personal situation comprehensively . in addition to conventional anamnesis , it includes explicit attention to the broader social and cultural context , in the case of migrants with issues like legal status , language skills , identity , and probably unconventional resources of social support like mosques or transnational family networks . however , the line between both is blurred and it depends on the disposition and abilities of the individual physician to advance in ethnography as far as the individual case demands . to support future physicians in the development of an ethnographic perspective in health care is the primary goal of the educational program in culture and healthcare at giessen medical school . in various ways , students are encouraged to have a closer look at different issues that are discussed in regard to ethnic diversity , migration and health today . the particular topics range from epidemiology and health service provision to legal regulations ( immigration laws ) and intercultural cooperation in healthcare . background information is given about the history of migration and immigration policy in germany , and on anthropological theory ( definitions of culture ) and method . already when discussing epidemiological findings , the anthropological perspective is exemplified by a careful examination of the criteria used in a study to distinguish the different groups and the underlying assumptions . what does it mean , for example , to apply criteria like ethnicity or nationality in epidemiological research , when growing parts of the target group have hybrid identities or have acquired german citizenship more or less recently ? the main strategy for applying the ethnographic approach in this program can best be characterized under the label ethnic diversity and migration are global phenomena , but they materialize locally in very different ways . in hamburg the situation is different from that in giessen or from that in rural areas near the dutch border and in saxony . content and teaching activities are thus explicitly oriented towards the local situation , because demographic aspects ( e.g. unequal numbers and origin of the migrant population in germany ) as well as the particular social , economic and political conditions define the situation a physician is confronted with . moreover , for widening the personal scope of action it is necessary to know in detail helpful resources available locally , like ngo s or religious communities . in addition , the cooperation with ecuador and peru opens a true global dimension through the comparison of multiple local sites internationally . one of the teaching modules most appreciated by our students is , for example , a visit to social workers of the local caritas service for the support of immigrants . the act of leaving the university building and translating the lesson into the office of the social workers symbolizes the idea of going local . the teaching purpose of providing a closer look on the living conditions of migrants at the very same place of the student s daily life becomes tangible . in the final evaluations sheet of the course , the stories of real patients told by the social workers and the high capacity they display to solve problems that in first instance appear to be insuperable , provide vivid insights both into the normally hidden social reality of these people and the wide scope of helpful resources available . legal status and complex social as well as economic aspects have a huge influence on an individual s way to display pain and other symptoms , on compliance and communication style . in case of patients of seemingly foreign ethnicity , however , this kind of variations and problems are often wrongly attributed to cultural factors or ancestry . it s a widespread clich , for instance , that people from islamic countries are different with regards to the perception and expression of pain : they are supposed to be unable to provide medically exact information and to use rather metaphorical and socially distorted ways to display pain , . apart from the complete neglect of the complex interplay between physiological , psychological , social and cultural dimensions of pain , , statements of this kind mistake culture , religion and origin as synonyms and consider an idealised western standard universal . yet physicians have to be able to look under the surface of what at first glance appears to be cultural . in the giessen course , this is exemplified with two important modules that have not been mentioned so far : one provides basic knowledge about islam in relation to medicine ; the second is on the psychosomatic dimension of diseases among patients with migration background . regarding islam , students get to know basic principles of faith relevant to medical practice , and learn about the main sources of religious knowledge and guidance : the quran and the collection of the prophet muhammad s traditions and actions , sunnah . priority is given , however , to link religious principles with real situations from daily medical life . students are encouraged to bring in personal experiences and questions that evolved during practical trainings in the hospital . what can be done , for example , if a patient with diabetes insists to fast during ramadan though this would be inconsistent with his treatment ? after learning that religious rules ( like to fast in ramadan ) are not obligatory , and that any muslim is free to decide and at the same time responsible to god for maintaining his body healthy , new possibilities for solving what at first glance appears to be a conflict between faith and medicine evolve . students feedback in course - evaluation show that this kind of basic knowledge about islam is highly appreciated and considered helpful for daily practice . psychosomatic medicine is emphasized because the migration background of a patient implies multiple risks for important medical factors being overlooked or misinterpreted as cultural . yet migration in itself is not " pathological " , ambivalent social relations and feelings both towards home and receiving country can become a strain . for various reasons , migrants are known to be a vulnerable group for affective disorder and somatization , , , . moreover , the dynamics of difficult verbal communication and cultural assumptions about foreign patients may foster both equivocal interpretations of allegedly bizarre presentations of symptoms as cultural as well as the accentuation of pain symptoms ( and thus further somatisation ) by the patient . to improve the quality of care and prevent inappropriate prescription of analgesics and antidepressant drugs , awareness for these dynamics and for adequate communication is necessary , also beyond specialized services of psychosomatic medicine . making culture and ethnicity useful categories for medical practice is not an easy task . a strong commitment to anthropological theory and methods is needed , just as an adequate adaptation of these to the particular context of healthcare . for teaching purposes , the ethnographic approach proved useful , just as the inclusion of attending physicians and social workers who in addition to formal lectures strengthen the didactically important informal curriculum . the best way , finally , to deepen the impact of the course as well as to assess the achievement of the teaching objectives turned out to be the compulsory elaboration of a term paper in the form of mini - ethnography based on personal observation by the student . they are encouraged to write about experiences during medical clerkship and to provide a differentiated analysis of concrete situations or case histories from the perspective of an actively engaged , participant observer . the results usually echo what other studies have shown repeatedly : thoughtful attention to culture is a way to recover awareness for the individual in the healthcare system in general , , . since the importance of culture is not bound to a particular ethnicity or profession , both patients and health care providers benefit from this rehumanising effect . subject related partnership in medical education in the field on medical humanities and intercultural cooperation in health , funded by the german academic exchange service ( daad ) , with the pontificia universidad catlica del ecuador , quito / ecuador and the universidad nacional mayor de san marcos lima / peru . department of medical sociology , university medical centre hamburg - eppendorf , working group migration and health , coordination : niels - jens albrecht . subheadline " culture , healthcare and ethonography " corrected to " culture , healthcare and ethnography " . notes 3 : " fatma kaya " corrected to " fatma kisa " .
one of the main challenges for teaching programs on immigration , ethnic diversity and health is to transform the commonplace notion of culture into a helpful tool for medical training and practice . this paper presents the teaching approach of an interdisciplinary course on migrants health established at the university of giessen since 2004 , which has recently been complemented by a thematically related collaboration with two universities in latin america ( ecuador , peru ) . the overall goal is to translate the abstract philosophy of think global and teach local into medical practice , and to provide students with the insights , attitudes and skills needed for a fruitful use of concepts like culture , ethnicity and migration background . a key feature of the course is the strong commitment to ethnography as an important means for looking under the surface of superficial attributions to culture , and for grasping the interplay of medicine and health with cultural , social , religious , economic and legal aspects in its particular local and/or individual shape . three elements of the course are presented to illustrate this approach : first , a unit on islam and medicine , as important parts of the local immigrant community are muslims . the second one deals with psychosomatic aspects , because in case of immigrants , complex symptoms and disease representations like somatisation are easily misinterpreted as cultural . the third element consists of a unit with specialized social workers form outside the university , who provide direct insights into the living conditions and health problems of local immigrant communities .
the doetinchem cohort study ( dcs ) ( 11 ) is an ongoing prospective study , initially carried out in a random general population sample of 7,769 men and women aged 2059 years ( 19871991 ) . the aim of the doetinchem cohort study was to study the impact of ( changes in ) lifestyle factors and biological risk factors on various aspects of health , such as the incidence of chronic diseases , physical and cognitive functioning , and quality of life . reexamination lifestyle factors and biological risk factors are assessed by questionnaires and a physical examination at the research center . three subsequent examination rounds were completed in the years 19931997 , 19982002 , and 20032007 . the study was approved by the external medical ethics committee of the netherlands organization of applied scientific research according to the guidelines of the declaration of helsinki . details on the dcs have been extensively described elsewhere ( 11 ) . from 1995 onward , cognitive testing for dcs participants aged 45 years was introduced . in the years 19951997 , a random sample of one - third of participants aged 45 years was enrolled in the study on cognitive functioning , and a random sample of two - thirds was enrolled in an additional dietary study . those participating in the dietary study during 19951997 had their baseline measurement of cognitive functioning during 20002002 . between 1995 and 2002 , 3,350 respondents aged 4370 years , 96% of all respondents invited , participated in cognitive testing for the first time . five years later , between 2000 and 2007 , 2,690 of them ( 80% ) participated in cognitive testing again . at the first cognitive testing , participants who reported ( at baseline or at follow - up ) having experienced a stroke ( n = 77 ) were excluded from the analyses , because stroke has direct effects on brain functions and cognition . a total of 2,613 people ( 1,288 men and 1,325 women ) who participated in two cognitive measurements were included in this study . the neuropsychological test battery included four tests , the 15-word verbal learning test ( vlt ) , the stroop color and word test ( scwt ) , a fluency test , and the letter digit substitution test ( ldst ) , to measure global cognitive function and specific cognitive domains , namely memory , speed of cognitive processes , and cognitive flexibility ( i.e. , higher order information processing ) . in the vlt , 15 monosyllabic words printed on paper are displayed , one by one , in three subsequent trials , with a free recall procedure immediately after each presentation ( immediate recall ) . after a delay of about 15 min , there is an additional free recall trial ( delayed recall ) . the vlt total is calculated by summation of the words recalled correctly on the three immediate recalls . the vlt maximal represents the highest score on one of the three immediate recalls . in the scwt , three skills are tested : 1 ) to read 40 written color names , 2 ) to name the color of 40 colored patches , and 3 ) to name the color of the ink in which 40 incongruously named color words are printed ( so , e.g. , the word blue is printed in red ) . in the fluency test , the participant is asked to name as many animals as possible within 1 min . in the ldst , nine letters are given a unique digit code ( 1 to 9 ) in a key displayed on the same sheet of paper . the participant is asked to fill in the correct digits corresponding to the letters , as fast as possible . distributions of scores on the scwt were normalized ( distributions were unimodal and skewed to the right ) . for each cognitive test , a z score was computed for each participant at baseline and at follow - up , based on the means and sds of the test scores at baseline . in this way we were able to examine changes over time . standardized scores on the scwt were inverted , so that higher scores represent better cognition . all ( inverted ) standardized scores were then combined to form scores for specific cognitive domains , i.e. , scores for memory function , speed of cognitive processes , and cognitive flexibility , and a summary score for global cognitive function , as follows : at baseline and at follow - up , participants were asked whether they had diabetes by means of a self - administered questionnaire . for all patients with self - reported diabetes who had given written informed consent for it , their general practitioner was contacted for verification via mailed questionnaires . for 90% of patients with self - reported diabetes at baseline and for 88% of those with self - reported diabetes at follow - up , information regarding their diabetes status was obtained . individuals with type 1 diabetes ( n = 5 ) or with an unknown type of diabetes ( n = 4 ) were excluded from the analyses . three individuals with self - reported diabetes for whom the general practitioner did not confirm the diagnosis and women with gestational diabetes mellitus in the past but no diabetes at present were classified as not having diabetes . in addition , in the entire cohort a random ( nonfasting ) venous blood sample was taken to determine the plasma glucose level with the hexokinase method ( 13 ) . for three individuals , plasma glucose could not be determined . in conclusion , diabetes was defined on the basis of self - report confirmed by the general practitioner , self - report alone ( when no general practitioner verification was available ) , or a random plasma glucose of 11.1 each assessment round included a physical examination at the research center , involving height , weight , waist circumference , and blood pressure measurements and obtaining nonfasting blood samples . bmi was determined as weight in kilograms divided by the square of height in meters . blood pressure was measured with the subject in the sitting position using a random zero sphygmomanometer . total and hdl cholesterol were measured using standardized enzymatic methods ( 11 ) . in every assessment , information on demographic characteristics ( e.g. , age and educational level ) , lifestyle factors ( e.g. , smoking , alcohol consumption , and physical activity ) , and history of chronic diseases ( e.g. , myocardial infarction ) was also collected using standardized questionnaires . educational level was evaluated as the highest level reached and classified into five categories : 1 ) primary school , 2 ) lower vocational education , 3 ) intermediate secondary education , 4 ) intermediate vocational or higher secondary education , and 5 ) higher vocational education or university . smoking status was defined as being a nonsmoker ( never or former smoker ) or smoker ( of cigarettes ) and further according to the number of pack - years smoked at baseline . one pack - year corresponds to smoking 20 cigarettes / day for 1 year ( or , e.g. , smoking 1 cigarette / day for 20 years ) . alcohol consumption was classified into five categories : 1 ) abstainers , 2 ) 01 glasses / day , 3 ) 12 glasses / day , 4 ) 24 glasses / day , and 5 ) > 4 glasses / day . physical activity level was assessed by the use of the validated european prospective investigation into cancer and nutrition ( epic ) questionnaire on physical activity ( 15 ) and classified into four categories : inactive , moderately inactive , moderately active , and active ( 16 ) . depressive symptoms were assessed using the dutch version ( 17 ) of the sf-36 ( 18 ) . scores on both scales range from 0 to 100 in which higher scores represent better ( mental ) health . multivariate linear regression analyses and ancova were used to study the association between diabetes status and changes in cognitive function over follow - up . changes in cognitive domains and global cognitive function were analyzed as continuous outcome measures , with diabetes status as the main independent measure . first , we tested a basic model , adjusting for age , sex , level of education , and baseline level of cognitive function . second , to find out whether associations between diabetes and change in cognitive function could be explained by other diabetes - related factors , we tested the basic model with additional adjustment for factors of the metabolic syndrome ( waist circumference , systolic blood pressure , use of blood pressure - lowering medication , and hdl cholesterol level ) , physical activity , alcohol consumption , smoking , and history of myocardial infarction . because depression is quite common among people with diabetes and depression negatively affects cognitive function , we additionally adjusted this second model for depressive symptoms ( mental health and vitality ) . for all these covariates , baseline measures were taken for inclusion in the analyses . to test whether the association between diabetes and cognitive function was different at both ends of the middle - age range , additional analyses were performed including an interaction term of diabetes and age ( 60 vs. > 60 years ) . all analyses were performed using sas ( version 9.2 ; sas institute , cary , nc ) . the neuropsychological test battery included four tests , the 15-word verbal learning test ( vlt ) , the stroop color and word test ( scwt ) , a fluency test , and the letter digit substitution test ( ldst ) , to measure global cognitive function and specific cognitive domains , namely memory , speed of cognitive processes , and cognitive flexibility ( i.e. , higher order information processing ) . in the vlt , 15 monosyllabic words printed on paper are displayed , one by one , in three subsequent trials , with a free recall procedure immediately after each presentation ( immediate recall ) . after a delay of about 15 min , there is an additional free recall trial ( delayed recall ) . the vlt total is calculated by summation of the words recalled correctly on the three immediate recalls . the vlt maximal represents the highest score on one of the three immediate recalls . in the scwt , three skills are tested : 1 ) to read 40 written color names , 2 ) to name the color of 40 colored patches , and 3 ) to name the color of the ink in which 40 incongruously named color words are printed ( so , e.g. , the word blue is printed in red ) . in the fluency test , the participant is asked to name as many animals as possible within 1 min . in the ldst , nine letters are given a unique digit code ( 1 to 9 ) in a key displayed on the same sheet of paper . the participant is asked to fill in the correct digits corresponding to the letters , as fast as possible . distributions of scores on the scwt were normalized ( distributions were unimodal and skewed to the right ) . for each cognitive test , a z score was computed for each participant at baseline and at follow - up , based on the means and sds of the test scores at baseline . in this way we were able to examine changes over time . standardized scores on the scwt were inverted , so that higher scores represent better cognition . all ( inverted ) standardized scores were then combined to form scores for specific cognitive domains , i.e. , scores for memory function , speed of cognitive processes , and cognitive flexibility , and a summary score for global cognitive function , as follows : at baseline and at follow - up , participants were asked whether they had diabetes by means of a self - administered questionnaire . for all patients with self - reported diabetes who had given written informed consent for it , for 90% of patients with self - reported diabetes at baseline and for 88% of those with self - reported diabetes at follow - up , information regarding their diabetes status was obtained . individuals with type 1 diabetes ( n = 5 ) or with an unknown type of diabetes ( n = 4 ) were excluded from the analyses . three individuals with self - reported diabetes for whom the general practitioner did not confirm the diagnosis and women with gestational diabetes mellitus in the past but no diabetes at present were classified as not having diabetes . in addition , in the entire cohort a random ( nonfasting ) venous blood sample was taken to determine the plasma glucose level with the hexokinase method ( 13 ) . for three individuals , diabetes was defined on the basis of self - report confirmed by the general practitioner , self - report alone ( when no general practitioner verification was available ) , or a random plasma glucose of 11.1 each assessment round included a physical examination at the research center , involving height , weight , waist circumference , and blood pressure measurements and obtaining nonfasting blood samples . bmi was determined as weight in kilograms divided by the square of height in meters . blood pressure was measured with the subject in the sitting position using a random zero sphygmomanometer . total and hdl cholesterol were measured using standardized enzymatic methods ( 11 ) . in every assessment , information on demographic characteristics ( e.g. , age and educational level ) , lifestyle factors ( e.g. , smoking , alcohol consumption , and physical activity ) , and history of chronic diseases ( e.g. , myocardial infarction ) was also collected using standardized questionnaires . educational level was evaluated as the highest level reached and classified into five categories : 1 ) primary school , 2 ) lower vocational education , 3 ) intermediate secondary education , 4 ) intermediate vocational or higher secondary education , and 5 ) higher vocational education or university . smoking status was defined as being a nonsmoker ( never or former smoker ) or smoker ( of cigarettes ) and further according to the number of pack - years smoked at baseline . one pack - year corresponds to smoking 20 cigarettes / day for 1 year ( or , e.g. , smoking 1 cigarette / day for 20 years ) . alcohol consumption was classified into five categories : 1 ) abstainers , 2 ) 01 glasses / day , 3 ) 12 glasses / day , 4 ) 24 glasses / day , and 5 ) > 4 glasses / day . physical activity level was assessed by the use of the validated european prospective investigation into cancer and nutrition ( epic ) questionnaire on physical activity ( 15 ) and classified into four categories : inactive , moderately inactive , moderately active , and active ( 16 ) . depressive symptoms were assessed using the dutch version ( 17 ) of the sf-36 ( 18 ) . scores on both scales range from 0 to 100 in which higher scores represent better ( mental ) health . multivariate linear regression analyses and ancova were used to study the association between diabetes status and changes in cognitive function over follow - up . changes in cognitive domains and global cognitive function were analyzed as continuous outcome measures , with diabetes status as the main independent measure . first , we tested a basic model , adjusting for age , sex , level of education , and baseline level of cognitive function . second , to find out whether associations between diabetes and change in cognitive function could be explained by other diabetes - related factors , we tested the basic model with additional adjustment for factors of the metabolic syndrome ( waist circumference , systolic blood pressure , use of blood pressure - lowering medication , and hdl cholesterol level ) , physical activity , alcohol consumption , smoking , and history of myocardial infarction . because depression is quite common among people with diabetes and depression negatively affects cognitive function , we additionally adjusted this second model for depressive symptoms ( mental health and vitality ) . for all these covariates , baseline measures were taken for inclusion in the analyses . to test whether the association between diabetes and cognitive function was different at both ends of the middle - age range , additional analyses were performed including an interaction term of diabetes and age ( 60 vs. > 60 years ) . all analyses were performed using sas ( version 9.2 ; sas institute , cary , nc ) . nonparticipants and individuals lost to follow - up were slightly older and less educated than individuals who completed the follow - up assessment . individuals lost to follow - up scored 0.4 sds lower at baseline on all cognitive domains . in addition , the prevalence of several cardiovascular risk factors was higher among the dropouts , and the prevalence of type 2 diabetes ( self - report or plasma glucose level 11.1 mmol / l ) among them was also higher ( 6.2 vs. 2.6% in the follow - up group ) . at follow - up , 139 individuals were classified as having type 2 diabetes : 129 based on self - report ( 113 verified by the general practitioner ) and 10 based on their elevated plasma glucose levels . of those 139 , 61 ( 2.3% of the total population ; 31 men and 30 women ) had prevalent diabetes at baseline , and 78 ( 3.0% of the total population ; 42 men and 36 women ) developed type 2 diabetes during follow - up ( incident cases ) . patients with prevalent and incident diabetes were older and less educated and had higher systolic blood pressure and bmi at baseline than individuals without diabetes . furthermore , baseline cognitive function in diabetic patients was worse than that of individuals without diabetes ( table 1 ) . general baseline characteristics of the study population by diabetes status data are means sd unless otherwise indicated . diabetes is defined as self - reported diabetes ( verified by the general practitioner ) or having a random plasma glucose level 11.1 mmol / l . * physical inactivity is defined as being classified in the lowest two of four categories ( inactive and moderately inactive ) according the wareham classification for physical activity ( 16 ) . scores range from 0 to 100 in which higher scores represent better ( mental ) health ( 18 ) . we observed an interaction effect of diabetes with age ( 60 vs. > 60 years ) on the association between diabetes and change in cognitive flexibility . therefore , results for change in cognitive flexibility will be presented separately for individuals aged 60 years and those aged > 60 years . prevalent diabetic patients showed statistically significantly greater declines in memory function , cognitive flexibility , and global cognitive function than individuals without diabetes after adjustment for age , sex , and educational level . incident diabetic patients showed about twice the decline observed in individuals without diabetes , but this decline was statistically significant for memory , speed , and flexibility ( for individuals aged 60 years ) only ( table 2 ) . relative changes in cognitive function scores by diabetes status relative decline in cognitive domain scores is shown with individuals with no diabetes as the reference group : in the reference group of healthy individuals , we set the cognitive decline to 1.0 . the numbers in the columns of patients with diabetes reflect how many times stronger the cognitive decline was among diabetic patients compared with individuals without diabetes . no diabetes indicates no diabetes at baseline or at follow - up ( n = 2,460 ) . incident diabetes indicates no diabetes at baseline and diabetes at follow - up ( n = 78 ) . prevalent diabetes indicates diabetes at baseline and at follow - up ( n = 61 ) . diabetes was defined as reporting to have diabetes ( verified by the general practitioner ) or having random plasma glucose levels 11.1 change scores are adjusted for age , sex , level of education , and baseline cognitive score . change scores are adjusted for age , sex , level of education , waist circumference , hdl cholesterol level , systolic blood pressure , use of blood pressure - lowering medication , history of myocardial infarction , depressive symptoms ( vitality and mental health ) , physical activity , alcohol consumption , smoking , and baseline cognitive score . different from no diabetes group at p < 0.10 ; in the fully adjusted model , cognitive decline in memory , flexibility , and global cognitive function in prevalent diabetic patients was about 3 times greater than that in individuals without diabetes , although this decline was statistically significant only for flexibility ( for individuals aged 60 years ) and global cognitive function . differences in cognitive decline in memory and speed between incident diabetic patients and individuals without diabetes were no longer statistically significant in the fully adjusted model ( table 2 ) . associations between diabetes status and changes in cognitive function were not statistically significantly different for men compared with women . average cognitive function with 95% ci at baseline and at follow - up for individuals with no diabetes ( ) , incident diabetes ( ) , and prevalent diabetes ( ) . for change in cognitive flexibility , an interaction effect was observed for diabetes status and age . therefore , cognitive flexibility is displayed for individuals aged 60 years ( upper lines ) and individuals aged > 60 years ( lower lines ) separately . we observed an interaction effect of diabetes with age ( 60 vs. > 60 years ) on the association between diabetes and change in cognitive flexibility . therefore , results for change in cognitive flexibility will be presented separately for individuals aged 60 years and those aged > 60 years . prevalent diabetic patients showed statistically significantly greater declines in memory function , cognitive flexibility , and global cognitive function than individuals without diabetes after adjustment for age , sex , and educational level . incident diabetic patients showed about twice the decline observed in individuals without diabetes , but this decline was statistically significant for memory , speed , and flexibility ( for individuals aged 60 years ) only ( table 2 ) . relative changes in cognitive function scores by diabetes status relative decline in cognitive domain scores is shown with individuals with no diabetes as the reference group : in the reference group of healthy individuals , we set the cognitive decline to 1.0 . the numbers in the columns of patients with diabetes reflect how many times stronger the cognitive decline was among diabetic patients compared with individuals without diabetes . no diabetes indicates no diabetes at baseline or at follow - up ( n = 2,460 ) . incident diabetes indicates no diabetes at baseline and diabetes at follow - up ( n = 78 ) . prevalent diabetes indicates diabetes at baseline and at follow - up ( n = 61 ) . diabetes was defined as reporting to have diabetes ( verified by the general practitioner ) or having random plasma glucose levels 11.1 * change scores are adjusted for age , sex , level of education , and baseline cognitive score . change scores are adjusted for age , sex , level of education , waist circumference , hdl cholesterol level , systolic blood pressure , use of blood pressure - lowering medication , history of myocardial infarction , depressive symptoms ( vitality and mental health ) , physical activity , alcohol consumption , smoking , and baseline cognitive score . different from no diabetes group at p < 0.10 ; in the fully adjusted model , cognitive decline in memory , flexibility , and global cognitive function in prevalent diabetic patients was about 3 times greater than that in individuals without diabetes , although this decline was statistically significant only for flexibility ( for individuals aged 60 years ) and global cognitive function . differences in cognitive decline in memory and speed between incident diabetic patients and individuals without diabetes were no longer statistically significant in the fully adjusted model ( table 2 ) . 1 . associations between diabetes status and changes in cognitive function were not statistically significantly different for men compared with women . average cognitive function with 95% ci at baseline and at follow - up for individuals with no diabetes ( ) , incident diabetes ( ) , and prevalent diabetes ( ) . for change in cognitive flexibility , an interaction effect was observed for diabetes status and age . therefore , cognitive flexibility is displayed for individuals aged 60 years ( upper lines ) and individuals aged > 60 years ( lower lines ) separately . in the present study , diabetic patients showed a greater decline in cognitive function ( cognitive flexibility and global cognitive function ) than individuals without diabetes . the magnitude of decline in cognitive function in individuals who developed diabetes during follow - up was between that of individuals without diabetes and those who had diabetes at baseline but was not statistically significantly different from either group after adjustment for other cardiovascular risk factors . strengths of the present study are its prospective design , the relatively young population , and the long follow - up period with repeated assessment of cognitive function using a sensitive cognitive test battery . for most patients who reported diabetes , further , a large number of covariates were assessed , which enabled adjustment for a broad array of potential confounders . limitations of the present study can be found in the dropout of individuals during follow - up . although dropout of this order of magnitude ( 20% ) is inherent to cohort studies , there are reasons to believe that in our study it was selective to some extent . overall , cognitive function was better in the follow - up group and especially among individuals without diabetes . based on associations in the follow - up group , some of these observed differences in baseline characteristics between the group of dropouts and the follow - up group would weaken associations between diabetes and change in cognitive function , whereas other observed differences would make these associations stronger . furthermore , we may have missed some cases of diabetes because we measured random glucose levels rather than fasting glucose levels , and we did this only once . to diagnose diabetes , two measurements of glucose levels in addition , although most self - reported cases of diabetes were verified with the general practitioner , we can not exclude the possibility of some misclassifications in the diabetic groups either . therefore , we could not relate longer - term glucose levels to changes in cognitive function . the relation between diabetes and cognitive decline in middle - aged individuals was evaluated in three previous longitudinal studies ( 710 ) . in the atherosclerosis risk in communities ( aric ) study , diabetic patients showed greater declines over 6 and 14 years in scores representing speed of cognitive processes and verbal fluency but not in scores for memory ( 7,8 ) . in the interdisciplinary longitudinal study of aging ( ilse ) diabetic patients showed a greater decline at 4 years of follow - up in intelligence tasks but not in memory and speed than individuals without diabetes ( 10 ) . ( 9 ) , no differences in cognitive decline on several tests were observed between individuals with and without diabetes over a 4-year period . however , our study differs from these studies as to the tests used to determine cognitive domain functions . studying different age - groups can result in different conclusions , as reflected by the interaction between age and diabetes in our study . with one exception ( 9 ) , the overall conclusion of the previous studies and ours is that diabetes is associated with greater cognitive decline in middle - aged individuals , but that it remains uncertain which cognitive domain is affected most . the magnitude of cognitive decline in incident diabetic patients tended to be somewhere between the cognitive decline in individuals without diabetes and that of patients with diabetes at baseline , but the observed association was not significant . incident diabetic patients may thus also benefit from timely and appropriate treatment at the level of cognitive functions ( 19 ) . improved glycemic control reduces the damaging effects of hyperglycemia on neuronal and microvascular structures ( 5 ) . in this respect , it is remarkable that random plasma glucose levels of incident diabetic patients were similar to those of prevalent diabetic patients ( 8.5 and 8.6 mmol / l , respectively ) , which might be an indication that treatment was insufficient . results of our study seem to indicate that hyperglycemia affects different domains of cognitive functioning at different stages of the disease process . for instance , memory seems to be affected continuously ( lower score at baseline and a [ borderline significantly ] greater decline during follow - up for diabetic patients ) , whereas speed of cognitive processes seems to be affected during the first years of hyperglycemia only ( worse score at baseline , but no greater decline over follow - up for diabetic patients than for individuals without diabetes , whereas incident diabetic patients show a greater decline in speed of cognitive processes ) . these results suggest that early treatment of hyperglycemia could prevent some of the decline in speed of cognitive processes , but probably less so in the case of memory . for example , hyperglycemia causes oxidative stress and glycation of important functional and structural proteins ( 20 ) , which can have a direct detrimental effect on brain cells and the microcirculation in the brain ( 21 ) . in addition , higher fasting plasma glucose has been associated with functional changes in regional cerebral perfusion ( 22 ) . in addition , type 2 diabetes is associated with increased central arterial stiffness ( 23 ) , which has been shown to be a strong predictor of loss in cognitive function in older individuals ( 24 ) . improvement in glycemic control may improve cognitive functioning in adults with type 2 diabetes ( 19 ) and reduce the risk for ( cardiovascular ) complications . because we observed that cognitive decline was greater in prevalent diabetic patients than in incident diabetic patients and individuals without diabetes , duration of exposure to hyperglycemia could be the main factor that induces and maintains cognitive decline . to further explore this hypothesis , we performed ad hoc analyses on a subset of our data , relating diabetes duration to cognitive decline . a verified date of diagnosis of diabetes was available for 109 ( 57 incident and 52 prevalent ) diabetic patients at follow - up . on average , diabetes in these patients had been diagnosed 6.5 6.8 ( mean sd ) years before the follow - up assessment . we did not observe an association between duration of diabetes and change in cognitive functioning within this subgroup of diabetic patients . type 2 diabetes is often associated with other conditions that may influence cognitive function , such as hypertension , hypercholesterolemia , and central obesity . however , trends observed in the fully adjusted model were similar to those in the basic model , indicating that comorbidities of diabetes only partly explain the associations between diabetes and cognitive decline . in summary , middle - aged diabetic patients have greater cognitive decline than individuals without diabetes . therefore , cognitive function should be assessed and monitored in middle - aged individuals with type 2 diabetes .
objectiveto test the hypothesis that type 2 diabetes is associated with greater decline in cognitive function in middle - aged individuals.research design and methodsin the dutch prospective doetinchem cohort study , cognitive functioning was measured twice within a 5-year time interval in 2,613 men and women . participants were aged 4370 years at baseline ( 19952002 ) , and no one had a history of stroke . change in scores on global cognitive function as well as on specific cognitive function domains ( memory , speed of cognitive processes , and cognitive flexibility ) were compared for respondents with and without type 2 diabetes ( verified by the general practitioner or random plasma glucose levels 11.1 mmol / l).resultsat the 5-year follow - up , the decline in global cognitive function in diabetic patients was 2.6 times greater than that in individuals without diabetes . for individuals aged 60 years , patients with incident and prevalent diabetes showed a 2.5 and 3.6 times greater decline , respectively , in cognitive flexibility than individuals without diabetes . for most cognitive domains , the magnitude of cognitive decline in patients with incident diabetes was intermediate between that of individuals without diabetes and that of patients with diabetes at baseline.conclusionsmiddle-aged individuals with type 2 diabetes showed a greater decline in cognitive function than middle - aged individuals without diabetes .
