article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
highly
regioselective remote hydroxylation of a natural product
scaffold is demonstrated by exploiting the anchoring mechanism of
the biosynthetic p450 monooxygenase pikcd50n - rhfred .
previous
studies have revealed structural and biochemical evidence for the
role of a salt bridge between the desosamine n , n - dimethylamino
functionality of the natural substrate yc-17 and carboxylate residues
within the active site of the enzyme , and selectivity in subsequent
c h bond functionalization . in the present study ,
a substrate - engineering
approach was conducted that involves replacing desosamine with varied
synthetic n , n - dimethylamino anchoring groups .
we then determined their ability to mediate enzymatic total turnover
numbers approaching or exceeding that of the natural sugar , while
enabling ready introduction and removal of these amino anchoring groups
from the substrate .
the data establish that the size , stereochemistry ,
and rigidity of the anchoring group influence the regioselectivity
of enzymatic hydroxylation .
the natural anchoring group desosamine
affords a 1:1 mixture of regioisomers , while synthetic anchors shift
yc-17 analogue c-10/c-12 hydroxylation from 20:1 to 1:4 .
the work
demonstrates the utility of substrate engineering as an orthogonal
approach to protein engineering for modulation of regioselective c
h
functionalization in biocatalysis . | |
a commercially available ruthenium(ii )
pnp - type pincer catalyst
( ru - macho ) promotes the formation of -chiral tert - butanesulfinylamines from racemic secondary alcohols and ellman s
chiral tert - butanesulfinamide via a hydrogen borrowing
strategy .
the formation of -chiral tert - butanesulfinylamines
occurs in yields ranging from 31% to 89% with most examples giving
> 95:5 dr . | |
the long - term renal epithelial cell line llc - pk1 expresses at confluence several differentiated characteristics of renal proximal tubule including na / glucose cotransport and several brush border membrane hydrolases .
the differentiation - inducing chemical hexamethylene bisacetamide ( hmba ) triggers a dramatic induction of na+/glucose symport , trehalase and maltase , expressed as an increase in the number of cells in the culture that express the differentiated phenotype .
characteristics of the induction response are reviewed in terms of proposed mechanisms of inducer action .
new evidence suggests that in addition to elevation of intracellular na levels mediated by partial inhibition of the sodium pump , hmba treatment also alters polyamine levels via effects on ornithine decarboxylase .
these responses may be mediated by hmba effects on protein kinase c activity .
the possible role of polyamine fluctuations and dna demethylation in mediating hmba effects on differentiated gene expression is currently being investigated.imagesfigure 2.figure 3 . | |
sensor - augmented pump systems provide insulin delivery and continuous glucose monitoring therapies that can improve the management of diabetes . the minimed paradigm veo and minimed 530 g systems ( medtronic , northridge , ca ) are capable of suspending insulin delivery in response to sensor glucose ( sg ) values at or below a prespecified threshold ( low glucose suspend [ lgs ] and threshold suspend [ ts ] , respectively ) ( table 1 ) .
the suspension automatically resumes ( auto - resume ) in 2 hours unless basal insulin delivery is manually resumed .
four hours after automatic insulin delivery resumption , the threshold suspend feature of both systems can allow resuspension of insulin delivery if the sensor glucose is still at or below prespecified threshold .
this feature significantly reduces the severity and duration of hypoglycemic events once they occur , and has a salutary effect on the frequency of such events .
sensor - augmented pump system features the difference between lgs and ts is the suspend threshold range .
automatic resumption can occur sooner if , at 30 min since the start of pump suspension , the sg value is above the low limit and predicted to remain above the low limit within 30 min .
lgs , low glucose suspend ; sg , sensor glucose ; ts , threshold suspend .
in addition to a threshold suspend feature ( suspend on low ) , the minimed 640 g system ( medtronic ) can suspend insulin delivery based on predicted hypoglycemia ( suspend before low ) ( table 1 ) , which can reduce the frequency of hypoglycemic events to a greater extent . when
suspend before low is enabled , basal insulin delivery is stopped if the sg value is predicted to reach or fall below a preset low limit within 30 min .
similar to the minimed paradigm veo and minimed 530 g systems , basal insulin delivery can be manually resumed at any time during a suspend event and automatically resumes after 2 hours .
in contrast , auto - resume can occur sooner if , at 30 min since the start of pump suspension , the sg value is above the low limit and predicted to remain above the low limit within 30 min .
carelink personal therapy management software for diabetes provides remote storage and retrospective analysis capabilities of data from the pump , sensor , and blood glucose meter .
carelink software data from individual users can be reviewed in collaboration with healthcare providers to guide therapy adjustments , or can be aggregated and analyzed to detect large - scale patterns and outcomes in an anonymized manner .
the effectiveness and usage patterns of the automated insulin management features of the minimed 640 g system , in addition to specific minimed paradigm veo and minimed 530 g comparator data , were evaluated .
anonymized carelink data , voluntarily uploaded from 4818 individuals using the minimed 640 g system between january 13 , 2015 , and january 14 , 2016 ( 286,149 user - days of data ) ; 39,219 individuals using minimed 530 g system between october 15 , 2013 , and june 25 , 2015 ( 2,777,117 user - days of data ) ; and 43,193 individuals using the minimed paradigm veo system between october 1 , 2011 , and july 14 , 2015 ( 4,101,706 user - days of data ) ; were analyzed .
users of each system uploaded , at least , 5 days of carelink data during the aforementioned time periods .
the aforementioned data included information on insulin delivery from the pumps and information from cgm sensors ( enlite sensor [ minimed 530 g system ] and enhanced enlite sensor [ minimed paradigm veo and minimed 640 g systems ] ; medtronic ) .
for this retrospective analysis , users were not provided specific instruction from healthcare professionals on when or how long to use system features or how often to calibrate systems with self - monitored blood glucose measurements .
voluntarily uploaded and anonymized data were captured from carelink software . to compare sg trajectories associated with different types of pump suspension , user - days
suspend before low or reactive suspend on low ) in use during that day .
suspend before low and suspend on low was 5090 mg / dl ( 3.35.0 mmol / l ) .
the threshold range for the minimed paradigm veo system was 40110 mg / dl ( 2.26.1 mmol / l ) and that for the minimed 530 g was 6090 mg / dl ( 2.85.0 mmol / l ) .
while the minimed paradigm veo lgs and the minimed 530 g ts features differ in suspend threshold range , they are considered functionally equivalent . for simplicity ,
pump suspension events were characterized according to whether insulin delivery was resumed automatically or manually .
hypoglycemia and hyperglycemia were defined as sg values 70 mg / dl ( 3.9 mmol / l ) and 240300 mg / dl ( 13.316.7 mmol / l ) , respectively , and were compared across systems using a kruskal
severe hyperglycemia was defined as 300 mg / dl ( 16.7 mmol / l ) .
hypoglycemic and hyperglycemic excursions were defined as 2 consecutive hypoglycemic or hyperglycemic sg values per day or night ( 8:00 pm8:00 am ) and , in addition to area under the glucose concentration time curve ( auc ) , were compared between the minimed paradigm veo and minimed 640 g systems using a wilcoxon signed - rank analysis .
glycemic variability between manual and automatic resumptions , as measured by a coefficient of variability ( cv , standard deviation / mean ) , was calculated using the last sg value collected from each resumption and analyzed using a paired t - test . to characterize the postsuspend behavior of sg values ,
recovery time was defined as the interval from pump suspend to the start of the first 20-min interval with sg values 68119 mg / dl ( 3.86.6 mmol / l ) . for additional glycemic comparisons between the
suspend before low and the suspend on low features , we identified 851 people who switched from the minimed paradigm veo system to the minimed 640 g system and uploaded 7 days of data from both systems between february 28 , 2010 , and september 29 , 2015 .
suspend on low on 11% of the user - days , and neither suspend feature on 6% of the user - days .
more than 99% of all users used one or both suspend features at least once ; most ( 59% ) used suspend before low exclusively . among all sg values from minimed 640 g users
when suspend before low was enabled , 0.39% were in the 50 mg / dl range , 2.11% were in the 5070 mg / dl range , 63.53% were in the 70180 mg / dl range , 30.42% were in the 180300 mg / dl range , and 3.55% were in the > 300 mg / dl range . in comparison , the
feature was used on 72% of the minimed paradigm veo and 82% of minimed 530 g user - days . among all sg values from minimed paradigm veo users ,
suspend on low was enabled , 1.0% were in the 50 mg / dl range , 4.1% were in the 5070 mg / dl range , 61.2% were in the 70180 mg / dl range , 29.6% were in the 180300 mg / dl range , and 4.1% were in the > 300 mg / dl range . among all sg values from minimed 530 g users , when
suspend on low was enabled , 0.7% were in the 50 mg / dl range , 3.4% were in the 5070 mg / dl range , 60.6% were in the 70180 mg / dl range , 30.7% were in the 180300 mg / dl range , and 4.6% were in the > 300 mg / dl range .
suspend before low on 693,626 occasions , at an average rate of 2.9 per user - day . over half of the suspend events ( 55% , 381,803 )
ended due to auto - resume based on sg , 11.5% ( 79,525 ) due to the 2-h auto - resume , and the remainder due to manual resumption ( 33.5% , 232,298 ) .
auto - resume based on sg events was 58 25 min and that of the manually resumed events was 33 23 min .
sg values associated with automatically resumed events showed less glycemic variability than those associated with manually resumed events , as measured by the coefficient of variation ( cv ) ( p < 0.001 , 0.18 vs. 0.24 , respectively ) , and faster recovery times ( p < 0.001 , 29.4 vs. 35.1 min , respectively ) .
the distribution of pump suspension events across duration for each system is shown in figure 1 .
about one - third of manually resumed events for the minimed 640 g system ( fig .
1a ) and more than half for the minimed 530 g ( fig . 1b ) and minimed paradigm veo ( fig .
the distribution in automatically resumed events for the minimed 640 g system was partly bimodal .
specifically , many auto resume events occurred soon after the minimum 30-min interval ( inherent to minimed 640 g technology ) and continued , although at a decreased percent , until the maximum suspend duration of 2 hours .
the distribution of manual and automatic pump resumption events across bins of suspend duration time ( min ) is shown for minimed 640 g ( a ) , minimed 530 g ( b ) , and minimed paradigm veo ( c ) systems .
for all three , a majority of pump resumption events were triggered manually within the first 15 min of pump suspension .
events during the day and night associated with the set low limit sg value ( mean sd = 66.7 9.9 mg / dl [ 3.7 0.5 mmol / l ] ) .
overall , 75% ( 353,748 [ day ] + 166,470 [ night ] = 520,218 ) of the 693,626 predicted hypoglycemic events were not followed by an sg value at or below the low limit .
most suspend events occurred during the daytime hours , and the hypoglycemia prevention rate was slightly higher for suspend events occurring at night .
feature resulted in the avoidance of 73.9% of predicted hypoglycemic events during the day and 77.4% of predicted hypoglycemic events during the night ( white bars ) .
the proportion of events that reached or fell below the preset limit ( black bars ) was 26.1% and 22.6% , respectively .
the benefits of automated pump suspension with predictive versus reactive pump suspension features during nocturnal hypoglycemia are shown in table 2 .
the duration of hypoglycemia between 8:00 pm and 8:00 am was calculated for users of the minimed paradigm veo , minimed 530 g , and minimed 640 g systems on nights when the pumps ' suspend features were not in use and compared to nights when they were in use .
statistically significant reductions were seen when either pump suspension feature was used ( p < 0.001 ) , but the reductions associated with the predictive feature of the minimed 640 g system were greater .
hypoglycemia was defined as 70 mg / dl ( 3.9 mmol / l ) .
the suspend before low and suspend on low pump suspension features are compared in figure 3 , in which sg trajectories surrounding 59,823
the low limit was set to 60 mg / dl . at the outset , the median sg value for suspend on low
events was 58 mg / dl , whereas the median value at the time the suspend before low events began was 92 mg / dl .
for both types of suspend events , the median sg value stabilized to around 144 mg / dl by 4 hours .
events followed a more predictable trajectory during the recovery phase , as indicated by the narrower interquartile range .
sg trajectories associated with enabled event start time ( min ) for suspend before low and suspend on low features .
suspend before low events of any duration for which the low limit was set to 60 mg / dl .
suspend on low events of any duration for which the low limit was set to 60 mg / dl .
a separate analysis of data from 851 users who switched from the minimed paradigm veo system to the minimed 640 g system is presented in table 3 . after switching , users experienced less time in hypoglycemia and their hypoglycemic exposure was significantly less in duration and severity as measured by excursions and the auc .
there was also a significant improvement in severe hyperglycemic parameters after switching to the 640 g system .
glycemic parameters associated with suspend on low and suspend before low hypoglycemia was defined as sg 70 mg / dl ( 3.9 mmol / l ) .
severe hyperglycemia was defined as sg 300 mg / dl ( 16.7 mmol / l ) .
suspend on low comprised data from the 851 minimed paradigm veo users who transitioned to minimed 640 g .
the rate of hypoglycemia , whether severe or nonsevere , during the day or at night , may be underestimated in clinical trial settings , stressing the need for retrospective real - world analyses such as this one . in 2015 , dexcom reported data from 300 users of their platinum g4 cgm system , in which users experienced a mean of 1.2 1.9 ( mean sd ) hours per day with sensor readings 70 mg / dl , half of which were at night . this rate is in agreement with data from users of medtronic cgm systems on nights when system suspend functions were not used .
as shown in table 2 , the duration of nocturnal hypoglycemia was reduced by 50% with use of the minimed paradigm veo and minimed 530 g
suspend on low features , and was reduced by 75% with use of the minimed 640 g suspend before low feature .
this reduction in hypoglycemia exposure ( i.e. , number of events ) attributable to the predictive insulin pump suspension technology in the minimed 640 g system agrees with that reported in a recent study of children and adolescents that found slight elevations in overnight mean glucose levels and no increase in morning blood ketosis on nights that pump suspensions occurred .
the hypoglycemia prevention attributable to the minimed 640 g system was also measured in a recent predictive low glucose management ( plgm ) pivotal study , in which standardized increases in basal insulin delivery were used to trigger insulin pump suspension . a 60% reduction in hypoglycemia
was reported based on 68 automatic pump - suspension events , among which the hypoglycemic criterion ( two or more reference plasma glucose levels of < 65 mg / dl ) did not occur in 41 cases .
this is less than the 75% prevention rate reported here and the 83% prevention rate reported in a plgm user evaluation study .
the smaller reduction observed in the pivotal study was likely due to the basal insulin delivery escalation protocol known to result in hypoglycemia 93% of the time , relative to the day - to - day environment settings of the later studies . in the present study data , the minimed 640 g algorithm governing automatic resumption of insulin delivery based on sg appeared to work well and resumed insulin delivery primarily within 3045 min after pump suspension . while more than half of manually resumed events occurred within the first 15 min after pump suspension for the minimed paradigm veo or minimed 530 g systems , only one - third occurred within the same period for minimed 640 g .
it is not known what user characteristics or physiologic and metabolic factors may have influenced the different extent of manual resumption between the systems .
the auto resume based on sg feature , not available in minimed paradigm veo or minimed 530 g systems , appeared to allow a more immediate real - time solution for maintaining target glucose levels .
specifically , there was a faster hypoglycemia recovery and less glycemic variability ( as measured by the cv of sg values ) , compared to users who restart the pump manually .
this study benefits from the large number of users and user - days available for analyses , although data from system users who did not upload to carelink software were unavailable .
data could not be analyzed , due to an insufficient number of events during use of the former feature .
the lack of detailed user demographic information is another limitation , as is a lack of detailed information regarding user - system interface ( e.g. , calibrations , sensor changes , and carelink software upload frequency ) , physician - to - user instructions , and dietary and exercise behaviors .
the false - positive rate of predictive pump suspensions , as well as sensor accuracy , could not be assessed because of the study 's retrospective nature .
the effect of sensor life on the rate of pump suspension events was also not possible to assess . within - user comparisons of minimed paradigm veo and minimed 640 g system use
may have been influenced by the unidirectional nature of the minimed paradigm veo system use preceding minimed 640 g system use , and by uncharacterized or unknown behaviors related to becoming familiar with a new pump system .
several challenges remain on the path to a fully closed - loop insulin delivery system . although no such systems are commercially available , a recent hybrid - closed loop ( hcl ) pivotal trial , completed in april 2016 ( nct02463097 ) , allowed subjects to wear investigational systems in an unsupervised outpatient setting for an extended period of time ( i.e. , 3 months ) . in other outpatient studies , hcl systems outperformed sensor - augmented pumps in terms of glucose control , time in hypoglycemia , and glycated hemoglobin levels .
the minimed 640 g system is the first commercially available system to offer predictive suspension and automatic resumption , based on sg , of basal insulin delivery .
the benefits attributable to these features were previously reported in the context of a user evaluation study .
analysis of real - world usage patterns of minimed 640 g use and the predictive pump suspension feature reported here supports earlier results and establishes the validity of this integrative technology for routine use in insulin - requiring individuals with diabetes .
the minimed paradigm veo and minimed 640 g systems are not commercially available for use in the u.s . | abstractbackground : automated insulin management features of the minimed 640 g sensor - augmented pump system include suspension in response to predicted low sensor glucose ( sg ) values ( suspend before low ) , suspension in response to existing low sg values ( suspend on low ) , and automatic restarting of basal insulin delivery upon sg recovery .
the effectiveness of these features was evaluated using carelink software data.methods : anonymized data from minimed 640 g system users ( n = 4818 ) , minimed 530 g system users ( n = 39,219 ) , and minimed paradigm veo system users ( n = 43,193 ) who voluntarily uploaded pump and sensor data were retrospectively analyzed .
comparisons were made between days in which system features were enabled at any time and those in which they were not .
comparisons were also made between pump suspension events for which insulin delivery was automatically or manually resumed and between glycemic parameters of users who switched from the minimed paradigm veo system to the minimed 640 g system.results : days in which the minimed 640 g suspend before low
feature was enabled had lower percentages of sg readings 70 mg / dl ( 3.9 mmol / l ) or 240 mg / dl ( 13.3 mmol / l ) than days when it was not enabled ( p < 0.001 for each ) .
users who switched from the minimed paradigm veo system to the minimed 640 g system had fewer excursions below 70 mg / dl ( p < 0.001 ) and 240 mg / dl ( p < 0.001 ) .
sg values following automatically resumed pump suspension events recovered more rapidly and had a more stabilized endpoint than following manually resumed events.conclusions : automated insulin management features of the minimed 640 g system can reduce the frequency of both high and low sg values and help stabilize sg after resumption of insulin delivery . |
several groups in canada and the us have recently pondered disastrous scenarios where demand for hospital admission and critical care resources would vastly outstrip supply in an influenza pandemic or other health emergency . rather than leave wrenching prioritization decisions to exhausted , frontline health professionals ,
the groups have proposed algorithms that would be used to triage patients and to allocate - and even reallocate - lifesaving resources .
questions have been raised about the ability of physicians to implement these proposals , however , which in some cases call for categorically excluding groups of patients from needed care and withdrawing life support regardless of the wishes of patients or their proxies .
evidence that these protocols would accurately predict which patients are likely or unlikely to survive , and to direct resources accordingly , has also been insufficient .
a pilot study by christian and colleagues tackles some of these questions by examining the results of applying ontario 's draft critical care triage protocol to an actual cohort of intensive care unit ( icu ) patients .
one - half of the pilot study 's authors were original authors of the ontario protocol . in the us and in canada , many governmental bodies , hospitals , and the us veterans health administration have incorporated aspects of the ontario protocol into pandemic planning documents .
patients who would have been triaged to expectant and designated for withdrawal of icu care and ventilator support in fact had substantial survival rates .
the findings suggest that rationing paradigms which include categorical exclusion criteria and withdrawal of lifesaving resources may need to be rethought , and public input sought on nonclinical aspects .
patients who would have been excluded from icu admission in a pandemic had significantly lower rates of survival than other patients when they received standard treatments . a full one - quarter of these patients , however , survived their hospital stays .
the rate of survival was higher still among groups of patients who would have failed the protocol 's ventilator time trials .
for example , more than 70% of those who would have been triaged to expectant after a 5-day icu time trial and would have been designated for terminal extubation or icu discharge actually survived with continued treatment .
paradoxically , under the triage algorithm their ventilators could have been reassigned to newly admitted , intermediate treatment priority patients whose rate of survival was lower ( 62.5% ) .
many of the days of ventilation made available through the use of the protocol were thus made available by denying or removing them from patients who would have benefited .
the study fails to account for these patients ' deaths explicitly in its discussion of the protocol 's ability to increase resource availability .
for example , the authors use ' rates from the first wave of h1n1 in canada ' to contend that the protocol could have saved 50 lives ' based upon the 568 days of ventilation made available ... assuming an average of 10 days of ventilation and an 89% survival rate ' .
the calculation does not subtract for h1n1 survivors who would have probably died after being either excluded from icu care - comorbidities described in these patients suggest many would have been - or withdrawn from treatment under the ontario protocol guidelines .
the fact that most of the critically ill h1n1 patients had acute respiratory distress syndrome and a long icu course suggests that , in many of them , sequential organ failure assessment scores would not have improved after 48 or 120 hours .
many patients would therefore probably have fallen into the protocol 's blue category ( for example , sequential organ failure assessment score < 8 and no change at 120 hours ) and would have been terminally extubated .
this raises the specter of wave after wave of acute respiratory distress syndrome patients being put on ventilators for 2 to 5 days only to be extubated before they improve .
one could envision a greater loss of life using the triage tool , which the study 's triage officers were instructed to consider as the standard of care , compared with using another approach that did not involve extubation .
many draft pandemic triage plans in the us include reassessment tools that are similar to those of ontario .
further , the calculation of lives saved does not subtract for the deaths of 30 patients who would have been excluded or withdrawn from needed treatment under the protocol , but who actually survived in the real world . also , the days of ventilation made available by excluding these patients would not necessarily be contiguous for each new h1n1 patient or available in the ideal way assumed by the calculation .
further , first - wave h1n1 survivors in canada required a median of 12 days ( not 10 days ) of ventilation , and overall survival in the critically ill was 83% ( not 89% ) .
the pilot study also hints at the excruciating difficulties clinicians would have faced in implementing the protocol .
although three of four triage officers in the study were involved in drafting the original triage instrument , considerable inter - officer disagreement and lack of confidence in triage decisions were noted . in a situation where triage decisions carry life and death stakes , and family members vent their anguish , these difficulties will be heightened .
for example , in one isolated new orleans hospital after hurricane katrina , family members objected when clinicians assigned patients with do not resuscitate orders the lowest evacuation priority .
several altered standard protocols , although not that of ontario , use do not resuscitate status as an exclusion criterion for hospital admission in a pandemic ; an expert panel convened by the us institute of medicine recently recommended against using do not resuscitate status in this way . to date , rationing protocols for pandemics have been developed like ontario 's , by expert panels with great effort and intentions but without significant input from the general public .
triage decision - making algorithms , unlike evidence - based guidelines for disease treatment , are shaped by many nonclinical considerations .
medical experts and the lay public may have different views about what ethical principles and values should guide triage priorities ( the role of age , chronic illness , disability , and previous access to care are but a few examples ) ; this can not be known unless those developing guidelines find ways to engage the public . some authors and an ethics advisory subcommittee to the director of the centers for disease control and prevention have suggested algorithms that prioritize patients along a scale with a sliding cutoff point rather than categorically excluding certain groups ; patients who are assigned a low priority would then be provided treatment if it becomes available . in the days after hurricane katrina ,
certain patients triaged to the lowest priority category were not evacuated even after resources became available to do so , suggesting the need to emphasize situational awareness and for frequent reassessment in triage protocols .
ultimately the use of even the best survivorship prediction tool may need to be leavened by individual clinician judgment and be weighed against factors such as fairness , the effect on public trust , and mental distress caused to triage officers , clinicians , patients , and family members .
| demand for critical care resources could vastly outstrip supply in an influenza pandemic or other health emergency , which has led expert groups to propose altered standards for triage and resource allocation .
a pilot study by christian and colleagues applied the ontario , canada draft critical care triage protocol to an actual retrospective cohort of intensive care unit patients .
the findings are troubling .
patients who would have been triaged to expectant and designated for withdrawal of intensive care unit care and ventilator support in fact had substantial survival rates .
triage officers often disagreed and lacked confidence in their categorization decisions .
these findings suggest that rationing paradigms which include categorical exclusion criteria and withdrawal of lifesaving resources should be reconsidered , and public input sought on nonclinical aspects . |
experimental evidence indicates a critical role of cyclic guanosine monophosphate ( cgmp ) in antinociception .
this evidence is in line with the observation that local administration of l - arginine produces antinociception in rats with carrageenin - induced hyperalgesia , the effect being blocked by nitric oxide ( no ) inhibitors and methylene blue ( soluble guanyly cyclase inhibitor ) ( 1 ) .
moreover , the possibility of such a role is supported by the fact that intraplantar injection of dibutyryl - cgmp causes antinociception ( 2 ) .
therefore , cgmp seems to be very important for the functional up - or down - regulation of the nociception .
intracellular cgmp concentrations are regulated by the action of guanylyl cyclases and the degradation rate induced by cgmp - specific phosphodiesterases ( pdes ) ( 3 ) .
it has been reported that pde-5 seems to be the most relevant enzyme for the cgmp inactivation in cells ( 4 ) .
vardenafil is a selective and potent inhibitor of cgmp - specific pde-5 which catalyzes the hydrolyzis of cgmp .
although , previous studies have consistently found that sildenafil , another cgmp - specific pde-5 inhibitor , produces antinociception in the formalin test in rats , to date the possible role of vardenafil in the nociception has not been defined ( 5 , 6 ) . on the other hand , scott et al .
have recently shown that a-1048400 , a novel , orally active , neuronal calcium channel blocker produced dose - dependent antinociception thus , establishing a link between ca channels and antinociception ( 7 ) .
the role of this pathway in possible vardenafil - induced antinociception has not been studied extensively and requires further clarification . in this study
, we aimed to investigate the antinociception effects of specific pde-5 inhibitor vardenafil on carrageenan - induced nociception in rats , and to investigate the possible role of no / cgmp / ca channels pathway in this effect .
in this study 64 adult male wistar - albino rats , weighing between 200 and 280 g , were used .
the care of animals and realization of approaches and procedures within the study framework were realized in strict compliance with the principles stated by the national institutes of health in their guide for care and use of laboratory animals .
this study was performed in the experimental medical research center of akdeniz university medical faculty , and approved and guidance of ethics committee on animal research of akdeniz university medical faculty . during the study period
, rats were fed a standard laboratory diet , allowed water ad libitum and housed in a light - controlled room with a 12 h light / dark cycle .
animal groups are as follows : 1 ) control group ( saline injected ) , 2 ) carrageenan group , 3 ) vardenafil group , 4 ) vardenafil + carrageenan group , 5 ) vardenafil + l - name group , 6 ) vardenafil + odq group , 7)vardenafil + l - arginine , 8) vardenafil + a23187 group .
induction and assessment of carrageenan - induced hyperalgesia
carrageenan is an irritant that induces an acute inflammatory response on injection into tissues ( 8) .
it is injected into the footpad of rodents and known to cause physiological and biochemical changes over a short time course and limited to the effected limb .
this model results in oedema , pain and hyperalgesia of the injected footpad and limb ( 9 ) . in our study
, hyperalgesia was induced in the right hind paw of rats by injecting 0.1 ml of a freshly prepared solution of 2% carrageenan .
the extent of hyperalgesia was determined by measuring the mechanical nociceptive pressure threshold by the paw pressure test via a commercially available analgesiometer ( ugo basile , model no : 37215 , italy ) , which is based on the determination of the animal threshold response to pain that is induced to the paw by the application of a uniformly increasing pressure ( 10 ) .
briefly , the rats were maintained in a normal / horizontal position in the hand of the researcher .
the right hind paw was placed in an analgesiometer , which was composed of a cone - shaped paw - presser with a rounded tip that was used to apply linear increasing force to test paw .
the weight in grams that was required to elicit a nociceptive response , such as paw flexion , represented the nociceptive threshold .
a maximum pressure force of 400 g was used to prevent damage to the paws .
the apparatus was set up to apply a force of 0 - 400 g , increasing from zero .
the nociceptive threshold was taken as the point at which the rat vocalized or struggled vigorously and determined by the average of three consecutive pressure tests recorded before injection of carrageenan ( zero time , 100% ) and 2 h after the injection of carrageenan , which represented the peak of effect .
vardenafil was injected intraplantarly in the right paw 30 min before the carrageenan challenge and the pressure threshold was observed at 15 , 30 , 60 and 120 min after carrageenan administration .
the extent of hyperalgesia was calculated as the difference between the pretreatment and the peak of effect pressure test averages ( of nociceptive threshold ) and expressed as % . to reduce stress ,
the rats were habituauted to the pressure test apparatus one day prior to the experiments .
vardenafil , n - nitro - l - arginine methyl ester ( l - name ) , 1h-(1 , 2 , 4 ) oxadiazolo ( 4 , 3 , a ) quinoxalin-1-one ( odq ) , l - arginine , a23187 ( calcium ionophore ) carrageenan and dimethyl - sulfoxide ( dmso ) were obtained from sigma ( sigma chemical co. , st.louis , mo .
vardenafil , odq and a23187 were dissolved in dmso whereas carrageenan , l - name and l - arginine were dissolved in saline .
all solvents were tested alone and showed as ineffective in carrageenan - induced nociception test ( dmso at a final concentration of 0.2% ( v / v ) did not effect carrageenan - induced nociception test ) .
experimental design
determination of antinociceptive effect of vardenafil in carrageenan - induced nociception test : rats were treated with vehicle ( dmso ) or vardenafil ( 50 , 100 g / kg , i.pl ) and 30 min later , carrageenan was injected .
antinociception response was determined before ( 0 min ) and after ( 15 , 30 , 60 and 120 min ) carrageenan administration with analgesiometer .
same protocol was applied to left paw with dmso ( vehicle of vardenafil ) as control .
effect of pretreatment with l - name , odq or l - arginine on antinociceptive activity of vardenafil in carrageenan - induced nociception test : to examine the effect of l - name ( nitric oxide synthase inhibitor ) , odq ( a specific inhibitor of guanylyl cyclase ) or l - arginine ( nitric oxide donor ) on vardenafil activity , animals were pretreated with l - arginin ( 10 g / kg , i.pl ) , l - name ( 100 g / kg , i.pl ) or odq ( 50 g / kg , i.pl ) 10 min before vardenafil ( 100 g / kg , i.pl ) injection .
antinociception response was determined before ( 0 min ) and after ( 15 , 30 , 60 and 120 min ) carrageenan administration with analgesiometer .
same protocol was applied to left paw with dmso ( vehicle of vardenafil and odq ) or saline ( vehicle of l - name and l - arginin ) as control .
role of a23187 ( calcium ionophore ) on vardenafil - induced antinociception
vardenafil ( 100 g / kg , i.pl ) was injected to right paw 10 min after a23187 and 30 min before carrageenan administration in order to evaluate the ca - related dynamics in vardenafil s antinociceptive effect .
antinociception response was determined before ( 0 min ) and after ( 15 , 30 , 60 and 120 min ) carrageenan administration with analgesiometer .
same protocol was applied to left paw with dmso ( vehicle of a23187 ) as control .
data analysis and statistics
all results are presented as means s.e.m . for ten animals per group .
the significance of the differences in the responses of treatment groups in comparison to the control was determined by mann - whitney u test .
carrageenan response
intraplantar injection of 0.1 ml carrageenan into the right paw of the rats produced a significant decrease in nociception pressure at 15 , 30 , 60 and 120 min compared to control group ( p < 0.05 ) ( 0.1 ml saline injected group , figure 1 ) .
time course of hyperalgesia observed following local administartion of carrageenan ( 0.1 ml ) in rats .
( n = 10 ) . * p < 0.05 when compared to control group
antinociceptive action of vardenafil
intraplantar injection of 0.1 ml vardenafil ( 50 , 100 g / kg,0.1ml , i.pl ) produced a significant increase in nociception threshold that had been decreased by carrageenan .
this effect is more pronounced at 30 , 60 and 120 min in 50 g / kg vardenafil - injected group , whereas it is significant at all measurement times in 100 g / kg vardenafil - injected group ( p < 0.05 ) ( figure 2a - b ) .
local , dose - dependent ( 50 g / kg , i.pl ( a ) or 100 g / kg , i.pl ( b ) ) antinociceptive effect of sildenafil in the carrageenan hyperalgesia test . each point represents the mean s.e.m .
* p < 0.05 when compared to control group
effect of , l - name , odq , l - arginine and a23187 on the antinociception produced by vardenafil
the inhibitor of nitric oxide synthase l - name ( 100 g / kg , i.pl ) and the inhibitor of guanylyl cyclase odq ( 50 g / kg , i.pl ) , significantly inhibited the vardenafil - induced antinociception whereas , l - arginine ( nitric oxide donor , 10 g / kg , i.pl ) significantly ( p < 0.05 ) enhanced the antinociceptive effect of vardenafil .
moreover , a23187 ( calcium ionophore ) ( 1 g / kg , i.pl ) injection 10 min before vardenafil ( 100 g / kg , i.pl ) administration caused a significant decrease ( p < 0.05 ) in antinociception at 30 , 60 and 120 min ( figure 3a - d ) .
the effect of l - name ( a ) , odq ( b ) , l - arginine ( c ) or a23187 ( d ) on vardenafil - induced antinociception in carrageenan hyperalgesia test in rats .
* p < 0.05 when compared to control group as previously reported for sildenafil , we have found that intraplantar administration of vardenafil is also able to produce antinociception in carragenan - induced hyperalgesia test ( 11 ) .
based on the fact that vardenafil is a potent , selective , and reversible phosphodiesterase type-5 inhibitor that blocks cgmp hydrolysis , we suggest that vardenafil could produce its antinociceptive effect through the activation of no - cgmp transduction pathway .
becuse , this suggestion is in line with evidence that showing that this pathway plays an important role in sildenafil - induced analgesia ( 5 , 12 , 13 ) .
recent studies have suggested that l - arginine / no - cgmp pathway is involved in the modulation of pain perception ( 14 , 15 ) .
nitric oxide and cgmp appears to involve in certain drugs induced antinociception mechanisms ( 16 , 17 ) .
the no - cgmp pathway depends on the synthesis and release of no triggered by the activation of nitric oxide synthase ( nos ) , which then activates the guanylate cyclase enzyme , guanylyl synthase , which is directly responsible for an increase in the intracellular level of the most important messenger of the system , cgmp ( 18 ) .
it has been reported that cgmp plays an important role in the up - or down - regulation of nociceptors and is a key mediator of antinociceptive activity ( 19 ) .
intracellular concentration of cgmp is regulated with the balance of phosphodiesterase and guanylate cyclase activity .
phosphodiesterase type-5 is the predominant enzyme for hydrolysis of cgmp ( 3 ) . in order to examine antinociceptive effect of vardenafil and to explain the participation of the no - cgmp pathway , carrageenan - induced hyperalgesia model was used . as shown in figure 1 ,
injection of carregeenan ( 0 1ml ) into the right paw of rats evoked a significant hypersensivity when compared with saline group .
carrageenan - induced hyperalgesia model is an example of acute and local inflammation . in this model ,
physiological and biochemical changes occur over a short time course and limited to the only effected limb .
we administered all drugs also , carrageenan , via intraplantar injection ( local administration route ) .
so , we suppose to avoid the effects of a systemic inflammation . on the other hand
, it has been recently demonstrated that sildenafil has a partial anti - inflammatory effect through inos inhibition ( 20 ) .
also , sildenafil has been known to reduce the expression of proinflammatory cytokines and cyclooxygenase-2 ( cox-2 ) . moreover , in - vitro treatment with tadalafil or vardenafil in human myofibroblast prostatic cells , reduced il-8 secretion and blunt inflammatory response , induced by inflammatory stimuli , likely via activation of cgmp / pkg signaling ( 21 ) .
but , investigators declared the necessity of further studies to explain the molecular mechanisms of this protection in nervous system .
the results presented here show that vardenafil exhibits antinociceptive activity in dose - dependent manner .
this study presents for the first time the interesting fact that vardenafil - induced antinociception is significantly blocked by l - name , a nos inhibitor and odq , a guanylyl cyclase inhibitor while , l - arginine ( nitric oxide donor , 10 g / kg , i.pl ) enhanced the antinociceptive effect of vardenafil .
together these data suggest major participation of the no - cgmp pathway in the antinociception produced by vardenafil .
we assume that the inhibition of pde type-5 and therefore the accumulation of cgmp is sufficient to produce antinociception .
there is now a substansial body of evidence indicating the relationship between ca channels and analgesia ( 22 , 23 ) .
it is well known that ca channels play essential roles in setting the resting membrane potential as well as controlling the excitability of neurons ( 24 ) .
the opening of cachannels leads to depolarization of cell membranes , and that increase cell excitability .
the results demonstrated in our study show that the pre - treatment of rat wit a calcium ionophore , a23187 ( 1 g / kg , i.pl ) significantly decreased the antinociception caused by vardenafil .
such results support that the antinociceptive effect caused by vardenafil in rats seems to involve ca - related dynamics .
since vardenafil is well documented in the treatment of pulmonary hypertension and erectile dysfunction , our study offers a new approach for its potential therapeutic utility in analgesia . to our knowledge , this is the first one to directly demonstrate that vardenafil exhibit antinociception and this effect thought to be mediated primarily through no - cgmp signaling pathway and additional ca - related mechanisms . | in this study , we aimed to investigate the peripheral antinociception effects of specific phosphodiesterase 5 ( pde-5 ) inhibitor vardenafil on carrageenan - induced nociception in rats , and the role of calcium besides the l - arginine- nitric oxide ( no)- cyclic guanosine monophophate ( cgmp ) pathway in these effects .
hyperalgesia was induced by the intraplantar injection of 0.1 ml fresh carrageenan solution to right hind - paw whereas , saline as a vehicle of carrageenan was injected to the left paw .
this procedure was used for measuring mechanic nociception pressure via an analgesimeter .
pressure which produced nociception was measured before ( 0 minute ) and after(15 , 30 , 60 and 120 minutes ) carrageenan injection .
local administration of vardenafil produced a dose - dependent antinociceptive effect .
pretreatment with nw - nitro - l - arginine methyl ester ( l - name , nitric oxide synthase inhibitor ) , oxadiazolo ( 4 , 3 , a ) quinoxalin -1-one ( odq , inhibitor of guanylyl cyclase ) or a23187 ( calcium ionophore ) decreased the effect of vardenafil .
in contrast , l - arginine ( nitric oxide donor ) seemed to potentiate the vardenafil - induced antinociception .
our results suggest that phosphodiesterase type-5 inhibitor vardenafil may offer a new therapeutic tool to treat pain .
it s effect was probably result from l - arginine / no - cgmp pathway activation and ca + 2 channels are also involved . |
nursing forms the backbone of patient care management in an intensive care setting . the overall care ,
including patient comfort and sedation , is provided by the nursing personnel . because of lack of scientific sedation practices in the intensive care unit ( icu ) , patients usually face over- or undersedation .
the results of oversedation in the mechanically ventilated patients are an increased time of ventilation , an increased stay in the icu and an increased cost of care .
the untoward effects of undersedation include an increased production of endogenous catecholamines that result in an increase in blood pressure , heart rate and myocardial oxygen consumption .
use of a bispectral index ( bis ) monitoring in the icu is based on three primary goals : enhancing patient care by optimizing sedations , decreasing nurse 's workload and reducing the cost of sedation .
the use of the bis monitoring system in many indian icus is in the introductory phase . before recommending the use of bis in indian intensive care settings ,
thus , this study was undertaken to assess the knowledge of bis among the nursing personnel working in various icus of a tertiary care medical centre of india .
using the purposive sampling technique 54 nursing personnel working in various icus ( anaesthesia / main , hepatic , respiratory , gastroenterology and cardiothoracic and vascular surgery ) of the hospital were included in the study .
a questionnaire was developed after reviewing the relevant literature and consultation with the experts from the department of anaesthesia and nursing education .
it contained 10 questions , of which nine were multiple choice questions and one was to match the columns between bis score and clinical state .
the mean knowledge score was calculated by adding the total score of all the participants and dividing it by the total number of participants .
knowledge assessment questionnaire focused group discussions were also conducted in a group of four to six nursing personnel .
it helped the interviewer to collect data regarding the viewpoint of nursing personnel about bis .
the mean age ( years ) of the subjects was 30.77.19 years , with the range of 2147 years . majority ( 83.3% ) were females , of which 34 ( 62.96% ) were diploma holders and 20 ( 37.03% ) were graduates .
demographic data of the subjects all the study subjects were aware of the fact that bis stands for bispectral index monitoring system . majority ( 94.44% )
had the knowledge that bis interprets neuronal activity and is a modified form of electroencephalogram ( eeg ) , which is interpreted by using noninvasive forehead electrodes .
in actual practice , bis monitoring was incorporated only in the main icu ; hence , nursing personnel working in the main icu were comparatively more aware of the fact . regarding cleansing of the patient 's forehead before applying the bis electrode , 40 ( 74.07% ) subjects considered spirit to be used for cleaning , whereas 10 ( 18.15% ) considered tincture , three ( 5.55% ) considered saline and one ( 1.85% ) considered betadine for the same purpose . majority ( 94.44% ) of the subjects
were of the clear - cut view point that bis will help the nursing personnel in titrating the sedative drugs in patients .
forty - three ( 79.62% ) nursing personnel knew that knowledge of bis can prevent both under- and oversedation .
forty - one ( 75.92% ) subjects responded that bis is not always reliable in assessing the neuronal activity of the patient , 11 ( 20.37% ) subjects had no comments on its reliability , whereas two ( 3.70% ) subjects thought that bis is always reliable .
forty - four ( 81.48% ) subjects were aware of the artifacts that makes bis nonreliable sometimes .
the mean knowledge score of the subjects was 11.872.43 , with a range of 615 .
mean knowledge score of the subjects regarding bispectral index monitoring system majority of the subjects knew that 0 bis score represents clinical state of flat line of eeg ( 98.14% ) and 100 bis score represents state of awake ( 85.18% ) .
around 50% of the subjects were aware of the clinical state of the patient as per the 20 , 40 , 60 and 80 bis score [ table 4 ] .
awareness of the subjects regarding their knowledge about correlation of bispectral index monitoring system with its clinical state most of the nursing personnel were in favour of the use of bis in icus to titrate the sedation levels within the recommended dosage levels .
the use of bis will prevent both the under- and oversedation among mechanically ventilated patients .
nursing personnel considered bis a relevant tool to assess the neuronal state of the patient as compared with the glasgow coma scale ( gcs ) , which becomes irrelevant when patients are on paralytic sedations or muscle relaxants .
one factor that they considered as a drawback was the cost of the bis sensor , which is around 1000 in indian rupees .
the patients in our hospital belong to the low - socioeconomic income group and they find this expensive to purchase .
all the nursing personnel appreciated the bis monitoring system , but they wanted to have more elaborated and detailed teaching programmes regarding the bis monitoring system .
all the study subjects were aware of the fact that bis stands for bispectral index monitoring system . majority ( 94.44% ) had the knowledge that bis interprets neuronal activity and is a modified form of electroencephalogram ( eeg ) , which is interpreted by using noninvasive forehead electrodes .
in actual practice , bis monitoring was incorporated only in the main icu ; hence , nursing personnel working in the main icu were comparatively more aware of the fact . regarding cleansing of the patient 's forehead before applying the bis electrode , 40 ( 74.07% ) subjects considered spirit to be used for cleaning , whereas 10 ( 18.15% ) considered tincture , three ( 5.55% ) considered saline and one ( 1.85% ) considered betadine for the same purpose . majority ( 94.44% ) of the subjects
were of the clear - cut view point that bis will help the nursing personnel in titrating the sedative drugs in patients .
forty - three ( 79.62% ) nursing personnel knew that knowledge of bis can prevent both under- and oversedation .
forty - one ( 75.92% ) subjects responded that bis is not always reliable in assessing the neuronal activity of the patient , 11 ( 20.37% ) subjects had no comments on its reliability , whereas two ( 3.70% ) subjects thought that bis is always reliable .
forty - four ( 81.48% ) subjects were aware of the artifacts that makes bis nonreliable sometimes .
the mean knowledge score of the subjects was 11.872.43 , with a range of 615 .
mean knowledge score of the subjects regarding bispectral index monitoring system majority of the subjects knew that 0 bis score represents clinical state of flat line of eeg ( 98.14% ) and 100 bis score represents state of awake ( 85.18% ) .
around 50% of the subjects were aware of the clinical state of the patient as per the 20 , 40 , 60 and 80 bis score [ table 4 ] .
awareness of the subjects regarding their knowledge about correlation of bispectral index monitoring system with its clinical state
most of the nursing personnel were in favour of the use of bis in icus to titrate the sedation levels within the recommended dosage levels .
the use of bis will prevent both the under- and oversedation among mechanically ventilated patients .
nursing personnel considered bis a relevant tool to assess the neuronal state of the patient as compared with the glasgow coma scale ( gcs ) , which becomes irrelevant when patients are on paralytic sedations or muscle relaxants .
one factor that they considered as a drawback was the cost of the bis sensor , which is around 1000 in indian rupees .
the patients in our hospital belong to the low - socioeconomic income group and they find this expensive to purchase .
all the nursing personnel appreciated the bis monitoring system , but they wanted to have more elaborated and detailed teaching programmes regarding the bis monitoring system .
the use of bis is not very popular in a greater part of the intensive care settings in india .
although majority of the nurses working in our icus were aware of bis and its purpose , this finding may not be true about other icus in india .
bis - guided sedation needs to be introduced in the critical care settings in an indian scenario .
focused group discussion revealed that bis is a relevant tool to assess the neuronal state of the patient as compared with gcs , which becomes irrelevant at various clinical situations .
similarly , the study by olson et al . showed that indirect monitoring of sedation by using vital signs and subjective sedation scales have shortfalls , because heart rate and blood pressure are not consistently sensitive to changing levels of consciousness .
monitoring of sedation in an intensive care setting can be challenging for the nursing staff because the effects of sedative medications vary from patient to patient . as per kaplan , 69% of the icu patients
were inappropriately sedated , 54% were oversedated and 15% were undersedated . with bis monitoring , fewer patients experience adverse physiological effects related to inadequate sedation . according to the study held in a neurocritical care unit
, nurses found that sedation could be optimized by incorporating bis monitoring into the care of patients in the icu .
the survey reveals that greater part of the critical care nursing personnel in our institution were aware of the importance of bis monitoring
. however , this may not be true for majority of the icus throughout our country , and needs to be studied in the national perspective .
it is high time that we introduce bis monitoring in the critical care settings in the indian scenario to optimize sedation . before that , we need to generate awareness among the critical care personnel as a strategy to successfully implement its use in the indian context . | background : bispectral index monitoring system ( bis ) is one of the several systems used to measure the effects of anaesthetic and sedative drugs on the brain and to track changes in the patient 's level of sedation and hypnosis .
bis monitoring provides information clinically relevant to the adjustment of dosages of sedating medication .
it can help the nursing personnel in preventing under- and over sedation among intensive care unit ( icu ) patients.objective:the present study was conducted to assess the knowledge of nursing personnel working in the icu regarding bis.methods:fifty-four subjects participated in the study .
a structured questionnaire was developed to assess the knowledge of the nursing personnel regarding bis .
focus group discussions were held among the nursing personnel to know their views regarding bis.results:mean age ( years ) of the subjects was 30.77.19 ( 2147 ) years , with a female preponderance . although the use of bis in icu is not common , majority ( 94.44% ) were aware of bis and its purpose .
79.62% of the subjects knew about its implication in patient care .
the mean knowledge score of the subjects was 11.872.43 ( maximum score being 15).conclusion : there exists an awareness among the critical care nursing staff in our institution regarding bis and its clinical implications .
its use in the critical care setting may benefit the patients in terms of providing optimal sedation . |
central corneal thickness ( cct ) measurement plays a major role in diagnostic and therapeutic approaches to corneal pathology and has an important impact on intraocular pressure readings . an ideal method of corneal thickness measurement should be accurate , repeatable , reproducible , and safe , as well as easy and quick to perform .
cct can be assessed by means of many instruments , including specular microscopy , confocal microscopy , ultrasound pachymetry , ultrasound biomicroscopy ( ubm ) , slit - scanning corneal topography , the scheimpflug system , optical biometry , and spectral optical coherence tomography ( soct ) .
ultrasound pachymetry , which used to be a gold standard for measuring corneal thickness , is a contact method where the place of measurement is strongly dependent on the operator .
therefore , other noninvasive methods have gained popularity ; nevertheless , the accuracy of some of these methods has not been thoroughly examined .
the most important features of a measuring technique are accuracy and precision . because the true value of the corneal thickness of a particular eye is unknown , it is impossible to calculate the accuracy of measurements .
therefore , the agreement between new devices and an instrument considered to be a gold standard should be used .
repeatability is defined as the variability of results obtained from one object in the same measurement conditions ( time , instrument , technique , place , and operator ) , while reproducibility is the variability of results obtained from one object using the same device in different measurement conditions . in this study
, we assessed the agreement , repeatability , and interoperator reproducibility of cct and minimal corneal thickness ( mct ) measurements obtained with two modern noncontact devices ( soct and the scheimpflug system ) , as well as conventional ultrasound instrument .
the study was conducted in the department of ophthalmology , collegium medicum , nicolaus copernicus university in bydgoszcz , poland , after written informed consent was provided by the participants following the bioethics committee guidelines .
eyes with apparent corneal pathologies that might influence corneal thickness or structure were excluded from the study .
the mean age of the study group participants was 36.86 7.95 years ( range , 2450 years ) .
the group included 11 female ( 78.6% ) and 3 male ( 21.4% ) participants .
each operator took five measurements with each instrument ( rtvue 100 , optovue ; pentacam hr , oculus ; pachette 3 , dgh ) .
the measurements were taken the same day with ten - minute intervals between operators , giving a total of 2100 measurement . the way corneal thickness is evaluated differs among the three instruments .
the rtvue-100 fd is based on soct ; it is a frequency - domain oct utilizing an 840 nm wavelength .
a cornea adapter module ( cam ) was used to visualize and measure anterior chamber parameters .
the pentacam hr is a rotating scheimpflug camera that provides 25 tomograms of the anterior segment of the eye in three dimensions in less than 2 sec .
the time of an examination consisting of 10 single measurements usually does not exceed 3 sec . because ultrasound pachymetry is the only contact method used in this study , ultrasound measurements were taken last to avoid cornea changes caused by probe application that might influence the two other measurements .
repeatability of cct and mct measurements was estimated by the coefficient of repeatability which is defined as the standard deviation divided by the mean result .
interoperator reproducibility was estimated by comparison of the operators ' results in pairs ( operator 1 with operator 2 , operator 2 with operator 3 , and operator 1 with operator 3 ) for all the devices consecutively .
the coefficient of reproducibility was then calculated as the sd of the differences between the pairs of measurements obtained by each pair of operators , divided by the average of the means of each pair of measurements . as with the coefficient of repeatability ,
conditions were standardized by using the same method , the same patient , the same device , and the same operator ( pairs of operators ) in short - time intervals .
the rtvue 100 fd resulted in some mct readings that were higher than the cct readings . additionally , an archiving error occasionally occurred in a single measurement . in both cases ,
pentacam hr measurements often had to be repeated because of an incorrect result caused by fixation loss , blinking , or incorrect head position .
pachette 3 was the only contact method used in our study and it required topical anesthesia .
the mean values of cct and mct obtained by the rtvue 100 fd , pentacam hr , and pachette 3 are shown in figure 1 .
the differences between the devices are statistically significant ( p < .001 for both cct and mct ) .
the cct results obtained with the rtvue 100 fd and pentacam hr are 3.21% and 1.76% , respectively , lower than with the pachette .
the mct results obtained with the rtvue 100 fd are 2.95% lower than with the pentacam hr .
figure 2 depicts the mean cct and mct with respect to each instrument and operator .
the mean standard deviations for a series of 5 cct and mct measurements of one eye taken by one operator are summarized in table 1 .
the coefficients of repeatability for cct and mct measurements for different instruments and operators are summarized in table 2 .
the mean coefficient of cct repeatability was 0.61 for the rtvue 100 fd , 0.82 for the pentacam hr , and 0.80 for the pachette 3 .
the mean coefficient of mct repeatability was 0.41 for the rtvue 100 fd and 0.81 for the pentacam hr .
the rtvue 100 fd demonstrated significantly higher repeatability of cct and mct measurements when compared with the pentacam hr and pachette 3 ( p < .001 ) .
analysis of the mean cct and mct , taking into consideration both the instrument and the operator , proved that the differences between mean results are significant ( p < .001 ; figure 2 ) . statistical analysis revealed that the bifactorial differences are due to the instrument and not the operator .
all operators obtained the same tendency of results ( i.e. , the highest from the pachette 3 , followed by the pentacam hr and rtvue 100 fd ) .
the mean coefficient of cct reproducibility was 0.91 for the rtvue 100 fd , 1.11 for the pentacam hr , and 1.25 for the pachette 3 ( p < .003 ) .
the mean coefficient of mct reproducibility was 0.91 for the rtvue 100 fd and 1.27 for the pentacam hr ( p < .003 ) .
corneal thickness plays an important role in evaluation of intraocular pressure and glaucoma progression risk in patients with ocular hypertension as thinner corneas may lead to the underestimation of intraocular pressure [ 37 ] . additionally , corneal thickness measurement is necessary to determine and plan the type and extent of corneal refractive surgery [ 3 , 6 ] .
ultrasound pachymetry has been considered the gold standard for corneal thickness measurement for many years [ 810 ] . however ,
many other methods can be used , including scheimpflug systems and soct , which have the great advantage of noncontact .
these methods use different measurement technologies and give different results . according to different researchers , cct
measurement obtained with standard ultrasound pachymetry varies from 542 to 550 m [ 1 , 1012 ] . in our hands , the mean cct measured by the pachette 3 was somewhat higher : 555.74 49.09 m . with the use of the pentacam hr ,
the results of cct by different researchers were between 544 and 552 m [ 1 , 10 ] ; our result of 545.94 47.11 m is within the previously reported range .
the mean cct measured by different types of oct instruments was previously reported within the range of 523527 m [ 13 , 14 ] . in our hands , the mean cct measured with the rtvue 100 fd was 537.92 50.21 m .
the mean cct measurements from the pachette 3 are 9.8 m higher than those from the pentacam hr , and 17.82 m higher than those from the rtvue 100 fd ; the differences are statistically significant .
these results remain in accordance with other studies in which the pentacam hr and soct measurements were lower than ultrasound pachymetry measurements , on average , by 6.09.8 m and 11.6449.4 m , respectively [ 1 , 9 , 1319 ] .
one possible reason for the difference may be the use of topical anesthetics to take a contact measurement with the ultrasound pachymeter which may cause corneal epithelial edema resulting in overestimation of the results .
additionally , the subjective choice of the place of measurement can lead clinicians to obtain results from paracentral regions of the cornea . however , there are also studies [ 1 , 20 ] showing an opposite relation , in which the results from ultrasound pachymetry are lower in comparison to other methods .
according to the authors , ultrasound pachymetry causes tear film dislocation and epithelium compression , resulting in cct measurements that are lower by 730 m .
we hypothesize that cct readings with ultrasound pachymeters may depend on which model of the instrument is used .
when comparing mean standard deviations of cct and mct measurements in a series of 5 measurements from the same patient by different devices regardless of operator , the rtvue 100 fd shows the lowest values ( table 1 ) .
repeatability may also be expressed as the coefficient of repeatability , defined as the standard deviation divided by the mean result .
the mean respective coefficients of cct repeatability were 0.61% , 0.82% , and 0.80% for the rtvue 100 fd , pentacam hr , and pachette 3 .
the mean respective coefficients of mct repeatability were 0.41% and 0.81% for the rtvue 100 fd and pentacam hr . in a study by barkana et al .
, the coefficient of repeatability was 0.74% for pentacam hr and 0.71% for ultrasound pachymetry .
according to the authors , such repeatability makes this examination practically independent of the operator and enables reliable measurement in just one reading .
assessed the repeatability of oct ( humphrey - zeiss medical systems ) and the average coefficient of repeatability was 2% ( 1.76% for horizontal scans and 2.32% for vertical scans ) which is , according to the authors , sufficient to obtain and monitor corneal thickness in a reliable and useful way .
for visante oct with a coefficient of repeatability of 2% in healthy eyes and 3% in keratoconic eyes .
its higher value compared with our results may be due to using a double - standard deviation to calculate the coefficient . in another study by de sanctis et al .
conducted on keratoconic eyes using ultrasound pachymetry and the scheimpflug system , the coefficient of repeatability for the allergan - humphrey 850 was twice of that for the pentacam hr .
our results confirm that all of the instruments evaluated in this study provide measurements with clinically sufficient repeatability and the rtvue 100 fd performs slightly better in this area .
we used reproducibility to assess the operator 's impact on the results . in the present study
, we compared the results of pairs of operators taking measurements with every device , consecutively .
the coefficient of reproducibility was then calculated as the standard deviation of the difference of the two measurements divided by the average of each pair of results .
the average coefficients of reproducibility for cct measurements taken by three operators using the rtvue 100 fd , pentacam hr , and pachette 3 were 0.91% , 1.11% , and 1.25% , respectively .
for mct measurements obtained using the rtvue 100 fd and pentacam hr , the coefficients of reproducibility were 0.91% and 1.27% , respectively . in the study by muscat et al .
, oct demonstrated a much lower coefficient of reproducibility of 0.18% , which , at least in part , may be due to the comparison of only one pair of operators .
the coefficient of reproducibility between a pair of operators estimated by shaheeda et al . for visante oct measurements was 2% in healthy eyes and 4% in keratoconic eyes ; however , similarly to the coefficient of repeatability calculation , the double - standard deviation was used .
assessed reproducibility between two operators for the pentacam hr and their published coefficient of reproducibility ( 1.10% ) was similar to ours .
on ultrasound pachymetry showed that differences between measurements taken by three operators were higher than those between measurements of one operator which , according to the authors , proves the great impact of an operator to the results .
subjective estimation of the center of the cornea , the technique of placing a probe , and its subsequent perpendicular alignment may all contribute to the discrepancy of measurements .
in the case of the scheimpflug system , the reproducibility and repeatability of results are similar ; according to the authors , this similarity is due to higher automatization of the examination which depends primarily on correct patient position and gaze , and only to a lesser extent on the operator . in the present study , none of the results obtained from different instruments depended significantly on the operator .
cct and mct measurements demonstrate moderate agreement between instruments . therefore , different technologies can not be used interchangeably without using correcting coefficients .
the repeatability and interoperator reproducibility of the measurements obtained by the rtvue 100 fd are somewhat higher than those of other systems . | background and objective . evaluation of agreement , repeatability , and reproducibility of central and minimal corneal thickness ( cct and mct ) measurements obtained by soct , the scheimpflug system , and ultrasound pachymetry .
materials and methods .