public healthcare resources are limited all over the world ; hence , encouraging the use of evidencebased and transparent decisionmaking processes to inform the allocation of scarce resources is essential at both global and national levels . multidisciplinary tools and methods need to be established and implemented in order to improve the efficiency of resource allocation . regardless of current global and national health policy agendas , decisionmaking should rely on strong scientific evidence ( hoomans and severens , 2014 ; rudmik and drummond , 2013 ) . additional research is needed in different jurisdictions on the factors influencing the uptake of research findings into health policymaking ( innvaer et al . , 2002 ; oliver et al . , 2014 ) , for example , how political and institutional dimensions affect the use of health evidence in decisionmaking ( liverani et al . , 2013 ) . health technology assessment ( hta ) is a multidisciplinary field of policy analysis , which studies the medical , social , ethical , and economic implications of the development , diffusion , and use of health technologies ( inahta , 2014 ) . the purpose of hta is to support policymakers with the best available information about new and already widely used health technologies in order to inform resource allocation decisions in a variety of settings , including lowincome and middleincome countries ( grutters et al . furthermore , the formal implementation of hta can improve allocative efficiency ( henshall 2012 ; tunis and turkelson 2012 ) and have positive spillovers beyond sound reimbursement decisions , such as strengthening the dialogue between relevant stakeholders and focusing the public debate on patientlevel outcomes ( gerhardus et al . , 2008 ) . the vast majority of methodological work on hta , to date , builds on the experiences of highincome countries , especially in western europe , north america , and australia . however , many countryspecific factors can play an important role in the relative value of a technology to the decisionmaker . the demand from one side , the affordability on the other , and the gap between them highly depend on socioeconomic factors . added therapeutic benefits , baseline risks , and local treatment practices reflect on the effectiveness of the technologies . differences among countries can be observed in the basic benefit packages and formulary lists , and consequently , in the unmet medical need and standard care for the comparator in hta analyses . variations in philosophies and techniques across national and regional hta systems in europe as well as worldwide are the result of health , social , financial , and political differences ( allen et al . , 2013 ) . as such , the evaluations and recommendations issued by different hta bodies over the same technologies differ ( kristensen and gerhardus , 2010 ; nicod and kanavos , 2012 ) because of differences in local data in addition to differences in methodological and institutional approaches . our study is focusing on the application of hta in central and eastern european ( cee ) countries . the exact countries included in the term central and eastern europe could be contentious , as it does not refer to an official definition or predefined group of countries ( e.g. , by oecd , see http://stats.oecd.org/glossary/detail.asp?id=303 ) . it rather attempts to cover countries in europe , which share both a similar economical , demographical patterns and a history of socialist rule as well . these could have important implications for resource allocation and decisionmaking process in healthcare systems . without making any declarations as to regional boundaries , we believe that our framework and analysis are broadly relevant to the widest definitions of the cee ( from the baltic to the balkan region and from central to southeastern europe ) , as many of these countries also share low per capita gross domestic product ( gdp ) and/or low total gdp , which severely limits the national resources available for hta . for example , according to the international monetary fund world economic outlook database october 2014 edition ( see http://www.imf.org/external/pubs/ft/weo/2014/02/weodata/index.aspx ) , even higher income cee countries such as poland and hungary have more than three times lower gdp per capita compared with france , germany , or uk . further , many of the countries in the region are small , so while the gdp per capita of baltic states ( estonia , latvia , and lithuania ) is relatively high ( > 16.000 usd in 2014 ) , they all have populations under 23 million , resulting in very limited national resources for countryspecific hta research . these countries also share similarities in healthcare decisionmaking processes as they face particular challenges in providing highly developed health services compared with more affluent countries : the delays in pricing and reimbursement decisions may be substantial ( ades et al . , 2014 ) , patient access to high cost technologies in rare diseases is more limited ( iskrov et al . , 2012 ) , the resources to provide complex biological therapies are fewer ( pntek et al . , 2014 ) , expensive oncological therapies are rarely affordable ( vladescu et al . , 2009 ) , and several isolated ethnic groups face access barriers even to basic services ( rechel et al . , 2009 ) . when comparing the cee region to the wealthier western european ( we ) countries , five contextual factors particularly influence hta development and the associated decisionmaking process : ( 1 ) financial resources for improving health through innovative and expensive technologies are more limited ; ( 2 ) the health status of the population is worse ; hence , the actual needs for effective medical technologies could be higher ; ( 3 ) the reliance on public financing and provision of health care is heavier in postcommunist countries . historically free and easy access to healthcare technologies and services makes rationalization a sensitive issue in the public domain ; ( 4 ) the pricing rationale of new healthcare technologies ( especially pharmaceuticals ) in europe is primarily driven by requirements and needs of large we countries;. and ( 5 ) capacity for hta is insufficient , for example , there is a deficit of trained hta doers ( especially health economists ) , and budgets for conducting hta are low ( boncz et al . , 2014 ; inotai et al . , 2012 ; jakovljevic , 2013 ; kal et al . , 2013 ) our objective was to summarize the major types of hta implementation practices and to propose an hta implementation scorecard that can support the formulation of hta roadmaps in cee countries . the paper summarizes the current conclusions of an ongoing consultation process conducted by authors during their work at international levels in fora , which included eunethta , ispor cee network , and ispor hta roundtable europe . draft components of the hta roadmap have been identified earlier and have already been presented and discussed at several meetings . the situation analysis was informed by a pragmatic literature review of current hta practices in cee countries . initially , we searched for articles listed on pubmed and scopus with keywords of hta in combination of cee or cee country names . additionally , we looked at the reference list in publications included in the literature review . as scientific papers in english language are limited or outdated with the exception of few cee countries , such as poland or hungary , we also reviewed the gray literature , including web pages of ministries of health and hta bodies in each cee country . two major outputs were prepared for this paper as a result of the abovementioned methods . firstly , a summary on major types of hta implementation practices was presented to understand how cee countries adjusted their decisionmaking process to the specific economic and political conditions . based on this overview , we prepared a draft hta roadmap scorecard to support hta implementation strategies in cee countries through an assessment of the current status of hta implementation and future longterm objectives in seven different categories . the draft hta scorecard was applied at the adriatic pharmacoeconomic congress in april 2015 in sibenik , croatia . fortyone congress participants from 12 different countries filled in the scorecard , and then aggregated responses were discussed by a roundtable panel . based on the feedback of participants , the scorecard has been extended with one additional category related to international collaboration on hta , and certain items of the scorecard have been amended to improve the clarity of statements . although cee countries share a common history as well as similarities in the postcommunist transition , there are still significant political and economic differences among countries with important constraints on hta implementation . when large multinational blocks dissolved ( soviet union , yugoslavia , and czechoslovakia ) , smaller countries were reestablished or created , especially in the baltic and adriatic regions . such small countries face more limitations in full hta implementation because of correspondingly fewer resources and larger difficulties in building large capacities for hta . although collaboration among small countries in hta and health services research with neighboring countries may be highly beneficial , some of the political and ethnical tensions that eventually resulted in separation of these countries remain . at a higher level , successful paneuropean collaborations among european hta agencies are possible ( woodford and cook , 2014 ) , but some barriers should still be overcome in terms of communication , identifying collaborative partners , differences in the methodology of assessment , for example , outcome selection , and the level of acceptance of different types of comparison and study type ( hui et al . , 2013 ; ten have et al . , 2013 ) . secondly , the economies of cee countries have evolved differently from the setback following the political transition . financial recovery was rapid in countries with peaceful transitions , while others have not recovered for many years . in addition , the political and economic transition became european union ( eu ) accession oriented in selected cee countries . eu institutions guided reforms in these countries by setting intermediate and final objectives , permanently monitoring the process and providing financial and technical assistance for the timely accomplishment of necessary steps . the economic performance of eu member states from cee is generally stronger than noneu countries ( european transition compendium , 2015 ) . although poorer countries have a greater need to minimize the opportunity cost of inappropriate health policy decisions , they can not allocate sufficient resources for hta capacity building ; therefore , they are less advanced in hta implementation . lastly , policy leaders in cee countries had no intention to apply transparent decisionmaking processes before the political and economic transition , thus the evidence base on healthcare resource allocation decisions was limited . after the transition , nontransparent privatization processes and the expansion of the informal sector resulted in affluent economic and political segments in several cee countries . many individuals in these segments may have an interest in preserving status quo , thus have disincentives to support transparent resource allocation algorithms in public sector decisions , including public healthcare financing . as such , there has been little political support towards hta implementation , which would clearly reduce the scope for individual decisions lacking strong scientific evidencebased and verifiable criteria . in addition , several previous healthcare policymakers established consulting companies in the region , benefiting from personal insights to nontransparent hta , pricing , and reimbursement processes . this particular lack of political will coupled with underdeveloped accountability mechanisms must be distinguished from the wider political resistance towards formalizing hta components or processes , which highincome countries may also experience , albeit for more substantive reasons such as centralizationdecentralization tensions ( artells et al . , 2014 ) and the reluctance to rationalize care ( neumann and weinstein , 2010 ) . the aforementioned factors make the implementation of hta difficult in cee countries , and they generate a wide range of hta implementation experience . the initial question of hta implementation is whether the process should start with mandating the use of technology assessment in pricing and reimbursement decisions or with investing into hta capacity building . if mandating hta evidence comes first , it poses an additional question on the degree of hta institutionalization . hta activities , especially the critical appraisal of technology assessment , can be coordinated either by public hta offices / institutes or by special committees . figure 1 describes the major types of hta implementation practices in cee countries across the two key dimensions : the extent to which hta implementation is a public priority and the focal hta development area ( capacity building or mandate to inform decisions ) . in extreme cases , hta implementation has not yet started , or , on the contrary , has already been fully implemented . in the first case , the decisionmaking process hardly includes any hta evidence , and policymakers do not intend to pursue the application of this tool ; therefore , they pay no attention on hta capacity building . this is typically the case of small countries with health systems in transition , such as the lately established states in southeast europe , like kosovo or montenegro ( jakovljevic , 2013 ) . in the second extreme case , hta implementation is already a recognized public priority , accompanied by heavy reliance on local hta evidence in the decisionmaking process . consequently , these countries , such as poland and hungary , have already seen investments in the development of versatile educational system and established public hta organizations . permanent hta graduate and postgraduate programs supplemented with short courses contribute to the quantity and the quality of the hta capacities ( gulcsi et al . major types of health technology assessment ( hta ) implementation practices in central and eastern european countries in between these extreme types , countries can be clustered according to their current focus either on capacity building or policy implementation . in many cee countries , the mandatory use of hta evidence in decisionmaking is not supported by adequate human resource capacities and legal framework . in such cases , the decisionmaking process may dominantly rely on international hta evidence , for example , in romania ( lopert et al . , however , transferring the data and the results from other jurisdictions without any local adaptation and adjustment may do more harm than good ( kal et al . , 2012 ) . because of limitations of hta transferability , this practice could be only a transient state of hta implementation . despite general recommendations for local adaption of hta evidence , smaller countries have more constraints to advance their hta system to capture local evidence . mandating the use of local hta evidence without adequate human resources and permanent educational programs may also negatively influence the quality of technology assessment processes . in such cases ( e.g. , bulgaria ) , stakeholders may not fully rely on hta recommendations in policy decisions ( iskrov et al . , when permanent hta graduate courses appear in the education system , there is a good opportunity to improve the quality and the quantity of national hta capacity , which could also raise the quality of hta appraisals . in serbia , hta has slowly gained momentum , and the key reason for its slow implementation was the lack of health economic experts in the country ( zah , 2011 ) . institutionalization of the hta process , including establishment of public hta offices , is an important element of implementation ( oortwijn et al . , , the agency for quality and accreditation in health care and social welfare has been covering health technology assessment since 2009 ( hui , 2011 ; mittermayer et al . , 2010 ) . because of the limited human and financial hta resources , and being subject to a legal framework in which hta is still not mandatory , the croatian hta department from the begining of the establishment of an hta process recognized the importance of international collaboration through eunethta within capacity building and joint collaborative work on core htas . in slovenia , limited human resources led to plans of setting up a structured hta network integrating existing national institutions in order to overcome capacity limitations ( turk et al . , 2010 ) . , a methodological guideline was published with a strong commitment for economic evaluations to contribute to efficient resource allocation decisions . however , without sufficient capacity , the role of hta was not accurately defined within the healthcare system ( tesar , 2012 ) . these examples clearly show that at this stage of implementation , more capacity is needed for a wellfunctioning hta system . making hta for example , the baltic countries had already shown an interest in hta capacity building more than a decade ago ( danguole , 2009 ; gibis et al . even less developed countries , such as albania , pursued initiatives to modernize the health system in which a number of medical professionals received hta training ( jakovljevic , 2013 ) . the canadian society for international health ( csih ) provided an initial hta mentoring program in kazakhstan with the partnership of kazakhstan ministry of health ( moh ) . a sevenmember csih team provided hta materials , short courses , and oneonone support for moh hta staff over a 2.5year project ( muratov et al . , investing in capacity building alone does not guarantee the use of hta evidence in health policy decisions even after sufficient human resources become available if appropriate legal framework and public hta organizations are not established . if the demand for hta evidence from decisionmakers is limited , academic centers sometimes conduct technology assessments mainly on pharmaceuticals without strong influence on pricing and reimbursement decisions . our research indicates that the current practice of hta implementation is highly heterogeneous in the cee region . some countries are still in the initial phases and several others are in transition towards full hta implementation . although there are some countries with full hta implementation , our experience suggests that the even these countries have room for improvement , for example , in the transparency of the hta process ( kal et al . , 2013 an hta implementation scorecard can be a useful tool to assess the current status of hta implementation and to set up longterm objectives . based on our experience and review of the scientific literature on hta implementation practices in cee , we developed such a scorecard focusing on eight key components ( table i ) . hta capacity building hta capacity building hta implementation scorecard comparison of current status and future directions hta is a multidisciplinary field , and several of its components , especially those related to synthesizing clinical evidence , are included in the traditional curriculum of medical or pharmacy graduate training . however , cee countries have limited capacity for delivering postgraduate hta courses , especially in the field of developing skills in economic modeling . until such training courses are established in the region , this is a very costly alternative to local education , and actually , a high proportion of cee experts with master or phd degrees obtained abroad do not return to their own country to support hta implementation . undergraduate courses are not an option for indepth training , especially in economic evaluation methodology and transferability ; however , they are important to raise the awareness , positive attitude , basic knowledge , and understanding on the potential contribution of medical professionals . local projectbased or regular short courses may be useful options to alleviate the need for trained hta professionals , as well as hta courses provided by international networks and organizations , such as eunethta , htai , and ispor . such short courses are also valuable for hta users . however , the fluctuation of toplevel policymakers is relatively high in cee countries , which necessitates the repetition of these courses . hta funding health technology assessment processes have clear associated costs proportional with their scope ( ten have et al . , 2013 ) ; therefore , funding is needed to conduct both the technology assessment ( i.e. , the research part ) and the appraisal of evidence submitted by researchers or manufacturers ( i.e. , the appraisal part ) . if hta becomes a mandatory element of the pricing and reimbursement process of new technologies , manufacturers of new technologies are able to fully or partially fund the research activity of hta doers from private resources . also , in such cases , submission fees related to pricing and reimbursement dossiers of new technologies may be the primary funding source of the critical appraisal process of technology assessment , and therefore governments do not need to allocate significant budget for hta implementation . however , such a development would allow limited budgets to revise previous hta recommendations , conduct technology assessment in areas with no new products , or development of hta guidelines , standards and databases , and communication and stakeholder engagement . that is why it is desirable to invest public resources in both the assessment and appraisal components of hta . hta legislation and governance hta legislation and governance in several cee countries , hta has no formal role in health policy decisions , such as the pricing and reimbursement of new technologies . some countries ( e.g. , romania ) predominantly rely on international hta guidance in policy decisions without formally assessing the transferability of international hta evidence , especially conclusions of economic evaluations ( drummond et al . , 2009 ; welte et al . , countries like poland , slovakia , and hungary request hta evidence based on local input data or the translation of international evidence to local practice before approving the price and reimbursement of new pharmaceuticals or medical devices ( kal et al . the organizational structure related to the critical appraisal of hta evidence provided by hta doers and researchers or submitted by manufacturers is crucial . if only a committee reviews the quality of hta submissions , there is no room for indepth appraisal . if a public hta institute or agency is established , in addition to a more detailed appraisal process , there is also more opportunity for revising previous decisions or conducting hta in areas with no new products to support disinvestment decisions or optimization of healthcare delivery . the hta organization may rely on external expertise , for example , the scottish medicines consortium with limited internal staff relies heavily on the contribution by academic centers ( stafinski et al . , 2011 ) . in large countries , especially those with multipayer health care financing , establishing multiple hta agencies may reduce a potentially monopolistic position of a central hta office . however , inappropriate coordination among several hta bodies may result in duplication of efforts when generating hta evidence or recommendations . scope of hta implementation scope of hta implementation if capacity for hta is limited , it makes sense to introduce its use only for selected health technologies . in several countries , countries , however , may have significant differences in applying hta evidence only for new products with significant budget impact , all new products , or even revision of hta evidence for products already on the reimbursement list ( carone et al . , 2012 ) . health technology assessment can not be limited to pharmaceutical technologies ; therefore , it is increasingly used for policy decisions of new medical devices or medical prevention ( drummond et al . , 2008 ) . as hta capacities are limited , priority setting process may facilitate the selection of topics for assessment in a period of time . decision criteria health technology assessment evidence can be mandated in policy decisions by requesting all or only some components of hta . healthcare priority and the assessment of therapeutic value are commonly used criteria even in countries without formal hta processes . costeffectiveness evidence , however , is requested only in countries with more advanced hta implementation . in addition to financial criteria , policymakers need to consider the program feasibility in terms of the availability of quality workforces , efficient management strategy , and social acceptability of new technologies . for example , it is difficult to judge how much added therapeutic value is needed to justify reimbursement or how much is the acceptable budget impact , if the new technology can not save public resources ( e.g. , oncology drugs with significant survival benefit ) . costeffectiveness thresholds can be soft or hard depending on how much deviation is allowed in policy decisions compared with conclusions of the economic evaluation ( kolasa et al . , 2012 ) . in poland and hungary , costeffectiveness thresholds are soft , that is , new technologies with incremental costeffectiveness ratio ( icer ) above the published threshold still can be reimbursed , especially if they provide solutions to high unmet medical needs or inequities and their budget impact is relatively small , such as orphan drugs in rare diseases ( grzywacz et al . , 2014 ; szegedi et al . , , slovakia applies a hard threshold , that is , reimbursement can not be granted for new pharmaceuticals with an icer above the threshold determined by the parliament . however , based on the slovak legislation , drugs in rare diseases ( i.e. , with prevalence below 1:100 000 ) can be reimbursed without considering the threshold , and patient access schemes for highly innovative pharmaceuticals can be applied if the icer is above the threshold . different components of hta can be assessed jointly and explicitly in multicriteria decision analysis ( mcda ) . in 2010 , mcda was introduced for new hospital technologies in hungary , primarily for medical devices ( endrei et al . , 2014 ) . quality and transparency of hta implementation quality and transparency of hta implementation the quality of hta implementation can be improved by several tools , such as published methodological guidelines for technology assessment . a detailed critical appraisal checklist can standardize the appraisal process of hta submissions and consequently improve the consistency of reimbursement decisions ( inotai et al . , 2012 ) . publishing a critical checklist provides indirect guidance for hta doers and therefore may prevent unnecessary errors or mismatches in the interpretation of scientific evidence . the learning process on hta quality can be improved by regular followup research on previous hta recommendations . transparency is essential to successful hta implementation as clear requirements and published evidence can formally justify previous policy decisions and create verifiable criteria for future decisions . despite sophisticated hta methodology in hungary , technology assessment and critical appraisal reports , or hta recommendations , are not published and not even available for public scrutiny . in poland and croatia , hta reports with recommendations issued by national hta agency are published , therefore researchers can review the appropriateness of previous recommendations ( kolasa et al . , another component of transparency is the timeliness of the hta process . ideally , hta submissions are accepted continuously , and issuing recommendations has transparent timelines . use of local data if human and financial resources for hta are limited and the availability and quality of local data on the effectiveness of health technologies and costs of care are low , hta users may not request local evidence and data in the decisionmaking process . for example , the current romanian pharmaceutical reimbursement process relies heavily on hta recommendations issued in germany , france , and uk , while policymakers can not take into account local costeffectiveness studies . on the other hand , several cee countries with more advanced hta implementation mandated the use of local data in economic evaluations ( skoup et al . , 2014 ) . local effectiveness and cost data can be more easily generated in countries where patient registries in the most important disease areas and payers ' databases are available and accessible for hta doers . international collaboration international collaboration according to the new european hta network strategy , international collaboration in hta may prevent duplication of efforts . although individual cee countries may just choose the reuse or adaptation of international hta reports or models , active contribution to joint assessment reports represents an increased level of commitment to hta implementation . international collaboration in continuous education on hta can reduce the scarcity of human resources in cee , including development of training course materials and delegation of participants at international hta training programs . because of poorer population health and more limited healthcare resources , the opportunity costs of suboptimal health policy decisions are greater in cee compared with we . cee countries could pay an even higher price for inappropriate reimbursement and resource allocation decisions , especially in difficult economic periods . cee decisionmakers , in their capacity as hta users , must improve the appropriateness of reimbursement and resource allocation decisions to increase the allocative efficiency of healthcare financing ( kal et al . , 2012 ) . as resources for hta are insufficient in cee countries compared with we countries , they need more creativity and special skills to develop and implement hta . cee hta doers should rely more on collaborative efforts , such as the eunethta reports in relative effectiveness and core hta ( kristensen et al . , 2009 ) and ispor hta roundtable europe . active cee participation in international collaborations and joint hta work ensures that advancement of hta tools takes into account cee needs and constraints . therefore , increased funding and involvement of cee researchers in european projects focusing on public health provision and methodological development of evidencebased health policy are essential . however , the transferability of pricing and reimbursement practices and hta recommendations from we countries may be limited . consequently , the national adaptation of international hta evidence has vital importance , which still necessitates local hta capacity , budget , and wellfunctioning organizations . although cee countries with similar cultural environment and economic status can learn from each other in improving their healthcare systems , there is no generalizable gold standard for hta implementation . hta roadmaps are not fully transferable without taking into account countryspecific aspects , such as country size , gdp per capita , major social values , public health priorities , and the fragmentation of healthcare financing . countries need to focus on identifying and formulating their own values , health policy objectives , and constraints in order to develop their own hta systems . we believe that the availability of and adherence to a clear roadmap can support this process and improve the efficiency of hta implementation in each country . this may eventually result in better health outcomes and more equitable access to health technologies in parallel with improving the sustainability of health care financing in the cee region . the proposed hta implementation scorecard is designed to set up longterm objectives for the roadmap . it is informed by empirical observations and a pragmatic review of scientific and gray literature and stakeholder consultations . limited research has looked into the applicability and political feasibility of such tools ; therefore , we propose that future research address this aspect . our scorecard must be viewed as an initial step in a multistakeholder dialogue on best hta implementation practices in cee countries and should be updated as needed . we plan to use the scorecard at international training courses ( such as the ispor health technology assessment training program see http://www.ispor.org/education/htatraining/index ) to facilitate workshops on hta implementation . in addition , we aim to collect information on current and preferred status on local hta implementation in cee countries and publish results in scientific journals . the hta implementation scorecard may also be generalizable to other emerging regions with similar constraints as cee , such as limited human resources , budget , and yet unestablished organizational structure for hta .
abstractthe opportunity cost of inappropriate health policy decisions is greater in central and eastern european ( cee ) compared with western european ( we ) countries because of poorer population health and more limited healthcare resources . application of health technology assessment ( hta ) prior to healthcare financing decisions can improve the allocative efficiency of scarce resources . however , few cee countries have a clear roadmap for hta implementation . examples from highincome countries may not be directly relevant , as cee countries can not allocate so much financial and human resources for substantiating policy decisions with evidence.our objective was to describe the main hta implementation scenarios in cee countries and summarize the most important questions related to capacity building , financing hta research , process and organizational structure for hta , standardization of hta methodology , use of local data , scope of mandatory hta , decision criteria , and international collaboration in hta.although hta implementation strategies from the region can be relevant examples for other cee countries with similar cultural environment and economic status , hta roadmaps are not still fully transferable without taking into account countryspecific aspects , such as country size , gross domestic product per capita , major social values , public health priorities , and fragmentation of healthcare financing . copyright 2016 john wiley & sons , ltd .
the extremely high predictability of endodontic success has made it possible to retain the pulpally involved teeth , the main reason behind this is the much advancements in endodontics . the main causes of endodontic failure , making retreatment necessary , are thought to be insufficient cleaning and inadequate obturation . the endodontic failure cases can be treated in three ways : nonsurgical retreatment , surgical retreatment , or extraction . among all these treatment alternatives nonsurgical success rates for orthograde retreatment are 65% to more than 80% . the main goals of orthograde retreatment are gaining access to the apical foramen by complete removal of the root canal filling material thus facilitating sufficient cleaning and shaping of the complete root canal system and final obturation . gutta - percha can be removed using rotary instruments , heat carrying instruments , and solvents . however , previous studies have revealed that canal walls completely free of debris are not usually obtained . it remains unclear what method of evaluation indicates complete removal of filling material during orthograde retreatment . in some retreatment studies , the criteria for completion of retreatment was no evidence of gutta - percha or sealer on the files or paper points . in other studies , radiographs were exposed and evaluated . but none are conclusive methods for arriving at a decision that the retreatment is completed . clearly , more convincing methods are required for detecting the remaining root canal filling material . the dental operating microscope ( dom ) is used increasingly in vivo for routine endodontic procedures because of enhanced visibility and lighting . the reported advantages of using an operating microscope for conventional endodontics include improved the visualization of root canal anatomy that enables the operator to investigate the root canal system and to clean and shape it more efficiently . thirty freshly extracted human maxillary central incisors were collected from the department of oral and maxillofacial surgery , faculty of dental sciences , csmmu , lucknow . in all the samples , the clinical crowns were resected before cleaning and shaping of the root canal in order to keep similar length of all the samples which was 16 mm . the access opening was made using # 2 round diamond instrument in a high speed hand - piece . the working length was determined using a radiograph which was kept 1 mm short of the radiographic tip . the apical preparation was then enlarged up to # 50 k - file ( dentsply maillefer , switzerland ) size in all samples while irrigating frequently with 5% naocl and edta and the rest of the canal was prepared using the step - back technique using successively larger number files . after biomechanical preparation , the root canals were dried and obturated with gutta - percha and ah - plus sealer ( dentsply detrey , germany ) by the cold lateral condensation method . access cavities in all samples were sealed with composite synergy d6 ( coltene whaledent , switzerland ) restorative material . gutta - percha was removed from the root canals using h - files with sizes 25 , 30 , 35 , 40 , 45 , and 50 in a circumferential quarter - turn push - pull motion . the retreatment was deemed completed when no gutta - percha and sealer material could be seen on the instrument and also when the canal appeared clean when inspected with naked eyes . the samples in these groups were retreated with protaper universal retreatment files ( dentsply maillefer , switzerland ) . without engaging dentin d1 was used to remove the obturation material from the coronal one - third of the root canal . after using d1 , the remaining obturation material from the apical one - third of the root canal was removed with d3 . in between the files were removed frequently for inspecting the flutes . continued as long as the obturation material was visualized between the cutting blades . the filling material was removed using gates - glidden drills from the coronal and middle third of the root canal and the apical third was cleaned using h - files . after retreatment was completed , the samples were observed under a dom at 5.1 magnification ( opmi proergo carl zeiss germany ) to detect residual obturation material . the photographs of all the samples were stored on a computer and later on evaluated for the remaining filling material using image analysis software ( image tool 3.00 uthsc san antonio ) . linear measurement of the remaining filling material was done in millimeters and scores were given to each sample for cleanliness of canal walls as follows . the teeth in all the groups were made transparent by robertson 's method : after observing the samples under a dom , the specimens were decalcified in 5% nitric acid for 72 h , then washed for 4 h and dehydrated in increasing concentrations of alcohol , i.e. 80% alcohol for 12 h , 90% alcohol for 1 h , and 99% alcohol for 3 h. the samples were then subsequently cleared by storing them in methyl salicylate . after clearing , olympus america inc . ) and the images were subjected to image analysis software ( image tool 3.00 uthsc san antonio ) , for detection of residual obturation material [ figure 1 ] . the samples were scored for residual obturation material , and the criteria adopted for scoring was the same as the one followed when observed under a dom . apart from measuring the residual filling material linearly , the area of residual obturation material was also measured in mm . transparent teeth of all the three groups were observed under a stereomicroscope to detect and measure the remaining obturation material after retreatment ( 6.5 ) ; ( a ) sample from group i , the teeth appear clean with no remaining obturation material ; ( b ) sample from group ii , a large portion was seen containing the remaining obturation material ; and ( c ) sample from group iii , remaining fi lling material was seen at apical third the upper and lower confidence limit for the mean was calculated to show the significant difference between the scores obtained with a dom and a stereomicroscope . furthermore , the mean was calculated to show the significant difference among the three groups in scores given by a dom and a stereomicroscope and the areas measured in mm by a stereomicroscope . in addition , statistically significant differences were evaluated using the paired t - test . the confidence limits and paired t - tests were used to show statistically significant differences between the scores given by a dom and a stereomicroscope . spearman 's correlation coefficient was used to determine the correlation between the area of remaining obturation material measured in transparent roots and the scores obtained by the dom and the stereomicroscope . the samples were retreated using h - files ( dentsply maillefer , switzerland ) . gutta - percha was removed from the root canals using h - files with sizes 25 , 30 , 35 , 40 , 45 , and 50 in a circumferential quarter - turn push - pull motion . the retreatment was deemed completed when no gutta - percha and sealer material could be seen on the instrument and also when the canal appeared clean when inspected with naked eyes . the samples in these groups were retreated with protaper universal retreatment files ( dentsply maillefer , switzerland ) . without engaging dentin d1 was used to remove the obturation material from the coronal one - third of the root canal . after using d1 , the remaining obturation material from the apical one - third of the root canal was removed with d3 . in between the files were removed frequently for inspecting the flutes . continued as long as the obturation material was visualized between the cutting blades . the filling material was removed using gates - glidden drills from the coronal and middle third of the root canal and the apical third was cleaned using h - files . after retreatment was completed , the samples were observed under a dom at 5.1 magnification ( opmi proergo carl zeiss germany ) to detect residual obturation material . the photographs of all the samples were stored on a computer and later on evaluated for the remaining filling material using image analysis software ( image tool 3.00 uthsc san antonio ) . linear measurement of the remaining filling material was done in millimeters and scores were given to each sample for cleanliness of canal walls as follows . the teeth in all the groups were made transparent by robertson 's method : after observing the samples under a dom , the specimens were decalcified in 5% nitric acid for 72 h , then washed for 4 h and dehydrated in increasing concentrations of alcohol , i.e. 80% alcohol for 12 h , 90% alcohol for 1 h , and 99% alcohol for 3 h. the samples were then subsequently cleared by storing them in methyl salicylate . after clearing , the samples were observed under a stereomicroscope at 6.5 ( szx7 olympus america inc . ) and the images were subjected to image analysis software ( image tool 3.00 uthsc san antonio ) , for detection of residual obturation material [ figure 1 ] . the samples were scored for residual obturation material , and the criteria adopted for scoring was the same as the one followed when observed under a dom . apart from measuring the residual filling material linearly , the area of residual obturation material was also measured in mm . transparent teeth of all the three groups were observed under a stereomicroscope to detect and measure the remaining obturation material after retreatment ( 6.5 ) ; ( a ) sample from group i , the teeth appear clean with no remaining obturation material ; ( b ) sample from group ii , a large portion was seen containing the remaining obturation material ; and ( c ) sample from group iii , remaining fi lling material was seen at apical third the samples were retreated using h - files ( dentsply maillefer , switzerland ) . gutta - percha was removed from the root canals using h - files with sizes 25 , 30 , 35 , 40 , 45 , and 50 in a circumferential quarter - turn push - pull motion . the retreatment was deemed completed when no gutta - percha and sealer material could be seen on the instrument and also when the canal appeared clean when inspected with naked eyes . the samples in these groups were retreated with protaper universal retreatment files ( dentsply maillefer , switzerland ) . without engaging dentin , d1 was gently pressed into the obturation material . d1 was used to remove the obturation material from the coronal one - third of the root canal . after using d1 , the remaining obturation material from the apical one - third of the root canal was removed with d3 . in between the files were removed frequently for inspecting the flutes . continued as long as the obturation material was visualized between the cutting blades . the filling material was removed using gates - glidden drills from the coronal and middle third of the root canal and the apical third was cleaned using h - files . after retreatment was completed , the samples were observed under a dom at 5.1 magnification ( opmi proergo carl zeiss germany ) to detect residual obturation material . the photographs of all the samples were stored on a computer and later on evaluated for the remaining filling material using image analysis software ( image tool 3.00 uthsc san antonio ) . linear measurement of the remaining filling material was done in millimeters and scores were given to each sample for cleanliness of canal walls as follows . the teeth in all the groups were made transparent by robertson 's method : after observing the samples under a dom , the specimens were decalcified in 5% nitric acid for 72 h , then washed for 4 h and dehydrated in increasing concentrations of alcohol , i.e. 80% alcohol for 12 h , 90% alcohol for 1 h , and 99% alcohol for 3 h. the samples were then subsequently cleared by storing them in methyl salicylate . after clearing , the samples were observed under a stereomicroscope at 6.5 ( szx7 olympus america inc . ) and the images were subjected to image analysis software ( image tool 3.00 uthsc san antonio ) , for detection of residual obturation material [ figure 1 ] . the samples were scored for residual obturation material , and the criteria adopted for scoring was the same as the one followed when observed under a dom . apart from measuring the residual filling material linearly , the area of residual obturation material was also measured in mm . transparent teeth of all the three groups were observed under a stereomicroscope to detect and measure the remaining obturation material after retreatment ( 6.5 ) ; ( a ) sample from group i , the teeth appear clean with no remaining obturation material ; ( b ) sample from group ii , a large portion was seen containing the remaining obturation material ; and ( c ) sample from group iii , remaining fi lling material was seen at apical third the upper and lower confidence limit for the mean was calculated to show the significant difference between the scores obtained with a dom and a stereomicroscope . furthermore , the mean was calculated to show the significant difference among the three groups in scores given by a dom and a stereomicroscope and the areas measured in mm by a stereomicroscope . in addition , statistically significant differences were evaluated using the paired t - test . the confidence limits and paired t - tests were used to show statistically significant differences between the scores given by a dom and a stereomicroscope . spearman 's correlation coefficient was used to determine the correlation between the area of remaining obturation material measured in transparent roots and the scores obtained by the dom and the stereomicroscope . the mean score of residual filling material after observing the samples under a dom and then under a stereomicroscope is given in table 1 . the statistically significant difference was found between the mean scores of groups i and ii for a dom and a stereomicroscope ( p = 0.014 and p = 0.0045 , respectively ) . the difference between the mean scores of groups ii and iii for a dom and a stereomicroscope was also significant ( p = 0.016 and p = 0.0022 , respectively ) . mean residual obturation material score by a dental operating microscope and a stereomicroscope the mean area of residual obturation material after observing the three groups under a stereomicroscope was the highest in group ii ( 3.5820 mm ) and the lowest in group i ( 2.9520 mm ) [ table 2 ] . there was a low and nonsignificant correlation between the scores obtained by the dom and areas of residual filling material measured in transparent roots [ table 3 ] . in addition , there was a low and nonsignificant correlation between the scores obtained with the stereomicroscope and areas of residual filling material measured in the transparent root [ table 3 ] . the difference in the mean scores obtained with the dom and the stereomicroscope taking all the samples together was statistically significant ( p = 0.05 ) . therefore , the scores given by a stereomicroscope were significantly higher than the scores given by a operating microscope . no method of retreatment could completely clean the root canal walls , but the h - file was found to be more efficient than the other two methods for the root canal retreatment . the dom detected the residual obturating material left in the canal after completion of retreatment , but stereomicroscopic evaluation of the samples showed that dom underestimated the amount of residual material left inside the canal though the difference was found to be small . mean areas of residual obturation material measured by a stereomicroscope in transparent roots in the three groups correlation between scores ( using a dental operating microscope and a stereomicroscope ) and the areas of residual filling material measured in the transparent roots ( spearman 's correlation coefficient ) the retreatment can be accomplished by various instruments and techniques , i.e. , stainless steel hand files , heat , ultrasonic , laser , and rotary instruments with and without the aid of solvents . in many cases , the combined use of different techniques may be the most efficient and time saving method . the criteria for completion of retreatment may be no evidence of gutta - percha or sealer on the files or paper points and evaluation of post - treatment radiographs . however , a previous ex vivo study showed that radiographic examination provided an over optimistic impression of cleanliness compared with examination of vertically split roots . tooth clearing has been employed to obtain information on various aspects of endodontic treatment including morphology , canal instrumentation techniques , the influence of post - design and its influence on the root fracture , sealer placement techniques in curved canals , and quality of canal fillings . a similar method for detection of residual obturation material by the operating microscope was utilized in previous studies . it has been previously demonstrated that it is almost impossible to remove all traces of gutta - percha / sealer from the canal walls . h - files were found to be more effective in removing gutta - percha / sealer . h - files are better in adapting themselves to the root canal walls during hand instrumentation by a circumferential filling technique , thereby digging into the softened gutta - percha adhering to the root canal walls . the gates - glidden drills are effective removers of gutta - percha within coronal one - third and middle part of the root canal . there was statistical difference found in the cleanliness of canal walls as observed under dom in groups i and ii [ p = 0.014 ] . this was due to the fact that it proved to be difficult if not impossible to direct the niti instruments to a certain aspect of the root canal wall at least in the apical region . the use of rotary devices in endodontic retreatment should be followed by hand instrumentation to achieve optimal cleanliness . the stainless steel hand files remove filling material more effectively than niti rotary instruments . in this study , the roots were cleared to allow the measurement of the area of residual obturation material because remaining gutta - percha or sealer might get lost by splitting the roots longitudinally . comparing the scores obtained in each group by examining the samples under a dom and stereomicroscope , there was statistically significant difference between the scores obtained by the two methods of evaluating the re - treated roots ( p = 0.05 ) . even though the co - relation between the scores given after microscopic examination of the roots and the area measured in the transparent roots was low , the microscope with its increased illumination and magnification seemed to facilitate detection of remaining filling material that may harbor necrotic tissue or bacteria . therefore , it can be argued that dom is indispensable in the root canal retreatment especially in teeth with straight roots . from this study , it can be concluded that : it is not possible to remove gutta - percha / sealer from the root canal completely during retreatment.no single instrument is capable of removing gutta - percha completely from the root canals during retreatment . hand instruments produce better root canal cleanliness.visualization of the root canal under a dom during retreatment increases the ability of the operator to remove remaining obturation material . from this study , it can be concluded that : it is not possible to remove gutta - percha / sealer from the root canal completely during retreatment . no single instrument is capable of removing gutta - percha completely from the root canals during retreatment . visualization of the root canal under a dom during retreatment increases the ability of the operator to remove remaining obturation material .