28 eyes of healthy patients were enrolled .
pachymetry measurements were performed with soct , the scheimpflug system , and ultrasound instrument .
each measurement was taken by 3 operators on 3 devices providing a total of 2100 measurements .
results .
the mean cct for soct , scheimpflug system , and ultrasound instrument was 537.92 , 545.94 , and 555.74 m , respectively , ( p < .001 )
. the respective mean coefficients of repeatability for cct were 0.61 , 0.82 and 0.80 , whereas mean coefficients of interoperator reproducibility for cct were 0.91 , 1.11 , and 1.25 . conclusions .
cct and mct measurements show moderate agreement between instruments .
the repeatability and interoperator reproducibility of the results obtained by soct are somewhat higher .
the operator 's impact on cct and mct measurements is insignificant in all devices . |
the prevention and management of anaphylaxis in the school setting is increasingly recognized as a public health concern as the incidence of food allergies , a major trigger for anaphylaxis , appears to be on the rise in children.1 from 1997 to 2007 , the prevalence of reported food allergy in the us increased by 18% in children < 18 years of age.2 unfortunately , many times the school is unaware that a child has a life - threatening allergy before the occurrence of an anaphylactic event.3 likewise , it is not uncommon for a child to experience a first - time anaphylactic attack in the school setting.4 often , children who experience an anaphylactic reaction do not receive epinephrine , the first - line treatment option , before presentation to the emergency department.5,6 delay in the recognition and treatment of anaphylaxis has serious ramifications from hospitalization5 and biphasic reactions7 ( ie , a reoccurrence of anaphylaxis symptoms hours after the index event ) to death.8,9 indeed , a majority of fatalities due to anaphylaxis that have been observed among adolescents and young adults have involved a lack of timely access to epinephrine.9 hospitalization also has serious repercussions as it is disruptive to school attendance and daily activities and is a source of financial burden . in the us , hospitalizations for anaphylaxis are estimated to cost $ 4,500 per event,10 and anaphylaxis is estimated to have total direct expenditures ranging from $ 288 million to $ 3.7 billion.11 to prevent or mitigate these adverse sequelae , adequate training programs are needed to properly educate school personnel to recognize and treat anaphylactic reactions . the results presented here from a pilot survey among us schools participating in the epipen4schools program ( mylan specialty l.p . , canonsburg , pa , usa ) describe the occurrence of anaphylactic reactions and the training and personnel resources available to manage these events . evaluating these aspects of anaphylaxis management will allow for a better assessment of school preparedness to deal with these serious and potentially life - threatening events .
eligible schools were participants in the epipen4schools program , which provides epipen ( epinephrine injection ) auto - injectors ( mylan specialty l.p . ) and training materials to qualifying public and private kindergarten , elementary , middle , and high schools in the us .
participating schools received two epipen auto - injector 2-packs , two epipen jr auto - injector 2-packs , or one of each 2-pack free of charge .
of the > 40,000 schools enrolled in the program , 32,387 schools had available contact information and were invited to participate in the survey .
the 15-question , web - based survey was to be completed by the person best qualified to provide information on anaphylactic events and preparedness , which was most often the school nurse.12 responses were limited to events that occurred during the 20132014 academic school year .
a total of 6,019 surveys were received between may 21 , 2014 and july 9 , 2014 .
study design and survey methodology have been previously described in greater detail.12 descriptive statistics were used to report the characteristics of participating schools ( eg , census region , state ) , anaphylactic events , and staff training .
statistics were unweighted and , therefore , did not account for potential variation in individual school populations .
most questions included a count of missing data , as respondents were not required to answer every question .
therefore , percentages calculated for the descriptive statistics were derived using the total number of responses per question .
the study was submitted to the rti institutional review board ( irb ) for approval , which determined that the research activity did not constitute research involving human subjects as defined by the us code of federal regulations ( 45 cfr 46.102 ) .
the approval of these activities by the rti irb was not necessary ; therefore , an exemption was granted .
eligible schools were participants in the epipen4schools program , which provides epipen ( epinephrine injection ) auto - injectors ( mylan specialty l.p . ) and training materials to qualifying public and private kindergarten , elementary , middle , and high schools in the us .
participating schools received two epipen auto - injector 2-packs , two epipen jr auto - injector 2-packs , or one of each 2-pack free of charge .
of the > 40,000 schools enrolled in the program , 32,387 schools had available contact information and were invited to participate in the survey .
the 15-question , web - based survey was to be completed by the person best qualified to provide information on anaphylactic events and preparedness , which was most often the school nurse.12 responses were limited to events that occurred during the 20132014 academic school year .
a total of 6,019 surveys were received between may 21 , 2014 and july 9 , 2014 .
descriptive statistics were used to report the characteristics of participating schools ( eg , census region , state ) , anaphylactic events , and staff training .
statistics were unweighted and , therefore , did not account for potential variation in individual school populations .
most questions included a count of missing data , as respondents were not required to answer every question .
therefore , percentages calculated for the descriptive statistics were derived using the total number of responses per question .
the study was submitted to the rti institutional review board ( irb ) for approval , which determined that the research activity did not constitute research involving human subjects as defined by the us code of federal regulations ( 45 cfr 46.102 ) .
the approval of these activities by the rti irb was not necessary ; therefore , an exemption was granted .
the number of schools that enrolled in the epipen4schools program varied by region and state , with the largest number of participating schools in the northeast and the greatest single - state participation rate in new york ( table 1 ) .
there was no apparent association between the number of schools within a state that enrolled in the epipen4schools program and percentage of schools that responded to the survey .
however , survey participation rates were the lowest among the largest school districts and , in some cases , large districts were unable to participate at all because of requirements for research approval that could not be completed within the time frame for the study .
of the 6,019 schools that participated in the survey , 5,683 provided information on the occurrence of anaphylactic events , with 607 ( 11% ) reporting that one or more anaphylactic events occurred during the 20132014 school year .
a total of 919 events were described.12 on a state - by - state basis , the number of anaphylactic events ranged from no events to a high of 103 events .
when calculating the mean number of anaphylactic events per school ( ie , number of anaphylactic events in a given state divided by number of responding schools in that state ) , the values ranged from 0 to 0.29 ( table 2 ) . of the 6,019 schools that participated in the survey ,
5,613 schools ( 93% ) provided information regarding staff members who were trained to recognize anaphylaxis . in response to the question , who in your school is trained to recognize the signs and symptoms of anaphylaxis ? , the most common answer ( reported by 36% of schools that provided data [ 2,022/5,613 ] ) was that only the school nurse and select staff were trained ( figure 1a ) .
less than a third of schools ( 1,730/5,613 ) trained all staff , and 29% ( 1,621/5,613 ) trained most staff in anaphylaxis recognition .
when analyzed by state , the percentage of schools that trained most or all staff in anaphylaxis recognition was highly variable ( table 2 ) .
all represented schools from iowa , north dakota , and washington , as well as the district of columbia , reported training most or all staff . however , most or all staff training rates as low as 13% were also observed .
a total of 5,578 schools provided information on the types of staff who were permitted to administer epinephrine via an epinephrine auto - injector ( eai ) .
the majority of schools ( 54% ; 3,024/5,578 ) permitted the school nurse and select staff to administer epinephrine ( figure 1b ) .
all or most staff were permitted to administer epinephrine in 38% of schools , and just 3% of schools limited eai use to the school nurse or visiting state school nurse consultant ( ie , a nurse who rotates among multiple schools to provide services as needed ) .
regional and state data demonstrated a high level of diversity in the types of staff who were permitted to administer epinephrine ( table 2 ) . in almost all cases , the proportion of schools that allowed most or all staff to administer epinephrine was lower than the proportion of schools that trained most or all staff to recognize anaphylaxis .
there was no apparent correlation between most / all staff training levels and most / all staff administration levels .
for example , the states listed above as having 100% training for recognition of signs and symptoms for most or all staff had comparatively low levels ( 25%38% ) of permission for eai administration by most or all staff . however , in general , states with a high proportion of schools in which most or all school staff were permitted to administer epinephrine had a high proportion of schools that trained most or all staff on anaphylaxis recognition .
for example , the five states listed as having > 65% permission for eai administration by most or all staff ( alaska , florida , idaho , montana , and wyoming ) also had relatively high rates of training for recognition of anaphylaxis signs and symptoms for most or all staff ( 67%83% ) .
( note : the rate of permission was 100% for the district of columbia , but there were only two schools in the district of columbia that responded to the survey . )
the number of schools that enrolled in the epipen4schools program varied by region and state , with the largest number of participating schools in the northeast and the greatest single - state participation rate in new york ( table 1 ) .
there was no apparent association between the number of schools within a state that enrolled in the epipen4schools program and percentage of schools that responded to the survey .
however , survey participation rates were the lowest among the largest school districts and , in some cases , large districts were unable to participate at all because of requirements for research approval that could not be completed within the time frame for the study .
of the 6,019 schools that participated in the survey , 5,683 provided information on the occurrence of anaphylactic events , with 607 ( 11% ) reporting that one or more anaphylactic events occurred during the 20132014 school year .
a total of 919 events were described.12 on a state - by - state basis , the number of anaphylactic events ranged from no events to a high of 103 events . when calculating the mean number of anaphylactic events per school ( ie , number of anaphylactic events in a given state divided by number of responding schools in that state ) , the values ranged from 0 to 0.29 ( table 2 ) .
of the 6,019 schools that participated in the survey , 5,613 schools ( 93% ) provided information regarding staff members who were trained to recognize anaphylaxis . in response to the question , who in your school is trained to recognize the signs and symptoms of anaphylaxis ? , the most common answer ( reported by 36% of schools that provided data [ 2,022/5,613 ] ) was that only the school nurse and select staff were trained ( figure 1a ) .
less than a third of schools ( 1,730/5,613 ) trained all staff , and 29% ( 1,621/5,613 ) trained most staff in anaphylaxis recognition . when analyzed by state ,
the percentage of schools that trained most or all staff in anaphylaxis recognition was highly variable ( table 2 ) . all represented schools from iowa , north dakota , and washington , as well as the district of columbia , reported training most or all staff .
however , most or all staff training rates as low as 13% were also observed .
a total of 5,578 schools provided information on the types of staff who were permitted to administer epinephrine via an epinephrine auto - injector ( eai ) .
the majority of schools ( 54% ; 3,024/5,578 ) permitted the school nurse and select staff to administer epinephrine ( figure 1b ) .
all or most staff were permitted to administer epinephrine in 38% of schools , and just 3% of schools limited eai use to the school nurse or visiting state school nurse consultant ( ie , a nurse who rotates among multiple schools to provide services as needed ) .
regional and state data demonstrated a high level of diversity in the types of staff who were permitted to administer epinephrine ( table 2 ) . in almost all cases , the proportion of schools that allowed most or all staff to administer epinephrine was lower than the proportion of schools that trained most or all staff to recognize anaphylaxis .
there was no apparent correlation between most / all staff training levels and most / all staff administration levels .
for example , the states listed above as having 100% training for recognition of signs and symptoms for most or all staff had comparatively low levels ( 25%38% ) of permission for eai administration by most or all staff . however , in general , states with a high proportion of schools in which most or all school staff were permitted to administer epinephrine had a high proportion of schools that trained most or all staff on anaphylaxis recognition .
for example , the five states listed as having > 65% permission for eai administration by most or all staff ( alaska , florida , idaho , montana , and wyoming ) also had relatively high rates of training for recognition of anaphylaxis signs and symptoms for most or all staff ( 67%83% ) .
( note : the rate of permission was 100% for the district of columbia , but there were only two schools in the district of columbia that responded to the survey . )
the results of this descriptive pilot study show that schools preparedness for managing anaphylaxis varies substantially .
training in the recognition of anaphylaxis predominantly included the school nurse and select staff , and regional / state proportions of schools in which most or all staff were trained ranged from 13% to 100% . in general , fewer staff were permitted to administer epinephrine than were trained to recognize ana - phylaxis signs and symptoms . in the majority of cases ( 54% )
, only the school nurse and select staff members were allowed to administer epinephrine . on a regional / state basis , the proportion of schools in which most or all school staff were permitted to treat anaphylactic events with eais ranged from 0% to 100% .
few studies have evaluated school staff training in anaphylaxis recognition , anaphylaxis management , or both .
when such studies have been conducted , they have typically involved a geographically limited sample .
for example , a recent survey of food allergy management readiness included 78 schools from southeastern wisconsin .
forty nine of the schools ( 66% ) reported that they provided staff training on anaphylaxis and epinephrine.13 by expanding training and the ability to treat anaphylaxis , schools are better able to provide a timely response and , hence , increase the potential for a more favorable outcome .
evaluations of pediatric emergency department records have shown that less than half of children presenting with anaphylaxis received treatment with epinephrine in the pre - hospital setting.5,6 one of these studies reported that 12% of the analyzed anaphylactic reactions occurred at school.6 of those , 69% of children were administered epinephrine by the school nurse . with the increasingly limited number of full - time school nurses6 and the potential for events to occur during field trips , before / after school hours , or during extracurricular activities,14 depending on a limited pool of trained responders may put children at risk .
along with the need for adequate staff training , it is important for schools to stock epinephrine because of the risk of reactions in individuals without previously known life - threatening allergies3 and because children and adolescents with known risk factors often fail to carry an unexpired eai15 or do not have ready access to an eai.16 additionally , the majority of individuals at high risk of anaphylaxis do not receive personal prescriptions for eais.17 in the epipen4schools survey , 22% of reported anaphylactic events occurred in individuals with no known allergies.12 the majority of anaphylactic events ( 75% ) reported were treated using eais ; of these events , 49% were treated with stock epipen auto - injectors from the epipen4schools program.12 most of the events that were not treated with an eai were instead treated with antihistamines.12 most states have legislation in place that allows schools to stock epinephrine.18 nine states
california , delaware , maryland , michigan , nebraska , nevada , new jersey , north carolina , and virginia have legislation that requires schools to stock epinephrine.18 nonetheless , in a survey of school nurses from california , where stocking epinephrine and administration training for unlicensed assistive personnel are permitted , only 13% reported that their school had a stock epinephrine program in place.19 moreover , despite the large presence of children with known food allergies , only 43% of schools from a houston , texas , school district reported having a stock eai.20 schools with lower socioeconomic status were less likely than schools with higher socioeconomic status to stock eais .
most states have laws regarding students carrying and self - administering prescribed epinephrine.21 while typically allowed by law , special approval is usually required .
since only 3% of responding schools said they allowed both students and staff to administer epinephrine , this suggests that , in practice , self - administration of eais by students may not be broadly permitted . as a voluntary survey that was open to a subset of us schools ( ie , those schools with a potentially higher allergy awareness information base as they were already participating in the epipen4schools program ) , the interpretation of these results is subject to inherent limitations ( eg , reporting bias , respondent recall , variance related to interpretation of meaning ) .
in addition , survey results were not adjusted for potential confounding factors such as regional variations in the size of the student populations and types of schools .
future studies may benefit from deeper analyses of the details surrounding each event , including specifics of treatment administered , location of the event , and hospital transport and follow - up ; demographic data such as race / ethnicity and sex may also be probed . moreover
, additional questions pertaining to the reasons for limited staff training or permission to treat , including regulations enacted by state or local governing bodies such as school boards , could provide greater insight into barriers that may prevent more extensive staff involvement in anaphylaxis management .
the risks and costs associated with anaphylaxis warrant that schools be prepared to act quickly both in the recognition of an anaphylactic event and in its treatment . broader training of school staff , expanded staff involvement in treatment , and ready availability of medication are necessary to achieve this goal .
the extent to which us schools have met these criteria is highly variable , both among schools and regions / states . to provide the best possible outcomes for children , barriers to their timely care within the school setting need to be identified and resolved | backgroundanaphylaxis is a serious , potentially life - threatening condition .
adequate preparation for anaphylaxis management is imperative for school personnel .
this descriptive pilot study assessed preparedness of us schools to manage anaphylactic reactions.methodsan exploratory , cross - sectional , web - based , pilot survey assessed the occurrence and characteristics of anaphylactic events , as well as training provided to school personnel for the recognition and treatment of anaphylaxis .
eligible us schools were participants in the epipen4schools program during the 20132014 school year .
epipen4schools provides epipen ( epinephrine injection ) auto - injectors and training materials to qualifying us schools .
survey data were parsed by us census bureau region and state and were evaluated using descriptive statistics.resultsschools from all 50 states and the district of columbia participated in the survey ( n=6,019 ) . among schools that provided information on anaphylactic events ,
11% ( 607/5,683 ) reported the occurrence of one or more events , with significant variability in incidence across census regions and among states .
a total of 5,613 schools provided information regarding which staff members were trained to recognize the signs and symptoms of anaphylaxis .
thirty - six percent of schools ( 2,022/5,613 ) indicated that only the school nurse and select staff were trained in anaphylaxis recognition .
the proportion of schools in which most or all school staff received such training differed by region / state ( range , 13%100% ) .
a total of 5,578 schools provided information on which staff were permitted to administer epinephrine .
the majority of schools ( 54% ; 3,024/5,578 ) permitted only the school nurse and select staff to administer epinephrine , although percentages varied by region / state ( range , 4%100%).conclusionschools differed substantially in their preparedness to manage anaphylaxis , with significant disparities in staff training and permission to treat .
given the ramifications of delayed treatment , removing barriers to the recognition and treatment of anaphylactic events in schools is an important public health goal . |
small cell carcinomas ( scc ) are the most frequent subtype among them and account for approximately 0.51% of all primary neoplasms of the urinary bladder .
pure scc of the bladder is known to be of high metastatic potential with lymph nodes , viscera , and vertebral bones being the most common sites of secondary deposits .
diagnosis of the disease in most cases is based on transurethral resection of the bladder tumor ( turbt ) .
prognosis of the disease remains poor as the majority of cases present with advanced disease .
scc of the urinary bladder can be treated with local resection of the tumor or radical cystectomy with neoadjuvant or adjuvant chemotherapy .
radiation therapy is used as an alternative to radical cystectomy or as a palliative measure .
a 76year old male was admitted to department of urology and urological oncology of medical university of lublin in september 2010 .
he presented to the department of urology two weeks earlier with gross hematuria and lower abdominal pain .
he had a history of tumor of the urinary bladder in august 2010 , which was removed by transurethral electroresection .
microscopic examination diagnosed the tumor as moderately differentiated transitional cell carcinoma ( no written data available ) .
cystoscopy done at the time of admission showed a diverticulum and a papillary tumor , both located within the posterior wall .
ct scan was performed and did not show any other lesion within the patient 's chest , abdomen , or pelvis .
as the patient did not agree for total cystectomy , we performed a partial resection of the bladder wall with removal of the tumor and diverticulum .
the surgical specimen was fixed in 10% buffered formalin and sent to the department of clinical pathomorphology for microscopic examination .
microscopy showed an ulcerated tumor composed of sheets and nests of mildly pleomorphic , small and mid
immunohistochemistry was performed and showed these neoplastic cells to be positive for cytokeratin , chromogranin , synaptophysin , and nse and negative for vimentin . scattered mitotic figures were observed and immunohistochemical staining for ki 67 , a marker of cell proliferation , was noticed to be positive in 33% of tumor cells . microscopic appearance and immunoprofile were consistent with diagnosis of primary neuroendocrine scc of the bladder .
he did not agree to the suggested treatment in the form of adjuvant chemo and radiotherapy .
the cystoscopy carried out three months after surgery did not show any gross lesion within the bladder wall .
nests of small cell carcinoma infiltrating the bladder wall ( h+e staining , magnification 200x ) .
immunohistochemical expression of neuron specific enolase ( nse ) in tumor cells ( magnification 200x ) .
scc of the urinary bladder is a rare tumor , but the bladder remains the most frequent location for non pulmonary scc of the urinary tract .
the clinical manifestation is very similar to other bladder tumors with painless gross hematuria and dysuria being the most frequent signs of the disease .
the estimated incidence of scc is 0.51% of all bladder tumors , with a male to female ratio of 6:1 [ 4 , 5 ] .
macroscopically they are usually 410 cm in size and polyp shaped with ulceration in some cases [ 5 , 6 ] .
gross examination reveals a solid tumor mass that originates from the mucosa and often penetrates deeply into the bladder wall [ 1 , 2 , 7 ] .
histologically , in 68% of cases , scc coexists with classic urothelial carcinomas or adenocarcinomas of the bladder .
microscopic examination reveals a tumor composed of sheets and nests of loosely cohesive , small , round , or oval cells with very scanty cytoplasm .
urinary cytology often shows single and loosely cohesive clusters of tumor cells with typical scc morphology .
neuroendocrine markers , such as chromogranin a , synaptophysin , cd56 , and neuron specific enolase ( nse ) , are often focally or diffusely positive for these tumors by immunohistochemical methods , and they are useful tools that aid in establishing the diagnosis [ 4 , 7 , 8 ] .
a cocktail of cytokeratin ( ck ) markers is often nonreactive , but low molecular cytokeratin , cam52 , and epithelial membrane antigen ( ema ) are mostly positive [ 4 , 7 , 8 ] .
mucosa of the bladder infiltrated by nests of small cell carcinoma ( h+e staining , magnification 100x ) .
prognosis of scc remains poor due to very aggressive behavior with up to 25% of patients presenting metastatic disease at the time of diagnosis and absence of symptoms at the beginning of disease .
the overall survival rate for all stages at five years is variable and ranges from 8% to 40% .
treatment outcome of scc of the urinary bladder is relatively better than for small cell lung carcinoma because the tumor volume at the time of diagnosis is smaller in urinary bladder than in lung .
it is advised to use chemotherapy regimens active in small cell lung carcinoma , with the cisplatin based regimen being the most important .
it has been shown that patients who received preoperative chemotherapy in a regimen directed towards small cell carcinoma had significantly increased 5year disease free survival , compared to patients receiving classical chemotherapy directed towards urothelial cancer ( m vac regimen ) .
radiation therapy can be used as an alternative to radical cystectomy or as a palliative measure . in our case
we performed diverticulectomy to preserve the patient 's urinary bladder since he refused to undergo radical cystectomy .
although the patient did not agree to be subjected to adjuvant chemotherapy or radiation therapy , a diagnostic cystoscopy performed three months postoperatively showed a normal mucosa without recurrence . | small cell carcinomas of the urinary bladder originating from the neuroendocrine cells are extremely rare .
we present a case of a 76year old patient with small cell carcinoma of the urinary bladder .
the patient had hematuria and cystoscopy revealed a tumor located in a urinary bladder diverticulum .
partial resection of the bladder wall with diverticulectomy was performed .
microscopic examination established the diagnosis of neuroendocrine carcinoma , which was confirmed by immunohistochemistry .
three
month follow up showed no recurrent disease .
patient refused further chemotherapy and radiotherapy . |
the tropical medicine foundation of amazonas is a tertiary care center for infectious diseases in manaus ( 38s , 601w ) . in 2001 and 2002 , a total of 13,056 cases of malaria were diagnosed in this institution ( 11,251 p. vivax ) , representing 65.1% of the total cases from manaus . during the same period , 358 ( 3.2% )
a retrospective analysis was performed of case - patients who fulfilled the malaria severity criteria of the world health organization ( who ) ( 8) .
these patients had an exclusive diagnosis of p. vivax malaria by thick blood smear ( reviewed 2 times by experienced microscopists ) and pcr , according to the technique described elsewhere ( 9 ) .
pcr was performed on whole blood from all patients with p. vivax malaria , confirmed by microscopy and any p. falciparum severity criterion recommended by who .
full clinical information was available from the patients charts , and serologic tests for dengue virus , leptospira spp . , and hepatitis a , b , and c viruses were performed on available serum samples stored at 20c .
patients were routinely discharged only after parasitologic clearance and clinical recovery . until 2006 , chloroquine was still prescribed for patients with severe cases at a dose of 10 mg / kg on the first day and 7.5 mg / kg on the second and third days , followed by primaquine ( 0.5 mg / kg / day for 7 days ) , according to the brazilian ministry of health guidelines . in 2006 , who formally recommended the treatment of severe vivax malaria to be the same as that for severe falciparum malaria , because of the risk for an unrecognized mixed infection ( 8) .
seventeen patients were included in the analysis , and their clinical and laboratory data are shown in table 1 and table 2 , respectively . all patients received chloroquine ( orally or through a nasogastric tube ) and primaquine .
acute respiratory distress syndrome ( ards ) ( diffuse interstitial and alveolar infiltrate by chest radiograph and partial o2 pressure 40 mm hg by arterial gas analysis ) developed in patient 11 two days after she received chloroquine , and she died 3 days later .
this patient had a negative thick blood smear from day 3 of treatment with choloroquine .
none had clinical symptoms of malaria , and all thick blood smears were negative at days 7 , 14 , and 28 . * who , world health organization ; icu , intensive care unit ; hav , hepatitis a virus ; ards , acute respiratory distress syndrome ( tachypnea , shortness of breath , and signs of hypoxemia ) .
hemoglobin < 7 g / dl in adults and < 5 g / dl in children .
who , world health organization ; ast , aspartate aminotransferase ; alt , alanine aminotransferase .
the patients in whom complications developed exhibited a remarkably wide age range ( 28 days80 years ) .
this age range is similar to that seen in other case series from latin america , such as in hospitalized children from venezuela with severe anemia that required blood transfusions ( 10 ) and in adults from rondnia ( a state in the western brazilian amazon ) who had severe anemia , jaundice , acute renal failure , ards , and shock ( 11 ) .
p. vivax malaria with ards has been reported in travelers who acquired the infection in manaus ( 12,13 ) .
the finding of severe anemia in 4 of 7 children highlights the relevance of this complication in p. vivax infection ( figure ) , as shown in a prospective study from papua , indonesia ( 14 ) .
nine patients sought treatment for cholestatic jaundice ; for 8 , jaundice was the only complication .
1 ) with severe anemia ( hemoglobin level 3.6 g / dl ) , showing intense pallor , compared with the hand of a healthy physician . photograph provided by authors .
the concomitant diagnosis of hepatitis a virus infection in patient 3 ( table 1 ) indicates that other infectious diseases should be excluded when characterizing severe p. vivax malaria . also of note
is the presence of thrombocytopenia in 15/17 patients ( none had clinical bleeding ) , which suggests that this hematologic complication may be a surrogate marker of severity .
the wide range of parasitemia found in our patients does not enable us to comment on the value of this variable as a determinant of severity .
sixteen patients recovered without the use of antimicrobial drugs ; therefore , it is highly improbable that bacterial sepsis was a factor for severity in our case series . in unstable transmission areas ( < 0.1 autochthonous case per 1,000 persons per year ) , malaria in older patients may pose an additional problem because chronic diseases ( e.g. , arterial hypertension and diabetes ) may predispose a patient to clinical decompensation . in vivo chloroquine resistance was not detected in any of the cases that were followed up , despite recent confirmation of the phenomenon in this same locality ( 15 ) . because a reliable molecular marker of chloroquine resistance is lacking and parenteral artemisinin derivatives are recommended for treatment of patients with severe p. vivax malaria , studies that assess clinical severity and chloroquine resistance would be unethical .
however , our findings suggest that chloroquine resistance would be a problem for individual patients and that the determinants of this resistance need to be clarified .
clearly , areas with chloroquine - resistant p. vivax also report severe p. vivax malaria , but we believe that these studies are not able to establish any firm causality .
the finding of both phenomena in some areas may simply reflect high transmission of this species .
our retrospective review illustrates the spectrum of severe p. vivax malaria in manaus , and these results parallel the increasing clinical severity described in malaria - endemic areas such as papua ( indonesia ) and india .
these severe p. vivax cases contribute to increased public health costs because of increased hospitalization and the need for intensive care and blood transfusions .
the major complications in patients who required hospitalization were jaundice and severe anemia , although whether these complications were responsible for deaths is undetermined .
however , who criteria formerly defined for p. falciparum malaria seem to be applicable to most of the severe p. vivax malaria cases reported in hospital - based studies in the literature .
pcr should be performed to rule out mixed infections and other common infectious diseases so that reports from different parts of the world are comparable . despite the small number of patients , our data corroborate previous findings of severe disease found in areas where chloroquine - resistant p. vivax is being reported but suggest that establishing direct causality is not straightforward .
we urgently need to know which clinical complications in p. vivax malaria are associated with death to validate severity criteria . a valid biomarker for chloroquine resistance would also enable associative studies to determine the association between resistance and severity . | we describe a case series of 17 patients hospitalized in manaus ( western brazilian amazon ) with pcr - confirmed plasmodium vivax infection who were treated with chloroquine and primaquine .
the major complications were jaundice and severe anemia .
no in vivo chloroquine resistance was detected .
these data help characterize the clinical profile of severe p. vivax malaria in latin america . |
charles darwin suffered illness for most of his adult life with many very differing symptoms .
some of these symptoms were present when he was a university student , both in edinburgh and cambridge . in edinburgh
he was known to have a weak stomach and was unable to watch surgical operations ; at cambridge he suffered from eczema of his lips and hands .
when attending two recitals in 1 day at a birmingham music festival , he experienced extreme fatiguemost terribly knocked up , as he expressed in his autobiography ( barlow 1958 ) .
when he was a resident in plymouth , before he sailed on hms beagle , he experienced an episode of rapid heartbeat with pain around the heart . during his voyage on the beagle , darwin suffered greatly from seasickness .
this was not ordinary seasickness but a sickness that became worse throughout the 5-year voyage . when ashore , he also had periods of illness , including attacks of headache and visual disturbances .
these episodes were severe enough for him to be incapacitated for days on end . before the voyage , apart from these unusual but mostly sporadic episodes of illness , darwin was a fit young man .
after the voyage , however , his illness progressed and he had attacks of sickness during which he was incapacitated for weeks , even months at a time .
he suffered with nausea , retching , vomiting , flatulence , episodes of abdominal pain , lumbago or backache , and symptoms of asthma .
eczema , diagnosed as atopic dermatitis ( sauer 2000 ) , was at times severe and was complicated by frequent boils .
he complained of numbness in his fingers ( peripheral neuropathy ) , together with shivering , sweating , and giddy turns ( dysautonomia ) .
he had psychological symptoms , waking at night with intense , irrational fear and other episodes of hysterical crying .
he continued to have periods of severe lethargy , with times when he could only lie on a sofa and do nothing .
darwin s main symptoms are listed in table 1 ; symptoms that may be considered secondary in nature are listed in table 2 together with their proposed relationship to his primary symptoms .
the two hormones are released together from the pituitary , molecule for molecule , by splitting of a large parent molecule .
his attacks were characteristically brought on by any forms of stress , even by pleasurable events .
darwin learned to prevent these events by restricting visitors and avoiding scientific and social occasions .
in older age there was no pressure to publish and darwin could work at a pace that suited him and , evidently , his frail condition .
many of the different diagnoses that have been proposed for darwin s illness are psychogenic or psychological in nature .
these include repressed hatred for a dominating father , or , alternatively , as a means of bonding with his father by developing a patient doctor relationship ( colp 2008 ) .
john bowlby , an english psychiatrist , propounded psychogenic causes for many illnesses , in particular mother child separation .
he suggested that unresolved grief over the death of his mother when he was 8 years old was the cause of darwin s psychosomatic illness ( bowlby 1965 ) .
bowlby suggested that his hypothesis could be tested by showing that darwin s symptoms were worse at anniversary dates , such as the date of his mother s death , and that his symptoms were similar to those of his mother s .
colp diligently examined the state of darwin s illness on these dates and found no such association ( colp 1977 ) .
it will be proposed here , however , that there was an important maternal link to darwin s illness but that it was genetic , not psychological . indeed
, darwin and his mother seem to have shared a number of symptoms as would be expected for such a connection .
other psychogenic causes that have been proposed include inner emotional conflict ( repressed hatred ) toward his loving and devoted wife emma and guilt over conflict with religious beliefs and his ideas of evolution ( colp 2008 ) .
darwin certainly had psychological symptoms , including symptoms of a panic disorder with periods of irrational fear ( barloon and noyes 1997 ) , episodes of hysterical sobbing , and other symptoms that may be psychological such as sweating , tremors , and palpitations .
other diagnoses relate to possible acquired infection during the voyage of the hms beagle ; the most persistent of these is that darwin had chagas disease ( american trypanosomiasis ) ( adler 1959 ) . despite a comprehensive rebuttal by woodruff and others this diagnosis persists ( woodruff 1965 ) .
woodruff pointed out that although darwin was bitten by a known vector , and certainly bitten several times , the insect in that place and at that time would be unlikely to have been carrying the infectious agent .
darwin suffered from severe incapacity but he lived to the age of 73 ; he almost certainly would not have survived to this age with advanced trypanosomal heart and intestinal disease .
in addition , darwin consulted the best physicians of his time and no physical abnormality in their examinations is recorded .
woodruff concluded : it is beyond credibility that severe incapacity could have been produced ( by chagas disease ) for 4050 years without the development of physical signs .
intestinal disorders have also been proposed including peptic ulceration , biliary disease , crohn s disease , and the irritable bowel syndrome ( ibs ) ( shanahan 2012 ) .
darwin certainly had symptoms of ibs ; he also had symptoms of another suggested diagnosis , that of paroxysmal tachycardia ( dent 1965 ) .
the symptoms of ibs , panic disorder , atopic dermatitis , and paroxysmal tachycardia may all occur with darwin s proposed diagnosis .
other diagnoses may be dismissed simply on the grounds that darwin had some early symptoms of his disorder before he sailed on the beagle , before he developed any ideas about evolution , and before his proposal and marriage to emma . in fairness , it should be remembered that many of these more imaginative diagnoses were put forward before there was much knowledge of mitochondrial genetic diseases .
most of darwin s symptoms are similar to those seen in patients with cyclic vomiting syndrome ( cvs ) ( hayman 2009 ) , including some of the more unusual features of this rather poorly defined disorder .
patients with cvs suffer from motion sickness , attacks may be brought on by pleasurable events ( positive stress ) , and patients often have relief from water exposure ( fleisher et al .
only one of the many treatments that darwin tried seemed to bring him any relief and that was hydropathy or the water cure .
patients with cvs today will spend hours in a bath or under a shower ( cyclic vomiting association 2010 ) .
some of darwin s symptoms , however , were not symptoms experienced by patients with cvs . in his 50 s ,
darwin experienced episodes of transient partial paralysis , inability to speak , and memory loss ( jones 1867 ) .
these symptoms , together with many of his other symptoms such as headache and visual disturbances may occur in melas syndrome ( pavlakis et al .
this syndrome , usually regarded as a fatal childhood disorder , may have less severe manifestations and symptoms may first appear in adult life ( higashikata et al . 2001 ) .
lactic acidosis , which is a biochemical feature of the disorder ( and part of the acronym ) may be associated with feelings of panic ( ehlers et al .
eighty percent of patients with this disorder have been shown to have a particular mitochondrial dna mutation , an a - to - g transition at nucleotide 3243 in the gene for leucine transfer rna in the mitochondrial ring chromosome ( goto et al .
1990 ) . this same mutation may be associated with cardiac and vestibular symptoms , atopy ( atopic dermatitis , asthma ) , dysautonomia , and peripheral neuropathy ( finsterer 2007 ) .
darwin s symptoms and their similarities to the effects created by the mtdna mutation associated with melas syndrome are summarized in table 1 .
although melas syndrome as initially described was progressive and fatal in early life , patients carrying the mutation commonly associated with the condition may have lesser symptoms and a normal lifespan ( manwaring et al . 2007 ) .
an examination of darwin s family history provides supporting evidence that charles darwin had such an inherited mitochondrial disorder .
erasmus alvey darwin ( 18041881 ) , charles elder brother , graduated in medicine from the university of edinburgh but never practiced .
instead , he spent a life in london partly as a socialite and partly as a chronic invalid ( healey 2001 ) .
he suffered from abdominal pain and lethargy ; today he would probably be diagnosed as having chronic fatigue syndrome .
his symptoms are consistent with his having had the same mtdna mutation as his younger brother but with a lower level of heteroplasmy .
susannah ( sukey ) darwin ( wedgwood ) ( 17651817 ) , charles and erasmus mother , suffered chronic ill health and was never quite well and never very ill
( wedgwood and wedgwood 1980 ) . as a child she suffered from vomiting and boils , and had difficulties with her pregnancies , spending much time in bed and suffering from what most likely was hyperemesis .
she also experienced motion sickness and preferred to ride in a phaeton rather than a carriage .
her symptoms are those that may occur in cvs ; female patients frequently have hyperemesis during pregnancy ( fleisher et al .
tom wedgwood ( 17711805 ) , susannah s youngest brother , was unwell for most of his short life .
as a student he suffered from headaches and later severe abdominal pains and would roll around the floor in agony . on his trip to the west indies he also suffered from seasickness and was confined to his cabin for the entire voyage with both vomiting and abdominal pain ( wedgwood and wedgwood 1980 ) .
his symptoms are consistent with what today would be called abdominal migraine , a disorder that may be associated with cvs and with the same mtdna mutation ( pronicki et al . 2002 ) .
mary anne wedgwood ( 17781786 ) , the youngest child in the family , had short stature and was physically and mentally retarded .
she died with progressive dementia at the age of eight ( wedgwood and wedgwood 1980 ) .
her symptoms are typical of the severer cases of melas syndrome , as associated with the a3243 g mtdna mutation ( goto et al . 1990 ) .
other siblings in the family suffered more ambiguous symptoms such as social and cognitive decline , while daughters of susannah s sisters also had similar problems .
although less specific as a symptom , psychosocial abnormality may also occur with the a3243 g mutation ( finsterer 2007 ) .
two brothers had tremors ; one had a lifetime tremor and the other developed classical parkinson s disease in later life .
a diagram , giving symptoms of charles darwin s siblings and his maternal ancestors is shown in figure 1 .
diagram showing charles darwin s siblings and his maternal ancestors , with their major symptoms .
most , if not all of these symptoms may occur with the a3243 g mtdna mutation .
charles darwin s 10 children were in general a sickly lot ; one died in infancy , one in childhood , and their first daughter died at the age of 10 .
their illnesses do not seem to be related to one another and not related to the illness of their father . as well as other symptoms , the children suffered from various infections .
their sicknesses may have at least in part been due to the consanguinity of their parents ( charles and his wife emma were first cousins ) as there may be increased susceptibility to infection in the children of such partnerships ( berra et al .
darwin s illness , the illnesses of his brother , their mother , his maternal uncle tom , and a child belonging to the maternal generation as well as other family members show a pattern of maternal inheritance that is the hallmark of mitochondrial mutations , while the particular symptoms point to one specific well - characterized mitochondrial disorder , melas syndrome .
the evidence is circumstantial , of course , but it is considerable and consistent . as darwin said of evolution and natural selection : let me add that there are many difficulties not satisfactorily explained by my theory of descent with modification , but i can not possibly believe that a false theory would explain so many classes of facts as i think it certainly does explain . much the same
if the conclusion that darwin s illness was due to a mtdna mutation is accepted , then the detailed , lifetime history of his illness and those of family members shows us the range of symptoms that may occur with the one mtdna abnormality .
further study of diseases associated with mtdna mutations may lead us to a better understanding of darwin s illness , in particular of his very diverse symptoms and the manner in which his attacks of illness were precipitated . | charles darwin s long - term illness has been the subject of much speculation .
his numerous symptoms have led to conclusions that his illness was essentially psychogenic in nature .
these diagnoses have never been fully convincing , however , particularly in regard to the proposed underlying psychological background causes of the illness .
similarly , two proposed somatic causes of illness , chagas disease and arsenic poisoning , lack credibility and appear inconsistent with the lifetime history of the illness .
other physical explanations are simply too incomplete to explain the range of symptoms . here ,
a very different sort of explanation will be offered .
we now know that mitochondrial mutations producing impaired mitochondrial function may result in a wide range of differing symptoms , including symptoms thought to be primarily psychological .
examination of darwin s maternal family history supports the contention that his illness was mitochondrial in nature ; his mother and one maternal uncle had strange illnesses and the youngest maternal sibling died of an infirmity with symptoms characteristic of mitochondrial encephalomyopathy , lactic acidosis , and stroke - like episodes ( melas syndrome ) , a condition rooted in mitochondrial dysfunction .
darwin s own symptoms are described here and are in accord with the hypothesis that he had the mtdna mutation commonly associated with the melas syndrome . |
microvascular decompression ( mvd ) was introduced in the late 1960s and is a widely accepted treatment for neurovascular compression , including hemifacial spasm ( hfs ) , trigeminal neuralgia ( tn ) , and glossopharyngeal neuralgia .
technological advances , combined with microsurgical innovations , make this procedure effective and safe9 ) .
additionally , mvd offers significant advantages for both hfs and tn in terms of success rates without further treatment when compared with alternative treatments , such as botulinum toxin injections for hfs and radiofrequency lesioning of the gasserian ganglion for tn5 ) .
however , to obtain these benefits , patients are subjected to a slightly higher treatment risk , including the risk of cerebellar injury , hearing loss , cerebrospinal fluid ( csf ) leakage , facial palsy , etc9 ) .
therefore , many efforts have been made to reduce the rates of complications following mvd via neurophysiologic monitoring and/or modified surgical techniques2,8 - 10,12 ) .
currently , the rate of facial palsy following mvd is very low , and the rates of cerebellar injury and hearing loss have been down by half , approximately less than 1%9 ) .
however , the rate of csf leakage , often causing fatal meningitis , remains high and has been reported to range from approximately 1% to 5%3,9,13,14 ) .
one of the most important aspects of mvd with respect to the avoidance of csf leakage is a watertight dural closure9 ) .
moreover , the appropriate choice of dural substitutes can also lower the risk of csf leakage11,12 ) .
closed - suction drainage has traditionally been used to prevent postoperative hematoma or in cases of uncertain hemostasis6 ) .
however , the quoted incidence of intracranial hematoma following mvd is only 0.4 - 0.5%5,7 ) .
moreover , epidural hematoma at the surgical site , for which only closed - suction drainage can work , appears to be even rarer .
furthermore , closed - suction drainage following mvd can cause csf leakage ( jacques magnan ; personal communication , september 9 , 2010 ) .
we compared a traditional retrosigmoid suboccipital craniotomy using closed - suction drainage to a minimally invasive small craniectomy without drainage .
we performed this study to investigate whether closed - suction drainage following mvd causes csf leakage by comparing the incidences of csf leakage following mvd for both of these surgical procedures .
between 2004 and 2011 , a total of 157 patients with neurovascular compression were treated with mvd . of these ,
mvd was performed for hfs in 150 ( 95.5% ) cases and for tn in 7 ( 4.5% ) cases .
our surgical procedures for mvd included a traditional retromastoid craniotomy and a minimally invasive approach in which a small 2 - 2.5 cm retromastoid craniectomy using a bony landmark of the incisura mastoidea or the mastoid notch , as described elsewhere4,9 ) .
a three - point head - fixation was applied while the patient is in the supine lateral position .
after shaving the area 4 to 5 cm behind the ear , the mastoid tip and notch were identified and marked .
a lazy - s skin incision of 8 to 10 cm in length and a half above the mastoid notch was made along the hair line .
a keyhole was drawn on the asterion , and the junction of the transverse sinus and sigmoid sinus was identified .
a bone flap of approximately 4 cm in size was removed using a high - speed drill , and bony exposure was laterally extended to identify the posterior margin of the sigmoid sinus .
the incision of the dura mater was made along the posterior margin of the sigmoid sinus .
following decompression of the offending vessel(s ) from the cranial nerves , the bone edges of the mastoid air cells were thoroughly sealed with bone wax .
a watertight dural closure was subsequently performed , and dural substitutes were used as necessary .
fibrin glue was applied on the epidural space , and the bone flap was repositioned usually with a titanium mesh . before approximation of the deep and superficial muscles , a closed - suction drainage system ( hemovac ; generally 400 cc ) was inserted into the subgaleal space between the bone flap and the muscle layer
. early mobilization of the patients was encouraged on postoperative day 1 , and the patients were discharged following resolution of postoperative dizziness and headache . with the patient in the supine position ,
the head was rotated approximately 20 to 30 away from the affected side without the use of head - fixation .
the mastoid tip and notch were identified and marked , and a 1 cm - wide area was shaved behind the hairline .
a 4 to 5 cm curvilinear skin incision is made along the hairline , in which three quarters were below the mastoid notch in cases of hfs and a half above the mastoid notch in cases of tn . following the identification of the digastric groove , a 2 to 2.5 cm craniectomy was performed below the digastric groove for hfs and above the digastric groove for tn4,9 ) .
an incision of the dura mater was made along the inferoposterior margin of the sigmoid sinus .
the offending vessel(s ) were decompressed from the cranial nerves , and the bone edges of the mastoid air cells were waxed , as described above .
if required , pieces of muscle from the adjacent neck muscles were used to perform the plugging muscle method , as described elsewhere12 ) . following application of fibrinogen / thrombin - based collagen fleece ( tachocomb ; nycomed , linz , austria ) for additional sealing of the dural incision and to achieve hemostasis of the outer surface of the exposed dura mater , a cranioplasty was performed usually using polymethylmethacrylate bone cement .
finally , the deep and superficial muscles were approximated without using closed - suction drainage .
csf leakage following mvd was defined as follows : 1 ) rhinorrhea , otorrhea , pseudomeningocele , and/or an incisional leak at any time following mvd irrespective of the development of central nervous system infections1 ) ; 2 ) middle ear effusions , generally accompanied by ear fullness , identified by thorough otological evaluations7 ) ; 3 ) csf leakage developing on postoperative day 2 or later , considering the time required for drainage of the fluid that potentially flowed into the mastoid air cells before waxing of the inlet during the procedure ; and 4 ) persistence of csf leakage for 2 or more days ; in cases of middle ear effusion , effusion was identified at the follow - up otological evaluation 2 or 3 days following the initial exam .
the duration of closed - suction drainage was defined as the interval between skin closure to the removal or clamping of the drainage system .
a single rater , who was blind to the clinical outcome data and the development of csf leakage , reviewed all of the immediate postoperative computed tomography ( ct ) scans .
this was performed to determine whether the mastoid air cells were opened during mvd or not , which may influence the development of middle ear effusion due to csf leakage .
the ct scan was obtained at a 2.5 - 5-mm thickness ( brilliance ct ; philips medical systems , wa , usa ) .
the clinical outcome of the neurovascular compression with respect to the surgical method was not a principal concern of this study and was not evaluated .
all of the patient data were based on information that was contained in hospital charts .
the radiological studies were collected in accordance with the case record form , which was approved by the institutional review board .
the incidence of csf leakage was compared between the two groups of patients using fisher 's exact test .
student 's t - test was performed to compare the means of the continuous variables between the groups . to reduce the probability of type ii errors considering the modest sample size , variables were considered for the multivariate analysis only if they were associated with a dependent variable in each analysis at the p<0.10 level .
when the estimate of the coefficient was zero or extreme , exact logistic regression was used to obtain a median unbiased estimate .
these statistical analyses were performed using pasw statistics software version 17.0.2 ( spss inc . ,
chicago , il , usa ) and the stata software package version 12.0 ( stata corp . , college station , tx , usa ) .
a three - point head - fixation was applied while the patient is in the supine lateral position . after shaving the area 4 to 5 cm behind the ear ,
a lazy - s skin incision of 8 to 10 cm in length and a half above the mastoid notch was made along the hair line .
a keyhole was drawn on the asterion , and the junction of the transverse sinus and sigmoid sinus was identified .
a bone flap of approximately 4 cm in size was removed using a high - speed drill , and bony exposure was laterally extended to identify the posterior margin of the sigmoid sinus .
the incision of the dura mater was made along the posterior margin of the sigmoid sinus .
following decompression of the offending vessel(s ) from the cranial nerves , the bone edges of the mastoid air cells were thoroughly sealed with bone wax
. a watertight dural closure was subsequently performed , and dural substitutes were used as necessary .
fibrin glue was applied on the epidural space , and the bone flap was repositioned usually with a titanium mesh . before approximation of the deep and superficial muscles , a closed - suction drainage system ( hemovac ; generally 400 cc ) was inserted into the subgaleal space between the bone flap and the muscle layer .
early mobilization of the patients was encouraged on postoperative day 1 , and the patients were discharged following resolution of postoperative dizziness and headache .
with the patient in the supine position , the head was rotated approximately 20 to 30 away from the affected side without the use of head - fixation . the mastoid tip and notch were identified and marked , and a 1 cm - wide area was shaved behind the hairline .
a 4 to 5 cm curvilinear skin incision is made along the hairline , in which three quarters were below the mastoid notch in cases of hfs and a half above the mastoid notch in cases of tn . following the identification of the digastric groove , a 2 to 2.5 cm craniectomy was performed below the digastric groove for hfs and above the digastric groove for tn4,9 ) .
an incision of the dura mater was made along the inferoposterior margin of the sigmoid sinus .
the offending vessel(s ) were decompressed from the cranial nerves , and the bone edges of the mastoid air cells were waxed , as described above .
if required , pieces of muscle from the adjacent neck muscles were used to perform the plugging muscle method , as described elsewhere12 ) .
following application of fibrinogen / thrombin - based collagen fleece ( tachocomb ; nycomed , linz , austria ) for additional sealing of the dural incision and to achieve hemostasis of the outer surface of the exposed dura mater , a cranioplasty was performed usually using polymethylmethacrylate bone cement .
finally , the deep and superficial muscles were approximated without using closed - suction drainage .
csf leakage following mvd was defined as follows : 1 ) rhinorrhea , otorrhea , pseudomeningocele , and/or an incisional leak at any time following mvd irrespective of the development of central nervous system infections1 ) ; 2 ) middle ear effusions , generally accompanied by ear fullness , identified by thorough otological evaluations7 ) ; 3 ) csf leakage developing on postoperative day 2 or later , considering the time required for drainage of the fluid that potentially flowed into the mastoid air cells before waxing of the inlet during the procedure ; and 4 ) persistence of csf leakage for 2 or more days ; in cases of middle ear effusion , effusion was identified at the follow - up otological evaluation 2 or 3 days following the initial exam .
the duration of closed - suction drainage was defined as the interval between skin closure to the removal or clamping of the drainage system .
a single rater , who was blind to the clinical outcome data and the development of csf leakage , reviewed all of the immediate postoperative computed tomography ( ct ) scans .
this was performed to determine whether the mastoid air cells were opened during mvd or not , which may influence the development of middle ear effusion due to csf leakage .
the ct scan was obtained at a 2.5 - 5-mm thickness ( brilliance ct ; philips medical systems , wa , usa ) .
the clinical outcome of the neurovascular compression with respect to the surgical method was not a principal concern of this study and was not evaluated .
all of the patient data were based on information that was contained in hospital charts .
the radiological studies were collected in accordance with the case record form , which was approved by the institutional review board .
the incidence of csf leakage was compared between the two groups of patients using fisher 's exact test .
student 's t - test was performed to compare the means of the continuous variables between the groups . to reduce the probability of type ii errors considering the modest sample size , variables were considered for the multivariate analysis only if they were associated with a dependent variable in each analysis at the p<0.10 level .
when the estimate of the coefficient was zero or extreme , exact logistic regression was used to obtain a median unbiased estimate .
these statistical analyses were performed using pasw statistics software version 17.0.2 ( spss inc . , chicago , il , usa ) and the stata software package version 12.0 ( stata corp . , college station , tx , usa ) .
ninety - two ( 58.6% ) patients underwent mvd using closed - suction drainage and were entered into the ' drainage group ' .
mvd without closed - suction drainage was performed in 65 ( 41.4% ) patients , designated the ' no - drainage group ' . in 44 ( 28.0% ) patients ,
dural substitutes , such as neuro - patch ( b. braun ) or muscle pieces were used ; a primary watertight dural closure without the use of dural substitutes was performed in the remaining patients .
the mastoid air cells were opened during the surgery in 78 ( 49.7% ) patients based on the routine postoperative ct scan . among 92 patients in the drainage group , the closed - suction drainage was removed or clamped due to csf drainage via the drainage system in 57 patients ( 62.0% ) , due to air drainage in 10 patients ( 10.9% ) , and due to no or very little drainage in 23 patients ( 25.0% ) . in two ( 2.2% ) patients , the closed - suction drainage was removed due to an additional surgery for postoperative supratentorial epidural hematoma .
the mean duration of the closed - suction drainage was 20.911.6 hours ( range , 0 - 48.3 ) . in two ( 2.2% ) patients , drainage was not performed following the placement of the closed - suction drainage because the csf was drained immediately after the surgery ; the drainage was therefore subsequently clamped and removed .
a total of 11 ( 7.0% ) patients experienced csf leakage following mvd based on the criteria of this study .
interestingly , all of these patients were in the drainage group ( 12.0% of the drainage group ) .
eight of these patients were conservatively treated with bed rest and local management , such as a mastoid compression dressing . in two of these patients ,
continuous lumbar drainage was put in place for 5 days , and csf leakage was successfully controlled .
one 50-year - old male , whose drainage system drained air immediately following the surgery , underwent an additional surgery on the 13th postoperative day for a cerebellar abscess combined with meningitis and middle ear effusion ( fig .
one patient exhibited a trace of slightly yellow fluid on her pillow on postoperative day 4 .
however , no evidence of middle ear effusion or wound leakage was identified , even following a thorough otological evaluation . no further event suggesting csf leakage developed thereafter . thus , based on our criteria of csf leakage ,
no patient in the no - drainage group experienced csf leakage following mvd . in the unadjusted analyses , the incidence of csf leakage
was significantly related with the use of closed - suction drainage following mvd ( 12.0% in the drainage group vs. 0% in the no - drainage group , respectively ; p=0.003 ; fisher 's exact test ) .
six ( 13.6% ) of the 44 patients for whom dural substitutes were used experienced csf leakage , as did 5 ( 4.4% ) of the 113 patients who did not receive dural substitutes ; however , this effect did not reach statistical significance ( p=0.075 ; fisher 's exact test ) .
lastly , the elderly patients ( cut - off value=60 years ) also exhibited a trend toward an increased risk of csf leakage ( p=0.090 ; fisher 's exact test ) ; however , this effect also did not reach statistical significance . the opening of the mastoid air cells during surgery was unrelated to the development of csf leakage following mvd ( p=0.369 ; fisher 's exact test ) . in the multivariate analysis , only the use of closed - suction drainage was significantly and independently related with the development of csf leakage following mvd ( odds ratio=9.900 ; 95% confidence interval , 1.418 to infinity ; p=0.017 ) .
the results of the statistical analyses are summarized in table 3 . a postoperative infection developed in 5 ( 3.2% ) patients .
one patient in the drainage group experienced a cerebellar abscess following a middle ear effusion , as mentioned above .
another patient in the drainage group developed pseudomeningocele combined with meningitis and was treated conservatively . in the no - drainage group ,
3 patients experienced postoperative infection ; one with aseptic meningitis and two successive cases of superficial wound infection caused by serratia marcescens .
an asymptomatic small amount of supratentorial subdural hematoma was observed on the routine immediate postoperative ct scan in 3 ( 1.9% ) patients ( 2 in the drainage group and 1 in the no - drainage group ) .
two ( 1.3% ) patients in the no - drainage group developed ecchymosis in the neck near the surgical wound ; however , they did not exhibit related symptoms or require further management .
interestingly , 4 ( 2.5% ) patients experienced an immediate postoperative seizure without any evidence of intracranial hemorrhage .
a total of 11 ( 7.0% ) patients experienced csf leakage following mvd based on the criteria of this study .
interestingly , all of these patients were in the drainage group ( 12.0% of the drainage group ) .
eight of these patients were conservatively treated with bed rest and local management , such as a mastoid compression dressing . in two of these patients ,
continuous lumbar drainage was put in place for 5 days , and csf leakage was successfully controlled . one 50-year - old male , whose drainage system drained air immediately following the surgery , underwent an additional surgery on the 13th postoperative day for a cerebellar abscess combined with meningitis and middle ear effusion ( fig .
one patient exhibited a trace of slightly yellow fluid on her pillow on postoperative day 4 .
however , no evidence of middle ear effusion or wound leakage was identified , even following a thorough otological evaluation . no further event suggesting csf leakage developed thereafter
thus , based on our criteria of csf leakage , no patient in the no - drainage group experienced csf leakage following mvd . in the unadjusted analyses ,
the incidence of csf leakage was significantly related with the use of closed - suction drainage following mvd ( 12.0% in the drainage group vs. 0% in the no - drainage group , respectively ; p=0.003 ; fisher 's exact test ) .
six ( 13.6% ) of the 44 patients for whom dural substitutes were used experienced csf leakage , as did 5 ( 4.4% ) of the 113 patients who did not receive dural substitutes ; however , this effect did not reach statistical significance ( p=0.075 ; fisher 's exact test ) .
lastly , the elderly patients ( cut - off value=60 years ) also exhibited a trend toward an increased risk of csf leakage ( p=0.090 ; fisher 's exact test ) ; however , this effect also did not reach statistical significance .
the opening of the mastoid air cells during surgery was unrelated to the development of csf leakage following mvd ( p=0.369 ; fisher 's exact test ) . in the multivariate analysis ,
only the use of closed - suction drainage was significantly and independently related with the development of csf leakage following mvd ( odds ratio=9.900 ; 95% confidence interval , 1.418 to infinity ; p=0.017 ) .
one patient in the drainage group experienced a cerebellar abscess following a middle ear effusion , as mentioned above .
another patient in the drainage group developed pseudomeningocele combined with meningitis and was treated conservatively . in the no - drainage group ,
3 patients experienced postoperative infection ; one with aseptic meningitis and two successive cases of superficial wound infection caused by serratia marcescens .
an asymptomatic small amount of supratentorial subdural hematoma was observed on the routine immediate postoperative ct scan in 3 ( 1.9% ) patients ( 2 in the drainage group and 1 in the no - drainage group ) .
two ( 1.3% ) patients in the no - drainage group developed ecchymosis in the neck near the surgical wound ; however , they did not exhibit related symptoms or require further management .
interestingly , 4 ( 2.5% ) patients experienced an immediate postoperative seizure without any evidence of intracranial hemorrhage .
the role of closed - suction drainage following surgery has been thoroughly investigated for various procedures to prevent postoperative hematoma and infection - related hematoma in the dead space6 ) .
however , the usefulness of closed - suction drainage following mvd has not been thoroughly investigated despite the quoted low incidence of intracranial hematoma following mvd and the potential harm of closed - suction drainage .
fortunately , we were able to address this issue by virtue of our modification of the mvd procedure , which improves the surgical outcome and reduces the rates of complications . based on our data
, closed - suction drainage appears to be significantly associated with csf leakage and postoperative infection following mvd . and the majority of the placed drainage systems were removed or clamped within one day or immediately after the surgery . furthermore , considering the rate of 10% ( one patient ) of cerebellar abscess and meningitis among the 10 patients who exhibited air drainage via their closed - suction drainage systems , air drainage may cause a fatal central nervous system infection , such as a cerebellar abscess .
although the pathogenesis of csf leakage following mvd is still debated , one of the most important aspects of mvd with respect to the avoidance of csf leakage is a primary watertight dural closure9,12 ) .
many dural substitutes have been developed and are used to make a watertight dural closure when a primary watertight dural closure is impossible due to shrinkage of the dural margins .
the appropriate choice of dural substitute also appears to affect the risk of csf leakage11 ) .
nonetheless , the use of dural substitutes tended to encourage csf leakage in our study , although this effect did not reach statistical significance and was dropped from the multivariate analysis .
one of the most notable aspects of this study was the definition of csf leakage .
many studies have examined csf leakage following lateral skull base surgeries for neurovascular compression , vestibular schwannoma , etc1,7,15 ) .
, middle ear effusion was regarded as csf leakage when it was identified by otological evaluations and persisted for 2 or more days following mvd .
this definition appears to be a possible reason for the relatively high incidence of csf leakage ( 12.0% ) observed in the drainage group .
however , considering that not even middle ear effusion developed in the no - drainage group , for which there was a higher incidence of opening of the mastoid aircells , closed - suction drainage appears to be one of major causes of csf leakage following mvd .
another interesting finding was that remote supratentorial epidural hematoma developed only in the drainage group .
although the pathogenesis of remote supratentorial epidural hematoma following mvd is unclear , excessive csf draining via the closed - suction drainage system may be a principal factor .
the same explanation may be applied for supratentorial subdural hematoma , although this condition did not cause any neurological symptoms in our cohort .
this study has several limitations , including a retrospective design , a relatively small sample size , and possible biases , such as the use of dural substitutes and different surgical methods .
however , the effects of these limitations on the primary conclusions of this manuscript are likely minimal .
the use of closed - suction drainage following mvd appears to be related to the development of csf leakage . | objectivewe performed this study to investigate whether the use of closed - suction drainage following microvascular decompression ( mvd ) causes cerebrospinal fluid ( csf ) leakage.methodsbetween 2004 and 2011 , a total of 157 patients with neurovascular compression were treated with mvd .
mvd was performed for hemifacial spasm in 150 ( 95.5% ) cases and for trigeminal neuralgia in 7 ( 4.5% ) cases .
the mean age of the patients was 49.89.6 years ( range , 20 - 69 ) .
dural substitutes were used in 44 ( 28.0% ) patients .
ninety - two patients ( 58.6% ) were underwent a 4 - 5 cm craniotomy using drainage ( drainage group ) , and 65 ( 41.4% ) did a small 2 - 2.5 cm retromastoid craniectomy without closed - suction drainage ( no - drainage group).resultseleven ( 7.0% ) patients experienced csf leakage following mvd based on the criteria of this study ; all of these patients were in the drainage group . in the unadjusted analyses ,
the incidence of csf leakage was significantly related with the use of closed - suction drainage following mvd ( 12.0% in the drainage group vs. 0% in the no - drainage group , respectively ; p=0.003 ; fisher 's exact test ) .
those who received dural substitutes and the elderly ( cut - off value=60 years ) exhibited a tendency to develop csf leakage ( p=0.075 and p=0.090 , respectively ; fisher 's exact test ) . in the multivariate analysis ,
only the use of closed - suction drainage was significantly and independently associated with the development of csf leakage following mvd ( odds ratio=9.900 ; 95% confidence interval , 1.418 to infinity ; p=0.017).conclusionthe use of closed - suction drainage following mvd appears to be related to the development of csf leakage . |
as narms participants , 17 state and local public health laboratories representing 40% of the us population submitted every tenth non - typhi salmonella isolate , every tenth shigella isolate , and every fifth e. coli o157 isolate received in 2000 to cdc for antimicrobial susceptibility testing .
the mic was determined for 17 antimicrobial agents at cdc by using partial range broth microdilution ( sensititre ; westlake , oh , usa ) .
isolates were chosen for further study based on the following mic criteria : cefoxitin ( > 16 g / ml ) , ceftiofur ( > 4 g / ml ) , or ceftriaxone ( > 16 g / ml ) .
-lactamase content was determined for all isolates that met the mic criteria for further study .
crude cellular protein extracts were prepared by pelleting 3-hour trypticase soy broth cultures ( grown at 37c with shaking at 300 rpm ) , resuspending in 0.2% sodium acetate at 5% of original culture volume , and freeze - thawing 4 times in a dry ice / ethanol bath and a 37c water bath .
preparations were then diluted twofold with distilled water and placed on ice for 30 min with occasional swirling .
the supernatant was collected after centrifuging for 30 min at maximum relative centrifugal force ( 14,000 rpm ) in a beckman 5417r microcentrifuge ( palo alto , ca , usa ) .
three- to 5-l aliquots of each preparation were resolved by focusing for 1.5 h on an ampholine pagplate polyacrylamide gel , ph range 3.59.5 ( apbiotech , piscataway , nj , usa ) , according to manufacturer 's instructions .
gels were stained by overlaying with a 500 g / ml solution of nitrocefin ( becton dickinson , franklin lakes , nj , usa ) .
isoelectric points were estimated by comparison with the following standard -lactamases : tem-12 ( pi 5.25 ) , shv-3 ( pi 7.0 ) and mir-1 ( pi 8.4 ) . for isolates that were ief - positive for a -lactamase with a pi > 8.4 , amplification of blacmy genes was attempted .
internal primers were used to amplify a 369-bp portion of blacmy genes from crude colony lysates .
the forward primer anneals to nucleotide ( nt ) 271289 of the 1,146-nt blacmy-2 sequence from klebsiella pneumoniae ( ncbi accession no .
the reverse primer anneals to nt 621 - 639 of blacmy-2 and has a sequence of 5-cagcggaaccgtaatccag-3 .
apbiotech ready - to - go beads ( piscataway , nj , usa ) were used to formulate 25-l reactions , which were run in an mjresearch thermocycler ( waltham , ma , usa ) under the following conditions : 1 cycle of 94c for 5 min followed by 25 cycles of : 94c for 30 s , 59c for 1 min , 72c for 1 min .
amplicons were resolved by electrophoresis in 1% agarose gels . for isolates exhibiting a -lactamase with a pi = 8.0 , blashv genes were amplified using primers 4 and 5 from rasheed et al .
( 7 ) with perkin - elmer amplitaq gold 2x master mix ( boston , ma , usa ) .
-lactamase content was determined for all isolates that met the mic criteria for further study .
crude cellular protein extracts were prepared by pelleting 3-hour trypticase soy broth cultures ( grown at 37c with shaking at 300 rpm ) , resuspending in 0.2% sodium acetate at 5% of original culture volume , and freeze - thawing 4 times in a dry ice / ethanol bath and a 37c water bath .
preparations were then diluted twofold with distilled water and placed on ice for 30 min with occasional swirling .
the supernatant was collected after centrifuging for 30 min at maximum relative centrifugal force ( 14,000 rpm ) in a beckman 5417r microcentrifuge ( palo alto , ca , usa ) .
three- to 5-l aliquots of each preparation were resolved by focusing for 1.5 h on an ampholine pagplate polyacrylamide gel , ph range 3.59.5 ( apbiotech , piscataway , nj , usa ) , according to manufacturer 's instructions .
gels were stained by overlaying with a 500 g / ml solution of nitrocefin ( becton dickinson , franklin lakes , nj , usa ) .
isoelectric points were estimated by comparison with the following standard -lactamases : tem-12 ( pi 5.25 ) , shv-3 ( pi 7.0 ) and mir-1 ( pi 8.4 ) .
for isolates that were ief - positive for a -lactamase with a pi > 8.4 , amplification of blacmy genes was attempted .
internal primers were used to amplify a 369-bp portion of blacmy genes from crude colony lysates .
the forward primer anneals to nucleotide ( nt ) 271289 of the 1,146-nt blacmy-2 sequence from klebsiella pneumoniae ( ncbi accession no .
x91840 ) and has a sequence of 5-ggcgtgttgggcggcgatg-3 . the reverse primer anneals to nt 621 - 639 of blacmy-2 and has a sequence of 5-cagcggaaccgtaatccag-3 .
apbiotech ready - to - go beads ( piscataway , nj , usa ) were used to formulate 25-l reactions , which were run in an mjresearch thermocycler ( waltham , ma , usa ) under the following conditions : 1 cycle of 94c for 5 min followed by 25 cycles of : 94c for 30 s , 59c for 1 min , 72c for 1 min .
amplicons were resolved by electrophoresis in 1% agarose gels . for isolates exhibiting a -lactamase with a pi = 8.0 ,
blashv genes were amplified using primers 4 and 5 from rasheed et al . ( 7 ) with perkin - elmer amplitaq gold 2x master mix ( boston , ma , usa ) .
in 2000 , 2,152 non - typhi salmonella , shigella , and e. coli o157 isolates were received and tested .
of these , 57 ( 2.6% ) met the mic criteria for additional testing to determine mechanisms of extended - spectrum cephalosporin resistance : 46 non - typhi salmonella isolates , 7 shigella isolates ( all s. sonnei ) , and 4 e. coli o157:h7 ( table ) .
one s. muenchen isolate with a cefoxitin mic = 16 g / ml yielded no -lactamases by ief .
this isolate exhibited very low mic of ceftriaxone and ceftiofur ( < 0.25 and < 0.5 g / ml , respectively ) .
* narms , national antimicrobial resistance monitoring system ; pcr , polymerase chain reaction ; ief , isoelectric focusing . the 7 s. sonnei isolates included in the study met only the cefoxitin mic criterion ( > 16 g / ml ) .
all 7 showed a ceftiofur mic 1.0 g / ml or less , and a ceftriaxone mic < 0.25 g / ml . six of these were also resistant to ampicillin , amoxicillin - clavulanate , and cephalothin .
each isolate was ief - positive for a -lactamase enzyme with a pi>8.4 , but was polymerase chain reaction
we suspect the resistance is related to overproduction of chromosomal ampc genes known to be present in shigella species ( 8) ; however , porin deficiency ( 9 ) and penicillin - binding protein changes ( 10 ) are worth exploration as well
. efflux mechanisms ( 11,12 ) are possible , but multidrug - resistance pumps might be less likely since none of the 7 isolates were resistant to chloramphenicol , nalidixic acid , or ciprofloxacin , and only 4 were resistant to tetracycline .
eight isolates ( 5 salmonella and 3 s. sonnei ) produced putative tem enzymes in addition to an enzyme with a pi>8.4 .
twenty - seven ( 61% ) of 44 blacmy - containing salmonella in 2000 were serotype newport .
this finding coincides with emergence of a multidrug - resistant strain of s. newport called mdrampc ( 14 ) .
mdrampc increased from 1% ( 1/77 ) of s. newport isolates tested by narms in 1998 to 22% ( 27/124 ) in 2000 ( 15 ) .
in addition , blacmy genes were found in 5 other salmonella serotypes ( typhimurium , heidelberg , agona , infantis , and reading ) in 2000 .
this contrasts with 19961998 , when blacmy was found in 3 serotypes ( newport , typhimurium , and thompson ) , which indicated that these genes or the mobile elements that house them have been disseminated .
furthermore , blacmy genes were identified in each of the 4 e. coli o157:h7 isolates that met the mic criteria in 2000 . to our knowledge
all 48 blacmy - positive isolates ( 44 salmonella and 4 e. coli o157:h7 ) exhibited a ceftiofur mic > 8 g / ml ; however , their ceftriaxone mic ranged from 2 to 32 g / ml . since the clinical and laboratory standards institute ( formerly national committee for clinical laboratory standards ) breakpoint for ceftriaxone resistance is 64 g / ml , none of these isolates were interpreted as ceftriaxone - resistant , and only 48% ( 23/48 ) were intermediate ( 16 or 32 g / ml ) .
in contrast , all 48 cmy - producing isolates showed a cefoxitin mic > 16 g / ml ( intermediate or resistant according to clsi guidelines ) .
narms sampling in 2000 showed that blacmy genes continue to be the major mechanism of extended - spectrum cephalosporin resistance among non - typhi salmonella ; other mechanisms of esc are rare .
the increasing diversity of blacmy - positive salmonella serotypes and the discovery of blacmy genes in e. coli o157:h7 highlight the mobility of these mechanisms .
this finding is not unexpected since these genes have been shown to be present on large plasmids , some of which are transferable by conjugation ( 4 ) . since s. newport mdrampc and e. coli o157:h7 have been associated with bovine reservoirs , we hypothesize that blacmy genes may be circulating among cattle .
this remains to be proven and warrants more intensive study of blacmy prevalence and movement in bovine production settings .
further research is also necessary to determine factors that contribute to dissemination of the mobile elements carrying these genes and selection of blacmy - positive strains such as s. newport mdrampc .
notably , isolates exhibiting this extended - spectrum cephalosporinase may show a ceftriaxone mic as low as 2 g / ml , but mic to ceftiofur and cefoxitin fall more reliably in the intermediate or resistant range .
for this reason , we currently performed subsequent -lactamase analysis on any isolate exhibiting a ceftriaxone or ceftiofur mic > 2 g / ml . | extended - spectrum cephalosporins ( esc ) are an important drug class for treating severe salmonella infections .
we screened the human collection from the national antimicrobial resistance monitoring system 2000 for esc resistance mechanisms .
of non - typhi salmonella tested , 3.2% ( 44/1,378 ) contained blacmy genes .
novel findings included blacmy - positive escherichia coli o157:h7 and a blashv - positive salmonella isolate .
cmy - positive isolates showed a ceftriaxone mic > 2 g / ml . |
. characterized by a combination of hyper cellular stroma and cleft - like spaces lined by epithelium , phyllodes tumor was classically known as cystosarcoma phyllodes because of the leaf - like projections .
renamed phyllodes tumor in the early 1980s , these tumors vary greatly in size and the histological characteristics continue to be the basis for diagnosis and sub classification . based on
established histological criteria pt are classified into three categories benign , borderline and malignant .
the majority of phyllodes tumors are benign and the primary concern after surgical treatment is primarily of local recurrence vs. distant recurrence ( fig .
there is an abundance of literature regarding invasive ductal carcinoma of the breast and its malignant potential however not as much research has been done on phyllodes tumors .
phyllodes tumors which fall into a malignant histological category do have a recurrence potential and a metastatic potential on the other hand not all malignant phyllodes tumors recur or metastasize . distinguishing this subset of malignant phyllodes tumors is paramount .
we present a case of malignant phyllodes tumor which presented with metastatic disease , however , what was fascinating about this case was not the as much the initial presentation but the aggressiveness of this variation of phyllodes tumor ( fig .
a 50 year - old woman g3p3 presented with a right breast mass which had been there for several years. a thorough history and physical exam revealed a mass localized to the right breast , which encompassed the entire breast .
the mass had increased in size rapidly in the past 6 weeks and it was painful with multiple open wounds .
the patient denied other lumps or mass , muscle / bone pain or headaches but complained of fatigue , night sweats and weight change .
there were multiple ulcerations and many engorged veins could be seen throughout breast mass as well .
the biopsy results were found to be a malignant neoplasm with carcinomatous and sarcomatous elements .
a metastatic workup was performed ; this included a ct chest , abdomen , pelvis and also pet scan .
the ct of chest was positive for bilateral chest masses which were concerning for metastatic disease as well as a 30 cm mass in the right breast .
the patient underwent a right simple mastectomy due to the massive size and ulcerations of the breast .
the final pathology from surgery revealed a malignant phyllodes tumor 31.5 cm length 15.6 cm height .
a minority of tumor cells in a high grade portion of round cells in the tumor are cytokeratin positive .
most of the round cell component is cytokeratin negative ; however the positive cells may represent a true differentiation to an epithelial component ( carcinosarcoma ) . in the immediate post - operative period the patient recovered well .
however , within 3 weeks of the mastectomy the patient complained of headaches and was found to have a right parietal mass .
metastatic malignant phyllodes tumor . follow up in our breast clinic one week after was unremarkable and follow up for lung masses was starting .
the patient was in clinic roughly 7 weeks from her original presentation with complaints of multiple
physical exam revealed 6 new masses were found , the largest measuring 6 cm and a mass was palpated in the right axilla . a fine needle aspiration was performed .
as stated prior , one of the challenges facing physicians for patients with phyllodes tumor is predicting which patients will develop local recurrence , metastatic disease or both . the majority of phyllodes tumors present as firm , smooth , well - circumscribed , and rarely painful masses .
depending on the size of the tumor ; wide local excision is the treatment of choice .
if margins of 1 cm can not be attained then simple mastectomy is the next best option .
most current studies show that wide local excision with adequate margins yield equivalent results to mastectomy is terms of overall surviva . in general , borderline tumors metastasize , however this is not common . in a case review by moffat
limited research and data is available regarding patients like ours ; those which present with metastatic disease and very aggressive tumors as far as treatment after primary surgical resection .
the overall metastatic rate of phyllodes tumor in general has been reported at < 5% . the histological classification adopted by the world health organization in the early 1980s allowed pathologist to classify phyllodes tumor into benign , borderline , and malignant categories .
this classification is currently the best method at trying to predict the likelihood of developing local recurrence , metastatic disease or both .
the system does have its limitations ; not all malignant tumors recur or metastasize and some borderline tumors do .
traditionally predictors of malignant behavior include tumor size , cytological atypia , mitotic rate , and stromal overgrowth .
various studies have reported the local recurrence rate at roughly 20% regardless of histological classification .
some studies report recurrence rates of malignant phyllodes in a range of 2065% . some of the factors which have shown an increase in the change of local recurrence ( lr ) are tumor size , positive surgical margins , stromal overgrowth , high mitotic count , and necrosis . from oktar et al .
, stromal overgrowth increased the probability of lr by 7-fold whereas surgical margin of < 1 cm , the risk was increased by 5-fold and if the tumor size was > 10 cm , then the prevalence of lr was 4x greater than smaller tumors . of note ,
similar reports have also shown a mean time of lr of around 2 years . in the previously sited report they had one patient which presented with a 30 cm tumor who within 2 months of a radical mastectomy developed a 2 cm chest wall recurrence , which was excised .
2 months later this patient presented with metastatic disease of the contralateral breast which was found to invade the chest wall and sternum .
geisler et al . had 3 patients which presented with metastatic disease , one patient had low - grade tumor with metastatic disease to the lung and thoracic vertebrae who died 14 months after presentation .
the first died 37 months following mastectomy with metastatic disease to the brain and the second patient was treated with partial mastectomy and died one month later with metastasis to the right sacral wing .
our patient had all the common factors for high probability of lr . with a tumor size of > 30 cm , surgical margins of < 1 mm , high mitotic rate of > 10 , focal tumor necrosis , marked pleomorphism , and stromal overgrowth .
however , we do not think we could have predicted such a rapid course . our patient and a few of the prior patients perhaps fall into a subcategory of rapidly aggressive malignant phyllodes tumors . even in that
perhaps there was a malignant transformation at the genetic level which accelerated the rate of spread of her disease in those prior weeks . in all likelihood
presenting with metastatic disease is likely a risk factor for local recurrence at the original site .
a question for our patient would have been continued treatment had she not had such aggressive disease .
also , would the patient have been a candidate for future surgery for her pulmonary metastases ?
most studies have involved those treated with wide local excision and not necessarily those treated with mastectomy .
reported that radiotherapy was associated with superior local control rate at 10 years , from 59% to 86% for both borderline and malignant phyllodes tumors .
also , in a prospective multi - institutional study of adjuvant radiotherapy ( rt ) on 46 patients with borderline or malignant phyllodes tumors treated with wide local excision followed by rt , there were no local recurrences with a median follow up of 56 months .
two patients with malignant phyllodes tumor died of metastatic disease . due to the fact that our patient was treated with simple mastectomy and had surgical margins at roughly 1 mm adjuvant radiotherapy
might have decreased her rate of local recurrence , however there are no data we found where a patient with metastatic disease was treated with rt . our patient would have had to have her metastatic disease dealt with likely before the subject of radiation therapy could have been approached .
there was an observational study over a 10 year period with patients treated with doxorubicin plus dacarbazine or observation alone after surgical resection . based on the limited data available on systemic therapy of soft tissue sarcoma , adjuvant chemotherapy could possibly be offered to patients with large ( > 5 cm ) , high - risk or recurrent malignant tumors .
this would be better understood through an evaluation of adjuvant and neo - adjuvant chemotherapy for soft tissue sarcoma which is not within the scope of this case report .
showed that doxorubicin and ifosfamide - based chemotherapies have some efficacy in women with metastatic phyllodes tumors .
the hormone receptors are component of the epithelial aspect of the tumor whereas the stromal aspect of the tumor is responsible for the metastatic behavior of the tumor .
the receptor from the stromal component expresses estrogen receptor beta , not alpha as with adenocarcinoma .
to date , there is no established role for adjuvant chemotherapy or hormonal therapy in phyllodes tumor .
had our patient presented earlier and despite limited data , she might have been a candidate for systemic therapy .
based on physical exam alone the case is extraordinary . through physical examination and biopsy data alone , in accordance with prognostic criteria , she was at an elevated risk for local recurrence and further metastatic disease .
even with this understanding , it would have been near impossible to predict such a rapid course of disease progression as she displayed due to the limitations of our knowledge of this disease .
our case illustrates the unpredictable nature of this disease in general and it likely sheds light on a variant of the phyllodes tumor which had undergone an aggressive transformation .
| highlightsphyllodes tumor of breast could be either benign or malignant variety and they can grow into very large sizes and distort the breast.who classifies tumors into benign , borderline and malignant and it is the best methods to predict the local recurrence , distant metastasis or bath after resection.borderline and malignant disease should have close follow up ; as some of these tumors can rapidly change and metastasize . |
a notice in diabetes forecast inviting participants to evaluate bgathome.com resulted in 210 individuals completing an online screening in 10 days .
participants were the first 40 individuals who , by telephone interviews , met the following inclusion criteria : type 1 diabetes , routinely measuring blood glucose levels more than twice a day , and willingness to devote 12 h / week for 810 weeks to completing bgathome .
of 108 responders telephoned , 38 were unreachable , 14 were ineligible , and 10 declined participation ( table 1 ) . after signing institutional review board approved informed consent , participants were mailed a handheld computer ( hhc ) and a lifescan one - touch meter with supplies for one month 's use . participants were instructed to 1 ) activate the hhc before performing routine self monitoring of blood glucose ( smbg ) ; 2 ) enter an estimate of their current blood glucose level ; 3 ) based on this estimate , indicate whether they should then eat fast - acting carbohydrates , engage in vigorous exercise , or drive ; and 4 ) perform smbg and record their actual blood glucose levels . after returning the hhc ,
participants completed online a demographic questionnaire , the diabetes knowledge scale , and the hypoglycemia fear survey ( 2 ) .
the hhc and questionnaire data were collected again 12 weeks later , along with likert - scale items assessing bgathome 's benefits and usability .
users were given 12 weeks to complete bgathome 's units , detailed elsewhere ( 1 ) .
central to bgat is completing daily blood glucose diaries , in which participants 1 ) record relevant blood glucose information and symptoms , 2 ) estimate their current blood glucose , 3 ) receive feedback on their estimate accuracy by performing and recording smbg , 4 ) interpret the clinical significance of their accuracy with the error grid ( 2 ) , and 5 ) anticipate their blood glucose level 1 h later . to encourage use of blood glucose diaries , participants were only given access to the next unit 7 days following completion of the previous unit .
with internet delivery to a heterogeneous sample , individuals would be expected to pursue bgat for various reasons .
thus , the primary outcome variable would need to incorporate a variety of possible desired outcomes .
consequently , our improved functioning score ( ifs ) is a composite score where assessment - dependent variables are converted to z scores .
assessment 2 performance was converted to z scores based on assessment 1 's mean and sd . z scores for each outcome variable were totaled , where zero reflects average baseline functioning for all variables and + 1 reflects performance across all variables one sd above the sample 's baseline mean ( 3 ) .
it incorporated the following variables from questionnaires : diabetes knowledge scale ( percent correct ) and hypoglycemic fear survey ( sum of worry subscale ) .
it also incorporated the following variables from the hhc : percent smbg readings within target range ( 3.9 10.0
mmol / l ) , number of undetected blood glucose readings < 3.9 mmol / l , overall blood glucose estimation accuracy ( accuracy index ) ( 4 ) , when blood glucose levels are < 3.9 mmol / l , number of risky decisions to drive , not eat fast - acting carbohydrates , and exercise .
two wait - list control group participants and one bgathome participant dropped out during the treatment period . two bgathome participants dropped out during assessment 1 .
anova demonstrated that bgathome resulted in greater improvement in ifs : interaction f(1,33 ) = 4.20 ; p = 0.048 ( table 1 ) . on a scale of 15
in which 1 = not at all and 5 = very , treatment participants rated bgathome as beneficial , easy to use , and enjoyable ( 3.8 1.17 , 3.9 0.73 , and 3.8 1.04 , respectively ) . on average , participants completed bgathome in 11 weeks , logged onto bgathome.com 30.4 16.51 times , and spent 26.4 16.3 min on each unit .
these measures of use indicate trends toward a relationship between more website use and increased benefits . more time spent on units
was associated with greater ifs improvement ( r = 0.36 , p = 0.10 ) .
more frequent log - ons were associated with greater improvement in knowledge ( r = 0.49 , p = 0.03 ) and lower blood glucose levels < 50 mg / dl ( r = 0.54 , p = 0.02 ) .
age was not correlated with ifs improvement ; however , education tended to be associated with improved ifs ( r = 0.45 , p = 0.07 ) .
this is the first time bgat was made available to individuals with various goals , needs , diabetes regimens , and resources . despite this heterogeneity , bgathome improved performance , summed across all eight dependent variables an average of 2.37 sds .
engagement might be further enhanced by 1 ) incorporating a chat room where users share experiences and support ; 2 ) employing a group context , led by a diabetes educator ( 5 ) ; 3 ) undergoing an initial motivational interview ( 6 ) ; 4 ) fiscally investing in training ; and 5 ) having a pressing personal goal , such as achieving tight metabolic control because of pregnancy without increasing risk of severe hypoglycemia ( 7 ) or following a costly hypoglycemia - related driving mishap . while our final participant sample came from 35 different u.s .
cities and 21 different states , allowing greater external validity , the sample size and its demographic composition ( white , middle - aged , educated individuals ) was a limitation of this study .
a larger , more representative sample would also allow investigation into the role of socioeconomic status , race , and education
. nevertheless , this study indicates the possible benefits of disseminating bgathome over the internet in a personalized and self - directed format , serving a large number of individuals in a cost - effective manner . | objective blood glucose awareness training ( bgat ) , a psycho - educational intervention , trains individuals with type 1 diabetes to 1 ) detect / interpret internal cues to better detect extreme blood glucose levels , e.g. , neurogenic and neuroglycopenic symptoms ; and 2 ) interpret external cues to detect current and anticipate future extreme blood glucose levels , e.g. , insulin timing / dose and recent self - monitoring of blood glucose results .
although outcome studies using bgat are significant , limitations include the requirement of eight weekly meetings and limited professionals trained to deliver bgat.research design and methods due to the limitations mentioned above , bgat was converted for web - based delivery .
the internet allows bgat delivery to be dynamic , engaging , convenient , and personalized .
efficacy was evaluated using a 2 ( bgathome , n = 20 , vs. control , n = 20 ) 2 ( pre / post ) design.resultsbgathome was judged as useful and easy to use , was completed by 94% of the participants , and resulted in significant clinical improvements ( p < 0.05).conclusions the internet may be an efficient and effective means of delivering diabetes interventions like bgat . |
clinically , the side effects of lasers on the skin include blistering , fine epidermal crusting and erosion , resulting from epidermal injury in the early stage after laser radiation . in the late stage , hyperpigmentation , hypopigmentation , scar or keloid formation
this report describes peculiar clinical and histopathological findings of eczematous dermatitis occurring on a caf - au - lait spot long after laser radiation .
on august 7 , 2006 , a 40-year - old woman with an itchy erythematosquamous lesion in her left lateral orbital region presented to my clinic . the lesion was a congenital , coin - sized , pigmented macule that had never been treated before . at the age of about 20 ,
although the pigmentation of the lesion disappeared after laser radiation , it recurred slightly after some time .
the patient moved from tokyo to niimi city , okayama prefecture , in july 2006 . immediately after her relocation , an erythematosquamous change on her pigmented lesion occurred .
there was erythema with a slight scale on roundish , sharply defined , light brown macule sized approximately 3 3 cm in the left lateral orbital region .
, there were relatively thick , confluent parakeratosis , moderate acanthosis , irregularly elongated rete ridges of uneven width , mild focal spongiosis and focal liquefaction degeneration of basal cells .
there was moderate lymphohistiocytic infiltration from the dermal - epidermal junction to the papillary dermis . in the subpapillary and superficial reticular dermis ,
the histopathological findings of these inflammatory skin reactions were applicable to spon - giotic dermatitis and interface dermatitis together with lymphohistiocytic cell infiltration ( fig .
in the sebaceous glands , one of the sebaceous lobules had sharply defined , circumscribed parts , which were occupied exclusively by small - sized sebocytes ( fig .
their size was reduced to almost half or one - third of the size of normal sebocytes .
some of their nuclei were compressed peripherally in the cell body and pyknosis , and the cytoplasm was scanty . in a word , these small - sized sebocytes were degenerative atrophic ones .
in some of the hair follicles , the lowermost portions had inflammatory cell infiltration of lymphocytes and histocytes , in which a small number of eosinophilic degenerative follicular keratinocytes were present .
there was erythema with a slight scale on roundish , sharply defined , light brown macule sized approximately 3 3 cm in the left lateral orbital region .
, there were relatively thick , confluent parakeratosis , moderate acanthosis , irregularly elongated rete ridges of uneven width , mild focal spongiosis and focal liquefaction degeneration of basal cells .
there was moderate lymphohistiocytic infiltration from the dermal - epidermal junction to the papillary dermis . in the subpapillary and superficial reticular dermis ,
the histopathological findings of these inflammatory skin reactions were applicable to spon - giotic dermatitis and interface dermatitis together with lymphohistiocytic cell infiltration ( fig .
one of the sebaceous lobules had sharply defined , circumscribed parts , which were occupied exclusively by small - sized sebocytes ( fig .
their size was reduced to almost half or one - third of the size of normal sebocytes .
some of their nuclei were compressed peripherally in the cell body and pyknosis , and the cytoplasm was scanty . in a word , these small - sized sebocytes were degenerative atrophic ones .
in some of the hair follicles , the lowermost portions had inflammatory cell infiltration of lymphocytes and histocytes , in which a small number of eosinophilic degenerative follicular keratinocytes were present .
caf - au - lait spots are one form of pigmented skin disease , which is treated with laser . from the mid-1980s to the early 1990s ,
the period during which our case received laser therapy , ruby laser was available in japan for the treatment of pigmented skin lesions such as caf - au - lait spots , nevus cell nevus , nevus of ota , etc . .
the present case showed that eczematous dermatitis occurred restrictedly on a caf - au - lait spot of the facial skin that was irradiated with laser .
this fact may suggest that laser radiation participates in the occurrence of such an eczematous tissue reaction because , to my knowledge , there are no descriptions of eczematous dermatitis developing spontaneously and exclusively on a caf - au - lait spot .
spongiotic dermatitis and interface dermatitis include a variety of skin diseases , each of which is quite different etiologically and pathogenetically [ 2 , 3 ] . in the present case ,
the onset of eczematous dermatitis was just after the patient had travelled the long distance from tokyo to her new residence in niimi ; it may thus be presumed that she must have endured a strong physiological and psychological stress .
in fact , cutaneous neurogenic inflammation can be induced by endogenous trigger factors such as stress , neurotransmitters , etc .
. however , there are no descriptions showing that neurogenic inflammation is liable to occur in certain portions irradiated by laser . nonetheless , taking the clinical observations of this case into account it is possible that there was an unknown pathogenesis between the occurrence of neurogenic inflammation and laser radiation .
while there is a paper that describes the development of a chemotherapy - induced recall reaction ( recall dermatitis ) in a laser - induced wound , the recall phenomenon in the laser - irradiated caf - au - lait spot in the face of the present patient may have been induced by psychosomatic factors . in the case
presented here , another interesting histopathological feature was the appearance of atrophic parts in a lobule .
in contrast to normally differentiated sebocytes , which have a centrally situated , crenated nucleus and a delicate network of fine cytoplasmic vacuoles , these atrophic sebocytes showed a peripherally located pyknotic nucleus and scanty cytoplasm . to my knowledge
possibly , these histopathological features did not merely indicate massive degenerative atrophy of the sebocytes but rather showed laser - induced alteration in the process of morphogenesis of the sebocytes , because the atrophic sebocytes were present only in the circumscribed areas of the same lobule and not in the normal parts of the lobule .
all sebocytes derive from basement membrane - bound germinative cells in the sebaceous lobules , from which arises the inner zone of the lipid - laden vacuolated cells [ 6 , 7 ] .
these germinative cells are analogous to basal cells of the epidermis , matrix cells of a follicular bulb and cells of a nail matrix .
, the biological action of lasers is attributable to photothermal , photochemical and photoacoustic effects , of which the photothermal effect plays a crucial role .
it has also been considered that visible light of a long wavelength has no influence on dna , because visible light is hardly absorbed by nucleic acid . however , according to recent descriptions , it has been shown that visible light can induce indirect dna damage through the generation of reactive oxygen species .
this suggests that only the dna of certain germinative cells in the lobule is damaged by laser radiation , resulting in the aggregation of atrophic sebocytes in the same lobule . in any event
, there may be the possibility that the appearance of the circumscribed areas of massive degenerative atrophic sebocytes in the same lobule express alteration in the morphogenetic process of the sebocytes , which is caused by laser radiation . | a 40-year - old woman presented with an itchy erythematosquamous change of a caf - au - lait spot in her face .
the onset of this change occurred just after her relocation .
the caf - au - lait spot had been irradiated by laser approximately 20 years ago .
clinically , there was a coin - sized erythema with a slight scale on the pigmented lesion in the left lateral orbital region .
histopathologically , the lesion demonstrated both spongiotic dermatitis and interface dermatitis together with lymphohistiocytic cell infiltration , in addition to moderate acanthosis and elongation of rete ridges with slight basal hyperpigmentation . from these clinical and histopathological findings
, the lesion was diagnosed as eczematous dermatitis occurring on the caf - au - lait spot after laser radiation .
another interesting histopathological finding was that some parts of a lobule of the sebaceous gland were occupied exclusively by degenerative atrophic sebocytes . from the viewpoint of pathogenesis
, the eczematous dermatitis of this patient could have been an accompanying feature of a neurogenic inflammation occurring on the caf - au - lait spot after laser radiation , and the atrophic change of a part of the sebaceous lobule might have been induced by a morphogenetic alteration of certain germinative cells of the sebaceous lobule due to laser radiation . |
benign prostatic hyperplasia ( bph ) is one of the most common chronic diseases in aging men .
the most potent androgen in men , 5-dihydrotestosterone ( dht ) , is widely accepted to be more essential than testosterone for prostatic epithelial cell proliferation and function .
it is believed to be largely converted from testosterone in prostate by the action of 5-reductase enzyme .
so the mainstay of therapies is the 5-reductase inhibitors , which regulate the levels of intraprostatic dht .
finasteride , a competitive inhibitor of 5-reductase - type ii with relatively low affinity for type i , has been one of the most commonly prescribed drugs for the management of bph .
5-reductase inhibitors ( finasteride ) exert a strong apoptotic effect on the dht - dependent epithelium , but in some bph patients finasteride fails to control symptoms . to date , chronic inflammation has been recognized as another key player in the bph pathogenesis and progression .
meanwhile , many studies have showed that the majority of lymphocytes in bph tissue were t - lymphocytes [ 7 , 8 ] ; infiltration of chronically t lymphocytes and secretion of inflammatory cytokines with the prostatic gland are considered a determinant factor in bph pathogenesis and progression .
unfortunately , most of the recent studies focused on the proinflammatory cytokines secreted by t - lymphocytes and bph cells .
the causes for t - cell infiltration and immune dysregulation in the prostate remain subjects of debate .
bph epithelial cells , an important component of prostatic microenvironment , are suggested as a key role of the induction of immune - mediated inflammatory processes . on the other hand ,
( 2012 ) reported that intraprostatic testosterone plays a protective role in metabolic syndrome - associated prostate inflammation in rabbit model . from a pathophysiological standpoint
, some studies showed correlation between dht level and inflammation , but the detail of t cell subsets infiltration influenced by bph epithelial cells and intraprostatic dht still remained largely unresolved . in the present work , we focused on the relationship between intraprostatic dht level , bph epithelial cells , and t - cell infiltration .
the patients were selected by considering medication duration from the medical records of 726 patients who underwent transurethral resection of the prostate ( turp ) between january 2008 and december 2011 in peking university first hospital . according to the medication history
patients were divided into two groups : group 1 consisted of 28 patients who had been medicated neither with -adrenergic blocker nor with 5-reductase inhibitor ; group 2 consisted of 36 patients treated with finasteride 5 mg daily for longer than six months before surgery .
all included samples were pathologically confirmed as benign prostatic hyperplasia without prostate cancer or prostatic intraepithelial neoplasia ( pin ) . and the patients who had urinary tract infection or previous prostate - related surgery or were treated with urinary catheter were excluded from the study .
monoclonal anti - ccl5 antibodies and the recombinant protein igg were purchased from r&d systems ( mab678 , mab002 , minneapolis , mn , usa ) , and 500 g / ml stock was reconstituted in phosphate buffered saline ( pbs ) . for anti - ccl5 treatment , stocks were adjusted to a final concentration of 6 g / ml .
ficoll - paque was purchased from amersham pharmacia biotech ( 17144002 , piscataway , nj , usa ) .
collagenase d was purchased from roche diagnostic ( 100 mg , 11088858001 indianapolis , in , usa ) and was adjusted to a final concentration of 1 mg / ml to use .
antibodies used for flow cytometry included pe - cy 7-conjugated mouse anti - human cd3 antibody ( 341091 ) , fluorescein isothiocyanate ( fitc)-conjugated mouse anti - human cd4 antibody ( 340133 ) , phycoerythrin ( pe)-conjugated mouse anti - human cd8 antibody ( 340046 ) , pe - cy 7-conjugated mouse igg1 , isotype ( 555872 ) , fitc - conjugated mouse igg1 isotype ( 555909 ) , or pe - conjugated mouse igg1 isotype ( 554680 ) .
antibodies used for immunohistochemistry included rabbit anti - cd4(+ ) ( dilution 1 : 50 , ab133616 , abcam , cambridge , uk ) , anti - cd8(+ ) ( dilution 1 : 50 , rm-9116-s1 , thermo fisher scientific , cheshire , uk ) , and the rabbit anti - ccl5 ( + ) ( 2 g / ml , ab9679 , abcam , cambridge , uk ) .
blood samples were collected in sterile heparinized containers from 6 health persons at 10 ml per tube .
peripheral blood mononuclear cells ( pbmc ) were isolated by ficoll density gradient and blood was centrifuged for 20 min at 2000 g .
the cells were washed twice in phosphate buffered saline ( pbs , ph 7.2 ) without calcium and magnesium and resuspended in x - vivo 15 medium ( 04 - 418q , lonza , nj , usa ) for further analysis .
one part of fresh prostate tissue which was got from surgery was placed in a solution of 1 mg / ml collagenase d ( roche ) in rpmi 1640 media containing 10% fbs with dnase i ( 20 g / ml ; sigma - aldrich , st .
tissue was minced at about 1 mm and placed at 37c for 1 hr for digestion , followed by passing through a 70 m filter .
then the tissue lysates were filtered through 0.22 m filter and 6 cases of these tissue lysates from each 2 groups were chosen randomly for the further migration assay .
the bph epithelial cell - line , bph-1 , was purchased from keygen biotech co. , ltd ( kg1008 , nj , china ) and the predominantly cd8(+ ) t - lymphocytic cell - line , molt-3 , was purchased from the american type culture collection ( crl-1552 , rockville , md , usa ) and grown in rpmi-1640 media containing 1% penicillin and streptomycin , supplemented with 10% fetal bovine serum ( fbs ) .
all cell lines were cultured in a 5% ( v / v ) co2 humidified incubator at 37c .
bph-1 cells of charcoal medium group were treated with 10% charcoal treated fetal calf serum ( sh30068.03 , hyclone , south logan ut , usa ) for 2 days , then collected supernatant and bph-1 cells were harvested for the further experiment .
peripheral blood mononuclear cells ( pbmc ) that were isolated from human blood were grown in x - vivo 15 medium ( 04 - 418q , lonza , nj , usa ) and all the further experiment would be finished in 2 days . to determine the expression of cd4 and cd8 on the cell surface and intracellular ccl5 in bph tissues ,
the specimens from tur - p surgery were fixed in 4% buffered formalin overnight at 4c and then dehydrated in an ascending ethanol series , routinely embedded in paraffin , and sectioned at 3 m .
after conventional deparaffinization , hydration , and antigen retrieve , endogenous peroxidase was inactivated by 3% hydrogen peroxide .
the primary antibodies of the rabbit anti - cd4(+ ) ( dilution 1 : 50 , abcam ) , anti - cd8(+ ) ( dilution 1 : 50 , thermo ) , and the rabbit anti - ccl5 ( + ) ( 2 g / ml , abcam ) were used for incubation at 4c overnight .
after washings with phosphate - buffered saline ( pbs ) , the primary antibody was recognized by the biotinylated secondary antibody ( pk-4001 , vector labs , burlingame , ca , usa ) at room temperature for 30 min and visualized by vectastain abc peroxidase system and peroxidase substrate dab kit ( sk-4100 , vector labs ) .
the max density of cd4 positive or cd8 positive cell was defined as ratio between the maximum positive cell number and all of nuclear cell number under 100x field . and these indexes were average value by two operators who are blind to each other and were calculated with image - pro plus 6.0 software ( media cybernetics , rockville , md , usa ) .
proteins expression of ccl5 was assessed semiquantitatively and a 4-tiered system ( 0 negative , 1 weak , 2 moderate , and 3 strong ) was used .
two pathologists evaluated the stain strength and the final result was the average of their scores . to further study the t - cell subpopulation infiltration among the total t cell ,
the isolated lymphocytes from prostate tissues were analyzed by two - color flow cytometry for phenotypic characterization of t cells according to manufacturer 's procedure .
cells were resuspended in staining buffer ( pbs containing 1% fetal bovine serum ) and stained for 30 min at 4c with anti - cd3 pe - cy 7 and anti - cd4 fitc or anti - cd8 pe and their isotype control antibodies
flow cytometry was done on a becton dickinson lsrii ( bd biosciences ) ; 1 10 cells were acquired and data were analyzed using flow jo software ( bd biosciences ) .
then the average percentage of cd4 positive or c8 positive among total t cell in each group was calculated . at the same time the cd8 + t cells from blood of healthy persons were also harvested by the same method .
total rna was extracted from each cell line using trizol ( 15596 - 018 , invitrogen , grand island , ny , usa ) . according to manufacturer 's protocol , cdna was synthesized from 1 g rna , using a high capacity cdna reverse transcription kit ( 4368813 , applied biosystem , ca , usa ) .
the standard pcr conditions included 2 minutes at 50c and 10 min at 95c followed by 40 cycles of extension at 95c for 15 seconds and one minute at 60c .
threshold lines were automatically adjusted to intersect amplification lines in the linear portion of the amplification curves and cycle to threshold ( ct ) were recorded automatically .
data were normalized with gapdh mrna transcription ( housekeeping gene ) and the fold change in gene expression relative to normal was calculated using the ddct method .
the sequences of the gene primers are designed by primer premier 5 software ( premier biosoft international , palo alto , ca , usa ) and are shown in table 1 . to detect the recruitment of cd8 + t cell by tissue lysates and bph-1 cells , the tissue lysates or 1 10 of bph-1 cells of different treatment were plated into the lower chamber of the transwells with 5 m pore polycarbonate membrane inserts ( 3421 corning , ma , usa ) .
t cells isolated by flow cytometry from 6 healthy persons and molt-3 cells were plated onto the upper chamber .
after 6 hrs , the cells migrated into the lower chamber media were collected and counted by the bio - rad tc10 automatic cell counter .
statistical analyses for continuous variables involved paired t - test with spss 17.0 ( spss inc . ,
data were also analyzed through one - way anova coupled with the newman - keuls test and mann - whitney test .
firstly , the immunohistochemical analysis using anti - cd4 and cd8 antibody showed that cd8 + t cells were identified surrounding the epithelium area , but cd4 + t cells in stromal area ( figures 1(a ) and 1(b ) ) .
furthermore , as shown in figure 1(a ) , the max densities of cd8 + t cells infiltrated in the finasteride group and in the no medication group were 0.23 0.06 , 0.14 0.04 , and they were significantly higher in the finasteride group than in the no medication group ( p = 0.013 ) . however , cd4 + t cells infiltration showed no difference ( figure 1(b ) ) .
the tissues of group 2 presented a significantly higher percentage of cd8 positive cells among all total t - lymphocytes than tissues of group 1 ( 21.36% versus 8.78% , figure 1(c ) ) . to study the potential cross talk between infiltrating cd8 + t cell and prostate epithelial cells as seen in bph specimens ( figure 1 ) , we established a coculture model for cd8 + t cell migration assay .
as shown in figures 2(a ) and 2(b ) , more than 60% of cd8 + t from blood of health persons migrated to the prostate tissue lysates from the finasteride group .
this data was then confirmed in bph epithelial cell - line . as shown in figure 2(c ) , bph-1 cells which were pretreated with charcoal medium had more capability to recruit molt-3 cells ( p = 0.026 ) .
the q - pcr was used to assay for the most reported chemokines that are related to attracting t cells [ 20 , 21 ] from bph-1 cells with normal versus charcoal medium .
the transcription of ccl5 mrna in bph-1 cells was higher in lower dht condition ( 1.18 0.02 ) than those in normal condition ( 0.37 0.05 ) ( figure 3(a ) ) .
in addition , mrna level of ccr5 was also upregulated nearly 3-fold in molt-3 cells after coculture with bph-1 cells in charcoal medium as shown in figure 3(b ) .
next , interruption assay was detected by using ccl5 neutralizing antibody in the migration system .
it was shown that blocking ccl5 led to significantly suppressing the molt-3 cells migration toward bph-1 cells in low dht condition figure 3(c ) .
the ccl5 expression was investigated in above bph patients by ihc staining as shown in figure 4 .
meanwhile , immunoreactive score was higher in the finasteride treatment group ( 2.79 0.26 ) , compared to the no medication group ( 1.41 0.28 ) .
at present , so many studies have shown the role of chronic inflammation in bph development .
cytokines , growth factors like il6 , il8 , ifn - r produced by t - lymphocytes , and bph cells are involved in altering tissue remodeling and hyperplastic growth at each stage of bph .
potential causes include infectious agents , exposure to other environmental and dietary factors , and hormonal and metabolic derangements . in this study
it is reported that prostatic immune inflammatory cells consist of 70% t lymphocytes , 15% b - lymphocytes , and 15% macrophages , as well as mast cells ( and our unshown data ) .
hence , in the present study , we focused on the t - cell subpopulation . to the best of our knowledge , 6 months
the ihc and flow cytometry results showed that finasteride treatment could lead to more infiltration of cd8 + t cells but not cd4 + t cells .
the ihc results in this study showed cd8 + t cells localized surrounding epithelial area in bph tissue .
bph epithelial cells have been previously described to act as a key cell , indicating their potential role in inducing and sustaining an autoimmune response within the prostatic gland . to better investigate whether androgens could directly suppress t - cell infiltration , we performed migration assay by using bph-1 cells and molt-3 cells in vitro studies with/ without low androgen condition .
results in this study demonstrated that intraprostatic dht has strong immune suppressive effects on cd8 + t cell infiltration induced by bph epithelial cells .
highlighted that dht exerts an immune regulatory role on human prostatic stromal cells , inhibiting their potential to actively induce and/or sustain autoimmune and inflammatory responses .
park and shim found that finasteride might interfere with the anti - inflammatory reaction induced by doxazosin in combination of doxazosin and finasteride treatment .
here we detected more patients and identified the t cell subsets which infiltrated in the prostatic tissue after finasteride treatment .
importantly , we also tried to find the key chemokine . to further dissect how bph-1 recruited more molt-3 cells , we applied q - pcr to examine the expression of t cell related chemokines in bph-1 cells at low dht level .
we found that ccl5 which functions as a chemokine playing a critical role in the recruitment of t cells was expressed significantly higher in bph-1 cells with androgen deprivation .
we also found that ccr5 which is the natural ccl5 coreceptor was upregulated in molt-3 cells after coculture with bph-1 cell in low androgen condition .
importantly , the ccl5 was localized surrounding the epithelial area . in normal and bph prostate tissue , infiltrating cd8 + t cells are mainly localized around epithelial ducts [ 31 , 32 ] . herein , the ccl5 expression was consistent with the distribution of cd8 + t cells .
it suggested that ccl5 may be the key chemokine which secreted by bph epithelial cells to recruit cd8 + t cells after anti - dht therapy . in conclusion ,
the most striking finding of the present study is that dht exerts an immune regulatory role on human prostate epithelial cell , inhibiting their potential to actively induce inflammatory responses , and ccl5 which secreted by prostate epithelial cell is the key chemokine in this progression ( figure 5 ) .
anti - inflammation furthermore via targeting ccl5 combined with anti - dht therapy in patients with bph may be warranted in the future . | clinical studies suggested thatandrogen might be associated with infiltrating t cells in prostate of benign prostatic hyperplasia ( bph ) patients , but detail of t - cell subset and mechanism still remained unclear .
the present study tested the hypothesis that intraprostatic 5-dihydrotestosterone ( dht ) exerts effects on t cells recruitment by bph epithelial cells .
prostate tissues from 64 cases of bph patients after transurethral resection of prostate ( turp ) were divided into 2 groups : ( 1 ) no medication history ; ( 2 ) administration of 5-reductase type ii inhibitor - finasteride 5 mg daily for at least 6 months before surgery .
group 2 presented significantly higher cd8 + t cells infiltration than group 1 , but no changes in cd4 + t cells ( immunohistochemistry and flow cytometry ) . in vitro study
more cd8 + t cell migrated to the prostate tissue lysates from group 2 and bph-1 cells in low dht condition .
transcription of chemokine ( c - c motif ) ligand 5 ( ccl5 ) mrna in bph-1 cells and chemokine ( c - c motif ) receptor 5 ( ccr5 ) mrna in cd8 + t cells were upregulated in low dht condition ( q - pcr ) .
ccl5 expression was also identified to be higher in group 2 prostate tissues by ihc .
this study suggested that intraprostatic dht may participate in regulating inflammatory response which was induced by human prostatic epithelial cell , via modulating ccl5 secretion . |
pseudomonas oryzihabitans , previously known as flavimonas oryzihabitans has been placed in cdc ( cdc : centers for disease control ) group ve-2 .
p. oryzihabitans has been recovered from various clinical samples , including wound swab , sputum , ear swab , conjunctival scrapings , urine , peritoneal fluid , and blood .
we report a case of urinary tract infection ( uti ) caused by p. oryzihabitans in a patient with anterior stricture of urethra .
chrysomonasluteola belongs to cdc group ve-1 recently , two cases of infection from indian patients by chrysomonas have been reported , from mumbai and hyderabad .
there is no documented report of p. oryzihabitans infection in any indian patient . in may 2011 ,
a 45-year - old male patient was admitted in the surgery ward with complaints of difficulty in passing urine since two months . there was no history of burning micturition and hematuria and no history of chronic illness suggestive of immunocompromised status .
hemoglobin was 13.8g / dl and erythrocyte sedimentation rate ( esr ) was19 mm / h .
urine sample was received for culture and sensitivity , and processed by routine semiquantitative method .
on blood agar and muller hinton agar rough wrinkled yellow pigmented colonies were grown [ figure 1 ] and on macconkey agar , nonlactose - fermenting colonies were grown .
the isolate was further identified as p. oryzihabitans ( % id98.3 ) by the api i d 32 gn automated identification system ( biomrieux , marcy i toile , france ) .
identification was based on the following tests : negative nitrate reduction , esculin hydrolysis , lysine decarboxylase , arginine dehydrolase , and orthonitrophenyl--d - galactopyranoside activity ( onpg ) , positive oxidation fermentation glucose , maltose , mannitol , and xylose activity .
antibiotic sensitivity was done by disc diffusion method using clinical and laboratory standards institute ( clsi ) guidelines .
the isolate was sensitive to piperacillin , cephalosporins , imipenem , meropenem , cotrimoxazole , aminoglycosides , and fluoroquinolones , and resistant to nitrofurantoin .
the patient was treated with oral norfloxacin 400 mg twice daily for ten days , and advised to come for follow - up after 15 days .
initial retrourethrogram showed narrowing in anterior urethra , but as the patient responded to antibiotic treatment and dysuria was relieved , repeat retrourethrogram was not done .
in hospitals , p. oryzihabitans has been isolated from sink drains and respiratory therapy equipment . in nature , this organism has been isolated from rice paddy .
four cases of community - acquired pneumonia infection by p. oryzihabitans were reported , three in hiv - positive patients and one in a patient with chronic myeloid leukemia .
most of the reports of p. oryzihabitans infection were of nosocomial origin in individuals with one of the predisposing factors like low - birth - weight neonate , premature neonate , biliary tract infection , peritonitis , subdural empyema , or pneumonia , and were associated with the presence of indwelling catheters .
there are very few reports of community - acquired infection by p. oryzihabitans , like the infection of a hickman catheter traced to a synthetic bath sponge , pneumonia , or a soft tissue infection .
p. oryzihabitans isolated from the blood sample of catheter associated infection in the aids patient was sensitive to broad - spectrum cephalosporins , aztreonam , imipenem , aminoglycosides , ciprofloxacin , and trimethoprim - sulfamethoxazole , and resistant to ampicillin , amoxycillin - clavulinic acid and cefazolin .
in contrast to the previously reported cases , where pseudomonas ( flavimonas ) showed resistance to cefazolin , cefuroxime , and trimethoprim , our isolate was found to be sensitive to these antibiotics this suggests that the strain could well have been a community isolate .
although p. oryzihabitans has been isolated occasionally from the environment , the source of human infection has been well documented only in a few cases ; in two reports , the source of infection was traced to a bath sponge . a pubmed search for p. oryzihabitans infection in indian patients did not yield any result .
this may be the first case report of p. oryzihabitans uti infection in an indian patient .
although a saprophyte , p. oryzihabitans could well emerge as a potential pathogen . therefore , clinical microbiologists should not ignore them as laboratory contaminants , because reports of infections are on the rise both in immune - compromised and in immune - competent individuals .
clinicians and laboratory personnel also have to be made aware of the pathogenic role of p. oryzihabitans which may become increasingly prevalent in the near future . | pseudomonas oryzihabitans and chrysomonas luteola has been placed in cdc group ve2 and ve1 respectively .
these bacteria appear to be emerging pathogens .
p. oryzihabitans was isolated from cases of bacteremia , cns infections , wound infections , peritonitis , sinusitis , catheter associated infections in aids patient , and pneumonia .
most of the reports of p. oryzihabitans infection were of nosocomial origin in individuals with some predisposing factors .
we report here a case of community acquired uti by p. oryzihabitans in an immune - competent patient with stricture of urethra . |
with penetrating trauma reaching epidemic proportions in the caribbean , emergency room ( er ) thoracotomies are performed regularly .
it may be life - saving by achieving four goals : ( i ) releasing cardiac tamponade , ( ii ) controlling haemorrhage , ( iii ) allowing access for internal cardiac massage and ( iv ) clamping the descending aorta to isolate circulation to the upper torso in damage control surgery [ 3 , 4 ] .
we theorize that a new goal should be achieving rapid , large - volume fluid resuscitation and we describe a technique to achieve this .
an important step during er thoracotomy is to detect cardiac tamponade by opening the pericardium with a vertical incision that avoids the phrenic nerve .
the heart is now exposed , providing the perfect opportunity for catheterization . in this technique , we place a large , curved satinsky clamp across the base of the right atrial appendage .
a 20fr foley 's catheter is then inserted into the incision , ensuring that the balloon is fully within the atrial appendage .
a heavy suture with a round - bodied needle is used to place a purse string around the incision .
the suture is tied firmly to achieve a water right seal around the catheter . before releasing the satinsky clamp ,
a pressure infuser is applied to a bag of warmed isotonic crystalloids or it can be squeezed by an assistant providing positive pressure .
the clamp is then removed and the balloon inflated to assist in the formation of a seal .
the wound is closed easily by tightening the purse - string suture after withdrawing the catheter ( figure 1 ) .
the pericardium has been opened to reveal the right ventricle ( rv ) and atrium .
a foley 's catheter has been introduced into the right atrial appendage ( black arrow ) and fixated with a purse - string suture .
the pericardium has been opened to reveal the right ventricle ( rv ) and atrium .
a foley 's catheter has been introduced into the right atrial appendage ( black arrow ) and fixated with a purse - string suture .
intravenous access is difficult to establish in these volume - depleted patients since there is peripheral vasoconstriction .
this technique allows rapid intravenous access because intra - cardiac catheterization can be achieved in 12 minutes with the heart already exposed at er thoracotomy .
furthermore , the volume of fluid that can be infused exceeds that which can be delivered by peripheral large bore cannulae . the procedure is easy to perform and requires little specialized equipment . even in the resource poor
application of the satinsky clamp sequesters blood within the right atrial appendage but it does not interfere with venous return or right atrial outflow tracts . therefore , there is no interruption of cardiac output while this is performed .
it allows large - volume fluid infusion to proceed , while the surgeon searches for sources of continued haemorrhage .
four life - saving goals can be achieved at er thoracotomy : ( i ) tamponade release , ( ii ) haemorrhage control , ( iii ) internal cardiac massage and ( iv ) clamping of the descending aorta .
| an emergency thoracotomy may be life - saving by achieving four goals : ( i ) releasing cardiac tamponade , ( ii ) controlling haemorrhage , ( iii ) allowing access for internal cardiac massage and ( iv ) clamping the descending aorta to isolate circulation to the upper torso in damage control surgery .
we theorize that a new goal should be achieving rapid , large - volume fluid resuscitation and we describe a technique to achieve this . |
the sample comprised of depressive patients diagnosed on the basis of international classification of disease-10 diagnostic criteria for research criteria and with minimum 2 years duration of illness .
patients were selected by purposive sampling technique from department of psychiatry bokaro general hospital bokaro steel city , psychiatric unit and private clinics of bokaro .
only right - handed patients having basic reading and writing ability to understand the instructions given were included in the study .
patients having co - morbid psychiatric disorder , substance abuse , visual and hearing impairment , organic pathology , and significant physical illness were not included in the study .
the study was hospital based pre - and post - intervention with follow - up assessment design .
sociodemographic and clinical data sheetannet 's hand preference scalebeck depression inventory ( bdi)digit span test of wechsler adult intelligence scale revised ( wais - r)wechsler memory scale ( wms ) .
sociodemographic and clinical data sheet annet 's hand preference scale beck depression inventory ( bdi ) digit span test of wechsler adult intelligence scale revised ( wais - r ) wechsler memory scale ( wms ) . after screening according to inclusion and exclusion criteria ,
annett 's hand preference battery was used to screen handedness and only right - handed patient were selected .
the attention and concentration digit span test from wais - r ( digit span test ) was administered .
after preassessment , cognitive rehabilitation was given to the depressive patients [ appendix 1 ] .
initially , 15 sessions of cognitive rehabilitation package was given ( which includes postassessment ) .
thereafter , postassessment was done to assess the outcome of rehabilitation after 3 months follow - up [ figure 1 ] .
scores of patients on digit span test and wms before and after intervention were compared with the student 's t - test .
plan of study [ * digit span test ( wechsler adult intelligence test ) , wechsler memory scale ]
the sample comprised of depressive patients diagnosed on the basis of international classification of disease-10 diagnostic criteria for research criteria and with minimum 2 years duration of illness .
patients were selected by purposive sampling technique from department of psychiatry bokaro general hospital bokaro steel city , psychiatric unit and private clinics of bokaro .
only right - handed patients having basic reading and writing ability to understand the instructions given were included in the study .
patients having co - morbid psychiatric disorder , substance abuse , visual and hearing impairment , organic pathology , and significant physical illness were not included in the study .
the study was hospital based pre - and post - intervention with follow - up assessment design .
sociodemographic and clinical data sheetannet 's hand preference scalebeck depression inventory ( bdi)digit span test of wechsler adult intelligence scale revised ( wais - r)wechsler memory scale ( wms ) .
sociodemographic and clinical data sheet annet 's hand preference scale beck depression inventory ( bdi ) digit span test of wechsler adult intelligence scale revised ( wais - r ) wechsler memory scale ( wms ) .
after screening according to inclusion and exclusion criteria , 30 depressive patients were included in study with their informed consent .
annett 's hand preference battery was used to screen handedness and only right - handed patient were selected .
the attention and concentration digit span test from wais - r ( digit span test ) was administered .
after preassessment , cognitive rehabilitation was given to the depressive patients [ appendix 1 ] .
initially , 15 sessions of cognitive rehabilitation package was given ( which includes postassessment ) .
thereafter , postassessment was done to assess the outcome of rehabilitation after 3 months follow - up [ figure 1 ] .
scores of patients on digit span test and wms before and after intervention were compared with the student 's t - test .
plan of study [ * digit span test ( wechsler adult intelligence test ) , wechsler memory scale ]
a total of 30 depression meeting the inclusion and exclusion criteria were included in the study with their informed consent .
the distribution of severity of depression based on scores on bdi was : mild in 2 ( 6.66% ) patients , moderate in 26 ( 86.66% ) patients and severe in 2 ( 6.66% ) patients .
scores of the depression patients on digit span test of wais - r before and after the intervention are shown in table 1 .
pre- and post - intervention scores of immediate and delayed memory subtests along with working and optional memory subtests of wms in depression patients are given in tables 2 and 3 respectively .
scores of the depression patients on digit span test of wais - r before and after the intervention pre- and post - intervention scores of immediate and delayed memory subtests of wms in depression patients pre- and post - intervention scores of working and optional memory subtests of wms in depression patients
in the present study , the aim was to assess the improvement in cognitive functioning of the patient through cognitive remediation techniques .
therefore a pretest was done to assess the level of sustain attention , selective attention , information and orientation , logical memory , verbal paired , visual reproduction , spatial span , mental control , and memory through appropriate test .
after 3 months of regular intervention , a posttest was again done and all areas were again assessed through the same test , that is , as in pretest .
results revels that there was a significant improvement in attention and concentration after the intervention , which can be explained as areas of brain mainly involved in attention are ascending reticular activation system ( arousal / vigilance ) ; superior colliculus ( involuntary eye movement ) ; pulvinar of thalamus ( filtering and redirecting visual attention ) ; cingulate cortex ( executive effortful attention ) ; parietal lobe ( engage / disengage ) ; frontal lobe ( directing attention ) . of these areas , sustained attention is the effort of right parietal and right frontal areas .
experiment that require sustained attention with discrimination were found to activate and maintain activity in right - sided prefrontal ( dorsolateral and ventrolateral ) and parietal lobe .
the circuit mainly involved in it is frontal - striatal pathway connecting frontal lobe and help in maintaining an activity for a considerable period of time ( la berge triangular circuit of attention ) .
therefore , deficits in sustained attention have been proposed as a vulnerability marker for depression .
the functional importance of this finding and the neuronal networks involved remain to be elucidated . thus direct training
involved repeated drills and exercises ( based on the model of parente and parente model of attention ) of sustained attention has been targeted to strengthen the triangular circuit of attention involving dorsolateral prefrontal cortex , parietal lobe and pulvinar , and it has been found to be fruitful in restoring the deficits of the patients . although the physiological mechanism behind the restoration is not known , but the technique has been found to be beneficial for the patients which is supported by another study which also reported that repeated practices is a viable method of cognitive remediation in patients with depression .
the performance on wms in pretest shows poor results on different areas of memory immediate memory ( logical memory i , visual reproduction i , faces i , verbal paired associates i , family pictures i ) which shows that during the phase of depression they are not able to remember information immediately after auditory and visual presentation . also in delayed memory ( logical memory ii , visual reproduction ii , faces ii , verbal paired associates ii , family pictures ii ) , patients are not able to remember orally , auditory and visual information . in working memory ,
depressive patients are unable to remember and manipulate both visually and orally presented information in short - term memory ( letter number sequencing , spatial span ) .
this is consistent with the findings of an earlier study that reported that depressive patients have deficits in their ability to monitor the contents of working memory .
it has also been reported that depressed patients showed inability to inhibit neutral information access to working memory , restrain and delete irrelevant information .
however , there was a significant improvement found in the performance of the patients after the intervention that was targeted to remediate the areas that were deficient in the patients in the present study .
this is consistent with the findings of a previous study that observed that patients who receive cognitive training improve on a range of neuropsychological tests targeting attention , verbal learning and memory , psychomotor speed , and executive function . in the present study , comparison of the pretest and posttest scores revealed significant improvement in all the areas of memory
this finding is consistent with a recent observation that cognitive training in depressive disorders improves memory performance .
study limitations include the relatively low number of subjects due to time constraints and the lack of a control group .
the current intervention package required a significant investment of time and human resources to deliver the therapeutic sessions that may not be available in other settings because of the requirement for trained therapist and cost .
in addition , the contribution of individual components of the rehabilitation package to the outcome measures should be investigated because the present work only assessed the impact of the global rehabilitation protocol .
depressive patients have severe cognitive deficits that may last for prolonged period despite treatment with medications and counseling .
cognitive rehabilitation provides a better scope for the patients with depression to show improvement in global functioning .
the psychosocial rehabilitation of depressive patients should involve cognitive rehabilitation as it directly or indirectly strengthen the patient and motivate him for better performance that is , more the attention and memory capacity better the patient 's performance . | background : cognitive deficits are an important component of depression and may remain impaired after recovery from depression.objectives:to evaluate the efficacy of cognitive rehabilitation in depression on cognitive dysfunction in the area of attention and memory.materials and methods : the study was hospital based pre- and post - intervention with follow - up assessment design .
selection of the depressive patients was by purposive sampling .
the sample size consists of 30 intervention depressive patients included in the study after giving written informed consent .
after preassessment , all patients underwent 15 sessions as part of cognitive rehabilitation .
postassessment was done to see the outcome of cognitive rehabilitation after 3 months follow-up.results:after the intervention , there was significant improvement in attention and memory area . along with these deficits ,
their basic living skills were also improved.conclusion:cognitive rehabilitation techniques are useful in remediating cognitive dysfunction in the area of attention and memory in patients with depression . |
evidence suggests that the glucagon - like peptide-1 receptor ( glp-1r ) agonist exendin-4 ( ex-4 ) , used in the treatment of type 2 diabetes mellitus , also displays neuroprotective properties in multiple cellular and in vivo models of neurodegenerative disorders .
evidence of its potential for the treatment of these neuropathologies has been accumulated rapidly [ 15 ] .
the drug appears to be well tolerated and its use in the clinic , albeit for a different indication , obviates many of the obstacles seen with other putative treatments for pd .
a key factor with ex-4 is that despite being a relatively large peptide it readily enters the cns .
ex-4 is a potent agonist at mammalian glp-1rs and promotes insulin secretion from beta islet cells .
additionally , ex-4 protects beta cells from cytotoxic insults and also promotes their proliferation and neogenesis from precursors [ 8 , 9 ] .
this suggests that similar mechanisms could be responsible for neuronal cell survival in animal models of neurodegenerative disorders in which ex-4 has been shown to be effective .
neuroprotective effects have been shown in vitro to be glp-1r dependent by the use of the glp-1r selective antagonist ex-(9 - 39 ) and also more recently in glp-1r knockout mice .
a possible mechanism of action for ex-4 is that it causes a reduction of deleterious inflammation .
however , ex-4 has also been shown to stimulate neurogenesis in the adult rat , which constitutes a possible means by which the peptide might restore function in a damaged system . in the context of pd
, a potential influence could also be activation of da d3 receptors , which are thought to be involved in stimulation of neurogenesis , as demonstrated in the rat 6-ohda model of pd [ 10 , 11 ] .
we have , therefore , decided to determine whether the neuroprotective effect of ex-4 is selectively glp-1r mediated by use of ex-(9 - 39 ) in our 6-ohda model . secondly ,
since stimulation of da d3 receptors has been shown to protect da neurons against 6-ohda - induced damage and promote neuronal survival as well as stimulate neurogenesis in the subventricular zone ( svz ) [ 10 , 11 ] , we wanted to evaluate the possible role of d3 receptors in ex-4-mediated neuroprotection by using nafadotride ( naf ) , a selective d3 receptor antagonist .
finally , we wished to determine the effects of ex-4 on brdu+ cell numbers in the svz and sn of 6-ohda - lesioned rats and how this might be altered by ex-(9 - 39 ) or naf .
all drugs and reagents were purchased from sigma - aldrich ltd . , uk , unless otherwise specified .
male wistar rats ( 250300 g ) were purchased from harlan , uk , and housed under standard conditions in an animal care facility with controlled temperature , humidity , and fixed light / dark cycles .
all experimental procedures were carried out in accordance with institutional and home office regulations ( 1986 scientific procedures act , uk ) and the helsinki agreement .
rats were anaesthetised using 5% isoflurane ( abbott , uk ) v / v in o2 for induction ( 1.5% for maintenance ) and then secured on a stereotaxic frame ( david kopf , usa ) .
prior to surgery , animals were injected with pargyline ( 50 mg / kg ) and desipramine ( 25 mg / kg ) intraperitoneally ( i.p . ) .
this was done to minimize the metabolism of 6-ohda and to preserve the noradrenergic system , respectively .
the animals were , then , injected with 6-ohda hydrochloride ( 8 g/2 l ) dissolved in saline containing 0.2% ascorbic acid into the left medial forebrain bundle ( from bregma in mm ; a 4.3 , l 1.4 , and v 8.2 ) .
infusion was performed at a rate of 1 l per minute , and a 5-minute period was allowed for diffusion of the toxin after which the syringe was slowly retracted .