aim : the study was designed to compare the efficiency of three different methods used for retreatment using a dental operating microscope ( dom ) and a stereomicroscope and to evaluate and compare the two methods for detection of residual obturation material after retreatment.background:the dom can play an important role in the successful retreatment by detecting the remaining obturation material.materials and methods : thirty extracted maxillary central incisors were collected and obturated after biomechanical preparation . the samples were divided into three groups depending on the method of retreatment : group i , h - files ; group ii , protaper universal retreatment files ; and group iii : h - files + gates - glidden drills , with 10 samples in each group . after retreatment , the samples were observed under a dom for detection of residual obturation material . later , the teeth were cleared and observed under a stereomicroscope for detecting the remaining filling material . the results were subjected to the spearman 's rank order test and other statistical analysis.results:the maximum cleanliness of the root canal walls was seen in group i while group ii showed the least . the difference between the mean scores obtained with a dom and a stereomicroscope was statistically significant ( p = 0.05).conclusion : none of the techniques could completely remove the obturation material . the root canal cleanliness is best achieved when retreatment is performed under a dom .
the patient was a 57-year - old man with a history of coming into contact with chemical gases during the war of 1981 . he was referred to the emergency room ( er ) with an acute abdomen and hemorrhage about 6 years ago . at that time , the diagnosis was acute renal failure and myeloma . the patient 's blood abnormality was treated very well in the hematology department and he went under dialysis . he did not come back to the hematology department for myeloma maintenance therapy until four months ago when he came to the er with hoarseness , tenderness in a hind limb , bone pains , movement limitation in the forelimbs with severe pain ( vas 6 ) in the left clavicle . his clavicular pain did not respond to radiotherapy and opioids . in the physical examination , there was a 5 7 cm mass in 1/3 of the internal part of the clavicle ( fig . 1 ) . there was no redness or edema and the mass was fixed to the bone and in pain on palpation . the patient 's blood test and coagulation test were normal ( platelet counts = 7,400 per microliter ) . in the plain radiography other than widespread lytic myeloma lesions especially in the shoulders and arms , there was a big lesion in the left clavicle which was also detected in the chest x - ray and chest ct scan ( fig . 2 ) . after iv sedation ( midazolam 1 mg and fentanyl 50 mg ) , sharp , 20 gauge , 100 mm , active tip 10 mm ) , 1.5 cm from each other were inserted into the mass . under the guide of the fluoroscopy , the needles were inserted into the middle part of the mass and during the pass , the needles were aspirated for any possibility of blood . and then , after passing the bone and feeling a sense of pop in the non - ionic water , 3 ml of soluble contrast media ( iodixanol 320 ) were injected and its distribution was seen directly and the contours of mass were clear . the patient informed us of any shooting pain in the upper extremity during the procedure . after placing the pads on the patient 's arm , the stylet was pulled out and the radiofrequency probe was inserted . then , two times a radiofrequency current at 90 was applied for 60 seconds at the two points 1 cm apart from each other . after that , 2 ml of 0.5% ropivacaine along with triamcinolone 40 mg were injected in each needle and then the needle and the probe were pulled out together ( fig . 3 - 5 ) . the procedure went very smoothly without any pain or need for more analgesic injection . in the recovery room there was no hematoma or sensory and motor deficits or any kind of radiating pain in the extremity . the visual analogue pain score ( vas from 0 to 10 ) decreased from 8 to 0 . in the next 3 months of follow - up , the patient was very satisfied with the procedure and there was no pain at the clavicular site and did not need any analgesic for it . he did not suffer from any pain at the clavicular site until he died after 3 months . our patient with painful myeloma of the clavicle responded very well to conventional radiofrequency and his pain was completely gone . the use of radiofrequency current at 90 for 60 seconds had very good result in managing painful myeloma of the clavicle . the pathophysiology of cancer pain is a local or systemic inflammatory response by producing pro - inflammatory cytokines that facilitates pain transmission . invasion of cancer cells to mechanically sensitive tissues ( e.g. visceral pain ) or the entrapment and injury of nerves ( e.g. neuropathic pain ) causes pain . tumors have immune system cells , which by releasing factors like endothelin , prostaglandin and tumor necrosis factor alpha ( tnf- ) , that cause the stimulation or sensitivity of afferent nerves . tumors also release some proteins which through acidosis cause local pain . nerve infiltration of sensitive bone marrow causes pain , osteolysis and fracture of abnormal bone structure . stimulation of the sensitive afferent nerves in the bone cortex and the surrounding tissues can also be a reason for pain [ 9 - 13 ] . its result is ion movement in the tissue producing heat and destroying the surrounding tissue and tumor . this severe heat destroys tumor cells , decreases cytokines and tumor factors involved in both nerve sensitization and osteoclast activity . in addition , stopping the tumor growth into the periosteum and surrounding tissue manages the pain and decreases microfractures . radiofrequency can be used in patients with moderate to severe pain ( 4 to 10 ) . the pain must be limited to one or two sites and confirmed by cross - sectional imaging . the lesion has to have an osteolytic or combined osteolytic and osteoblastic nature or be composed of soft tissue . dupuy reported on the use of radiofrequency in metastatic bone pain management which was confirmed by other studies . in addition , it is the gold standard treatment for osteoid osteomas . the success rate of radiofrequency in the liver , kidney , lungs and bone tumor ranges from 70 - 95% depending on the tumor location and nature . the radiofrequency probe is usually placed into the tumor with the help of ultrasonography , ct , mri or fluoroscopes . controlling the ablation procedure depends on the instrument . radiofrequency does not have major contraindication and can easily be repeated or mixed with other treatments . other benign conditions ( chondroblastoma , osteoblastoma , giant cell tumor , etc . ) can also be treated by this technique . today , we are witnessing an improvement in minimally invasive therapies like chemoablation , thermoablation , percutaneous grafting , acetabuloplasty and osteoblast skin grafts and vertebroplasty . microwave , radiofrequency , ultrasound or high frequency laser is used and ablation happens at over 60 so that tumor cells die . usually a radiofrequency below 30 mhz is used and most of the instruments are around 500 - 375 khz . ablation can occur through cryotherapy with necrosis occurring below 20 degrees . in a study by aono and coworkers , cooled rf radiofrequency was effective in managing intractable pain due to bone metastasis in 9 metastasis cancer patients ( metastasis to the femur , vertebrae column , pelvis , scapula and humerus ) with no possibility of surgery and in patients that did not respond to radiotherapy and opioid treatments . goetz and coworkers reported 43 patients with painful osteolytic bone metastasis who were treated with image - guided radiofrequency ablation using multiple needles . the primary pain score was 4 out of 10 and the patients did not respond to radiotherapy or opioids or were suitable candidates for these kinds of treatments . radiofrequency in the pain management of bone cancer is a cheap , effective method with few complications . conventional radiofrequency use in myeloma of the clavicle and its perfect response showed that conventional radiofrequency could be an effective method in managing painful osteolytic myeloma lesions . more use of this method in the future and gathering more information can introduce this method as a terminal method for managing painful bony metastatic lesions .
a 57-year - old male patient had myeloma . he had severe pain in the left clavicle that did not respond to radiotherapy ; therefore , it was treated with radiofrequency thermal ablation ( rfta ) . under fluoroscopic guidance , two rf needles at a distance of 1.5 cm from each other were inserted into the mass and conventional radiofrequency ( 90 and 60 seconds ) at two different depths ( 1 cm apart ) was applied . then , 2 ml of 0.5% ropivacaine along with triamcinolone 40 mg was injected in each needle . the visual analogue pain score ( vas from 0 to 10 ) was decreased from 8 to 0 . in the next 3 months of follow - up , the patient was very satisfied with the procedure and the mass gradually became smaller . there were no complications . this study shows that rfta could be a useful method for pain management in painful osteolytic myeloma lesions in the clavicle .
remove the scorpion from its home jar and place it in a pre - chilled glass container ; next , place the jar containing the scorpion into a freezing environment ( -5 c ) for a minimum of two minutes . this time may vary according to the age , size , species , etc . of the specific scorpion under study . after two minutes , remove the immobilized scorpion from the cold glass container , and place it ventral side up on a microscope slide . secure the stinger , tail , legs , and pedipalps with moldable clay ( oil - based , van aken plastalina ) . make a platform on which to put the scorpion 's pectines . adjust the platform 's length and width typically , our platforms are constructed out of microscope cover glass and are approximately 10(l ) x 18(w ) mm . adhere double - sided adhesive tape to the pecten platform , trimming the tape ( if necessary ) to fit . to make a pectinal chamber , put three of the platform 's four sides into pre - melted wax ( we use 100% beeswax chips ) to a depth of 3 - 4 mm . we melt the wax by placing the chips within a glass petri dish , located on a hot plate . once the wax on the edges of the pectinal chamber is cooled to room temperature , this should create walls of wax about 1 mm high . on the animal , locate the point of pectinal insertion , and place the un - waxed edge of the platform ( tape side - up ) just posterior to it . afterward , stabilize the platform ( so that it will not move later on ) by gently pressing its right and left peripheral edges against the clay used to restrain the animal 's legs . use fine - tipped forceps to carefully place the pecten or pectines inside the chamber . specifically , using forceps , hold the pecten along the pectinal spine , and gently bring the pecten out from underneath the cover glass and lower it onto the adhesive platform floor . establish a pecten - to - tape bond by carefully applying pressure to the pectinal spine . now apply melted wax ( we use a pre - heated metal spatula ) to the un - waxed edge of the platform . the purpose is two - fold , to secure the pecten and to fully enclose the chamber for future mineral oil introduction . use caution when applying the wax over the animal 's pecten , as it is possible to damage the pecten with wax that is too hot . next , establish an indifferent electrode connection with the animal 's hemolymph by inserting a silver wire between two tail segments . we prepare the animal 24 h prior to conducting extracellular , tip - recordings , which , among other reasons ( i.e. animal adjustment to fixed position ) , allows time to custom - make stimulant pipettes of a specific ( sensillum - dependent ) tip - diameter . we use a micropipette puller for achieving such specifications . ideally , the diameter of the pipettes is 2 m larger than the sensillar pore diameter . 1 h prior to recording , we add 5 l of mineral oil to the pectinal chamber , submerging the pecten under oil . then , we position the animal beneath a high - powered microscope , which has long working distance objectives and epi - illumination . to chemically stimulate peg sensilla , we introduce aqueous tastants ( i.e. citric acid and salt ) through the oil medium . first , we use a micropipette filler to inject the stimulant into the stimulant pipette . next , after positioning the stimulant pipette on a micromanipulator ( in the recording rig ) , insert the recording electrode into the blunt , open end of the stimulant pipette . once the preparation is electrically grounded ( via the indifferent electrode ) , simply lower the pipette through the oil medium and onto a sensillar pore . the duration of chemical stimulation per pectinal sensillum can vary from as much as thirty minutes to as little as one second . generally , we can sample multiple pegs ( > 30 ) per pipette . in the event that the stimulant pipette becomes clogged with minute debris , simply exchange the clogged pipette for a new , unused pipette . if the animal is to be used over an extended time period , we recommend reusing the pectinal chamber and replacing the drop of mineral oil for each recording session . after a given day 's recording session is complete , remove the animal from the recording set - up and perform a mineral oil wash . specifically , add another drop ( 5 l ) of mineral oil to the chamber , and remove all oil . this helps minimize the presence of residual stimulant , which may have leaked out of the pipette during the recording session . before the next session , depending on the recording equipment used ( e.g. the particular amplifier , digitizing hardware , etc . ) , a representative result is an extracellular recording with a s : n ratio of at least 3:1 . successful construction of the mineral oil chamber is necessary for isolating chemical stimulation to individual sensilla , as it provides a medium for delivering polar ( water - based ) chemical tastants . if there is too little oil or none at all , the stimulant solution will spread from the recorded sensillum to its neighboring sensilla , which is likely to cause a prolonged , uncontrolled bout of chemical stimulation . remove the scorpion from its home jar and place it in a pre - chilled glass container ; next , place the jar containing the scorpion into a freezing environment ( -5 c ) for a minimum of two minutes . this time may vary according to the age , size , species , etc . of the specific scorpion under study . after two minutes , remove the immobilized scorpion from the cold glass container , and place it ventral side up on a microscope slide . secure the stinger , tail , legs , and pedipalps with moldable clay ( oil - based , van aken plastalina ) . make a platform on which to put the scorpion 's pectines . adjust the platform 's length and width typically , our platforms are constructed out of microscope cover glass and are approximately 10(l ) x 18(w ) mm . adhere double - sided adhesive tape to the pecten platform , trimming the tape ( if necessary ) to fit . to make a pectinal chamber , put three of the platform 's four sides into pre - melted wax ( we use 100% beeswax chips ) to a depth of 3 - 4 mm . we melt the wax by placing the chips within a glass petri dish , located on a hot plate . once the wax on the edges of the pectinal chamber is cooled to room temperature , this should create walls of wax about 1 mm high . on the animal , locate the point of pectinal insertion , and place the un - waxed edge of the platform ( tape side - up ) just posterior to it . afterward , stabilize the platform ( so that it will not move later on ) by gently pressing its right and left peripheral edges against the clay used to restrain the animal 's legs . use fine - tipped forceps to carefully place the pecten or pectines inside the chamber . specifically , using forceps , hold the pecten along the pectinal spine , and gently bring the pecten out from underneath the cover glass and lower it onto the adhesive platform floor . establish a pecten - to - tape bond by carefully applying pressure to the pectinal spine . now apply melted wax ( we use a pre - heated metal spatula ) to the un - waxed edge of the platform . the purpose is two - fold , to secure the pecten and to fully enclose the chamber for future mineral oil introduction . use caution when applying the wax over the animal 's pecten , as it is possible to damage the pecten with wax that is too hot . next , establish an indifferent electrode connection with the animal 's hemolymph by inserting a silver wire between two tail segments . we prepare the animal 24 h prior to conducting extracellular , tip - recordings , which , among other reasons ( i.e. animal adjustment to fixed position ) , allows time to custom - make stimulant pipettes of a specific ( sensillum - dependent ) tip - diameter . we use a micropipette puller for achieving such specifications . ideally , the diameter of the pipettes is 2 m larger than the sensillar pore diameter . 1 h prior to recording , we add 5 l of mineral oil to the pectinal chamber , submerging the pecten under oil . then , we position the animal beneath a high - powered microscope , which has long working distance objectives and epi - illumination . to chemically stimulate peg sensilla , we introduce aqueous tastants ( i.e. citric acid and salt ) through the oil medium . first , we use a micropipette filler to inject the stimulant into the stimulant pipette . next , after positioning the stimulant pipette on a micromanipulator ( in the recording rig ) , insert the recording electrode into the blunt , open end of the stimulant pipette . it is important to ensure contact between the metal electrode and electrolytic stimulant solution . once the preparation is electrically grounded ( via the indifferent electrode ) , simply lower the pipette through the oil medium and onto a sensillar pore . the duration of chemical stimulation per pectinal sensillum can vary from as much as thirty minutes to as little as one second . generally , we can sample multiple pegs ( > 30 ) per pipette . in the event that the stimulant pipette becomes clogged with minute debris , simply exchange the clogged pipette for a new , unused pipette . if the animal is to be used over an extended time period , we recommend reusing the pectinal chamber and replacing the drop of mineral oil for each recording session . after a given day 's recording session is complete , remove the animal from the recording set - up and perform a mineral oil wash . specifically , add another drop ( 5 l ) of mineral oil to the chamber , and remove all oil . this helps minimize the presence of residual stimulant , which may have leaked out of the pipette during the recording session . before the next session , add one drop of oil as described previously . depending on the recording equipment used ( e.g. the particular amplifier , digitizing hardware , etc . ) , a representative result is an extracellular recording with a s : n ratio of at least 3:1 . successful construction of the mineral oil chamber is necessary for isolating chemical stimulation to individual sensilla , as it provides a medium for delivering polar ( water - based ) chemical tastants . if there is too little oil or none at all , the stimulant solution will spread from the recorded sensillum to its neighboring sensilla , which is likely to cause a prolonged , uncontrolled bout of chemical stimulation . the protocol above describes how to prepare a desert grassland scorpion ( paruroctonus utahensis ) for electrophysiological study . specifically , we show how to build a chamber for controlled extracellular tip - recordings of pectinal chemosensory neurons under oil . because oil and water do not mix , it is possible to isolate chemical stimulation ( with water - based stimulants ) to single sensilla . it should be stressed that p. utahensis , is a relatively small animal ( 2.5 - 5 cm ) and applying this protocol to larger animals may require many size adjustments , such as the size of the animal 's platform , chamber , and amount of oil applied . we recommend conducting pilot studies to test the minimum amount of oil necessary for controlled delivery of water - based chemical stimulants . furthermore , we found no effect of oil on the baseline neural activity within pectinal sensilla . this should be confirmed for other model systems as well , prior to assessing chemoresponsiveness . this method may be used in conjunction with another method to test for chemoresponse interaction effects among sensilla in the sensory field . for example , it is possible to tip - record ( under oil ) from one sensillum as we base - record ( via a tungsten electrode ) from a neighboring sensillum . such a recording configuration may be used to assess whether or not chemically stimulating one sensillum affects the neural activity of the base - recorded sensillum . to date , no one has tested this for scorpion pectinal sensilla , and it remains an open question for other chemosensory systems as well . to summarize , we think the tip - recording method under oil advances the scope of electrophysiological investigations into the neural basis of arthropod gustation . in this manuscript , we provide a protocol for preparing animals for this method , and we hope it provides a firm foundation for further study of peripheral sensory nervous systems . we have previously published these methods in two journals , knowlton and gaffin ( 2009 ) and knowlton and gaffin ( in press ) .
we describe a modification of an existing tip - recording technique1,2 for electrophysiologically investigating short , peg - like sensory sensilla3,4 . on the mid - ventral surface of all scorpions are two appendages called pectines , which have dense fields of mechano- and chemosensory peg sensilla5,6 . one method for assessing chemoresponsiveness of these sensilla uses a tungsten electrode for extracellularly recording neural activity within a sensillum as a volatile odorant is introduced to the sensory field5,7 . the limitations of this method include slow data collection and uncontrolled stimulant introduction to , and removal from , the peg field . to overcome these limitations , we developed a new tip - recording technique that uses nonpolar mineral oil as a medium through which to deliver water - based tastants to individual peg sensilla8,9 . we have successfully applied this method to obtain sensillar chemoresponses to citric acid , ethanol , and salt . here we describe the experimental protocol for such a study9 . we think this new method may be useful for studying the response properties of other arthropod chemosensory systems , including those of insects10 , 11 and crustaceans12 .
extracranial shunts are routinely used to divert cerebrospinal fluid ( csf ) into the extravascular compartment for the symptomatic relief from hydrocephalus . . though rarely used , today ventriculopleural shunt ( vpls ) is considered in patients who have failed vps or are unsuitable either due to adhesions , infection , thrombosis , or obliteration . studies have shown vpls to be effective alternative for draining csf both in children and adults . we report a case of a 6-year - old female child presenting with massive csf hydrothorax with respiratory failure following vpls . a 6-year - old child presented with progressively increasing breathing difficulty for 3 days , there was no fever , cough , or cold . she was being treated with oral antibiotics and salbutamol nebulization by a general practitioner for 3 days . on examination , the patient had tachypnea with severe respiratory distress , oxygen saturation was 70% which increased to around 90% with oxygen , and air entry was diminished on left side with dullness on percussion . the child was irritable due to hypoxia , but showed no signs of raised intracranial hypertension . the child was intubated due to hypoxemia and put on mechanical ventilator requiring high positive end - expiratory pressure up to 12 cm h2o and 100% oxygen initially for maintaining normal saturations . chest x - ray [ figure 1 ] showed massive left side pleural effusion with a shunt located on the same side , which was confirmed by ultrasonography . on further enquiry about the history , the child was found to be a patient of congenital aqueductal stenosis who underwent vps , which was later converted into vpls due to vps malfunction . intercostal drainage tube was inserted immediately , and 1 l of clear colorless fluid was drained slowly over the next 48 h. pleural fluid analysis showed the following results : cell count-2 ( 100% lymphocytes ) , protein-0.2 gm / dl , albumin-0.1 gm / dl , lactate dehydrogenase-70 u / l , and glucose-141 mg / dl . cytology , gram strain , and culture of fluid were negative proving transudative nature of the fluid . other causes for transudative effusion were excluded , as serum albumin , liver function , urine examination , and renal function were normal . the child improved following drainage , and repeat chest x - ray showed expanded lungs . neurosurgery consultation was taken , and imaging of brain was done which showed bilateral vps with collapse of occipital horns of bilateral lateral ventricle and crowding of posterior fossa structures suggestive of intracranial hypotension secondary to csf overshunting . the child was extubated successfully on the 2 day as ventilator requirements decreased and sensorium improved . vpls was later exteriorized at the distal end as external ventricular drainage and intercostal drain were clamped and removed . a new vps was inserted on the same side disconnecting the old one at previous incision site , and the old vpls was removed . the child was monitored for any complications post surgery for 3 days and was finally discharged on 3 postoperative day . chest x - ray showing massive left - sided hydrothorax with shunt end in pleural cavity in patients with hydrocephalus , csf can be shunted in any body cavity capable of absorbing csf ( peritoneum , pleura , and atrium ) . vpss are preferred over others due to the large absorption surface of the peritoneal lining , ease of insertion , and the low complication rate , but there are some instances where other modalities such as ventriculopleural or ventriculoatrial shunts have been preferred , especially in patients with active inflammation of peritoneum , adhesions due to past surgery , ascites , peritoneal dialysis , and failure of prior vps . in our case vplss are commonly associated with pleural effusion , but these are usually small and does not require any interventions and are treated conservatively . a small asymptomatic pleural effusion is typically visible on the chest x - ray , indicating that the vpls is in action , but does not imply that it is dysfunctional . the ability of pleural surfaces to absorb any accumulated fluid within the pleural cavity partially determines the occurrence and the degree of pleural fluid accumulation . large hydrothorax due to excess csf accumulation in the pleural cavity has been reported although rarely . two hypotheses can explain the hydrothorax complicating the vpls : ( a ) impaired pleural absorptive capacity , due to pleural damage secondary to prior infection and/or chronic exposure to csf and ( b ) excessive drainage of csf into the pleural space . shunt over drainage is seen in 1012% of patients with vps and may manifest as slit ventricle syndrome , intracranial hypotension syndrome , subdural fluid collections , craniosynostosis , ventricular compartmentalization , and cerebellar tonsillar herniation . the symptoms of over drainage can be very similar to those of underdrainage , though there are important differences . headaches , dizziness , and fainting occur and are often worse after getting up from lying down , whereas the headaches caused by high csf pressure are often worse on waking , before rising in the morning . intracranial hypotension syndrome is usually a late complication reported 517 years after the shunt placement and commonly affects adolescents and older patients and presents with triad of postural headache , diffuse pachymeningeal gadolinium enhancement , and low csf opening pressure . we hypothesized that our patient might have vpls malfunction leading to csf over drainage as suggested by the magnetic resonance imaging brain although our patient did not show any signs of intracranial hypotension or it may be a consequence of decreased pleural absorptive surface , which lead to gradual accumulation of csf . rapid drainage of hydrothorax could also lead to sudden drop of csf pressure in brain and cause intracranial hypotension syndrome , but this complication was avoided by slow drainage of csf , in our patient , over 48 h and later vpls was exteriorized at significant height to avoid intracranial hypotension . in our case , there was a delay in diagnosis by the practitioner , which led to slow accumulation of csf in pleural space leading to severe life - threatening massive hydrothorax . diagnosis at our center was also delayed initially due to lack of proper history and also as the initial emphasis was on the management of severe life - threatening episode and chest x - ray could only be done after intubation , which was inevitable at the situation . the child was later successfully treated with drainage of csf and later conversion of vpls to vps . the message conveyed by this case report was to emphasize getting early chest x - ray with the first sign of respiratory distress in these patients with vpls to avoid such severe life - threatening episodes as a complication of shunt malfunction .
cerebrospinal fluid ( csf ) diversion procedure has been used for long to treat hydrocephalus in children . the principle of shunting is to establish a communication between the csf and a drainage cavity ( peritoneum , right atrium , and pleura ) . ventriculoperitoneal shunt is used most commonly , followed secondly by ventriculopleural shunt ( vpls ) . hydrothorax due to excessive csf accumulation is a rare complication following both the type of shunts and is more frequently seen with vpls . we report a case of a 6-year - old female child presenting with massive csf hydrothorax with respiratory failure following vpls . the aim of the article is to highlight early recognition of this rare and life - threatening condition , which could easily be missed if proper history is not available .