( 0.5 g / kg ) or saline twice a day ( 10 am and 5 pm ) , for a period of one week , seven days after the administration of 6-ohda .
injections of the compound 1 g / kg or saline twice a day 5 min prior to ex-4 injection . in another group of rats
( 1 mg / kg ) , a dose that is very largely d3 selective , or saline twice daily , also 5 min prior to ex-4 .
the dose of naf was based upon studies also using this dose with apparent d3 selectivity [ 12 , 13 ] . in a separate set of treatment groups brdu
was injected to investigate if lesions and treatment with ex-4 altered cell proliferation in the svz .
brdu is a brominated thymidine analog able to incorporate into the dna of actively dividing cells and is currently a frequently used measure of presumed neurogenesis .
injections of the compound ( 50 mg / kg twice a day ) 10 min after injection of ex-4 and the antagonists .
these groups were used exclusively for brdu immunohistochemistry and at the end of the brdu treatment were allowed a 4-day washout period to excrete unincorporated brdu .
fourteen days after surgery , animals were injected with 0.05 mg / kg of apomorphine subcutaneously ( s.c . ) in saline , and after 15 minutes each rat was placed in a circular test arena .
we have used longer assessment periods in the past but found that these simply revealed quantitatively larger but qualitatively very similar numbers of turns between groups and were , therefore , deemed an unnecessary use of time .
this accords with procedures we have tested and used previously [ 2 , 3 ] .
animals were anaesthetised with isoflurane ( 5% induction v / v in o2 and 1.5% maintenance ) and then secured in a stereotaxic frame .
microdialysis probes , constructed as described previously and with a membrane length of 4 mm ( whitton et al . , 1991 ) , were bilaterally implanted into the striatum ( mm from bregma a + 0.2 , l 3 , and v 8) ; dental screws were placed within but not penetrating the skull ; the assembly was fixed solidly with dental acrylic ( duralay , reliance dental mfg .
after surgery , animals were placed in individual microdialysis cages and allowed to recover for 24 hours before dialysis .
the following day rats were perfused with artificial cerebrospinal fluid ( acsf ) ( 2.5 mm kcl , 125 mm nacl , 1.18 mm mgcl26h2o , and 1.26 mm cacl2 ) ph 7.4 at a rate of 1 l / min using harvard apparatus model 22 syringe infusion pumps . after a stable baseline
was established , around 1 hour , samples were collected every 30 minutes and after sample four normal acsf was switched to one containing 100 mm kcl , with na concentration reduction to maintain osmolarity , for 30 minutes before returning to normal acsf for the rest of the experiment .
samples were frozen immediately at 80c and analysed for da within one week using high - performance liquid chromatography ( hplc ) with electrochemical detection .
the hplc system comprised a p580 dionex , piston pump ( mobile phase : sodium acetate ; 90 mm , citric acid ; 35 mm , edta , 0.34 mm ; 1-octane - sulfonic acid , 0.06 mm and 5.5% methanol with ph was adjusted to 4.2 using citric acid , flow rate of 0.65 ml / min ) connected to a triathlon refrigerated ( 4c ) autosampler ( spark - holland , the netherlands ) and a c18 reverse phase column maintained at 35c ( ods 3 wm , 4.6 mm i.d .
usa ) and protected by a microsorb guard column ( c18 5 wm , 4.6 mm i.d .
detection was made with an antec - intro electrochemical detector ( antec leyden bv , the netherlands ) fitted with a vto3 flow cell ( vcell + 625 mv filtered to 5 abu with range set on 0.5 na / volt ) .
data capture was achieved and analysed by a pc system ( dell corporation , usa ) equipped with chromperfect for windows software ( justice innovations chromatography data systems , ca , usa ) . da peak areas were converted to amounts using the external standard method .
animals were always sacrificed on completion of microdialysis ( two weeks after 6-ohda surgery ) .
rats were lightly anaesthetised with 5% isoflurane v / v in o2 in order to minimise stress and decapitated , and the brains were rapidly removed , flash frozen on dry ice , and stored at 80c until use .
one day before histology , frozen brains were taken from 80c storage and stored at 20c overnight to facilitate dissection and cryostat sectioning .
striata were removed using a stainless steel punch , placed into microcentrifuge tubes containing 1 ml ice cold 0.01 m pbs and homogenised for da determination .
homogenates were centrifuged at 9000 g for 15 minutes , and duplicates of 50 l aliquots of the supernatant were treated with 0.2 m perchloric acid containing ascorbic acid ( 0.2 m ) and edta ( 0.2 m ) to precipitate the cell debris .
the 50 l homogenate and 10 l perchloric acid mixtures were centrifuged again at 9000 g for 15 minutes at 4c , and 25 l of this supernatant was injected in the hplc system to determine tissue da concentration in pg / gram of striatal tissue .
slide mounted 12 m thick cryostat sections from frozen brain blocks were removed from the freezer and allowed to equilibrate to room temperature for 30 minutes before fixation in 4% w / v paraformaldehyde containing 1% w / v glutaraldehyde in deionised water for 5 minutes at 0c .
following rinsing in 0.01 m pbs for 5 minutes , sections were dehydrated through graded ethyl alcohol concentrations , and endogenous peroxidase activity was blocked by incubation in 0.3% h2o2 in methanol for 10 minutes .
the sections were then rehydrated , and nonspecific immunoreactivity was blocked using 10% swine serum in 0.01 m. pbs for 10 minutes .
sections were then incubated in primary antibody ( anti - th igg raised in rabbit at 1 : 1000 in 0.01 m pbs ) for 15 hours at 4c . after rinsing , the sections were incubated sequentially in biotinylated swine anti - rabbit antibody 1 : 500 in 0.01 m. pbs and abc ( vector labs ltd . )
immunoreactivity was visualized through incubation in 0.5 mg / ml 3,3-diaminobenzidine ( dab ) , containing 0.009% h2o2 in 20 ml of dab solution , for 2 minutes at room temperature .
the sections were counterstained in harris haematoxylin , dehydrated , cleared , and mounted for examination .
digital images were captured using a leica dc500 system and the manufacturer 's software . for brdu histology ,
slide mounted 12 m thick cryostat sections from frozen brain blocks were removed from the freezer and allowed to dry for 24 hours before fixation in 75% acetone and 25% absolute alcohol for 5 minutes .
slides intended for brdu immunodetection were also preincubated in 2 m hcl for 30 min at 37c to facilitate antigen retrieval .
the brdu antibody used was a goat monoclonal raised against brdu ( 1/1000 ) followed by a secondary rabbit anti goat - polyclonal antibody with a biotin tag ( 1/500 ) .
brdu staining was quantified , by an investigator unaware of the treatment protocol , by manually counting cells over a set distance along the lateral ventricular wall viewing sagittal sections .
data obtained from apomorphine tests , tissue da , th , and brdu immunohistochemistry were subjected to one - way analysis of variance ( anova ) and post hoc bonferroni multiple comparison tests to compare difference between selected treatments .
microdialysis data were subjected to a two - way anova with a post hoc bonferroni multiple comparison test . in both cases ,
the 6-ohda - lesioned rats treated with apomorphine two weeks after surgery made intensive turning behavior compared to sham animals that do not show turns ( figure 1 ) . circling
was significantly reduced by cotreatment with ex-4 , an effect attenuated by both ex-9 - 39 and naf ( figure 1 ) . neither of the antagonists or ex-4 administered alone to nave animals had any effect on apomorphine circling . in sham groups
the mean da content was 6.8 1.1 pg / g of tissue while in 6-ohda - only groups there was a substantial reduction in da levels ( 0.77 0.2 pg / g ) . in groups cotreated with ex-4 tissue da was restored to 5.2 0.33 pg / g , an effect reversed by both ex-9 - 39 ( 0.19 0.1 pg / g ) and , to a lesser extent at the doses employed here , by naf ( 2.6 0.53 pg / g ) ; both results were significantly different from 6-ohda + ex-4 ( figure 2 ) .
animals treated with either ex-4 , ex-9 - 39 , or naf alone did not show significant changes in their striatal da tissue content compared to control groups .
basal and k - evoked striatal extracellular da were assessed using in vivo microdialysis , with da release shown as fmol/10 l of sample .
basal da levels in control groups were 39 1.2 fmol/10 l , increasing to 1108 113 fmol/10 l when stimulated with 100 mm kcl and rapidly returning to baseline on removal of this stimulus ( figure 3 ) . in 6-ohda - only - treated rats basal da was reduced to 8 3 and k - induced da release decreased to 188 34 fmol/10 l .
it is noteworthy that the decrease in extracellular da was proportionately less than tissue da in lesioned animals .
rats given 6-ohda and then cotreated with ex-4 displayed a significant restoration of both basal ( 28 9 fmol/10 l ) and k - evoked ( 780 87 fmol/10 l ) extracellular da ( figure 3 ) .
6-ohda rats cotreated with ex-9 - 39 + ex-4 displayed drastically reduced levels of both basal and k - induced extracellular da compared with 6-ohda and ex-4 groups ( figure 3 ) , as did ex-4 rats cotreated with naf ( basal 5 1 fmol/10 l and k - induced 125 21 fmol/10 l ; figure 3 ) .
da levels in sham animals treated with ex-4 , ex-9 - 39 , or naf only were statistically not different from the sham groups ( data not shown ) .
th staining is shown both qualitatively ( photomicrographs ) and quantitatively ( figures 4(a ) and 4(b ) ) .
control groups had a high level of th expression ( colour intensities of 21532 2853 ) while groups treated with 6-ohda and tested after two weeks showed an approximate 80% decrease in th content compared to controls ( figure 4 ) , an effect reversed by ex-4 ( 18293 2620 units ) . in 6-ohda and ex-4 groups which also received ex-9 - 39 , th
decreased to 3225 1893 units , while after cotreatment with naf intensities were decreased to 5680 2854 units ( figure 4 ) .
groups which were treated with ex-4 , ex-9 - 39 , or naf only were not significantly different from controls ( data not shown ) .
brdu was coadministered to treatment groups to investigate cell proliferation in the rat svz and sn while dab staining was used to visualise brdu antibody binding .
results were expressed as numerical density calculated as numbers of dab positive cells per section . in the svz
, 6-ohda - only - treated animals showed a significant increase in brdu+ cells , which was reversed by ex-4 .
in turn , the effects of ex-4 were markedly attenuated by ex-(9 - 39 ) ( figures 5 and 6 ) . in the sn , the reverse was seen .
6 - 0hda dramatically reduced the count of brdu+ cells , and this was largely reversed by ex-4 .
both antagonists decreased the effect of ex-4 , resulting in reductions in brdu+ cells similar to that seen with 6-ohda alone ( figures 5 and 6 ) .
many studies , both in vitro and now in vivo , strongly indicate the therapeutic potential of ex-4 in neurodegenerative disorders where glp-1rs appear to be the key in mediating these effects .
the present report indicates that glp-1rs as well as da d3 receptors are required for neuroprotective effect of ex-4 in the 6-ohda rat model of pd .
thus , when the specific antagonist of glp-1r ex-(9 - 39 ) was coadministered with ex-4 in 6-ohda rats , animals displayed increased contralateral circling , reduced extracellular as well as tissue da levels , and also decreased snc th expression , a complete reversal of the previously observed effects of ex-4 .
glp-1rs are also expressed throughout the central nervous system , with binding sites identified in both the human and the rat brain , and are produced by neuronal cells in discrete regions of the cns .
more recently , the neuroprotective role of glp-1rs was demonstrated in an mptp mouse model of pd .
ex-4 was able to protect normal mice against mptp - induced damage of the sn , whereas no effect was observed in glp-1r deficient mice , indicating that the glp-1r is instrumental for ex-4-mediated neuroprotection .
however , broadly , it seems that there may be a rescue of dying neurons that are not yet fatally damaged , quite possibly as a result of the well - known anti - inflammatory properties of these molecules .
alternatively , it has been suggested that glp-1 and ex-4 are able to promote de novo neurogenesis as indicated by the findings of bertilsson et al . .
in our studies we have observed increased accumulation of brdu+ cells in the svz of 6-ohda - treated animals , an effect which was reduced significantly when animals were given ex-4 , while in the sn the opposite effect was seen with reduced brdu+ cells in 6-ohda - treated rats and a reversal with ex-4 .
the effects of ex-4 were themselves completely reversed by ex-(9 - 39 ) , indicating a glp-1 receptor specific primary action .
additionally , the effects of ex-4 in the svz and sn were attenuated by naf , indicating that da d3 receptors play a role in the overall process .
d3 receptors are localized on da neurons of the adult sn [ 10 , 11 ] as well as upon the surface of progenitor cells in the svz , where their stimulation appears to elicit maturation and migration of these cells [ 10 , 11 , 18 ] .
these observations underpinned our interest in the possible role of these receptors as facilitators of glp-1r - mediated neuroprotection . interestingly , evidence has been accumulated from animal models suggesting that d3 receptor stimulation is neuroprotective .
selective agonists of this receptor subtype are effective in both mptp - treated mice [ 19 , 20 ] and 6-ohda rat models of pd [ 10 , 11 , 21 ] .
neuroprotective effects of these agents are abrogated in the presence of the d3 antagonist a-437203 and also in mice lacking d3 receptors .
evidence from both in vitro and in vivo studies suggests that protective effect of pramipexole , which is a preferential d3 agonist used in the treatment of early pd , is dependent on brain - derived neurotrophic factor ( bdnf ) signaling [ 19 , 23 , 24 ] . in vivo evidence
demonstrates that infusion of a d3 preferring agonist into lateral ventricles doubled cell proliferation in the svz and the olfactory bulb whereas no such effect was observed with a d1 preferring agonist or in the presence of a d3 antagonist [ 10 , 11 ] .
in addition , proliferation of cultured svz cells treated with various da agonists correlated with affinity of the agonist for the d3 receptor and was reduced in the presence of an antagonist of this receptor subtype .
d3 receptor stimulation not only results in svz cell proliferation but stimulated cells also display neuron specific markers in both svz and the rostral migratory stream [ 10 , 11 ] .
moreover , a 2-week infusion of a d3 preferring agonist into the third ventricle resulted in a sixfold increase in brdu - labeled cells in the sn which were also th positive and displayed a neuronal phenotype .
the linkage between glp-1r and d3 receptors has not been studied directly as far as we are aware but is of obvious interest and has been tentatively suggested .
our choice of the naf dose was based upon previous studies [ 12 , 13 ] where there was a clear selectivity for the use of a 1.0 mg / kg .
indeed , in one study a question raised was whether this dose is sufficient to determine the effect of d3 receptor blockade .
the effects of 6-ohda on brdu incorporation into cells in the svz are themselves somewhat controversial [ 26 , 27 ] .
progenitor cell numbers in the svz have been observed to decrease in response to dopaminergic denervation [ 28 , 29 ] while in other studies increases are observed [ 30 , 31 ] .
evidence for neurogenesis in the sn is also controversial with some studies reporting increased levels of this phenomenon in mptp models while others using 6-ohda - treated rats report no evidence of sn neurogenesis .
results obtained from human pd patients demonstrate reduced cell proliferation in the svz , and changes in adult neurogenesis resulting from neurodegenerative disorders likely depend on selected neuronal populations affected ; and the role of neurogenesis needs further clarification [ 26 , 27 ] .
the effects we observe here could be explained by alterations in the migration of brdu+ cells between the svz and sn .
these structures are linked by a dopaminergic pathway , stimulation of which would presumably increase da tone on progenitor cells and augment their proliferation and/or migration . presumably the converse may occur if the pathway is damaged , such as by daergic denervation , leading to a potential accumulation of progenitor cells in the svz and a decrease in the sn .
this is exactly what we have observed and is reversed by ex-4 , which is efficacious in preclinical pd models . whether this contributes to the positive effect of ex-4
is unclear but at the very least , in theory , could play some role in the neuroprotective actions of ex-4 in these models .
more recently evidence suggests that ex-4 has actual therapeutic efficacy , as indicated in a small scale clinical trial .
these observations have naturally led to understanding the mechanism of action of ex-4 being of intense interest .
the present data suggest that ex-4 reverses the decrease in brdu+ cells in the sn of lesioned rats .
this is blocked by da d3 receptor stimulation one possibility may be that ex-4 alters the migration and/or maturation of progenitor cells .
moreover , our findings with ex-9 - 39 unambiguously show that these effects are primarily mediated by the glp-1r . | glucagon - like peptide-1 receptor ( glp-1r ) activation by exendin-4 ( ex-4 ) is effective in preclinical models of parkinson 's disease ( pd ) and appears to promote neurogenesis even in severely lesioned rats . in the present study
, we determined the effects of ex-4 on cellular brdu incorporation in the rat subventricular zone ( svz ) and substantia nigra ( sn ) .
we also determined the specificity of this effect with the glp-1r antagonist ex-(9 - 39 ) as well as the potential role of dopamine ( da ) d3 receptors .
rats were administered 6-ohda and 1 week later given ex-4 alone , with ex-(9 - 39 ) or nafadotride ( d3 antagonist ) and brdu .
seven days later , rats were challenged with apomorphine to evaluate circling .
extracellular da was measured using striatal microdialysis and subsequently tissue da measured .
tyrosine hydroxylase and brdu were verified using immunohistochemistry .
apomorphine circling was reversed by ex-4 in lesioned rats , an effect reduced by ex-4 , while both ex-(9 - 39 ) and naf attenuated this .
6-ohda decreased extracellular and tissue da , both reversed by ex-4 but again attenuated by ex-(9 - 39 ) or naf .
analysis of brdu+ cells in the svz revealed increases in 6-ohda - treated rats which were reversed by ex-4 and antagonised by either ex-(9 - 39 ) or naf , while in the sn the opposite profile was seen . |
there are various body fluids , of which saliva is the most valuable oral fluid that can aid in the diagnosis of various diseases such as hiv , hepatitis , renal disease , and detection of apoptotic cells in saliva of patients with oral carcinoma .
saliva has also become useful as a non - invasive systemic sampling measure for medical diagnosis and research , so this valuable oral fluid is critical to the preservation and maintenance of oral health , yet it receives little attention until its quality or quantity is diminished .
there has been much recent research on the topic of salivary glandular dysfunction as it relates to disease or as a side effect of certain medications . in the salivary gland dysfunction , it can present as either hypersalivation or hyposalivation .
hyposalivation can occur in localized disease , systemic disease ( diabetes mellitus and parkinson 's disease ) , cystic fibrosis , and sarcoidosis of which diabetes is the most commonly reported disease in daily medical and dental practice . although hypersalivation usually caused by physiological factors such as mensuration or early pregnancy , local factors such as inflammatory lesions , food , or medication are also responsible .
diabetes mellitus is characterized by increased levels of glucose in the blood and abnormalities in the metabolism of lipid , protein induced by diminished levels , or total absence of insulin .
the incidence of diabetes is increasing at an alarming rate and the risk of diabetes has increased as people move away from their traditional lifestyle .
patients with diabetes can present with various oral manifestations such as gingivitis , periodontitis , candidiasis , burning mouth syndrome , delayed wound healing , and those who have poor glycemic control are more likely to complain of xerostomia and may have decreased salivary flow up to 82.5% .
the cause of salivary dysfunction may be related to polyuria ( or ) to alterations in the basement membrane of salivary glands , an investigation revealed parotid gland basement membrane abnormalities in all diabetic subjects as indicated by the binding of immunoglobulins ( igg ) albumin and polyvalent igg to ductal and acinar basement membranes .
so variation in parotid diabetic basement membranes evidenced that membranopathy in this disease is systemic in nature .
there are various imaging techniques used for salivary gland , e.g. , sialograms , computed tomography , magnetic resonance imaging , ultrasound , and scintigraphy .
scintigraphy is the only method available that can provide qualitative and quantitative functional assessments of the major salivary glands .
so various studies have been carried out in diabetic patients to detect salivary gland function , but only few studies in the past have used scintigraphy for assessing the salivary gland function in diabetic patients .
scintigraphy is a valuable tool as it provides dynamic , objective , and quantitative measurement of the major salivary gland function and allows for differentiation of abnormalities in saliva production as uptake ratios ( urs ) and secretion as excretory ratios ( ers ) . the isotopes used for salivary gland is technetium-99 m pertechnetate , which paves way for excellent images with sharp contrast .
the aim of this study was to evaluate the salivary gland dysfunction in patients with uncontrolled type 2 diabetes using salivary gland scintigraphy . to determine whether salivary gland scintigraphy can be used in diabetic patients to detect salivary gland dysfunction .
the aim of this study was to evaluate the salivary gland dysfunction in patients with uncontrolled type 2 diabetes using salivary gland scintigraphy . to determine whether salivary gland scintigraphy can be used in diabetic patients to detect salivary gland dysfunction .
patients were randomly selected in the department of oral medicine and the study comprised of 32 uncontrolled type 2 diabetic patients ( 20 females and 12 males ) and 30 ( 16 females and 14 males ) age- and sex - matched normal healthy individuals .
patients having any other systemic or nervous illness or taking any medications or having suffered in the past with any type of illness or treatment that could have an effect on the normal functioning of the salivary gland were excluded from the study .
the diabetic and normal healthy patients were selected according to american diabetes association expert committee .
fasting plasma glucose < 126 mg / dl , post - prandial glucose < 160 mg / dl , and hba1c < 6% were considered controlled diabetes .
diabetic status was considered uncontrolled when patients had fasting plasma glucose > 160 mg / dl , post - prandial > 200 mg / dl , and hba1c > 8% .
the salivary gland scintigraphy was performed in the department of nuclear medicine using gamma camera ( diacam , seimens , germany ) equipped with a low energy all - purpose collimator .
the patient was placed in supine position with the gamma camera close to the face to record activity in the major salivary glands and the surrounding tissues .
technetium-99 m about 5 mci ( 135 mbq ) was injected intravenously into antecubital vein .
the activity was measured at 1 , 20 , and 40 min [ figure 1 ] .
twenty minutes after the injection , vitamin c chewable tablet was given to stimulate the secretion and continued until the end of the study period ( 40 min ) .
the data were replayed and regions of interest were chosen over four salivary glands to obtain the uptake and er of the salivary glands .
scintigraphy in diabetic patients at 1 , 20 , and 40 min statistical analyses were done from the obtained data ; mean and standard deviation were estimated using the formula : where xi is the individual observation in the group .
the mean ur between diabetic and normal patients was compared and the p value was calculated using mann
the formula used was : t is the sum of the ranks in the smaller group . n1 and n2 are the sample sizes in each study group .
figure 1 shows scintigraphic images at different time intervals . the scintigraphic total uptake and er showed a decrease in both uptake and the er in diabetic patients , when compared to control patients [ table 2 , figure 2 ] .
when it was subjected to statistical analysis , it was found to be non - significant .
total uptake and excretory ratio of the major salivary glands in diabetic and control patients between 1 - 20 and 20 - 40 min comparison of mean uptake and excretory ratios between diabetic and control patients comparison of mean uptake ratios between diabetic and control group .
graph i shows a decrease in the mean uptake and excretory ratios in diabetic group as compared to control group
this study was carried out to detect whether diabetic patients have salivary gland dysfunction using salivary gland scintigraphy .
various literature studies have reported that diabetic patients have diminished salivary dysfunction,[51318 ] of which the xerostomia is seen in uncontrolled diabetic patients up to 82.5% .
the cause of salivary dysfunction may be related to polyuria ( or ) alteration in the basement membrane of salivary glands , and lot of literature studies have reported the parotid gland basement membrane abnormalities in all diabetic patients.[46 ] previous studies have included diabetic patients with age group of 50 - 60 years and another study has evaluated in diabetic patients with age group of 50 - 90 years .
this study was performed in 62 patients ( 32 diabetic and 30 controls ) with age range between 40 and 60 years , which is similar to the age range employed in other studies evaluating salivary gland dysfunction .
both the diabetic and normal patients were excluded , if they had any other systemic illness ( or ) were on any medication that could have an affect on salivary gland function .
a lot of studies in the past have been carried out in diabetic patients to detect salivary dysfunction , but only few studies in the past have used scintigraphy for assessing the salivary dysfunction in diabetic patients .
the imaging techniques used for visualizing salivary gland include sialography , computed tomography , magnetic resonance imaging ultrasound , and scintigraphy .
number of studies in the past had used scintigraphy to detect the glandular dysfunction in diabetic patients , chronic renal failure , parenchymal damage after treatment with radio - iodine , and in patients with xerostomia due to aging and medications.[1112192123 ] hence , scintigraphy was chosen as a choice in this study .
a number of studies have used technetium-99 m pertechnetate for imaging of salivary dysfunction.[12192123 ] technetium-99 m pertechnetate with its monochromatic energy of 140 kw is physically the ideal isotope for imaging .
because of their short half - life , these isotopes can be used in very large amounts of order of millicuries , without causing radiation hazards to patients .
technetium-99 m pertechnetate was injected in millicuries and about 5 mci ( 135 mbq ) was injected into antecubital vein and the activity was recorded with a low energy all - purpose collimator for data analysis .
the scintigraphic total ur and er in diabetic and control groups were compared [ table 1 ] .
the values in these two categories showed a decrease in both ur and the er in diabetic patients , when compared to control patients [ table 2 , figure 2 ] .
when it was subjected to statistical analysis , it was found to be non - significant as this could be due to smaller sample size of 32 numbers and marginal difference between diabetic and control groups .
scintigraphy has its limitations of free availability of equipment , cost factor , and patient 's acceptance for a long procedure .
the result of this study leads to the conclusion that salivary gland scintigraphy plays a significant role in the evaluation of salivary gland dysfunction .
however , its role as an independent investigative procedure in the evaluation of salivary gland dysfunction requires a study with larger sample size , which may yield a statistical significant result . | objective : the aim of the study was to evaluate the salivary gland dysfunction in a patient with uncontrolled type 2 diabetes using salivary gland scintigraphy.materials and methods : patients included in the study were 32 uncontrolled type 2 diabetic and 30 normal healthy individuals .
patients having any other systemic(or ) nervous illness(or ) taking medications that could affect the normal functioning of the salivary gland were excluded from the study .
the salivary gland scintigraphy was performed , with radioactivity measured at 1st , 20th , and 40th minutes .
twenty minutes after the injection , vitamin c chewable tablet was given to stimulate the secretion and continued until the end of the study period ( 40min ) .
the data were replayed and regions of interest were chosen over four salivary glands to obtain the uptake ratio ( ur ) and excretory ratio(er ) of the salivary glands .
result : the scintigraphic total urand er in diabetic and control groups was compared .
the values in these two categories showed decrease in both ur and er in diabetic patients , when compared to control patients.conclusion and significance : the result of this study suggests that salivary gland scintigraphy plays a significant role in the evaluation of salivary gland dysfunction in type 2 diabetic patients . |
ulcerative colitis ( uc ) is a major type of inflammatory bowel disease characterized by chronic , relapsing intestinal inflammation with extensive damage of colonic mucosa .
it is presented by a variety of clinical manifestations , including attacks of abdominal cramps , pain , bloody diarrhea , bleed per rectum , weight loss , fever , and easy fatigability , which may begin gradually or start totally all at once [ 1 , 2 ] .
there are different drugs currently used in uc , including aminosalicylates , corticosteroids , immunosuppressants , or biological therapies such as the use of anti - tnf antibodies .
although all of them have shown some grade of efficacy in these intestinal conditions , the frequency and severity of adverse effects , inconvenient dosing regimen , and partially prohibitive price limit their long - term use [ 3 , 4 ] .
for this reason , the development of new therapies that combine efficacy , convenient dosing , and fewer side effects is an important goal in human uc therapy . in this regard ,
the use of alternative therapies has emerged as a common approach in gastrointestinal diseases ; actually , studies describe that almost half of ibd patients have ever taken or currently use complementary remedies [ 5 , 6 ] .
different factors may contribute to this situation , including the lack of a complete response to standard therapy and the general feeling about a better safety profile of traditional remedies , in combination with the appreciation of an improved control of their disease .
there are many different types of alternative and/or complementary therapies , although the botanical drugs are very relevant for the treatment of the intestinal inflammation .
this can be mainly related to their safety , since they have been taken from ancient times , in addition to their reputed efficacy , most probably due to the presence of different active components that can concurrently target several pathways or mediators of the inflammatory response .
however , most of these uses have an empirical basis , and in consequence , it is necessary to properly evaluate these botanical drugs to consider them as an adequate strategy to treat ibd .
experimental colitis models have been used to identify therapeutic agents and elucidate the underlying physiologic mechanisms of uc .
the widely employed dss - induced colitis model recapitulates the histological characteristics of uc [ 8 , 9 ] .
amphipterygium adstringens schide ex schlecht ( julianiaceae ) is an endemic species in mexico commonly known as cuachalalate . the bark has traditionally been used by healers to treat gastritis , gastric ulcers , gastrointestinal cancer , colic , fever , and also tooth pain .
moreover , anti - inflammatory , hypocholesterolemic , antifungal , and antiprotozoal activities have also been reported as properties for this plant [ 1019 ] .
therefore , the present study aimed to investigate the antioxidant , anti - inflammatory , and immunomodulatory activities of a. adstringens ethanolic extract in a mouse model of experimental colitis induced by dss , regarding the activity of superoxide dismutase ( sod ) , catalase ( cat ) , and glutathione peroxidase ( gpx ) , cytokine levels , and macroscopic and microscopic changes of colonic mucosa .
dss ( mw : 35,00050,000 ; mp biomedicals , solon , oh , usa ) was used for induction of colitis ; sod , cat , and gpx kits were obtained from cayman chemical ( ann arbor , mi , usa ) and were used to determine the colonic antioxidant enzyme activities .
determination of cytokine levels was performed using a bio - plex pro mouse cytokine 8-plex panel ( bio - rad , hercules , california usa ) . for antioxidant activity ,
was collected in august 2013 in san rafael , coxcatlan , puebla , and the botanical authentication of the specimen was done by m. c. maria edith lopez villafranco ( curator at the izta herbarium ) .
voucher specimens were deposited in the herbarium izta at the facultad de estudios superiores iztacala ( voucher number izta-29285 ) .
san rafael is a village in the municipality of coxcatlan , which is located southeast of the tehuacan - cuicatlan valley at 1812 and 1814 north and 9707 and 9709 west , residing 957 m above sea level .
the climate is dry or arid with summer rains and a mean temperature of 22c .
the specimens were collected in the field with permission from the secretaria de medio ambiente y recursos naturales ( sgpa / dgvs/1266 ) .
female balb / c mice 68 weeks of age were purchased from harlan laboratories ( mexico ) .
mice were maintained in a pathogen - free environment at the fes iztacala , unam , animal facility according to faculty animal care and use committee and government guidelines ( official mexican regulation nom-062-zoo-1999 ) , which are in strict accordance with recommendations in the guide for the care and use of laboratory animals of the national institutes of health ( usa ) .
mice were sacrificed using co2 chamber , and all efforts were made to minimize pain .
the extract of the a. adstringens was obtained from dehydrated bark ( 555 g ) through maceration with ethanol ( 2.0 l ) at room temperature .
after filtration , the solvent was evaporated under reduced pressure , generating the ethanol extract ( aaee ) .
10 g of aaee was dissolved in ethanol ( 100 ml ) and hexane ( 100 ml ) before being placed in a separatory funnel .
after the solvent - solvent extraction , the hexane fraction ( f1 ) was removed from the aaee . to the ethanol residue
was added chloroform ( 100 ml ) , after the solvent - solvent extraction , the chloroform fraction ( f2 ) , was removed . after removing the solvent ,
0.078 g of hexane ( 0.78% ) and 0.296 g of chloroform ( 2.96% ) were obtained .
experimental colitis was induced by 4% dss . briefly , 68-week - old balb / c mice were housed at a temperature of 2224c under a 12 h light / dark cycle with free access to water . after a 1-week period of adaptation , the mice were randomly divided into the following 4 groups ( 6 mice / group ) : untreated ( no dss ) , dss - treated ( 4% dss ) , dss + aaee ( 4% dss and aaee at 200 mg / kg body weight per day ) , and vehicle ( 100 l eoh 50% v / v ) . the untreated group received tap water without dss . for the dss - treated group and dss + aaee group ,
the mice were scored daily with respect to body weight , stool formation , and bloody stool .
the weight loss , stool formation , and bloody stool scores were averaged to determine the dai .
scores were assigned as follows : weight change ( 0 : < 1% , 1 : 15% , 2 : 510% , 3 : 1015% , or 4 : > 15% ) , bloody stool ( 0 : negative , 2 : positive , or 4 : gross bleeding ) , and stool formation ( 0 : normal , 2 : loose stool , or 4 : diarrhea ) . on day 10 ,
the mice were sacrificed by cardiac puncture under ketamine / xylazine anesthesia ; blood was collected and centrifuged to isolate plasma , which was kept at 20c until use for cytokine determination . then , colon tissues were isolated .
colon tissue samples were fixed in 10% formalin and embedded in paraffin . then 5 micrometer - thick tissue sections were prepared and stained with hematoxylin and eosin ( he ) to evaluate mucosal damage .
the sections were also stained with alcian blue to evaluate the presence of goblet cells .
paraffin - embedded colon sections , fixed in formalin , were stained using hematoxylin and eosin ( h&e ) .
assessment included noting of edema , extent of injury , leukocyte infiltration , crypt abscesses , and loss of goblet cells . in this grading system ,
inflammation severity was scored on a 03 scale ( 0 : none ; 1 : slight ; 2 : moderate ; 3 : severe ) as was the extent of injury ( 0 : none ; 1 : mucosal ; 2 : mucosal and submucosal ; 3 : transmural ) ; crypt damage was scored on a 03 scale ( 0 : none ; 1 : basal third damaged ; 2 : basal two - thirds damaged ; 3 : loss of entire crypt and epithelium ) .
determination of tnf- , ifn- , il-1 , and il10 cytokine levels is using a bio - plex pro mouse cytokine 8-plex panel ( according to the manufacturer 's protocol ) .
the excised colons were homogenized in phosphate buffer using a bullet blender homogenizer ( next advance , ny , usa ) and the homogenates were centrifuged at 10,000 g for 15 min at 4c .
the levels of sod , gpx , and cat activity were all determined using the methods provided by the assay kits ( cayman chemical company , usa ) .
cayman 's sod assay kit utilizes a tetrazolium salt for detection of superoxide radicals generated by xanthine oxidase and hypoxanthine .
one unit of sod is defined as the amount of enzyme needed to exhibit 50% dismutation of the superoxide radical .
the sod assay measures all three types of sod ( cu / zn , mn , and fesod ) .
cayman 's gpx assay measures gpx activity indirectly by a coupled reaction with glutathione reductase ( gr ) .
oxidized glutathione ( gssg ) , produced upon reduction of hydroperoxide by gpx , is recycled to its reduced state by gr and nadph .
the oxidation of nadph to nadp+ is accompanied by a decrease in absorbance at 340 nm . under conditions
in which the gpx activity is rate limiting , the rate of decrease in the a340 is directly proportional to the gpx activity in the sample .
cayman 's cat assay kit utilizes the peroxidatic function of cat for determination of enzyme activity .
the method is based on the reaction of the enzyme with methanol in the presence of an optimal concentration of h2o2 .
purpald specifically forms a bicyclic heterocycle with aldehydes , which upon oxidation changes from colorless to a purple color .
ninety - six - well elisa plates were filled with extract concentrations ranging from 1 to 100 g / ml , hplc grade methanol served as a blank sample , and a 2,2-diphenyl-1-picrylhydrazyl solution ( dpph ) ( 100 m ) served as a control .
the plates were incubated for 30 min at 37c , and the absorbance values were determined at 517 nm with an elisa plate reader .
the antioxidant activity values were determined according to the following equation : % inhibition = [ ( absorbance of control absorbance of sample)/absorbance of control ] 100 . the concentration leading to 50% inhibition ( sc50 ) was determined graphically .
the folin - ciocalteu method was used to determine the total phenolic content of a 0.05 mg / ml concentration of the methanolic extract .
distilled water ( 6 ml ) and 500 l of folin - ciocalteu reagent were added , and after 5 minutes , 1.5 ml of na2co3 ( 200
after incubation at room temperature for 2 hours , absorbance readings were measured using a spectrophotometer at 760 nm .
the mean of three readings was used to interpolate with the gallic acid curve ( 6.25 , 12.5 , 25 , 50 , 100 , and 200 g / ml ) , and the total phenolic content was expressed in mg of gallic acid equivalents ( gae)/g of extract .
a solution of 2% aluminum trichloride ( alcl3 ) in hplc grade methanol and an extract concentration of 0.2 mg / ml was used .
readings at 415 nm using spectrophotometer were taken after 10 minutes against a blank sample ( 5 ml extract solution and 5 ml methanol without alcl3 ) . a quercetin ( 1100 g / ml ) calibration curve was used as the standard .
the mean of three readings was expressed as mg of quercetin equivalent qe / g of extract .
the aaee was loaded onto the hplc hp series 1100 separations module from hewlett - packard ( wilmington , de , usa ) , equipped with an allsphere ods-1 column , at 269 bar pressure and a temperature range of 22c-23c .
the mobile phase consisted of methanol : acetonitrile : h2o ( 25 : 25 : 50 ) for 20 minutes .
a dad detector was used at a wavelength of 260 nm with a full scan of 200400 nm .
f
1 and f2 fractions were injected into a gas chromatograph 6850 ( china ) equipped with a rtx column ( 30 m 0.25 mm i.d . ,
the temperature of the column was programmed starting at 70c for 2 min , and then the temperature was increased 8c / min to 270c . at 270c ,
the gas carrier was helium at a flow rate of 0.9 ml / min .
gc - ms analysis was performed on a agilent 5975c ( china ) mass spectrometer .
f2 fractions components were identified by comparison of the retention times and the mass spectra with the nist / epa / nih mass spectral library .
calculations were performed using graphpad prism ( version 6.0 ; graphpad software inc . , san diego , ca , usa ) .
these symptoms were more marked at the end of the experimental period , when animals showed multiple clinical signs of severe disease , including marked weight loss ( more than 15% ) .
the mortality in the dss group started at day 13 , ( 16.67% ) ; at day 16 , 100% of mortality was registered .
however , survival curves showed that aaee significantly increased the survival rate of the mice ( figure 1 ) .
the main clinical manifestations produced by the model of acute dss colitis are diarrhea and blood in the stool , always accompanied by considerable weight loss . in the dss - treated group
, a loss of body weight is recorded between days 3 and 4 after administration of dss ( 4% ) and this loss remained significantly higher compared with the group of normal mice until day 10 ( p < 0.05 ) .
treatment with aaee group ( 200 mg / kg ) + dss reversed the weight loss starting from day 6 ( figure 2(a ) , p < 0.05 ) .
dai scores significantly increased up between days 6 and 7 in dss group , as indicated by the incidence of diarrhea , weight loss , and bloody stools .
however , aaee - treated group exhibited significantly attenuated dss - induced disease severity ( figure 2(b ) ) .
in addition , we found that the colon was significantly shorter in the dss - treated mice ( 62.80 4.25 mm ) than in the control group ( 104.9 7.56 mm ) .
the colon length was 92.73 2.71 mm in these mice ( figures 2(c ) and 2(d ) ) .
histological examination of h&e - stained colonic sections under light microscopy revealed that dss mice showed typical inflammatory changes in colonic architecture , such as ulceration , crypt dilation , loss of tissue architecture , and goblet cell depletion , as well as cell infiltration ; the damage was assessed from the colonic histopathological scores ( range 09 ) .
compared to control mice , dss mice showed significantly increased histopathological scoring of disease ( figure 3(a ) ) .
after treatment with aaee ( 200 mg / kg ) , the ulcer area was significantly reduced , and edema and adhesion were alleviated .
the inflammatory cells were less prone to infiltration and were localized in the mucosa ( figure 3(b ) ) .
the activity of antioxidant enzymes in colonic tissues of control and experimental group of mice is shown in figure 4 .
a significant ( p < 0.05 ) decrease in the activities of sod , gpx , and cat was evident in dss - induced mice when compared with untreated mice .
in contrast , aaee - treated mice exhibited more prominent activities of the antioxidant enzymes sod and gpx ( 0.24 0.019 u / ml and 82.21 2.81 nmol / min / ml , resp . ) as compared with dss group .
cat showed no significant difference between the group treated with dss and aaee + dss group the effects of aaee on serum levels of several proinflammatory cytokines such as tnf- , ifn- , and il-1 were evaluated by bio - plex pro mouse cytokine assay .
as shown in figure 5(a ) , dss treatment increased significantly the serum tnf- levels to 321.5 24.75 pg / ml , compared to the control group ( 21.62 8.44
pg / ml ) . however , aaee treatment significantly reduced the levels observed in the dss group to 183.3 12.02 pg / ml ( p < 0.05 ) . with respect to ifn-
both treatment groups aaee and dss showed high levels of this cytokine compared to control group ( 4.82 1.6 pg / ml ) .
however aaee group displayed significantly lower levels of ifn- than dss mice ( 15.69 0.81 pg / ml and 39.36 4.9
serum level of il-1 increased more than ten times ( 227.6 8.66 pg / ml versus normal controls 20.15 4.35 pg / ml ) .
however , treatment with aaee significantly reduced il-1 observed in the dss group to 149.4 8.84 pg / ml ( p < 0.05 ) ( figure 5(c ) ) . systemic levels of il-10 were increased in the aaee - treated group in comparison with the dss group , although no statistically significant differences were observed between these groups ( figure 5(d ) ) . the total polyphenolic content ( tpc ) of aaee was determined by folin - ciocalteu assay . according to literature ,
phenols are the main responsible compounds of the antioxidant activity ; for this reason , the aaee has been analyzed .
results of aaee were expressed as mg of gallic acid equivalent ( gae)/g of extract ( table 1 ) , by using a standard curve .
total flavonoid content was expressed as mg of quercetin equivalent ( qe)/g of dried extract ( table 1 ) .
with respect to the antioxidant capacity , generally , phenolic compounds are responsible for biological activities as antioxidant capacity and inhibition of enzymes involved in common diseases . in vitro antioxidant tests using free radical traps are relatively straightforward to perform . among free radical scavenging methods ,
the one involving 2,2-diphenyl-1-picrylhydrazyl ( dpph ) is rapid , simple , highly reproducible , and inexpensive in comparison to other test models .
results were expressed as sc50 ( table 1 ) . according to al - fatimi et al .
, aaee showed a good dpph scavenging activity ( sc50 of 36.04 g / ml ) , while quercetin ( used as standard ) showed sc50 of 4.6 g / ml ( table 1 ) .
by hplc were identified 4 compounds ( table 2 ) and 15 by gc - ms ( table 3 ) .
the standard treatments for colitis are generally immunosuppressant and anti- inflammatory drugs , which have many undesirable side effects .
therefore , better therapeutic agents that effectively attenuate mucosal inflammation with minimum or no side effects are needed .
natural products , herbs , and dietary components have shown therapeutic effect against inflammatory colitis [ 3 , 7 ] .
medicinal plant - based traditional medicine has long provided ethnopharmacotherapy for the treatment of chronic inflammatory disorders .
the pharmacological activity of medicinal plants appeared to correlate with the presence of active compounds having antioxidant and anti - inflammatory activities .
several studies reported that amphipterygium adstringens commonly known as cuachalalate exhibit various biological activities , including antioxidant , anticancer , and anti - inflammatory properties [ 1019 ] . with this purpose ,
the present study has evaluated for the first time the potential application of ethanolic extract from a. adstringens ( aaee ) in the dss - induced colitis model in mice . in this study
, we showed that aaee inhibited experimental colitis , resulting in overall attenuation of inflammation dai , including colon length and body weight changes .
the effects of aaee were further confirmed by the h&e staining histological characterization in mouse acute colitis and colon tissue .
animals from this group showed a variety of clinical symptoms of ibd including diarrhea , bloody stool , and weight loss .
a disease activity index score was used as a reliable tool to assess the extent of the gastrointestinal disease in the dss - induced experimental colitis . at the end of the experimental period ,
our observations are in agreement with those reported in other studies using the dss - induced colitis model [ 2 , 26 ] .
however , mice treated with aaee ( 200 mg / kg ) significantly improved the clinical score , suggesting a protective effect of aaee in this model of colitis .
the histological scores indicate that treatment with aaee decreased mucosal damage characterized by loss of crypt glands and epithelium destruction and inhibited colon shortening as observed in the dss - alone group .
moreover , the alcian blue staining showed regular mucosal structure with goblet cells secreting mucus in the aaee + dss group , in stark contrast to the dss - treated mice .
this observation suggests that a. adstringens treatment may protect mice from dss - induced colitis by promoting mucus secretion .
oxidative stress is known to damage cellular macromolecules such as dna , lipids , and proteins . in the present study ,
the activity of enzyme antioxidants such as sod , cat , and gpx was decreased in dss - induced mice .
it has been proposed that an imbalance between prooxidant and antioxidant mechanisms may play an important role in the development of intestinal inflammation and mucosal tissue injury in colitis .
sod plays an important role in protecting cells from oxidative damage by converting o into h2o2 .
cat and gpx then transform the generated h2o2 into h2o , thus preventing the harmful effects of oxidative radicals and the initiation processes of lipid peroxidation .
it has been shown that sod , gpx , and cat levels are decreased in chemically induced colitis . in agreement with this , our results also revealed a decrease of sod , cat , and gpx activities in colonic mucosa of the inflamed control animals , while the levels of both sod and gpx were significantly increased in mice treated with aaee ( 200 mg / kg ) .
cat activity was slightly higher in the aaee + dss group than in the dss group , although the difference was not significant ; it has been reported that there is an increase in cat activity by administering natural products as treatments against uc and this appears to be due to the fact that cat has a lower affinity for that ros comparing to sod and gpx .
this result comes in concordance with many previous studies that reported that gpx plays a much greater role in the removal of h2o2 than cat [ 2931 ] .
therefore , our findings indicate that aaee treatment of colitis might be reducing the extent of colonic injury by its antioxidant ability . on the other hand , inflammatory responses play a critical role in the pathogenesis of uc .
the increased proinflammatory cytokines such as tnf- , ifn- , and il-1 amplify the inflammatory cascade and result in intestinal tissue damage in uc induced by dss . among those cytokines ,
adalimumab , a tnf- blocker , has been successfully used for the treatment of ibd patients in the clinic .
inhibition the action of il-1 can attenuate the severity of diarrhea and reduce infiltration of inflammatory cells into the intestinal tissue . in our study ,
the levels of tnf- , ifn- , and il-1 were remarkably reduced by aaee in dss - induced colitis mice , suggesting that the protective effect of aaee against colonic injury is related to the downregulation of tnf- , ifn- , and il-1. with respect to il-10 , this cytokine contributes to the differentiation of regulatory t cells ( treg ) , while suppressing dendritic cell - associated th1 and th17 immunity , as well as regulating inflammatory responses [ 36 , 37 ] .
however , the fact that il-10 levels did not show significant changes in our experiments is indicative that downmodulation of the inflammatory response by aaee treatment is not associated with il-10 levels and perhaps some of the compounds identified in our extracts of a. adstringens may act directly in the modulation of such inflammatory cytokines which are key to generate this disease
. it would be worth testing whether these extracts act by blocking some of the intracellular pathways associated with inflammatory responses such as the jak / stat pathway or nfkb activation .
the present study was specially focused on the effects of aaee on dss - induced colitis .
it is demonstrated here for the first time that oral administration of aaee effectively attenuates colonic inflammation in mice .
these results clearly demonstrate that , in a mouse model of colitis , body weight loss , dai , colon length , and histological score were significantly reduced after 10 days of aaee treatment ( 200 mg / kg day ) .
furthermore , aaee attenuated the dss - induced levels of tnf- , inf- , and il-1 and also increased the sod , cat , and gpx activities in colonic mucosa of mice treated with aaee .
these results give some clues about the compounds involved in the intestinal anti - inflammatory effect of the a. adstringens extract .
one of these mechanisms could be related to the well - known antioxidant properties ascribed to the majority of the plant extracts , due to their content in polyphenolic compounds , as it happens with the present extract that contains flavonoids , which has been reported to exert antioxidant properties [ 38 , 39 ] .
for example , the chemical structure of catechin consists of a polyphenolic ring condensed with six - member oxygen containing heterocyclic ring that carries another polyphenolic ring .
the 3,4 catechol structure on the polyphenolic ring is a potent scavenger of peroxyl , superoxide , and peroxy nitrite radicals .
the presence of hydroxyl groups in the structure also enhances the inhibition of lipid peroxidation [ 40 , 41 ] .
epigallocatechin-3-gallate ( egcg ) , a catechin of the green tea plant camellia sinensis , shows strong expanding beneficial effects in studies of diabetes , parkinson 's disease , alzheimer 's disease , stroke , inflammation , obesity , and cancer .
egcg exerts its antioxidant activity via decreasing no and malondialdehyde ( mda ) and increasing sod and ameliorates mucosal inflammation by inhibiting the production of tnf- , ifn- , and nf-b .
egcg reduces experimental colon injury by inhibiting macrophage chemotaxis toward n - formyl - l - leucyl - l - phenylalanine , thereby suppressing the mast cells and macrophage activities .
several studies revealed its pharmacological effects including antidiabetic , antiatherogenic , antidepressant , immunomodulatory , antitumor , hypolipidemic , antioxidant , and anti - inflammatory potentials .
naringenin abrogated experimental colitis by downregulating proinflammatory mediators like inos , icam-1 , monocyte chemoattractant protein-1 , cox-2 , tnf- , and il-6 .
it also decreased mucosal toll - like receptor 4 and nf-b p65 expression , thereby providing evidence for its potential in colitis . in another study ,
naringenin ameliorated dss - induced colitis by restoring the expression of tight junction proteins such as occludin , junctional adhesion molecule - a , and claudin-3 .
another important group of compounds present in the a. adstringens extract are the fatty acids ; they have been useful in numerous diseases like arthritis , diabetes , obesity , asthma , atherosclerosis , and cancer .
-linolenic acid has been reported to have cardiovascular - protective , anticancer , neuroprotective , antiosteoporotic , antioxidative , and anti - inflammatory effects . in a model of tnbs - induced colitis , supplementation of -linolenic acid in diet
it protected against colonic inflammation by reducing tnf- secretion , nf-b activation , ltb4 , and cox-2 expression . in another study ,
-linolenic acid decreased the expression of adhesion molecules like icam-1 , vcam-1 , and vegfr-2 , providing avenues for designing diets beneficial to ibd .
these phytochemicals compounds of aaee have been found to induce a wide spectrum of activities such as reduction in oxidative stress , suppression of inflammation , and cell proliferation and modulating numerous signal transduction pathways .
the findings of this study suggest that the extract of a. adstringens ( cuachalalate ) has substantial potential for the treatment of inflammatory colitis . | amphipterygium adstringens is an endemic species in mexico commonly known as cuachalalate .
healers to treat gastritis , gastric ulcers , and gastrointestinal cancer have traditionally used the bark .
we investigated the effects of alcoholic extract of a. adstringens ( aaee ) in dss - induced colitis in mice .
the protective effect of aaee was determined at 200 mg / kg by oral gavage for 10 days .
we determine the effect of aaee on clinical features ( disease activity index ) , antioxidants , anti - inflammatory , and immunomodulatory activities in relation to the activity of sod , cat , and gpx , levels of proinflammatory cytokines , and changes both macroscopic and microscopic of the colonic mucosa .
aaee significantly reduced the inflammation of colon and significantly increased sod and gpx activities .
aaee also significantly decreased tnf- , ifn- , and il-1 cytokine levels compared to dss - treated mice and reduced both infiltration of inflammatory cells and the mucosal damage in colon .
the results suggested the protective potential of aaee in dss - induced colitis and this might be attributed to its phytochemicals compounds that have been found to induce a wide spectrum of activities such as reduction in oxidative stress , suppression of inflammation , modulating numerous signal transduction pathways , and induction of apoptosis .
the findings of this study suggest that aaee has substantial potential for the treatment of inflammatory colitis . |
metastases of breast carcinoma are commonly found in the bone , liver , lungs and the brain .
gastrointestinal ( gi ) involvement is rare , with only few cases of such metastases reported in the literature .
invasive lobular carcinoma ( ilc ) accounts for 510% of invasive breast carcinomas . of the various histological subtypes it is more
although rare , colorectal metastases of ilc of the breast are a diagnostic challenge since they can simulate primary colon cancer or inflammatory bowel disease . often there may be a long disease - free interval and diagnosis therefore requires a high index of clinical suspicion .
here we report a case of metastases of lobular breast carcinoma in the terminal ileum ( ti ) and ileocaecal valve ( icv ) , associated with synchronous metastases to bones and the pleura , 19 years following treatment for primary breast carcinoma .
an 82-year - old female presented to the emergency department with a 48 h history of colicky central abdominal pain associated with vomiting and loose stools .
she also gave a 2 months ' history of unintentional weight loss of 12 kg .
she had a history of right breast ilc ( t3n1m0 ) which was treated 19 year previously with a modified radical mastectomy , axillary node clearance and adjuvant chemotherapy .
the tumour had been oestrogen receptor ( er ) and progesterone receptor ( pr ) positive and she had completed 5 years of adjuvant tamoxifen .
laboratory tests showed a mild normocytic anaemia ( haemoglobin count 11.2 g / dl ) and an elevated erythrocyte sedimentation rate count of 108 . computed tomography ( ct ) scanning revealed thickening of the wall of the caecum and suspicious lesions in the vertebrae and iliac bones .
a follow - up colonoscopy reported inflammation around the proximal caecal folds , icv and ti ( fig . 1 ) .
biopsies from the ti and icv confirmed adenocarcinoma with an infiltrative pattern being consistent with metastatic lobular carcinoma of the breast ( figs 24 ) .
this was further evaluated by immunohistopathology as demonstrating expression of er and cytokeratin 7 ( ck7 ) but negative for ck20 and e - cadherin .
findings from a subsequent staging ct scan showed a right basal pleural effusion , which upon cytological analysis was confirmed as metastatic lobular carcinoma .
nuclear medicine bone scans revealed extensive bone metastases involving the whole spine , skull , ribs , humeri and femur bones .
figure 1:colonoscopy views showing inflammation in the icv ( a ) and ti ( b ) .
figure 2:histology slide of tissue from the icv showing deposits of lobular breast carcinoma and infiltration of neutrophils into the surface epithelium and lamina propria .
colonoscopy views showing inflammation in the icv ( a ) and ti ( b ) .
histology slide of tissue from the icv showing deposits of lobular breast carcinoma and infiltration of neutrophils into the surface epithelium and lamina propria .
she was started on palliative hormonal therapy ( letrozole ) and denosumab with planned regular follow - up with the medical oncologists .
gi metastases from breast cancer are rare and can occur many years after the primary cancer .
borst and ingold in their study of 2604 cases of breast cancer over an 18-year period reported gi metastases in only 17 cases ( 0.7% ) .
. showed that gi metastases from primary breast carcinoma were as rare as 73 cases , with a mean interval from diagnosis of 7 years .
however , breast cancer is the second most common malignancy to metastasize to the gi tract , after malignant melanoma .
gi metastases occur more commonly in ilc than invasive ductal carcinoma and the reason for the variation in this metastatic pattern is not well understood . among gi metastases
the most commonly afflicted sites are the stomach and small intestine , with comparably fewer reports of dissemination to the colon and rectum .
our case study is the first to report metastases from ilc to the ti and icv with synchronous involvement of bones and the pleura .
our patient had presented with a short history of gi symptoms which could have suggested gastroenteritis as a likely diagnosis .
the 19-year interval between the primary diagnosis of breast cancer and occurrence of metastases would have made the diagnosis of bowel metastases unusual .
schwarz et al . reported a median interval between breast cancer and the gi metastases of 6 years ( range 0.2512.5 years ) and mclemore et al
our case demonstrates one of the longest time intervals between primary and gi metastatic disease reported in the literature .
furthermore , the inflammation around the ti during endoscopy made it difficult to differentiate its macroscopic appearance from inflammatory bowel disease .
colorectal metastases from lobular breast carcinoma can demonstrate nodular and cobblestone - like thickening of the mucosa that can mimic crohn 's disease .
additionally , metastatic lesions involving the colon may be difficult to differentiate from primary malignancies at these sites .
diagnosis of gi metastases in the context of present or previous breast cancer primarily requires a high degree of suspicion , particularly in patients with a history of lobular breast carcinoma .
endoscopic evaluation with tissue sampling for histological assessment will provide the final diagnosis that can be confirmed with immunohistopathology analysis . due to the relatively small number of reported cases
treatment usually comprises chemotherapy , endocrine therapy or both combined ; with remission being reported in 3258% of patients .
while palliative surgery was not shown to result in an increased overall survival , surgical intervention may be reserved for emergency presentations of perforation or haemorrhage in selected isolated lesions .
overall survival after diagnosis of gi metastases from a breast primary is poor with few patients surviving beyond 2 years , although reports of survival of up to 9 years have been published .
it therefore follows that any unusual gi symptoms present in a patient with a history of lobular carcinoma of the breast should be treated with a high index of suspicion .
written informed consent was obtained from the patient for publication of this case report and accompanying images .
| gastrointestinal ( gi ) metastases from primary breast carcinoma are rare but more common in invasive lobular carcinoma than invasive ductal carcinoma
. the symptoms may be non - specific and the presentation can occur many years after the initial primary breast carcinoma .
radiological and endoscopic findings can be difficult to distinguish from inflammatory bowel disease and primary carcinoma of the gi tract .
histological and immunohistopathology assessment will usually confirm the diagnosis of metastatic breast carcinoma .
we report the first case of lobular breast carcinoma metastasizing to the terminal ileum and ileocaecal valve 19 years following treatment for breast cancer in an 82-year - old woman .
staging investigations revealed synchronous metastases in bones and the pleura . a high index of suspicion and awareness of the potential long interval in the presentation of metastatic breast cancer help in making an accurate diagnosis and rapid clinical management . |
in addressing issues for translational medicine , we categorize the hurdles faced by our colleagues as follows :
therefore , it may behoove us to establish a common understanding of the definition of " translational medicine " to frame our expectations or frustrations . for most , " translational medicine " ( or " translational research " ) describes a uni - directional effort to test in humans novel therapeutic strategies developed through experimentation
this would suffice if animal or other experimental models were representative of human pathology , but this remains to be determined [ 8 - 10 ] . as well summarized by herbert slade 's : " there are no good animal models , but some are useful . " in addition , translational medicine may include the development of new devices or novel diagnostic tools . moreover , we suggested in a previous editorial that " translational medicine " is a two - way street where the drive to cure should be complemented by the pursuit to understand human diseases and their complexities .
thus , one important aspect of translational medicine is going back from the bedside to the laboratory with observations made in human studies .
this practice might be more constructive , focusing scientific thinking and providing more practical information .
mario sznol , a member of jtm editorial board , suggested that translational medicine should be defined as a discipline that encompasses : 1 .
investigations in humans which define the biology of disease and provide the scientific foundation for development of new or improved therapies for human disease 3 .
non - human or non - clinical studies conducted with the intent to advance therapies to the clinic or to develop principles for application of therapeutics to human disease 4 .
any clinical trial of a therapythat was initiated based on # 13 with any endpoint including toxicity and/or efficacy .
in addition , in the regulatory arena : 5 . translational research may be defined as appropriate product development for clinical use in various stages of investigational clinical trial .
for example , identity , purity and potency of a drug product must be studied during the early stages of the clinical trial .
however , these tests must be in place before implementing phase 3 trials as required by the regulations . establishing a definition of " translational medicine
currently , a large sector of the biopharmaceutical industry is devoted to the development of new therapeutic modalities .
however , industry is also concerned with the monitoring of ever - evolving therapeutic strategies by enhancing the quality , efficiency and throughput of available methods .
in addition , revolutionary progress in genomics , functional genomics and proteomics may result in the identification of new diagnostic and/or prognostic parameters and define therapeutic end - points based on novel surrogate markers relevant to disease progression and response to therapy [ 5,12 - 16 ] .
are public , government , academic and industry interests united in supporting this important direction of translational medicine ?
translational medicine covers a broad range of scientific , regulatory and clinical disciplines and there is no single organization currently in existence to embrace the field in its globality .
therefore , while scientific and clinical aspects related to individual fields can be addressed within the realm of specialized societies , other practical aspects often related to education , regulation , business and economic issues remain orphaned , with no focused outlet through which to address emerging issues .
an organization embracing the complexities of translational medicine should be considered with the goal of contributing information to all arenas of the need for translational efforts .
a translational medicine organization is particularly important in today 's era of federal budget constraints .
for example , most " standard " therapies for cancer do not affect survival , and billions of dollars are spent on drugs and therapeutic interventions that do not impact the natural history of most common diseases . should advocacy efforts seek to shift funds from other research areas to translational research ?
would it be savvier to join with other advocates of medical research to increase public and congressional awareness of the integrated need to understand basic as well as human biology ? and who should be responsible for such advocacy ?
the national institutes of health has recently staked a claim on this issue by defining a roadmap to accelerate medical discoveries to improve human health .
to be effective , barriers will only be removed by the collaborative efforts of multiple system stakeholders .
we confess to being baffled by some comments from reviewers solicited by the editorial board of jtm regarding some of the manuscripts submitted .
reviewers often dismiss some jtm submissions as not " hypothesis - driven " , not " mechanistic " , but " just " descriptive or discovery - driven .
such reviewers have often embraced solid hypotheses of their own to which they are strongly attached , like manzoni 's donna prassede who " in the matter of ideas followed the policy we are told we should follow with friends she had only a few , but she was strongly attached to them " . by their own admission , no objective evidence conclusively supports their hypotheses in the context of human disease , yet loyal they remain .
unfortunately , hypothesis - driven research alone can not meet the needs of translational medicine .
this is because hypotheses derived from complex experimental models often simply do not translate to human pathology .
thus , we suggested that discovery - driven research should be promoted in the context of translational medicine and should be better referred to as " reality - driven " research underlining the concept that direct human observation may direct to the study of hypotheses relevant to human reality .
few meetings are devoted primarily to bringing the two entities together to promote mutually beneficial exchange .
the paradigm between basic and clinical science has oftentimes put these two disciplines at odds with each other .
it is not in the interest of basic scientists to accept changes unless publishing and study section standards are realigned to reward clinical relevance .
clinical scientists for their part are often overwhelmed with information coming from the basic science community .
how can such a wealth of information be processed into a useful compendium that might contribute the understanding of human disease ?
furthermore , clinical scientists may be too distracted by the intensity of clinical care to be able to seriously help bridge this gap .
are clinical research grants providing sufficient support to academic clinicians to truly promote translational research ?
for instance , traditionally , r01 grants have been used to measure a scientist 's " independence " . however , such approach may distance newer basic or clinical investigators from the integrated approach often required for translational efforts
. should advocacy efforts voice the importance of more interdisciplinary grants ? confounding the whole picture is the fact that translational research is not pristine .
it is at once true that review standards for grant applications and publications need to account for this unavoidable " sloppiness " , and that clinical studies must be better designed prospectively to address biological questions beyond the routine assessment of safety and clinical efficacy .
this could be achieved by prospectively collecting biological material of broad scientific interest at time points relevant to the natural or treatment - induced history of a disease and applying modalities appropriate for the exploitation of modern scientific tools .
clinical scientists , particularly those not extensively and currently exposed to bench research , should receive special training to become at least informed of the ever growing scientific opportunities for translational research [ 19 - 23 ] .
there are few training programs that are ideally geared toward teaching all aspects of translational research .
although there are some attempts at developing clinical research training programs as evidenced by the nih initiative and the doris duke charitable foundation funding for medical students to spend one year engaged in clinical research programs , itis not clear that this will significantly impact the manpower shortage .
translational investigators must not only be familiar with the regulatory , statistical and administrative issues related to clinical investigation , but must also possess a highly specialized expertise in the basic science underlying the new technology or pharmacologic agents . at a time when there are more agents to test than ever before , it is problematic that medical schools and medical education programs are not ready to train physicians in translational research .
programs providing interested applicants with experience in both basic science and clinical investigation may be necessary to maintain a pool of competent translational researchers . furthermore , role models need to be developed for students and young investigators to begin to encourage the brightest students to enter this highly rewarding field .
however , several obstacles remain . for example , preclinical evidence is usually required despite its unclear relevance to human disease .
similarly , it remains unclear whether toxicity testing in animal models is relevant to humans , particularly when biological agents with strong species - specificity are considered . perhaps directly testing in humans , particularly for life threatening diseases
when standard therapies have failed , should be considered in a limited number of patients .
clinical trial designs for the early development of novel therapies could be simplified according to the anticipated biologic activity of the agent tested .
while biopharmaceutical companies employ contractors or staff to address and meet regulatory requirements as required by regulations and the law , many academic institutions do not provide appropriate regulatory support .
most translational research is supported by grants ; however , few provide funding for regulatory staff or consultation .
academic institutions do not provide support to non hypothesis driven research such as product development .
in addition , a grant application focused on translational research characterizing identity , purity , stability and potency is rarely funded . yet these characteristics are needed for advance testing of novel agents . by the time new therapies work their way through preclinical experimentation , clinical studies and phase iii studies
, they are often no longer state - of - the art and may even be scientifically obsolete .
therapeutic efficacy in the form of survival advantage remains a pre - requisite for regulatory approval of new therapies for cancer .
this requirement is a major financial burden for small industries since the long term costs of clinical testing have to be sustained without economic return .
this problem is compounded for tailored therapies such those directed against specific cancer mutations that target smaller market sizes while their development costs remain the same .
paradoxically , many currently accepted therapies are known to provide no statistically significant survival benefit yet they have both approval for distribution and coverage by insurance companies .
the national cancer institute leadership has recently put emphasis on " discovery , development and delivery " ( nci director 's report 2003 ) and , with the purpose of eliminating or reducing obstacles in translational research , the nci director 's office has appointed new deputies charged with streamlining the discovery to delivery process .
this strategy will hopefully yield results , at least in the context of cancer research , in a new modus operandi in clinical research where new agents could be quickly moved through the process and either approved or discarded .
obviously , regulatory problems are not only limited to the development and distribution of new therapeutics . institutional review boards and other internal review processes implement " ad hoc " rules to protect patients ' safety and privacy based on the well established principle of " primum non nuocere , i.e. do no harm " .
yet , it remains questionable as to whether this theoretical need to protect sufficiently balances the overwhelming desire of patients ' to attempt novel therapies when all other options are exhausted .
the current uni - directional paradigm of bench to bedside translational research is not cost - effective when one considers the long term expenditure of testing new drugs preclinically , obtaining regulatory approval for testing in humans and organizing increasingly larger clinical studies to demonstrate long - term clinical efficacy . how can small or medium biotechnology firms justify these costs ?
similarly , how can academic institutions seeking to translate ideas of their research faculty take the economical risk of supporting a promising clinical trial ? should the cost of clinical trials be partly covered by insurance ?
academic clinical centers currently have an incentive to re - try combination trials based on permutations of approved treatments .
real and effective academic translational research centers are slowly growing but they have to confront tremendous economic challenges since their funding continues to depend predominantly on industry , grants from federal and non federal agencies and philanthropy .
it may be possible to create a solvent system for translational research if the well - designed but standard biological studies are combined with already approved therapies .
for instance , interleukin-2 has been approved for the treatment of renal cell cancer and melanoma , yet the mechanism responsible for cancer rejection remains unknown .
centers could implement studies that generate revenue and provide material for biological studies while at the same time contribute to the support of novel experimental therapies .
the second hurdle is the translation of clinical studies into medical practice and health care policy . a third obstacle to effective
it is a fact that the available standard therapies for most common diseases are less efficacious than they are believed by the public to be and significant funds are allocated to maintain this " placebo " effect through standard care .
finally , it may be a mistake to think that basic science , without observations from the clinic and without epidemiological findings of possible associations between different noxes and disease , will efficiently produce the novel therapies that we are eager to test .
if we as a body can coordinate efforts by advocacy groups , academia and industry to educate the public and the government of the need for translational medicine , novel and effective therapies could be the significant result . in the upcoming translational research conference to be held september 2022 , 2004 in princeton ( for more information visit : ) we will be addressing these critical issues .
comments are welcome and should be directed to : or directly submitted to jtm at ) .
no official support or endorsement by the national institutes of health is intended or should be inferred .
we would like to thank most of the members of the editorial board who provided helpful suggestions for the preparation of this editorial and helped its revision .
in addition , we would like to thank elizabeth marincola , henriette ytting , wendy smith and other friends who took the time to read and comment on this manuscript . | when we launched the journal of translational medicine a few months ago , we were interested primarily in exploring scientific consideration of this discipline . however , as editors of jtm , we have been contacted almost daily to discuss the problems faced by scientists and clinicians around the world who are challenging the traditional boundaries of science and medicine . through these conversations
, we have learned that translational medicine is in fact " lost in translation , " inspiring much angst , many promises and some federal appropriations .
however , little has been done to substantively promote this important field .
authoritative reviews on the subject are available to the interested reader [ 1 - 7 ] . in this article , we will address jtm 's " constituency " to report what we 've learned about the obstacles to translational medicine from the myriad of phone conversations and e - mail interactions . |
atrial fibrillation ( af ) is the most common cardiac arrhythmia , affecting 1% of the general population and with its prevalence increasing with age .
most important , af has well - documented consequences as disabling symptoms , elevated stroke risk and major risk of congestive cardiac failure , being an independent predictor of death . in summary
, it represents a high cost on the health public systems of most developed countries .
surgeons were the first ones to treat af effectively and reverse it to sinus rhythm .
james cox described a series of surgical procedures known as cox - maze technique , between 1988 and 1991 , that crystallized in the cox - maze iii .
this surgical approach was directed to divide both right and left atria by a series of cuts and sutures to redirect the electrical impulse to close - end paths , to finalize atrial depolarization , and be ready for the next sinus node impulse .
this operation also included the exclusion of both atrial appendages and the isolation of the four pulmonary veins and the posterior wall of the left atrium .
although very effective , with over 91% patients maintaining sinus rhythm at 10 years , few surgical groups performed the cox - maze procedure due to the aggressiveness of it , with long suture lines and prolonged myocardial ischemic times [ 3 , 4 ] . in the last decade ,
three factors have changed the approach of surgeons to af : first , a better understanding of the electrophysiological basis of af . in 1998
, haissaguerre described that most patients with paroxysmal af have electric triggering zones localized within the antrum of the pulmonary veins , and that isolation of these areas was able to control af effectively .
however , later studies have demonstrated that pulmonary vein isolation alone was insufficient to control persistent or long - standing persistent af and that a maze approach is needed to be added in these patients .
also , multiple studies have shown better results when the maze procedure was applied biatrially , compared to when only the left atrium is approached .
the second factor has been the development of new surgical tools able to create a similar lesion set of the cox - maze procedure faster and less aggressively , but maintaining a consistent , transmural , and linear lesions .
initially , these were clamps or catheters delivering heat or cold , with microwave ultrasounds , radiofrequency , laser , or liquid nitrogen , and argon , respectively .
nowadays , cryotherapy , bipolar radiofrequency , and ultrasounds are the most used energy sources and are recognized as a useful treatment by the 2010 guidelines of the european society of cardiology ( esc ) together with the european association of cardiothoracic surgeons ( eacts ) and the european heart rhythm association ( ehra ) [ 7 , 8 ] .
finally , there has been increasing scientific evidence concerning cardiac surgeons of the deleterious effects of af in cardiac patients and the importance of treating this arrhythmia .
furthermore , patients with successful maze procedures have shown better long - term survival rates , higher freedom from stroke , and thromboembolic events , improved ventricular ejection fraction and exercise tolerance .
all the above factors have expanded the indications for the surgical treatment of concomitant af to most patients with coronary or valvular surgery . for patient with long - standing persistent af ,
the cox - maze procedure is still the gold standard treatment with the best results at 10- and 15-year followup .
the initial cox - maze iii operation ( cut - and - sew technique ) described by james cox consists in multiple biatrial lesions that interrupt the multiple reentrant circuits and redirects the sinus impulse to the atrioventricular node .
this technique has shown excellent results , with over 90% sinus rhythm restoration over 15 years , although the initial series included a large percentage of patients with paroxysmal af . when applied to long - standing af concomitant to valvular disease
, this technique has shown a 7580% success rates . as seen in figure 1(a ) , this operation includes several features .
first , it isolates all pulmonary veins and the posterior wall of the left atrium .
those are , in the left side , the mitral annulus and the left appendage , and , in the right side , the entrance of both the superior and inferior venae cavae , the tricuspid annulus and the right appendage .
third , the procedure finishes with the excision of right and left appendages , the later to avoid the main source of atrial thrombi .
the most important lines are the one connecting the pulmonary veins with the mitral annulus , to avoid left atrial flutter , and the line to the tricuspid annulus . as main setbacks of this operation , besides the need for long incisions that need to be sewed back prolonging myocardial ischemia and extracorporeal circulation times , between 45 minutes and 1 hour , were the need of pacemaker in 10% of patients , and a certain degree of chronic fluid retention in some patients , attributed to a lack of natriuretic peptide secretion induced by bilateral appendage amputation . nowadays ,
most surgeons apply different energy sources to perform the cox - maze procedure , then naming it cox - maze iv ( figure 1(b ) ) .
cryotherapy can be applied using liquid nitrogen or argon . to create effective lesions that block the electrical impulse ,
the temperature applied to the tissue must reach 60c or minus 65c during two minutes to create fibrosis .
instruments have been designed in the form of long clamps to create a consistent transmural lesion line without causing injury to surrounding tissues .
other energy types initially described , as microwave or monopolar radiofrequency , were abandoned due to lack of consistent transmural lesions or by increased risk of collateral injuries .
but , besides different instrumentation , the actual lesion pattern remains basically the one described by cox in 1991 , with few exceptions .
first , most surgeons avoid the atrial septal lesion , making this procedure no longer associated with a higher need of pacemaker implantation than what it is associated to whatever concomitant procedure is coupled with .
second , to avoid possible deficit of atrial natriuretic peptide production , only the left appendage is excluded .
the direct vision of the heart and the rapid creation of transmural lesions with these techniques add only 15 to 30 minutes to the surgical time .
surgeons tend to minimize the cut and sew lesions to the ones needed to access the atria , trying to perform the maximum number of lines with cold or heat therapies .
several techniques have been described to avoid coronary artery injuries when approaching the mitral and tricuspid annulus . when indicating a surgical therapy to af , factors influencing success rate must be foreseen .
these include atrial dilatation , age , years in af , and type of af ( paroxysmal , persistent , or long - standing persistent ) .
probably the most important is atrial dilatation , due to chronic af of by valvular dysfunction .
scientific evidence shows that cox - maze procedure is less effective when left atrial postero - anterior diameter reaches 60 mm , and even when effective , atrial electrical stimuli transport usually is impaired .
type of af is also an important condition for success rates . while pulmonary vein isolation has showed good results in patients with paroxysmal atrial fibrillation , persistent and long - standing persistent patients benefit from the complete biatrial lesion set in order to get sinus rhythm maintenance over 80% at 10 years
with the development of new energy sources for atrial fibrillation and a better knowledge of the pathophysiology of af , different surgical instruments have been created to allow a minimal invasive approach and effectively treat af without big thoracic incisions .
energy is applied epicardially through direct vision with clamps that allow long transmural lesions . moreover ,
epicardial ganglionic plexi around the pulmonary veins can be identified and ablated , and the left appendage excised or clipped to minimize thromboembolic events . in 2005 , wolf published a series of 27 patients with pulmonary vein ablation with epicardially applied bipolar radiofrequency and left appendage exclusion .
the sinus rhythm was restored in 91% of patients with previous paroxysmal af , without mortality and a low morbidity .
the procedure was performed through bilateral 5 cm thoracotomy incisions and video - thoracoscopy assistance . later on ,
this operation has evolved to a totally thoracoscopic technique , with three 1 cm incisions in each side . moreover ,
new connecting lesions from the right to the left superior veins and to the mitral annulus have been described to treat persistent af patients [ 14 , 15 ] .
these procedures have shown especially good results in patients with failed previous catheter ablation . in our series of 61 patients of pulmonary vein isolation with bipolar radiofrequency , postoperative sinus rhythm
was maintained in 82% paroxysmal , 60% persistent , and 20% long - standing persistent af patients at 12 months .
la size > 45 mm and af type showed to be preoperative factors that significantly influenced outcome .
the recent 2010 guidelines of the esc and eacts recommends , minimally invasive surgical ablation of af without concomitant cardiac surgery to patients with lone symptomatic af after failure of catheter ablation [ 7 , 8 ] .
with better knowledge of the physiopathology of af and easier access to energy sources that create consistent transmural lesions , surgery of atrial fibrillation has made a great impulse from the early days when cox first described his maze procedure .
concomitant surgical af treatment has shown better survival rate , higher freedom from stroke and thromboembolic events , better ventricular function , and better exercise tolerance .
still , success rates are lower in patients with long history of af , usually with enlarged atria , long - standing persistent af pattern , and older age .
probably , the alteration of the atrial substrate , with more fibrotic tissue and established macro - reentrant circuits may limit maze strategies in these patients . in addition , minimally invasive approaches have been described in the last five years with very good results for isolated paroxysmal or persistent af .
nevertheless , prospective randomized trials are necessary to confirm their long - term results , compared to catheter ablation . | surgery of atrial fibrillation ( af ) was first described in 1991 by james cox in what was named the cox - maze procedure , and over the years it has been considered the gold - standard treatment , with best results in maintaining sinus rhythm in the long term .
nevertheless , the complexity and aggressivity of the first techniques of cut - and - sew limited the application of this procedure , and few centers were dedicated to af surgery . in the past years , however , new devices able to ablate atrial tissue with cryotherapy , radiofrequency , or ultrasounds have facilitated this operation . in the mid - term , other energy devices with laser or microwave have been abandoned due to a lack of consistency in getting transmural lesions in a consistent and reproducible manner . additionally , better knowledge of the physiopathology of af , with
the importance of triggering zones around the pulmonary veins , has started new minimally invasive techniques to approach paroxysmal and persistent af patients through thoracoscopy . |
staphylococcus aureus could be considered a major cause of human diseases , particularly in the hospital setting .
it is one of the most feared pathogens because of its ability to cause overwhelming sepsis and death ( 1 ) .
methicillin - resistant staphylococcus aureus ( mrsa ) is a bacterial pathogen frequently isolated and presented in community and hospital environments ( 2 ) . since the first report of mrsa in 1961
, it has been considered an important pathogen in hospitalized patients that causes severe morbidity and mortality worldwide and is a major problem for public health and clinical settings ( 3 , 4 ) .
although hospital - acquired ( ha ) mrsa infections were initially reported in the 1980s , immediately after the introduction of methicillin in the hospital settings and they have continued to increase in last year s ( 5 ) .
the potential for ha infections increases when patients with unidentified community colonization are placed in healthcare - associated environments . in an active surveillance program ,
a patient is screened for carrying a selected organism , regardless of whether or not the patient is exhibiting signs and symptoms of infection at that time ( 6 ) .
the rate of nasal carriage of s. aureus isolates was found to vary from 10% to up 90% ( 7 - 9 ) .
methods such as polymerase chain reaction restriction fragment length polymorphism ( pcr - rflp ) typing are alternatives to more expensive techniques , such as pulsed - field gel electrophoresis ( pfge ) ( 9 ) .
pulsed - field gel electrophoresis is a labor - intensive and time - consuming technique and can be performed only in reference research laboratories with technically demanding but expensive than the present typing techniques such as coagulase gene restriction profile ( crp ) analysis and require only optimized and standard protocols ( 10 ) . a pcr - based typing systems , such as rep - pcr , pcr - rflp analysis of the coa and aroa gene would be appropriate for detection and typing of s. aureus isolates , because these are simple , inexpensive , rapid , reproducibility and easy in applicable settings and also ideal typing method for analysis of large numbers of methicillin - resistant staphylococcus aureus isolates in many outbreaks result from these organisms ( 11 ) .
s. aureus isolates can be confirmed with pcr amplification of the aroa gene ( 12 ) . on the other hand ,
coagulase ( coa ) gene typing has been used to identify and compare s. aureus genotypes , as it is a simple , specific , discriminatory , and reproducible method for the typing of s. aureus isolated from plain sources ( 13 , 14 ) .
the main objective of this study was to determine genotypes of mrsa strains isolated from the nares of hospitalized and community patients in kermanshah hospital , western iran , by pcr - rflp .
this cross - sectional study was conducted from october 2012 to august 2013 , in 1387 patients at the imam reza hospital , which is a major referral hospital in western iran with 514 tertiary care beds and 10 health wards , including emergency , pediatrics , internal medicine , intensive care unit ( icu ) infectious diseases , critical care unit , and pediatrics . in total , 1217 patients in different wards were screened more than 48 hour after admission for ha isolates , that is , for nosocomial infections defined as infections noted 48 hour after admission .
another 170 patients in the hemodialysis unit were screened for community - acquired isolates without gathering any admission history .
exclusion criteria for patient enrollment included the following items : antibiotic therapy in the previous week , hospitalization during the previous month , history of staphylococcus infections , and known immune deficiency . nasal samples ( n = 1387 )
( 8) . all swabs were transported in the amies medium and collected by the same researcher during the study .
each distinctive morphotype of the mannitol - fermenting colony was selected from the plate , subcultured on a blood agar plate ( merck , germany ) , and incubated at 37c in an incubator under humidified conditions .
s. aureus isolates were identified by standard phenotypic tests such as colonial morphology , coagulase production , and dnase and the api 20 staph test ( biomerieux , france ) .
mrsa was identified by the oxacillin strip test ( mast , uk ) ( 15 ) .
pcr for the aroa and coa genes and rflp for aroa were performed according to the method described by dastmalchi saei et al .
( table 1 ) , with minor modifications ( 16 ) . after optimizing pcr reactions for the amplification of the aroa gene ,
the reaction was carried out in a dna thermal cycler ( biorad c1000 , usa ) for obtaining a single amplicon with an anticipated size of 1153 bp .
each pcr reaction was carried out in a final volume of 50 l reaction containing 2 l of template dna , 0.5 mm of each primer , the four deoxynucleoside triphosphates ( each at 200 mm ) , pcr buffer 10 1.5 mm of mgcl2 , and 1.5 units of taqdna polymerase ( sinaclone , iran ) .
staphylococcus aureus atcc 25923 was used as the positive control for the aroa and coa genes and sterile water was used as the negative control .
amplified products were detected by electrophoresis at 60 v for 20 minutes and at 45 v for 70 minutes and photographed by gel doc ( bio - rad xr+ , hercules , ca , usa ) .
when the aroa gene was amplified , 10 l of the pcr product of this reaction was incubated with 16 l of sterile water , 3 l of 10 buffer , and 1 l ( 20 u/l ) of haeiii restriction enzyme ( fermentas , eu ) at 37c for 2.5 hours .
the digested pcr product was electrophoresed on a 1.5% agarose gel at 80 v for 60 minutes .
coagulase gene typing was performed as described by dastmalchi saei et al . with some modifications ( 16 ) .
the method is based on the heterogenicity of a region including tandem repeats with 81-bp size at the 3 end of the coa gene . after confirming the amplification of the variable region of the coa gene , 10 l of the pcr product of this gene was incubated with 16 l of sterile water , 3 l of 10 buffer , and 1 l ( 20 u/l ) of haeiii restriction enzyme ( fermentas , eu ) at 37c for 2.5 hour .
the digested pcr products were electrophoresed on a 1.5% agarose gel at 80 v for 60 minutes .
the products were stained with ethidium bromide and the images were obtained by a gel documentation ( biorad xr + , hercules , ca , usa ) system .
pcr for the aroa and coa genes and rflp for aroa were performed according to the method described by dastmalchi saei et al .
( table 1 ) , with minor modifications ( 16 ) . after optimizing pcr reactions for the amplification of the aroa gene ,
the reaction was carried out in a dna thermal cycler ( biorad c1000 , usa ) for obtaining a single amplicon with an anticipated size of 1153 bp .
each pcr reaction was carried out in a final volume of 50 l reaction containing 2 l of template dna , 0.5 mm of each primer , the four deoxynucleoside triphosphates ( each at 200 mm ) , pcr buffer 10 1.5 mm of mgcl2 , and 1.5 units of taqdna polymerase ( sinaclone , iran ) .
staphylococcus aureus atcc 25923 was used as the positive control for the aroa and coa genes and sterile water was used as the negative control .
amplified products were detected by electrophoresis at 60 v for 20 minutes and at 45 v for 70 minutes and photographed by gel doc ( bio - rad xr+ , hercules , ca , usa ) .
when the aroa gene was amplified , 10 l of the pcr product of this reaction was incubated with 16 l of sterile water , 3 l of 10 buffer , and 1 l ( 20 u/l ) of haeiii restriction enzyme ( fermentas , eu ) at 37c for 2.5 hours .
the digested pcr product was electrophoresed on a 1.5% agarose gel at 80 v for 60 minutes .
coagulase gene typing was performed as described by dastmalchi saei et al . with some modifications ( 16 ) .
the method is based on the heterogenicity of a region including tandem repeats with 81-bp size at the 3 end of the coa gene . after confirming the amplification of the variable region of the coa gene , 10 l of the pcr product of this gene was incubated with 16 l of sterile water , 3 l of 10 buffer , and 1 l ( 20 u/l ) of haeiii restriction enzyme ( fermentas , eu ) at 37c for 2.5 hour .
the digested pcr products were electrophoresed on a 1.5% agarose gel at 80 v for 60 minutes .
the products were stained with ethidium bromide and the images were obtained by a gel documentation ( biorad xr + , hercules , ca , usa ) system .
in this study , 258 s. aureus isolates were recovered from 1387 samples : 96 isolates were mrsa , which included 82 ha isolates and 14 community - acquired isolates .
the 96 isolates were collected from different wards : 6 ( 6.2% ) , icu ; 11 ( 11.5% ) , surgery ; 20 ( 20.8% ) , internal medicine ; 7 ( 7.3% ) , gynecology ; 5 ( 5.2% ) , infection ; 1 ( 1% ) , heart ; 21 ( 21.87% ) , pediatrics ; and 25 ( 26% ) , hemodialysis .
the aroa gene was successfully amplified in all mrsa isolates tested ( figure 1 ) .
in contrast , pcr amplification of coa produced bands of five different sizes , ranging from 490 bp to 810 bp ( figure 2 ) .
table 3 shows the genotype distribution of ha and community - acquired isolates , and table 4 lists the patterns seen within the different wards in our hospital .
table 3 also shows coa gene typing and pcr - rflp patterns detected using restriction enzyme alui .
lanes 3 - 7 : 490 bp , lane 2 : aroa gene pcr 1153 bp .
digestion : 850 and 300 bp , lane 4 : negative control . left to right lanes 1 and 8 : 100 bp dna ladder .
as the model pathogen , we selected mrsa because this multidrug - resistant nosocomial pathogen has previously been studied genetically worldwide ( 17 , 18 ) .
methicillin - resistant staphylococcus aureus isolates are suitable as the best model for investigating infection control and outbreak in hospitals and community ( 12 ) .
methicillin - resistant staphylococcus aureus is an increasingly common cause of nosocomial outbreaks with several morbidity and mortality worldwide , and more than 50% of all s. aureus diseases occurred in some part of hospitals .
another study reported that detection of hospital and community isolates of mrsa in nasal samples and their treatment may be an important modality in the prevention of infections by these isolates ( 19 , 20 ) . in this regard , molecular typing provides valuable information on the genetic background of mrsa isolates .
these techniques have been useful for differentiation of mrsa isolates and are further used as tools for epidemiological purposes ( 10 ) . in the present study , pcr products of five different sizes were obtained from amplification of the coa gene .
similarly , studies by other researchers in different parts of world ( 12 ) conducted using the same primer pairs also showed distinct coagulase gene types in some isolates .
this variation and polymorphism among some isolates of s. aureus is unclear , but some studies attribute it to the insertion or deletion mutations that occur at the 3 end of the coa gene ; these mutations change the coa gene size and also change the antigenic properties of the coagulase enzyme in serological tests .
this region of the coa gene may play an important role in the antigenic variation of coagulase and its escape from the inhibitory effect of anticoagulase agents ( 17 ) .
our results and those of other studies have shown that some specialized clones are responsible for the outbreak , most cases of mrsa nasal carriage , and skin colonization ( 16 , 21 ) .
the 3 end of the coa gene contains a series of tandem repeats 81-bp in size , which is distinctive among s. aureus isolates within their number or in the location of alui restriction sites .
the production of coa is important for the future of epidemiology typing and molecular identification of s. aureus ( 13 ) .
classification of s. aureus isolates based on the coa gene is a simple and accurate method for molecular typing ( 13 , 18 , 22 ) . detection and isolation of carriers is crucial for controlling the spread of nosocomial infection with mrsa isolates in a hospital setting . during nosocomial outbreaks , a rapid mrsa screening test based on molecular epidemiology typing
can be used for detecting the dna of epidemic strains in colonized sites of patients .
potential targets for genotyping of mrsa isolates based on the detection of conserved sequences include specific nucleotide sequences such as 81-bp tandem repeats in the 3 end of the coa gene , which is considered effective in identifying outbreaks . in this study , mrsa strains isolated in the different wards of the hospital were closely related when analyzed by aroa gene typing . in the present study , haeiii enzyme , which has been used in previous studies ( 23 , 24 ) for generating rflp patterns of the coa gene of s. aureus , did not digest all pcr products .
a possible reason for this finding might be alterations in the polymorphic repeated region of the coa gene because of point mutations ( 23 , 24 ) . as mentioned before , isolates with 740- and 650-bp pcr products were the predominant types , and interestingly all isolates with the 740- and 650-bp pcr products yielded the same rflp pattern , indicating no heterogeneity in haeiii recognition sites among this predominant type ( 25 ) .
aarestrup et al . reported that coa gene polymorphism is useful for classifying s. aureus strains ( 26 ) , because of its high typability , reproducibility , and good discriminatory power , and also because it can be used in epidemiological investigations and for molecular typing of s. aureus isolated from different origins ( 27 ) .
, in their study in northwest iran , observed that 58 s. aureus isolates from bovine mastitis were distributed over nine rflp different patterns with 490- to 850-bp fragments from digestion with haeiii enzyme ( 16 ) .
each of these patterns differed in frequency , with the highest frequency observed for pattern i ( 37% ) followed by pattern viii ( 24% ) .
colonization by a microorganism , an essential step leading to infection with that microorganism , may persist for months or years .
. nasal carriage of s. aureus is a substantial source of human infections in some wards of hospitals .
identifying patients colonized with mrsa during hospitalization and rapidly typing them with the methods presented in this paper may facilitate detection of outbreaks and prevention of the spread of the organism in hospitals .
our results showed that rflp types may differ between hospitalized and community patients in hospitals .
colonization by a microorganism , an essential step leading to infection with that microorganism , may persist for months or years .
nasal carriage of s. aureus is a substantial source of human infections in some wards of hospitals .
identifying patients colonized with mrsa during hospitalization and rapidly typing them with the methods presented in this paper may facilitate detection of outbreaks and prevention of the spread of the organism in hospitals .
our results showed that rflp types may differ between hospitalized and community patients in hospitals . | background : methicillin - resistant staphylococcus aureus ( mrsa ) is a bacterial pathogen frequently isolated in both hospital and community environments .
methicillin - resistant staphylococcus aureus is considered a major nosocomial pathogen that causes severe morbidity and mortality.objectives:the main objective of this study was to determine the genotypes of mrsa strains isolated from the nares of hospitalized and community patients in kermanshah hospital , western iran , by pcr - restriction fragment length polymorphism ( pcr - rflp).materials and methods : of 1387 patients , 1217 patients were screened for more than 48 hours after admission in hospital wards and 170 patients were screened in the hemodialysis unit of kermanshah hospital , which is the largest hospital in western iran .
s. aureus was identified by standard biochemical tests , including colonial morphology , production of coagulase , and dnase and the api20 staph test .
methicillin - resistant staphylococcus aureus was identified by the oxacillin strip test.results:in total , 258 s. aureus isolates were recovered from 1387 samples , of which 96 isolates were mrsa , 82 were hospital acquired , and 14 were community acquired .
digestion of the aro a gene revealed only one distinctive rflp pattern in the 258 isolates.conclusions:methicillin-resistant staphylococcus aureus is an increasingly common cause of nosocomial infections .
our results are in agreement with those of other studies reporting that a few specialized clones are responsible for most cases of mrsa nasal carriage . in this study ,
mrsa strains isolated from different wards of hospital were closely related when analyzed by coagulase gene typing .
identifying patients colonized with mrsa during hospitalization and rapidly typing them with these methods may facilitate detection of outbreaks and prevention of the spread of organisms in hospitals . |
as of january 2011 , peruvian migrants represent the largest latin american community in italy with 101,711 documented residents accounting for 2.9% of migrant population , corresponding to about 30% of latin americans in italy .
the number of peruvian citizens in italy has increased 30 folds since the early nineties .
the majority of them are young - adults ( 70% aged between 18 and 49 years ) and the female gender is slightly prevalent ( 61% ) . the large majority ( 70% )
are currently concentrated in few large metropolitan areas namely milan ( 33,919 documented residents ) , rome ( 15,262 ) , turin ( 10,872 ) , florence ( 7834 ) and genoa ( 3277 ) . in 2009
( the last year with official surveillance data available ) , 48.3% ( 2053 ) of tuberculosis ( tb ) cases in italy were diagnosed in foreign born subjects , with peruvians accounting for 5% of them ( 103 cases ) . in the health district of florence
( azienda sanitaria locale , asl 10 ) , the number of reported tb cases remained almost stable in the last 10 years with around 100 - 130 cases per year and an incidence of 10 - 14 cases per 100,000 populations .
nevertheless , in the same period , the number and the proportion of peruvian subjects diagnosed with tb in florence has steadily increased . starting from 2005 ,
peruvians represent the foreign community with highest tb burden in florence , accounting for about 20% of cases ( 22 out of 110 in 2009 and 25 out of 133 in 2010 ) .
the findings of a retrospective study aiming to understand the epidemiological dynamics of tb transmission in the peruvian community of florence are reported here .
main epidemiological and clinical features of tb cases notified in peruvian citizens resident in the asl 10 , in the period 2001 - 2010 were retrospectively collected from the databases of uf igiene e sanit pubblica , asl 10 zona firenze , florence , italy and sod microbiologia e virologia , centro di riferimento per i micobatteri della regione toscana , azienda ospedaliero universitaria careggi , florence , italy .
incidence of tb in the peruvian community of florence was estimated on the basis of number of tb cases notified each year in the asl 10 ( used as numerator ) and number of documented peruvian residents in the province of florence ( used as denominator ) .
available mycobacterium tuberculosis strains isolated were characterized by genotyping analysis with mycobacterial interspersed repetitive units - variable number tandem repeat ( miru - vntr-24 ) and spacer oligonucleotide typing ( spoligotyping ) .
clonally related strains were defined as clustered and assumed to belong to a chain of recent transmission , while patients whose m. tuberculosis isolate did not present a shared pattern were assumed to originate from reactivation of a latent tuberculosis infection ( ltbi ) . as this was a retrospective study on routinely collected surveillance data and on samples collected at the regional tb reference laboratory , ethical approval was not deemed necessary .
one hundred and thirty - eight tb cases were retrieved . among them , 119 ( 86% ) were microbiologically confirmed .
the number of reported cases steadily increased through the years , from 11 ( 8% ) in 2001 - 2002 to 47 ( 34.1% ) in 2009 - 2010 .
the estimated incidence rates varied , in the considered period , from 484 and 351 per 100,000 peruvian residents in florence .
eighty - seven m. tuberculosis strains were available for genotyping analysis ( figure 1 ) .
miru - vntr-24 analysis showed 48 strains ( 55.2% ) displaying a non - shared genotype , which were interpreted as originating from ltbi reactivation .
thirty nine ( 44.8% ) m. tuberculosis strains showed a genotype shared at least by another strain , fulfilling the definition of clustered cases .
three clusters included 2 subjects , 3 clusters included 3 subjects , 4 clusters included 4 subjects and 1 cluster included 6 subjects . in the majority of clusters ( 10 out of 12 )
the time elapsed between the diagnosis of the first and the last case was shorter than five years .
spoligotyping showed that the lineages circulating in the community were haarlem ( n=31 , 35.6% , 14 clustered and 17 non - clustered ) , latin american - mediterranean ( lam , n=28 , 32.1% , 12 clustered and 16 non - clustered ) , t - specific ( n=8 , 9.2% , 2 clustered and 6 non - clustered ) beijing ( n=5 , 5.7% , 4 clustered and 1 non - clustered ) , ural ( n=3 , 3.4% , all clustered ) , s ( n=1 , 1.1% ) .
eleven ( 12.6% , 4 clustered and 7 non - clustered ) previously unreported spoligotypes ( orphans ) were also present .
the study shows that tb in the peruvian community in florence is a concerning problem considering its high estimated incidence . in 2009 , the last year for which final data are available at national level ,
the estimated incidence of tb in peruvian born in italy ( 117 per 100,000 ) was very similar to the one reported for peruvian residents in peru ( 113 per 100,000 ) and much lower if compared with that found in this study ( 381 per 100,000 ) . supported by the finding of a high rate of clustered cases
, we can affirm that the higher tb incidence in peruvian residents in florence ( 3.2 time higher compared with incidence in the country of origin ) is related to an ongoing active transmission within the community . in the matter of facts , excluding one case for each cluster that should be considered the index case , the remaining clustered cases are due to recent infections occurred in florence .
a limitation of this study is that we considered in the analysis only m. tuberculosis strains isolated from peruvian individuals living in florence .
this greatly limit the possibility of inferring the origin of active tb ( new infection vs reactivation ) from cluster data . in other word , if a peruvian patients is not in a cluster with other peruvian patients , it is not possible to rule out that this patients was not part of a cluster in which the index case was a non - peruvian patient living in the same area , and thus to infer that tb in that patient was due to reactivation of a remotely acquired infection .
thus the number of patients in cluster should be regarded as a minimum estimate of cases due to recent infection .
peruvian origin has been previously identified as risk factors for tb clustering in a previous italian study carried out in milan .
another study conducted in the late nineties in milan evidence a 1.6 time higher tb incidence in peruvian migrants compared with tb incidence in peru . considering data obtained in the studies carried out in milan and in florence ,
peruvian migrant communities of both cities emerge as a vulnerable group which may benefit from targeted intervention and tb control activities .
strengthening of preventive intervention , such as early diagnosis of active tb cases and contact tracing procedures , should be prioritized for this population .
an easy access to tb services for the members of this communities should be assured , regardless of legal status of subjects .
collaboration between different partners such as public health services , primary care physicians , tertiary hospitals and non - for profit sector is warranted to achieve a timely diagnosis of tb and to ensure case holding of affected subjects .
socially and culturally acceptable education programs on tb with a multidisciplinary approach should be reinforced .
authors would also thank the cohemi project study group that includes : maurizio bonati ( a ) , chiara pandolfini ( a ) , francesca severino ( a ) , valeria confalonieri ( a ) , gianni tognoni ( a ) , zeno bisoffi ( b ) , dora buonfrate ( b ) , andrea angheben ( b ) , marco albonico ( b , c ) , alessandro bartoloni ( d ) , marianne strohmeyer ( d ) , lorenzo zammarchi ( d ) , filippo bartalesi ( e ) , jose muoz ( f ) , ana requena - mendez ( f ) , maria roura ( f ) , laia ventura ( f ) , robert pool ( g ) , christopher pell ( g ) , anita hardon ( g ) , peter chiodini ( j ) , juan moreira ( k ) , mariella anselmi ( k ) , roberto semprtegui ( k ) , eduardo gotuzzo ( l ) , maria alejandra mena ( l ) , carola liendo ( l ) , hctor h. garcia ( m ) , javier bustos ( m ) , saul santivaez ( m ) , faustino torrico ( n ) , daniel lozano ( n ) , teresa hinojosa cabrera ( o ) , javier ochoa morn ( o ) , ignacio abapori cuellar ( o ) , jaime amors suarez ( o ) , guido chumiray rojas ( o ) , alessandra nicoletti ( p ) , elisa bruno ( p ) . ( a ) department of public health , laboratory for mother and child health , mario negri pharmacological research institute , milan , italy .
b ) centre for tropical diseases , sacro cuore - don calabria hospital , negrar , verona , italy .
d ) infectious disease unit , department of experimental & clinical medicine , university of florence school of medicine , florence , italy .
e ) sod malattie infettive e tropicali , azienda ospedaliero - universitaria careggi , florence , italy .
f ) servicio de medicina tropical y salud internacional , centre de recerca en salut internacional de barcelona , hospital clnic - universitat de barcelona , barcelona , spain .
g ) centre for social science and global health , university of amsterdam , the netherlands .
j ) hospital for tropical diseases and london school of hygiene & tropical medicine , london , united kingdom .
l ) instituto de medicina tropical alexander von humboldt , universidad cayetano heredia , lima , peru .
m ) cysticercosis unit , instituto de ciencias neurologicas , department of microbiology , universidad peruana cayetano heredia , lima , peru . | tuberculosis is a leading cause of morbidity for peruvian migrants in florence , italy , where they account for about 20% of yearly diagnosed cases .
a retrospective study on cases notified in peruvian residents in florence in the period 2001 - 2010 was carried out and available mycobacterium tuberculosis strains were genotyped ( miru - vntr-24 and spoligotyping ) .
one hundred thirty eight cases were retrieved .
genotyping performed in 87 strains revealed that 39 ( 44.8% ) belonged to 12 clusters . assuming that in each cluster the transmission of tuberculosis from the index case took place in florence
, a large proportion of cases could be preventable by improving early diagnosis of contagious cases and contact tracing . |
erdheim - chester disease ( ecd ) is a rare non - langerhans cell histiocytosis that affects multiple organ and systems . since the first description by chester in 1930 ,
the disease is characterized by xanthogranulomatous infiltrates of foamy cd68/cd1a histiocytes usually surrounded by fibrosis .
the etiology and pathogenesis of ecd remain poorly understood and its classification as a tumoral or inflammatory disease is controversial .
a single patient may have a different combination of symptoms depending on the organs involved .
commonly involved sites are retro - orbital soft tissue , pituitary gland , lungs , and central nervous system , with manifestation ranging from diabetes insipidus to cerebellar or pyramidal syndromes , cognitive impairment and cranial nerve paralysis .
infiltration of the liver , spleen , thyroid , skin , conjunctiva , and false vocal cord may also occur .
the involvement of flat and long bones is almost universal and causes juxta - articular pain , mainly in the knees and ankles .
cardiovascular symptoms may also occur : they are mainly related to pericardial effusion , which bears a high risk of cardiac tamponade .
less commonly , myocardial infiltration may cause a typical pattern of pseudo - tumor , usually localized in the right heart .
kidneys may be involved in up to 30% of cases ; renal disease may be caused by a direct invasion of the renal sinus and parenchyma or by a distal ureteral obstruction . in some cases
, a periaortic infiltration extends to the renal vessels and spreads to the perirenal and hilar region of the kidneys , resulting in bilateral hydronephrosis or in renal artery compression , renovascular hypertension , and kidney ischemic injury , or in ureteral compression and bilateral hydronephrosis .
interestingly , both the vena cava and the pelvic ureters are usually unaffected , a feature that helps to distinguish ecd from retroperitoneal fibrosis .
kidney involvement is rarely symptomatic , but it may be progressive and lead to end - stage renal disease . prior to the introduction of interferon - alpha ( ifn ) , the mortality in patients with ecd was as high as 60% within 32 months from clinical diagnosis .
treatment with high - dose ifn improved prognosis in about 67% of patients , but myocardial , renal , pulmonary , or central nervous system complications remain a frequent cause of death . recently
, encouraging results have been reported with anakinra , the recombinant form of interleukin-1 ( il-1 ) receptor antagonist , , .
we report here the beneficial results of anakinra in an elderly patient affected by ecd with kidney , heart , and bone involvement .
a 76-year old man was admitted to our unit because of hypertension and renal function deterioration . his medical history was remarkable for chronic kidney disease with a baseline creatinine of 1.6 mg / dl ,
diabetes mellitus type 2 , transient ischemic attacks , coronary artery disease , and recurrent episodes of colicky pain due to kidney stones . at presentation , the patient complained of asthenia , permanent bone pain , dull chest pain , and dyspnea .
laboratory investigations showed : serum creatinine 2.6 mg / dl , phosphate 5.2 mg / dl , and glycated hemoglobin 7.2% .
all of the other tests , including complete blood count , electrolytes , and urinalysis , were normal .
urinary tract ultrasonography showed bilateral hydronephrosis with a stone measuring 10 mm in diameter in the right kidney .
contrast - enhanced computed tomography also revealed the presence of an extrapelvic fibrous tissue which extended up to the ureteral origin , determining a significant bilateral constriction and stretching of the renal pelvis , with retrodilation of the calyces .
the ureters were not dilated . at magnetic resonance imaging ( mri ) , the extrapelvic tissue signal was compatible with the presence of fibrous tissue ( fig .
1 ) . a laparotomy biopsy of the perirenal area showed a fibromuscular tissue diffusely infiltrated by foamy histiocytes , along with areas of steatonecrosis . on direct immunofluorescence , the histiocytes were cd68 and cd1a .
a cardiac mri showed pericardial effusion and a mass infiltrating the interatrial septum , which extended up to the junction of the cava veins .
the mass signal was not homogeneous , with punctiform nodulations , strongly suggesting a diagnosis of histiocytosis .
a diagnosis of ecd was made and treatment with subcutaneous pegylated ifn was started at a dose of 180 g / wk , which was afterwards reduced to 135 g / wk .
heart mri at 12 months showed reduction of the pericardial effusion and decrease of the right atrium wall thickening from 18 cm to 9 cm .
however , treatment was poorly tolerated because of weakness , edema , and hypotension . of more concern ,
ifn was withdrawn , and subcutaneous anakinra ( 100 mg / d , according to the technical schedule ) was started .
after 1 year of therapy , the symptoms improved , serum creatinine decreased to 2.0 mg / dl , and a follow - up ultrasound showed the absence of hydronephrosis .
after another year of follow - up , serum creatinine was still stable at around 2.0 mg / dl .
when the histiocytic xanthogranulomatous infiltrates invade the perirenal and hilar tissues , a number of consequences may occur , ranging from progressive parenchymal ischemia and renal artery stenosis to ureteral obstruction and hydronephrosis .
attempts to treat ecd have been based on glucocorticoids associated with bisphosphonates and/or cytotoxic drugs , or high - dose chemotherapy followed by peripheral autologous hematopoietic stem cell transplantation .
braiteh et al reported the first successful treatment with ifn in three patients with advanced ecd .
it has been suggested that ifn may activate cd40-ligand , a member of the tumor necrosis factor ( tnf ) superfamily which binds to cd40 on dendritic cells .
cd40-ligand accelerates the maturation of dendritic cells , and favors immune - mediated destruction of histiocytes .
moreover , ifn has an immunomodulatory effect and antiinflammatory action by reducing lesional histiocyte recruitment .
the efficacy of ifn depends on individual response and on the organs involved . in our patient
, ifn obtained an important reduction of myocardial pseudotumoral mass and pericardial effusion . however , renal function progressively deteriorated over time , with creatinine up to 3.9 mg / dl .
some authors reported that only high doses of ifn could obtain a significant improvement of symptoms in about 66% of patients , but half of them complained of side effects .
other investigators suggested that the initial dose of 3.06.010 units , three times / wk , given subcutaneously , may be safely reduced to 1.010 units in the long - term , to avoid side effects such as fatigue and flu - like syndrome .
however , in our patient , adverse events did not subside , even after dose adjustment .
previous studies in ecd patients reported increased levels of proinflammatory cytokines , such as il-1 and tnf. more recently , arnaud et al found a significant increase in plasma levels of il-6 , a proinflammatory cytokine induced by t helpher ( th)1 responses , along with an increase of il-12 , which favors the th1 pathway .
these data suggest that ecd is associated with a systemic immune th1-oriented disorder . in this
setting , novel therapeutic approaches may be based on drugs that prevent the biologic activity of proinflammatory cytokines , particularly il-1 .
anakinra is a recombinant , non - glycosylated form of human il-1 receptor antagonist ( il-1ra ) , which binds to il-1 membrane receptor and downregulates the biologic activities of il-1 , including inflammation .
this effect is similar to that exerted by ifn , which in fact increases the expression of il-1ra .
aouba et al first reported a significant reduction of il-1 ( a form expressed at the monocytes membrane surface after cell stimulation ) following treatment with 100 mg / d of anakinra , a finding that , along with clinical improvement , supported the hypothesis of il-1 as a primary actor in ecd systemic perturbation .
anakinra also showed important results in some ecd patients with skeletal and cardiac involvement . in all cases , a reduction of inflammatory markers , fever , and ecd symptoms
according to the technical schedule , anakinra should not be administered to patients with severe renal failure ( creatinine clearance < 30 ml / min/1.73 m ) and should be used with caution in geriatric patients . despite this
, we decided to use anakinra as a rescue therapy in our patient , because of the poor tolerance of ifn and the progressive deterioration of kidney function .
we closely monitored possible side effects related to drug administration , such as infections and neutropenia .
general conditions of the patient improved and plasma creatinine reduced from 3.9 mg / dl to 2.0 mg / dl . neither renal artery nor ureteral stenting were necessary to obtain this result . moreover , in contrast to ifn therapy , which caused severe side effects , anakinra was well tolerated with no side effects , even in the long - term . to the best of our knowledge , this is the first reported case of ecd with renal failure , unresponsive to ifn therapy , successfully treated with anakinra .
| erdheim - chester disease ( ecd ) is a rare non - langerhans cell histiocytosis characterized by infiltrates of lipid - laden cd68+/cd1a histiocytes , affecting heart , lungs , central nervous system , and bones .
kidney and adjacent structures can also be affected , leading to renal failure in about 30% of cases .
the diagnosis is challenging , and treatment is generally based on administration of interferon - alpha ( ifn ) , but preliminary results also showed the therapeutic efficacy of anakinra , an antagonist of the receptor of interleukin-1 ( il-1 ) .
we report the case of an elderly patient with ecd and severe involvement of the heart and kidneys who was successfully treated with anakinra . |
proteus syndrome is a hamartomatous disorder consisting of disproportionate , asymmetric overgrowth of body parts , malformations of the capillary , venous and lymphatic types , and dysregulated adipose tissue .
disproportionate overgrowth and giant hemangiomas have also been reported to involve the viscera such as spleen .
we hereby present a case of traumatic injury to a pathologic spleen in a patient of proteus syndrome .
the decision - making with regard to surgery or non - operative management in such unusual cases of splenic injury is complicated due to the possibility of pathology in spleen with high chances of bleeding .
a 20-year - old female , a known case of proteus syndrome , presented four days after fall from a bike .
she was referred to our level i trauma center after being managed non - operatively for three days at a different hospital in view of increasing abdominal distention and pain .
the exact details of the treatment given were not available . on admission in the emergency department ( ed ) ,
abdominal examination revealed significant distention with tenderness over the left hypochondrium without rebound tenderness or guarding .
the general physical examination was remarkable for the manifestations of proteus syndrome that included arteriovenous malformations and hemihypertrophy of her left leg with multiple lipomas over the abdomen [ figure 1 ] .
her hemoglobin was 2.9 g / dl with packed cell volume ( pcv ) of 12% , platelet count of 1,08,000 cells / cubic mm , and pt - inr of 1.29 .
ultrasonogram ( usg ) of the abdomen showed a moderately enlarged spleen with cystic reticulated appearance .
contrast - enhanced tomography ( cect ) of the abdomen showed a non - enhancing enlarged spleen of size 17 cm 15 cm 10 cm [ figure 2 ] , massive hemoperitoneum with normal liver and kidney with no leakage of the contrast . in view of low hemoglobin and possibility of
intra - operative findings included an enlarged spleen with 3 cm laceration along the lower pole and 2 liter of hemoperitoneum .
her injury severity score ( iss ) was 9 ( 3 for splenic injury ) .
pathological examination showed an enlarged spleen of size 17 cm 15 cm 10 cm with spongy cut surface , weighing 230 gm .
histological examination showed multiple vascular spaces lined by single flattened layer of endothelium filled with fibrin and red blood cells , suggesting a hemangiolymphangioma [ figure 3 ] .
she required 5 units of blood transfusion in the peri - operative period , and her hemoglobin increased to 8.7 gm% with a hematocrit of 30% , platelet count of 1,30,000 cells / cubic mm , and pt - inr of 1.20 .
she was discharged on the 5 post - operative day and is doing well at 6 months of follow - up .
disproportionate growth of toes with vascular malformations cect scan of the abdomen showing enlarged spleen h and e 400 showing multiple cystic spaces lined by flattened endothelial cells , filled with eosinophilic material and blood , separated by fibrous stroma , extensively replacing the splenic architecture
proteus syndrome , first described by cohen and hayden in 1979 , is a congenital dysplasia syndrome of patchy , irregular overgrowth of multiple body tissues and cell lineages arising from a mosaic mutation .
it was named by wiedemann et al . in 1983 after the greek god proteus who could change his form at will .
around 200 cases have only been reported worldwide till now . once thought to have neurofibromatosis , joseph merrick (
also known as the elephant man and studied by treves in the 1800s ) is now , in retrospect , thought by clinical experts to actually have had proteus syndrome .
common findings are hemihypertrophy , subcutaneous and visceral hamartomatous tumors , pigmented nevi and exostoses .
partial gigantism with limb or digital overgrowth is pathognomonic , with an unusual body habitus and , often , cerebriform thickening of the soles of the feet may be present .
the patient in our discussion had hemihypertrophy and vascular malformations over the left lower extremity with digital overgrowth and multiple lipomas over the abdomen .
kts is characterized by vascular malformations , unusual varicosities , and asymmetric enlargement of the limbs , whereas in proteus syndrome , vertebral , visceral malformations , and other malformations can occur independent of vascular malformations .
classical hemangiomas are often present at birth and regress spontaneously while in proteus syndrome , they appear after birth and grow gradually .
these vascular malformations are larger , softer , and more disseminated with histopathology showing variable portions of vascular , lymphatic , and organ tissue .
giant hemangiomas in spleen , causing kasabach - merritt syndrome and chronic dic have been reported in proteus syndrome .
spontaneous rupture is a risk with such large hemangiomas and occurs in about 25% of such cases .
magnetic resonance ( mr ) imaging is more sensitive and specific than other modalities in the diagnosis of splenic hemangioma . in our case , spleen was grossly enlarged with usg and ct scan showing multiple cystic spaces raising the possibility of vascular malformations .
non - operative management is currently being advocated in the management of splenic injury if the following criteria are satisfied- hemodynamic stability ( systolic blood pressure > 90 mmhg is generally accepted ) , blunt abdominal injury , absence of associated intestinal injuries , normal level of consciousness , and 24 hour availability of trauma surgeons . a case of non - operative management of splenic injury in a patient with proteus syndrome complicated with kasabach - merritt syndrome
has been reported where a 23-year - old male suffered a grade iii injury after a fall from a horse and was successfully managed with embolization of splenic artery . in our case ,
delayed splenic rupture could be one of the possible reasons for late deterioration . in view of enlarged spleen with cystic spaces raising suspicions of giant hemangiomas , progressively increasing abdominal distention with pain ,
two other cases of proteus syndrome involving pubic fractures and recurrent clavicular fractures following trauma have been reported .
we suggest that non - operative management ( nom ) should be abandoned , and operative management should be undertaken in splenic trauma if there is some pre - existing splenic pathology ( like in our case splenomegaly with possibility of splenic hemangioma ) along with evidence of hemorrhage or infarction of spleen or significant abdominal pain .
nom may still be tried in pathological spleen with trauma if the injury is minimal ( aast grade i injury ) with no significant hemorrhage , abdominal pain , and at no time , the patient had been under hemorrhagic shock / hypotension . | a 20-year - old female with proteus syndrome sustained splenic injury after fall from a bike . she was initially managed non - operatively at a different hospital for three days and was then referred to our level i trauma center in view of increasing abdominal pain and distention . on admission in the emergency department ( ed ) ,
her pulse rate was 120 per minute and blood pressure was 108/68 mm hg . clinical examination showed a distended abdomen with left hypochondrial pain .
ultrasonogram ( usg ) and computed tomography ( ct ) of the abdomen showed splenomegaly and grade iii splenic injury with significant hemoperitoneum . her hemoglobin was 2.9 g / dl with packed cell volume ( pcv ) of 12% . in view of low hemoglobin and possibility of
pathologic spleen , splenectomy was done .
microscopic examination of the spleen showed hemangiolymphangioma .
the patient was discharged on the 5th post - operative day and is doing well at 6 months of follow - up . |
the pathogenesis of iga nephropathy ( igan ) involves multiple hits [ 1 , 2 ] .
it is thought that increased levels of circulating galactose - deficient iga1 in association with the production of unique anti - glycan antibodies leads to the formation of pathogenic iga1 containing circulating immune complexes that are deposited within the mesangium leading to activation of mesangial cells and thus glomerular damage .
that complement components including c3 , c4d , c5b-9 , properdin , factor h , c4bp and mbl are deposited within the glomerulus in igan has been known for some time [ 35 ] .
in addition it has been shown that there are genetic susceptibility factors for igan that involve complement . a common deletion in the regulators of complement activation cluster at 1q32 , which incorporates the genes ( cfhr3 and cfhr1 ) encoding factor h - related protein 3 and 1 , has been shown to protect against igan , possibly by reducing the ability of complement factor h - related proteins to inhibit the regulatory function of cfh .
it thus seems possible that complement inhibition might be beneficial in the treatment of igan and in particular the crescentic form with rapidly progressive glomerulonephritis ( rpgn ) , which has a poor prognosis .
we report here the use of eculizumab in a young man with henoch schnlein purpura and crescentic igan .
a 16-year - old man was admitted in september 2013 with a 2-week history of mild abdominal pain , arthralgia and purpura on the lower extremities .
mol / l ( 1.08 g / dl ) and creatinine clearance 159 ml / min .
g / l but there was no evidence of oedema . since 2010 he had been treated with atomoxetine for attention deficit hyperactive disorder .
a diagnosis of henoch schnlein purpura was made and he was started on an angiotensin - converting enzyme inhibitor .
two months later he was readmitted with increasing creatinine of 98 mol / l ( 1.11 g / dl ) and declining serum albumin of 19
g / l . a biopsy ( figure 1a ) revealed epithelial crescents in 6 of 14 glomeruli , mesangial hyperplasia , endocapillary hypercellularity and deposition of both iga ( + + + + /4 + ) and c3 ( + + + /4 + ) on immunofluorescence ( m1 s0 e1 t0 according to oxford classification ) .
fig .
1.(a ) glomerulus with a cellular crescent in a first renal biopsy ; 20 , pas .
( b ) segmental glomerulosclerosis and atrophy of tubuli and fibrosis of interstitium in a second renal biopsy 11 months later , 20 , pas ( left ) and iga immunofluorescence ( right ) .
( a ) glomerulus with a cellular crescent in a first renal biopsy ; 20 , pas .