proteases constitute the most important group of industrial enzymes used in the world today , accounting for approximately 50% of the total industrial enzyme market . they have diverse applications in a wide variety of industries such as detergent , food , pharmaceutical , leather , peptide synthesis , and for the recovery of silver from used x - ray films [ 2 , 3 ] . fish viscera , one of the most important by - products of fishing industry , is known to be a rich source of digestive enzymes , especially proteases that have high activity over a wide range of ph and temperature conditions [ 46 ] and exhibit high catalytic activity at relatively low concentration . these characteristics of fish proteases have made them suitable for some interesting new applications in food - processing operations . in addition , fish enzymes could be utilized to produce bioactive peptides from fish proteins [ 8 , 9 ] . considering the specific characteristics of these enzymes , fish processing by - products are currently used for enzyme extraction . the most important digestive proteolytic enzymes from fish and aquatic invertebrates viscera are the aspartic protease pepsin secreted from gastric mucosa , and the serine proteases , trypsin , and chymotrypsin secreted from the pancreas , pyloric caeca , and intestine . acidic proteases from fish stomachs display high activity between ph 2.0 and 4.0 , while alkaline digestive proteases , such as trypsin , are most active between ph 8.0 and 10.0 . digestive enzymes of several species of fish have been isolated from the internal organs including gastric , intestinal , and hepatopancreas [ 5 , 9 , 1113 ] . chitin , a homopolymer of n - acetyl - d - glucosamine residues linked by -1,4 bonds , is the most abundant renewable natural resource after cellulose . chitin and its derivatives are biomolecules of a great potential , possessing versatile biological activities , demonstrating excellent biocompatibility and complete biodegradability . therefore , they have found extensive applications in pharmacy , medicine , agriculture , food and textile industries , cosmetics , and wastewater treatment [ 1517 ] . the main sources of raw material for the production of chitin are cuticles of various crustaceans , principally crabs and shrimps . chitin in biomass is closely associated with proteins , inorganic compounds ( such as calcium carbonate ) , lipids , and pigments . they all have to be quantitatively removed to achieve the high purity of chitins necessary for biological applications . conventionally , to extract chitin from crustacean shells , chemicals processing for demineralization and deproteinization have been applied . raw materials were first treated with dilute hydrochloric acid at room temperature to remove metal salts , particularly calcium carbonate , and then with strong bases to remove proteins . however , the use of these chemicals may cause a partial deacetylation of the chitin and hydrolysis of the polymer , resulting in final inconsistent physiological properties . an alternative approach to these harsh chemical treatments is the use of proteolytic microorganisms [ 2023 ] or proteolytic enzymes . bustos and healy demonstrated that chitin obtained by the deproteinization of shrimp shell waste with various proteolytic microorganism had higher molecular weights compared to chemically prepared shellfish chitin . in the present paper , we describe the extraction and characterization of alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa which are suitable in the chitin production process . casein sodium salt from bovine milk , trichloroacetic acid ( tca ) , ethylene diamine tetraacetic acid ( edta ) , and bovine serum albumin were purchased from sigma company co. ( st louis , mo , usa ) . hydrochloric acid and tris(hydroxymethyl)aminomethane were procured from panreac quimica sa ( barcelone , spain ) . sodium dodecyl sulphate ( sds ) , acrylamide , ammonium persulphate , n , n , n , n - tetramethyl ethylenediamine ( temed ) , and coomassie brilliant blue r-250 were from bio - rad laboratories ( mexico city , mexico ) . goby ( z. ophiocephalus ) , thornback ray ( r. clavata ) , and scorpionfish ( s. scrofa ) were purchased from the fish market of sfax city , tunisia . the samples were packed in polyethylene bags , placed in ice with a sample / ice ratio of approximately 1 : 3 ( w / w ) and transported to the research laboratory within 30 minutes . after the fish were washed with water , their viscera were separated , rinsed with cold distilled water , and then stored in sealed plastic bags at 20c until they were used for enzyme extraction . viscera ( 20 g ) were separated and rinsed with distilled water , and then homogenized for 5 minutes with 20 ml of extraction buffer ( 10 mm tris - hcl , ph 8.0 ) with the use of tissue homogenizer . the resulting preparations were centrifuged at 8500 g for 30 minutes at 4c . the pellets were discarded and the supernatants were collected and then frozen at 20c and used as crude protease extracts . sodium dodecyl sulphate - polyacrylamide gel electrophoresis ( sds - page ) was carried out as described by laemmli , using 5% ( w / v ) stacking and 15% ( w / v ) separating gels . samples were prepared by mixing the crude enzyme extracts at 1 : 5 ( v / v ) ratio with distilled water containing 10 mm tris - hcl ph 8.0 , 2.5% sds , 10% glycerol , 5% -mercaptoethanol , and 0.002% bromophenol blue . after electrophoresis , the gel was stained with 0.25% coomassie brilliant blue r-250 in 45% ethanol-10% acetic acid and destained with 5% ethanol-7.5% acetic acid . protease activity staining was performed on sds - page according to the method of garcia - carreno et al . with a slight modification . after electrophoresis , the gel was submerged in buffer a ( 100 mm of tris - hcl buffer ( ph 9.0 ) ) containing 2.5% triton x-100 , with shaking for 1 hour to remove sds and allow enzyme renaturation . triton x-100 was removed by washing the gel three times with buffer a. the gel was then immersed in 100 ml of 1% ( w / v ) casein in buffer a for 5 minutes at 4c , then further incubated for 10 minutes at 50c to allow for the digestion of the protein substrate ( casein ) by the active enzymes . finally , the gel was stained with 0.25% coomassie brilliant blue r-250 in 45% ethanol-10% acetic acid and destained with 5% ethanol-7.5% acetic acid . the development of clear bands on the blue background of the gel indicated the presence of protease activity . protease activity in the crude alkaline enzyme extracts was measured by the method described by kembhavi et al . using casein as a substrate . a 0.5-ml aliquot of the crude enzyme extract , suitably diluted , was mixed with 0.5 ml of 100 mm tris - hcl ( ph 8.0 ) containing 1% ( w / v ) casein , and incubated for 15 minutes at 50c . the reaction was stopped by the addition of 0.5 ml of tca 20% ( w / v ) . the mixture was allowed to stand at room temperature for 15 minutes and then centrifuged at 10.000 g for 15 minutes to remove the precipitate . one unit of protease activity was defined as the amount of enzyme required to liberate 1 g of tyrosine per minute under the experimental conditions used . the optimum ph of the crude protease extracts was studied over a ph range of 5.013.0 , using casein as a substrate at 50c . for the measurement of ph stability , the crude enzyme extracts were incubated for 1 hour at 4c in different buffers and then the residual proteolytic activities were determined under standard assay conditions . the following buffer systems were used : 100 mm sodium acetate buffer for ph 5.0 - 6.0 , tris - hcl buffer for ph 7.0 - 8.0 , glycine - naoh buffer for ph 9.011.0 , na2hpo4-naoh buffer for ph 12.0 , and kcl buffer for ph 13.0 . to investigate the effect of temperature , the activity was tested using casein as a substrate at the temperature range from 30 to 80c in 100 mm tris - hcl buffer , ph 8.0 for z. ophiocephalus and r. clavata proteases , and ph 10.0 for s. scrofa crude alkaline proteases . thermal stability was - examined by incubating crude enzyme extracts for 60-minutes at different temperatures from 30 to 70c . aliquots were withdrawn at desired time intervals to test the remaining activity at standard conditions . the influence of various metals ions , at a concentration of 5 mm , on enzyme activity was investigated by adding the monovalent ( na or k ) or divalent ( mg , hg , ca , zn , cu , co , ba , or mn ) metal ions to the reaction mixture . the activity of the crude enzyme extracts without any metallic ion was considered as 100% . the effect of nacl concentrations on the activity of the alkaline crude protease extracts was studied , using casein as a substrate , by increasing nacl concentrations in the reaction mixture . the effects of some surfactants ( triton x-100 , tween 80 , and sds ) and oxidizing agents ( sodium perborate ) on alkaline crude proteases stability were studied by preincubating enzymes for 1 hour at 30c . briefly , shrimp waste , collected from the marine food processing industry , was washed thoroughly with tap water and then cooked 20 minutes at 90c . the solid material obtained was dried , minced to obtain a fine powder , and then stored in glass bottles at room temperature . the chemical composition ( proteins , chitin , lipids , and ash ) was determined . the moisture and ash content were determined according to the aoac standard methods 930.15 and 942.05 , respectively , . shrimp shell wastes ( 15 g ) were mixed with 100 mm tris - hcl buffer ph 8.0 at a ratio of 1 : 3 ( w / v ) , minced and then cooked for 20 minutes at 90c to inactivate endogenous enzymes . the ph of the mixture was adjusted to 8.0 , and then the shrimp waste proteins were digested with proteolytic enzymes at 45c using en enzyme / substrate ratio of 10/1 ( unit of enzyme / mg of protein ) . after 3-hour incubation at 45c , the reaction was stopped by heating the solution at 90c during 20 minutes to inactivate enzymes . the shrimp waste protein hydrolysates were then centrifuged at 5000 g for 20 minutes to separate insoluble and soluble fractions . the solid phase was washed , pressed manually through four layers of gauze , and then dried for 1 hour at 60c . the press cake was packed in a plastic bag and stored at 20c until further processing . deproteinization percentage ( % dp ) was calculated by the following equation as described by rao et al . : ( 1)%dp=[(poo)(prr)]100poo , where po and pr are protein concentrations ( % ) before and after hydrolysis ; while o and r represent the mass ( grams ) of original sample and hydrolyzed residue in dry weight basis , respectively . all experiments were carried out in triplicate , and average values with standard deviation errors are reported . mean separation and significance were analyzed using the spss software package ( spss , chicago , ill ) . in order to estimate the number of proteases in the alkaline crude enzyme extracts , samples were separated by sds - page , and then proteolytic activities were revealed by casein zymography activity staining . casein zymography is a very sensitive and rapid assay method that detects nanogram of proteins , in contrast with sds - page which detects micrograms . as can be observed in figure 1 , all crude enzyme extracts showed several clear bands of protease activity with different molecular weights , indicating the presence of several different proteases . it seems that goby crude enzyme extract contained more proteolytic enzymes than the other ones as illustrated in figure 1 by the presence of at least five clear bands of proteolytic activity . when comparing the different profiles , it can be observed the presence of at least one protease common with all crude proteases . the activity of proteolytic enzymes was determined at different ph values from 5.0 to 13.0 . the ph activity profiles of the crude alkaline proteases are shown in figure 2(a ) . the relative activities at ph 7.0 and 10.0 were 55.6% and 81.3% , respectively , of that at ph 9.0 . however , protease activity decreased significantly above ph 10.0 . at ph 11.0 , the activity was approximately 5-fold lower than that at ph 9.0 . the relative activity at ph 9.0 was about 94% . however , an appreciable decrease in activity was observed above ph 9.0 . with s. scrofa crude enzyme extract , the enzyme preparation was highly active between ph 8.0 and 11.0 , with an optimum at ph 10.0 . the relative activities at ph 9.0 , 11.0 , and 12.0 were about 94% , 69% , and 39% , respectively , of that at ph 10.0 . the optimum ph for s. scrofa proteases was similar to those reported by esposito et al . for proteases extracted from the viscera of colossoma macropomum and el hadj - ali et al . for proteases extracted from striped seabream ( lithognathus mormyrus ) . the ph stability profiles of the three crude alkaline proteases are reported in figure 2(b ) . interestingly , the three crude enzyme extracts are highly stable over a wide broad ph range , maintaining about 100% of their original activity between ph 5.0 and 10.0 after 1 hour of incubation at 4c . our results showed that goby proteases present a high ph stability compared to the others crude enzyme extracts . the enzyme preparation from scorpionfish , which is highly active in the alkaline ph range , was also stable over a wide ph range . these results suggest that the viscera of scorpionfish would be a potential source of alkaline proteases for certain industrial applications that require high alkaline conditions , such as detergents . in fact , one of the most important parameters for selection proteases for detergents is the optimum ph . since the ph of laundry detergents is commonly alkaline ( in the range of 9.012.0 ) , protease and other enzymes currently used in detergent formulations should be alkaline in nature with a high optimum ph . optima temperatures for activity of crude alkaline proteases were determined in order to assess their suitability for biotechnological applications . the relative activities at various temperatures using casein as a substrate are reported in figure 3 . the optimum temperature for s. scrofa proteases was 55c , however , alkaline proteases from goby and thornback ray displayed maximum activity at 50c . the relative activities of goby proteases at 40 and 60c were 54% and 70% , respectively . however , an appreciable decrease in enzyme activity was observed above 65c , due to thermal denaturation . thornback ray proteases were more active at 60c than the other crude proteases , retaining 90% of their activity after 1-hour incubation . however , the relative activities of z. ophiocephalus and r. clavata crude proteases were 70% and 45% , respectively . thermal stability of crude alkaline proteases is depicted in figure 4 . enzyme preparations from goby and scorpionfish are highly active at temperatures below 40c , while that of thornback ray were stable at 30c . goby crude enzyme remains fully active even after 60 minutes of incubation at 40c , indicating that this crude enzyme might be used under mild heating conditions . the enzyme preparations from z. ophiocephalus and s. scrofa retained about 24% and 45% of their initial activity after 60 minutes of incubation at 50c , respectively . however , the proteolytic enzymes from r. clavata were completely inactivated in the same conditions . the effects of various metal ions , at a concentration of 5 mm , on the activity of the crude alkaline proteases were studied at optimum conditions for each crude enzyme by the addition of the respective cations to the reaction mixture ( table 1 ) . the addition of cacl2 and mgso4 increased the activity of crude protease extracts of goby and scorpionfish . ca increased the activity of crude proteases from goby and scorpionfish to 110% and 129% , respectively . these results indicated that ca was very effective in improving the activity of the crude proteases . the enhancement of protease activity in the presence of calcium may be explained by the strength of interactions inside protein molecules and the better stabilization of enzymes against thermal stabilization . the ions ba affect partially the protease activity with a relative activity between 87% and 96% . however , fe and hg affect greatly the activity of all crude enzymes . the presence of 5 mm nacl and kcl did not affect protease activity . in addition to activity and stability at high ph range and various temperatures , enzymes incorporated into detergent formulations must be compatible and stable with all commonly used detergent components such as surfactants , perfumes , oxidizing agents , and other additives which might be present in the formulation . furthermore , detergent enzymes should be stable during storage and active during washing in the detergent solution for a long period of time . the suitability of crude alkaline proteases as detergent additive was investigated by testing their stability in the presence of some surfactants and oxidizing agents . as shown in table 2 , crude protease extracts were highly stable in the presence of non - ionic surfactants such as tween 20 , tween 80 , and triton x-100 . for example , the activities of scorptionfish after incubation for 1 hour at 40c were 107% , 109% , and 107% in the presence of 5% triton x-100 , tween 20 , and tween 80 , respectively . however , the strong anionic surfactant ( sds ) at 1% caused 100% inhibition proteolytic activity of r. clavata proteases . in addition , we investigated the effects of oxidizing agents on the crude protease extract . thornback ray and goby proteases were little influenced by oxidizing agents , retaining about 70% and 66% of their initial activity after incubation for 1 hour at 30c in the presence of 1% ( w / v ) sodium perborate , respectively . interestingly , the crude enzyme of scorpionfish remains fully active after 1 hour incubation at 40c . the stability of scorpionfish enzyme extract against sodium perborate was higher than a21 protease from bacillus mojavensis which retained 35% of its initial activity in the presence of 1% oxidizing agent after incubation for 1 hour at 30c . the high stability of scorpionfish enzyme extract in the presence of oxidizing agents is a very important characteristic for its eventual use in detergent formulations . important commercial detergent proteases like subtilisin carlsberg , subtilisin bpn , alcalase , esparase , and savirase are stable in the presence of various detergent components . however , most of them are unstable in the presence of oxidant agents , such as hydrogen peroxide . the effect of nacl concentration on the activity of crude alkaline proteases is shown in figure 5 . the relative activities of goby , scorpionfish , and thornback ray at 10% nacl were approximately 53% , 37% , and 14% , respectively . the results showed that goby proteases exhibited a high activity in the presence of nacl compared to the other crude enzymes . the decrease in activity might be due to denaturation of enzymes caused by the salting out chitin , a polysaccharide found in abundance in the shell of crustaceans , is closely associated with proteins . chemical treatment requires the use of hcl and naoh , which can cause deacetylation and depolymerization of chitin . few studies on the use of proteolytic enzymes for the deproteinization of shrimp wastes have been reported . to the best of our knowledge , there are no available reports on the enzymatic deproteinization of shrimp wastes by fish proteases . many factors , such as the specificity of the enzyme used for the proteolysis , e / s ratio and the conditions used during hydrolysis ( initial temperature value and hydrolysis time ) have been reported to influence the enzymatic deproteinization process . in the present study , alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa were applied for the deproteinization of shrimp waste to produce chitin and protein hydrolysates using an e / s ratio of 10 u / mg . as depicted in figure 6 , all fish extracts were efficient in shrimp waste deproteinization , and s. scrofa crude extract was the most efficient with a deproteinization percentage of 80% . the deproteinization activity of crude proteases used in this study was similar to many bacterial proteases reported in many previous studies [ 20 , 25 ] . in the present study , alkaline proteases were extracted from the viscera of z. ophiocephalus , r. clavata and s. scrofa and characterized , and their efficiencies in deproteinization of shrimp waste to produce chitin were investigated . crude alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa showed optimum activity at ph 8.0 - 9.0 , 50c ; ph 8.0 , 55c , and ph 10.0 , 55c , respectively . the alkaline crude proteases were found to be effective in the deproteinization of shrimp waste powder . the protein removals with a ratio e / s of 10 were more than 76% . considering their promising properties , crude protease extracts used in this study may find potential applications in the deproteinization of shrimp waste to produce chitin and chitosan . further research is needed to purify alkaline proteases , and to determine their properties as a possible biotechnological tool in the fish processing and food industries .
the aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby ( zosterisessor ophiocephalus ) , thornback ray ( raja clavata ) , and scorpionfish ( scorpaena scrofa ) , and to investigate their applications in the deproteinization of shrimp wastes . at least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation . the optimum ph for enzymatic extracts activities of z. ophiocephalus , r. clavata , and s. scrofa were 8.0 - 9.0 , 8.0 , and 10.0 , respectively . interestingly , all the enzyme preparations were highly stable over a wide range of ph from 6.0 to 11.0 . the optimum temperatures for enzyme activity were 50c for z. ophiocephalus and r. clavata and 55c for s. scrofa crude alkaline proteases . proteolytic enzymes showed high stability towards non - ionic surfactants ( 5% tween 20 , tween 80 , and triton x-100 ) . in addition , crude proteases of s. scrofa , r. clavata , and z. ophiocephalus were found to be highly stable towards oxidizing agents , retaining 100% , 70% , and 66% , respectively , of their initial activity after incubation for 1 h in the presence of 1% sodium perborate . they were , however , highly affected by the anionic surfactant sds . the crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin . all proteases were found to be effective in the deproteinization of shrimp waste . the protein removals after 3 h of hydrolysis at 45c with an enzyme / substrate ratio ( e / s ) of 10 were about 76% , 76% , and 80% , for z. ophiocephalus , r. clavata , and s. scrofa crude proteases , respectively . these results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process .
epidemiologic data were obtained from a nationwide survey of 269 villages conducted from august through september 2005 . the country was divided into 4 ecologic zones on the basis of differences in elevation , temperature , and land cover type ( figure , panel a ) . the number of villages selected in each zone was proportional to the population in each zone . these data were combined with data from an additional 64 villages in known areas of malaria endemicity that were surveyed during 20002003 , to give data from a total of 333 villages . comparability was ensured by using the same sampling and parasitologic methods in each set of surveys . in each village , households were sampled along perpendicular transects . the survey team started from a central point and randomly selected the direction by spinning a bottle . along the transect , every household was selected and every household member invited to participate . a blood sample was collected from each person , and giemsa - stained thick and thin blood films were prepared and stored for microscopic examination for the presence of malaria parasites . a case - patient was defined as a person for whom malaria blood stage parasites were seen after examination of 100 fields . a ) prevalence of plasmodium vivax in afghanistan , according to a 2005 survey ( n = 269 ) and previous prevalence surveys conducted by healthnet - tpo , 20002003 ( n = 64 ) . lower - right inset shows ecologic zones in afghanistan according to differences in elevation , temperature , and land cover . white , high altitude rangeland ; light gray , desert ; dark gray , grassland ; black , irrigated / marshland . b ) predicted probability of p. vivax transmission ( prevalence > 0% ) in afghanistan , according to logistic regression model . the geographic locations of villages were recorded in the field by using a nondifferential global positioning system ( garmin international inc . , the village - level prevalence data were then included into the geographic information system ( gis ) ( arcview , version 3.2 , esri inc . , redlands , ca , usa ) . global satellite sensor - derived data at 88 km spatial resolution were obtained from the united states geological survey , distributed active archive center ( http://edcdaac.usgs.gov/1km/comp10d.asp ) and included the normalized difference vegetation index ( ndvi ) and land surface temperature . ndvi is an indicator of photosynthetic activity and is associated with saturation deficit and rainfall . the locations of rivers were downloaded from afghanistan information management system project 's website ( http://www.aims.org.af ) , and minimum distance between each village and rivers was calculated by using arcview . these environmental data were imported into arcview and linked by location to the parasitologic data . we used logistic regression analysis to investigate the relationship between environmental variables and the probability of transmission ( p. vivax prevalence > 0% ) . initial variables were selected by developing univariate models ; variables with wald p>0.2 were excluded from further analysis . colinearity was investigated between all possible pairs of potential predictor variables ; if any pair had a correlation coefficient > 0.9 , the member of the pair that was less likely to be biologically important was excluded . with the remaining variables , backward - stepwise logistic regression analysis was conducted by using wald p>0.1 as the exit criterion and p<0.05 as the entry criterion . entry of categorized predictor variables into the models was explored , but preliminary analysis indicated that linear forms were most significant . the final model was then cross - validated by using a jackknife procedure ( 5 ) . predicted occurrence was compared with observed occurrence by using receiver operating characteristic analysis . the statistic used for the comparison was the area under the curve , a plot of sensitivity versus 1 minus specificity ( 6 ) . the coefficients from the best - fit model were then applied to the predictor variables to generate a map of predicted probability of transmission . a total of 40,350 persons in 269 villages , ranging in age from 1 through 98 years , were examined . the overall prevalence of p. vivax was 0.49% , but infection levels varied considerably among areas of the country ( figure , panel a ) . prevalence of p. vivax was highest in faryab province in the north and in nangarhar and kunar provinces in the southeast part of the country . small foci of p. vivax were found in baghlan and badakhshan in the northeast and kandahar and hilmand in the south . no transmission occurred in villages at elevations > 2,000 m , likely because of variation in temperature . prevalence was highest in river valleys , and no transmission occurred in villages > 10 km from rivers . the odds ratios indicate that transmission probability was much higher in locations adjacent to perennial rivers . validation of the model using an observed prevalence threshold of > 0% gave an area under the curve of 0.67 ( 95% confidence interval 0.610.74 ) , which indicates a moderately good predictive performance of the model . the map of predicted probability of transmission is presented in the figure , panel b. * wald , 14.26 ; probability> , 0.0008 ; log pseudo - likelihood , 184.38873 ; pseudo r , 0.062 . spatial epidemiology aims to investigate spatial distributions of disease to identify geographic risk factors and populations at risk , which facilitates the rational implementation of control . although p. vivax malaria is a serious problem in afghanistan , only certain areas of the country are affected . our analysis shows that this distribution is determined by climatic and other geographic factors , which affect mosquito and plasmodium reproduction . the use of gis and remote sensing has enabled the first detailed description of the spatial variation of p. vivax malaria in afghanistan and will facilitate implementation of a rational strategy by allowing differential , stratified control mechanisms to be used and resource allocation to be managed more efficiently . afghanistan 's malaria control strategy consists mainly of social marketing of insecticide - treated nets , coupled with support for healthcare providers in the delivery of effective diagnosis and treatment . the national malaria strategic plan ( 2005 ) , which adopted the millennium development goals for malaria , calls for targeted interventions aimed at reducing the prevalence and effects of disease in those areas most at risk . our results demonstrate that gis and remote sensing are important tools for rapid mapping of disease patterns and for targeting limited control resources . further work is ongoing to determine areas at risk for p. falciparum transmission , the less prevalent but more dangerous parasite , and to devise a combined risk map .
plasmodium vivax is endemic to many areas of afghanistan . geographic analysis helped highlight areas of malaria risk and clarified ecologic risk factors for transmission . remote sensing enabled development of a risk map , thereby providing a valuable tool to help guide malaria control strategies .
angioedema manifests as episodes of localized swelling in the dermis , subcutaneous tissue , mucosa and/or submucosal tissues . when angioedema affects the airway , it is a potential cause of complete airway obstruction which could have fatal consequences if left untreated . etiologies of this condition include ; idiopathic , genetic , allergic , toxic or drugs . common drugs associated with angioedema : non - steroidal anti - inflammatory drugs including aspirin , angiotensin converting enzyme ( ace ) inhibitors and angiotensin receptor antagonists ( arbs ) . the challenge of this condition is whether to observe the patient or immediately secure the airway , either by intubation or surgical airway . airway edema may become so severe and extensive that tracheotomy may not be successful in providing a patent airway . until recently , fiberoptic intubation of a spontaneously breathing patient was regarded as the gold standard for anticipated difficult airway . however , within the last decade , the use of new videolaryngoscopic devices ( glidescope , the pentax aws , truview evo2 ) has increased . these devices have been observed to provide a viable alternative for management of difficult airway . to date , there has been no published data regarding the comparison of fiberoptic bronchoscope versus the videolaryngoscopic devices in the setting of angioedema . in this study we retrospectively evaluated successful tracheal intubations using the fiberoptic bronchoscopy versus alternative methods such as vl , intubating lma , and standard direct laryngoscopy . the focus of the study was to determine whether or not fiberoptic bronchoscopy was superior to videolaryngoscopy and other alternative intubating techniques . a retrospective chart review was conducted over a three year period ( 2008 - 2010 ) at our institution . this study was approved by the governing institutional review board protocol receipt number 1009008817 . as this was a retrospective study , informed consent could not be obtained , but data was suitably anonymised according to irb recommendations . all investigators in this study read and followed the guidelines found in the declaration of helsinki . potential charts were identified by a computerized search of the hospital 's records ( surginet , cerner corporation , kansas city , mo ) with the search terms being emergency intubation and/or emergency tracheostomy . all tracheal intubations were performed by attending anesthesiologist in the operating room with a trauma surgeon on standby for possible tracheostomy . the glidescope device had been used by all ten of them one year prior ( 2007 - 2008 ) to the time period reviewed . patient charts were analyzed to determine the cause of the angioedema , patient 's age , presenting symptoms , location of edema , and duration of intubation . also , recorded was the device used for intubation , the proportion of successful first intubation attempts , failures of any other device , progression to a surgical airway , and complications of the intubation . the outcome of each intubation effort was evaluated , comparing the number of attempts to secure the airway and length of time taken for intubation . in this study , duration of intubation time was defined as the period of time beginning from administration of intravenous medications until an appropriate end - tidal co2 capnograph trace was recorded . inclusion criteria included patients aged 18 - 80 , and a diagnosis of angioedema that compromised the airway and required intubation as determined by the anesthesiologist . all patients in this study received corticosteroids , h-1 and h-2 blockers in the emergency department prior to airway management . the anatomical site and symptoms of each angioedema case were recorded in table 1 . the decision to proceed with intubation was based on angioedema resulting in one or more of the following : stridor , shortness of breath , difficulty controlling secretions , hypoxia ( o2 saturation below 90% ) , and hypercapnia ( paco2>45 mmhg on abg ) . other difficult airways that did not meet the clinical criteria for the diagnosis of angioedema were excluded . electronic data handling included each patient being assigned a three digit number kept on a secured master list . all gathered information was stored in accordance with hippa guidelines for the protection of any confidential patient information . angioedema presenting site and symptoms in each patient group comparisons between the 3 study groups used a parametric analysis of variance ( anova ) procedure to examine mean differences between study groups on the continuously scaled variables of number of attempts to secure airway and duration of intubation time . categorical data ( occurrence of successful first intubation attempt ) was measured using a chi - squared test . as the data for groups for duration of intubation showed a non - normal distribution , a kruskal - wallis anova significant differences between the groups for duration of intubation were measured with pair - wise mann - whitney tests . comparisons between the 3 study groups used a parametric analysis of variance ( anova ) procedure to examine mean differences between study groups on the continuously scaled variables of number of attempts to secure airway and duration of intubation time . categorical data ( occurrence of successful first intubation attempt ) was measured using a chi - squared test . as the data for groups for duration of intubation showed a non - normal distribution , a kruskal - wallis anova was used to examine differences between the means . significant differences between the groups for duration of intubation were measured with pair - wise mann - whitney tests . fifty - eight patients were identified as potentially eligible for the study with the inclusion process outlined in figure 1 . from these patients 43 were given a diagnosis of angioedema . ten of these 43 patients were excluded from the study ; 8 based on age criteria and the other 2 patients were diagnosed with angioedema but were excluded as no airway intervention was required . the remaining 33 patients were then divided into three groups based on the primary device used to secure the airway ; ( 1 ) fiberoptic bronchoscopy ( fob ; n=12 ) , ( 2 ) videolaryngoscopy ( vl ; n=11 ) and ( 3 ) miscellaneous ( n=10 ) . of the ten patients in the miscellaneous group , six patients had their trachea intubated via direct laryngoscopy , three with an intubating laryngeal mask airway ( ilma ) , and one performed with a blind nasal technique . there was no statistical difference in the mean age of all thirty - three patients . there was no statistically significant difference in the proportion of successful first intubation attempts or the total number of attempts of intubation between the three groups [ table 2 ] . there was a statistically significant difference in the duration of intubation time ( p<0.05 ) , with the vl group ( 6.90.9 min ) and miscellaneous group ( 9.12.0 min ) significantly less than that of the fob group ( 10.40.7 min ; table 2 ) . thirty cases were determined to result from by ace inhibitor therapy , while three were idiopathic . much has been published about angioedema regarding its epidemiology , airway risk , and demographics . nonetheless , to date there has been no analysis of the devices / methods used to intubate the trachea in this setting . traditionally , fiberoptic intubation of the spontaneously breathing patient has been employed for the anticipated difficult airway . the last decade has seen the introduction of new devices that can be used effectively in intubating these challenging airways ( glidescope , the pentax aws , truview evo2 ) . macro view of the supraglottic structures . furthermore , proficiency in fiberoptic intubation can take significantly longer then that of videolaryngoscopy . the observation that there was no statistically significant difference in the number of attempts to intubate the trachea when using either one of the devices is an indication of the utility of vl . moreover , vl appeared a more efficient method as it required the least amount of time in establishing a safe and secured airway , which could make the difference in avoiding cardiopulmonary arrest secondary to hypoxemia . in a multicenter review proposed a staging system based on the location and severity of angioedema with the purpose to aid the clinician to make a decision whether to intubate or observe the patient . this classification system describes three types of angioedema and other authors suggested possible management options [ table 3 ] . patients presenting with type 1 and 2 angioedema are to be observed in a monitored setting . for patients presenting with a type 3 angioedema , intubation with a fiberoptic bronchoscope has been recommended as any airway manipulation to already swollen airway can exacerbate the condition , turning a type 1 airway into a type 3 . a patient presenting with a type 3 angioedema should have the airway secured with fiberoptic bronchoscope , however there are reports available of anesthesia providers securing this airway through other devices . classification of angioedema and suggested plans of management while the data in our pilot study is underpowered due to its small sample size , additional numbers may give a clearer indication in cases of angioedema of when to intubate and which device to use . a published case series suggests both fiberoptic and vl could be used in combination for an awake difficult intubation . specific anatomical considerations would preclude the use of vl such as inability to insert the blade secondary to tongue and lip edema or massive edema of the pharynx that would render one unable to maneuver the device . specifically , glidescope as a vl method has its own inherent risks such as uvular , soft palate , and tonsillar pillar injuries . in the three cases the intubating lma was used twice as a rescue device for failed direct laryngoscopy and once as the primary method . although in these 3 cases it was successfully used , we suggest it is not an ideal device for airway management . the distorted swelling in angioedema prevents secured seal with the intubating lma , thus impairing ventilation . one case of blind nasal intubation was successfully used in this study . in general , blind nasal intubations are used less frequently due to the popularity of vl which can provide an operator with better control . direct laryngoscopy may still have a role in less severe ( type i and ii ) angioedema class . a limitation of this study was that this was a retrospective review with a small sample size . additional numbers are needed to confirm if the significant differences between fob and vl groups observed in this study are valid . another major limitation was that intubations were performed by different anesthesiologists ( n=10 ) and there was no grading system to evaluate the severity of angioedema . also , in our study we have included only cases managed in the operating suites . this means that our study is more representative of urgent cases , not emergent variety . although fiberoptic and videolaryngoscopic intubation methods were similarly effective in the airway management if angioedema , videolaryngoscopy was significantly more time efficient in securing the airway . a more rapid securing of the airway during angioedema may change patient outcomes dramatically , particularly in avoiding cardiopulmonary arrest secondary to hypoxemia .
background : angioedema ( ae ) is edema of the skin , subcutaneous tissue and/or submucosal tissues , resulting from extravasation of intravascular fluid . swelling of the supraglottic mucosa can lead to airway obstruction with consequent hypoxia , brain damage and death . to date , fiberoptic bronchoscope ( fob ) intubation of the spontaneously breathing patient is the preferred method for an anticipated difficult intubation . however , other alternative devices can be utilized to intubate angioedema successfully.materials and methods : a retrospective chart review was performed over a three - year period ( 2008 - 2010 ) of all patients with angioedema that required airway intervention . we hypothesized that fiberoptic intubation would have a higher success rate for intubation attempts ; however , would take longer to perform when compared to videolaryngoscopic ( vl ) intubation . outcomes for fob versus vl intubations were reviewed , along with alternative miscellaneous methods of tracheal intubation in the setting of angioedema.results:thirty-three patients were grouped , according to the chosen method of intubation into fob ( n=12 ) , vl ( n=11 ) , and miscellaneous ( n=10 ) groups . no significant difference was found in first intubation attempts or number of intubation attempts between the three groups . duration of time to perform successful intubation revealed a significantly shorter intubation time ( p<0.05 ) in the vl group ( 6.90.9 min ) and miscellaneous group ( 9.12.0 min ) than that of the fob group ( 10.40.7 min).conclusion : this retrospective review of intubation methods showed that vl could be performed faster than fob without an increase in adverse events .