( b ) segmental glomerulosclerosis and atrophy of tubuli and fibrosis of interstitium in a second renal biopsy 11 months later , 20 , pas ( left ) and iga immunofluorescence ( right ) .
because of the rapid loss of renal function and the acute changes on biopsy with no evidence of chronic damage it was elected to treat him with prednisolone 40 mg daily and cyclophosphamide 100 mg ( 1.5 mg / kg ) .
he was , therefore , given three daily pulses of methylprednisolone 500 mg followed by five plasma exchanges ( 40 ml / kg ) .
this did not result in any improvement . as a last resort and without any direct proof of complement involvement we decided to treat with eculizumab .
four weekly doses of 900 mg were administered intravenously followed by a single dose of 1200 mg accompanied throughout by penicillin . immediately after the first dose of eculizumab
after 3 months cyclophosphamide was replaced with azathioprine and the dose of prednisolone was tapered .
a further renal biopsy ( figure 1b ) taken 11 months after presentation revealed chronicity with 2 of 19 glomeruli completely and 7 partially sclerosed , tubular and interstitial changes with 50% atrophy and fibrosis
. there was evidence of residual activity with a single glomerulus showing a cellular crescent . according to oxford classification
accordingly , renal function slowly declined to end - stage in spring 2015 with unabated nephrotic range proteinuria but consistently well - controlled blood pressure .
cd46 expression on peripheral blood mononuclear cells was normal and factor h autoantibody screening was negative .
mutation screening of cfh , cfi , cd46 , c3 and cfb showed no abnormalities .
multiplex ligation - dependent analysis ( mlpa ) showed no evidence of genomic disorders affecting cfh or cfhr1 - 5 .
kdigo guidelines recommend that steroids and cyclophosphamide be used to treat crescentic ( > 50% crescents ) igan [ 1012 ] with rpgn .
therefore , because of the possible involvement of complement in the pathogenesis of igan we elected to treat the patient with eculizumab as a last resort . with this there was a significant immediate improvement in renal function .
proteinuria , however , persisted and a repeat renal biopsy has shown evidence of chronicity . as with all anecdotal reports it is difficult to know whether the improvement in renal function can be ascribed to the intervention .
it is indeed possible that the effect of the massive therapy provided incidentally materialized at exactly the moment eculizumab was started .
there is , however , evidence emerging from other forms of glomerulonephritis that complement blockade may play a role in inducing remission in aggressive forms including crescentic dense deposit disease [ 1315 ] and lupus nephritis .
this is perhaps not surprising given that complement activation results in the generation of powerful inflammatory anaphylatoxins such as c5a .
macrohaematuria may cause acute kidney injury and persistent injury but one would then expect tubular injury rather than crescentic disease on biopsy . notwithstanding free haemoglobin could exacerbate the disease process by activating complement .
eculizumab was started when deterioration in renal function occurred despite treatment with mycophenolate mofetil and steroids .
the introduction of eculizumab was associated with temporary stabilization in renal function but the therapy was eventually withdrawn when a further renal biopsy showed severe chronicity .
these two cases suggest that the mechanisms underlying chronic progression may not be amenable to complement inhibition as we provided it .
recently it was shown that inhibiting c5ar resulted in more rapid amelioration of proteinuria than steroid in patients with anca - positive vasculitis .
following the comprehensive treatment in our patient , crescents improved , but nonetheless severe and progressive chronicity developed .
if this deterioration is the result of the initial severe crescentic disease , perhaps earlier treatment with eculizumab could improve the final outcome .
however , it is also possible that even if complement is involved in the causation of nephritis , either components proximal to the effect of eculizumab could be paramount or there is no direct relationship between initial inflammation and development of chronic scarring .
we were not able to accomplish that during the acute treatment of our desperately ill patient .
the patients concerned in this case report consented to its publication after seeing the final version .
rapidly progressive iga nephropathy : a form of vasculitis or a complement - mediated disease ?
clinical features of iga nephropathy with serum anca positivity : a retrospective case control study . | iga nephropathy ( igan ) is characterized by a variable clinical course and multifaceted pathophysiology .
there is substantial evidence to suggest that complement activation plays a pivotal role in the pathogenesis of the disease .
therefore , complement inhibition using the humanized anti - c5 monoclonal antibody eculizumab could be a rational treatment .
we report here a 16-year - old male with the vasculitic form of igan who failed to respond to aggressive conventional therapy including high - dose steroids , cyclophosphamide and plasma exchange and who was treated with four weekly doses of 900 mg eculizumab followed by a single dose of 1200 mg .
he responded rapidly to this treatment and has had a stable creatinine around 150 mol / l ( 1.67 mg / dl ) for > 6 months .
however , proteinuria was unabated on maximal conventional anti - proteinuric treatment , and a repeat renal biopsy 11 months after presentation revealed severe chronic changes .
we believe this case provides proof of principle that complement inhibition may be beneficial in igan but also that development of chronicity may be independent of complement . |
on a glass slide , freshly cut surface of the specimen is gently pressed , misrepresentation of the cell 's shape can be prevented by restricting a gliding movement . then the slide is stained with hematoxylin and eosin stain before that it is fixed with 95% of ethyl alcohol for 56 s.
however , it is extensively used in the diagnosis of benign and malignant lesions . in tumors such as meningiomas ,
imprint cytology provides good results without any difficulties in basal carcinomas of the skin . in the diagnosis of ovarian cancers ,
imprint cytology is used as a diagnostic tool in the study for assessing the salivary gland tumors such as mixed parotid tumors , pleomorphic adenoma and mucoepidermoid carcinoma .
the procedure for imprint cytology can be done even in underdeveloped infrastructure and deficient trained technician .
it provides an immediate result with minimal artifacts , it is cheaper and so it is most commonly used . a precise diagnosis is received through this technique .
tumors and well - differentiated tumors with dense fibrous stroma can not be interpreted through this method .
thus , imprint cytology plays a significant role in the quick diagnosis of the lesion .
cost effectiveness , rapid results and simplicity are the further criteria promoting it to be a better option when compared with other techniques such as frozen sections . | a valuable information on morphological details of the cell can be obtained through imprint cytology . though it has some pitfalls , it is still considered to be one of the best methods as it provides an excellent cytological clarity in fresh surgical specimens .
this article shares knowledge about the procedure , uses , advantages and disadvantages of imprint cytology . |
the clinical protocol was approved by the human research committees at massachusetts general hospital ( mgh ) and boston university .
, subjects were required to be aged 18 years , to have had type 1 diabetes for at least 1 year , and to have a stimulated c - peptide level in response to a mixed - meal tolerance test 0.1 nmol / l . the study cohort and the closed - loop experiments have been described previously ( 4 ) .
each subject participated in two separate 48-h experiments ( 96 h of data for each subject ) .
subjects were admitted to the mgh clinical research center wearing navigator , seven plus , and guardian sensors and transmitters , which were inserted the day before the study at 1500 h according to the respective manufacturers directions . upon admission ,
venous pg levels were measured every 15 min with the glucoscout ( international biomedical ) and confirmed hourly with a ysi 2300 stat plus analyzer ( ysi life sciences ) .
the three cgm devices were calibrated according to the manufacturers instructions , except that venous pg rather than capillary self - monitored bg ( smbg ) values were used for calibration . during each 48-h experiment , the navigator required one scheduled calibration , and the seven plus and guardian required four scheduled calibrations . beyond the usual scheduled calibrations ,
in addition , if the cgmg reading of any device did not meet the international organization for standardization standard for accuracy relative to pg at 0600 h daily , then a forced calibration of that device was performed ( see supplementary data for further details ) .
fully automated closed - loop bg control was initiated at 1500 h and ran continuously for 51 h ; the last 48 h of each experiment were included in this analysis .
six meals were provided during this period ; mean carbohydrate consumption was 78 12 g ( range 60117 ) per meal .
moderate exercise on a stationary bicycle began 25 h into the experiment and lasted 30 min .
the point accuracy of each cgm device is measured in terms of the relative difference ( rd ) , defined as [ ( cgmg pg)/pg ] , and the absolute relative difference ( ard ) , defined as [ ( cgmg pg)/pg ] .
negative rd values correspond to an underestimation and positive values to an overestimation of pg by the cgm device .
rd provides insight into the extent and direction of bias in the estimation of pg by a cgm device but is not as useful as the ard is in determining the average error across a set of data because of the cancelation that occurs when summing positive and negative rd values .
the 48-h mean ard ( mard ) relative to pg was calculated for each of the three cgm devices during the 48-h period from 1800 h at the beginning of the first day of each experiment to 1800 h at the end of the second day .
the mean and sd of the 48-h mard across the 12 experiments are shown in fig .
whereas the average of the 48-h mard characterizes the mean accuracy of a particular sensor session in a given experiment , the sd of this mard provides a precision metric of the variation around mean accuracy from one sensor session to another for each device .
in essence , the sd quantifies the consistency relative to the device s average performance that can be expected from one sensor to another for a given cgm device .
a : representative results from one of twelve 48-h closed - loop bg control experiments in one of six subjects showing venous pg concentrations measured every 15 min with the glucoscout ( red symbols ) and cgmg values measured approximately every 5 min with the navigator ( black symbols ) , seven plus ( blue symbols ) , and guardian ( green symbols ) .
one period of structured exercise at 1600 h ( 2 h before the fourth meal ) is indicated by a gray square .
listed in the legend for each cgm device is the number ( n ) of glucose values measured , the data reporting percentage ( in square brackets ) , and the mard averaged over the 48-h period , based on 194 , 171 , and 180 paired pg
b : the 48-h mards computed in each of the 12 experiments are shown for each sensor , with the mean and sd of each of those mards superimposed on the data for each device .
in addition to assessing point accuracy , we evaluated the rate - of - change accuracy of each of the three cgm devices .
reference rate - of - change data were obtained by taking the difference between two consecutive pg values and dividing by the sampling interval between those two pg measurements ( typically 15 min ) .
device reliability is measured with the data reporting percentage , defined as the ratio of the number of glucose values reported by the cgm receiver over the 48-h period relative to the total number possible for that period .
the seven plus , which has a rechargeable battery that did not have sufficient capacity to power the device for the entire experiment , was kept plugged into its charging device .
repeated - measurements models were used for within - subject repeated measurements on the differences between the paired measurements .
the clinical protocol was approved by the human research committees at massachusetts general hospital ( mgh ) and boston university .
, subjects were required to be aged 18 years , to have had type 1 diabetes for at least 1 year , and to have a stimulated c - peptide level in response to a mixed - meal tolerance test 0.1 nmol / l . the study cohort and the closed - loop experiments have been described previously ( 4 ) .
each subject participated in two separate 48-h experiments ( 96 h of data for each subject ) .
subjects were admitted to the mgh clinical research center wearing navigator , seven plus , and guardian sensors and transmitters , which were inserted the day before the study at 1500 h according to the respective manufacturers directions . upon admission ,
venous pg levels were measured every 15 min with the glucoscout ( international biomedical ) and confirmed hourly with a ysi 2300 stat plus analyzer ( ysi life sciences ) .
the three cgm devices were calibrated according to the manufacturers instructions , except that venous pg rather than capillary self - monitored bg ( smbg ) values were used for calibration . during each 48-h experiment , the navigator required one scheduled calibration , and the seven plus and guardian required four scheduled calibrations . beyond the usual scheduled calibrations ,
in addition , if the cgmg reading of any device did not meet the international organization for standardization standard for accuracy relative to pg at 0600 h daily , then a forced calibration of that device was performed ( see supplementary data for further details ) .
fully automated closed - loop bg control was initiated at 1500 h and ran continuously for 51 h ; the last 48 h of each experiment were included in this analysis .
six meals were provided during this period ; mean carbohydrate consumption was 78 12 g ( range 60117 ) per meal .
moderate exercise on a stationary bicycle began 25 h into the experiment and lasted 30 min .
the point accuracy of each cgm device is measured in terms of the relative difference ( rd ) , defined as [ ( cgmg pg)/pg ] , and the absolute relative difference ( ard ) , defined as [ ( cgmg pg)/pg ] .
negative rd values correspond to an underestimation and positive values to an overestimation of pg by the cgm device .
rd provides insight into the extent and direction of bias in the estimation of pg by a cgm device but is not as useful as the ard is in determining the average error across a set of data because of the cancelation that occurs when summing positive and negative rd values .
the 48-h mean ard ( mard ) relative to pg was calculated for each of the three cgm devices during the 48-h period from 1800 h at the beginning of the first day of each experiment to 1800 h at the end of the second day .
the mean and sd of the 48-h mard across the 12 experiments are shown in fig .
whereas the average of the 48-h mard characterizes the mean accuracy of a particular sensor session in a given experiment , the sd of this mard provides a precision metric of the variation around mean accuracy from one sensor session to another for each device .
in essence , the sd quantifies the consistency relative to the device s average performance that can be expected from one sensor to another for a given cgm device .
a : representative results from one of twelve 48-h closed - loop bg control experiments in one of six subjects showing venous pg concentrations measured every 15 min with the glucoscout ( red symbols ) and cgmg values measured approximately every 5 min with the navigator ( black symbols ) , seven plus ( blue symbols ) , and guardian ( green symbols ) .
one period of structured exercise at 1600 h ( 2 h before the fourth meal ) is indicated by a gray square .
listed in the legend for each cgm device is the number ( n ) of glucose values measured , the data reporting percentage ( in square brackets ) , and the mard averaged over the 48-h period , based on 194 , 171 , and 180 paired pg
b : the 48-h mards computed in each of the 12 experiments are shown for each sensor , with the mean and sd of each of those mards superimposed on the data for each device .
in addition to assessing point accuracy , we evaluated the rate - of - change accuracy of each of the three cgm devices .
reference rate - of - change data were obtained by taking the difference between two consecutive pg values and dividing by the sampling interval between those two pg measurements ( typically 15 min ) .
device reliability is measured with the data reporting percentage , defined as the ratio of the number of glucose values reported by the cgm receiver over the 48-h period relative to the total number possible for that period .
the seven plus , which has a rechargeable battery that did not have sufficient capacity to power the device for the entire experiment , was kept plugged into its charging device .
repeated - measurements models were used for within - subject repeated measurements on the differences between the paired measurements .
six subjects ( three men , three women ) each participated in two 51-h closed - loop bg control experiments .
subjects weighed 72 10 ( 5485 ) kg , were aged 52 14 ( 3372 ) years , and had type 1 diabetes for 32 14 ( 1750 ) years .
no additional navigator calibrations were performed other than the scheduled calibrations requested by the device ( corresponding to one calibration during the 2-day duration of each experiment ) ; the final 4142 h of each experiment were performed without any calibrations of the navigator .
the scheduled calibrations of the seven plus and guardian occurred approximately every 12 h ; therefore , four calibrations occurred during the 2-day duration of each experiment .
an average of 4.7 ( 46 ) calibrations per experiment were performed for the guardian ( see supplementary data for further details ) .
the 48-h mard for the navigator was 11.8 3.8% compared with 16.5 6.7% for the seven plus ( z = 2.05 , p = 0.040 ) and 20.2 6.8% for the guardian ( z = 3.14 , p = 0.002 ) .
the 48-h mards for the seven plus and guardian were not significantly different ( z = 1.17 , p = 0.240 ) .
the point accuracy for each cgm device is shown as clarke error grids in fig . 2 and as rd and ard distributions in fig .
3 . the aggregate mard across the 2,356 paired points obtained with the navigator was 11.8 11.1% compared with an aggregate mard of 16.5 17.8% for the 1,799 paired points obtained with the seven plus ( z = 1.62 , p = 0.110 vs. navigator ) , and 20.3 18.0% for the 2,328 paired points obtained with the guardian ( z = 3.07 , p = 0.002 vs. navigator ) .
the aggregate mards for the seven plus and guardian were not significantly different ( z = 1.31 , p = 0.190 ) . to put these mard values in perspective
, we calculated the maximum bound on the mards for each of the three devices by randomly shuffling the paired cgmg and pg values for each dataset and recalculating the mards ( see supplementary data for details ) .
this procedure yielded upper bounds on the mard of 41% for the navigator , 54% for the seven plus , and 47% for the guardian .
we estimate that the lower bound of the possible mard values would be 5.1% , the mard of the reference quality glucoscout device relative to the reference quality ysi stat plus glucose monitor when measuring the same sample .
clarke error grid analyses of venous plasma glucose ( pg ) measured by the glucoscout ( a ) , with venous bg measured by the ysi designated as the reference , and cgmg measured by the navigator ( b ) , the seven plus ( c ) , and the guardian ( d ) , with venous pg measured by the glucoscout designated as the reference . a : based on a total of 597 glucoscout
ysi glucose pairs , 98.3% of points fell in zone a and the remaining 1.7% fell in zone b. the slope and intercept of the linear least squares fit to these data ( solid red line ) were 1.02 and 2 mg / dl , respectively .
the mard was 5.1% between glucoscout pg and ysi bg ( after converting the latter to pg with a multiplicative factor of 1.12 ) .
b : based on a total of 2,356 navigator glucoscout pairs , the navigator achieved 80.6% of points in zone a , 18.3% in zone b , 0% in zone c , and 1.0% in zone d. the slope and intercept of the linear least squares fit to these data ( solid black line ) were 0.71 and 33 mg / dl , respectively .
the navigator achieved an overall data reporting percentage of 99.8% and a mard of 11.8 11.1% .
c : based on a total of 1,799 seven plus glucoscout pairs , the seven plus achieved 76.2% of points in zone a , 22.7% in zone b , 0.9% in zone c , and 0.1% in zone d. the slope and intercept of the linear least squares fit to these data ( solid blue line ) were 1.02 and 1 mg / dl , respectively .
the seven plus achieved an overall data reporting percentage of 76.2% and a mard of 16.5 17.8% .
d : based on a total of 2,328 guardian glucoscout pairs , the guardian achieved 63.7% of points in zone a , 33.2% in zone b , 0.3% in zone c , and 2.1% in zone d. the slope and intercept of the linear least squares fit to these data ( solid green line ) were 0.77 and 26 mg / dl , respectively .
the guardian achieved an overall data reporting percentage of 98.6% and a mard of 20.3 18.0% . a : distribution , as a function of pg , of the rd between each cgmg measurement and its corresponding pg value ( measured with the glucoscout ) for the navigator ( black ) , seven plus ( blue ) , and guardian ( green ) .
b : histograms in the pg rd plane for each of the datasets shown above in a. the horizontal line in each panel in a and the line in the pg rd plane in each panel in b correspond to the mrd for each of the three datasets .
c : distribution , as a function of pg , of the ard between each cgmg measurement and its corresponding pg value ( measured with the glucoscout ) for the navigator ( black ) , seven plus ( blue ) , and guardian ( green ) .
d : histograms in the pg ard plane for each of the datasets shown in c. the horizontal line in each panel in c and the line in the pg ard plane in each panel in d correspond to the mard for each of the three datasets .
note , it can be seen that the data in c and d are derivable by reflecting all negatively valued rd data that fall below the pg axis in a and b to their corresponding positive values above the pg axis .
the five largest bins for the navigator had frequencies of 96 , 103 , 105 , 85 , and 81 ( all between 0 and 7% ard ) corresponding with pg values of 9198 , 98105 , 105112 , 112119 , and 119126 mg / dl , respectively .
of the 2,356 data points , 940 ( 40% ) fell in the bins with 07% ard .
the five largest bins for the seven plus had frequencies of 46 , 48 , 46 , 43 ( all between 0 and 7% ard ) , and 44 ( between 7 and 14% ard ) corresponding with pg values of 98105 , 105112 , 112119 , 119126 , and 98105 mg / dl , respectively .
of the 1,795 data points , 565 ( 31.5% ) fell in the bins with 07% ard .
the five largest bins for the guardian had frequencies of 50 , 58 , 61 , 53 , and 56 ( all between 0 and 7% ard ) , corresponding with pg values of 9198 , 98105 , 105112 , 112119 , and 119126 mg / dl , respectively .
of the 2,324 data points , 569 ( 24.5% ) fell in the bins with 07% ard .
the rd distributions are shown in fig . 3a . in the case of the navigator
, 13 of 2,356 points had positive rd values > 50% ( range 51167% ) .
of these 13 points ( pg range 36135 mg / dl ) , 6 corresponded to pg values < 70 mg / dl , and all pg values < 76 mg / dl had positive rd values .
thus , the navigator consistently overestimated pg in the hypoglycemic range ; conversely , there were no negative navigator rd values > 50% ( 43% was the most negative rd value ) .
data in the hyperglycemic range accounted for the most negative rd values ; 92% of points with pg values > 250 mg / dl had negative rd values for the navigator .
thus , the navigator tends to underestimate pg in the hyperglycemic range . with the seven plus , 48 of 1,795 points had rd values > 50% ( 51247% ) , but these were distributed over a much broader range of pg values ( 36261 mg / dl ) than with the navigator .
the guardian had even more points ( 78 of 2,324 ) with rd values > 50% ( 50143% ) , and like the seven plus , these were distributed over a much broader range of pg values ( 49257 mg / dl ) than with the navigator .
like the navigator , the guardian also tended to underestimate pg in the hyperglycemic range , with 77% of pg values > 250 mg / dl having negative rd values .
this was not the case for the seven plus , where only 45% of pg values > 250 mg / dl had negative rd values , showing essentially no bias in the hyperglycemic range .
this lack of bias in the seven plus data is also evident in the near - unity slope ( 1.02 ) of the linear least squares fit ( fig .
the slopes of the linear least squares fit are 0.71 for the navigator and 0.77 for the guardian ( fig .
2b and d ) , which is consistent with the bias in those two devices to underestimate pg in the hyperglycemic range and , to a lesser extent , overestimate pg in the hypoglycemic range .
this bias in the navigator and guardian devices is further evident in the underestimation in the mean pg obtained from each device .
the mean pg across the 12 experiments as measured by the glucoscout was 158 20 mg / dl ; the navigator and guardian underestimated the mean pg by 13 mg / dl ( 145 17 , z = 3.78 , p = 0.0002 ) and 12 mg / dl ( 146 26 , z = 3.62 , p = 0.0003 ) , respectively , whereas the seven plus overestimated the mean pg by 5 mg / dl ( 163 24 , z = 2.67 , p = 0.0075 ) .
3a and c , particularly over the range of pg values between 80 and 160 mg / dl , it is instructive to collect the data into frequency bins in the pg rd plane of fig . 3a and in the pg ard plane of fig .
3d ) , respectively . for the bin sizes shown in fig . 3b and d ( which span 7% by 7 mg / dl in the pg rd and pg ard planes ) , the navigator had bins with the highest number of pg rd and pg ard pairs .
relative to the data obtained from the seven plus and guardian , the data obtained from the navigator are much more concentrated in the 07% error bins and show much less dispersion over the pg rd and pg ard planes ( fig .
3 ) , demonstrating graphically the greater accuracy and precision of navigator estimates of pg . when the mard is calculated for the clinically relevant pg ranges of 70120 , 120180 , and 180250 mg / dl ( fig .
4d ) , the navigator outperformed the other two devices in mard and sd of the mard .
its performance was relatively better in the 70 to 120 mg / dl range than in the 180 to 250 mg / dl range , but the seven plus and guardian each showed relatively similar performance across the three pg ranges , with the former outperforming the latter in a mean sense in all three .
c : the mard and sd in the mard corresponding to each pg value from 70 to 320 mg / dl for the navigator , seven plus , and guardian , respectively .
d : the mard and sd in the mard corresponding to the clinically relevant pg ranges from 70120 , 120180 , 180 250 , and 250 mg / dl for the navigator , seven plus , and guardian .
the number ( n ) of data in each pg range is shown in the corresponding bar for each device . for pg values in the normoglycemic range , from 70 to 120 mg / dl ,
the mards were 9.1 9.3% ( n = 899 ) , 16.5 17.8% ( n = 677 ) , and 20.0 19.9% ( n = 889 ) , for the navigator , seven plus , and guardian , respectively .
much less reliable , because of the small sample size obtained , are the data corresponding to pg values in the moderate - to - mild hypoglycemic range from 50 to 70 mg / dl ( not shown here ) ; in this range , the mards were 46 33% ( n = 14 ) , 31 25% ( n = 11 ) , and 36 40% ( n = 14 ) , for the navigator , seven plus , and guardian , respectively
. we also evaluated the time - rate - of - change accuracy for each of the three cgm devices .
rate - of - change measurements from the reference pg data yielded 1,699 slopes from the twelve 48-h experiments .
similarly , time - rate - of - change data corresponding to these 1,699 reference values were extracted from the cgm data .
the absolute value of the difference between the pg slopes and each of the corresponding cgm slopes was computed and averaged over the 1,699 paired slopes for all three cgm devices .
on average , the time - rate - of - change error ( relative to pg ) for the navigator was 0.66 0.96 mg / dl / min compared with 0.86 1.20 mg / dl / min for the seven plus ( z = 2.94 , p = 0.003 vs. navigator ) and 0.86 1.26 mg / dl / min for the guardian ( z = 2.60 , p = 0.009 vs. navigator ) . the time - rate - of - change errors for the seven plus and guardian were not significantly different ( z = 0.01 , p = 0.990 ) .
figure 5 shows , for each of the three cgm devices , the absolute value of the time - rate - of - change error sorted into eight bins , where each bin includes all paired points in a particular range of absolute values of the time rate of change in pg . the largest physiological rise and fall in pg that we observed over a 15-min interval was 8.1 and 7.3 mg / dl / min , respectively . the absolute value of the difference between the time rate of change in cgmg and the time rate of change in pg corresponding to eight different ranges in the absolute value of the time rate of change in pg ( 00.25 , 0.250.5 , 0.50.75 , 0.751 , 11.5 , 1.52 , 23 , and 3 mg / dl / min ) for the navigator , seven plus , and guardian .
the number ( n ) of data in each range is shown below the range label . when the mean and sd of all pg
ard pairs associated with a particular pg value were computed for each pg value between 70 and 320 mg / dl ( fig .
c ) , the average sd at each pg value was much smaller for the navigator ( 8.8 3.9 ) than for the seven plus ( 13.9 8.7 ) and the guardian ( 15.1 7.4 ) , indicative of higher precision of the navigator relative to the other two devices . occasionally , glucose values will be skipped during online operation of a cgm . when averaged across the 12 experiments , the data reporting percentages were 99.8 0.6% for the navigator , 75.9 20.7% for the seven plus , and 98.5 2.5% for the guardian .
data reporting percentages for the three cgm devices for each experiment are provided in the legends of supplementary figs .
no additional navigator calibrations were performed other than the scheduled calibrations requested by the device ( corresponding to one calibration during the 2-day duration of each experiment ) ; the final 4142 h of each experiment were performed without any calibrations of the navigator .
the scheduled calibrations of the seven plus and guardian occurred approximately every 12 h ; therefore , four calibrations occurred during the 2-day duration of each experiment .
an average of 4.7 ( 46 ) calibrations per experiment were performed for the guardian ( see supplementary data for further details ) .
the 48-h mard for the navigator was 11.8 3.8% compared with 16.5 6.7% for the seven plus ( z = 2.05 , p = 0.040 ) and 20.2 6.8% for the guardian ( z = 3.14 , p = 0.002 ) .
the 48-h mards for the seven plus and guardian were not significantly different ( z = 1.17 , p = 0.240 ) .
the point accuracy for each cgm device is shown as clarke error grids in fig . 2 and as rd and ard distributions in fig .
3 . the aggregate mard across the 2,356 paired points obtained with the navigator was 11.8 11.1% compared with an aggregate mard of 16.5 17.8% for the 1,799 paired points obtained with the seven plus ( z = 1.62 , p = 0.110 vs. navigator ) , and 20.3 18.0% for the 2,328 paired points obtained with the guardian ( z = 3.07 , p = 0.002 vs. navigator ) .
the aggregate mards for the seven plus and guardian were not significantly different ( z = 1.31 , p = 0.190 ) . to put these mard values in perspective
, we calculated the maximum bound on the mards for each of the three devices by randomly shuffling the paired cgmg and pg values for each dataset and recalculating the mards ( see supplementary data for details ) .
this procedure yielded upper bounds on the mard of 41% for the navigator , 54% for the seven plus , and 47% for the guardian .
we estimate that the lower bound of the possible mard values would be 5.1% , the mard of the reference quality glucoscout device relative to the reference quality ysi stat plus glucose monitor when measuring the same sample .
clarke error grid analyses of venous plasma glucose ( pg ) measured by the glucoscout ( a ) , with venous bg measured by the ysi designated as the reference , and cgmg measured by the navigator ( b ) , the seven plus ( c ) , and the guardian ( d ) , with venous pg measured by the glucoscout designated as the reference . a : based on a total of 597 glucoscout
ysi glucose pairs , 98.3% of points fell in zone a and the remaining 1.7% fell in zone b. the slope and intercept of the linear least squares fit to these data ( solid red line ) were 1.02 and 2 mg / dl , respectively .
the mard was 5.1% between glucoscout pg and ysi bg ( after converting the latter to pg with a multiplicative factor of 1.12 ) .
b : based on a total of 2,356 navigator glucoscout pairs , the navigator achieved 80.6% of points in zone a , 18.3% in zone b , 0% in zone c , and 1.0% in zone d. the slope and intercept of the linear least squares fit to these data ( solid black line ) were 0.71 and 33 mg / dl , respectively .
the navigator achieved an overall data reporting percentage of 99.8% and a mard of 11.8 11.1% .
c : based on a total of 1,799 seven plus glucoscout pairs , the seven plus achieved 76.2% of points in zone a , 22.7% in zone b , 0.9% in zone c , and 0.1% in zone d. the slope and intercept of the linear least squares fit to these data ( solid blue line ) were 1.02 and 1 mg / dl , respectively .
the seven plus achieved an overall data reporting percentage of 76.2% and a mard of 16.5 17.8% .
d : based on a total of 2,328 guardian glucoscout pairs , the guardian achieved 63.7% of points in zone a , 33.2% in zone b , 0.3% in zone c , and 2.1% in zone d. the slope and intercept of the linear least squares fit to these data ( solid green line ) were 0.77 and 26 mg / dl , respectively .
the guardian achieved an overall data reporting percentage of 98.6% and a mard of 20.3 18.0% . a : distribution , as a function of pg , of the rd between each cgmg measurement and its corresponding pg value ( measured with the glucoscout ) for the navigator ( black ) , seven plus ( blue ) , and guardian ( green ) .
b : histograms in the pg rd plane for each of the datasets shown above in a. the horizontal line in each panel in a and the line in the pg rd plane in each panel in b correspond to the mrd for each of the three datasets .
c : distribution , as a function of pg , of the ard between each cgmg measurement and its corresponding pg value ( measured with the glucoscout ) for the navigator ( black ) , seven plus ( blue ) , and guardian ( green ) .
d : histograms in the pg ard plane for each of the datasets shown in c. the horizontal line in each panel in c and the line in the pg ard plane in each panel in d correspond to the mard for each of the three datasets .
note , it can be seen that the data in c and d are derivable by reflecting all negatively valued rd data that fall below the pg axis in a and b to their corresponding positive values above the pg axis .
the five largest bins for the navigator had frequencies of 96 , 103 , 105 , 85 , and 81 ( all between 0 and 7% ard ) corresponding with pg values of 9198 , 98105 , 105112 , 112119 , and 119126 mg / dl , respectively .
of the 2,356 data points , 940 ( 40% ) fell in the bins with 07% ard .
the five largest bins for the seven plus had frequencies of 46 , 48 , 46 , 43 ( all between 0 and 7% ard ) , and 44 ( between 7 and 14% ard ) corresponding with pg values of 98105 , 105112 , 112119 , 119126 , and 98105 mg / dl , respectively .
of the 1,795 data points , 565 ( 31.5% ) fell in the bins with 07% ard .
the five largest bins for the guardian had frequencies of 50 , 58 , 61 , 53 , and 56 ( all between 0 and 7% ard ) , corresponding with pg values of 9198 , 98105 , 105112 , 112119 , and 119126 mg / dl , respectively .
of the 2,324 data points , 569 ( 24.5% ) fell in the bins with 07% ard .
the rd distributions are shown in fig . 3a . in the case of the navigator ,
of these 13 points ( pg range 36135 mg / dl ) , 6 corresponded to pg values < 70 mg / dl , and all pg values < 76 mg / dl had positive rd values .
thus , the navigator consistently overestimated pg in the hypoglycemic range ; conversely , there were no negative navigator rd values > 50% ( 43% was the most negative rd value ) .
data in the hyperglycemic range accounted for the most negative rd values ; 92% of points with pg values
thus , the navigator tends to underestimate pg in the hyperglycemic range . with the seven plus , 48 of 1,795 points had rd values > 50% ( 51247% ) , but these were distributed over a much broader range of pg values ( 36261 mg / dl ) than with the navigator .
the guardian had even more points ( 78 of 2,324 ) with rd values > 50% ( 50143% ) , and like the seven plus , these were distributed over a much broader range of pg values ( 49257 mg / dl ) than with the navigator .
like the navigator , the guardian also tended to underestimate pg in the hyperglycemic range , with 77% of pg values > 250 mg / dl having negative rd values .
this was not the case for the seven plus , where only 45% of pg values > 250 mg / dl had negative rd values , showing essentially no bias in the hyperglycemic range .
this lack of bias in the seven plus data is also evident in the near - unity slope ( 1.02 ) of the linear least squares fit ( fig .
the slopes of the linear least squares fit are 0.71 for the navigator and 0.77 for the guardian ( fig .
2b and d ) , which is consistent with the bias in those two devices to underestimate pg in the hyperglycemic range and , to a lesser extent , overestimate pg in the hypoglycemic range .
this bias in the navigator and guardian devices is further evident in the underestimation in the mean pg obtained from each device .
the mean pg across the 12 experiments as measured by the glucoscout was 158 20 mg / dl ; the navigator and guardian underestimated the mean pg by 13 mg / dl ( 145 17 , z = 3.78 , p = 0.0002 ) and 12 mg / dl ( 146 26 , z = 3.62 , p = 0.0003 ) , respectively , whereas the seven plus overestimated the mean pg by 5 mg / dl ( 163 24 , z = 2.67 , p = 0.0075 ) .
3a and c , particularly over the range of pg values between 80 and 160 mg / dl , it is instructive to collect the data into frequency bins in the pg rd plane of fig . 3a and in the pg
3d ) , respectively . for the bin sizes shown in fig . 3b and d ( which span 7% by 7 mg / dl in the pg rd and pg ard planes ) , the navigator had bins with the highest number of pg rd and pg ard pairs .
relative to the data obtained from the seven plus and guardian , the data obtained from the navigator are much more concentrated in the 07% error bins and show much less dispersion over the pg rd and pg ard planes ( fig .
3 ) , demonstrating graphically the greater accuracy and precision of navigator estimates of pg . when the mard is calculated for the clinically relevant pg ranges of 70120 , 120180 , and 180250 mg / dl ( fig .
4d ) , the navigator outperformed the other two devices in mard and sd of the mard .
its performance was relatively better in the 70 to 120 mg / dl range than in the 180 to 250 mg / dl range , but the seven plus and guardian each showed relatively similar performance across the three pg ranges , with the former outperforming the latter in a mean sense in all three .
c : the mard and sd in the mard corresponding to each pg value from 70 to 320 mg / dl for the navigator , seven plus , and guardian , respectively .
d : the mard and sd in the mard corresponding to the clinically relevant pg ranges from 70120 , 120180 , 180 250 , and 250 mg / dl for the navigator , seven plus , and guardian .
the number ( n ) of data in each pg range is shown in the corresponding bar for each device . for pg values in the normoglycemic range , from 70 to 120 mg / dl ,
the mards were 9.1 9.3% ( n = 899 ) , 16.5 17.8% ( n = 677 ) , and 20.0 19.9% ( n = 889 ) , for the navigator , seven plus , and guardian , respectively .
much less reliable , because of the small sample size obtained , are the data corresponding to pg values in the moderate - to - mild hypoglycemic range from 50 to 70 mg / dl ( not shown here ) ; in this range , the mards were 46 33% ( n = 14 ) , 31 25% ( n = 11 ) , and 36 40% ( n = 14 ) , for the navigator , seven plus , and guardian , respectively .
we also evaluated the time - rate - of - change accuracy for each of the three cgm devices .
rate - of - change measurements from the reference pg data yielded 1,699 slopes from the twelve 48-h experiments .
similarly , time - rate - of - change data corresponding to these 1,699 reference values were extracted from the cgm data .
the absolute value of the difference between the pg slopes and each of the corresponding cgm slopes was computed and averaged over the 1,699 paired slopes for all three cgm devices .
on average , the time - rate - of - change error ( relative to pg ) for the navigator was 0.66 0.96 mg / dl / min compared with 0.86 1.20 mg / dl / min for the seven plus ( z = 2.94 , p = 0.003 vs. navigator ) and 0.86 1.26 mg / dl / min for the guardian ( z = 2.60 , p = 0.009 vs. navigator ) . the time - rate - of - change errors for the seven plus and guardian were not significantly different ( z = 0.01 , p = 0.990 ) .
figure 5 shows , for each of the three cgm devices , the absolute value of the time - rate - of - change error sorted into eight bins , where each bin includes all paired points in a particular range of absolute values of the time rate of change in pg . the largest physiological rise and fall in pg that we observed over a 15-min interval was 8.1 and 7.3 mg / dl / min , respectively . the absolute value of the difference between the time rate of change in cgmg and the time rate of change in pg corresponding to eight different ranges in the absolute value of the time rate of change in pg ( 00.25 , 0.250.5 , 0.50.75 , 0.751 , 11.5 , 1.52 , 23 , and 3 mg / dl / min ) for the navigator , seven plus , and guardian . the number ( n ) of data in each range is shown below the range label .
ard pairs associated with a particular pg value were computed for each pg value between 70 and 320 mg / dl ( fig .
c ) , the average sd at each pg value was much smaller for the navigator ( 8.8 3.9 ) than for the seven plus ( 13.9 8.7 ) and the guardian ( 15.1 7.4 ) , indicative of higher precision of the navigator relative to the other two devices . occasionally , glucose values will be skipped during online operation of a cgm . when averaged across the 12 experiments , the data reporting percentages were 99.8 0.6% for the navigator , 75.9 20.7% for the seven plus , and 98.5 2.5% for the guardian .
data reporting percentages for the three cgm devices for each experiment are provided in the legends of supplementary figs .
results from this head - to - head - to - head analysis of three commercially available cgm devices worn simultaneously by each subject for 2 days under the same experimental conditions are in remarkably good agreement with the results of studies reported in the manufacturers own labeling . however , the direct comparison of the three cgm devices over a broad range of pg values is unique and , we think , compelling .
the manufacturers user guides for each of these devices report mards ( relative to ysi bg measurements ) of 12.8 13.6% for the navigator for 20,362 paired glucose values 20 mg / dl ( compared with 11.8 11.1% for 2,356 paired points in the current study ) , 16% for the seven plus for 1,827 paired glucose values between 40 and 400 mg / dl ( compared with 16.5 17.8% for 1,799 paired points in the current study ) , and 19.7 18.4% for the guardian for 3,941 paired glucose values 40 mg / dl ( compared with 20.3 18.0% for 2,328 paired points in the current study ) .
thus , the manufacturers labeling for point accuracy is consistent with our findings in a direct comparison study , despite inevitable differences in study populations and conditions between the different manufacturers studies .
the clinical utility of the cgm devices , especially when applied to closed - loop bg control , depends not only on device accuracy but also on reliability .
interruption in the glucose data stream under open - loop glucose management requires the user to revert to smbg therapy without trend information until data reporting resumes . under automated closed - loop bg control
of the three cgm devices studied here , only the seven plus seemed prone to gaps in data reporting .
another metric of reliability is precision , as measured by the variability around mean performance .
this was quantified here by the sd around the aggregate mean of all ard values and around the mean of ard values from each individual experiment from each cgm device .
the latter confers information about the variation in performance of a cgm device from one sensor session to another and may be a more clinically useful concept than the sd around the aggregate mean .
the navigator variability was approximately one - half that of the other two cgm devices for both metrics . in essentially every respect ( aggregate mard , mard per experiment , precision , distribution of relative errors in the pg
rd plane , rate - of - change errors , and data reporting frequency ) , the results of the current study point to the navigator as having the best performance in the normoglycemic and hyperglycemic range .
although the guardian had comparable performance to the navigator in data reporting frequency , it had numerically the worst performance for most of the metrics analyzed .
our conclusions about performance in the normoglycemic range are qualitatively and quantitatively different from those of a previous study that directly compared the accuracy of the navigator and guardian devices in the setting of a short - term glucose clamp study ( 3 ) .
that study concluded that the accuracy of the guardian and navigator was comparable in the normoglycemic range ( 3 ) .
all of their data were collected when the bg was clamped at 100 or 45 mg / dl , or during a slow transition ( at a rate of 1 mg / dl / min ) between these two bg values .
thus , no data were collected in the hyperglycemic range , and the effect of physiologic lag on accuracy was minimized by the negligible or low time rates of change in bg during the measurement period . in contrast , our data include many comparisons in the hyperglycemic range , and we sampled a much broader range of rates of change of bg ( up to 7 and + 8 mg / dl / min for short periods of time ) .
further , the number of paired bg - cgmg points in the normoglycemic range was at least threefold greater than in the study of kovatchev et al .
( 3 ) , and each experiment was much longer , allowing us to observe sensor inaccuracies associated with sensor drift , which is a common source of error for cgm devices . finally , the study of kovatchev et al . ( 3 ) did not show , as we did , the degree of variability in the accuracy of each sensor , a critical determinant of its reliability .
therefore , the results of our study are more informative regarding the suitability of each cgm device as the input sensor for closed - loop bg control .
one of the purposes of this head - to - head - to - head comparison study was to determine whether the seven plus and/or guardian could substitute for the navigator in closed - loop bg control . in the closed - loop experiments from which these data are derived ( 4 ) , the navigator served as the sole input to a fully autonomous system that successfully regulated bg continuously over a 2-day period
( average pg of 158 mg / dl , with pg < 70 mg / dl < 0.7% of the time ) ( 4 ) .
other closed - loop studies have used the seven plus or guardian and reported mards for those devices that were much better than the mards we found for those devices in this study and were comparable to the mard we found for the navigator ( 59 ) .
however , some of these studies report switching between multiple sensors based on reference data and/or calibrating sensors more frequently than recommended by the manufacturer ( on average every 46 h ) ( 79 ) , while the others report inserting two sensors on each subject ( 5,6 ) without providing details about when and if switching between sensors occurred .
high - frequency calibrations are impractical in outpatient usage , and switching between multiple sensors based on frequently sampled bg undermines system autonomy ; results of experiments using these strategies will not be representative of system performance in routine outpatient usage .
thus , it is not clear whether the seven plus or guardian devices are accurate or reliable enough to serve as the sole input to an autonomous closed - loop bg control system when calibrated at a practical clinical frequency and operating without the benefit of frequently sampled bg to monitor their accuracy . evidence that the seven plus or guardian devices may not meet this standard was apparent in several of the experiments conducted in this study .
there were repeated instances during which the seven plus and guardian devices showed aberrant behavior that would likely have led a control algorithm to severely underdose insulin on some occasions and to severely overdose on others .
there were three occasions each for the seven plus and guardian when the devices overestimated the subject s glucose by 70 mg / dl for a period of 15 h ( supplementary figs . 2 and 12 for the seven plus and supplementary figs . 1 and 12 for the guardian ) , which would have resulted in overdosing insulin .
conversely , we observed one occasion for the seven plus ( supplementary fig . 1 ) and seven for the guardian ( supplementary figs . 1 , 2 , 7 , 9 , and 10 ) when the devices failed to detect large postprandial glucose excursions around meals , and underdosing insulin would have resulted .
finally , we observed one occasion for the seven plus ( supplementary fig . 1 ) and three occasions for the guardian ( supplementary figs . 1 , 2 , and 6 )
when the devices falsely predicted severe hypoglycemia for 3 h. one of the limitations of our analysis was that the data were collected as part of a closed - loop study and , therefore , contained relatively few points < 70 and > 250 mg / dl .
glucose values were thus concentrated in a narrower range than typically arises in standard - of - care type 1 diabetes therapy . in particular ,
our data do not allow us to assess the accuracy of the three sensors in the hypoglycemic range ( bg < 70 mg / dl ) . when comparing the accuracy of the guardian and navigator , kovatchev et al .
however , that study censored data in the hypoglycemic range whenever the cgmg was at the low threshold for that cgm device and was not changing with respect to time ( 3 ) .
furthermore , different percentages of the data were censored for the two sensors ( 3 ) .
this approach undermines the applicability of their analysis to closed - loop control because a control decision must be rendered at each time step under closed loop .
another limitation of our work is that although the timing of calibrations was strictly followed according to the manufacturers specifications , the calibrations were done using reference - quality pg rather than capillary smbg measurements .
these factors could have led us to overestimate the accuracy of the cgm devices when used as a part of current standard - of - care therapy .
an additional limitation is that our dataset , although containing a large number of bg - cgmg pairs , was collected from 12 experiments in six subjects and therefore may not sample as much biological variability as a study in which fewer measurements were collected from each of a larger number of participants .
a post hoc analysis revealed that there was nearly as much variation in the accuracy ranking of the three cgm devices between experiments in a single subject as there was between subjects , suggesting that the results were not due to the chance inclusion of subjects who idiosyncratically were capable of achieving better performance with one sensor than another ( data not shown ) .
although the performance differences we observed between the seven plus and guardian are not as pronounced as between the navigator and seven plus , the seven plus demonstrates consistently better point accuracy and comparable rate - of - change accuracy compared with the guardian .
however , an evident disadvantage of the seven plus relative to the guardian lies in its lower data reporting frequency .
this weakness is less critical under open - loop than under closed - loop control . according to dexcom representatives , leaving the receiver device plugged in to its charger during the experiments
however , we observed that gaps in reporting were not randomly distributed but tended much more often to occur during times when the seven plus cgmg was changing rapidly ( typically > 2 mg / dl / min ) , suggesting that loss of reporting may be related to filters in the bg estimation algorithm .
the results of this head - to - head - to - head comparative effectiveness study reveal the navigator was the most accurate and precise of the current generation of cgm devices , followed by the seven plus and the guardian .
integration of the navigator into a truly autonomous closed - loop bg control system provides a demonstration of the clinical utility of the navigator in driving that system ( 4 ) .
combining those findings with results of the current study provides quantitative benchmarks for accuracy and reliability for a cgm device to serve as sole input for a closed - loop bg control system .
further study is required to determine whether the seven plus or guardian , calibrated according to manufacturer s directions , would be sufficiently accurate and reliable for effective closed - loop bg control in a clinical protocol that does not undermine the autonomy of the system by acting on the knowledge of frequently sampled pg values . in light of the results of our analysis , it is unfortunate that the manufacturer has recently withdrawn the navigator from the north american market .
we are currently using the same methodology described in this report to compare the performance of the next - generation navigator with the next - generation devices from dexcom and medtronic .
| objectiveto compare three continuous glucose monitoring ( cgm ) devices in subjects with type 1 diabetes under closed - loop blood glucose ( bg ) control.research design and methodssix subjects with type 1 diabetes ( age 52 14 years , diabetes duration 32 14 years ) each participated in two 51-h closed - loop bg control experiments in the hospital .
venous plasma glucose ( pg ) measurements ( glucoscout , international biomedical ) obtained every 15 min ( 2,360 values ) were paired in time with corresponding cgm glucose ( cgmg ) measurements obtained from three cgm devices , the navigator ( abbott diabetes care ) , the seven plus ( dexcom ) , and the guardian ( medtronic ) , worn simultaneously by each subject .
errors in paired pg cgmg measurements and data reporting percentages were obtained for each cgm device.resultsthe navigator had the best overall accuracy , with an aggregate mean absolute relative difference ( mard ) of all paired points of 11.8 11.1% and an average mard across all 12 experiments of 11.8 3.8% . the seven plus and guardian produced aggregate mards of all paired points of 16.5 17.8% and 20.3 18.0% , respectively , and average mards across all 12 experiments of 16.5 6.7% and 20.2 6.8% , respectively .
data reporting percentages , a measure of reliability , were 76% for the seven plus and nearly 100% for the navigator and guardian.conclusionsa comprehensive head - to - head - to - head comparison of three cgm devices for bg values from 36 to 563 mg / dl revealed marked differences in performance characteristics that include accuracy , precision , and reliability .
the navigator outperformed the other two in these areas . |
in our daily lives we are surrounded by animals and plants that belong to distinct and quite clearly demarcated species .
even little children know that dogs and cats , or apples and pears , are different , and so we come to expect that different species should look different .
yet there is no biological imperative dictating this . to paraphrase an eminent entomologist , the stripes on the legs of mosquitoes are not there for the taxonomist 's benefit to facilitate the identification of different species .
on the other hand , there may be striking phenotypic variations between individuals of the same species , as exemplified by dogs and other domestic species , that are considered to have no taxonomic relevance .
taxonomy is traditionally based on morphological differences , but identification of species by morphology is not without pitfalls .
biologists believe in the concept that ( eukaryote ) species are defined by the ability of individuals to mate and produce viable and fertile offspring . in practice , this is never actually put to the test in the majority of cases .
instead , a taxonomist with expert knowledge of the group of organisms , extrapolates from detailed information on a few species to make judgements on the group as a whole . the key taxonomic characters defining species will vary from group to group .
unfortunately , the biological species concept offers no guidance on the taxonomy of asexually reproducing organisms .
the difficulty arises in determining what level of similarity defines a species , and just how long ago the event took place that separated 2 lineages . just as with morphological characters , it takes expert knowledge of the extent of variation within and between known species in the group of organisms to make a judgement on what level of difference constitutes a new species . again
the key taxonomic characters ( genes ) used for each group of organisms may differ , and even when the same gene is used , for example the 18s ribosomal rna gene , different levels of variation may prove significant in defining species .
it is illuminating to compare taxonomic ideas for two subgenera of african tsetse - transmitted trypanosomes . in subgenus
how do these criteria compare to observed levels of genetic divergence ? for subgenus nannomonas , data from molecular characterisation studies are revealing a growing number of distinct genotypes .
it is generally accepted that subgenus trypanozoon is divided into 3 species : trypanosoma brucei , t. evansi and t. equiperdum , with t. brucei further subdivided into 3 subspecies defined by pathogenicity , distribution and host range .
bloodstream form trypanosomes of the 3 species are morphologically indistinguishable , save for the occurrence of short - stumpy forms in t. brucei .
confusingly , the trait of pleomorphism can be lost in laboratory isolates of t. brucei , and they then become indistinguishable from the monomorphic species , t. evansi and t. equiperdum . at the functional level pleomorphism
reflects the ability of t. brucei to develop in its vector , the tsetse fly , and this is in turn dependent on possession of a complete and functional set of genes for mitochondrial operation . the mitochondrial genome is contained in the maxicircle dna of the kinetoplast of t. brucei , together with the set of minicircle - encoded genes necessary for editing the maxicircle transcripts so they can be correctly translated .
these features define t. brucei , and their absence defines t. evansi and t. equiperdum ( table 1 ) .
neither t. evansi or t. equiperdum is cyclically transmitted by tsetse ( although tsetse potentially could transmit t. evansi mechanically ) , and indeed , neither species is capable of cyclical development .
t. evansi lacks a mitochondrial genome and its kinetoplast contains only a homogeneous set of minicircles .
one chinese strain of t. equiperdum had maxicircles just over half the size of those of t. brucei and homogeneous minicircles like t. evansi .
two other laboratory strains of t. equiperdum also had homogeneous minicircles ; one had full - size and one reduced size maxicircles .
examination of nuclear dna polymorphisms by isoenzymes , rflp , karyotype , minisatellite or phylogenetic analysis has shown no obvious differences between t. evansi , t. equiperdum and t. brucei [ 2,5 - 8 ] characteristics of species within subgenus trypanozoon see text for explanation . in a sense then , t. evansi and t. equiperdum can both be regarded as natural mutants of t. brucei .
arguably yes , because both satisfy the biological species definition above of non - interbreeding populations .
since genetic exchange in t. brucei takes place during cyclical development in the tsetse fly , this excludes participation of either t. evansi or t. equiperdum .
trypanosoma brucei consists of 3 morphologically indistinguishable subspecies , all of which started as full species .
the demotion to subspecies came about after recognition that the biological differences between the 3 species were not that significant and could mostly be explained by host range variation and geographical distribution ( table 2 ) .
molecular evidence has not changed that view for t. b. brucei and t. b. rhodesiense .
these 2 subspecies share the same range of genetic polymorphisms [ 8,10 - 13 ] and have been demonstrated to interbreed in the laboratory .
most compellingly , it has now been demonstrated that t. b. brucei and t. b. rhodesiense can differ by as little as the expression of a single gene [ 15 - 17 ] .
in fact there is a greater level of genetic variation between different t. b. brucei isolates than between t. b. brucei and t. b. rhodesiense .
characteristics of subspecies and subgroups within trypanosoma brucei see text for explanation the majority of t. b. gambiense isolates form a homogeneous group ( group 1 ) that stands apart from the rest of the t. brucei group , because of its restricted range of genetic polymorphisms and limited antigenic repertoire [ 20 - 24 ] .
it is clear that there is a much greater genetic distance between t. b. gambiense group 1 and other t. brucei subspecies than between t. b. brucei and t. b. rhodesiense .
t. b. gambiense group 1 conforms to the classical concept of t. b. gambiense as a slow growing parasite in experimental rodents in contrast to the typically fast growing t. b. brucei / t .
if t. b. gambiense group 1 is genetically isolated , there may be a case for reinstating it as the species t. gambiense .
importantly , can t. b. gambiense group 1 undergo genetic exchange with t. b. brucei ?
these experiments are not easy , because t. b. gambiense group 1 is not readily transmitted through the morsitans group flies , which are commonly kept as laboratory colonies .
it is unlikely that t. b. gambiense group 2 isolates represent genetic hybrids of t. b. gambiense group 1 and t. b. brucei , although they have the human infectivity of the former and the virulence and fly transmissibility of the latter .
t. b. gambiense group 2 isolates shared only a single microsatellite marker with sympatric group 1 isolates . t. b. gambiense groups 1 and 2 are also unlikely to have the same mechanism of human serum resistance . we know that neither group possesses the sra gene , which confers human infectivity on t. b. rhodesiense , but whereas t. b. gambiense group 1 shows solid resistance to human serum , human serum resistance in t. b. gambiense group 2 varies with parasite passage as in t. b. rhodesiense
we already know that t. b. gambiense group 1 isolates have a restricted range of genetic polymorphisms and the smallest genomes within the t. brucei species complex .
perhaps a genome - wide comparison of t. b. gambiense group 1 and t. b. brucei will provide an answer .
trypanosomes of subgenus nannomonas are defined by their developmental cycle in the tsetse fly , which involves the midgut and proboscis . as bloodstream forms these trypanosomes are the smallest of the salivaria , but there is considerable morphological variation , both in dimensions ( length and maximum width ) , and in features such as body shape , prominence of the undulating membrane and presence of a free flagellum .
coupled with variation in host range and pathogenicity , this morphological variation led to the description of many species and variants in the past .
however , these fine distinctions were later disregarded and traditionally subgenus nannomonas is split into 2 species : trypanosoma congolense , which has a wide range of ungulate hosts , and t. simiae , for which pigs are regarded as the most important host .
this simplifies clinical diagnosis : if you find a small trypanosome in the blood of a sick ox , goat or sheep , it will be t. congolense , while in pigs with acute trypanosomiasis it will be t. simiae .
a number of hitherto cryptic subgroups have been discovered by molecular characterisation during the past 20 years or so .
only one of these has been described in sufficient detail to warrant acceptance as a new species , t. godfreyi .
molecular characterisation reveals that t. congolense is divided into 3 subgroups , savannah , forest and kilifi ( or kenya coast ) , while the t. simiae group comprises t. simiae and t. simiae tsavo ( table 3 ) [ 29 - 35 ] .
each subgroup possesses a unique satellite dna sequence , and these sequences have been exploited for the development of specific dna probes and pcr tests [ 36 - 39 ] .
the ability to identify these subgroups accurately opens the way for systematic studies of their host range , distribution , pathogenicity , etc .
the satellite dna repeats are sensitive tools for identification , because they are highly reiterated in the genome , forming the bulk of the minichromosomes .
this suggests either that the satellite repeats evolve very rapidly in subgenus nannomonas compared to subgenus trypanozoon , or that divergence between subgroups in subgenus nannomonas is greater than that between subdivisions in subgenus trypanozoon .
see text for explanation few attempts have been made to assess the level of genetic divergence within subgenus nannomonas .
total dna hybridisation showed that t. congolense savannah and kilifi subgroups were only distantly related compared to species within subgenus trypanozoon .
a survey of nuclear and kinetoplast dna polymorphisms in 5 species / subgroups ( t. congolense savannah , forest and kilifi , t. simiae , t. godfreyi ) revealed differences in the size of miniexon repeats and kdna minicircles and maxicircles ( table 3 ) . in this study , the most closely related trypanosomes were t. congolense savannah and forest , which share 71% similarity in satellite dna sequence compared to an average 4045% similiarity in the rest of the subgenus .
the t. congolense kilifi subgroup was as divergent from other t. congolense subgroups as from t. simiae or t. godfreyi .
the gene for the major surface glycoprotein , glutamate and alanine rich protein or garp , is well conserved among t. congolense subgroups ; the amino acid sequences of t. congolense savannah and forest strains differed by 45% , compared to about 16% from kilifi subgroup .
more divergent garp genes have also been identified in t. simiae and t. godfreyi . in agreement with the variation seen in garp genes , phylogenetic analysis based on the 18s ribosomal rna gene divides subgenus nannomonas into 2 major clades : ( 1 ) t. congolense savannah , forest and kilifi subgroups , ( 2 ) t. simiae , t. godfreyi and t. simiae tsavo ( previously designated t. congolense tsavo .
the absolute nucleotide differences between 18s ribosomal rna genes in subgenus nannomonas are larger than those in subgenus trypanozoon . in summary , there is compelling molecular evidence of far greater levels of genetic divergence within subgenus nannomonas compared to subgenus trypanozoon . however , biological criteria to support these " molecular taxa " are scarce .
the inability of several of these trypanosomes to grow in experimental rodents has precluded the isolation of bloodstream forms from mammalian hosts or tsetse mouthparts in the field , so host range and distribution data are incomplete ( table 3 ) .
the use of pcr identification of tsetse infections has led to recognition that some of these new genotypes are extremely widespread and prevalent in the field , e.g. [ 47 - 51 ] .
are these various genotypes responsible for assumed " strain " differences in drug response , virulence or fly transmission dynamics ? can these new genotypes be correlated with the old morphological criteria and species designations ?
we really need the biology to catch up with the molecular taxonomy to answer these questions .
there is no consistency in the way species and subspecies names are applied in subgenera trypanozoon and nannomonas . in subgenus
trypanozoon the taxonomic importance of pathogenicity , host range and distribution appear to have been inflated relative to actual levels of genetic divergence .
taking all evidence into account , it is arguable that t. b. gambiense group 1 should be reinstated as the species t. gambiense , leaving t. b. rhodesiense and t. b. gambiense group 2 as host range variants of t. b. brucei . in comparison , current taxonomic usage badly underrepresents diversity in subgenus nannomonas .
data from molecular characterisation are revealing a growing number of genotypes , which may represent distinct taxa .
unfortunately few of these genotypes are yet supported by sufficient biological data to be recognized taxonomically .
but we may be missing fundamental epidemiological information , because of our inability to distinguish these trypanosomes in host blood morphologically or in tsetse by their developmental cycle .
molecular taxonomy has led the way in identifying these new genotypes and now offers the key to elucidating the biology of these organisms .
| the way species and subspecies names are applied in african trypanosomes of subgenera trypanozoon and nannomonas is reviewed in the light of data from molecular taxonomy . in subgenus trypanozoon the taxonomic importance of pathogenicity , host range and distribution appear to have been inflated relative to actual levels of genetic divergence .
the opposite is true for subgenus nannomonas , where current taxonomic usage badly underrepresents genetic diversity .
data from molecular characterisation studies are revealing a growing number of genotypes , which may represent distinct taxa .
unfortunately few of these genotypes are yet supported by sufficient biological data to be recognized taxonomically .
but we may be missing fundamental epidemiological information , because of our inability to distinguish these trypanosomes in host blood morphologically or in tsetse by their developmental cycle .
molecular taxonomy has led the way in identifying these new genotypes and now offers the key to elucidating the biology of these organisms . |
epidermoid and dermoid cysts are benign lesions encountered throughout the body that are derived from abnormally situated ectodermal tissue .
histologically , epidermoid cyst is a cyst lined by stratified squamous epithelium and lumen is filled with lamellated keratin while dermoid cyst contains skin adnexal structures in the cyst wall .
epidermoid cysts are uncommon in the head and neck region , occurring about 7% in this region and 1.6% within the oral cavity . within the oral cavity ,
rare cases have been reported from tongue , uvula , intraosseously within mandible and maxilla and palatine tonsil .
however , epidermoid cyst occurring in the upper lip is very uncommon and rarely reported in english literature .
we intend to present a case of epidermoid cyst of the upper lip , which was diagnosed by fine - needle aspiration cytology ( fnac ) and subsequently confirmed by histopathology .
a 52-year - old male attended fnac clinic of our hospital with a globular swelling in the upper lip [ figure 1 ] .
the size of the swelling was approximately 2.5 cm 1 cm , cystic , non - tender and soft in consistency .
cystic mass in the upper lip with a clinical diagnosis of mucocele , fine needle aspiration was performed using a 22 gauge needle .
aspiration yielded pultaceous material and the smears were stained with may - grnwald giemsa stain .
cytological smears showed many anucleated squames and few benign mature squamous cells in a dirty background [ figure 2 ] .
a cytological diagnosis of epidermoid cyst was made with a recommendation for excision of the swelling and histopathological examination .
fine - needle aspiration cytology showing many anucleated squames and few benign nucleated squamous cells in a dirty background ( may - grnwald - giemsa , 100 ) excision biopsy and histopathological examination of the resected specimen showed a cyst lined by stratified squamous epithelium filled with lamellated keratin [ figure 3 ] .
histopathological section showing a cyst lined by keratinized squamous epithelium , cavity filled with lamellated keratin .
histologically meyer divided the cysts of the floor of mouth into three categories : epidermoid cysts , true dermoid cysts and teratoid cysts . in the epidermoid cysts ,
the cyst cavity is lined by squamous epithelium without skin appendages , while the true dermoid cyst contains skin appendages such as hair , hair follicles , sebaceous and sweat glands etc .