efforts have subsequently been made to identify new predictors of coronary artery disease ( cad ) as 20% of coronary events occur in the absence of traditional risk factors . to determine whether there are psychological risk factors for cad has been a challenge for evidence - based medicine , however , it is not prudent to affirm that they do not affect it pathogenesis , since depression and psychological stress have been associated with increased risk of cad . denollet et al . proposed that there is a type - d or distressed personality that describes individuals with high levels of negative affectivity ( na ) and social inhibition ( si ) . na is characterized by the tendency to experience negative emotions , and si by the tendency to inhibit the expression of these emotions during social interactions , due to fear of disapproval or rejection by others . high - na individuals have a negative view of self and experience feelings of dysphoria , anxiety , irritability . high - si individuals tend to feel inhibited , tense , and insecure when with others . na and si combine synergistically to influence clinical outcomes , and their interaction can be viewed as a form of stress that may induce or exacerbate serious health problems . type - d personality has been shown to have effects on cardiac prognosis independent of mood states such as anxiety and depression . the first study to suggest that type - d personality had adverse health effects was published in 1995 , and other subsequent studies have shown type - d personality as an independent risk factor for general and cardiac mortality in patients with cad . the dobutamine - atropine stress echocardiography ( dase ) for the detection of cad is well - established both by american heart association / american college of cardiology and european society of cardiology guidelines . this study aims to assess the prevalence of type - d personality and its association with the occurrence of myocardial ischemia as assessed by dase . this study has followed the guidelines of the declaration of helsinki and the brazilian resolution 196/96 for biomedical research in humans . the study was approved by the ethics committee on human research at the clinical hospital of the universidade federal do paran . the sample size for this study was based on previous studies that identified a 30% prevalence of type - d personality among patients with cardiac disease , and mortalities of 5% among non - type - d and 39% among type - d patients ( 16 ) . for an error of 95% and error of 80% , 76 patients ( 57 non - type - d patients and 19 type - d patients ) were needed for statistically significant results . this was a case - control study using a non - consecutive convenience sampling ( according to availability of the researchers ) . the inclusion criterion was patients aged 18 years old , referred to assessment of myocardial ischemia by pharmacological stress echocardiography . between march 2010 and april 2012 , exclusion criteria were patients referred to dase to assessment of pathologies other than myocardial ischemia , and patients with inconclusive dase . after filling out consent forms and before undergoing dase , patients were asked about chest pain , presence of classic risk factors for cad ( age , smoking , hypertension , diabetes mellitus , dyslipidemia , sedentary lifestyle , obesity , drug therapy , family history of cad ) , and a positive cad history ( defined as a history of myocardial infarction , angioplasty , or coronary artery bypass surgery ) . a questionnaire designed for type - d personality ( ds14 ) was completed and were identified as type - d personality those individuals whose total na and si scores were 10 . the standardized dase protocol consisted of dobutamine infusion starting at 5 g / kg / min and increasing at 3-min intervals to 10 , 20 , 30 and 40 g / kg / min . atropine , in divided doses of 0.25 - 0.5 mg to a total of 2.0 mg , was used as needed to achieve the target heart rate . atropine could be used in early stages of the test , to reduce infusion times . at peak stress or during recovery , a beta - blocker was administered to reverse the side effects of dobutamine and increase test sensitivity . interruption end points included the achievement of target heart rate ( defined as 85% of the age - predicted maximum heart rate ) , significant arrhythmias , hypotension , severe hypertension , and intolerable symptoms . positivity criteria were electrocardiographic st segment changes ( with > 2 mv st segment shift ) and new or worsening wall - motion abnormalities . patients whose dase did not present new or worsening wall - motion abnormalities and who did not reach the target heart rate at the end of the protocol were excluded from the study ( inconclusive dase ) . fisher 's exact test or the chi - square test was used to evaluate the association between qualitative variables and the presence of ischemia on stress echocardiography . first , we evaluated the association between each variable and the presence or absence of ischemia . variables that showed p < 0.20 were included in the multivariate model , adjusted for type - d personality . the wald test was used to assess the effect of variables on the probability of ischemia on dase . this study has followed the guidelines of the declaration of helsinki and the brazilian resolution 196/96 for biomedical research in humans . the study was approved by the ethics committee on human research at the clinical hospital of the universidade federal do paran . the sample size for this study was based on previous studies that identified a 30% prevalence of type - d personality among patients with cardiac disease , and mortalities of 5% among non - type - d and 39% among type - d patients ( 16 ) . for an error of 95% and error of 80% , 76 patients ( 57 non - type - d patients and 19 type - d patients ) were needed for statistically significant results . this was a case - control study using a non - consecutive convenience sampling ( according to availability of the researchers ) . the inclusion criterion was patients aged 18 years old , referred to assessment of myocardial ischemia by pharmacological stress echocardiography . between march 2010 and april 2012 , exclusion criteria were patients referred to dase to assessment of pathologies other than myocardial ischemia , and patients with inconclusive dase . after filling out consent forms and before undergoing dase , patients were asked about chest pain , presence of classic risk factors for cad ( age , smoking , hypertension , diabetes mellitus , dyslipidemia , sedentary lifestyle , obesity , drug therapy , family history of cad ) , and a positive cad history ( defined as a history of myocardial infarction , angioplasty , or coronary artery bypass surgery ) . a questionnaire designed for type - d personality ( ds14 ) was completed and were identified as type - d personality those individuals whose total na and si scores were 10 . the standardized dase protocol consisted of dobutamine infusion starting at 5 g / kg / min and increasing at 3-min intervals to 10 , 20 , 30 and 40 g / kg / min . atropine , in divided doses of 0.25 - 0.5 mg to a total of 2.0 mg , was used as needed to achieve the target heart rate . atropine could be used in early stages of the test , to reduce infusion times . at peak stress or during recovery , a beta - blocker was administered to reverse the side effects of dobutamine and increase test sensitivity . interruption end points included the achievement of target heart rate ( defined as 85% of the age - predicted maximum heart rate ) , significant arrhythmias , hypotension , severe hypertension , and intolerable symptoms . positivity criteria were electrocardiographic st segment changes ( with > 2 mv st segment shift ) and new or worsening wall - motion abnormalities . patients whose dase did not present new or worsening wall - motion abnormalities and who did not reach the target heart rate at the end of the protocol were excluded from the study ( inconclusive dase ) . fisher 's exact test or the chi - square test was used to evaluate the association between qualitative variables and the presence of ischemia on stress echocardiography . first , we evaluated the association between each variable and the presence or absence of ischemia . variables that showed p < 0.20 were included in the multivariate model , adjusted for type - d personality . the wald test was used to assess the effect of variables on the probability of ischemia on dase . of the 321 participants enrolled in the study , 15 ( 4.7% ) were excluded as follows : 10 ( 3.1% ) for inconclusive stress echocardiography ; 2 ( 0.6% ) with contraindications for undergoing dase ( abdominal aortic aneurysm ) , and 3 ( 0.9% ) for incomplete data collection . the mean age of participants was 61 9.6 years and 57.8% were female . at the time of testing , 287 ( 93.8% ) of the patients were under medical therapy , 82% taking antihypertensives , 58.5% statins , 29.1% oral hypoglycemic agents , 13.4% insulin , 59.5% platelet antiaggregants , and 17.3% antidepressants ( tricyclics or selective serotonin reuptake inhibitors ) . the prevalence of type - d personality was 34.6% ( 106 patients ) . regarding the classic risk factors for cad , 38.9% of the patients had diabetes , 83.3% hypertension , 68.0% dyslipidemia , 69.6% sedentary lifestyle , 44.4% family history of cad , 14.7% were smokers , 34.6% were obese ( body mass index > 30 kg / m ) , 66.0% had visceral obesity , 34.0% cad , and 10.5% presented cerebrovascular ischemia . to assess the prevalence of risk factors for cad and sample homogeneity , the clinical characteristics were also analyzed according to personality type ( d or non - d ) . chest pain was the only statistically significant variable observed in 77.4% ( 82 ) of the type - d patients versus 57.0% ( 115 ) of non - type - d patients with p < 0.001 . dase was positive for myocardial ischemia in 32.4% ( 99 ) of the 306 participants . univariate analysis for positivity on dase showed that there was no significant difference in gender , age , visceral obesity , cerebrovascular ischemia , smoking , and type - d personality . for the logistic regression model for multivariate analysis , the authors included type - d personality , adjusted for diabetes , hypertension , dyslipidemia , sedentary lifestyle , familiar history of cad , obesity , cad , and chest pain . the results showed that , in the presence of those variables , there was no significant association between type - d personality and ischemic changes on dase ( p = 0.941 ; odds ratio [ or ] : 0.98 ; confidence interval 95% : 0.57 - 1.69 ) . only the presence of cad showed a significant difference ( p = 0.003 ) for prediction of ischemia on dase . chest pain showed a tendency to positivity on dase ( p = 0.053 ) [ table 1 ] . the present study revealed a high risk population for cardiovascular disease due to of the high prevalence of classic risk factors for cad . the prevalence of type - d personality in this case - control study was similar to that observed in other studies . although the prevalence of type - d personality in this population was similar to that observed in the literature , type - d personality was not found to be a statistically significant risk factor for myocardial ischemia assessed by dase . recent reports have questioned the relevance of type - d personality as a risk factor for cad . in a recent meta - analysis , identified a significant association between type - d personality and cardiovascular events . however , the importance of this association has been declining over the years ( or changed from 5.02 to 1.54 ) and studies with high methodological quality failed to confirm this association . in another study , schmidt et al . evaluated patients who underwent percutaneous coronary intervention and major cardiovascular events were not associated with type - d personality . in our study , among patients with and without type - d personality , there were no statistically significant differences in the prevalence of classical risk factors for cad . however , kupper et al . , after evaluating 6222 patients with cad in 22 european countries , concluded that there was a significant pancultural association between type - d personality and some cardiovascular risk factors , including hypertension , smoking , and sedentary lifestyle . kuijpers et al . observed that type - d personality was independently associated with psychopathology ( panic disorder and depression ) in patients referred to emergency rooms with non - cardiac - associated chest pain . in our study , chest pain was the only clinical variable with statistically significant prevalence in type - d personality patients . however , we could not identified significant correlation between chest pain and ischemic changes on dase in this group . some doubts still prevail about the pain pathophysiology in these patients : would they be more sensitive to ischemic and/or non - ischemic pain ? would they present a higher prevalence of non - cardiac chest pain ? would it be accounted for by the psychological characteristics and associated disorders of these patients ? the present study confirmed the trend of recent findings that previous results might be spurious , leading to overestimations of the effects of type - d personality on the prognosis of cardiac patients . the authors argue that the practice of dichotomization of the interaction of na and si were methodologically problematic in type - d studies . de voogd et al . argued that previous studies that identified type - d personality as a predictor of negative cardiovascular outcomes and mortality , came from small studies ( 4 , 6 , 8 , 12 and 47 deaths ) conducted by a single investigative group ( denollet 's group at tilburg university ) . a larger study of mortality with 192 deaths , conducted by coyne et al . our study has some limitations , such as its cross - sectional nature , which does not allow to test the prognostic validity , and a pre - selected patient sample . additional well - designed studies are needed to clarify the role of type - d personality in cad patients . the prevalence of type - d personality in the present study was similar to previously published results . type - d personality was not a significant risk factor for the presence of ischemic changes on dase . patients with type - d personality tended to complain more frequently of chest pain than non - type - d patients .
background : type - d personality has been identified as a risk factor for general and cardiac mortality in patients with coronary artery disease ( cad ) . dobutamine - atropine stress echocardiography ( dase ) is an established method for non - invasive evaluation of myocardial ischemia in patients with cad . the objective of this study was to evaluate the prevalence of type - d personality and its association with the occurrence of myocardial ischemia as assessed by dase.methods:this case - control study enrolled 306 patients ( 61 9.6 years , 57.8% female ) who were referred by physicians to assessment of myocardial ischemia . before undergoing dase , the patients answered the type - d scale , which identifies type - d personality.results:type-d personality was identified in 106 patients ( 34.6% ) . dase was positive for myocardial ischemia in 32.4% ( 99 ) of 306 participants there was no significant association between type - d personality and ischemic changes on dase ( p = 0.941 ; odds ratio : 0.98 ; confidence interval 95% : 0.57 - 1.69 ) . chest pain was the only clinical variable with statistically significant prevalence in type - d personality patients ( 77.4% vs. 57.0% ; p < 0.001).conclusions : type - d personality was not a significant risk factor for the presence of ischemic changes on dase . patients with type - d personality tended to complain more frequently of chest pain than non - type - d patients .
cognitively able adolescents and adults with a diagnosis of autism spectrum disorder ( asd ) , such as those once diagnosed with asperger s syndrome ( as ) or high functioning autism , commonly have restricted social participation as a result of social and communication deficits.14 they frequently report social isolation and negative experiences in social situations , which may influence their motivation for social engagement . whether individuals with asd wish to engage socially ( ie , the term autism is drawn from the greek word , autos , meaning self . the name was first applied to children who were socially isolated , seemingly by choice . thus , the popular belief that individuals with asd lack the motivation to engage socially . recently , chevallier et al proposed a social motivation theory of autism , describing it as an extreme case of diminished social motivation.5 other researchers studying social motivation concluded that children with asd display less desire for interaction than typically developing peers,6 a finding explicitly and directly gleaned from asking participants to view pictures of people taken from the side view and indicate whether they wanted to interact with those individuals . for example , deckers et al asked children with asd to indicate whether they would like to get acquainted with individuals presented in profile pictures of faces.6 if they wanted to know a person , they pulled on a joystick and turned the photo toward them . if they did not want to meet the person , they pushed on the joystick which turned the picture away ( ie , face turn approach - avoidance task).7 unlike asking them explicitly , using this implicit approach , deckers et al found that children with asd were inclined to express a desire to approach others . other researchers8,9 have used electroencephalography with cognitively able children with asd , finding greater left than right anterior cortical activity while at rest , a pattern associated with a disposition to approach socially.10 a third hypothesis is that social motivation in individuals with asd is context dependent . that is , individuals are motivated to engage socially in specific contexts and not in others . for example , using experience sampling methodology ( esm ) , hintzen et al found that cognitively able adults with asd chose to spend more time with familiar people than did adults without asd.11 in addition , we found that cognitively able adolescents and adults with asd reported enjoying everyday social situations when they were conversing with friends compared with other people or being alone ( chen et al , unpublished data , 2015 ) . self - determination theory ( sdt),1214 which focuses on how social contexts affect engagement , may help understand the contextual nature of motivations for social interaction in people with asd . instead of treating motivation as a unitary construct , sdt addresses the orientation / type of motivation which concerns the reasons or goals that give rise to an action.14 according to sdt , motivations can be self - determined in situations that individuals find compelling ( ie , intrinsically motivated ) or that they think are good for them ( ie , identified regulation ) . in contrast , individuals sometimes perform behaviors to satisfy external demands ( ie , external regulation ) , or to avoid guilt or attain recognition ( ie , introjected regulation ) ; both are extrinsically motivated . however , amotivated behaviors occur in situations where an individual lacks a reason for or an intention to act . sdt suggests that orientation of motivation can be predicted by the degree to which an action satisfies basic psychological needs . deci and ryan described three basic psychological needs inherent to all human beings:12 autonomy , competence , and relatedness . human needs play a mediating role between the actions of individuals and the social context.1214 deci and ryan suggested that participation in a supportive social environment is crucial to satisfaction of psychological needs ; which , in turn , facilitates self - determined behaviors and positive experiences . our previous findings that cognitively able adolescents and young adults with asd enjoyed social interactions with certain contexts suggests that those interactions met basic needs . in contrast , whitehouse et al found that adolescents with as have little intrinsic motivation for establishing friendships , probably because their needs are not met.15 the lack of clarity around the motivation for social participation of adolescents and adults with asd may , in part , reflect differences in methodology . while we have used esm16,17 to explore social experiences in everyday contexts , most previous researchers have used retrospective interview or global self - rating scales . for example , whitehouse et al15 used the friendship motivation questionnaire,18 which required participants to indicate how true statements were of them . this task is highly cognitive , requiring aggregation of experiences over time.19 retrospective responses are easily contaminated by memory bias20 or by the emotional states elicited by reflective questioning.19 more importantly , retrospective and one - time reporting are divorced from real life contexts and experiences of social participation . thus , the low motivation for social engagement identified by whitehouse et al15 may not truly reflect their social desires in everyday life . esm is an ecological momentary assessment used to identify dynamic relationships between subjective experiences and everyday contexts.19 esm allows participants to report their actions , momentary thoughts , and feelings in real time , across natural settings and over a period of time . this method enables to identify fluctuations in perceptions about everyday experiences within a person.21 as such , it is suited to capturing the variability inherent to the asd population . unlike single - case studies , data collected with esm can be aggregated and analyzed at within- and between - person levels simultaneously.21 in addition , compared with retrospective approaches , data collected through esm have greater ecological validity and are less subject to recall or social appropriateness bias.16,19 further , esm survey questions are short , straightforward , and address only the immediate context , which involves less cognitive demand than retrospective methods . recent research has established the validity and usability of esm with the asd population.11,2226 the purpose of the present study was to examine motivation for social participation in everyday contexts among cognitively able adolescents and adults with asd . we used sdt as a theoretical framework and esm as a methodology . to examine the extent to which the basic needs of competence and relatedness were met in everyday social experiences , we investigated perceptions of difficulty and social reciprocity . given the heterogeneity of people with asd and our previous findings ( chen et al , unpublished data , 2015 ) , we examined severity of asd symptomology and global social anxiety as moderators of motivation for and perceptions of everyday participation . in addition , because we had found that australian females with asd are more socially active than australian males and taiwanese people ( chen et al , unpublished data , 2015 ) , we also examined whether participant group ( australian females vs other people ) served as a moderator . the study had approval from the university of sydney human research ethics committee , the autism spectrum australia research approval committee , and the research ethics committee of national taiwan university hospital ( ntuh ) . all participants provided written consent , and parents provided additional consent for participants younger than 18 . because the study began prior to release of the diagnostic and statistical manual of mental disorders ( dsm ) 5th edition,27 we used dsm - iv criteria for asd diagnosis . thirty - two individuals with as or high functioning autism agreed to participate : 14 australians ( four males ) were recruited via research flyers circulated around australia and 18 taiwanese ( 14 males ) were referred by psychiatrists employed at ntuh . all individuals met the following inclusion criteria : 1 ) a formal diagnosis from a psychiatrist or psychologist using the dsm - iv criteria;3 2 ) aged between 16 and 45 years , and 3 ) having sufficient reading comprehension to understand the surveys . reading comprehension of australian participants was confirmed by standard scores of 85 on the reading comprehension subtest of woodcock reading mastery test-3rd edition.28 because there are no equivalent reading assessments for taiwanese adults , the reading comprehension of taiwanese participants was confirmed by a verbal intelligence quotient 70 on the wechsler adult intelligence scale - iv.29 no participants had a diagnosis of intellectual disability , neurological or other developmental disorders ( eg , cerebral palsy ) . in order for their data to be included , participants had to have completed at least 17 of 49 surveys ( > 33% ) in accordance with suggestions from previous researchers.30 data from two taiwanese males were excluded from the final sample . the second completed only 15 surveys in 7 days ; the minimum requirement was 17 surveys ( see procedure ) . thus , the final sample included data from 14 australians ( four males ; aged 1643 years [ mean = 24.8 , standard deviation { sd } = 9.0 ] ) and 16 taiwanese ( 12 males ; aged 1945 years [ mean = 27.8 , sd = 6.3 ] ) . in the final sample , the main diagnosis was as ( n=12 [ 86% ] in the australian group and n=13 [ 81% ] in the taiwanese group ; table 1 ) . half of the australian participants and a quarter of the taiwanese participants had concomitant mental health diagnoses ( eg , attention deficit / hyperactivity disorder , depression , anxiety , obsessive compulsive disorder ) . regarding current education and employment status , seven ( 50% ) australians and four ( 25% ) taiwanese were still students . we developed an esm survey to explore what participants were doing ( everyday activities , figure 1 for options ) and who they were communicating with ( social interaction conditions , figure 2 for options ) . each time they were signaled , participants chose the main activity in which they were engaged and as many social partners as were relevant . they indicated why they were doing the activity ( from a list ) and their experiences of : a ) difficulty of activity engagement , and b ) social reciprocity during interactions . social reciprocity included questions about being listened to ( do you think they were really listening to what you had to say ? ) and caring about others ( did you care about what they were doing / saying ? ) . participants responded yes or no to perceived difficulty and from 0 ( not at all ) to 10 ( very much ) for perceived social reciprocity . the esm survey was loaded to the participation in everyday life survey application ( piel app ) , an esm platform designed for ios devices.31 the piel app prompted participants to complete the esm surveys , time stamped the responses , and stored the data . the social responsiveness scale second edition ( srs-2)32 was used to evaluate the severity of asd symptoms . in taiwan , the chinese version of srs33 was used . the srs-2 is a parent / teacher - report or self - report questionnaire for individuals 2.5 years or older . in this study , participants who were aged 19 years and above completed the self - report version . the srs-2 comprises 65 items organized into five subscales : social awareness , social cognition , social communication , social motivation , and restricted interests and repetitive behaviors . items are rated on a 4-point likert scale from 0 ( not true ) , to 3 ( almost always true ) . total standard scores of 60 or higher are clinically significant and indicate deficiencies in social reciprocal behavior that may interfere with everyday social interactions . the srs-2 has evidence of sound psychometric properties when used with adults.32,34 to evaluate the severity of global social anxiety in australian and taiwanese participants , the social interaction anxiety scale ( sias)35 and the chinese version of the sias36 were used . the 20-item self - report scale measures experiences in social situations associated with social anxiety according to dsm - iv criteria.3 participants rated the items using a 5-point scale ( 0= not at all characteristic of me to 4= extremely characteristic of me ) . the sias and chinese version of the sias have good evidence of reliability and validity across clinical and community populations.35,36 we provided participants with an ipod touch or delivered the piel app to their ios device ( ie , ipod touch or iphone ) . we conducted a 30- to 60-minute individual training session with each participant on the use of the piel app and the ios device . the training was held at a university campus , outpatient clinic of the hospital or a quiet public place ( eg , a library ) . during the training parents of participants under 19 received the school - age version of srs-2 by mail . the device prompted participants seven times each day at random intervals to respond to the same esm survey . they were instructed to answer as many surveys as possible but to ignore signals that occurred at inconvenient times ( eg , when bathing ) . the survey became dormant if participants did not respond to a prompt within 2 minutes . we coded activities into five types : non - activity , productivity , solitary / parallel leisure , social activities , and self - care we coded reasons for engaging in activities into five levels based on degree of self - determination drawn from sdt:12 a ) intrinsic motivation ( i like it ) , b ) three levels of extrinsic motivation : identified regulation ( i am doing it for my own good ) ; introjected regulation ( i want people to like me ; i want to look occupied ) , and external regulation ( i have to ) , and c ) amotivation ( it s just a habit ; nothing else to do ) . for each participant , we calculated the proportion of each motivation associated with each activity and interaction with different people . we also calculated the proportion of perceived difficulty and overall means of social reciprocity associated with each activity and interaction , respectively . prior to calculating overall means , we centered each participant s ratings at his or her mean to account for individual differences . esm data have a hierarchical structure with multiple surveys ( level 1 ) nested within data from each participant ( level 2 ) . we performed multilevel analyses to examine how motivation and perceptions were associated with everyday participation . given that multilevel analysis takes into account the dependency of the surveys from the same participant,37,38 the method is preferred over the conventional ordinary least squares approaches for esm data.39,40 in addition , multilevel analysis allows examination of relationships between variables at different levels and also accounts for potential moderating effects of level 2 variables on the relationships of level 1 variables.37,38 previous researchers suggested a minimum level 2 sample size of 30 to achieve sufficient power.41,42 we examined associations between everyday activities and the dependent variables , degree of self - determination and perceived difficulty , in two multilevel logistic analyses . in each analysis , non - activity , productivity , solitary / parallel leisure , and social activities were the level 1 independent variables and self - care was the reference . to examine source of motivation as a dependent variable in multilevel logistic analysis , the five motivation levels were coded as relatively self - determined ( intrinsic motivation , identified regulation ) or relatively externally determined ( introjected regulation , external regulation , amotivation ) ; the relatively externally determined was the reference . to examine perceived social reciprocity , we conducted two multilevel linear analyses with being listened to and caring about others as continuous dependent variables . because participants were able to select multiple social partners in a single interaction , we coded each social partner as a binary ( yes / no ) variable : no one , family members , casual / intimate friends , or people at school / work all the four types of social partners were included as level 1 independent variables in the analysis of motivation . the analyses of perceived social reciprocity included only three independent variables : family members , casual / intimate friends , and people at school / work because social reciprocity requires the presence of a social partner . in each multilevel analysis , we simultaneously analyzed individual characteristics as level 2 independent variables to examine their associations with motivation and perceived social reciprocity . these variables were severity of asd ( ie , total standard scores of srs-2 ) , severity of global social anxiety ( ie , total raw scores of sias ) , and participant group ( australian females vs other participants ) . srs-2 and sias data were grand mean centered for comparisons across participants.37,38 to examine potential moderating effects of individual characteristics ( severity of asd , global social anxiety , and participant group ) , we added the interactions between level 1 and level 2 independent variables to the original multilevel analyses . these additional analyses helped identify whether the level 2 independent variables moderated the relationships between level 1 independent and dependent variables . to reduce model complexity and maximize stability , we removed cross - level interactions which showed no significant relationships to the dependent variable when establishing the final model.37,38 we used hierarchical linear and nonlinear modeling ( hlm 6.08 ) software43 to perform the multilevel analyses . associations between independent and dependent variables were evaluated through the estimation of the odds ratios ( ors ) and corresponding 95% confidence intervals ( cis ) for the multilevel logistic analysis , and a fixed regression coefficient ( ) and standard errors for the multilevel linear analysis . significance in cross - level interaction indicates a significant moderating effect of a level 2 independent variable on the relationship between level 1 independent and dependent variables . thirty - two individuals with as or high functioning autism agreed to participate : 14 australians ( four males ) were recruited via research flyers circulated around australia and 18 taiwanese ( 14 males ) were referred by psychiatrists employed at ntuh . all individuals met the following inclusion criteria : 1 ) a formal diagnosis from a psychiatrist or psychologist using the dsm - iv criteria;3 2 ) aged between 16 and 45 years , and 3 ) having sufficient reading comprehension to understand the surveys . reading comprehension of australian participants was confirmed by standard scores of 85 on the reading comprehension subtest of woodcock reading mastery test-3rd edition.28 because there are no equivalent reading assessments for taiwanese adults , the reading comprehension of taiwanese participants was confirmed by a verbal intelligence quotient 70 on the wechsler adult intelligence scale - iv.29 no participants had a diagnosis of intellectual disability , neurological or other developmental disorders ( eg , cerebral palsy ) . in order for their data to be included , participants had to have completed at least 17 of 49 surveys ( > 33% ) in accordance with suggestions from previous researchers.30 data from two taiwanese males were excluded from the final sample . the second completed only 15 surveys in 7 days ; the minimum requirement was 17 surveys ( see procedure ) . thus , the final sample included data from 14 australians ( four males ; aged 1643 years [ mean = 24.8 , standard deviation { sd } = 9.0 ] ) and 16 taiwanese ( 12 males ; aged 1945 years [ mean = 27.8 , sd = 6.3 ] ) . in the final sample , the main diagnosis was as ( n=12 [ 86% ] in the australian group and n=13 [ 81% ] in the taiwanese group ; table 1 ) . half of the australian participants and a quarter of the taiwanese participants had concomitant mental health diagnoses ( eg , attention deficit / hyperactivity disorder , depression , anxiety , obsessive compulsive disorder ) . regarding current education and employment status , seven ( 50% ) australians and four ( 25% ) taiwanese were still students . we developed an esm survey to explore what participants were doing ( everyday activities , figure 1 for options ) and who they were communicating with ( social interaction conditions , figure 2 for options ) . each time they were signaled , participants chose the main activity in which they were engaged and as many social partners as were relevant . they indicated why they were doing the activity ( from a list ) and their experiences of : a ) difficulty of activity engagement , and b ) social reciprocity during interactions . social reciprocity included questions about being listened to ( do you think they were really listening to what you had to say ? ) and caring about others ( did you care about what they were doing / saying ? ) . participants responded yes or no to perceived difficulty and from 0 ( not at all ) to 10 ( very much ) for perceived social reciprocity . the esm survey was loaded to the participation in everyday life survey application ( piel app ) , an esm platform designed for ios devices.31 the piel app prompted participants to complete the esm surveys , time stamped the responses , and stored the data . the social responsiveness scale second edition ( srs-2)32 was used to evaluate the severity of asd symptoms . in taiwan , the chinese version of srs33 was used . the srs-2 is a parent / teacher - report or self - report questionnaire for individuals 2.5 years or older . in this study , participants who were aged 19 years and above completed the self - report version . the srs-2 comprises 65 items organized into five subscales : social awareness , social cognition , social communication , social motivation , and restricted interests and repetitive behaviors . items are rated on a 4-point likert scale from 0 ( not true ) , to 3 ( almost always true ) . total standard scores of 60 or higher are clinically significant and indicate deficiencies in social reciprocal behavior that may interfere with everyday social interactions . the srs-2 has evidence of sound psychometric properties when used with adults.32,34 to evaluate the severity of global social anxiety in australian and taiwanese participants , the social interaction anxiety scale ( sias)35 and the chinese version of the sias36 were used . the 20-item self - report scale measures experiences in social situations associated with social anxiety according to dsm - iv criteria.3 participants rated the items using a 5-point scale ( 0= not at all characteristic of me to 4= extremely characteristic of me ) . the sias and chinese version of the sias have good evidence of reliability and validity across clinical and community populations.35,36 we provided participants with an ipod touch or delivered the piel app to their ios device ( ie , ipod touch or iphone ) . we conducted a 30- to 60-minute individual training session with each participant on the use of the piel app and the ios device . the training was held at a university campus , outpatient clinic of the hospital or a quiet public place ( eg , a library ) . during the training parents of participants under 19 received the school - age version of srs-2 by mail . australian participants took the woodcock reading mastery test-3rd edition to ensure reading comprehension ability . following training , the device prompted participants seven times each day at random intervals to respond to the same esm survey . they were instructed to answer as many surveys as possible but to ignore signals that occurred at inconvenient times ( eg , when bathing ) . the survey became dormant if participants did not respond to a prompt within 2 minutes . we coded activities into five types : non - activity , productivity , solitary / parallel leisure , social activities , and self - care ( figure 1 for types ) . we coded reasons for engaging in activities into five levels based on degree of self - determination drawn from sdt:12 a ) intrinsic motivation ( i like it ) , b ) three levels of extrinsic motivation : identified regulation ( i am doing it for my own good ) ; introjected regulation ( i want people to like me ; i want to look occupied ) , and external regulation ( i have to ) , and c ) amotivation ( it s just a habit ; nothing else to do ) . for each participant , we calculated the proportion of each motivation associated with each activity and interaction with different people . we also calculated the proportion of perceived difficulty and overall means of social reciprocity associated with each activity and interaction , respectively . prior to calculating overall means , we centered each participant s ratings at his or her mean to account for individual differences . esm data have a hierarchical structure with multiple surveys ( level 1 ) nested within data from each participant ( level 2 ) . we performed multilevel analyses to examine how motivation and perceptions were associated with everyday participation . given that multilevel analysis takes into account the dependency of the surveys from the same participant,37,38 the method is preferred over the conventional ordinary least squares approaches for esm data.39,40 in addition , multilevel analysis allows examination of relationships between variables at different levels and also accounts for potential moderating effects of level 2 variables on the relationships of level 1 variables.37,38 previous researchers suggested a minimum level 2 sample size of 30 to achieve sufficient power.41,42 we examined associations between everyday activities and the dependent variables , degree of self - determination and perceived difficulty non - activity , productivity , solitary / parallel leisure , and social activities were the level 1 independent variables and self - care was the reference . to examine source of motivation as a dependent variable in multilevel logistic analysis , the five motivation levels were coded as relatively self - determined ( intrinsic motivation , identified regulation ) or relatively externally determined ( introjected regulation , external regulation , amotivation ) ; the relatively externally determined was the reference . to examine perceived social reciprocity , we conducted two multilevel linear analyses with being listened to and caring about others as continuous dependent variables . because participants were able to select multiple social partners in a single interaction , we coded each social partner as a binary ( yes / no ) variable : no one , family members , casual / intimate friends , or people at school / work . all the four types of social partners the analyses of perceived social reciprocity included only three independent variables : family members , casual / intimate friends , and people at school / work because social reciprocity requires the presence of a social partner . in each multilevel analysis , we simultaneously analyzed individual characteristics as level 2 independent variables to examine their associations with motivation and perceived social reciprocity . these variables were severity of asd ( ie , total standard scores of srs-2 ) , severity of global social anxiety ( ie , total raw scores of sias ) , and participant group ( australian females vs other participants ) . srs-2 and sias data were grand mean centered for comparisons across participants.37,38 to examine potential moderating effects of individual characteristics ( severity of asd , global social anxiety , and participant group ) , we added the interactions between level 1 and level 2 independent variables to the original multilevel analyses . these additional analyses helped identify whether the level 2 independent variables moderated the relationships between level 1 independent and dependent variables . to reduce model complexity and maximize stability , we removed cross - level interactions which showed no significant relationships to the dependent variable when establishing the final model.37,38 we used hierarchical linear and nonlinear modeling ( hlm 6.08 ) software43 to perform the multilevel analyses . associations between independent and dependent variables were evaluated through the estimation of the odds ratios ( ors ) and corresponding 95% confidence intervals ( cis ) for the multilevel logistic analysis , and a fixed regression coefficient ( ) and standard errors for the multilevel linear analysis . significance in cross - level interaction indicates a significant moderating effect of a level 2 independent variable on the relationship between level 1 independent and dependent variables . participants completed an average of 38 , of a possible 49 ( average response rates : 77.6% ) , esm surveys ( sd = 7 , range = 2349 ) , providing a total of 1,131 surveys . overall , participants spent the majority of time engaging in activities related to solitary / parallel leisure ( 42.4% ) , followed by 25.0% in productivity ( ie , home chores and class , work or meeting ) , and 12.2% in non - activity . they engaged infrequently ( 10.8% ) in social activities and they did not interact with another person most of the time ( 71.6% ) . casual friends / an intimate friend ( 11.4% ) were the ones they mainly interact with when they engaged in conversation . figure 1 shows that participants were most frequently intrinsically motivated to engage in social and solitary / parallel leisure activities , except running / jogging / fitness / sport where the behaviors were identified as regulated . conversely , participants were frequently externally regulated ( the least autonomous response ) when they engaged in self - care and productive activities . they described productive activities as difficult only 16.3% of the time , social activities figure 2 shows that participants were intrinsically motivated to interact with family members and casual / intimate friends . however , they frequently perceived interaction with people at school / work as externally regulated . in terms of perceived social reciprocity , participants perceived relatively high levels of being listened to while interacting with family members ( mean [ m ] = 0.313 , sd = 1.139 ) and casual / intimate friends ( m = 0.281 , sd = 0.753 ) compared with people at school / work ( m = 0.004 , sd = 0.804 ) . further , they cared more about family members ( m = 0.345 , sd = 0.876 ) and casual / intimate friends ( m = 0.035 , sd = 0.985 ) than people at school / work ( m = -0.305 , sd = 0.736 ) . table 2 summarizes the results of the multilevel analyses of motivation and perceived difficulty of activities . participants were more likely to be self - determined while engaging in solitary / parallel leisure and social activities than in other activities . however , australian females displayed a weak relationship between self - determined motivation and solitary / parallel leisure ( or = 0.44 , 95% ci = 0.220.89 ) . regarding perceived difficulty , participants were more likely to report productive activities as difficult than other activities . participants with higher levels of global social anxiety had stronger relationships between perceived difficulty and engagement in productive activities ( or = 1.05 , 95% ci = 1.011.09 ) and social activities ( or = 1.08 , 95% ci = 1.031.14 ) . multilevel analyses in table 3 showed that participants were more likely to be self - determined while interacting with family members and casual / intimate friends than with other social partners . further , they were more likely to perceive higher levels of being listened to during interaction with casual / intimate friends . upon close inspection , global social anxiety moderated the relationship between thought of caring about others and interaction with casual / intimate friends ( =0.10 , standard error = 0.02 , p<0.01 ) . that is , participants with higher levels of global social anxiety were less likely to care about casual / intimate friends while interacting with them . table 2 summarizes the results of the multilevel analyses of motivation and perceived difficulty of activities . participants were more likely to be self - determined while engaging in solitary / parallel leisure and social activities than in other activities . however , australian females displayed a weak relationship between self - determined motivation and solitary / parallel leisure ( or = 0.44 , 95% ci = 0.220.89 ) . regarding perceived difficulty , participants were more likely to report productive activities as difficult than other activities . participants with higher levels of global social anxiety had stronger relationships between perceived difficulty and engagement in productive activities ( or = 1.05 , 95% ci = 1.011.09 ) and social activities ( or = 1.08 , 95% ci = 1.031.14 ) . multilevel analyses in table 3 showed that participants were more likely to be self - determined while interacting with family members and casual / intimate friends than with other social partners . further , they were more likely to perceive higher levels of being listened to during interaction with casual / intimate friends . upon close inspection , global social anxiety moderated the relationship between thought of caring about others and interaction with casual / intimate friends ( =0.10 , standard error = 0.02 , p<0.01 ) . that is , participants with higher levels of global social anxiety were less likely to care about casual / intimate friends while interacting with them . we explored the motivation for social engagement in everyday contexts among cognitively able adolescents and adults with asd through the lens of sdt , using esm as a methodology . we investigated the controversy whether cognitively able adolescents and adults with asd desire to engage socially . three possible perspectives have been proposed : they prefer not to engage socially;5,6 they wish to engage socially but express that desire more implicitly than explicitly;6,8,9 and the desire for social engagement is context specific as suggested by sdt.1214 our findings support the latter view . in line with sdt,12,14 the results suggest that cognitively able adolescents and adults with asd were motivated to interact in situations where they felt competent and experienced social reciprocity . specifically , they were motivated to engage in social activities where they did not experience significant difficulty . further , cognitively able adolescents and adults with asd were motivated to interact with friends and perceived their friends as listening to them during interactions . these findings indicate that social activities and interactions with friends are the everyday contexts that support basic psychological needs and facilitate motivation for engagement . consequently , they reported enjoying these social situations ( chen et al , unpublished data , 2015 ) . thus , our findings highlight the importance of context when exploring motivation for , and perceptions of , everyday social participation . perceiving the social contexts of interaction with friends as being listened to may reflect how cognitively able adolescents and adults with asd characterize friendship . our findings are similar to those of howard et al44 who found that adolescents with asd defined a friend as a person who provides care and responds to needs . these findings suggest that , whereas children consider friendships in terms of companionship,45 adolescents and adults value the affective components of friendship . in addition to the impact of context , our findings suggest that global social anxiety , an individual characteristic , influences perceptions of competence and social reciprocity in social interactions . individuals with higher global social anxiety were more likely to perceive social activities as difficult than those with lower levels of social anxiety . this finding may suggest that cognitively able individuals with asd who concurrently have social anxiety may be more self - aware of their social difficulties than those without social anxiety.46 the association between perception of difficulty in social activities and social anxiety may explain our previous finding of a negative relationship between time spent in social situations and severity of social anxiety ( chen et al , unpublished data , 2015 ) . in contrast to our current findings , other researchers15 have identified that adolescents with as are not intrinsically motivated to develop friendships . in addition to the difference in methodology used , the discrepancy in the findings may be explained by the extent to which basic needs to feel competent and related are met at different stages of a social interaction . when our participants responded to a signal from the ios device and indicated that they were already engaged in a social interaction with a trusted friend or partner other researchers , however , have described difficulty with the initiation of social interactions and establishing friendships,4 which may reflect a gap between social demands and their beliefs about their social skills.47,48 conscious awareness of being different and fear of being excluded may contribute to reduced feelings of relatedness;4 which , in turn , may result in fewer attempts at initiating everyday social interactions.11,49,50 presumably , friendships develop out of a motivation to engage with others ; if motivation is low because of unmet basic needs , then friendships will not follow . however , clearly our participants managed to establish some valued friendships . we did not find a significant relationship between interacting with friends and caring about what they were thinking or doing . this may reflect a core characteristic of asd : a lack of social reciprocity.3 deficits in understanding social or emotional cues of others and considering others perspectives may influence willingness to care about others.51,52 although our participants nominated friends , further research is required to investigate the meaning and true nature of their friendships . first , we did not recruit neurotypical adolescents and adults because the purpose of the study was to explore the motivation for social engagement and identify individual characteristics related to motivation and needs satisfaction among individuals with asd . thus , we do not know how the experiences of our participants compare with those of neurotypical adolescents and adults . further , because of the relatively low incidence of cognitively able adolescents and adults with autism , our participants represented a wide age range . second , due to different recruitment procedures , we were unable to match the number of males and females in australia and taiwan . we had more female participants in australia , probably due to their interest and willingness to volunteer.16 nonetheless , we did not find differences between groups as a function of nationality . finally , half of the participants from australia and a quarter of those from taiwan had comorbid mental health diagnoses . because of the relatively small sample size , we were not able to take into account the effects of additional diagnoses or medications on social experience . further research is needed to examine the effects of comorbidities and compare the findings with neurotypical adolescents and adults . while the application of multilevel analysis may offset the unequal numbers of male and female participants in the two countries,37 a larger sample size is required before the findings can be generalized . our findings highlight several important considerations for research and practice . exploring in - the - moment experiences may provide contextually accurate and detailed information to facilitate intervention to enhance social participation of cognitively able adolescents and adults with asd . although our participants were motivated and did not perceive significant difficulty while being engaged socially , they still spent limited time in social situations . researchers and professionals may need to consider ways to improve social skills and enhance perceived competence for initiating social interactions . perceived challenges with initiating social interaction may be the result of previous experiences ( eg , being excluded ) . given that severity of social anxiety was often associated with perceptions of social engagement , strategies targeting social anxiety management should be incorporated into interventions . because cognitively able adolescents and adults with asd were motivated to interact with friends , service providers and researchers may need to consider incorporating peers in intervention and promoting friendship as an important intervention outcome .
objectivethe purpose of the present study was to examine motivation for the contextual nature of motivations for social participation in cognitively able adolescents and adults with autism spectrum disorder , using self - determination theory as a theoretical framework.methodsfourteen australians and 16 taiwanese ( aged 1645 years ) with asperger s syndrome and high functioning autism were asked to carry a device which prompted them seven times / day for 7 days , to record what they were doing , with whom , perceived difficulty and social reciprocity , and the reasons for engaging in a situation , which were then coded into degree of self-determination.resultsmultilevel analyses showed that participants were more likely to be self - determined while engaging in solitary / parallel leisure and social activities than in other types of activities . interactions with family members and casual / intimate friends were also positively associated with self - determined motivation . further , participants were more likely to perceive higher levels of being listened to during interaction with casual / intimate friends than in interaction with other people . global social anxiety served as a moderator for their perceptions of difficulty and social reciprocity during social engagement.conclusionthe findings highlight the context - dependent motivations for social engagement of cognitively able individuals with autism spectrum disorder .
the use of nutritional supplements by athletes has been widespread in various sports and is growing rapidly . extra energy providing , performance improvement , prevention of fatigue , and compensation for insufficient diet , are among major reasons reported for supplement use by athletes,[38 ] whereas , there is little scientific evidence that confirms the beneficial effects of nutritional supplements in athletes . furthermore , there is some risks of an unintentional doping as a result of supplement use , too.[1114 ] several studies also have demonstrated some adverse effects of dietary supplements use such as cardiovascular , hematological , metabolic , and neurological problems.[1517 ] nevertheless , nutritional supplements manufacturers claim that their products are safe and improve performance of athletes . in the united states , consumers spending on supplements was increased from 6.5 billion $ in 1996 to 18 billion $ in 2002 . consumption includes dietary supplements , ergogenic aids , recovery nutrients , and sport foods among athletes is 46% to 100%.[192026 ] some of these supplements may cause harm or have potential health problems if use inappropriate . as our knowledge , there are not reports on nutritional supplements use by iranian university athletes ; therefore , the aims of this study were to assess the prevalence and type of supplement use , the reasons for use , the frequency of use , and relationships between use and age , body mass index , training load and type of sport . one hundred and ninety two male students from isfahan university of medical sciences were enrolled in this study . at first , the objectives of the study were explained and informed consent was obtained from all students . a questionnaire draft was sent to five athletes who are playing for sepahan novin sports club to determine clarity , in the beginning . the questionnaire included questions about supplementation patterns , type of sports , effects and side effects of consumption , place of obtaining , and recommendation resources . the contact details of the researchers were included at the end of questionnaire for any possible question . questions were about supplements usage within the past six months . in the data analyses , supplements were defined as dietary supplements ( proteins , amino acids , carbohydrates , slimming products , fish oils ) , ergogenic aids ( creatine , caffeine ) , and recovery nutrients ( vitamins , minerals , glucosamine / chondroitin sulphate ) . statistical analyses were conducted using the statistical program for the social sciences ( spss version 13 , inc . , chicago , il ) computer software package . pearson analysis was used to analyze the correlation between supplement use and the study variables . the characteristics of the students are shown in table 1 and type of products and frequency of use are presented in table 2 . general characteristics of the respondents type of supplements and frequency of use overall , 45% of respondents ( 78 students ) used some forms of nutritional supplements . no significant relationship was observed between the use of the supplements and age ( p = 0.3 ) , body mass index ( p = 0.24 ) , and training volume ( p = 0.18 ) . each athlete , however , took as many as 1.8 1.2 different supplemnts during the past six months . the most popular supplements were multivitamins ( 64% ) and vitamin c ( 42% ) , respectively . athletes , who participated in individual sports , were more likely to use dietary supplements ( p < 0.05 ) and ergogenic aids ( p < 0.01 ) . on the other hand , team sports table 3 shows that 45 supplement users ( 57.5% ) obtained their supplements from pharmacies , 31 ( 40% ) from sport supplements stores and 2 ( 2.5% ) from their friends . seventy - seven percent of them ( 60 ) had been recommended to take supplements by their friends , followed by their trainers ( 11.5% ) and advertisements ( 11.5% ) [ table 4 ] . correlation between supplement use and age , bmi and training volume in individual and team sports place of supplements obtaining by users the most frequent positive effects that reported from dietary supplements consumption included improved performance ( 34.6% ) , reduced fatigue ( 23% ) , and faster recovery ( 14.1% ) . this diversity may be explained by methodological differences such as data collection methods and definition of supplements . meanwhile , athletes in our study were not professional and they had physical activity alongside their study courses . in this study , this study , however , was conducted in male students , merely , and results might be different than a general population . students were also asked to recall only the past six months when estimating their supplement use because some of students were in first trimester . the most popular supplements consumed by athletes participated in team sports were the recovery nutrients . this might be explained by the finding that many vitamins and minerals have possible positive effects on aerobic capacity . dietary supplements and ergogenic aids more than the team sports athletes . these findings are supported by the sundgot - borgen et al . study . this is not similar with the slater findings that only one athlete , a canoeist , used creatine . although some studies show that creatine have ergogenic effects , nevertheless , these substance may have side effects . gastrointestinal distress , water retention and nephritis have been reported with creatine consumption in some studies.[3537 ] there is no enough scientific documents supporting the consumption of nutritional supplements in a healthy athlete following a balanced diet , but side effects are likely if supplements are consumed more than prescribed dosages . the american college of sports medicine ( acsm ) , the american dietetic association ( ada ) , and the canadian dietetic association , have declared that if energy intake of athletes is sufficient to maintain body weight at the time of training or competition , they do not require vitamin / mineral supplementation . however , a study showed an increasing inclination among athletes to use vitamin / mineral supplements more than general population . none of the supplement users in our study sought information on supplements from reliable resources such as healthcare professionals or textbooks [ table 5 ] . consistent with these results , 77.6% and 41% of the athletes in herbold and jacobson studies obtained information from family members , friends and the media . sources of recommendation most trainers and friends have little or no knowledge on sports nutrition ; therefore , their advice may be inaccurate or inappropriate . we did not consider sport foods such as sport drinks and sport bars and selected only male athletes ; these were the main limitations of our study . they had been recommended to take supplements by inappropriate resources but most of them , supplied the products from reliable places such as pharmacies .
background : the consumption of nutritional supplements is high in various sports , whereas , there are not enough documents supporting the beneficial effects of supplements in athletes . in addition , there is no information about taking supplements by iranian students who participate in sports . therefore , the goals of this study were to assess the type and prevalence of supplement use , the frequency of use , and relationships between consumption and age , body mass index , training load and type of sport.methods:one hundred ninety two male students from isfahan university of medical sciences participated in this study , voluntarily . a questionnaire that included questions about type and effects of supplements , recommendation resources , place of obtaining , and type of sports were sent to students . descriptive data were calculated as frequencies ( % ) . chi - square ( 2 ) analysis was used to analyze the correlation between supplement use and the study variables.results:forty-five percent of respondents used some forms of supplements . supplement users consumed 14 different supplements and each used as many as 1.8 1.2 various supplements during the past six months . multivitamins ( 64% ) and vitamin c ( 42% ) were the most popular supplements . students , who participated in individual sports , were more likely to consume dietary supplements ( p < 0.05 ) and ergogenic aids ( p < 0.01 ) , but team sports athletes , took more recovery nutrients ( p < 0.01 ) . fifty seven point five percent of student bought their products from pharmacies , 40% from sport supplements stores and 2.5% from their friends.conclusions:it can be concluded that less than half of these students consumed supplements and their information resources were inappropriate .
prospective epidemiologic studies have shown that blood levels of low - density lipoprotein cholesterol ( ldl - c ) significantly predict incident atherosclerotic cardiovascular disease ( cvd ) , and ldl - c - lowering therapy has been repeatedly demonstrated in many populations to reduce cvd risk . this has led to the formulation of risk prediction algorithms for identification of high - risk individuals and specific ldl - c goals to be achieved with lifestyle and pharmacological interventions . many individuals with normal ldl - c levels nevertheless develop cvd , particularly in older age groups . there is considerable heterogeneity among low - density lipoproteins ( ldl ) , ranging from small , dense , lipid - depleted particles to large , buoyant cholesterol - enriched particles . these particles have typically been grouped into four categories ranging from ldl1 ( largest ) to ldl4 ( smallest ) and subdivided even further into as many as eight subfractions . a number of studies have suggested that small ldl particles carry disproportionate atherogenic risk [ 47 ] . this suggests that treatment based on ldl - c levels alone potentially provides a suboptimal treatment for a significant proportion of at - risk individuals . high - density lipoprotein cholesterol ( hdl ) also has a strong epidemiological relationship with cvd , with increased hdl - c levels protective against disease , and is divided into two to three subfractions . as with ldl - c , some studies suggest that specific hdl subfractions are more predictive of cvd than hdl - c , whereas others suggest no distinction [ 913 ] . first described a risk - conferring lipid / lipoprotein profile , termed atherogenic dyslipidemia or the atherogenic lipoprotein phenotype , that comprises a higher proportion of small ldl particles , reduced hdl - c , and increased triglycerides . atherogenic dyslipidemia is characteristically seen in patients with obesity , the metabolic syndrome , insulin resistance , and type 2 diabetes mellitus [ 15 , 16 ] and has emerged as an important marker for the increased cvd risk observed in these populations . herein we review the present understanding of the contribution of atherogenic dyslipidemia to cvd , as well as the genetic and dietary influences underlying atherogenic dyslipidemia . besides the traditional blood lipid measurements of ldl - c , hdl - c , and triglycerides , there now exist a number of alternative measures that assess lipoprotein subfractions in some way . the best established is the measurement of the blood concentration of apolipoprotein b ( apob ) . each non - hdl particle including ldl particles , intermediate - density lipoprotein ( idl ) particles , very - low - density lipoprotein ( vldl ) particles , chylomicrons , and their remnants typically harbors one apob molecule . thus , the apob measure represents a count of non - hdl particles circulating in the bloodstream . more sophisticated techniques can quantify the numbers of particle within each lipoprotein class , as well as within subfractions of each lipoprotein class ; in addition , peak particle size within a class ( e.g. , ldl peak particle diameter ) can be calculated . these techniques include analytical ultracentrifugation , gradient gel electrophoresis , nuclear magnetic resonance ( nmr ) , and a relatively new gas - phase differential electrophoretic macromolecular mobility - based method ( termed as the ion mobility method ) . a number of studies have now used one of the lipoprotein subfraction measurement techniques to assess whether any of the subfractions have prognostic power for cvd or intermediate endpoints for cvd such as coronary calcium score or carotid intima - media thickness . notably , many of these studies find that the small ldl particle concentration predicts cardiovascular endpoints comparably to if not better than ldl - c [ 7 , 1721 ] . there is biological plausibility for a causal role of small ldl particles in atherosclerotic disease , with evidence that small , dense , lipid - poor ldl particles may be inherently more atherogenic than large ldl particles . they have greater susceptibility to oxidation than larger particles and thus may be more likely to instigate the inflammatory processes in vascular endothelium that underlie atherosclerotic disease . they bind more tightly to arterial proteoglycans and may penetrate into the arterial wall more easily . finally , small ldl particles have relatively lower affinity for the ldl receptor compared to mid - size particles , resulting in decreased cellular uptake and increased time spent circulating in the bloodstream , where the particles would have prolonged influence on the atherosclerotic process . however , each of the studies that have demonstrated that small ldl particle concentrations are predictive of cardiovascular endpoints also showed that the total ldl particle number ( ldl - p ) is similarly predictive [ 7 , 1721 ] . this is because the small ldl particle number is highly correlated with ldl - p . intuitively , this can be explained by the reasoning that among individuals with equal ldl - c levels , the same of amount of cholesterol distributed among a larger number of particles implies that the particles must be of smaller size on average . it is possible , then , that all ldl particles are similarly atherogenic and the association of increased small ldl particle concentrations with disease is simply the result of the increased number of ldl particles , rather than small ldl particles being uniquely atherogenic . epidemiological studies to date have not been able to unequivocally distinguish between these two possibilities . regardless of whether the small ldl particle number or ldl - p is used , either offers prognostic information distinct from the standard ldl - c measure obtained with a fasting lipid profile . reinforcing this point was the finding in the framingham offspring study that when participants were divided into four groups low ldl - c + low ldl - p , low ldl - c + high ldl - p , high ldl - c + low ldl - p , high ldl - c + high ldl - p stratification by ldl - p markedly discriminated by cvd event - free survival , whereas there was no difference seen with stratification by ldl - c . given the data suggesting a particular role for small ldl particles in cvd , and the epidemiological observation of the atherogenic lipoprotein phenotype of increased small ldl particle numbers , decreased hdl - c , and increased triglycerides , some lipoprotein assays have defined cutoffs for ldl peak particle size , with high particle sizes designated as pattern a ( normal ; defined as > 25.5 nm when measured by gradient gel electrophoresis ) and low particle sizes designated as pattern b ( having an increased proportion of small ldl particles and , thus , more likely to have atherogenic dyslipidemia ; defined as 25.5 nm when measured by gradient gel electrophoresis ) to aid clinicians in categorizing patients at risk for cvd . although numerous studies have demonstrated that some lipoprotein subfractions are predictive of cvd , none of these studies systematically analyzed the interrelationships among all of the various lipoprotein subfractions to determine whether there are distinct combinations of subfractions that independently confer cardiovascular risk . to address this question , we have applied the technique of principal component analysis to identify interrelated combinations of subfractions and determine their relationship with cvd in a large prospective cohort study , the malm diet and cancer - cardiovascular cohort ( mdc - cc ) . principal component analysis is a statistical method that analyzes the interrelationships between numerous variables and yields a fewer number of components that explain most of the correlation information of the original variables . each of the resulting components is an independent linear combination of the original variables ; furthermore , the components are fully independent of one another , i.e. , they have zero correlation . when we applied principal component analysis to eleven lipoprotein subfractions measured by ion mobility analysis of samples from more than 4,500 individuals in mdc - cc , we identified three major independent components , all of which were associated with incident cvd in the cohort [ 23 , 24 ] . notably , one of the three components represented a pattern of increased small and medium ldl particle concentrations , decreased large hdl particle concentrations , and increased triglycerides corresponding to atherogenic dyslipidemia . this component was much more highly associated with incident cvd events ( hazard ratio of 1.22 per 1 standard deviation ) than ldl - c ( hazard ratio of 1.10 per 1 standard deviation ) , indicating it to be a superior predictor of disease . the other two principal components represented ldl - associated cvd risk ( hazard ratio of 1.10 per 1 standard deviation ) and hdl - associated cvd protection ( hazard ratio of 0.81 per 1 standard deviation ) . thus , our analysis established that atherogenic dyslipidemia is an epidemiologically distinct risk factor for cvd than the traditional risk factors of ldl - c and hdl - c and represents an independent mechanistic pathway contributing to the pathogenesis of cvd . accordingly , there is a strong rationale to explore genetic and dietary modifiers of this pathway in order to better craft targeted interventions to reduce cvd risk . family - based segregation analyses suggest that the atherogenic lipoprotein phenotype has a strong genetic basis that likely reflects contributions from numerous genes [ 14 , 25 , 26 ] . candidate genes include those that influence ldl peak particle size ; family - based and twin studies indicate a large heritable component of ldl size , ranging from 40 to 60% of the trait . genes with variants that have been reported to be associated with ldl size include : cetp , encoding cholesteryl ester transfer protein , which exchanges cholesteryl esters and triglycerides from hdl lipoprotein particles to ldl particles ; ldlr , encoding the ldl receptor , which is responsible for cellular uptake of ldl particles from the bloodstream ; lpl , encoding lipoprotein lipase , which hydrolyzes triglycerides in chylomicrons and vldl particles , converting the latter to ldl particles , as well facilitating cellular lipoprotein uptake ; mtp , encoding microsomal triglyceride transfer protein , which transfers triglycerides to nascent vldl particles in hepatocytes ; and the apolipoprotein genes apoa5 , apob , apoc3 , and apoe , which are important constituents of varied lipoprotein particles [ 2535 ] . all of these genes play credible roles in determining the size and lipid content of ldl particles as well as other lipoprotein particles and so might directly contribute to atherogenic dyslipidemia . by applying principal component analysis in the mdc - cc this enabled us to perform genetic analyses on this specific component and thereby identify gene variants directly linked to the dyslipidemia profile , rather than a property of an individual lipoprotein ( such as ldl size ) . we took advantage of data from a recent genome - wide association study on lipid traits , which identified 30 genetic loci strongly linked to one or more of the blood ldl - c , hdl - c , and triglyceride levels . we assessed the strength of association between snps in each of these genetic loci and the atherogenic dyslipidemia component . we found that variants in six loci , harboring the cetp , lpl , apoa5 , lipc , galnt2 , and mlxipl genes , were highly associated with this component . in confirmation , each of the snps at these genes was also associated with small / medium ldl particle concentrations and in the opposite direction interestingly , the variants at all but two of the six genes ( cetp and apoa5 ) were not associated with ldl - c . thus , the mdc - cc study validated several of the genes previously linked to ldl size as also having variants associated with atherogenic dyslipidemia , as well as identifying a few novel candidate genes . the implicated genes may interact in biological pathways that regulate the different components of the dyslipidemia profile ; conceivably , interventions targeting one or more of these specific genes may modulate an individual s lipid / lipoprotein profile in a clinically favorable way and reduce the risk of cvd , even if they do not affect blood ldl - c levels . an important question is whether alterations in diet whether in regard to carbohydrate , fat , or saturated fat content have predictable effects on lipoprotein profiles and , specifically , atherogenic dyslipidemia . this has implications for nutritional counseling for patients at risk for cvd : which diets are likely to induce or worsen atherogenic dyslipidemia and thereby increase cvd risk , and thus should be avoided , and which diets may reverse the dyslipidemia and should be recommended . a related question is whether particular diets are of greater or less benefit in individuals with atherogenic dyslipidemia compared to those without it . in one study , 105 healthy middle - age men were placed on high - fat ( 46% of calories from fat ) , low - carbohydrate and low - fat ( 24% of calories from fat ) , high - carbohydrate diets in a crossover design in which they experienced 6 weeks on each diet . to simplify the interpretation of the study results , the proportions of types of fat ( unsaturated vs. saturated , 1:1 ratio ) and types of carbohydrates ( simple vs. complex , 1:1 ) remained fixed in these diets . across all subjects , there were significantly higher levels of triglycerides and the ldl3/ldl4 subfractions ( small and very small ldl particle concentrations ) , as well as lower hdl - c levels , while on the low - fat diet compared to the high - fat diet . thirty - six subjects who were pattern a or intermediate ( as judged by ldl peak particle diameter ) when on the high - fat diet converted to pattern b on the low - fat diet ; all of the individuals who were pattern b on the high - fat diet remained pattern b on the low - fat diet . in a follow - up study , the individuals who had been pattern a on both the high - fat and low - fat diets were subjected to a very - low - fat diet ( 10% of calories from fat , with replacement by carbohydrates ) . thus , reduction of fat along with increased carbohydrate intake altered lipoprotein profiles towards atherogenic dyslipidemia . of interest , individuals who were pattern b on a high - fat diet , when compared to those who were pattern a on a high - fat diet , experienced a much larger reduction in ldl - c when on a low - fat diet . this was confirmed in both men and in pre - menopausal women , with a two- to threefold greater reduction in ldl - c observed [ 39 , 40 ] . pattern a individuals experienced a larger decrease in ldl1 ( large ldl particle concentrations ) and an increase in ldl3 ( small ldl particle concentrations ) with little change in ldl2 ( medium - large particle concentrations ) , whereas pattern b individuals displayed a decrease in ldl2 with a smaller decrease in ldl1 and no change in ldl3 . besides explaining the discrepancy in ldl - c alteration , these observations also explain why many pattern a individuals converted to pattern b ( 35% ) but not vice versa ( 6% ) . extrapolating across all of these studies , the prevalence of pattern b increases with the amount of dietary carbohydrate and decreases with the amount of dietary fat . however , in these studies the changes in the proportions of calories derived from fat were largely balanced by reciprocal changes in calories from carbohydrates , making it difficult to determine whether dietary fat or carbohydrates are the major influence on atherogenic dyslipidemia . a study in 178 overweight men when compared on a higher - carbohydrate diet ( 54% of calories from carbohydrates , 1:1 simple : complex ) versus a lower - carbohydrate diet ( 39% of calories from carbohydrates , 1:1 simple : complex ) , between which the difference was made up of protein calories ( 15 vs. 29% ) rather than fat ( minimal change ) , the subjects had a higher prevalence of pattern b when on the higher - carbohydrate diet . this observation suggests that dietary carbohydrates are the principal driver of atherogenic dyslipidemia . a more complete analysis with the 178 overweight men was highly informative as to the effects of varying carbohydrates and saturated fat , as well as weight loss , on lipoprotein profiles . four diets were compared : ( 1 ) 54% of calories from carbohydrates ( 1:1 simple : complex ) with low saturated fat , ( 2 ) 39% of calories from carbohydrates ( 1:1 simple : complex ) with low saturated fat , ( 3 ) 26% of calories from carbohydrates ( 1:1 simple : complex ) with low saturated fat , and ( 4 ) 26% of calories from carbohydrates ( 1:1 simple : complex ) with high saturated fat . diets ( 1 ) and ( 2 ) had equal fat content , diets ( 3 ) and ( 4 ) had equal fat content that was higher than that of diets ( 1 ) and ( 2 ) . the subjects underwent a weight - maintenance phase of 3 weeks on the assigned diets , followed by a weight - loss phase of 5 weeks ( with a subsequent four - week weight stabilization period ) on the same diets . during the weight - maintenance phase , the subjects on the low - carbohydrate diets [ ( 3 ) and ( 4 ) ] experienced significant decreases in their triglyceride levels as well as their ldl3 and ldl4 levels ( small and very small ldl particle concentrations ) ; the individuals on the higher - carbohydrate diets displayed only modest changes . in contrast , during the weight - loss phase , the individuals on higher - carbohydrate diets experienced larger decreases in triglycerides and small ldl particle concentrations than did those on low - carbohydrate diets . thus , by the end of the study , the higher - carbohydrate subjects had caught up with the low - carbohydrate subjects . the lower the dietary carbohydrate content , the lower the prevalence of pattern b , both after the weight - maintenance phase and after the weight - loss phase , although the differences in the prevalence of pattern b were smaller after weight loss , again pointing to a catch - up phenomenon . comparing the low - saturated - fat and high - saturated - fat low - carbohydrate diets [ ( 3 ) vs. ( 4 ) ] , there were essentially no differences in changes in triglycerides , small ldl particle concentrations , or prevalence of pattern b , either in the weight - maintenance or weight - loss phases . this finding indicates that dietary saturated fat content has little influence on the components of the atherogenic lipoprotein phenotype . this agrees with the results of a study that compared the effects of four - week treatments with a high - saturated - fat diet ( 38% of calories from fat , with 20% of calories from saturated fat ) , a monounsaturated fatty acid ( mufa ) olive oil - rich diet ( 38% of calories from fat , with 22% of calories from mufa ) , and a high - carbohydrate diet ( 30% of calories from fat , with < 10% of calories from saturated fat , and 55% of calories from carbohydrates ) in 84 individuals . ( in all diets , ~40% of the carbohydrate calories came from simple carbohydrates , the remainder from complex carbohydrates . ) there were no differences in triglycerides , ldl size , or prevalence of pattern b between the high - saturated - fat and high - mufa diets ; in contrast , both high - fat diets yielded higher ldl sizes than the high - carbohydrate diet , with one - third of the subjects converting from pattern a to pattern b with the high - carbohydrate diet . the lack of difference in ldl size seen between the two high - fat diets is consistent with two earlier studies , one of which noted a minimal increase in ldl size with a high - mufa diet compared to a high - saturated - fat diet , the other of which reported no difference . finally , analysis of a prospective cohort study ( the framingham heart study ) confirmed that fat content in the diet , after multivariable adjustment for carbohydrate intake and a variety of other potential confounders , did not significantly affect ldl size or triglyceride levels in either men or women . this was true regardless of the quality of fat studied total fat , saturated fat , mufa , or polyunsaturated fatty acid ( pufa ) content . thus , it appears that both the quantity and quality of fat consumed ( assuming no change in the number of calories obtained from carbohydrates ) have minimal effects on the atherogenic lipoprotein phenotype . although it is possible that different types of carbohydrates may have different effects on lipoproteins , none of the discussed studies were able to shed light on this question , since in all cases the ratio of simple to complex carbohydrates was kept constant among the experimental diets . it would be desirable for future studies to directly compare diets in which the proportions of different types of carbohydrates are varied , with the overall number of calories coming from carbohydrates being held constant . in conclusion , either lowering the dietary carbohydrate content or losing weight appears to attenuate atherogenic dyslipidemia ( although there does not appear to be an additive effect of the two ) , whereas altering the total fat or saturated fat content has little influence . however , being placed on a lower - fat , higher - carbohydrate diet appears to result in lower ldl - c levels than a higher - fat , lower - carbohydrate diet , particularly for individuals starting with pattern b. thus , it remains unclear whether having high or low dietary carbohydrate content is more beneficial for cardiovascular health . it should be noted that the intervention studies described above were all short - term ( weeks ) and so were not able to compare long - term cvd outcomes resulting from the various diets . thus , we await long - term studies before these data can be used to help shape nutritional recommendations for patients at cvd risk . given that both genetics and diet contribute to the atherogenic lipoprotein phenotype , it is natural to expect that there may be interactions between the two factors . for example , individuals with specific variants in a gene may experience changes in lipoprotein concentrations when placed on a particular diet , whereas individuals with other variants in the gene may be resistant to the effects of that diet . another possibility is that individuals with one set of genetic variants may experience different types of lipoprotein changes than individuals with a different set of genetic variants , when all are placed on the same diet . this might manifest , for instance , as some individuals being more prone than others to developing atherogenic dyslipidemia on a high - carbohydrate diet . although data is sparse in regard to whether such interactions exist , some limited work suggests that interactions may play an important role in determining lipoprotein profiles and may thus be informative for cvd risk prediction . for example , knowledge of a patient s genetic information may allow medical providers and nutritional counselors to predict what lipoprotein changes are likely to occur if the patient starts a particular dietary intervention and , thus , better advise the patient regarding lifestyle changes . in one study , 50 individuals with pattern a lipoprotein profiles , offspring of 29 sets of parents , were tested for induction of pattern b with a very - high - carbohydrate diet . notably , all six of the subjects who converted to pattern b were descended from two pattern b parents . quantitatively , ldl peak particle size decreased to a greater degree in offspring of two pattern b parents than in offspring of two pattern a parents . these findings suggest that there is a heritable basis for the induction of atherogenic dyslipidemia by a carbohydrate - rich diet . a more detailed study was performed to examine the interaction of varied dietary fat content and variation in the apoa5 gene , one of the genes previously linked to atherogenic dyslipidemia [ 39 , 48 ] . an uncommon dna sequence variant in apoa5 ( ~6% frequency in individuals of european descent ) that alters the 19th amino acid of the apoa - v protein from serine to tryptophan , termed apoa5 * 3 , was compared to the usual variant at the dna base , termed apoa5 * 1 . individuals who had a genotype of * 1/*3 ( one of each variant ) , when compared to individuals with * 1/*1 ( two copies of the usual variant ) had higher small ldl particle concentrations and triglycerides , as well as higher prevalence of pattern b , regardless of whether they were on a low - fat or high - fat diet . also , there were higher small ldl particle concentrations and triglycerides and higher prevalence of pattern b when comparing all individuals on a low - fat diet compared to those on a high - fat diet . however , there were no differences in the relative changes of small ldl particle concentrations and triglycerides or relative rates of pattern b between * 1/*3 and * 1/*1 individuals on low - fat versus high - fat diets . thus , while both the * 3 allele and , separately , a low - fat diet influenced the lipoprotein profile towards atherogenic dyslipidemia , there was no evidence for an interaction between genotype and diet . interestingly , the only significant difference seen in the relative changes of lipoproteins between the two genotype groups on fat - varied diets was with the ldl2 subfraction ( corresponding to medium - large ldl particle concentrations ) , where * 1/*3 subjects experienced a threefold greater decrease in ldl2 than * 1/*1 subjects when on a low - fat diet versus a high - fat diet . thus , apoa5 did not appear to affect dietary induction of atherogenic dyslipidemia , though it did modulate dietary effects on some lipoproteins . a somewhat different analysis in the framingham heart study examined both the apoa5 * 3 variant as well as a different variant that alters a dna base in the apoa5 promoter ( 1131 t > c , termed apoa5 * 2 ) with respect to potential interactions with dietary fat intake in modulating lipoproteins . individuals with the apoa5 * 2 variant displayed increased triglycerides and smaller ldl size when the dietary pufa content was > 6% ( by calories ) ; individuals without the variant showed no differences with varied pufa intake . there were no interactions of the apoa5 * 2 variant with total fat , saturated fat , or mufa intake , nor were there any interactions of the apoa5 * 3 variant with any type of fat . thus , while both of the apoa5 studies discussed here suggest that apoa5 does influence the dietary effects of fat intake on lipoproteins , they disagree on the effects of specific gene variants . this highlights a critical problem in the study of gene - diet interactions , the lack of consistency between studies . in this example , the two studies differed in study design ( one was a short - term interventional study , the other an observational prospective cohort study ) , the types of diets examined ( one focused only on total fat intake , the other on total fat as well as specific types of fat ) , the variants examined ( one focused only on apoa5 * 3 , the other on both apoa5 * 2 and apoa5 * 3 ) , the measurement of lipoproteins ( one assessed each of the ldl subfractions , the other only ldl size ) , and the populations studied ( one focused on overweight men , the other on a population - based sample ) . as such , it is difficult to draw any firm conclusions from any one gene - diet study in the absence of replication by another study that examined the same question using similar methodologies . for example , one study demonstrated that a mediterranean - style , mufa - rich diet compared to a high - carbohydrate diet increased ldl size in individuals with certain apoe gene variants but decreased ldl size in those with other apoe variants ; this is potentially a clinically important observation , but no confirmatory study has yet emerged , calling this observation into doubt . as pointed out by others , the field would greatly benefit from increased collaboration and coordination of studies among international nutrition researchers . atherogenic dyslipidemia appears to be an important independent risk factor for cvd , confirmed by principal component analysis of lipoprotein subfractions in a large prospective cohort study . as the genetic basis of lipoprotein metabolism becomes better understood , gene variants contributing to atherogenic dyslipidemia are being identified ; these genes may serve as therapeutic targets to modulate the adverse effects of the dyslipidemia . it is clear that either reduction of dietary carbohydrate content or weight loss will improve an atherogenic dyslipidemic profile , whereas specifically altering fat or saturated fat content may have little influence . we await long - term clinical trials to assess whether genetic and/or dietary interventions with the intent of modifying the dyslipidemia will ultimately translate into reduction of cvd risk .