, cyst is defined as teratoid when in addition to skin appendages other tissuessuch as muscle , bone , cartilage etc . , are present .
although typical dermoid cyst is a distinct entity , all above mentioned three types of cysts generally mentioned as dermoid cyst .
the most common sites of dermoid are ovaries and testicles ( 80% ) , with head and neck accounting for only 7% .
epidermoid and dermoid cysts are uncommon in the mouth and comprises less than 0.01% of all the oral cysts .
epidermoid cysts can be classified as congenital or acquired ; however clinical presentation or histology of both types is similar .
congenital cysts are dysembryogenetic lesions that arise from ectodermal elements entrapped during the midline fusion of the first and second branchial arches between the 3 and 4 weeks of intrauterine life
. acquired epidermoid cysts occur due to traumatic or iatragenic implantation of epithelium or occlusion of a sebaceous duct .
dermoid cysts are usually diagnosed in young adults in the second and third decades of life . in our case
as epidermoid cysts are quite rare in the upper lip , correct clinical diagnosis is usually not possible .
the most common clinical differential diagnosis of cystic lip mass is mucocele as in our case .
lip contains adipose tissue , connective tissue , blood vessels , nerves and salivary glands ; so that any lesion that may originate from these components may occur in lips .
other clinical differential diagnosis of lipmass include fibroma , lipoma , mucous retention cyst , sialolith , phlebolith and salivary gland neoplasms .
they are the most common intraoral soft - tissue lesion and are seen most frequently in lips .
clinically they are soft , mobile and fluctuation may be present , which may give a cystic consistency .
sialolith may also present as the upper lip mass , however they are usually firm not cystic .
rarely phleboliths , which occurs due to calcification of intravascular thrombi may present as lipmass .
various salivary gland pathologies ranging from salivary gland cysts , benign salivary gland neoplasmssuch as canalicular adenoma , pleomorphic adenoma to malignant neoplasmssuch as mucoepidermoid carcinoma , acinic cell carcinoma etc .
vascular malformationssuch as hemangiomas and varices may also be considered in the differential diagnosis of lip mass in children .
they are usually blue in colour and blench in pressure , which differentiates it from mucoceles .
the characteristic abrupt transition from basaloid squamous epithelial cells to keratinized globules can be rarely seen in fine - needleaspiration smears of trichilemmal cysts .
hair shafts can be present in aspiration of dermoid cyst in addition to mature squamous cells and anucleate squames .
histopathologic examination provides the correct diagnosis and shows a cyst cavity lined by squamous epithelium and filled with lamellated keratin .
we have presented this case because of the rare site of presentation of epidermoid cyst in the upper lip .
we also want to highlight the role of fnac in the diagnosis of this simple benign lesion from any site , which is easily accessible .
patient presented with a cystic mass in the upper lip from where fine - needle aspiration was easily done , which gives a correct pre - operative diagnosis .
finally , we recommend fnac from any accessible mass , because it is cheap , easy to perform and gives a correct diagnosis in most of the cases . | epidermoid cyst and dermoid cysts are developmental pathologies thought to derive from aberrant ectodermal tissue .
they are uncommon in the head and neck region .
rarely , they can be found in the oral cavity and buccal mucosa . however , epidermoid cyst is extremely uncommon in the upper lip and is rarely reported . in this study , we report an uncommon case of epidermoid cyst occurring in the upper lip diagnosed by fine - needle aspiration cytology ( fnac ) .
we present this case because of its extremely rare site of presentation and also to highlight the role of fnac to in the pre - operative diagnosis of this benign lesion . |
taking drug is one of the rings of the treatment chain , while self - medication is one of the problems in treatment cycle .
self - medication without prescription is the main problem of the drug culture that , in addition , to disturb the treatment process and incidence of side effects ; it imposes huge costs of the drugs . in this regard , iran is considered as the country with highly self - medication prevalence .
previous studies showed that drug use does not follow any proper pattern in the country .
efforts done to modify the pattern have not been successful , and the national medical system is still faced with the problem of excessive consumption and self - medication .
in addition to the prescription of the drugs by physicians , many people directly refer to pharmacies and prepare and consume various drugs to prevent and treat diseases and possibly strengthen themselves depending on their own diagnosis which is often wrong .
studies also show that the rate of drug prescription is not consistent with the population and the epidemiological status of diseases which may be resulted from self - medication in the community .
given the increasing prevalence of self - medication in the community and the direct role of individuals in the selection and use of medicines , it is necessary to identify factors influencing the change in behavior to achieve healthy behavior ( lack of self - medication ) so that individuals can have long - life and relatively healthy and active life .
although the frequency of self - medication has been well - documented in the public health literature , but no study has examined the relationship between health literacy and self - medication yet . whereas , evidences showed the association between patient literacy skills and a number of medication - related behaviors and outcomes however , kim et al .
findings showed that patients with adequate health literacy performed worse in certain self - management behaviors compared with the limited literacy group . as far as we know no studies examined relationship between health literacy and self - medication in the community population and this is first study to look specifically at the link between health literacy and self - medication , we feel the data can provide important preliminary evidence on policy makers and health professionals for enhancing health literacy and promoting community knowledge and literacy on self - medication and also on which future studies should be based .
therefore , given that the health literacy can provide useful guides on how to design educational interventions for improving patients knowledge and skills , the current study was done with the aim of investigating the relationship between health literacy and self - medication in a community - based study .
this cross - sectional study was conducted to survey association between health literacy and self - medication among peoples in ardabil city ( ardabil is located in northwest of iran , near iran - azerbaijan border ) in 2014 who were selected using a multi - stage random sampling method .
sample size was calculated by the function n = z
1a/2p ( 1 p)/d deff . the health literacy survey in 2012 regarding health literacy in iran showed the inadequate health literacy percentage was 76% ( p = 0.76 ) .
the confidence interval was 3% , d = 0.03
p = 0.70 , = 0.05 , z1/2 = 1.96 , deff is design effect , defined as 2 due to cluster sampling .
therefore , the minimum sample size is calculated 950 . with considering response rates of the questionnaire 90%
, the actual sample size should be at least 1045 , in the present study 1100 people were asked to participate that 924 participants completed the study .
the target population was first stratified into local ( urban ) and nonlocal ( rural ) residents , with an equal sample size for each group .
then , based on the principle of balancing samples among factors such as age and occupation , cluster sampling was conducted in six places where local residents gather ( including communities , government organizations and other institutions ) and six places where nonlocal residents gather ( including near the hospitals and shops ) .
a total of 1,100 adults aged 18 and older were selected and interviewed for participation in the survey . excluding nonresponders ( subjects who refused or could not complete questionnaires ) , and illiterate subjects ( illiterate subjects may feel embarrassed about not being able to read and may be uncomfortable taking the self - administered health literacy test , which requires the respondent to read and answer to health related questions .
subjects who had uncorrectable vision and hearing problems and who were cognitively impaired , 924 adults voluntarily completed questionnaires and participated in the survey .
health literacy was measured by the test of functional health literacy in adults ( tofhla ) which was originally designed by parker et al . for the adult population .
the tofhla contains a reading comprehension and numeracy section , and the sum of the two sections yields the tofhla score , which ranges from 0 to 100 , with higher scores indicating better health literacy .
scores are classified and interpreted as follows : 059 , inadequate functional health literacy ; 6074 , marginal health literacy ; 75100 , adequate functional health literacy .
the tofhla had high internal reliability , in the current study sample ; the internal reliability of the scale was 0.82 for numeracy section and 0.9 for reading comprehension section .
health status was measured by the 12-item general health questionnaire ( ghq ) , ghq-12 was a shorter 12-item version of gho , which originally consisted of 60 items with four response categories in each item indicating the severity of psychological distress experienced in past 4 weeks .
its psychometric properties have been validated in persian language and in the present study cronbach 's alpha coefficient was found to be 0.88 .
our study used the lickert scoring method , in which each response categories scored 0 , 1 , 2 , and 3 , respectively .
the summation of scores from all the 12 questions gave a final result ranging from 0 to 36 .
self - rated health status was assessed by asking respondents to self - rate their physical and mental health over the past 6 months on a 5-point likert scale , ranging from 1 ( very poor ) to 5 ( excellent ) .
self - reported self - medication ( overall , sedative , antibiotic and herbal ) in last 3 months was assessed by two points include yes or no . for descriptive analysis ,
age was classified into 1824 years , 2535 years , 3645 years , 4655 years and 5665 years .
significant differences in hl across self - reported self - medication groups analyzed with using t - test , associations of self - reported self - medication groups with self - rated health status were assessed using the chi - square test , correlation of self - medication with health literacy and health status was analyzed with using logistic regression analysis .
all statistical analysis was performed using the spss version 18 and a p < 0.05 was considered significant . before the interview , the interviewerfirst explained the purpose of the survey , the study participants rights , and the confidentiality of study participants .
this cross - sectional study was conducted to survey association between health literacy and self - medication among peoples in ardabil city ( ardabil is located in northwest of iran , near iran - azerbaijan border ) in 2014 who were selected using a multi - stage random sampling method .
sample size was calculated by the function n = z
1a/2p ( 1 p)/d deff . the health literacy survey in 2012 regarding health literacy in iran showed the inadequate health literacy percentage was 76% ( p = 0.76 ) .
the confidence interval was 3% , d = 0.03
p = 0.70 , = 0.05 , z1/2 = 1.96 , deff is design effect , defined as 2 due to cluster sampling .
therefore , the minimum sample size is calculated 950 . with considering response rates of the questionnaire 90%
, the actual sample size should be at least 1045 , in the present study 1100 people were asked to participate that 924 participants completed the study .
the target population was first stratified into local ( urban ) and nonlocal ( rural ) residents , with an equal sample size for each group .
then , based on the principle of balancing samples among factors such as age and occupation , cluster sampling was conducted in six places where local residents gather ( including communities , government organizations and other institutions ) and six places where nonlocal residents gather ( including near the hospitals and shops ) .
a total of 1,100 adults aged 18 and older were selected and interviewed for participation in the survey . excluding nonresponders ( subjects who refused or could not complete questionnaires ) , and illiterate subjects ( illiterate subjects may feel embarrassed about not being able to read and may be uncomfortable taking the self - administered health literacy test , which requires the respondent to read and answer to health related questions .
subjects who had uncorrectable vision and hearing problems and who were cognitively impaired , 924 adults voluntarily completed questionnaires and participated in the survey .
health literacy was measured by the test of functional health literacy in adults ( tofhla ) which was originally designed by parker et al . for the adult population .
the tofhla contains a reading comprehension and numeracy section , and the sum of the two sections yields the tofhla score , which ranges from 0 to 100 , with higher scores indicating better health literacy .
scores are classified and interpreted as follows : 059 , inadequate functional health literacy ; 6074 , marginal health literacy ; 75100 , adequate functional health literacy .
the tofhla had high internal reliability , in the current study sample ; the internal reliability of the scale was 0.82 for numeracy section and 0.9 for reading comprehension section .
health status was measured by the 12-item general health questionnaire ( ghq ) , ghq-12 was a shorter 12-item version of gho , which originally consisted of 60 items with four response categories in each item indicating the severity of psychological distress experienced in past 4 weeks .
its psychometric properties have been validated in persian language and in the present study cronbach 's alpha coefficient was found to be 0.88 .
our study used the lickert scoring method , in which each response categories scored 0 , 1 , 2 , and 3 , respectively .
the summation of scores from all the 12 questions gave a final result ranging from 0 to 36 .
self - rated health status was assessed by asking respondents to self - rate their physical and mental health over the past 6 months on a 5-point likert scale , ranging from 1 ( very poor ) to 5 ( excellent ) .
self - reported self - medication ( overall , sedative , antibiotic and herbal ) in last 3 months was assessed by two points include yes or no .
for descriptive analysis , age was classified into 1824 years , 2535 years , 3645 years , 4655 years and 5665 years .
significant differences in hl across self - reported self - medication groups analyzed with using t - test , associations of self - reported self - medication groups with self - rated health status were assessed using the chi - square test , correlation of self - medication with health literacy and health status was analyzed with using logistic regression analysis .
all statistical analysis was performed using the spss version 18 and a p < 0.05 was considered significant . before the interview , the interviewerfirst explained the purpose of the survey , the study participants rights , and the confidentiality of study participants .
the mean age and weight of respondents were 37 years and 74.7 kg , respectively .
the largest group of respondents ( 32.1% ) had middle school literacy ( 69 years of formal schooling ) and the second largest had 912 years ( high school ) .
the percentage of self - administering antibiotics , sedative and herbal medicines were 40 , 54.4 and 59.1 in the last 3 months , respectively .
the most common reasons for self - medication were previous experience of diseases and high cost of a physician visit 41.9% , 25.6% , respectively . the mean score of total health literacy among the participants who self - medicated was significantly lower than who had not the self - medication .
furthermore , the mean score of total health literacy among the participants who self - medicated sedative and antibiotic medicines were significantly lower than who reported no self - medication [ table 1 ] .
mean and sd of health literacy based on self - medication status the mean score of total general health status among the participants who self - medicated was significantly lower than who had not the self - medication .
furthermore , the mean score of total general health status among the participants who self - medicated sedative and antibiotic medicines were significantly lower than who reported no self - medication [ table 2 ] .
mean and sd of general health status based on self - medication status the prevalence of self - medication among participants with poor and very poor self - rated physical health was significantly ( p < 0.001 ) higher and in contrast , good and excellent self - rated physical health was significantly more prevalent in no self - medication group .
furthermore , poor and very poor self - rated physical health was significantly ( p < 0.001 ) more prevalent in participants who self - medicated antibiotic , sedative and herbal medicines [ table 3 ] .
self - rated physical health and self - medication in participants the prevalence of self - medication among participants with poor and very poor self - rated mental health was significantly ( p < 0.001 ) higher and in contrast , good and excellent self - rated mental health was significantly more prevalent in no self - medication group . furthermore , poor and very poor self - rated mental health was significantly ( p < 0.001 ) more prevalent in participants who self - medicated antibiotic , sedative and herbal medicines [ table 4 ] .
self - perceived mental health and self - medication in participants logistic regression analysis was conducted for predictability of health status and health literacy variables on self - medication .
an enter model building procedure was conducted and according to the results as showed in table 5 , the general health status , perceived mental health , perceived physical health and health literacy variables were selected more influential predictor on antibiotic medicines use and perceived mental and physical health and health literacy variables were selected more influential predictor on sedative medicines self - medication . after adjusting for potentially confounding covariates such as age , sex and weight ,
the general health status , perceived mental health , perceived physical health and health literacy variables were selected more influential predictor on antibiotic and sedative medicines self - medication . the correlation self - medication with health literacy and health status using logistic regression analysis
some higher rates were reported , in another iranian study , 76.6% of the students had used analgesics in self - medication in the previous 3 months in a study was conducted in iran , 91% of migraine patients used self - medication ; acetaminophen and codeine were the most common and some lower rates reported 35.4% of the participants had self - medication the results indicated that 35.4% of the respondents had practiced self - medication past 2 weeks .
the percentage of self - medicated antibiotics , sedative and herbal medicines was 40 , 54.4 and 59.1 in the last 3 months , respectively .
the percentage of self - administering antibiotics was 19.1% in the last 12 months in another study 48.1% of the study population had used antibiotics without a prescription within 1-month .
this variation could be partly due to the differences in study design and studied samples . regarding the growing global resistance for antibiotic and documented health issues related to inappropriate use of such drugs , our findings approve emergency of legal regulation in this issue .
alghanim study showed that respondents with poor health status were more likely to practice self - medication .
the results of this study showed that respondents with very poor and poor self - reported health status were more likely to practice self - medication than those who reported their health conditions good or excellent .
it is evidenced that people with low health literacy understand health information less well and in a meta - analysis conducted by berkman et al .
finding from 96 peer reviewed papers on health literacy showed that low health literacy was consistently associated with greater use of emergency care , poorer ability to demonstrate taking medications appropriately and with poorer overall health status .
evidences showed that self - medication occurred in an attempt to resolve health problems , so , the decision process of self - medication depends on individual knowledge , perceptions and health - related behaviors and purchasing and using of over - the - counter medicines influenced by these factors .
self - medication is considered as a major issue of communities for their side effects , risks , mortality and its huge costs in drug budgets of governments , insurance companies , and general population .
thus , the identification and analysis of reasons for self - medication are very important among various groups of community
. one of these reasons is the low level of health literacy . in his study ,
sahebi et al . stated that among patients referred to tabriz pharmacies , analgesics and antibiotics had the highest rates of drug consumption for self - medication . on the importance of health literacy in self - medication behaviors of people , studies conducted on its reasons
the reasons for self - medication reported in previous studies may pertain to inadequate health literacy . in this regard
, several factors such as lack of enough time , symptomatic treatment by physicians and assuming unimportant problem by patients , not considering serious illness and fear of treatment , symptomatic treatment of diseases , not considering important disease and expensive visits , having experience in the treatment of diseases , lack of accurate information on the effects of drugs and lack of confidence in physicians practices in various studies and lack of need to referring to physician in the study by corbally had been the most important reasons for self - medication among participants . logistic regression analysis showed that the general health status , perceived mental and physical health and health literacy variables were more influential predictor on self - medication , this result was is consistent with carrasco - garrido et al .
previous studies had shown that people with poor perception of health status are more likely to use analgesic medication . however , no studies were examined relationship between self - medication and health literacy .
the issues outlined in the results and discussion of our study also point to the necessity that the theme of self - medication and health literacy should be present in the education of future nursing professionals , who must have sound knowledge about fundamental aspects for the practice of care for another , not only regarding adverse events , medication interactions , or importance of adherence to the therapeutic regimen , among others ; but also skills in the preparation and implementation of educational nursing programs on responsible self - medication .
thus , the present study showed a significant difference between those who are involved in self - medication and those who did not report self - medication ; however , given the lack of information on this issue , further studies are needed to prove the relationship .
the present study suffers from some limitations such as collecting data through questionnaire . in this regard
, it should be noted that in studies using questionnaire to collect data , it is assumed that the respondent states correct and true information ; however , the questionnaire may not be completed honestly by the respondents .
it is also suggested that considering the nature of self - medication , presence or absence of difference in the prevalence and type of medicines used in different seasons be studied . the optimal number of samples and collecting information from the community are considered as the study strengths . to the best knowledge of the researchers ,
this study is the first one which assesses the relationship between health literacy and self - medication in the community .
the optimal number of samples and collecting information from the community are considered as the study strengths . to the best knowledge of the researchers , this study is the first one which assesses the relationship between health literacy and self - medication in the community .
self - medication , especially antibiotics use had a high prevalence in the studied community and had significant relationship with health literacy and health status therefore , the design and implementation of training programs are necessary to increase the perception on the risk of self - medication among various groups .
the results of our study showed that self - medication rate was high , and health literacy rate was low , therefore these results indicate a serious crisis in the public health and our society , which can impose expensive costs to society and the healthcare system .
hence , health and national policy makers might increase funding for research and actions into social and health interventions in various health and healthcare settings to improve health literacy .
furthermore , health care systems and medical universities should have more attention for health literacy skills and health professions education and training programs , particularly programs that train professionals in the fields of direct patient interaction . as well as ,
with regard to the findings of this study , the followings are recommended : to provide appropriate , systematic and widespread educational programs on the serious complications of self - medication among different social groups ; to monitor the pharmacies in order not to sell antibiotic and seductive medicines without prescription ; to pay particular attention to obstacles on referring patients to physicians and to receive medicines under the supervision of doctors and to eliminate obstacles such as insurance of medical care and prevention
the results of our study showed that self - medication rate was high , and health literacy rate was low , therefore these results indicate a serious crisis in the public health and our society , which can impose expensive costs to society and the healthcare system .
hence , health and national policy makers might increase funding for research and actions into social and health interventions in various health and healthcare settings to improve health literacy .
furthermore , health care systems and medical universities should have more attention for health literacy skills and health professions education and training programs , particularly programs that train professionals in the fields of direct patient interaction . as well as , with regard to the findings of this study ,
the followings are recommended : to provide appropriate , systematic and widespread educational programs on the serious complications of self - medication among different social groups ; to monitor the pharmacies in order not to sell antibiotic and seductive medicines without prescription ; to pay particular attention to obstacles on referring patients to physicians and to receive medicines under the supervision of doctors and to eliminate obstacles such as insurance of medical care and prevention | background : although the frequency of self - medication has been well - documented in the public health literature , but no study has examined the relationship between health literacy and self - medication yet . this study was aimed to investigating the relationship between health literacy and self - medication in a community - based study.methods:this cross - sectional study was conducted on 924 adults to survey association between health literacy and self - medication among peoples in ardabil city in 2014 who were selected using a multi - stage random sampling method .
health literacy was measured by the test of functional health literacy in adults and general health status was measured by the 12-item general health questionnaire , and self - reported self - medication ( overall , sedative , antibiotic and herbal ) in last 3 months was assessed .
all statistical analysis was performed using the spss version 18 and a p < 0.05 was considered significant.results:the mean age and weight of respondents were 37 years and 74.7 kg , respectively .
the prevalence of self - medication was 61.6% , and the percentage of self - administering antibiotics , sedative , and herbal medicines were 40% , 54.4% , and 59.1% in the last 3 months , respectively .
significant relationship was found between of total health literacy and general health status with self - medication .
the prevalence of self - medication among participants with poor and very poor self - rated physical and mental health was significantly higher than other participants ( p < 0.001).conclusions : self - medication had a significant relationship with health literacy and health status .
therefore , the design and implementation of training programs are necessary to increase the perception on the risk of self - medication . |
praxis is ability to formulate skilled movements in a nonparetic limb by planning a schema based on stored complex representations and previously learned movements and apraxia is inability to carry out a learned motor act in the absence of motor , sensory or cerebellar deficit on command . according to geshwind , apraxia is failure to produce a correct movement in response to verbal command , imitate an action performed by the examiner , and perform the movement correctly in response to a seen object and failure to handle an object correctly .
the errors may be temporal , spatial , content or lack of response ( disconnection model of geschwind 1965 ) . according to liepman
there is a motor engram which is the space , time plan which is conveyed by the left parietal lobe through association fibers to central regions which includes pre- and post - central gyrus , superior frontal gyrus and the underlying white matter . according leiguarda and marsden 2000 , parietofrontal system encodes reaching and grasping , and frontostriatal system encodes the sequential motor events .
praxis circuit consists of wernicke 's area which analyses the verbal request and sends it to left parietal lobe , left motor cortex , anterior corpus callosum to right motor cortex [ figure 1 ] .
lhermitte in 1942 ( psychopathologie de la vision by jean lhermitte1 edition - first published in 1942 ) postulated that both parietal lobes mediate orienting response to a sensory stimulus in space .
right parietal lobe mediates attention to stimuli from both hemisphere and left from right hemisphere only .
the principal categories of spatial disorientation are : leipman 's praxis circuit
disorders in the judgment of location or orientation of stimuli with respect to each other and to self.impairment of memory for location.topographic disorientation and the topographic memory.route finding difficulty.constructional apraxia.spatial dyslexia and acalculia ( benton 1969 ) .
disorders in the judgment of location or orientation of stimuli with respect to each other and to self .
there can be impairment of localization of single stimulus , when it is called absolute localization , or it could be difficulty with perceived spatial relation between two or more stimuli called as relative localization ( peterson and zangwill 1944 ) .
defective appreciation of spatial relations in visual field with or without impairment of visual localization is otherwise called visual agnosia , which is due to dissociation between relative and absolute localization
. there can be overestimation of distance of nearby objects and underestimation of distance for far off objects .
this can be assessed using benton visual retention test , which is sensitive to subtler defects in spatial relations .
it is difficult to disentangle this influence on motor performance in space , the role of praxis , memory , and intelligence .
dissociation can occur between localization disorders and topographical disorders of orientation memory in which situation the simple test of spatial localization may be normal and relative tests will show an abnormality .
well - defined types of apraxia are ideational , ideomotor , limb - kinetic , dressing , and constructional .
ideational apraxia is a situation where patient knows the object including its name , but handles it as if he has never used it before due to the overall loss of the concept regarding the motor plan for use of objects .
ideomotor apraxia is a situation where patient can identify the object , knows its use , therefore , takes the right object , but does not know the motor sequence in carrying out the activity .
therefore , if patient is prompted at every step , he will complete the act .
these are sub categorized into conduction apraxia when they have superior performance on verbal commands than imitation .
this can be further subdivided into ability to imitate meaningful or meaning less gestures , and it can be transitive if defect is with tools and intransitive if present without tools being available
. it is called dissociative if the performance is better on imitation and less on verbal command without object
. it is called apperceptive if patient lacks the concept , which is equivalent to ideational .
limb - kinetic apraxia is a situation where patient is slow and clumsy in the use of a limb .
these occur in lesions of the dominant parietal , premotor or sometimes parieto - occipital strip .
dressing apraxia is a situation where patient has difficulty in dressing properly due to both visuospatial and sequencing errors and often seen in nondominant parietal lobe dysfunction .
constructional apraxia is inability to execute the right movement to form two- or three - dimensional pictures using single dimension lines .
the other apraxias known are buccopharyngeal apraxias , apraxia of speech , gait apraxia , occulomotor apraxia , apraxia of eyelid opening , arm apraxias , etc . in patients with dementia ,
several kinds of apraxias are seen which is often mistaken as nonorganic in the absence of demonstrable cognitive or other deficits .
as the disease advances , the diagnosis of organicity becomes easy , and most of the patients suffer severe nutritional deficiency due to buccopharyngeal apraxias and locomotion related dependence due to gait apraxia .
left arm apraxia is seen in corpus callosum lesions , which disconnects the praxicons in the left parietal lobe from the movement plans located in the right frontal lobe needed to move left hand .
right parietal lobe interferes with the sense of direction , position and movement of the left hand .
finkelinburg in 1870 described a catholic who forgot to draw a cross and carried his hand behind the ear , neck and was suspected to have a conceptual thinking problem .
steinthal 1881 described a patient who used objects as if he had never used them before .
liepman postulated that this is due to inability to transform the image of intended actions with appropriate motor commands and neither a motor , cognitive cause could be implicated and probably represents something in between .
deleuze 1990 , postulated a person imitating the movement of another provides the model for an action automatically .
therefore , when a schema is provided externally , problem can be due to executive defect and called it as visuo - imitative apraxia .
this is also seen when patients retrieve action from long - term memory , e.g. , pantomimes of tool use .
1991 , postulated two pathways . a direct route from the vision to motor control accommodating both meaningful and meaningless gestures . an indirect route for familiar meaningful gestures for
which ability to recognize the gesture and pull it out from the store of familiar gestures is needed .
morlass in 1928 postulated imitating meaningless gestures involves comprehension and reproduction of body centered spatial relationships .
goldenberg and strauss in 2002 , said that perception and replication of meaningless gestures involves a coding of the demonstrated gestures with reference to the classification of body parts and knowledge of the boundaries defining them .
body part coding reduces the multiple visual features of the demonstrated gesture to one of a simple relationship of one body part to the other independent of the different modalities of perception .
orienting apraxia is difficulty in orienting one 's body with reference to objects and space ( roy and squares cognitive model of limb praxis ) dyssynchronous apraxia indicates failure to combine simultaneous preprogrammed movements .
allokinesia is the term used to represent a situation where patient moves the body parts in the wrong direction or respond with wrong direction to commands , seen in nondominant parietal lobe .
we analyzed apraxias in patients with dementia with the objective of whether it can be used as an early biomarker to categorize the dementia , the influence of intervention in reducing patient and caregiver burden and also to know if an insight can be produced among medical persons regarding the organic nature of certain bizarre symptoms in these patients .
patients who fulfilled diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) criteria for dementia and were willing to participate in the study were taken .
they were then categorized into frontotemporal lobe dementia ( ftd ) , alzheimer 's disease ( ad ) , diffuse lewy body disease ( dlbd ) and cortical basal ganglionic degeneration ( cbgd ) [ figure 2a - d ] using lund manchester criteria , ninds - airen criteria for ad , consensus guidelines for the clinical and pathologic diagnosis of dlb and criteria for diagnosis of cgbd for cbgd . apraxia was tested with verbal , visual , tactile presentation of test objects , imitation of gestures , transitive / intransitive and meaningless nonrepresentational / meaningful representational gestures , single versus multiple step tests .
common tests used for ideational was use of the comb , brush , and spoon . for ideomotor , a matchbox , candle and a board was provided and asked to light .
then construction of the clock , flower pot , crossing pentagons , and three - dimensional cube as well as wearing sari , shirt was tested .
buccopharyngeal apraxia was tested using the standard oral questionnaire which involve 20 questions ( darley 1969 ) : ( a ) dragon shaped dilatation of the frontal and temporal horns in frontotemporal lobe dementia ( ftd ) .
( d ) asymmetrical ventricular dilatation in cortical basal ganglionic degeneration
open your mouthstick out your tongueblowshow your teethpucker your lipstouch your nose with your tonguebite your lower lipwhistlelick your lipsclear your throatmove tongue in and outclick teeth togethersmilecarry tongue to the top of the mouthchatter teeth like coldtouch your chin with your tonguecoughpuff out cheekwiggle tongue side to sidehum
stick out your tongue touch your nose with your tongue move tongue in and out carry tongue to the top of the mouth chatter teeth like cold touch your chin with your tongue wiggle tongue side to side gait was tested using sit , stand walk assessment of the primary four parameters involving anti - gravity stretch , stepping , propulsion and equilibrium in addition to visual assessment of stance , pace , turns , ability to climb up and down . also asked to imitate kicking a ball and putting out cigarettes .
gait lab was not used as patients were having dementia , and it involves time in making the patient understand what is expected from them .
other neuropsychological tests done include : ( 1 ) motor speed ( digit symbol substitution test ) .
( 2 ) category fluency ( animal names ) . ( 3 and 4 ) working memory ( verbal n - back tests ) . ( 5 ) planning ( tower of london ) . ( 6 ) set shifting ( wisconsin card sorting test ) . ( 7 ) response inhibition ( stroop test ) .
a total of 300 patients were studied with 211 males ( 70.3% ) and 89 females ( 29.67% ) and the mean age of 62.5 years . of these
males constituted maximum number among ftd and ad groups , but females dominated in the dlbd group and there was no gender difference among cbgds [ table 1 ] . patients with ad showed maximum incidence of apraxia , the most common in the early phase being constructional and dressing apraxia [ video 1 ] and as the disease evolved developed ideational and ideomotor apraxia .
limb - kinetic apraxia is seen in only one patient and is the least common .
after 3 years into the disease patients developed buccopharyngeal apraxia resulting in severe swallowing and speech difficulty and gait apraxia limiting locomotion .
patients with ftd did not suffer from apraxias in the early stage but as the disease progressed over 3 - 4 years , buccopharyngeal apraxia and gait apraxia became symptomatic . in patients with dlbd ,
early defect in construction , ideational and ideomotor apraxia is the only apraxia seen in 50% of our patients .
patients with corticobasal ganglia degeneration showed early shift of hand use in either the dominant or nondominant hand with clumsy trajectory in 70% of the patients .
one patient showed the classical pusher phenomena characterized by drift during arm abduction with twisting of the hand at wrist resulting in diagnostic confusion as fatigability and dystonia which was excluded with negative repetitive nerve stimulation and dystonia was excluded as the tone in the limb remained unaltered .
one patient had very interesting trajectory apraxia in the form of bending the whole trunk forward along with the limb when asked to bring the hand down from above head position . then brings the trunk up keeping the limb in the down position .
this 4 years follow - up assessment of patients with dementia reveals that at least in the hospital - based population , ftd is the most common among degenerative dementias . both in ftd and
ftd patients have a lower age of onset from 35 to 75 years , whereas alzheimer 's patients usually become symptomatic in the late fifth decade .
the other two groups have very few numbers , but females were more in dlbd and no gender difference observed among cbgd group .
this study reveals that apraxias of all types are common in ad in early stage itself interfering with their functional efficiency .
as the disease advances , buccopharyngeal and gait apraxias get added due to involvement of corticocortical circuits between parietal lobe and frontal lobe resulting in secondary complications . in patients with ftd
, apraxias are seen only in late stage , and they are mostly buccopharyngeal and gait related which could be due to involvement of frontal subcortical circuits as the disease advances .
cbgd and dlbd have variable association with apraxias , but gait and buccopharyngeal apraxias appear less common compared to the other dementias .
buccopharyngeal apraxias are disturbances of volitional movement of tongue , jaw , and lips during nonspeech tasks , whereas apraxia of speech are situations where there is impaired ability to execute voluntarily the appropriate movements of articulation of speech in the absence of other deficits .
the clinical semiology is unique in these situations as they can be inconsistent with less error in involuntary speech and more errors in voluntary speech , and there can be errors of substitution , addition , deletion , distortion , repetition , and simplification .
there can be prosodic disturbances due to self - monitoring of speech and anticipatory correction .
these disturbances lead to a significant burden for patients and caregivers interfering with the minimal degree of communicative skills that may be preserved and also feeding .
all higher level gait disorders are called gait apraxias and are a task specific gait disorder defined by meyer and barran in 1960 as a loss of ability to properly use the lower limbs in the act of walking , which can not be accounted for by demonstrable sensory impairment or motor weakness , which can manifest as reduced velocity , short hesitant steps , pulsion abnormalities , wide base , poor balance , start hesitation , freezing and absence of rescue responses .
a distributed representation for praxis is described by haaland et al . in 2000 and buxbaum et al .
according to them , left inferior parietal and dorsolateral frontal lobe is consistently involved in praxis .
posterior lesions produce target and spatial errors , and the anterior lesions produce attention related errors .
according to marsden and pramstaller basal ganglia is extensively connected to superior parietal lobule , premotor area and supplementary motor area and results in subcortical apraxias .
anterior dementias affect gait by involving corticobasal ganglia thalamocortical loop and posterior dementias by corticocortical loop . in posterior dementia patients present with difficulty in adopting the body to space and objects resulting in difficulty in sitting down with relative ease than getting up ,
sit on edge , stand in incorrect direction , face backwards , trying to manipulate in the air instead of orienting toward guiding objects .
if apraxias are recognized early quality of life can be improved by the various options available like transitive gesture training , intransitive gesture training , intransitive nonsymbolic gesture training , addition of visual cues to the environment in addition to environmental manipulation designed to reduce the risk of injury , encourage visual scanning of the environment , techniques to improve balance using vestibular stimulators , neck muscle vibrators , etc .
pharmacotherapy with levodopa , carbidopa , ropinirole , pramipexole , tizanidine , donepezil , rivastigmine , galantamine , and memantine also helps if recognized early .
buccopharyngeal apraxias can be treated by melodic intonation therapy making the patient sing an utterance , gestures introduced into speaking facilitate deblocking and inter - systemic reorganization .
our study shows that ftd is the most common dementia in the hospital population as against the data available in the literature .
this could be due to the increased caregiver burden because of the behavioral consequences of these patients . in both ad and ftd males
dominated which could also be due to the probable gender bias in seeking treatment in the community .
apraxias are seen in dlbd and ad and agnosias are seen in all types of dementia in early stage .
early alzheimer 's dementias present with dressing apraxia , ideomotor apraxia and ideational apraxia in the order of frequency and when advanced presents with buccopharyngeal and gait apraxias .
buccopharyngeal and gait apraxias are often seen in the absence of other limb apraxias and early into the course of ftd .
agnosias and shift of the use of the hand is more common in early cbgd .
hallucinations and agnosias are common than apraxias in dlbd . in general , in patients with dementia , there is inadequate examination of praxis , gnosis , buccopharyngeal skills and gait
. even when complaint is there from caregivers , lack of clarity in the examiner in classification and terminologies leads to lack of attention to these symptoms . moreover , there are no well - defined diagnostic criteria .
awareness into apraxias will avoid diagnostic confusion in these patients including being labeled as nonorganic . it will help in categorization , caregiver education , planning strategies for improving quality of life as well as prognostication and avoidance of anti - psychotics and use of disease modifying treatment , which may help to slow down the progression .
| background : apraxia is a state of inability to carry out a learned motor act in the absence of motor , sensory or cerebellar defect on command processed through the praxis circuit .
breakdown in default networking is one of the early dysfunction in cortical dementias and result in perplexity , awkwardness , omission , substitution errors , toying behavior and unrecognizable gestures in response to command with voluntary reflex dissociation where , when unobserved patient will carry out reflex movements normally .
awareness into the organicity of these phenomenas will help in early diagnosis , which will help in initiating appropriate treatment and slowing down the progression of the disease.aims and objectives : the aim was to look for the various kinds of apraxias in patients with dementia using appropriate simple tests.patients and methods : three hundred patients satisfying diagnostic and statistical manual of mental disorders , fourth edition criteria for dementia were evaluated in detail with mandatory investigations for dementia followed by testing for ideational , ideomotor , limb - kinetic , buccopharyngeal , dressing apraxia , constructional apraxia and gait apraxias in addition to recording of rare apraxias when present.results:alzheimer's disease showed maximum association with apraxias in all the phases of the disease ideational , ideomotor , dressing and constructional apraxias early and buccopharyngeal and gait apraxia late .
frontotemporal lobe dementia showed buccopharyngeal and gait apraxias late into the disease .
cortical basal ganglionic degeneration showed limb apraxias and diffuse lewy body disease showed more agnosias and less apraxias common apraxias seen was ideational and ideomotor.conclusion:recognition of the apraxias help in establishing organicity , categorization , caregiver education , early strategies for treatment , avoiding anti - psychotics and introducing disease modifying pharmacotherapeutic agents and also prognosticating . |
injection drug is one of the main modes of hiv transmission in many parts of the world , particularly in industrialized and middle - income countries , including many countries in asia ( 1 , 2 ) .
the recent global estimation in 2014 indicates that there are 12.7 million injecting drug users ( idus ) , and 13.1% of them are living with hiv ( 3 ) .
the main behaviors that increase the risk of hiv infection and other blood borne diseases such as hepatitis b and c among idus are using non - sterile needles and other injecting equipment as well as engaging in unprotected sex practices ( 4 ) . in the absence of cure for hiv infection , prevention is the best strategy for its control within the communities ( 5 ) .
some interventions such as needle and syringe provision aim to reduce unsafe injection ( 6 , 7 ) .
other approaches aim to lower the risk of sexual transmission by distribution of condoms and education of safe sex ( 7 - 9 ) .
recently , the interventions on personal and drug injection networks of idus have been greatly taken into account by many health policymakers ( 10 - 12 ) .
there is evidence that shows a higher percentage of drug injectors in the social network of idus are associated with increase in their risky behavior ( 12 , 13 ) .
the key outcome of interest in all strategies is the prevention of hiv and viral hepatitis ( b , c ) transmission among idus ( 5 ) . for policymakers and harm reductionists who are interested in evaluating the efficacy of such programs and tracing the trends over time , applying
a simple , brief , and valid measure that incorporates different dimensions of hiv transmission risks among idus may be more advantageous than looking at individual outcomes ( 14 ) .
an effective scale to measure the mixed nature of hiv transmission risks among idus should address all aspects of hiv transmission , including injecting drugs , sexual behaviors , and risk network characteristics of individuals .
although there are several scales that measure hiv transmission risks among populations at higher risk of hiv infection ( e.g. men who have sex with men ) ( 14 - 16 ) , few scales are available for idus ( 17 , 18 ) and none of them has been validated in iran .
the lack of risk network information within them is another limitation and indicates the demand for developing a multi - dimensional scale to capture hiv transmission by conducting a simple and brief interview that can be flexible in clinical settings , large scale surveys , and research .
the aim of the present study was to create a brief scale applicable for policymakers , harm reductionists , and researchers for measuring hiv transmission risk among idus .
we collected the data related to the risk of hiv transmission among idus as a part of the project entitled social network analysis of idus in kerman , iran . from october 2013 to march 2014 , three trained interviewers conducted face - to - face interviews with 147 idus .
we used chain referral techniques to enroll a representative sample of idus from all affected sites , including drop - in centers , shelters , voluntary counseling , testing centers , and outreach spots .
eligible participants were individuals above 18 years old who had injected drugs at least once during the last year and had not participated in similar studies in the past 2 months .
the interviews were conducted in two drop - in centers ( dics ) in a very confidential setting . in some cases that the individuals were unwilling to complete the interviews at dics , the interviewers completed the questionnaires on site . to design a scale for measuring hiv transmission risk among idus , we specified 11 items , which address different dimensions of hiv risk taking behaviors / situations based on experts opinions .
the scale covered both injecting and sexual risk behaviors as well as risk network characteristics of individuals , use of stimulants , and engagement in methadone maintenance therapy ( mmt ) .
high risk behaviors related to injection were as follows : history of needle sharing , the history of using shared cookers , cotton and rinse water ; the number of needle sharing partners ; average number of daily injections within the last 6 months ; duration of time since first injection ; and proportion of idus in the personal network of participants . the items related to sexual behaviors were as follows : the number of sexual partners , extent of using condoms during sexual intercourse , and whether the participants used a condom at last sex .
we also asked the participants to specify if they used any types of stimulant drugs or currently engaged in mmt .
we applied exploratory factor analysis ( efa ) with principal component extraction and varimax with kaiser normalization rotation to develop scales .
the cronbach s coefficient was calculated to estimate the internal consistency of the scale .
most of individuals were male ( 91% ) , single ( 50.1% ) , and educated up to guidance school ( 73.5% ) ( table 2 ) .
we developed the final scale based on 7 items loaded on the first factor that accounted for 21% of variance .
the mean score in the overall sample was 3.002 2.33 with a median of 2.3 ( range 0 - 11 ) .
the mean score in injection subscale ( items 1 - 4 in table 3 ) was 2.11 1.88 with the median of 1.52 ( range 0 - 9).the mean ( sd ) and median in sexual behavior subscale ( items 5 - 7 in table 3 ) were 0.88 ( 0.95 ) and 0.4 , respectively ( range 0 - 3.91 ) .
the results of the present study indicate that employing a 7-item scale to measure the hiv transmission risk among idus may be useful for evaluation of intervention programs in this key group . in many studies ,
the focus of risk analysis is on discrete behaviors to identify trends in behaviors or to study the determinants of high risk behaviors in this population ( 19 , 20 ) . for a better understanding of the current status of hiv transmission risks among idus , looking simultaneously at multiple factors and conditions may provide better insight for policymakers and researchers into the mixed nature of hiv transmission risks and assist with identifying idus with higher risk of hiv acquisition or transmission based on their behaviors
furthermore , measuring the impact of interventions on multiple discrete outcomes may increase the chance of type i errors by introducing the problem of multiplicity into the analysis ( 21 ) . to prepare this scale ; we used principal component analysis , a multivariate technique which simplifies a set of items to their linear combination in a way that they successively have a maximum variance for the data .
the measure of internal consistency , the cronbach , was satisfactory , which indicates that summation of different items to construct a global scale for measuring hiv transmission risks is proper
. this approach may be more statistically powerful and informative in etiologic research as well as program evaluation efforts .
regarding high risk behaviors related to injection practice , the highest weight pertained to the needle sharing followed by the number of injection partners and sharing of injection equipment .
these findings are supported by the literature that suggests the higher likelihood of hiv transmission among those who share needles with multiple partners than those who only share injection equipment such as cookers or rinse water ( 22 ) .
in addition , the use of a condom during sexual intercourse is of much more significance than the number of sexual partners .
another item that was extracted in the final scale was proportion of idus in the personal network of participants .
this item has been ignored in available scales while in many situations , the higher proportion of idus in personal networks of individuals has been associated with a higher rate of risky behaviors ( 12 , 13 ) .
in addition , out of 11 items that we entered in the initial scale , 4 were dropped from the final model .
these items were duration of injection , average number of daily injections , engagement in mmt program , and use of stimulant drugs within the last 6 months . as these items indirectly affect the risk of hiv transmission among idus , it is uninformative to retain them in this scale .
we asked about the high risk behaviors of idus during the last 6 months to take into account the turnover of their relations that usually exist among idus .
in addition , we supposed that some questions such as the number of anal intercourse acts during the last month ( that was considered by darke and colleagues in a similar scale ) does not necessarily affect the risk of hiv transmission ( 17 ) . instead , the safety of sexual acts ( e.g. use of condoms ) is the main determinant of hiv transmission during sexual relationship .
applying a 7-item scale can help harm reductionists and clinical practitioners to simply measure the current status of hiv transmission risks among idus in a short period of time ( 3 - 5 minutes ) .
it also provides an opportunity for policymakers to evaluate the impact of intervention programs by measuring the changes in hiv transmission risk by employing a comprehensive scale that captures different factors related to virus transmission .
undoubtedly , an effective rapport between interviewers and participants increase the validity of such self - reported data .
nevertheless , the cross - sectional nature of the data has limited our ability to assess the usefulness of scales in prediction of hiv seroconversion among idus . | background : one of the main concerns of policymakers is to measure the impact of harm reduction programs and different interventions on the risk of hiv transmission among injecting drug users ( idus ) . looking simultaneously at multiple factors and conditions that affect the risk of hiv transmission may provide policymakers a better insight into the mixed nature of hiv transmission.objectives:the present study aimed to design a simple , brief , and multi - dimensional scale for measuring hiv transmission risk among idus.patients and methods : from october 2013 to march 2014 , we conducted face - to - face interviews with 147 idus .
eligible participants were individuals 18 years or older who had injected drugs at least once during the last year and had not participated in similar studies within the 2 months before the interview . to design a scale for measuring hiv transmission risk , we specified 11 items , which address different dimensions of hiv risk taking behaviors / situations based on experts opinion .
we applied exploratory factor analysis ( efa ) with principal component extraction to develop scales .
eigen values greater than 1 were used as a criterion for factor extraction.results:we extracted 7 items based on first factor , which were accounted for 21% of the variations .
the final scale contained 7 items : 4 items were related to injecting practice and 3 items related to sexual behaviors .
the cronbach s coefficient was 0.66 , acceptable for such a brief scale.conclusions:applying a simple and brief scale that incorporates the different dimensions of hiv transmission risk may provide policymakers and harm reductionists with a better understanding of hiv transmission in this key group and may be advantageous for evaluating intervention programs . |
bilateral cystic adrenal neuroblastoma with cystic liver and lymph nodal metastases and generalized intratumoral hemorrhage is extremely rare .
a 6-month - old boy presented with abdominal discomfort of 15 days duration and a mass noticed for the past 2 days .
he was born at term by caesarean section for fetal bradycardia and had a normal antenatal ultrasonography . on examination
, he was active , alert , weighed 6.1 kg , blood pressure 100/60 mm hg and pulse rate 90/min .
an irregular , firm , 6 8 cm size mass was palpable in the left hypochondrium .
a non tender liver was palpable 2 finger breadths below the costal margin with a prominent right lobe .
his hemoglobin was 7g/ dl , total leukocyte count 15,040/mm and platelet count 45410/ mm .
the electrolytes , renal and liver function tests were within normal limits except sgot [ 82.5 u / l ( range 15 - 60 ) ] .
an ultrasonography ( usg ) of the abdomen showed bilateral adrenal space occupying lesions suggestive of hemorrhage .
usg guided fine needle aspiration cytology ( fnac ) of the left sided mass withdrew hemorrhagic fluid with few clusters of round blue cells with scanty cytoplasm .
a whole body bone scan showed increased osteoblastic activity in the left upper end of femur .
a contrast enhanced computed tomographic ( cect ) scan of the abdomen [ figure 1 ] showed a 9.18.55.6 cm hypodense predominantly cystic mass in the left adrenal gland area with multiple linear calcifications and a similar lesion 2.21.4 1.4 cm in size in the right adrenal gland .
there were multiple hypodense lesions in the liver and a few prominent upper retroperitoneal nodes with central necrosis and calcification .
there was a small lytic lesion with cortical breach in the shaft of left upper femur .
his n - myc was in range ( 1% ) and no gene amplification was detected on assay .
cect abdomen shows a large cystic mass in the left adrenal region pushing the kidney inferiorly and cystic lesions in the right adrenal area and liver at laparotomy , a 109 cm cystic lesion arising from the left adrenal gland pushing down the kidney and adherent to the splenic capsule and adjacent mesocolon and a prominent draining vessel was excised without spillage .
a large lymph nodal mass with variegated consistency engulfing the renal vessels and extending into the preaortic area was excised .
the right adrenal gland had a variable consistency with multiple cysts , 1 - 2 cm in size .
the liver surface showed multiple 5 mm size hemorrhagic cysts , more so in the right lobe and one of them was biopsied .
the histopathology of the left adrenal mass showed overall features of a differentiating neuroblastoma [ figure 2 ] .
histopathology of left adrenal mass showing ( a ) clusters of tumors cells amidst areas of calcification and fibrinous exudates ( h and e , 40 ) .
( b ) neoplastic cells present in diffuse sheets interspersed by fine fibrovascular septa ( h and e , 200 ) .
( c ) higher magnification showing small , round to oval cells with high n / c ratio , and stippled chromatin .
few homer - wright rosettes are also seen ( h and e , 400 ) .
( d ) neoplastic cells positive with neuron - specific enolase ( nse ) , ( immunoperoxidase , 400 ) the child had an uneventful postoperative recovery .
he received 4 cycles of etoposide ( 12.5 mg / kg ) and carboplatin ( 6.6 mg / kg ) at 3 week intervals .
a cect done after 2 cycles of chemotherapy showed few focal hypodense lesions in segment vi of liver and multiple small lymph nodes in retroperitoneum , left suprarenal , aortocaval and paraaortic location .
adrenal neuroblastoma is a common solid malignant childhood tumor with bilateral presentation occurring in only 10% cases .
differential diagnosis includes adrenal hemorrhage , abscess , adrenal cytomegaly , dilated upper pole renal calyces etc .
bilateral hemorrhagic adrenal cysts resolving spontaneously have been reported in an incomplete form of beckwith - weidemann syndrome . however , the presence of hepatic cystic lesions and multiple linear calcifications in the mass pointed to a neuroblastoma . our patient
however , miller et al . showed an increased incidence of brain and skull defects in 2% children with neuroblastoma .
our patient had low set ears and brachycephaly and interestingly there was a previous pregnancy that had been aborted following a diagnosis of arnold chiari malformation pointing to a genetic influence in the etiology .
histopathological differentiation from other tumors was possible in our case as the tumor was positive for neuron specific enolase .
the tumor also showed penetration of the pseudocapsule and infiltration of surrounding tissue which is often seen with neuroblastoma .
interestingly , there was a great difference in size between the tumors on either side as observed in previous reports also , giving rise to a speculation that the left sided tumor was the primary and the other a metastatic lesion .
although cystic neuroblastomas have a good prognosis and may regress spontaneously , early excision is advisable .
bilaterality , large left sided lesion , generalized tumoral hemorrhage and bone cortex metastasis in an infant prompted us to excise the larger mass with aspiration of the smaller adrenal mass followed by chemotherapy . | a 6-month - old boy presented with pallor , large left hypochondrial mass and hepatomegaly .
computerized tomography ( ct ) revealed cystic lesions in bilateral adrenals , liver and retroperitoneal lymph nodes and a lytic left femur lesion .
there was hemorrhagic aspirate with round blue cells . excised left sided mass with adjacent lymph nodes and biopsies of others confirmed well differentiated neuroblastoma .
he received 4 cycles of chemotherapy with remaining lesions markedly reduced at 2 months ct scan . at 2 year
follow up he is doing well . |
spatial navigation is the ability to determine and maintain a route from one place to another ( gallistel , 1990 ) .
it consists of phylogenetically old cognitive functions allowing animals and humans to remember important locations and their mutual relations as well as their relation to the organism itself .
spatial navigation deficits are frequently observed in older population with a significant influence on the quality of life .
spatial navigation difficulties can represent the first sign of alzheimer 's disease ( ad ) development .
the recent trend of spatial navigation research relies on tests translated from animal experiments , e.g. , the human analog of the morris water maze ( mwm ) , used for clinical examination of people at risk of ad . in this article
we summarize findings on spatial navigation changes in the physiological and pathological ageing and their practical significance for the early diagnosis of ad .
as many neuropsychological tools still evoke controversies regarding the accuracy of detecting ad in its predementia stages , it is important to design a battery of tests , including spatial navigation testing for improving early diagnosis of ad .
physiological ageing is associated with structural and functional changes , mainly in the prefrontal cortex ( cabeza et al . , 1997 ; resnick et al . , 2003 ) and to a lesser extent in the hippocampus ( jack et al . , 1998
; grady et al . , 1999 ) , these are mirrored by changes in cognitive functions .
age - related changes in cognition include mild decline in attention , executive functions , working memory , and free memory recall , while other functions such as visuospatial functions , language , and semantic memory remain generally preserved for a long time ( park , 2000 ) .
pathological ageing is caused by underlying vascular or neurodegenerative diseases leading gradually to a dementia syndrome , where ad is the most common cause .
the hallmark of ad is medial temporal lobe ( mtl ) atrophy including the hippocampus and the enthorinal cortex ( jack et al . , 1997 ) .
some recent studies on patients with ad suggested that atrophy is unequally distributed even within the hippocampus being most pronounced in the ca1 subfield compared to hippocampal atrophy pattern in normal ageing , where the ca1 subfield is relatively spared ( frisoni et al .
the ca1 atrophy in patients with mild cognitive impairment ( mci ) can even predict conversion to dementia due to ad ( chtelat et al .
, the precuneus was shown to be impaired very early even in presymptomatic ad ( scahill et al . , 2002 ) . with the disease progression ,
structures beyond mtl including lateral temporal , parietal and frontal cortices become affected ( braak and braak , 1991 ) . the first clinical sign of ad
is usually the insidious onset of episodic memory impairment caused by neuropathological changes in mtl .
early in the course of the disease , memory impairment is followed by executive dysfunction together with impairment of working memory and attention .
later on , other cognitive domains including praxis , visuo - constructive skills , and language become affected , which reflects the spreading of the pathology further to the neocortex ( kertesz et al .
proceeding cognitive impairment leads to a decline in every day functional abilities , which constitutes an important criterion for the diagnosis of the dementia syndrome . in recent years , increasing attention has been paid to the mild end of the cognitive spectrum encompassing a transient zone between the normal ageing and dementia , caused most frequently by ad .
this transitional zone has been described by the term mci ( petersen et al . , 1999 ) .
the concept of mci refers to a group of individuals who have some cognitive impairment yet of insufficient severity to constitute dementia due to a very slight degree of functional impairment .
the individuals with mci form a heterogeneous group . those with memory impairment ( amnesia ) present amnestic mci ( amci ) , those with the non - memory domain impairment ( i.e. , executive functions , language , and visuo - spatial skills ) present non - amnestic mci ( namci ) ( petersen et al . , 2001 )
. further sub - classification of both mci subtypes is based on the number of affected cognitive domains .
isolated memory impairment represents amci single domain ( amcisd ) , similarly , single non - memory domain impairment represents namci single domain ( namcisd ) .
impairment in additional domains to these two subtypes assigns to amci multiple domain ( amcimd ) , or namci multiple domain ( namcimd ) .
individuals with amci subtype have a high risk of ad development ; while those with namci subtype have a higher probability of progressing to non - ad dementias such as dementia with lewy bodies , frontotemporal or vascular dementia .
the risk of progression from mci to dementia , particularly to ad , is not uniform and varies across epidemiological studies ( tierney et al .
, 1996 ; petersen et al . , 1999 ; morris et al . , 2001 ) .
the average rate of conversion is estimated to 12% per year ( petersen and morris , 2003 ) .
in contrast , in healthy elderly subjects the rate of conversion to dementia is about 12% per year ( petersen et al . , 1999 ) .
although amci patients represent at - risk population for ad development , this population is somewhat heterogeneous as it encompasses also individuals who will never progress to dementia . lately
, much effort is spent to identify the high risk patients with underlying ad pathology already in this prodromal ( predementia ) stage of the disease . for identification of prodromal ad patients ,
these include structural and functional neuroimaging , focused on the hippocampus and related structures ( small et al . , 1999 ;
2010 ) , magnetic resonance spectroscopy ( modrego et al . , 2011 ) , cerebrospinal fluid assessment of amyloid- peptide , tau and phosphorylated tau proteins ( hulstaert et al . , 1999 ; shaw et al . , 2009 ) , and amyloid labeling pet ligands ( resnick et al . , 2010 ) . among neuropsychological tools ,
specific memory tests play an important role for identification of memory profile characteristic for ad that is present already in the predementia stages ( sarazin et al .
, 2007)amnestic syndrome of the hippocampal type ( dubois and albert , 2004 ) .
this syndrome forms a clinical core of the revised research diagnostic criteria for ad ( dubois et al .
, 2007 ) and is characterized by decreased memory recall despite controlled encoding and using of facilitation retrieval techniques ( cueing or recognition ) ( dubois , 2000 ) . the mci individuals with amnestic syndrome of the hippocampal type ( hamci ) , compared to those with the amnestic syndrome of the non - hippocampal type ( nhamci ) , form the major at - risk subgroup of mci population ( sarazin et al . , 2007 ) for the development of dementia due to ad .
although the tests designed to detect hippocampal amnestic syndrome ( grober et al . , 1988 ) were shown to reflect atrophy of the hippocampus , especially its ca1 subfield ( sarazin et al . , 2010 ) , it still remains controversial , whether these tests are superior to other tests for the detection of early stage dementia ( de jager et al .
the uncertainty about the usefulness of cued recall as a diagnostic tool for mci and ad is expressed also in the national institute on aging and the alzheimer 's association guidelines ( albert et al . , 2011 ; mckhann et al . ,
recent studies indicate that there is a promising chance that , spatial navigation tests reflecting mtl damage may identify patients with ad already in the prodromal stages ( lacz et al . , 2009 ) .
while navigating through the environment , people can use two basic navigation strategies associated with distinct internal representations of space .
the egocentric navigation is body - centered strategy that utilizes distances and directions to or from individual landmarks with respect to the subject 's body position .
the allocentric navigation is a world - centered strategy using information about distances and angles between different locations in the environment independent of the position of the subject .
animal research yielded valuable information about the role of mtl in the processes of spatial navigation ( o'keefe and dostrovsky , 1971 ; o'keefe and nadel , 1978 ; morris et al . , 1982 ) .
a key structure of the allocentric navigation is the hippocampus , especially its ca1 subfield ( brun et al . , 2008 ) .
in 1971 o'keefe and dostrovsky discovered specific place - firing cells in the hippocampus of the rat ( o'keefe and dostrovsky , 1971 ) .
these findings supported the theory of a cognitive map ( tolman , 1948 ) and the dissociation between the egocentric and allocentric navigation strategies .
experiments in the mwm demonstrated spatial navigation impairment in the rats after hippocampal lesion ( morris et al . , 1982 ) .
hippocampus is crucial for consolidation , encoding , and long term storage of spatial information ( squire , 1992 ) .
the association of hippocampus with allocentric navigation in humans has been demonstrated in various studies in real - space and virtual environments ( maguire et al . , 1998 ;
( 2000 ) tested patient ( yr ) with selective bilateral hippocampal lesion for recall of visuospatial information and found that yr was more impaired at recalling allocentric than egocentric information .
more specifically , right ca1 hippocampal subfield seems to be involved in encoding of allocentric spatial information in humans ( suthana et al . , 2009 ) .
there is evidence that egocentric information is processed outside of the hippocampal system ( o'keefe and nadel , 1978 ) , in the parietal cortex including precuneus and the caudate nucleus ( mountcastle et al . , 1975 ; maguire et al . ,
lesions of the right posterior parietal cortex are characterized by an egocentric orientation deficit ( kase et al . , 1977 ; levine et al . , 1985 ; stark et al . , 1996
navigational tasks based on the models of mwm ( morris , 1981 ) were used in testing rats of different age ( ingram , 1988 ; mclay et al . , 1999 ;
results of these studies suggested age - related deficit of navigational abilities in aged rodents and inspired translational research of spatial navigation in humans .
significant deficits in learning a route through a hospital lobby was described in participants 60 years and older , with a tendency to be impaired even in participants in their 50s ( barrash , 1994 ) .
several studies suggested that elderly people have lower cognitive capacity limits in temporospatial processing . in one experiment using series of slides of unfamiliar neighborhood , elderly adults recalled landmarks by their saliency and non - spatial associations rather than by their spatial relationships ( lipman , 1991 ) . however , many other studies emphasized deficits specifically in spatial configuration memory and in place navigation in aged population .
( 1997 ) let participants undergo navigational tasks in university building and found that older persons made more errors than their younger counterparts in temporal ordering of landmarks , in recalling the learned route , and in using the learned map in navigation .
another study showed navigational difficulties of healthy elderly while driving a car leading to avoidance of unfamiliar places and routes and thus limiting their mobility ( burns , 1999 ) .
human analog of the mwm was developed in an effort to transform navigational tasks into laboratory conditions .
it was employed in a study that demonstrated impairment in acquisition and use of the cognitive map of the maze in the group of elderly participants ( newman and kaszniak , 2000 ) .
moffat and resnick ( 2002 ) were among the first authors implementing the use of virtual reality in testing of spatial navigation .
they compared performance of elderly and younger individuals in the virtual analog of mwm and found deficit of place learning using room - geometry cues in the group of older participants .
furthermore , they suggested that allocentric impairment may contribute to age - related deficit of spatial navigation .
this hypothesis was later supported by the study of iaria and colleagues , according to which the older participants are less effective in forming and using the cognitive maps of an environment ( iaria et al . , 2009 ) .
a recent study examined age - related differences in strategy preference and found a shift toward egocentric navigation strategy in older participants , which may reflect an adaptation mechanism for the hippocampal dysfunction ( rodgers et al . , 2012 ) .
studies correlating hippocampal volume with spatial navigation performance in cognitively healthy elderly provided however contradicting results , with some of them documenting positive correlation ( driscoll et al . , 2003 ; head and isom , 2010 ) and other reporting no association ( moffat et al . , 2006 ; nedelska et al . , 2012 ) .
spatial navigation impairment occurs early in ad ( monacelli et al . , 2003 ; pai and jacobs , 2004 ) ; reports about spatial deficits such as getting lost in familiar places and other can in many cases lead to diagnosis of dementia ( klein et al . , 1999 ) .
the combination of visual perception and memory deficits is probably the mostly defining factor of spatial disorientation in patients with ad ( henderson et al . , 1989 ) , where both allocentric and egocentric navigation strategies are impaired ( hort et al .
according to several studies , these general spatial deficits in ad seem to be linked mainly to impairment of visual motion processing ( kavcic et al . , 2006 ) .
nevertheless , spatial navigation impairment can be detected even before the development of the full blown dementia syndrome , in the stage of mci ( mapstone et al .