atherogenic dyslipidemia comprises a triad of increased blood concentrations of small , dense low - density lipoprotein ( ldl ) particles , decreased high - density lipoprotein ( hdl ) particles , and increased triglycerides . a typical feature of obesity , the metabolic syndrome , insulin resistance , and type 2 diabetes mellitus , atherogenic dyslipidemia has emerged as an important risk factor for myocardial infarction and cardiovascular disease . a number of genes have now been linked to this pattern of lipoprotein changes . low - carbohydrate diets appear to have beneficial lipoprotein effects in individuals with atherogenic dyslipidemia , compared to high - carbohydrate diets , whereas the content of total fat or saturated fat in the diet appears to have little effect . achieving a better understanding of the genetic and dietary influences underlying atherogenic dyslipidemia may provide clues to improved interventions to reduce the risk of cardiovascular disease in high - risk individuals .
this work was supported by the national cancer institute at the national institutes of health , ellipse game - on u19 initiative for prostate cancer ( u19 ca148537 ) . authors : david v. conti , kan wang , xin sheng , jeannette t. bensen , dennis j. hazelett , michael b. cook , sue a. ingles , rick a. kittles , sara s. strom , benjamin a. rybicki , barbara nemesure , william b. isaacs , janet l. stanford , wei zheng , maureen sanderson , esther m. john , jong y. park , jianfeng xu , victoria l. stevens , sonja i. berndt , chad d. huff , zhaoming wang , edward d. yeboah , yao tettey , richard b. biritwum , andrew a. adjei , evelyn tay , ann truelove , shelley niwa , thomas a. sellers , kosj yamoah , adam b. murphy , dana c. crawford , susan m. gapstur , william s. bush , melinda c. aldrich , olivier cussenot , gyorgy petrovics , jennifer cullen , christine neslund - dudas , mariana c. stern , zsofia - kote jarai , koveela govindasami , anand p. chokkalingam , ann w. hsing , phyllis j. goodman , thomas hoffmann , bettina f. drake , jennifer j. hu , peter e. clark , stephen k. van den eeden , pascal blanchet , jay h. fowke , graham casey , anselm j. m. hennis , ying han , alexander lubwama , ian m. thompson , jr , robin leach , douglas f. easton , fredrick schumacher , david j. van den berg , susan m. gundell , alex stram , peggy wan , lucy xia , loreall c. pooler , james l. mohler , elizabeth t. h. fontham , gary j. smith , jack a. taylor , shiv srivastava , rosalind a. eeles , john carpten , adam s. kibel , luc multigner , marie - elise parent , florence menegaux , geraldine cancel - tassin , eric a. klein , laurent brureau , daniel o. stram , stephen watya , stephen j. chanock , john s. witte , william j. blot , brian e. henderson , christopher a. haiman ; for the practical / ellipse consortium affiliations of authors : department of preventive medicine ( dvc , kw , xs , sai , mcs , yh , djvdb , smg , as , pw , lx , lcp , dos , beh , cah ) and department of translational genomics ( jc ) , keck school of medicine , and norris comprehensive cancer center ( sai , mcs , dos , beh , cah ) , university of southern california , los angeles , ca ; department of epidemiology ( jtb ) and lineberger comprehensive cancer center ( jtb , jlm ) , university of north carolina at chapel hill , chapel hill , nc ; bioinformatics and computational biology research center , biomedical sciences , cedars - sinai medical center , los angeles , ca ( djh ) ; division of cancer epidemiology and genetics , national cancer institute , national institutes of health , bethesda , md ( mbc , sib , sjc ) ; university of arizona college of medicine and university of arizona cancer center , tucson , az ( rak ) ; department of epidemiology , university of texas md anderson cancer center , houston , tx ( sss , cdh ) ; department of public health sciences , henry ford hospital , detroit , mi ( bar , cnd ) ; department of preventive medicine , stony brook university , stony brook , ny ( bn , ajmh ) ; james buchanan brady urological institute , johns hopkins hospital and medical institution , baltimore , md ( wbi ) ; division of public health sciences ( jls ) and swog statistical center ( pjg ) , fred hutchinson cancer research center , seattle , wa ; department of epidemiology , school of public health , university of washington , seattle , wa ( jls ) ; division of epidemiology , department of medicine , vanderbilt epidemiology center , vanderbilt university school of medicine , nashville , tn ( wz , wjb ) ; department of family and community medicine , meharry medical college , nashville , tn ( ms ) ; california prevention institute of california , fremont , ca ( emj ) ; department of health research and policy ( epidemiology ) ( emj ) and department of medicine ( awh ) , stanford cancer institute , stanford university school of medicine , stanford , ca ; department of cancer epidemiology ( jyp , tas ) and department of radiation oncology and cancer epidemiology ( ky ) , moffitt cancer center and research institute , tampa , fl ; program for personalized cancer care and department of surgery , northshore university healthsystem , evanston , il ( jx ) ; epidemiology research program , american cancer society , atlanta , ga ( vls , smg ) ; department of computational biology , st . jude children 's research hospital , memphis , tn ( zw ) ; university of ghana medical school , accra , ghana ( edy , yt , rbb , aaa , et ) ; korle bu teaching hospital , accra , ghana ( edy , yt , rbb , aaa , et ) ; westat , rockville , md ( at , sn ) ; department of urology , northwestern university , chicago , il ( abm ) ; institute for computational biology , department of epidemiology and biostatistics ( dcc , wsb ) and department of epidemiology and biostatistics ( fs ) , case western reserve university , cleveland , oh ( dcc , wsb ) ; division of epidemiology , department of thoracic surgery ( mca ) and department of medicine and urologic surgery ( jhf ) , vanderbilt university medical center ( pec ) , nashville , tn ; cerepp , grc no . 5 oncotype - uro , institut universitaire de cancrologie , upmc univ paris 6 , paris , france ( oc , gct ) ; department of surgery , center for prostate disease research , uniformed services university of the health sciences , bethesda , md ( gp , jc , ss ) ; the institute of cancer research , sutton , london , uk ( zkj , rae ) ; oncogenetics team , the institute of cancer research and royal marsden nhs foundation trust , sutton , uk ( kg ) ; school of public health , university of california , berkeley , berkeley , ca ( apc ) ; department of epidemiology and biostatistics ( th , jsw ) and institute for human genetics ( jsw ) , university of california , san francisco , ca ( th , jsw ) ; department of surgery , division of public health sciences , washington university school of medicine , st . louis , mo ( bfd ) ; sylvester comprehensive cancer center and department of public health sciences , university of miami miller school of medicine , miami , fl ( jjh ) ; division of research , kaiser permanente northern california , oakland , ca ( skvde ) ; university hospital of pointe - - pitre , guadeloupe ( pb , lb ) ; fwi and inserm u1085-irset , rennes , france ( pb , lb ) ; french west indies university , pointe - - pitre , guadeloupe , fwi ( pb , lb ) ; center for public health genomics , department of public health sciences , university of virginia , charlottesville , va ( gc ) ; chronic disease research centre and faculty of medical sciences , university of the west indies , bridgetown , barbados ( ajmh ) ; school of public health , makerere university college of health sciences , kampala , uganda ( al , sw ) ; department of urology , university of texas health science center at san antonio , san antonio , tx ( imtjr , rl ) ; centre for cancer genetic epidemiology , department of oncology , university of cambridge , cambridge , uk ( dfe ) ; department of urology , roswell park cancer institute , buffalo , ny ( jlm , gjs ) ; school of public health , louisiana state university health sciences center , new orleans , la ( ethf ) ; epigenetic and stem cell biology laboratory and epidemiology branch , national institute of environmental health sciences , research triangle park , nc ( jat ) ; royal marsden nhs foundation trust , london , uk ( rae ) ; division of urology , brigham and women 's hospital / dana - farber cancer institute , boston , ma ( ask ) ; washington university , st . louis , mo ( ask ) ; inserm u1085 irset , rennes , france ( lm ) ; inrs - institut armand - frappier , institut national de la recherche scientifique , university of quebec , laval , quebec , canada ( mep ) ; inserm , team cancer - environment , center for research in epidemiology and population health , universit paris - saclay , universit paris - sud , villejuif , france ( fm ) ; glickman urological and kidney institute , cleveland clinic , cleveland , oh ( eak ) ; uro care , kampala , uganda ( sw ) . additional members and affiliations appear in the supplementary note ( available online ) . the study funders had no role in the design of the study ; the collection , analysis , or interpretation of the data ; the writing of the manuscript ; or the decision to submit the manuscript for publication . a full listing of acknowledgements is detailed in the supplementary methods ( available online ) .
abstractprostate cancer incidence is 1.6-fold higher in african americans than in other populations . the risk factors that drive this disparity are unknown and potentially consist of social , environmental , and genetic influences . to investigate the genetic basis of prostate cancer in men of african ancestry , we performed a genome - wide association meta - analysis using two - sided statistical tests in 10 202 case subjects and 10 810 control subjects . we identified novel signals on chromosomes 13q34 and 22q12 , with the risk - associated alleles found only in men of african ancestry ( 13q34 : rs75823044 , risk allele frequency = 2.2% , odds ratio [ or ] = 1.55 , 95% confidence interval [ ci ] = 1.37 to 1.76 , p = 6.10 1012 ; 22q12.1 : rs78554043 , risk allele frequency = 1.5% , or = 1.62 , 95% ci = 1.39 to 1.89 , p = 7.50 1010 ) . at 13q34 , the signal is located 5 of the gene irs2 and 3 of a long noncoding rna , while at 22q12 the candidate functional allele is a missense variant in the chek2 gene . these findings provide further support for the role of ancestry - specific germline variation in contributing to population differences in prostate cancer risk .
however , hyperinsulinism , hypopituitarism , or hereditary hepatic enzyme deficiencies are considered in patients with persistent or refractory hypoglycemia ( 1 ) . insulinoma is the most common cause of hyperinsulinemic hypoglycemia ( 1 - 4/million patients ) and the second most common ( 10%-30% ) functioning pancreatic islet cell tumor associated with multiple endocrine neoplasia type 1 ( men1 ) ( 2,3 ) after gastrinoma . in contrast , only 4%-6% of patients with insulinoma will develop men1 ( 4 - 6 ) . unlike sporadic insulinomas that usually develop after the age of 40 , men - associated insulinomas usually occur before 40 years of age and even sometimes before 20 ( 7,8 ) . nevertheless , there are rare cases of insulinoma presenting as the first sign of men1 in the pediatric population . men is characterized by the occurrence of a tumor involving two or more endocrine glands within a single patient and has an equal sex distribution ( 9,10 ) . it encompasses tumors of the parathyroids ( 95% of cases ) , pancreatic islets ( 30%-80% ) , and anterior pituitary ( 15%-90% ) . we report a girl with a newly diagnosed men1 who presented with hypoglycemia as initial presentation . in may 2013 , a 9-year - old female presented with an episode of sudden loss of balance at home and some tremor . she had experienced occasional seizure like movements early in the morning for the past 3 months . the patient therefore ate more than usual and gained 10 kg within the previous year . she was not taking any prescription medications at the time of her evaluation . on the day of the hospital visit , she had experienced generalized tonic - clonic seizure that lasted for 5 minutes early in the morning . she weighed 41 kg with body mass index ( bmi ) of 22.5 kg / m . laboratory evaluation showed elevated insulin of 142.7 uiu / ml and elevated c - peptide at 5.88 ng / ml . her serum pth level was 15 pg / ml ( normal range , 1162 pg / ml ) , serum igf-1 was 298 ( normal range , 78517 ng / ml ) , serum prolactin level was 7.5 ng / ml ( normal range , 2.7 - 19.7 ng / ml ) and serum calcium level was 9.3 mg / dl ( normal range , 8.8 - 10.8 mg / dl ) . we then began to check for diseases that could cause hyperinsulinemic hypoglycemia and conducted an image work - up to rule out insulinoma . magnetic resonance study of the pancreas revealed a 1.3 1.5 cm nodule with high signal intensity on t2 weighted images , which appeared as a well circumscribed mass at the head of the pancreas and with hyposignal intensity on t1 weighted images ( fig . 1 ) . we suspected insulinoma and performed hepatic venous sampling , collecting 8 samples at the splenic vein , the superior mesenteric vein , and the portal vein . the insulin levels for the 8 samples were 127.1 , 126.7 , 115.2 , 118.4 , 251.6 , 129.8 , 458.6 , and 199.4 uiu / ml , with the highest levels in the portal vein . ( a ) a mass with hyposignal intensity on t1 weighted images , 1.3 1.5 cm . ( b ) high signal intensity on t2 weighted images at the head of the pancreas . histopathological evaluation of the pancreatic mass was consistent with insulinoma , specifically , a well differentiated pancreatic insulinoma with a grandular growth pattern and a fibrous stroma . immediately after removal of the mass , the patient s glucose level increased to 152 mg / dl . post - operative glucose levels were consistently over 100 mg / dl and she experienced no further hypoglycemic episodes . the patient was discharged in good health with proper glucose level . four months after the patient s hospital visit , her father had a health checkup due to occasional hypoglycemia and was diagnosed with pancreatic tumor , parathyroid tumor and prolactinoma . based on his daughter s history and the presence of three different tumors , he was suspected of men . dna sequencing analyses revealed that not only did the father have a mutation in the men1 gene , the patient and patient 's younger sister also had the same mutation ( fig . 2 ) . however , the younger sister had no symptoms or signs of men1 . we have monitored the patient with regular follow - ups at the out - patient department for a year and have not detected any abnormal signs or symptoms . ( c.1121_1126delacctgcinsgggga ) was found in the patient , patient 's father and younger sister . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional review board . the institutional review board of the ajou university hospital reviewed and approved the present genetic study ( ajirb - med - exp-15 - 109 ) . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional review board . the institutional review board of the ajou university hospital reviewed and approved the present genetic study ( ajirb - med - exp-15 - 109 ) . most cases of men1 are the familial form , which is inherited as an autosomal - dominant disorder . the sporadic form develops in 8%14% of patients with men1 and molecular genetic studies have confirmed the occurrence of de novo mutations of the men1 gene about 10% of patients with men1 ( 11,12 ) . a diagnosis of men1 may be established in an individual that fulfills one of three criteria . men1 may be clinically diagnosed in an individual based on the occurrence of two or more men1-associated endocrine tumors ( 4,13 ) . a diagnosis of familial men1 can be established in individuals with one of the men1-associated tumors who are first degree relatives of patients with a clinical diagnosis of men1 . finally , a genetic diagnosis of men1 is made upon identification of a germline men1 mutation in an individual who may be asymptomatic and has not yet developed any of the serum biochemical or radiological abnormalities indicative of tumor development ( 13 ) . in our case , genetic study of men1 was not performed because insulinoma was the only manifestation and there was no familial history at the first evaluation . however , her father s diagnosis led to additional dna sequencing analysis , resulting in the diagnosis of men1 in the patient . an electronic search of the pubmed database was conducted using the keywords insulinoma and men1 . the search was limited to children and all abstracts were screened for insulinoma with men1 , revealing only four pediatric cases . the minimum age of onset was 8 for men1 insulinoma ( age range 8 - 14 years ) ( 14 ) . our case was consistent with previous cases of pediatric men1 , in which patients diagnosed with hyperinsulinism - related hypoglycemia presented with loss of consciousness , seizure or syncope ( 14 - 17 ) and were treated with surgery . in the previously reported case , one patient died due to multiple metastases . metastases occur in up to 50% of patients with men1-associated insulinomas , compared to 10% of non - men1 insulinomas , in all age groups ( 3,18 ) . the international guideline of management and therapy in men1 mutations recommends a biochemical evaluation of prolactin serum concentration from age 5 , a biochemical screen of fasting total serum calcium concentration ( corrected for albumin ) from age 8 , a biochemical screen of fasting serum gastrin concentration from age 20 , magnetic resonance imaging ( mri ) of the head every 35 years from age 5 and abdominal ct or mri every 35 years from age 20 in children diagnosed with men1 mutation ( 9 ) . a biochemical screening for the fasting serum concentration of full - length pth , yearly chest ct , yearly somatostatin receptor scintigraphy and yearly octreotide scans are also recommended . in conclusion , this case reports men1 mutation in a 9-year - old girl that showed insulinoma as the first manifestation . early clinical and genetic identification of affected individuals is helpful for monitoring them and also for genetic counseling even if the patient shows only one manifestation that is not insulinoma .
multiple endocrine neoplasia ( men ) mutation is an autosomal dominant disorder characterized by the occurrence of parathyroid , pancreatic islet , and anterior pituitary tumors . the incidence of insulinoma in men is relatively uncommon , and there have been a few cases of men manifested with insulinoma as the first symptom in children . we experienced a 9-year - old girl having a familial men1 mutation . she complained of dizziness , occasional palpitation , weakness , hunger , sweating , and generalized tonic - clonic seizure that lasted for 5 minutes early in the morning . at first , she was only diagnosed with insulinoma by abdominal magnetic resonance images of a 1.3 x 1.5 cm mass in the pancreas and high insulin levels in blood of the hepatic vein , but after her father was diagnosed with men1 . we found she had familial men1 mutation , and she recovered hyperinsulinemic hypoglycemia after enucleation of the mass . therefore , the early genetic identification of men1 mutation is considerable for children with at least one manifestation .
nigella sativa l. ( ranunculaceae ) ( n. sativa ) is an annual herbaceous plant native to ( and cultivated in ) south west asia , and cultivated and naturalized in europe and north africa . n. sativa seeds are commonly known as black cumin , and have been used as a spice and a condiment . in traditional medicine , n. sativa has been used in different forms to treat many diseases including asthma , hypertension , diabetes , inflammation , cough , bronchitis , headache , eczema , fever , dizziness and influenza ( 1 , 2 ) . recent research reports conducted in muslim countries have shown that n. sativa is very commonly used by cancer patients as dietary supplement ( ds ) in complementary and alternative medicine ( cam ) along with chemotherapy ( 3 , 4 ) . n. sativa seed extract , fixed oil and essential oil showed a wide spectrum of favorable biological activities , the most prominent being antioxidant ( 2 , 5 - 7 ) , anti - inflammatory ( 2 , 8 , 9 ) , antibacterial ( 10 - 12 ) , hepatoprotective ( 13 - 17 ) , antimutagenic ( 18 , 19 ) and antitumor ( 20 - 22 ) activities . the plant attracts the interest of researchers all over the world , and a lot of investigations have reported its importance . searching the database pubmed for the keyword , black cumin , gives 645 results , and searching for the keyword , nigella sativa , gives more than 582 results . in preparing this review article we used the key words , nigella sativa and thymoquinone , and the most recently published articles are cited in this review . n. sativa seeds contain fixed oil , proteins , alkaloids , saponins , and essential oil . the biological effects of n. sativa are attributed to the various characterized constituents ( 1 ) . thymoquinone ( tq ) , the most prominent constituent of n. sativa seeds essential oil has been intensively investigated , 406 research reports have been posted on the pubmed database about tq since 1960 . a selection of these properties will be discussed ( table 1 ) . selected pharmacological effects of thymoquinone to investigate the cytoprotective effects of tq against acetaminophen - induced hepatotoxicity , wistar albino rats were given 500 mg / kg acetaminophen orally , followed by three doses of tq at a total dose of 15 mg / kg within an 18 hr time interval ( three times 5 mg / kg oral thymoquinone for every six hr ) . the levels of serum alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , tissue levels of malondialdehyde ( mda ) , oxidized glutathione ( gssg ) , and superoxide dismutase ( sod ) activity were found to be lower compared to that of rats treated with acetaminophen only . histopathological studies further revealed significant liver necrosis and toxicity with acetaminophen treatment , whereas those of tq treatment significantly lowered liver injury scores ( 23 ) . supplementation of tq ( 2 mg / kg / day ) for 5 days before acetaminophen administration reversed the acetaminophen - induced increase in alt , total nitrate / nitrite and lipid peroxide , and the decrease of reduced gsh and atp . tq was effective in protecting mice against acetaminophen - induced hepatotoxicity possibly via increased resistance to oxidative and nitrosative stress ( 24 ) . treatment with anti - cancer drugs like the alkylating agent 5-(aziridin-1-yl)-2,4-dinitrobenzamide ( cb 1954 ) is associated with significant hepatotoxicity . balb / c mice transplanted with the mouse mammary cancer cell line ( 66cl-4-gfp ) were treated in vivo with the antitumor drug cb 1954 ( 141 mg / kg ) , tq ( 10 mg / kg ) , and a combination of cb 1954 and tq . histological examination revealed significant tumor regression and maintenance of the liver enzymes alt and ast in the combined treatment compared to cb 1954 alone ( 25 ) . furthermore , the effects of aqueous extracts of n. sativa seeds ( 50 mg / kg ) or tq ( 5 mg / kg in corn oil ) applied by gavage for 5 days were investigated on detoxifying enzymes and glutathione by comparing healthy and ccl4-challenged ( 1 ml / kg in corn oil , intraperitoneally , a single dose ) rats . both n. sativa and tq reduced the increased levels of serum alt activity , the levels of oxidized glutathione , and the stress ratio caused by ccl4 . both n. sativa and tq also ameliorated the reduced messenger rna ( mrna ) levels of glutathione s - transferase ( gst ) , nad ( p ) h - quinone oxido - reductase ( nqo1 ) , and microsomal epoxide hydrolase ( ephx1 ) , as well as the reductions in reduced glutathione and cysteine levels caused by ccl4 . this protection may be attributed to the increased transcription of chemoprotective enzyme mrnas ( 26 ) . tq supplementation also normalized liver reduced glutathione ( gsh ) and decreased the levels of mda and caspase-3 activity in the liver , and reduced serum tumor necrosis factor - alpha ( tnf - alpha ) , serum total bilirubin and the activities of alkaline phosphatase ( alp ) and gamma - glutamyl transferase ( gamma - gt ) enzymes . histopathological examination revealed that tq administration improved lipopolysaccharide ( lps)-induced pathological abnormalities in liver tissues ( 27 ) . summarizing these investigations revealed a protective effect of tq against the cytotoxicity of different agents in vivo . cyto- and genotoxicity evaluation of tq in primary rat hepatocyte cultures at final concentrations ranging from 1.25 to 20 m and three hr exposure , in contrast to the in vivo studies , revealed cytotoxicity of tq as evidenced by increased levels of necrotic cells at concentrations between 2.5 and 20 m , and gave also evidence for genotoxicity at concentrations 1.25 m using the same assay system ( 28 ) . serum / glucose deprivation - induced dna damage was significantly decreased in pc12 cells pretreated with n. sativa extract and tq ( 29 ) . for the in vivo cytoprotective studies absolute doses ranging from 2 to 10 mg / kg of animal body weight for a period of 15 days were applied ( 23 - 25 ) . taking the pharmacodynamics and pharmacokinetics of the compound into consideration , the effective concentration in vivo is certainly lower than the final concentrations applied directly to hepatocyte primary cultures in vitro . furthermore , an acute treatment like this does not allow any adaptive response , which will gradually establish . there are many reports on the anti - inflammatory activity of tq ( 30 - 50 ) . kundu et al ( 30 ) , stated that the anti - inflammatory effect of tq is caused by the upregulated expression of heme - oxygenase 1 ( ho-1 ) in human keratinocytes ( hacat ) by activating nuclear factor ( nf)-erythroid2-(e2)-related factor-2 ( nrf2 ) via reactive oxygen species ( ros)-mediated phosphorylation of protein kinase b ( pkb / akt ) and cyclic amp - activated protein kinase - alpha ( ampkalpha ) . according to bai et al ( 37 ) , tq attenuated thioacetamide ( taa)-induced liver fibrosis accompanied by reduced protein and mrna expression of of -smooth muscle actin ( -sma ) , collagen - i and tissue inhibitor of toll - like receptor 4 ( tlr4 ) and decreased pro - inflammatory cytokine levels . it also inhibited phosphatidylinositol 3-kinase phosphorylation and enhanced the phosphorylation of adenosine monophosphate - activated protein kinase ( ampk ) and liver kinase b ( lkb ) . tq has also been reported to inhibit the effects of 12-o - tetradecanoylphorbol-13-acetate ( tpa)-induced expression of cyclooxygenase-2 ( cox-2 ) and nuclear factor kappa - light - chain - enhancer of activated b cells ( nf-b ) ( 38 ) . n. sativa and tq treatment also suppressed the expression of the cox-2 enzyme in the pancreatic tissue of streptozotocin ( stz)-induced diabetic rats ( 39 ) . the anti - ulcerative effect of n. sativa and tq was demonstrated by kanter et al ( 40 , 41 ) by investigating ethanol induced mucosal ulceration in rats , which was inhibited by pretreatment with tq and n. sativa . furthermore , oral administration of tq in wistar rats at 5mg / kg body weight for 21 days led to a significant reduction of the levels of different pro - inflammatory mediators ( il-1 , il-6 , tnf , ifn and pge(2 ) ) ( 42 ) . intraperitoneal treatment of mice with thymoquinone ( 6 mg / kg ; ip ) , 24 and 1 hr before intratracheal treatment with diesel exhaust particles ( dep ) ( 30 g / mouse ) , prevented pulmonary inflammation and the increase of airway resistance caused by dep , and inhibited the increase of blood leukocyte numbers and plasma il-6 concentrations ( 43 ) . the effects of tq on airway inflammation in a mouse model of allergic asthma were investigated by intraperitoneal injection of tq before airway challenge of ovalbumin ( ova)-sensitized mice , and caused a marked decrease in lung eosinophilia and elevated th2 cytokines - both in vivo and in vitro - following stimulation of lung cells with ova . histological examination of lung tissue demonstrated that the compound significantly inhibited allergen - induced lung eosinophilic inflammation and mucus - producing goblet cells ( 44 ) . using an asthmatic murine model , tq has also been demonstrated to have a high potential in inhibiting the inflammatory changes associated with asthma , especially the aggregation of inflammatory cells in bronchoalveolar lavage ( bal ) fluid and in lung tissues . in addition it inhibited mrna expression of inducible nitric oxide synthase ( inos ) and transforming growth factor-1 ( tgf-1 ) ( 45 ) . in experiments on ovalbumin - sensitized guinea pigs and sulfur mustard exposed guinea pigs , an outstanding evidence of the preventive anti - inflammatory effects of tq and n. sativa has been reported ( 46 - 50 ) . different extracts , mainly aqueous extracts , from n. sativa seeds proved to possess relaxant ( bronchodilatory ) effects on tracheal chains of guinea pigs ( 51 ) . thymoquinone and thymohydroquinone inhibited in vitro non - enzymatic lipid peroxidation in hippocampal homogenates induced by iron - ascorbate ( 52 ) . pretreatment of male nmri rats with tq and n. sativa oil significantly decreased lipid peroxidation levels measured as mda in hippocampus portion following cerebral ischemia - reperfusion injury ( iri ) ( 53 ) . according to abdel - wahab and aly ( 6 ) , n. sativa oil neutralized the toxicity of aflatoxins , and treatment with n. sativa oil of rats fed an aflatoxin - contaminated diet resulted in significant protection against aflatoxicosis . recent reports further demonstrate that tq at a dose of 9 mg / kg body weight protects liver injury induced by aflatoxin b1 ( afb1 ) as evidenced by a reduction of the serum concentrations of ast , alt and alp as marker enzymes for liver injury . when rats were pretreated with tq followed by afb1 the gsh content of the liver was restored and mda production prevented ( 54 ) . n. sativa oil and its active component , tq have also been shown to protect brain tissue from radiation - induced nitrosative stress ( 55 ) . oral administration of tq in wistar rats at 5 mg / kg body weight for 21 days resulted in a significant reduction of the levels of different antioxidant parameters ( myeloperoxidase mpo , lpo , gsh , catalase ( cat ) , sod and no ) in collagen induced arthritis ( cia ) ( 42 ) , and similarly reduced the fe(iii ) nitrilotriacetic acid ( fe - nta ) induced oxidative stress after oral administration in wistar rats ( 56 ) . furthermore , the glycation of sod by glucose or methylglyoxal ( mg ) and its protection by tq has been investigated . incubation of sod with glucose at 37c resulted in a progressive decrease in the activity of the enzyme due to fragmentation , evidenced by a decrease in the amount of protein on sds - page gels . on the other hand , incubation of sod with mg or both glucose and mg glucose at 37c caused protein cross linking evidenced by the formation of high molecular weight aggregates . tq offered protection against glucose or methylglyoxal ( mg ) induced loss of sod activity and fragmentation or cross - linking ( 57 ) . pretreatment of wistar rats with tq and 1,2-dimethylhydrazine ( dmh ) for 10 weeks prevented the depletion of antioxidant enzymes catalase , glutathione peroxidase , and superoxide dismutase in red blood cells and maintained a similar value as the control group . at the same time , it prevented erythrocyte damage in dmh - induced colon post initiation carcinogenesis in rats ( 58 ) . tq and n. sativa oil possess cytoprotective effects against the anti - cancer drugs cyclophosphamide ( ctx ) via maintenance of hemoglobin and blood sugar levels , and the activities of liver enzymes , bilirubin , urea , creatinine , lipids ( triglyceride , cholesterol and low - density lipoprotein ( ldl)-cholesterol ) and lipid peroxidation in the liver . the cytoprotective effects of n. sativa oil and tq were associated with induction of antioxidant mechanisms ( 59 ) . neuron - protective effects have also been studied in cultured hippocampal and cortical neurons treated with amyloid- peptide ( a1 - 42 ) and tq simultaneously for 72 h. tq efficiently attenuated a1 - 42-induced neurotoxicity by improving cell viability . it has also been shown to inhibit mitochondrial membrane potential depolarization and the generation of reactive oxygen species caused by a1 - 42 , and to restore synaptic vesicle recycling inhibition and to partially reverse the loss of spontaneous firing activity , and a1 - 42 aggregation in vitro ( 60 ) . there has been growing interest in natural compounds with anti - cancer properties because they are presumably non - toxic to healthy cells and are available in a readily digestible form . there is a wide consensus in cancer research that tq has promising anti - cancer activity . thus it may be useful as a dietary supplement to enhance the effects of anti - cancer drugs . there is evidence that tq induces p53-independent apoptosis via the activation of caspase-8 and caspases 9 and 3 in the caspase cascade . it also modulates the bax / bcl2 ratio by upregulation of proapoptotic bax and down - regulation of antiapoptotic bcl2 proteins in p53-null hl-60 cells during apoptosis ( 61 ) . investigating the anti - cancer effects of tq on a549 non - small cell lung cancer cells exposed to benzo(a)pyrene , ulasli et al ( 62 ) found that tq treatment up - regulated bax and down - regulated bcl2 proteins , and increased the bax / bcl2 ratio . it also decreased the expression of cyclin d and increased the expression of p21 , and it up - regulated trail receptor 1 and 2 expression . these molecular events lead to regulatory p53 levels affecting the induction of g2/m cell cycle arrest and apoptosis . in breast cancer cells tq was able to increase peroxisome proliferator - activated receptor gamma ( ppar- ) activity and to down - regulate the expression of the genes for bcl-2 , bcl - xl and survivin . more importantly , the increase in ppar- activity was prevented in the presence of ppar- specific inhibitors and ppar- dominant negative plasmids , suggesting that tq may act as a ligand of ppar- ( 63 ) . treatment of human breast carcinoma in both in vitro and in vivo models demonstrated antiproliferative and proapoptotic effects of tq , which are mediated by its inductive effect on p38 and ros signaling . tq possesses anti - tumor effects in breast tumor xenograft mice and it potentiates the antitumor effect of doxorubicin ( 64 ) . tq has also been shown to inhibit the growth of the human cholangiocarcinoma ( cca ) cell lines tfk-1 and hucct1 in a dose- and time - dependent manner . the mechanism of cca cell line growth inhibition is exerted by down - regulation of pi3k / akt and nf-b , and regulated gene products , including x - linked inhibitor of apoptosis protein ( xiap ) , vascular endothelial growth factor ( vegf ) , p - akt , p65 , bcl-2 and cox-2 ( 65 ) . tq also exerts an inhibitory effect on migration of metastatic human ( a375 ) and mouse ( b16f10 ) melanoma cells by inhibition of nlrp3 inflammasome resulting in a decreased proteolytic cleavage of caspase-1 . thus , it can be a potential immunotherapeutic agent not only in adjuvant therapy for melanoma , but also in the control and prevention of metastatic melanoma ( 66 ) . tq is also a microtubule - targeting agent ( mta ) , and binds to the tubulin - microtubule network , thus preventing microtubule polymerization and causing mitotic arrest and apoptosis of a549 cells but not of normal huvec cells ( 67 ) . investigating the putative anti - cancer activities of tq on / tubulin expression in human astrocytoma cells ( cell line u87 , solid tumor model ) and in jurkat cells ( t lymphoblastic leukaemia cells ) evidence was provided for tq to target the level of / tubulin proteins in cancer cells . the degradation found was associated with the upregulation of the tumor suppressor p73 with subsequent induction of apoptosis . no effect on / tubulin protein expression these data indicate that tq exerts a selective effect on / tubulin in cancer cells ( 68 ) . furthermore , tq effects on human topoisomerase ii were investigated and demonstrated that it enhances enzyme - mediated dna cleavage 5-fold , which is similar to the anti - cancer drug etoposide indicating that tq can be considered as human type ii topoisomerase poison ( 69 ) . the majority of patients with glioblastoma , the most aggressive malignant astrocytic brain tumor in adults , experience a recurrence of the tumor because of these cells ` resistance to apoptotic cell death following ionizing radiation and chemotherapy with temozolomide ( tmz ) , and an increased autophagy , tq proved to induce caspase - dependent apoptosis and to inhibit autophagy of glioblastoma cells ( 70 ) . by studying the mechanisms of cytotoxicity on neuroblastoma ( neuro-2a ) cells it was additionally found that tq induces apoptosis by increasing the bax / bcl-2 ratio , which leads to the release of cytochrome c from mitochondria into the cytoplasm . tq treatment also directs the activation of caspase-3 followed by the cleavage of poly ( adp - ribose ) polymerase ( parp ) and down - regulates the caspase inhibitor xiap ( 71 ) . cytotoxicity of tq was also tested in triple - negative breast cancer ( tnbc ) cells that lack functional tumor suppressor p53 . tq treated cells showed g1 phase cell cycle arrest and apoptosis characterized by the loss of mitochondrial membrane integrity as evidenced by release of cytochrome c and caspase 9 activation ( 72 ) . thymoquinone treatment also inhibits the proliferation of multiple myeloma ( mm ) cells and potentiates the apoptotic effect of bortezomib in various mm cell lines via the activation of caspase-3 , resulting in the cleavage of parp . tq treatment also inhibits chemotaxis and invasion induced by c - x - c motif chemokine 12 ( cxcl12 ) in mm cells in vitro and a xenograft mouse model ( 73 ) . it increases levels of ros and mrnas of the oxidative stress - related genes , nqo1 and ho-1 . pretreatment of hepg2 cells with n - acetylcysteine , a scavenger of ros , prevented tq - induced cell death . tq treatment also stimulated mrna expression of pro - apoptotic bcl - xs and trail death receptors , and inhibited expression of the anti - apoptotic gene bcl-2 . conclusively , tq enhanced trail - induced death of hepg2 cells , in part by upregulating trail death receptors , inhibiting nf-b and il-8 and stimulating apoptosis . these manifold molecular mechanisms of tq - dependent suppression of hcc cell growth underscore the potential of this compound as anti - hcc drug ( 74 ) . n. sativa seeds contain fixed oil , proteins , alkaloids , saponins , and essential oil . the biological effects of n. sativa are attributed to the various characterized constituents ( 1 ) . thymoquinone ( tq ) , the most prominent constituent of n. sativa seeds essential oil has been intensively investigated , 406 research reports have been posted on the pubmed database about tq since 1960 . a selection of these properties will be discussed ( table 1 ) . selected pharmacological effects of thymoquinone to investigate the cytoprotective effects of tq against acetaminophen - induced hepatotoxicity , wistar albino rats were given 500 mg / kg acetaminophen orally , followed by three doses of tq at a total dose of 15 mg / kg within an 18 hr time interval ( three times 5 mg / kg oral thymoquinone for every six hr ) . the levels of serum alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , tissue levels of malondialdehyde ( mda ) , oxidized glutathione ( gssg ) , and superoxide dismutase ( sod ) activity were found to be lower compared to that of rats treated with acetaminophen only . histopathological studies further revealed significant liver necrosis and toxicity with acetaminophen treatment , whereas those of tq treatment significantly lowered liver injury scores ( 23 ) . supplementation of tq ( 2 mg / kg / day ) for 5 days before acetaminophen administration reversed the acetaminophen - induced increase in alt , total nitrate / nitrite and lipid peroxide , and the decrease of reduced gsh and atp . tq was effective in protecting mice against acetaminophen - induced hepatotoxicity possibly via increased resistance to oxidative and nitrosative stress ( 24 ) . treatment with anti - cancer drugs like the alkylating agent 5-(aziridin-1-yl)-2,4-dinitrobenzamide ( cb 1954 ) is associated with significant hepatotoxicity . balb / c mice transplanted with the mouse mammary cancer cell line ( 66cl-4-gfp ) were treated in vivo with the antitumor drug cb 1954 ( 141 mg / kg ) , tq ( 10 mg / kg ) , and a combination of cb 1954 and tq . histological examination revealed significant tumor regression and maintenance of the liver enzymes alt and ast in the combined treatment compared to cb 1954 alone ( 25 ) . furthermore , the effects of aqueous extracts of n. sativa seeds ( 50 mg / kg ) or tq ( 5 mg / kg in corn oil ) applied by gavage for 5 days were investigated on detoxifying enzymes and glutathione by comparing healthy and ccl4-challenged ( 1 ml / kg in corn oil , intraperitoneally , a single dose ) rats . both n. sativa and tq reduced the increased levels of serum alt activity , the levels of oxidized glutathione , and the stress ratio caused by ccl4 . both n. sativa and tq also ameliorated the reduced messenger rna ( mrna ) levels of glutathione s - transferase ( gst ) , nad ( p ) h - quinone oxido - reductase ( nqo1 ) , and microsomal epoxide hydrolase ( ephx1 ) , as well as the reductions in reduced glutathione and cysteine levels caused by ccl4 . this protection may be attributed to the increased transcription of chemoprotective enzyme mrnas ( 26 ) . tq supplementation also normalized liver reduced glutathione ( gsh ) and decreased the levels of mda and caspase-3 activity in the liver , and reduced serum tumor necrosis factor - alpha ( tnf - alpha ) , serum total bilirubin and the activities of alkaline phosphatase ( alp ) and gamma - glutamyl transferase ( gamma - gt ) enzymes . histopathological examination revealed that tq administration improved lipopolysaccharide ( lps)-induced pathological abnormalities in liver tissues ( 27 ) . summarizing these investigations revealed a protective effect of tq against the cytotoxicity of different agents in vivo . cyto- and genotoxicity evaluation of tq in primary rat hepatocyte cultures at final concentrations ranging from 1.25 to 20 m and three hr exposure , in contrast to the in vivo studies , revealed cytotoxicity of tq as evidenced by increased levels of necrotic cells at concentrations between 2.5 and 20 m , and gave also evidence for genotoxicity at concentrations 1.25 m using the same assay system ( 28 ) . serum / glucose deprivation - induced dna damage was significantly decreased in pc12 cells pretreated with n. sativa extract and tq ( 29 ) . for the in vivo cytoprotective studies absolute doses ranging from 2 to 10 mg / kg of animal body weight for a period of 15 days were applied ( 23 - 25 ) . taking the pharmacodynamics and pharmacokinetics of the compound into consideration , the effective concentration in vivo is certainly lower than the final concentrations applied directly to hepatocyte primary cultures in vitro . furthermore , an acute treatment like this does not allow any adaptive response , which will gradually establish . there are many reports on the anti - inflammatory activity of tq ( 30 - 50 ) . kundu et al ( 30 ) , stated that the anti - inflammatory effect of tq is caused by the upregulated expression of heme - oxygenase 1 ( ho-1 ) in human keratinocytes ( hacat ) by activating nuclear factor ( nf)-erythroid2-(e2)-related factor-2 ( nrf2 ) via reactive oxygen species ( ros)-mediated phosphorylation of protein kinase b ( pkb / akt ) and cyclic amp - activated protein kinase - alpha ( ampkalpha ) . according to bai et al ( 37 ) , tq attenuated thioacetamide ( taa)-induced liver fibrosis accompanied by reduced protein and mrna expression of of -smooth muscle actin ( -sma ) , collagen - i and tissue inhibitor of toll - like receptor 4 ( tlr4 ) and decreased pro - inflammatory cytokine levels . it also inhibited phosphatidylinositol 3-kinase phosphorylation and enhanced the phosphorylation of adenosine monophosphate - activated protein kinase ( ampk ) and liver kinase b ( lkb ) . tq has also been reported to inhibit the effects of 12-o - tetradecanoylphorbol-13-acetate ( tpa)-induced expression of cyclooxygenase-2 ( cox-2 ) and nuclear factor kappa - light - chain - enhancer of activated b cells ( nf-b ) ( 38 ) . n. sativa and tq treatment also suppressed the expression of the cox-2 enzyme in the pancreatic tissue of streptozotocin ( stz)-induced diabetic rats ( 39 ) . the anti - ulcerative effect of n. sativa and tq was demonstrated by kanter et al ( 40 , 41 ) by investigating ethanol induced mucosal ulceration in rats , which was inhibited by pretreatment with tq and n. sativa . furthermore , oral administration of tq in wistar rats at 5mg / kg body weight for 21 days led to a significant reduction of the levels of different pro - inflammatory mediators ( il-1 , il-6 , tnf , ifn and pge(2 ) ) ( 42 ) . intraperitoneal treatment of mice with thymoquinone ( 6 mg / kg ; ip ) , 24 and 1 hr before intratracheal treatment with diesel exhaust particles ( dep ) ( 30 g / mouse ) , prevented pulmonary inflammation and the increase of airway resistance caused by dep , and inhibited the increase of blood leukocyte numbers and plasma il-6 concentrations ( 43 ) . the effects of tq on airway inflammation in a mouse model of allergic asthma were investigated by intraperitoneal injection of tq before airway challenge of ovalbumin ( ova)-sensitized mice , and caused a marked decrease in lung eosinophilia and elevated th2 cytokines - both in vivo and in vitro - following stimulation of lung cells with ova . histological examination of lung tissue demonstrated that the compound significantly inhibited allergen - induced lung eosinophilic inflammation and mucus - producing goblet cells ( 44 ) . using an asthmatic murine model , tq has also been demonstrated to have a high potential in inhibiting the inflammatory changes associated with asthma , especially the aggregation of inflammatory cells in bronchoalveolar lavage ( bal ) fluid and in lung tissues . in addition it inhibited mrna expression of inducible nitric oxide synthase ( inos ) and transforming growth factor-1 ( tgf-1 ) ( 45 ) . in experiments on ovalbumin - sensitized guinea pigs and sulfur mustard exposed guinea pigs , an outstanding evidence of the preventive anti - inflammatory effects of tq and n. sativa has been reported ( 46 - 50 ) . different extracts , mainly aqueous extracts , from n. sativa seeds proved to possess relaxant ( bronchodilatory ) effects on tracheal chains of guinea pigs ( 51 ) . thymoquinone and thymohydroquinone inhibited in vitro non - enzymatic lipid peroxidation in hippocampal homogenates induced by iron - ascorbate ( 52 ) . pretreatment of male nmri rats with tq and n. sativa oil significantly decreased lipid peroxidation levels measured as mda in hippocampus portion following cerebral ischemia - reperfusion injury ( iri ) ( 53 ) . according to abdel - wahab and aly ( 6 ) , n. sativa oil neutralized the toxicity of aflatoxins , and treatment with n. sativa oil of rats fed an aflatoxin - contaminated diet resulted in significant protection against aflatoxicosis . recent reports further demonstrate that tq at a dose of 9 mg / kg body weight protects liver injury induced by aflatoxin b1 ( afb1 ) as evidenced by a reduction of the serum concentrations of ast , alt and alp as marker enzymes for liver injury . when rats were pretreated with tq followed by afb1 the gsh content of the liver was restored and mda production prevented ( 54 ) . n. sativa oil and its active component , tq have also been shown to protect brain tissue from radiation - induced nitrosative stress ( 55 ) . oral administration of tq in wistar rats at 5 mg / kg body weight for 21 days resulted in a significant reduction of the levels of different antioxidant parameters ( myeloperoxidase mpo , lpo , gsh , catalase ( cat ) , sod and no ) in collagen induced arthritis ( cia ) ( 42 ) , and similarly reduced the fe(iii ) nitrilotriacetic acid ( fe - nta ) induced oxidative stress after oral administration in wistar rats ( 56 ) . furthermore , the glycation of sod by glucose or methylglyoxal ( mg ) and its protection by tq has been investigated . incubation of sod with glucose at 37c resulted in a progressive decrease in the activity of the enzyme due to fragmentation , evidenced by a decrease in the amount of protein on sds - page gels . on the other hand , incubation of sod with mg or both glucose and mg glucose at 37c caused protein cross linking evidenced by the formation of high molecular weight aggregates . tq offered protection against glucose or methylglyoxal ( mg ) induced loss of sod activity and fragmentation or cross - linking ( 57 ) . pretreatment of wistar rats with tq and 1,2-dimethylhydrazine ( dmh ) for 10 weeks prevented the depletion of antioxidant enzymes catalase , glutathione peroxidase , and superoxide dismutase in red blood cells and maintained a similar value as the control group . at the same time , it prevented erythrocyte damage in dmh - induced colon post initiation carcinogenesis in rats ( 58 ) . tq and n. sativa oil possess cytoprotective effects against the anti - cancer drugs cyclophosphamide ( ctx ) via maintenance of hemoglobin and blood sugar levels , and the activities of liver enzymes , bilirubin , urea , creatinine , lipids ( triglyceride , cholesterol and low - density lipoprotein ( ldl)-cholesterol ) and lipid peroxidation in the liver . the cytoprotective effects of n. sativa oil and tq were associated with induction of antioxidant mechanisms ( 59 ) . neuron - protective effects have also been studied in cultured hippocampal and cortical neurons treated with amyloid- peptide ( a1 - 42 ) and tq simultaneously for 72 h. tq efficiently attenuated a1 - 42-induced neurotoxicity by improving cell viability . it has also been shown to inhibit mitochondrial membrane potential depolarization and the generation of reactive oxygen species caused by a1 - 42 , and to restore synaptic vesicle recycling inhibition and to partially reverse the loss of spontaneous firing activity , and a1 - 42 aggregation in vitro ( 60 ) . there has been growing interest in natural compounds with anti - cancer properties because they are presumably non - toxic to healthy cells and are available in a readily digestible form . there is a wide consensus in cancer research that tq has promising anti - cancer activity . thus it may be useful as a dietary supplement to enhance the effects of anti - cancer drugs . there is evidence that tq induces p53-independent apoptosis via the activation of caspase-8 and caspases 9 and 3 in the caspase cascade . it also modulates the bax / bcl2 ratio by upregulation of proapoptotic bax and down - regulation of antiapoptotic bcl2 proteins in p53-null hl-60 cells during apoptosis ( 61 ) . investigating the anti - cancer effects of tq on a549 non - small cell lung cancer cells exposed to benzo(a)pyrene , ulasli et al ( 62 ) found that tq treatment up - regulated bax and down - regulated bcl2 proteins , and increased the bax / bcl2 ratio . it also decreased the expression of cyclin d and increased the expression of p21 , and it up - regulated trail receptor 1 and 2 expression . these molecular events lead to regulatory p53 levels affecting the induction of g2/m cell cycle arrest and apoptosis . in breast cancer cells tq was able to increase peroxisome proliferator - activated receptor gamma ( ppar- ) activity and to down - regulate the expression of the genes for bcl-2 , bcl - xl and survivin . more importantly , the increase in ppar- activity was prevented in the presence of ppar- specific inhibitors and ppar- dominant negative plasmids , suggesting that tq may act as a ligand of ppar- ( 63 ) . treatment of human breast carcinoma in both in vitro and in vivo models demonstrated antiproliferative and proapoptotic effects of tq , which are mediated by its inductive effect on p38 and ros signaling . tq possesses anti - tumor effects in breast tumor xenograft mice and it potentiates the antitumor effect of doxorubicin ( 64 ) . tq has also been shown to inhibit the growth of the human cholangiocarcinoma ( cca ) cell lines tfk-1 and hucct1 in a dose- and time - dependent manner . the mechanism of cca cell line growth inhibition is exerted by down - regulation of pi3k / akt and nf-b , and regulated gene products , including x - linked inhibitor of apoptosis protein ( xiap ) , vascular endothelial growth factor ( vegf ) , p - akt , p65 , bcl-2 and cox-2 ( 65 ) . tq also exerts an inhibitory effect on migration of metastatic human ( a375 ) and mouse ( b16f10 ) melanoma cells by inhibition of nlrp3 inflammasome resulting in a decreased proteolytic cleavage of caspase-1 . thus , it can be a potential immunotherapeutic agent not only in adjuvant therapy for melanoma , but also in the control and prevention of metastatic melanoma ( 66 ) . tq is also a microtubule - targeting agent ( mta ) , and binds to the tubulin - microtubule network , thus preventing microtubule polymerization and causing mitotic arrest and apoptosis of a549 cells but not of normal huvec cells ( 67 ) . investigating the putative anti - cancer activities of tq on / tubulin expression in human astrocytoma cells ( cell line u87 , solid tumor model ) and in jurkat cells ( t lymphoblastic leukaemia cells ) evidence was provided for tq to target the level of / tubulin proteins in cancer cells . the degradation found was associated with the upregulation of the tumor suppressor p73 with subsequent induction of apoptosis . no effect on / tubulin protein expression these data indicate that tq exerts a selective effect on / tubulin in cancer cells ( 68 ) . furthermore , tq effects on human topoisomerase ii were investigated and demonstrated that it enhances enzyme - mediated dna cleavage 5-fold , which is similar to the anti - cancer drug etoposide indicating that tq can be considered as human type ii topoisomerase poison ( 69 ) . the majority of patients with glioblastoma , the most aggressive malignant astrocytic brain tumor in adults , experience a recurrence of the tumor because of these cells ` resistance to apoptotic cell death following ionizing radiation and chemotherapy with temozolomide ( tmz ) , and an increased autophagy , tq proved to induce caspase - dependent apoptosis and to inhibit autophagy of glioblastoma cells ( 70 ) . by studying the mechanisms of cytotoxicity on neuroblastoma ( neuro-2a ) cells it was additionally found that tq induces apoptosis by increasing the bax / bcl-2 ratio , which leads to the release of cytochrome c from mitochondria into the cytoplasm . tq treatment also directs the activation of caspase-3 followed by the cleavage of poly ( adp - ribose ) polymerase ( parp ) and down - regulates the caspase inhibitor xiap ( 71 ) . cytotoxicity of tq was also tested in triple - negative breast cancer ( tnbc ) cells that lack functional tumor suppressor p53 . tq treated cells showed g1 phase cell cycle arrest and apoptosis characterized by the loss of mitochondrial membrane integrity as evidenced by release of cytochrome c and caspase 9 activation ( 72 ) . thymoquinone treatment also inhibits the proliferation of multiple myeloma ( mm ) cells and potentiates the apoptotic effect of bortezomib in various mm cell lines via the activation of caspase-3 , resulting in the cleavage of parp . tq treatment also inhibits chemotaxis and invasion induced by c - x - c motif chemokine 12 ( cxcl12 ) in mm cells in vitro and a xenograft mouse model ( 73 ) . it increases levels of ros and mrnas of the oxidative stress - related genes , nqo1 and ho-1 . pretreatment of hepg2 cells with n - acetylcysteine , a scavenger of ros , prevented tq - induced cell death . tq treatment also stimulated mrna expression of pro - apoptotic bcl - xs and trail death receptors , and inhibited expression of the anti - apoptotic gene bcl-2 . conclusively , tq enhanced trail - induced death of hepg2 cells , in part by upregulating trail death receptors , inhibiting nf-b and il-8 and stimulating apoptosis . these manifold molecular mechanisms of tq - dependent suppression of hcc cell growth underscore the potential of this compound as anti - hcc drug ( 74 ) . in conclusion , it is evident that thymoquinone , the predominant constituent of n. sativa volatile oil has a wide spectrum of favorable effects . in our review we concentrated on four properties of tq : hepatoprotective , anti - inflammatory , antioxidant and anti - cancer effects , which are supported by evidence - based research elaborating the molecular mechanisms . these beneficial effects of thymoquinone support the use of this natural compound as a drug with a wide range of medical applications .
nigella sativa has attracted healers in ancient civilizations and researchers in recent times . traditionally , it has been used in different forms to treat many diseases including asthma , hypertension , diabetes , inflammation , cough , bronchitis , headache , eczema , fever , dizziness and influenza . experimentally , it has been demonstrated that n. sativa extracts and the main constituent of their volatile oil , thymoquinone , possess antioxidant , anti - inflammatory and hepatoprotective properties.in this review we aimed at summarizing the most recent investigations related to a few and most important effects of thymoquinone . it is concluded that thymoquinone has evidently proved its activity as hepatoprotective , anti - inflammatory , antioxidant , cytotoxic and anti - cancer chemical , with specific mechanisms of action , which provide support to consider this compound as an emerging drug . further research is required to make thymoquinone a pharmaceutical preparation ready for clinical trials .
acute myocardial infarction ( ami ) is one of the major problems influencing public health , and pci is one of the most effective method to reduce myocardial ischemia , ventricular remodeling and restore myocardial functions after ami . timi flow grade was at first related to a postthrombosis 's coronary flow status measured by coronary angiography , where a totally obstructed flow receive grade 0 and a totally opened artery grade 3 . nowadays these flow grading is applied in others circumstances , supporting clinical decisions about pci and making timi risk one of reference standards in acs clinical management [ 3 , 4 ] . despite the clinical role of coronary flow in the prediction of myocardial ischemia , coronary angiography power of visualization is restricted to blood vessels with diameter > 100 m , which is not so accurate for collateral vessels and capillaries assessment , consequently not accurate for myocardial perfusion data . recently , the confirmation of myocardial microvascular integrity before pci procedure becomes one of important concerns to achieve better survival and functional recovery of myocardium , and myocardial contrast - enhanced echocardiography ( mce ) can assess the myocardial blood volume changes at stress using adenosine for accurately and securely evaluating of myocardial microvascular perfusion in a real - time manner . this technique , which became more popular in clinical practice [ 6 , 7 ] , detects contrast microbubble at the capillary level within the myocardium and , thus , has the potential to assess tissue viability and the duration of the contrast effects . mce has been used for the determination of functional relevance of coronary stenoses of intermediate angiographic severity and is at least equivalent to single - photon emission computed tomography ( spect ) in microvascular disease and acs evaluation , with a tendency toward higher sensitivity [ 9 , 10 ] . otherwise , mce has a great advantage as a bedside technique and can be used early in patients presenting with acute heart failure to rapidly assess left ventricular ( lv ) function ( regional and global ) and perfusion ( rest and stress ) [ 11 , 12 ] . there is no research data comparing timi flow grade with mce perfusion in acute patients , neither comparing a quantitative and a visual mce analysis for this purpose . so the objective of the study is to validate mce as a useful tool for predict coronary flow dysfunctions and determinate which mce analysis technique is more accurate . the study was conducted during the period of march to december 2008 , consisted of 41 patients ( 34 men , 3669 years old and mean age 54 10.8 ) who were diagnosed as acute coronary syndrome ( acs ) highly elected for a pci treatment . from the final population , diagnosis of acs and ami was based on the criteria by international society of cardiology and world health organization . all patients underwent rest and hyperemic stress real - time myocardial contrast echocardiography ( rt - mce ) before coronary angiography ( cag ) . all the diseases arteries had stents implanted with the blood flow of each reached 3 in timi flow grade after pci . this study was approved by the ethics committee of the first affiliated hospital of xinjiang medical university , and all of the patients provided written informed consent forms before their enrollment in the study . the contrast agent sonovue ( bracco imaging b. v. , switzerland ) is a suspension of microbubbles whose active product is sulphur hexafluoride , an innocuous gas eliminated through the respiratory system . the product is presented in the form of particles that activate when added to a saline solution and shaken vigorously for 30 seconds . a total amount of 2 ml was administered intravenously using an infusion pump at the rate of 1 ml / min . adenosine was the clinical stress agent preferred due to the efficient vasodilatation effect , the rapid effect and short half - life , and the modest chronotropic and inotropic effects . when resting rt mce cine loops had been captured , adenosine was administered intravenously at a rate of 140 g / kg / min for up to 6 minutes . after 2.5 minutes of infusion , destruction - replenishment sequences were repeated in all apical views . heart rate and rhythm were monitored continuously , and blood pressure and 12-lead electrocardiogram recorded every minute . all patients underwent the examinations in the research protocol , and no side effects occurred during these procedures . echocardiography was performed within 48 hours before pci , using a philips ie 33 unit with s5 sound , the transmitting and receiving frequency was 1.8 mhz and 3.6 mhz , respectively . rt - mce was performed using the technique of power modulation with the angiographic mode , which used a combination of low ( 0.08 ) and high ( 1.7 ) mechanical indexes . after obtaining an adequate acoustic window , when a good signal was seen in the myocardium , a high ( 1.7 ) mechanical index impulse was given to destroy the contrast agent . soon after , a low ( 0.08 ) mechanical index of rt - mce was switched on , the myocardial contrast replenishment was visualized . images of the apical 2- , 3- , and 4-chamber views were acquired for up to 15 cardiac cycles after the flash sequence was obtained and stored for offline evaluation later . the mce data of rest and stress cine loops were transferred to an offline computer workstation for analysis using q - lab ( version 6.0 , philips ultrasound ) and performed by two independent researchers ; both blinded to the results of cag . the myocardial segments from the apical 2- , 3- and 4-chamber views were divided into 16 segments according to the standard segmentation scheme recommended by american society of echocardiography ( ase ) . there were three segments ( the basal , the middle , and the apical ) within each wall of the anterior , inferior in apical 2-chamber , anterior interventricular septum and post in apical 3- chamber , and lateral and post interventricular septum in apical 4- chamber . totally , 646 segments were analyzed among 41 patients . for qualitative analysis of myocardial perfusion the visual interpretation was used considering the degree of perfusion : the uniform distribution of contrast scored 1 , no uniform scored 0.5 , and no visualization scored 0 . the quantitative analysis region of interest ( roi , 5 mm 5 mm ) was placed in the middle of each myocardial segment by using qlab software quantitatively analyzing the reperfusion curve of real - time acoustic radiography . the mean value of three measurements was taken for the parameters in each region ( figure 1 ) . plots of contrast intensity versus time were constructed and fitted to an exponential function , y = a(1 e t ) . the plateau of signal intensity ( a ) and the slope of maximum signal intensity rise ( ) were measured , and the product of a was computed . then the mean value of a , , and a in each segment was calculated . a , , and a represent myocardial blood volume , myocardial blood flow velocity , and myocardial blood flow , respectively . the segmental mce parameters and their vasodilator reserves ( stress - rest ratios ) were recorded , named for a - reserve ( stress a / rest a ) , -reserve ( stress /rest ) , and a -reserve ( stress a /rest a ) . selective coronary angiography on device innova 2000 ( ge , usa ) was performed in all patients within 48 hours of the mce . the coronary timi flow grading was expressed , using digital substation angiography , which was equipped with the function of image counting . the visual interpretation scoring and quantitative assessment of blood flow parameters were conducted by two doctors blindly . we randomly selected 50 segments of the patients to assess the inter- and intra - observer agreement . categorical variables were expressed as number ( % ) of myocardial segments and quantitative variables as mean standard deviation ( sd ) . the comparisons for categorical data were performed by wilcoxon signed ranks test and consistency test by kappa . univariate anova or welch tests that are similar to anova were used for quantitative data . spearman - rank correlation was used to analyze the correlation between visual interpretation perfusion score , perfusion parameters and timi flow grade . inter- and intra - observer reproducibility of ordered variables agreement was assessed by kappa . for quantitative variables , interclass correlation coefficient ( icc ) was used with reproducibility considered perfect if the icc was between 0.81 and 1.0 . the statistical analysis was done using the statistical package for social sciences , version 13.0 for windows ( spss , inc . , all results were considered to be statistically significant when the p value was less than 0.05 . from 41 patients that underwent coronary angiography , 36 were elected for pci , 28 had single - vessel disease , and 8 were multivessel . all the diseases arteries ( 36 patients ) had stents implanted with the blood flow of each reached 3 in timi flow grade after pci . in the 41 patients , 123 vessels were selected . a total of 656 myocardial segments from the apical 2- , 3- , and 4-chamber views were imaged . 567 segments were analyzable and had clear images being used for mce qualitative and quantitative analysis at rest and at stress . 271 segments were fed by the diseased arteries , in which 198 by lad , 28 by lcx and 45 by rca . the number of myocardial segments analysed by mce in each timi flow grade were shown in tables 2 and 3 ( rest and stress ) . there was a positive correlation between mce and timi flow grade ( rs = 0.738 , p values < 0.001 ) at stress . on diagnosing myocardial perfusion abnormality , mce at rest and at stress had a high degree of agreement comparing with timi flow grade ( kappa = 0.687 , p values < 0.001 ) and ( kappa = 0.827 , p values < 0.001 ) . the results of myocardial perfusion parameters ( a , , and a ) before pci at rest and at stress were shown in table 4 . the differences in a , , and a values at rest between any of two groups were different and statistically significant ( w = 382.13 , 192.61 , and 450.96 resp . , p values < 0.001 ) . these results also apply to the stress group ( w = 499.64 , 318.15 , and 601.17 resp . , a , , and a values at rest and at stress increased linearly with the timi flow grading , and the means of the parameters correlated with timi flow grade ( rs = 0.741 , 0.528 , and 0.715 for a , , and a , p values < 0.001 , and rs = 0.872 , 0.767 and 0.845 for a , , and a , p values if one considers timi grade < 1 is abnormal , mce visual interpretation ( at rest / at stress ) had 72.0%/65.5% accuracy with 85.4%/97.9% sensitivity and 70.7%/62.6% specificity respectively . if one considers timi grade < 2 is abnormal , mce visual interpretation ( at rest / at stress ) had 77.7%/76.7% accuracy with 76.8%/93.6% sensitivity and 78.1%/71.9% specificity , respectively . if one considers timi grade <3 is abnormal , mce visual interpretation ( at rest / at stress ) had 73.1%/80.4% accuracy with 58.2%/76.6% sensitivity and 84.2%/83.3% specificity , respectively ( see table 5 ) . the correlation between the trend of a - reserve , -reserve , a -reserve , and timi grade are shown in figure 2 . for mce visual interpretation , a high degree of intraobserver agreement ( kappa = 0.79 , p = 0.08 ) and interobserver agreement ( kappa = 0.76 , p = 0.09 ) was observed . the iccs were 0.950 , 0.820 , and 0.873 for , a , , and a , respectively . the interobserver agreement was perfect for a , and a , with iccs being 0.950 , 0.869 , and 0.851 for a , , and a , respectively ( table 6 ) . the results of visual interpretation and parametric quantification of mce and timi flow grade were not totally similar and the correlation was quite different . using mce visual interpretation scoring method , the changes in cardiac imaging can be directly observed with unaided eyes , and the pci preoperative microcirculation status can be preliminarily evaluated . the results of mce visual interpretation at rest and stress had a positive correlation with timi flow grade . it indicated that visual interpretation could reflect myocardial perfusion and timi flow grade as well . however , the results of the quantitative analysis from our study expressed by the myocardial perfusion parameters ( a , , and a ) can directly reflect the status of blood perfusion and coronary timi flow grade even more accurate and precise than visual analysis . with the help of this parametric quantification , this could overcome the limitations of visualization and part of operator dependency bias . study demonstrate that the importance of quantitative assessment of rt - mce by myocardial perfusion parameters ( velocity ) and a ( volume velocity ) has more influence in prediction of coronary artery stenosis . in the mean time , study from li et al . showed that when there were no collateral circulation patencies , , and a decreased with the aggravation of coronary artery stenosis . through quantitative analysis of myocardial perfusion parameters , we observed that and a value increased at rest and being more exponential at stress to timi flow grading level reaching at least 13 folds . it also indicated that perfusion injury became severe with the decrease of value ( velocity ) more accentually , confirming the importance of pathophysiology of steal phenomenon from coronary artery flow , more evident at stress . even though timi flow grade and mce focused on different ways to look at the same physiopathology , the epicardical coronary tree flow had a great concordance with myocardial flow measured by mce , inferring that in acute patients timi 's grading still has a good accuracy as a perfusion - deficit predictor . however , there were two patients where timi grade was abnormal and mce was normal , possibly because collateral microcirculation takes place in those patients . there were no data that supports a conservative treatment for then , despite clinical evidence that percutaneous interventions without myocardial ischemia leads to a worst prognostic tendency [ 20 , 21 ] . for the acs patients screening before pci , the mce technique could raise more necessary evidence for clinician in evaluating the status of myocardial perfusion give the data of possible improvements of preoperative myocardial microvascular perfusion and also filtering case for correct treatment choice . in conclusion , mce parametric quantification had a positively correlation with timi flow grading and can qualitatively and quantitatively assess the myocardial perfusion more accurately than the visual one . the technique of mce can work as a beneficial tool aiding before coronary angiography to predict timi risk and help clinical decision . the limitations of the study include no data about mce side effects and the level of acceptability by the patients and the absent of traditional perfusion gold standards , like fractional flow reserve ( ffr ) or rubidium nuclear imaging . the improvements of the myocardial perfusion has not been further investigated by conducting follow - up visits 36 months after the surgery , which will be improved in the future studies .
the study aim was to compare two different stress echocardiography interpretation techniques based on the correlation with thrombosis in myocardial infarction ( timi ) flow grading from acute coronary syndrome ( acs ) patients . forty - one patients with suspected acs were studied before diagnostic coronary angiography with myocardial contrast echocardiography ( mce ) at rest and at stress . the correlation of visual interpretation of mce and timi flow grade was significant . the quantitative analysis ( myocardial perfusion parameters : a , , and a ) and timi flow grade were significant . mce visual interpretation and timi flow grade had a high degree of agreement , on diagnosing myocardial perfusion abnormality . if one considers timi flow grade <3 as abnormal , mce visual interpretation at rest had 73.1% accuracy with 58.2% sensitivity and 84.2% specificity and at stress had 80.4% accuracy with 76.6% sensitivity and 83.3% specificity . the mce quantitative analysis has better accuracy with 100% of agreement with different level of timi flow grading . mce quantitative analysis at stress has showed a direct correlation with timi flow grade , more significant than the visual interpretation technique . further studies could measure the clinical relevance of this more objective approach to managing acute coronary syndrome patient before percutaneous coronary intervention ( pci ) .