, 2003 ; deipolyi , 2007 ; hort et al . , 2007 ; lacz et al . ,
2011 ) . given that amci is associated with a higher risk of progression to ad , the current research of spatial navigation has focused on this group of patients . a visuospatial subtype of amci with impaired radial motion perception indicating spatial perception deficit was identified in one of the first studies in this field ( mapstone et al . , 2003 ) .
spatial navigation impairment was documented in amci patients performing a route - learning task in the hospital lobby ( deipolyi , 2007 ) . in this study
, the patients , who made at least one error on the road , did not differ in neuropsychological tests from those with no errors on the road , but they had lower right mtl and posterior parietal cortex volumes that probably underlie spatial navigation deficit .
temporal order spatial memory was recently suggested as another cognitive marker of ad and amci ( bellassen et al .
remembering a sequence of three turns in a simple maze distinguished well between ad , healthy older subjects , and group of patients with frontotemporal lobe degeneration .
spatial navigation impairment is present even in patients with isolated memory deficit amcisd ( hort et al . , 2007 ) .
the patients with amcisd tested in the real - space human version of the mwm had an isolated impairment of allocentric navigation , suggesting spatial memory impairment due to mtl dysfunction . on the other hand , the patients with amcimd had more general spatial navigation impairment in both , allocentric and egocentric strategies , indicating that structures beyond mtl , presumably the parietal cortex , are affected in this group ( hort et al . , 2007 ) .
consistent with these findings patients with amci were impaired in both egocentric and allocentric strategies in a study using virtual reality environment , where right precuneus volume was associated with egocentric navigation performance ( weniger et al . , 2011 ) .
further study examined spatial navigation in a real - space human version of mwm and found more profound spatial navigation deficit in the hamci group in comparison to the nhamci group , especially in allocentric navigation , which corresponds with the probable hippocampal dysfunction ( lacz et al . , 2009 ) .
in addition , the hamci group resembled the ad group in spatial navigation performance thus indicating that spatial navigation deficit in the hamci may be the first sign of incipient ad . in the same vein , in another study using real - space human analogy of mwm ( nedelska et al . , 2012 ) , right hippocampal volume in amci and ad patients was associated with an allocentric navigation performance .
thus testing of the allocentric navigation , targeting hippocampus and its ca1 subfield ( suthana et al . ,
2009 ) , and egocentric navigation , focusing more on posterior parietal cortex and precuneus , could be a useful method of recognizing the amci patients at higher risk of ad .
virtual analogs can probably substitute the real space environment in estimating the navigational deficits of mci and ad patients , as implied by two recent studies . in an experiment consisting of learning a route through a hospital lobby and of a follow - up spatial tests series
, strong correlation was found across all subject groups between the total spatial score from the real hospital lobby and the total score from its virtual analog ( cushman et al . , 2008 ) .
similarly , high correlation was found in another study between scores in a real - space human version of mwm and its virtual 2d analog on a computer monitor representing the circular space as from above ( lacz et al . , 2012 ) .
these results suggest that computer analogs of real space tests can yield measures of broad applicability to early detection of navigational impairment in mci or ad .
in the course of physiological ageing , there is a selective mild decline of spatial navigation .
particularly allocentric navigation is impaired , which may be a consequence of the age - related deficits in mediotemporal functioning observed in the elderly .
ad is associated with the development of characteristic pathological changes in the brain , especially in the hippocampus and its ca1 subfield , that further spread to parietal cortex , including precuneus , and other areas as the disease progresses .
the severe spatial navigation deficits demonstrated in patients in early stage of ad are caused by both hippocampal and parietal dysfunction .
those spatial navigation deficits can be detected even in the stage of mci patients with amnestic syndrome of hippocampal types , who are at the highest risk of ad development , and who manifest with the spatial navigation deficit similar to that in ad .
therefore , spatial navigation testing could become a reliable tool of identifying patients in the prodromal stages of ad , before the development of dementia syndrome ( vlcek , 2011 ) .
adding spatial navigation tests to neuropsychological batteries will increase the diagnostic accuracy and early detection of patients with ad in the predementia stages . given that real - space testing is technically difficult ,
2d computer tests and virtual reality environments appear to be promising areas for extension of spatial navigation testing to the routine clinical use .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | spatial navigation is a skill of determining and maintaining a trajectory from one place to another .
mild progressive decline of spatial navigation develops gradually during the course of physiological ageing .
nevertheless , severe spatial navigation deficit can be the first sign of incipient alzheimer 's disease ( ad ) , occurring in the stage of mild cognitive impairment ( mci ) , preceding the development of a full blown dementia .
patients with amnestic mci , especially those with the hippocampal type of amnestic syndrome , are at very high risk of ad .
these patients present with the same pattern of spatial navigation impairment as do the patients with mild ad .
spatial navigation testing of elderly as well as computer tests developed for routine clinical use thus represents a possibility for further investigation of this cognitive domain , but most of all , an opportunity for making early diagnosis of ad . |
it is often referred to as a group of diseases because of the varied spectrum of clinical manifestations , which range from small cutaneous nodules to gross mucosal tissue destruction .
cutaneous leishmaniasis can be caused by several leishmania spp and is transmitted to humans and animals by sandflies .
zoonotic cutaneous leishmaniasis ( zcl ) , a highly prevalent disease in north africa , sub - saharan west africa , middle east , and central asia , is caused by leishmania major . in humans , previous studies have reported that healing of cutaneous leishmaniasis is generally associated with the development of a cellular immune response against the parasite , as well as a positive leishmanin skin test ( lst ) reactivity [ 1 , 3 ] .
moreover , healing is usually correlated with resistance to a subsequent symptomatic infection [ 4 , 5 ] demonstrating that immunity against leishmaniasis is possible and can be achieved through vaccination .
the prevailing view is that th1 responses are essential for the control of parasite multiplication .
previously , we have demonstrated that parasite - specific cytotoxic immune responses are developed by individuals living in areas of l. major transmission and could play a crucial role in resistance to reinfection [ 6 , 7 ] .
therefore , it seems that elucidation of the specific effective immunological mechanisms and the cell populations operating in the resistance against human leishmania infection is fundamental for vaccine development . in this setting , we were interested in the excreted / secreted proteins of leishmania major .
indeed , it has previously been hypothesized that the secreted and surface molecules are mainly important for the establishment of infection , protecting the parasite from the early action of the host immune system and acting as invasive / evasive determinants . in addition , it was reported in animal models that excreted / secreted molecules from other intracellular pathogens , such as mycobacterium tuberculosis and toxoplasma gondii , contain highly immunogenic and protective antigens [ 911 ] .
furthermore , there is evidence that leishmania promastigote culture filtrate proteins eliciting a strong protective immunity against the infection in balb / c mice [ 1214 ] .
similarly , in dogs , l. infantum excreted / secreted antigens inducing a long lasting and strong immune response against canine visceral leishmaniasis [ 1517 ] . in the present study
, we aimed at better evaluating the nature of the cellular effectors involved in leishmania infection by focusing on the cytotoxic immune response induced by the parasite antigens , and at validating lmes as potential target of this immune response .
peripheral blood samples were obtained from 15 individuals living in sidi bouzid governorate ( central tunisia ) ; an endemic area of l. major infection .
these hzcl individuals had characteristic scars of leishmaniasis on skin examination and/or a positive lst ( mean induration > 5 mm ) and/or a positive lymphoproliferative response to soluble leishmania antigens ( sla ) ( table 1 ) .
thirteen healthy individuals living in tunis , a nonendemic region for zcl , were included as healthy controls ( hc ) , ( table 1 ) .
all subjects provided written informed consent for participation in the study and sample collection and analyses .
the protocol was approved by the institutional review board of the pasteur institute of tunis .
l. major parasites ( mhom / tn/94/glc94 , zymodeme mon25 ) were cultured on novy - nicolle - mcneal medium at 26c and progressively adapted to rpmi 1640 medium ( sigma , st .
louis , mo ) containing 2 mm l - glutamine ( sigma , st .
louis , mo ) , 100 u / ml penicillin ( sigma , st .
louis , mo ) , 100 mg / ml streptomycin ( sigma , st .
louis , mo ) , and 10% heat - inactivated fetal calf serum ( fcs ) ( invitrogen , cergy - pontoise , france ) .
proteins were analyzed by sds - page and their concentrations were determined with a bradford protein assay .
lst was performed by intradermal injection of 100 l of leishmanin suspension containing 5 10 l. major promastigotes / ml in 0.5% phenol saline .
after 72 h , the induration was measured along 2 diameters by the ballpoint pen technique .
pbmcs were separated from heparinized blood samples using ficoll - paque ( ge healthcare , uppsala , sweden ) density gradient centrifugation . in some experiments ,
cd8 or cd4 t cells were depleted directly from pbmcs according to the manufacturer 's recommendations ( miltenyi biotec gmbh , bergisch gladbach , germany ) .
cd4cd25 t - lymphocytes were purified by a two - step immunomagnetic technique : purification of cd4 t - lymphocytes using a mab - cocktail ( miltenyi biotec gmbh , bergisch gladbach , germany ) and positive selection of cd4cd25 t - lymphocytes using anti - cd25 magnetic microbeads .
the isolation of cd4cd25cd127 regulatory t cells was also performed in a two - step procedure .
first , the non - cd4 and cd127 cells are indirectly magnetically labeled with a cocktail of biotin - conjugated antibodies . in the second step ,
the cd4cd25cd127 regulatory t cells are directly labeled with cd25 microbeads and isolated by positive selection from the preenriched cd4 t cell fraction .
the purity of each depleted fraction was assessed by flow cytometry and was above 85% for all samples .
total or depleted pbmcs were cultured in 96-well plates at a concentration of 1 10 cells / ml in a final volume of 200 l of complete medium containing rpmi 1640 medium ( sigma , st .
louis , mo ) supplemented with 2 mm l - glutamine ( sigma , st .
louis , mo ) , 100 u / ml penicillin ( sigma , st .
louis , mo ) , 100 g / ml streptomycin ( sigma , st .
louis , mo ) , and 10% ( v / v ) heat - inactivated human ab serum ( sigma , st .
louis , mo ) , 1% hepes ( 0.01 m ) , ( invitrogen , cergy - pontoise , france ) , 1% sodium pyruvate ( 1 mm ) ( invitrogen , cergy - pontoise , france ) , 1% mem non - essential amino acids ( invitrogen , cergy - pontoise , france ) , 1 2-mercaptoethanol ( 10 m ) , ( invitrogen , cergy - pontoise , france ) , and 0.2% gentamicin ( 20 g / ml ) ( invitrogen , cergy - pontoise , france ) .
pbmcs were stimulated with lmes ( 10 g / ml ) or sla ( 10 g / ml ) for five days . the uptake of [ h]-thymidine ( amersham , saclay , france ) was measured after adding 1 mci / well for the last 6 h and evaluated for cell proliferation in a liquid scintillation counter ( rack beta , lkb wallace , australia ) .
results were expressed as a proliferation index : mean counts of triplicates in antigen - stimulated cultures / mean counts of triplicates in unstimulated cultures .
pbmcs were treated with 50 g / ml mitomycin c ( sigma , st .
louis , mo ) at 2 10 cells / ml in rpmi supplemented with 10% fcs for 1 h at 37c followed by 3 washes with rpmi 1640 medium .
these cells were used as antigen - presenting cells ( apcs ) and incubated in the presence of lmes ( 10 g / ml ) , alone or with cd4cd25 , cd4cd25 , or cd4cd25cd127 t cells at different ratio of effector cells / apcs ( 5/1 to 50/1 ) .
the number of apcs was kept constant and the number of effector cells was increasing according to the appropriate ratios .
measurement of grb was carried out using commercially available human granzyme b elisa set ( mabtech ab , nacka strand , sweden ) according to the manufacturer 's recommendations .
opteia set elisa set ( bd biosciences , san jose , ca ) was used to detect ifn-. the results were interpolated from a standard curve using recombinant cytokines and expressed in pg / ml .
pbmcs ( 2 10 cells / well ) were stimulated in vitro for 16 h in presence of lmes ( 10 g / ml ) , or medium alone with golgistop ( bd biosciences , san jose , ca ) added for the last 6 h of culture .
cells were surface stained ( with percp - cd3 , pe - cy7-cd4 , anti - cd28 , anti - cd25 , anti - cd57 , and anti - cd16 coupled to fitc ) , fixed , and permeabilized using bd cytoperm / cytofix plus kit ( bd biosciences , san jose , ca ) according to the manufacturer 's recommendations and stained with pe - conjugated anti - human grb ( fitzgerald industries inc . , biolegend , london , uk ) and apc - conjugated anti - human ifn- ( bd biosciences , san jose , ca ) .
analyses were performed with a facs canto flow cytometer using the facs diva software ( bd biosciences , san jose , ca ) .
the dual elispot assay specific for grb and ifn- was performed to quantify lmes - specific t cells . in brief ,
pbmcs or purified cd4 and cd8 t cells were cultured at room temperature for 30 min in the presence or absence of lmes at a final concentration of 10 g / ml . for positive controls ,
cells under stimulation were then transferred in a pvdf - bottomed - well elispot plate coated with ifn- and grb capture antibodies ( abcam , cambridge , ma ) and incubated overnight in a humidified 5% co2 incubator at 37c .
the plates were further washed and incubated with anti - fitc hrp and streptavidin - alkaline phosphatase conjugates for 1 h at 37c .
the plates were then developed , first using aec buffer and then bcip / nbt buffer .
spots were analyzed using ctl immunospot reader ( ctl analyzers , shaker hights , oh ) .
data were expressed as the mean spot - forming units ( sfu ) per 10 cells calculated after subtracting spots of the negative controls .
mann - whitney test was used for comparison of lymphoproliferative response and induction of grb and ifn- between the different study groups .
correlation between grb and ifn- levels was estimated using spearman 's rank order correlation coefficient .
statistical analyses were performed using spss 10.0 statistical program ( ibm , armork , ny ) .
the effect of leishmania proteins on ifn- and grb production by immune cells was studied in 15 hzcl individuals in whom pbmcs proliferate when stimulated with leishmania antigens ( lmes and sla ) and 6 hc who do not show any pbmc cell proliferation ( figure 1(a ) ) .
leishmania antigens induced significantly high levels of ifn- and grb in culture supernatants of pbmcs from hzcl individuals compared to those of hc ( p < 0.001 and p = 0.009 , resp . ) , ( figures 1(b ) and 1(c ) ) .
interestingly , a highly significant correlation was found between the levels of grb and ifn- produced by leishmania antigen - stimulated pbmcs ( spearman 's rank correlation coefficient ; r = 0.816 , p < 0.0001 ) , ( data not shown ) . in an attempt to better define the features of the cellular population activated by leishmania antigens and
more specifically , to determine the effector cells producing ifn- and grb , cell depletion experiments were done using pbmcs obtained from four representative hzcl individuals and five donors from the hc group .
we first demonstrated that only cd8-depleted pbmcs ( -cd8 ) from hzcl individuals proliferate in response to leishmania antigens ( figure 2(a ) ) .
accordingly , no significant proliferation of cd4-depleted pbmcs ( -cd4 ) was observed in response to stimulation with such antigens .
in addition , only total pbmcs or ( -cd8 ) from hzcl individuals produced high levels of ifn- and grb in response to leishmania antigen stimulation ( figures 2(b ) and 2(c ) ) . in contrast , for the ( -cd4 ) , grb and ifn- were detected at low levels and no significant differences were observed between unstimulated and stimulated conditions ( p > 0.05 ) .
altogether , our results suggest that in response to leishmania antigens , the main effector cells were cd4 t cells in term of cell proliferation and ifn- and grb production . in order to assess
if grb and ifn- are produced by the same populations of cd4 t cells , intracellular production of ifn- and grb in stimulated pbmcs was studied .
flow cytometry analyses performed in 7 hzcl individuals confirmed that stimulation of pbmcs with leishmania antigen proteins induces the production of ifn- and grb by cd4 t lymphocytes in most hzcl individuals ( figure 3 ) .
in fact , a significant high percentage of cd4 t cells positive for grb was obtained following lmes stimulation when compared to that of the unstimulated cells ( p = 0.044 ) .
a similar result was found with regard to the percentage of cd4 t cells positive for ifn- in pbmcs from hzcl individuals stimulated with lmes ( p < 0.0001 ) .
although a high percentage of cd8 t cells and cd57 cells ( nkt cells ) positive for grb was found in hzcl individuals compared to that of hc , this percentage did not augment after lmes stimulation .
similarly , a high percentage of cd4 t cells positive for grb or ifn- was found in response to lmes stimulation in hzcl individuals , yet the absence of a double positive staining of cd4 t cells demonstrated by flow cytometry suggests that both molecules are produced by different cd4 t cell subsets ( figures 4(a ) and 4(b ) ) . to confirm these results and for further characterization of this response , we used the dual color elispot assay .
cd4 t cells were isolated from pbmcs obtained from four hzcl individuals , challenged with lmes , and tested separately for ifn- and grb production .
mitomycin c - treated pbmcs were used as apcs . in response to lmes stimulation ,
the mean number of grb positive spots was 1219.91 ( ds = 979.81 ) sfu/10 cd4 t cells and 9.26 ( ds = 7.09 ) sfu/10 cd4 t cells for ifn- ( figure 4(c ) ) .
considering the fact that cd4cd25 treg cells might have cytolytic effects on target t cells , as well as on apcs through the secretion of grb and perforin , we attempted to track their involvement in the production of grb induced by leishmania antigen stimulation . therefore , the cd4cd25 and cd4cd25 t cells from 4 hzcl individuals and 3 hc were immunomagnetically purified and cultured with autologous pbmcs treated with mitomycin c ( apcs ) at different ratios in presence of lmes , then grb and ifn- production was evaluated .
as shown in figure 5 , both cd4cd25 and cd4cd25 t subsets from immune individuals produced ifn- and grb after lmes stimulation . ifn- and
grb levels were enhanced in parallel to the increase of effector cell / apc ratio and reached the highest levels at the ratio of 50/1 . at this ratio ,
ifn- generated by both t cell populations from hzcl individuals was significantly higher than in hc subjects ( p = 0.028 and p = 0.024 for cd4cd25 and cd4cd25 t cells , resp . ) .
likewise , significant differences were obtained for grb levels when comparing hzcl individuals to hc ( p = 0.034 and p = 0.034 for cd4cd25 and cd4cd25 t cells , resp . ) . to test whether cd4cd25 t cells activated by lmes correspond to regulatory t cells
, cd4cd25cd127 peripheral regulatory t cells were isolated from cryopreserved cells from the same donors and used in a similar experiment .
no ifn- was detected in supernatants of cd4cd25cd127 peripheral regulatory t cells in all tested conditions ( data not shown ) .
in contrast , grb was detected in treg cell culture supernatants , yet with low levels comparing to the previous experiment , and a significant difference was found between unstimulated and stimulated conditions at the ratio of 50/1 ( p = 0.024 ) ( figure 6 ) . taken together
, our data suggest that stimulation by leishmania antigens activates a cd4cd25 regulatory t cell population that produces grb .
the rationale for leishmania vaccine development is provided by the evidence that most individuals that had leishmaniasis or symptomless infection are resistant to subsequent symptomatic infections
this is mostly due to the difficulties in defining the immunopathological and protective mechanisms in leishmania infections , the nature of effector cells involved in the resistance , and the parasite antigens targeted by this immune response . in the present study , we aimed at investigating the potential existence of cytotoxic immune response through grb production against leishmania antigens ex vivo , using cells from individuals with a confirmed previous contact with the parasite .
in addition to leishmania soluble antigens , we have chosen to use leishmania excreted / secreted antigens as previous reports have shown that such proteins , released by the parasite in the phagolysosomal compartment , may constitute interesting targets for the host cellular th1 and cytotoxic immune responses and have been shown to be strongly immunogenic and protective in mice and dogs [ 1217 ] . in humans ,
few reports have described the cellular immunity against leishmania excreted / secreted proteins . herein , we report two important findings .
the first is that leishmania excreted / secreted antigens are able to induce a similar cellular immune response to that induced by sla , in terms of intensity of proliferation and cytokine production . indeed , as these antigens are released into the host cell phagosomes , they might be processed to generate both mhc class ii and class i binding peptides and be presented to effector cells .
our results showed evidence of immunogenicity of these proteins in humans , corroborating the previously published data in different experimental models [ 1217 ] , and suggest that they are target of a cellular immune response .
our second finding is that grb is significantly and specifically produced in response to leishmania antigens in immune individuals .
however , unexpectedly , the main source of grb seems to be cd4 t cells and not cd8 t cells as usually described .
in fact , depletion experiments showed that cd4 are as expected the main source of ifn- , but they also produce high levels of grb in response to leishmania antigens .
interestingly , ifn- and grb production in culture supernatants of stimulated cells from such individuals showed a strong positive correlation ( r = 0.8 ) , though the absence of double positive ifn-grb cells in elispot and flow cytometry analyses showed that grb and ifn- are produced by different cd4 t cell subsets .
flow cytometry analyses also showed high percentages of cd8 t and cd57 t cells ( nkt cells ) positive for grb in hzcl individuals compared with those of hc , but it appears that this increase in percentages is independent of the antigen stimulation and no difference was observed between lmes - stimulated and -unstimulated pbmcs .
nevertheless , the percentage of cd4grb t cells is significantly increased specifically in response to our antigens and these percentages are higher in hzcl individuals compared to those of hc .
to better define these effector cells and check whether regulatory t cells are the source of grb , additional analyses were performed on cd4 t cells .
in fact , studies using mice and human cells suggest that a subset of cd4cd25 t cells can have cytolytic activity .
cd4cd25 t cells isolated from human subjects have been shown to express perforin and grb and exhibit cytotoxicity against a variety of autologous target cells including cd4 and cd8 t cells , cd14 monocytes , and dendritic cells .
our results showed that purified cd4cd25 and cd4cd25 t cell subsets were both able to produce grb and ifn- at high levels in hzcl individuals compared to hc .
finally , in order to discriminate between regulatory and activated t cells , cd4cd25cd127 peripheral regulatory t cells were purified .
our data showed their capacity to produce grb but not ifn- in response to leishmania antigens in hzcl individuals . yet
this could be explained by the use of lower numbers of cells after cell sorting from cryopreserved cells .
altogether , our findings may suggest that regulatory t cells are involved , among other cell populations , in grb production in response to leishmania antigens , suggesting a potential role of a cytotoxic pathway in treg cell immune regulation in leishmaniasis .
treg cells have been reported to use several mechanisms to suppress the activation and proliferation of conventional t cells .
they can modulate the functions of apcs or proceed through the secretion of inhibitory cytokines , such as tgf- , il-10 , and il-35 .
, there is a strong correlation between activation of different t cell subsets and disease outcome .
the th1 response is characterized by secretion of proinflammatory cytokines , while th2 response is associated with anti - inflammatory cytokines , such as il-10 and tgf- , which promote macrophage inactivation and prevent excessive production of protective cytokines . the role of regulatory t cells in cutaneous leishmaniasis has only recently been investigated .
several groups have shown that during l. major infection , cd4cd25 treg cells accumulate at the primary infection site in both humans and mice where they suppress parasite elimination by cd4cd25 effector cells and mediate chronicity , and their depletion leads to parasite clearance [ 2325 ] .
the balance between th1 , th2 , treg , and other effector cells will determine the disease outcome .
in the present study , while we expected a classical cytotoxic immune response where the main effectors are cd8 t cells , our results surprisingly showed that cd4 t cell populations , including treg cells , are rather the ones involved in the immune response against leishmania antigens .
cytotoxic cd4 t cells have been described in several studies and have been implicated in the control of a variety of persistent viral infections , such as ebv , hcv , and hiv-1 infections .
analyses of cytotoxic cd4 t cells indicate that they have lytic granules containing cytotoxic factors , such as granzymes and perforin , and are characterized by a loss of cd28 surface expression .
the involvement of such cd28 cytotoxic t lymphocytes in leishmania infection is currently under investigation in our laboratory .
our study provides new insights and strong evidence regarding the involvement of cd4 t cells producing grb in the immune response against leishmania antigens .
this cell population deserves further consideration during leishmania infection to figure out whether they are actually involved in the promotion of or protection against leishmaniasis development . | the nature of effector cells and the potential immunogenicity of leishmania major excreted / secreted proteins ( lmes ) were evaluated using peripheral blood mononuclear cells ( pbmcs ) from healed zoonotic cutaneous leishmaniasis individuals ( hzcl ) and healthy controls ( hc ) .
first , we found that pbmcs from hzcl individuals proliferate and produce high levels of ifn- and granzyme b ( grb ) , used as a marker of activated cytotoxic t cells , in response to the parasite antigens .
ifn- is produced by cd4 + t cells , but unexpectedly grb is also produced by cd4 + t cells in response to stimulation with lmes , which were found to be as effective as soluble leishmania antigens to induce proliferation and cytokine production by pbmcs from immune individuals . to address the question of regulatory t cell ( tregs ) involvement ,
the frequency of circulating tregs was assessed and found to be higher in hzcl individuals compared to that of hc .
furthermore , both cd4+cd25 + and cd4+cd25 t cells , purified from hzcl individuals , produced ifn- and grb when stimulated with lmes .
additional experiments showed that cd4+cd25+cd127dim/ tregs were involved in grb production .
collectively , our data indicate that lmes are immunogenic in humans and emphasize the involvement of cd4 + t cells including activated and regulatory t cells in the immune response against parasite antigens . |
ribosomes catalyze protein synthesis but have only a few characterized roles in regulating it ( mauro and edelman , 2002 , xue and barna , 2012 ) . rather , the most - studied molecular regulatory mechanisms of translation are mediated by eukaryotic initiation factors , rna binding proteins , and micrornas ( hendrickson et al . , 2009 , fabian and sonenberg , 2012 ) .
the characterized catalytic role of the ribosomes corresponds well to the model of the ribosome as a single complex with a fixed stoichiometry : four ribosomal rnas and 80 core rps ( warner , 1999 , ben - shem et al . , 2011 ) , some of which are represented by several paralogous rps . despite the longstanding interest in ribosome structure and function , the exact stoichiometry and possible heterogeneity of the ribosomes
have been challenging to measure directly ( weber , 1972 , westermann et al . , 1976 , hardy , 1975 ) .
indeed , ms has transformed our understanding of protein complexes , such as proteasomes ( wang et al . , 2007 ) and nuclear pore complexes ( ori et al . , 2013 ) ,
furthermore , quantitative ms has proved useful in characterizing ribosome biogenesis ( chen and williamson , 2013 ) .
komili et al . , 2007 , kondrashov et al . , 2011 ,
2013 ) have demonstrated that ( 1 ) genetic perturbations to the core rps specifically affect the translation of some mrnas but not others and ( 2 ) mrnas coding for core rps are transcribed , spliced , and translated differentially across physiological conditions ( ramagopal and ennis , 1981 , ramagopal , 1990 , parenteau et al . , 2011 , slavov and dawson , 2009 , slavov and botstein , 2011 , slavov and botstein , 2013 , oleary et al . , 2013 , slavov et al .
, 2014 , gupta and warner , 2014 , jovanovic et al . , 2015 ) .
these results suggest the hypothesis ( mauro and edelman , 2002 , gilbert , 2011 , xue and barna , 2012 ) that , depending on the tissue type and the physiological conditions , cells can alter the stoichiometry among the core rps comprising the ribosomes and thus , in turn , alter the translational efficiency of distinct mrnas .
alternatively , differential rp - expression can reflect extra ribosomal functions of the rps ( mazumder et al .
furthermore , polysomes ( multiple ribosomes per mrna ) from different cancer cell lines have similar core rp stoichiometries ( reschke et al . , 2013 ) .
thus , the variable rp stoichiometry in the ribosomes of wild - type cells that is suggested by the ribosome specialization hypothesis remains unproven .
we sought to test whether wild - type cells have ribosomes with differential rp stoichiometry . for this test ,
we chose budding yeast because of our previous observations that rps are differentially transcribed across growth rates ( slavov and botstein , 2011 , slavov and botstein , 2013 ) and that rp levels change differentially between glucose and ethanol carbon source ( slavov et al . , 2014 ) . to investigate whether such differential transcription of rps affects the ribosomal composition
, we used the same media as in our previous experiments , minimal media supplemented with 0.2% glucose . in this media , unlike in rich media supplemented with 2% glucose , yeast cells have a prominent monosomal peak that may reflect different translational regulation ( ashe et al .
, 2000 , castelli et al . , 2011 , vaidyanathan et al . , 2014 ) .
we chose embryonic stem cells to test differential rp stoichiometry in wild - type mammalian cells because of the interesting phenotypes of rp deletions / knockdowns in esc .
for example , haploinsufficiency for rps5 , rps14 , or rps28 interferes with esc differentiation but not with their self - renewal ( fortier et al . , 2015 ) .
furthermore , unlike heteroploid cancer cell lines grown in culture , esc have a high monosomes - to - polysomes ratio , consistent with the possibility of differential translational regulation ( sampath et al . , 2008 , fortier et al . , 2015 ) .
to explore whether the stoichiometry among core rps can vary , we first isolated monosomes and polysomes from exponentially growing mouse embryonic stem cells ( esc ) , doubling every 9 hr , figure s1a .
the esc ribosomes were isolated by velocity sedimentation in sucrose gradients ( figure 1a ) ; see experimental procedures . to confirm that the prominent monosomal peak is reflective of esc biology and not of poor ribosome fractionation
, we also fractionated the ribosomes of neuroprogenitor cells derived from the esc . despite growing three times slower (
doubling time 29 hr ) than the esc , the neuroprogenitor cells have a larger fraction of their ribosomes in polysomal complexes , figure s1b .
( 2008 ) , and thus further bolsters the conclusion that a low polysome - to - monosomes ratio is characteristic of esc . having isolated monosomes and polysomes , we sought to quantify their protein composition .
the proteins from individual sucrose fractions were digested to peptides , labeled with tandem mass tags ( tmt ) , and quantified on orbitrap elite based on the ms2 intensities of the tmt reporter ions ; see supplemental information .
the monosomal sample was quantified in two replicates ( 1a and 1b ) , and the results indicate very high reproducibility ( = 0.92 ; figure 1b ) . to control for protease and peptide biases ,
the proteins from each analyzed sucrose fraction were digested either by trypsin ( t ) or by lys - c ( l ) , and peptides from each digestion were quantified independently .
because of the different specificity of trypsin and lys - c , most rp peptides ( 1,058 ) were identified and quantified only in the trypsin or only in the lys - c digestion , while only 269 peptides were identified and quantified in both digestions .
thus , only very few peptide - specific biases ( such as co - isolation interference ) may be shared between the two digestions
. the measured levels of a unique peptide ( a peptide present in a single rp ) reflect the levels of the corresponding rp , post - translational modifications ( ptms ) of the peptide ( if any ) , and measurement error .
we quantify on average ten distinct rp peptides per rp ( figure s2a ) , and the levels of these peptides allow both the estimation of the rp levels and the consistency of these estimates . to depict both the estimates and their consistency , we display the full distributions of relative levels of all peptides unique to an rp as boxplots in figures 1c and 1d .
the rp levels across the sucrose gradient ( estimated as the median of the levels of unique peptides ) indicate that some rps are enriched in monosomes ( figure 1c ) , while other rps are enriched in polysomes ( figure 1d ) .
each rp group includes proteins from both the large ( 60s ) and the small ( 40s ) subunits of the ribosomes and thus differential loss of 40s or 60s can not account for the rp levels displayed in figures 1c and 1d . indeed , normalizing for the total amount of 40s and 60s proteins in each fraction does not alter significantly the results .
the rp enrichment in figure 1 is substantially higher than the measurement noise , consistent across replicates and across distinct peptides , and highly statistically significant at false discovery rate ( fdr ) < 10 .
the relative levels of all rps with quantified unique peptides are displayed in figure 2 to illustrate the global pattern of rp levels across monosomes and polysomes .
in contrast , the levels of rps buried in the core of the ribosomes remain constant , with estimates fluctuating within the tight bounds of the measurement noise , figure 2 .
this fixed stoichiometry among rps constituting the ribosomal core suggests that even ribosomes lacking some surface rps likely have the same core structure . in principle , if only a few peptides are quantified per rp , the measured peptide variability might reflect reciprocal variability in corresponding ptm isoforms ( if any ) across the sucrose gradients ; e.g. , the unmodified isoform is enriched in monosomes and a phosphorylated isoform is enriched in polysomes .
such differential distribution of ptm isoforms ( if any ) is interesting since it represents another layer of ribosome regulation but can not explain the data for an rp quantified by dozens of peptides spanning the protein length and indicating highly consistent fold changes across the sucrose gradient ; see figures 1 and s2 and supplemental information .
we further tested the differential rp stoichiometry with an independent method , western blots , and in another strain of mouse esc .
consistent with the ms data in figure 2 , the western blot data ( figure s3 ) indicate that rps29 and rps14 are enriched in polysomes , rpl11 is enriched in monosomes , and rpl32 does not change beyond the measurement noise .
having found differential stoichiometry among mouse rps , we sought to further explore ( 1 ) whether such ribosome heterogeneity is conserved to budding yeast and ( 2 ) whether the rp stoichiometry can change with growth conditions and metabolic state . to this end , we employed sucrose gradients to separate the ribosomes from yeast cells grown in minimal media with either glucose or ethanol as the sole source of carbon and energy ( slavov et al . , 2014 ) ; see supplemental information .
consistent with previous observations that the type and the concentration of the carbon source influence the ratio of monosomes to polysomes ( ashe et al .
, 2000 , castelli et al . , 2011 , vaidyanathan et al . ,
2014 ) , the ratio of monosomes to polysomes in our yeast cells grown in 0.4% ethanol ( figure
3a ) or in 0.2% glucose ( figure 3b ) is higher than is typically observed for yeast grown in rich media containing 2% glucose . as in mouse ,
some rps are enriched in monosomes ( figure 3c ) and others in polysomes ( figures 3d and 3e ) .
this enrichment is reproducible ( correlation between replicates = 0.97 ; figure 3f ) and consistent across independent unique peptides whose levels are shown as boxplot distributions in figures 3c and 3d .
we investigated whether the differential levels of rps , both in yeast and in mouse , may reflect the presence of ribosome biogenesis complexes or other extra - ribosomal complexes containing rps .
we estimated that biogenesis factors are over 200-fold less abundant than rps across all samples ( figure s4a ) , and 80-fold less abundant even in the monosomal fractions ( figure s4b ) where ribosome biogenesis particles are enriched ; see supplemental information .
these data suggest that the proteins derived from immature ribosomes can contribute about 1%3% to the rp fold changes , while some measured rp fold changes exceed 100% ( figure 1 ) .
the contribution of immature ribosomes to our rp estimates can be further tested by using the order in which rps are incorporated into the small subunits .
this order has been established for bacterial rps in vitro ( mulder et al . , 2010 ) and confirmed in vivo ( chen and williamson , 2013 ) .
we used this order , as well as the correspondence and nomenclature between orthologous bacterial and mammalian rps ( jenner et al . , 2012 ) ,
to test the trends that are expected if biogenesis particles are abundant enough to influence rp quantification : rps that are incorporated early should be enriched in the monosomal fractions and depleted from polysomal fractions ; the late rps should show the converse trend . while these trends are observed for some rps ( such as s4 and s14 ) , the opposite trends are observed for other rps ( such as s3 , s5 , s11 , and s15 ; figure s4c ) .
the overall pattern of relative rp levels in figure 2 can not be fully accounted for by the order of rp incorporation during ribosome biogenesis ( figure s4c ) .
the pattern of relative rp levels shown in figures 3c3e indicates that rp stoichiometry depends on two factors : the number of ribosomes per mrna ( as in mouse ) and the carbon source in the growth media ; the rp levels that are higher in glucose compared to ethanol also tend to increase with the number of ribosomes per mrna ( figures 3c3e ) .
furthermore , the ratios between the polysomal and monosomal levels of yeast rps correlate to the corresponding ratios for their mouse orthologs ( figure 3 g ; p value < 0.03 ) , suggesting that the rp - stoichiometry differences between monosomes and polysomes are conserved across yeast and mouse .
many yeast rps are represented by two highly homologous paralogs , and we explored whether the exchange among paralogs ( one paralog substituting for the other ) can account for the measured differential stoichiometry in figure 3e . the levels of paralogs localized on the surface of the ribosome , such as rpl17a and rpl17b , are positively correlated and thus inconsistent with paralog exchange across the analyzed ribosomes ( figure 3e ) . in contrast , rps embedded deep in the core of the ribosomes either remain constant ( the estimated fluctuations of their levels are within error bars ) or their paralogs exchange ( e.g. , the levels of rpl37a and rpl37b are anticorrelated ; see figure 3e ) , indicating that each ribosome has a copy of rpl37 . in general , the rps whose levels differ the most among the different fractions are located on the surface of the yeast ribosomes , as can be seen from their 3d color - coded rendition in file s1 ( movie s1 and pdb files ) .
next , we tested the differential rps stoichiometry and its phenotypic consequences by independent fitness measurements .
our observation that the rp stoichiometry depends on the number of ribosomes bound per mrna parallels measurements of higher translational activity of polysomes compared to monosomes ( warner et al .
, 1963 , goodman and rich , 1963 ) ; some studies have even reported that the translational activity per ribosome increases with the number of ribosomes bound per mrna ( noll et al . , 1963 , wettstein et al . , 1963 ) , but this finding has not been widely reproduced .
we therefore hypothesized that genetic deletions of rps enriched in the more active ribosomes as compared to rps enriched in less active ribosomes may result in a larger decrease of the translation rate and thus lower fitness . to test this hypothesis , we computed the correlation ( figure 4a ) between the fitness of yeast strains with single rp gene deletions ( qian et al . , 2012 ) and the corresponding relative rp levels measured in the tetra - ribosomal fraction ( four ribosomes per mrna ) .
consistent with our hypothesis , the fitness of strains lacking rp genes is inversely proportional to the relative levels of the corresponding rps in the tetra - ribosomes ( figure 4a ) . extending this correlation analysis to the rp levels in all sucrose fractions shown in figure 3e results in a correlation pattern ( figure 4b ) that further supports our hypothesis by showing the opposite dependence for fractions with fewer ribosomes per mrna : the fitness of strains lacking rp genes is proportional to the relative levels of the corresponding rps in fractions with fewer ribosomes per mrna ( figure 4b ) .
this correlation pattern holds both for ethanol and for glucose carbon sources . to mitigate possible artifacts in the fitness data due to potential chromosome duplications in the deletion strains
, we computed the correlations between the rp levels and the fitness of the corresponding rp deletion strains only for rps without paralogs ( thus unlikely to be affected by chromosome duplication ) and found much higher magnitudes of the correlations ( figures 4a and 4b ) .
this result suggests that the differential rp stoichiometry is not limited to paralogous rps substituting for each other . to further explore the functional significance of the differential rp stoichiometry , we examined whether polysome - enriched rps are preferentially induced at higher growth rates .
we previously found that the degree of growth - rate - dependent transcriptional induction varies significantly across rps ( brauer et al .
, 2008 , slavov and botstein , 2011 , slavov and botstein , 2013 , slavov et al . , 2012 ) .
we quantified the growth - rate responses of rps by regressing their mrna levels on growth rates and computing growth rate slopes .
the magnitudes of rp growth - rate slopes range from positive ( mrna levels increase with increasing growth rate ) to negative ( mrna levels decrease with increasing growth rate ) , see figure s5 .
analogously to our fitness analysis ( figure 4a ) , we correlated the growth - rate slopes to the relative rp levels from figure 3e .
consistent with our hypothesis , the correlation pattern ( figure 4c ) indicates that the higher the growth - rate slope of a rp , the higher its enrichment in sucrose fractions corresponding to increasing numbers of ribosomes per mrna .
we extended our fitness analysis from yeast to mouse using the published depletion data from crispr knockouts in human esc ( shalem et al . , 2014 ) ; see supplemental information .
we used blast to identify the closest mouse orthologs of each human rp with depletion data ( figure 4d ) and correlated the fitness of human esc lacking the human rp orthologs to the rp levels across sucrose fractions that we measured ( figure 2 ) .
the correlation pattern ( figure 4e ) is similar to the one in yeast ( figures 4a4c ) and highly significant ( fdr < 0.1% ) .
this pattern indicates that the fitness of esc lacking rp genes is directly proportional to the relative rp levels in monosomes and inversely proportional to the relative rp levels in polysomes .
the magnitude of this inverse proportionality increases with the number of ribosomes per mrna ( figure 4e ) , consistent with our hypothesis .
the fact that the fitness of human esc lacking rps correlates significantly to the levels of the corresponding mouse orthologous rps suggests that the differential rp stoichiometry and its biological functions are likely conserved across mouse and human .
the magnitude of this correlation increases when the correlation is computed based only on the orthologs whose sequences are over 80% identical between mouse and human ( figure 4e ) , providing further evidence for the conserved fitness consequences of the altered rp stoichiometry .
for decades , the ribosome has been considered the preeminent example of a large rna - protein complex with a fixed stoichiometry among the constituent core rps ( warner , 1999 , ben - shem et al . , 2011 ) .
however , the direct and precise measurements of rp levels required to support this view have been very challenging . prior to our work , the most direct and precise quantification of rp stoichiometry that we know of is based on measuring the radioactivity from rps labeled with c or h and separated on 2d gels . some of these studies ( weber , 1972 , westermann et al . ,
1976 ) achieved very high precision ( se < 10% ) and reported over 2-fold deviation from 1:1 stoichiometry for multiple rps .
other studies of prokaryotic ribosomes ( hardy , 1975 ) achieved lower precision , and the deviation from 1:1 stoichiometry was within the experimental error of the measurements .
the results reported in weber , 1972 , westermann et al . , 1976 , and hardy ( 1975 ) are all consistent with our findings , albeit our measurements are limited to eukaryotic ribosomes . this prior work and
our measurements reflect population averages across a heterogeneous pool of ribosomes and thus likely underestimate the magnitude of the variability among rp stoichiometries .
a simple mechanism that may account for our observations is that the rates of translation initiation and elongation depend on the rp composition .
ribosomes whose rp composition corresponds to higher ratios between the initiation and the elongation rates are likely to be found in fractions with multiple ribosomes per mrna .
conversely , ribosomes whose rp composition corresponds to lower ratios between the initiation and the elongation rates are likely to be found in fractions with fewer ribosomes per mrna .
indeed , increased growth rate on glucose carbon source that we find associated with altered rp stoichiometry has been previously reported to be associated with faster elongation rates ( bonven and gullv , 1979 , young and bremer , 1976 ) .
velocity sedimentation in sucrose gradients is unlikely to perfectly separate ribosomes based on their rp composition .
for example , short mrnas and the ribosomes translating them can be found only in the fractions containing few ribosomes per mrna regardless of the efficiency of translation and the rp composition of the ribosomes ( arava et al . , 2003 ) .
similarly , even the most highly translated mrna that is likely to be translated by polysome - type ribosomes will go through a stage when only a single ribosome is loaded and thus will be found in the monosomal fraction .
other factors may also contribute to the mixing of different ribosomes in each sucrose fraction , including variation in the mrna length , any degree of ribosome runoff , and mrna shearing during sample handling , if any .
none of these factors , however , is likely to artifactually contribute to the differential rp stoichiometry that we observe .
rather , the presence of ribosomes with different rp compositions in the same sucrose fraction would average out and decrease the differences , resulting in underestimation of the rp variability .
the conserved difference between monosomal and polysomal ribosomes ( figure 3 g ) raises the question about the activity of monosomes , especially given the lower estimates for their translational activity ( warner et al .
the rp levels in figure 3e indicate that the rp composition of trisomes in ethanol is more similar to the composition of monosomes than to tetrasomes .
this observation shows that monosomes may have similar rp composition to polysomes , suggesting that the rp composition of monosomes is not necessarily indicative of a nonfunctional state
. the correlations between rp composition and fitness can be explained by the expectation that the higher the translational activity of a ribosome , the higher the fitness cost of its perturbation in rapidly growing stem cells .
the key factor required for this expectation is the differential rp stoichiometry that we measured . the differential rp stoichiometry in the absence of external perturbations suggests that cells use it as a regulatory mechanism of protein synthesis .
one such example might be the preferential transcriptional induction of polysome - enriched rps at higher growth rates ( figure 4c ) .
variable mammalian rps , such as rps4x , rps14 , rps20 , rpl5 , rpl10 , and rpl27 , directly bind mrnas ( castello et al . , 2012 ,
2013 ) , and this binding might mediate translational regulation as previously suggested ( mauro and edelman , 2002 , landry et al . , 2009 ,
furthermore , deletions or overexpressions of many of the variable rps ( figure 1b ) have well - characterized phenotypes both in development and in cancer .
for example , the knockdown or haploinsufficiency of the polysomally enriched rps19 ( figure 1b ) causes diamond blackfan anemia by selectively affecting the synthesis of some proteins but not of others ( horos et al . , 2012 ) .
interestingly , our data indicate that rps that are frequently mutated in cancers , such as rpl5 and rpl10 ( de keersmaecker et al . , 2013 , lawrence et al . , 2014 ) , are enriched in the monosomes ( figures 1a and 2 ) .
conversely , rps whose ( over)expression promotes cancer , such as rpl30 , rps20 , and rpl39 ( de bortoli et al . , 2006 , dave et al . , 2014 ) , are enriched in the polysomes ( figures 1b and 2 ) .
one interpretation , among others , of these data is that loss of function of monosomally enriched rps or overexpression of polysomally enriched rps might promote protein synthesis and cancer cell growth .
all yeast experiments used a prototrophic diploid strain ( dby12007 ) with a s288c background and wild - type hap1 alleles ( slavov and botstein , 2011 ) .
we grew our cultures in a bioreactor ( lambda laboratory instruments ) using minimal media with the composition of yeast nitrogen base ( ynb ) and supplemented with 2 g / l d - glucose .
mouse embryonic stem cells ( e14 10 passage ) were grown as adherent cultures in 10-cm plates with 10 ml dmem / f12 media supplemented with 10% knockout serum replacement , nonessential amino acids ( neaa supplement ) , 0.1 mm -mercapto - ethanol , 1% penicillin and streptomycin , leukemia inhibitory factor ( lif ; 1,000 u lif / ml ) , and 2i ( gsk3 and mek1/2 inhibitors ) .
both yeast and mouse embryonic stem cells were lysed by vortexing for 10 min with glass beads in cold polysome lysis buffer ( plb ) buffer .
the resulting supernatants were applied to linear 11-ml sucrose gradients ( 10%50% ) and spun at 35,000 rpm in a beckman sw41 rotor either for 3 hr ( for yeast samples ) or for 2.5 hr ( for mouse samples ) .
; writing original draft , n.s . ; writing review and editing , n.s . , s.s . , and a.v.o .
; funding acquisition , a.v.o and n.s . ; resources , a.v.o , e.a . , and n.s . | summaryunderstanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease .
while ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins ( rps ) , some experiments suggest a more variable composition .
testing such variability requires direct and precise quantification of rps .
we used mass spectrometry to directly quantify rps across monosomes and polysomes of mouse embryonic stem cells ( esc ) and budding yeast .
our data show that the stoichiometry among core rps in wild - type yeast cells and esc depends both on the growth conditions and on the number of ribosomes bound per mrna .
furthermore , we find that the fitness of cells with a deleted rp - gene is inversely proportional to the enrichment of the corresponding rp in polysomes . together ,
our findings support the existence of ribosomes with distinct protein composition and physiological function . |
breast cancer evolves from normal epithelium of the terminal duct or lobular unit through a series of increasingly abnormal proliferative lesions beginning with atypical hyperplasia , to premalignant in situ disease , to malignant and increasingly invasive neoplasia [ 13 ] . in situ carcinoma
is characteristically contained within the epithelium , with the basement membrane intact , and without any signs of invasion .
ductal carcinoma in situ ( dcis ) is probably a continuum of successive steps of the same process , with increasing malignant potential as the disease progresses from papillary to comedo forms .
dcis originates by proliferation of the ductal luminal cells , which form protrusions into the lumen , called papillary dcis .
these may become more coalescent , leaving a few empty , rounded spaces , known as cribriform dcis . when the lumen is filled with proliferating cells , it becomes completely obliterated , termed as solid dcis .
central areas of these ducts undergo necrosis because of the ischemic microenvironment , which results in comedo dcis .
er expression is generally low in normal breast epithelium , except for a small peak in the first week of the menstrual cycle . on average ,
approximately 75% of low - grade dcis lesions express er compared to only 30% of the high - grade dcis lesions [ 812 ] .
er positivity is found in up to 60 to 70% of invasive breast cancers [ 13 , 14 ] .
expression of er in dcis alone compared to contiguous dcis associated with invasive carcinoma has been investigated in the past .
one study showed that intraductal carcinoma associated with invasive cancer was more frequently er - positive compared to dcis without associated invasion .there was a strong concordance of er / pgr expression in contiguous dcis associated with invasive cancer ( 98% ) with virtually all cases being er / pgr positive . to our knowledge
there is no literature regarding the hormone receptor status of noncontiguous dcis occurring concurrently in er / pgr - negative invasive cancer .
the current study was undertaken to investigate the hormonal receptor status of dcis of the breast in patients with er / pgr - negative invasive breast cancer .
we reviewed er / pgr immunohistochemical ( ihc ) staining of invasive breast cancer cases performed by the pathology department at winthrop university hospital from 1995 to 2003 .
the stain results were as follows : er+/pgr+ = 358 cases ( 50.4% ) , er+/pgr = 109 cases ( 15.3% ) , er/pgr+ = 56 cases ( 7.9% ) , and er/pgr = 187 cases ( 26.3% ) .
of these , 187 cases of er - negative / pgr - negative breast cancer were the subgroup of interest for this study .
for the purpose of our study , the dcis component for er / pgr analyses was required to be at least 1 mm remote from the border of invasive cancer in order to ensure noncontiguity .
cases with dcis only within the tumor and cases with no residual dcis were excluded from the study . given this strict inclusion criteria , 150 women were excluded from the study . the remaining 37 cases , representing 19.7% of the er / pgr - negative carcinomas and 5.2% of the total group of breast carcinomas , were the subject of er / pgr status of dcis that occurs in association with er / pr - negative invasive breast carcinoma .
er / pgr staining by immunohistochemistry using avidin biotin complex methodology ( abc ) with heat - induced epitope retrieval was performed on all cases of invasive breast carcinoma as a routine test to render prognostic information to clinicians treating these patients .
the positive control had both strong and weak staining of the dcis component and required positive reactivity of the benign terminal duct lobular units .
in addition , all study cases showed positive staining of benign terminal duct lobular units .
all histological sections of er / pgr - negative breast carcinomas were reviewed by two pathologists .
the histological evaluation of dcis type , nuclear grade , presence of intraductal necrosis , and dcis er and pgr staining and stain intensity were evaluated .
a semiquantitative scoring of percentage of positive cells with nuclear staining was used : 0 = no staining , 1 + = 110% staining , 2 + = 1150% staining , and 3 + = > 50% positive nuclear stain .
nuclear er and pgr stain intensity was graded as weak , moderate , or strong .
the study was in compliance with the institutional internal review board ( irb ) for which we received a waiver , as all the subjects in the study were deidentified .
one hundred and eighty - seven invasive cancers were found to be er / pgr negative .
we found a subgroup of 37 cases that had a dcis component at least 1 mm remote from the border of invasive cancer .
sixteen of the 37 er / pgr - negative breast cancer cases ( 43.2% ) had a dcis component showing positive staining for er , pgr , or both er and pgr tables 1 and 2 . upon further analysis , the subtypes of dcis were identified as follows table 3 : 15 percent of cases were comedocarcinoma and 39.4% demonstrated mixed pattern of dcis .
of the cases that demonstrated mixed pattern , 46% contained comedocarcinoma along with another architectural pattern of dcis .
therefore , more than 33% of the patients were found to have comedocarcinoma or a mixed pattern containing comedocarcinoma , a subtype of dcis with poor differentiation .
a majority of the cases ( 60.6% ) showed a high nuclear grade table 4 .
a large percentage of cases thus demonstrated a high nuclear grade and poorly differentiated subtype of dcis suggesting that these lesions are aggressive .
in this study of hormone - negative invasive breast cancer with concurrent noncontiguous dcis , we demonstrate that 43.2% of the cases of dcis were hormone receptor positive .
this is in contrast to prior observations of strong concordance between hormone receptor status of breast tumors containing dcis and contiguous invasive cancer [ 9 , 15 , 16 ] . in a study by bur et al .
, there was a 98% correlation between er positivity in dcis and the invasive component .
dcis associated with an invasive carcinoma was more frequently er positive than dcis without invasion .
all cases of er - negative dcis showed no er expression in the adjacent invasive carcinoma .
barnes and masood also reported a concordance between er status of dcis and the invasive component .
immunohistochemical staining was positive for er in 75% of the dcis , 73% of dcis with invasive cancer , and 100% of atypical hyperplasia . in 29 of 30 cases
er expression of the dcis concurred with that found in the invasive component . these studies , however , only examined dcis that occurred within the invasive cancer . in our study , we examined noncontiguous dcis at least one millimeter apart from the invasive component .
the discrepancy between the current study and previously published ones raises the question of whether er positive and er negative breast cancers arise from distinctly separate clones as in multifocal or multicentric disease , or evolve from one clone .
the best model for breast cancers that arise from different clones is the example of contralateral breast cancer .
there have been a number of studies investigating the er / pgr status in contralateral breast cancer [ 17 , 18 ] . in the study by arpino
the er status of the primary breast cancer ( pbc ) was not related to the hormone receptor status of the subsequent contralateral breast cancer ( cbc ) , suggesting that this was a stochastic stem cell event . in the absence of adjuvant tamoxifen , 88% patients who had an er - positive pbc and 75% who had an er - negative pbc developed an er - positive cbc ( p = 0.11 ) .
the authors concluded that patients with an er - negative pbc were just as likely to develop an er - positive cbc as patients with an er - positive pbc .
this was a retrospective analysis of data from national surgical and adjuvant breast and bowel project trials ( nsabp ) b-18 , b-22 , and b-25 , which demonstrated that among patients who did not receive tamoxifen , 89% with an er - positive pbc had an er - positive cbc and 70% with an er - negative primary breast cancer had an er - negative contralateral breast cancer ( odds ratio = 14.8 ,
the authors concluded that the er status of a primary breast cancer correlates with the er status of a subsequent contralateral tumor , suggesting that another model may be operative .
it is unclear whether hormone receptor - positive and hormone receptor - negative breast cancer are derived from the same or from different stem cells .
the stochastic stem cell model would support the hormone receptor - positive and hormone receptor - negative tumors derived from separate stem cells [ 19 , 20 ] .
a more modern theory postulates that er - positive stem cells can evolve from er - negative ones .
liu et al . recently showed that brca1 regulates human mammary stem / progenitor cell fate . by using in vitro systems and a humanized nod / scid mouse model
, they demonstrated that brca1 expression is required for the differentiation of er - negative stem / progenitor cells to er - positive luminal cells . in our series
most of the cases of er / pgr - positive dcis were in the intermediate grade .
this is consistent with previously published studies . in the study by bur et al .
the nuclear pleomorphism was significantly correlated with absence or low percentage of er staining in dcis .
er - positivity was more likely observed in monomorphic nuclei ( p < 0.001 ) .
barnes and masood also reported that the degree of nuclear polymorphism was generally inversely related to er positivity .
the finding of hormone receptor - positive dcis in as many as 8% cases of hormone receptor - negative invasive breast cancer raises the issue of chemoprevention .
hormonal therapy is not indicated in the treatment of hormone receptor - negative invasive breast cancer .
chemoprevention , however , is widely used in the treatment of dcis . in the 2000 early breast cancer trialists ' collaborative group ( ebctcg )
meta - analysis , compared to no adjuvant therapy , 5 years of tamoxifen was associated with a 41% relative reduction in the risk of recurrence and a 34% relative reduction in the risk of death in women with er+/unknown breast cancers .
in addition , tamoxifen was associated with a 39% reduction in the annual risk of developing a contralateral breast cancer in all er - positive women . in a pooled analysis of nsabp trials , where tamoxifen was only given to all women above 50 years old , swain et al .
also noticed that the use of adjuvant tamoxifen appeared to reduce the risk for developing an er - positive contralateral breast cancer .
however , the same study showed that 30% of patients ( 8 of 27 patients ) with er - negative breast tumors who were not on tamoxifen would develop an er - positive contralateral tumor , identifying a group which may potentially benefit from hormonal therapy .
it is possible that some of these er - positive contralateral tumors may have developed from an er - positive dcis associated with the er - negative invasive primary breast cancer .
in contrast to the studies in invasive breast cancer , hormonal therapy does not appear to be effective in chemoprevention in er - negative dcis .
the nsabp b-24 trial randomized women undergoing breast - sparing surgery and radiation for dcis , to adjuvant tamoxifen versus placebo for 5 years , irrespective of er status .
there was 39% reduction of all ipsilateral and contralateral breast cancer events ( 16.0% in the placebo arm versus 10.0% in the tamoxifen arm ; p = 0.0003 ) .
there was a 31% reduction in the cumulative incidence of ipsilateral breast cancers ( 11.1% with tamoxifen versus 7.7% with placebo , p = 0.02 ) and 47% reduction in the cumulative incidence of contra - lateral breast cancers ( 4.9% versus 2.3% , p = 0.01 ) .
subsequently observed that the subgroups that appears to have benefited the most were er - positive dcis . in those subgroups
tamoxifen was clearly effective ( relative risk for all breast cancer events : 0.41 , p = 0.0002 ) .
significant clinical benefit was achieved in both the ipsilateral and the contralateral breast . in patients with er - negative tumors ,
a very modest benefit was observed ( relative risk for all breast cancer events : 0.80 , p = 0.51 ) .
data from other tamoxifen prevention trials also showed a reduction in breast cancer events that was restricted to er - positive tumors .
based upon the nsabp b-24 results , a new clinical trial for patients with dcis was initiated ( nsabp b-35 ) .
only those patients with localized er / pgr - positive dcis will be randomized to tamoxifen for five years or to anastrozole for five years .
the primary endpoint of the study is to evaluate the effectiveness of anastrozole compared to tamoxifen in preventing subsequent breast cancer events . in summary ,
the finding that er / pgr - positive dcis coexists in a minority of patients with er / pgr - negative breast cancer , raises the issue of chemoprevention in this cohort of patients .
clinically , hormonal therapy is not used in the treatment of er / pgr - negative invasive breast cancer and chemoprevention has not had demonstrated to be of benefit in er / pgr - negative invasive breast cancer or er / pgr - negative dcis .
the finding of er / pgr - positive dcis in some patients with er / pgr - negative breast cancer may be clinically relevant and may necessitate a more careful analysis of the tissue for this setting .
confirmation of our data by other institutions , by centralized immunohistochemistry and reverse - transcription pcr ( rt - pcr ) is warranted . | background . to our knowledge ,
the hormone receptor
status of noncontiguous ductal carcinoma in situ ( dcis ) occurring
concurrently in er / pgr - negative invasive cancer has not been studied .
the current study was undertaken to investigate the er / pgr receptor
status of dcis of the breast in patients with er / pgr - negative invasive
breast cancer .
methods .
we reviewed the
immunohistochemical ( ihc ) staining for er and pgr of 187 consecutive
cases of er / pgr - negative invasive breast cancers , collected from 1995
to 2002 . to meet the criteria for the study
, we evaluated er / pgr
expression of dcis cancer outside of the invasive breast cancer . results . a total of 37 cases of
dcis meeting the above criteria were identified . of these
, 16 cases
( 43.2% ) showed positive staining for er , pgr , or both .
conclusions . in our study of er / pgr - negative
invasive breast cancer we found that in 8% of cases noncontiguous
er / pr - positive dcis was present . in light of this finding
, it may be
important for pathologists to evaluate the er / pgr status of dcis
occurring in the presence of er / pgr - negative invasive cancer , as this
subgroup could be considered for chemoprevention . |
between 25% and 40% of childhood epilepsies are caused by malformations of cortical development ( mcds).1 mcds result from abnormal neuronal and glial proliferation or differentiation ( tuberous sclerosis , focal cortical dysplasia [ fcd ] , hemimegalencephaly ) , anomalous neuronal migration ( subcortical band heterotopia , periventricular nodular heterotopia ) , and abnormal cortical organization ( polymicrogyria , schizencephaly).2 hemimegalencephaly is a rare brain malformation ( occurring in 0.10.3% of children with intractable epilepsy ) caused by anomalous neuronal and glial proliferation or differentiation , with an abnormally enlarged and dysplastic hemisphere.3
4
5 three forms of hemimegalencephaly are described : isolated ( without hemicorporal hypertrophy or cutaneous or systemic involvement ) , syndromic ( associated with other diseases ) , and total ( enlargement of the ipsilateral brainstem and cerebellum ) .
hemispherectomy or hemispheric disconnection is used in young children when other brain regions can take over some functions of the resected brain.6 if resective surgery is impossible , vagus nerve stimulation ( vns ) can be used for seizure palliation.7
the etiology of hemimegalencephaly is not clear .
some authors consider abnormal neuroepithelial cell lineage as the primary cause ; migratory disorders and cellular proliferation are secondary findings.8
9 in a study of resected hemimegalencephalic hemispheres , lee et al found de novo somatic mutations in identified genes ( phosphatidylinositol 3-kinase [ pik3ca ] , the protein akt kinase [ akt3 ] , and a mammalian target of rapamycin [ mtor ] ) that are known to be associated with malignant tumors ( breast and pancreas).10 because of the excessive neuronal and glial proliferation in hemimegalencephaly and also because of genetic changes associated with malignant tumors , an increased incidence of brain tumors might be expected in hemimegalencephalic patients .
however , no data describing glioblastoma development in the hemimegalencephalic hemisphere have been published yet .
we present an exceptional case of a patient with hemimegalencephaly who was followed throughout his life for intractable epilepsy treated with vns , and with glioblastoma development in the hemimegalencephalic hemisphere 6 years after surgery .
an 18-year - old man had been followed in the pediatric neurologic department since neonatal age for severe mental retardation and pharmacoresistant epilepsy .
neurologic examination revealed a slight left - sided hemiparesis , horizontal nystagmus , and convergent strabismus .
there were several seizures types ( myoclonic seizures , simple partial seizures with motor symptoms , complex partial seizures , and generalized tonic - clonic seizures ) .
scalp electroencephalogram revealed epileptic activity predominantly over the right hemisphere ( gradual development of multifocal spike wave complexes with a tendency to generalize ) .
repeated magnetic resonance imaging ( mri ) studies before the subject was 10 years of age proved right hemisphere hemimegalencephaly .
at this point , the patient was referred for surgery , but resection was not indicated .
the last follow - up mri study ( at age 17 years ) confirmed stable findings . after reaching adulthood ( 18 years ) , the patient was referred to the comprehensive epilepsy center for further treatment . because of the intractability of his seizures , surgical treatment was reconsidered .
a detailed mri investigation confirmed the typical features of isolated hemimegalencephaly : increased cortical thickness , cortical - subcortical border blurring , irregular hyperintensity of hypertrophic white matter ( advanced myelination ) with the periventricular maximum also affecting the anterior callosal body , no detectable gray matter heterotopia , and no cerebellar or brainstem hypertrophy ( fig .
because of the patient 's severe mental retardation , multifocal seizure origin , and adult age , resective surgery was contraindicated and vns was implanted . stimulation ( 1.75 ma , 20 hz , 250 microseconds , 30 seconds on , 5 minutes off ) led to a significant reduction in partial and generalized seizures ( > 60% ) , and
( a ) diffuse cortical thickening with some blurring of the cortical - subcortical border , irregular white matter hyperintensity , and right callosal body dysgenesis .
( b ) extent of cortical involvement in the area corresponding to the brain tumor ; note marked cranial asymmetry .
six years after implantation , the patient sought an emergency evaluation after 3 weeks of a severe headache with vomiting that did not respond to analgesics or benzodiazepines , without seizure accumulation .
the patient 's neurologic status remained unchanged : discrete left - sided hemiparesis , horizontal nystagmus , and convergent strabismus . computed tomography revealed an extensive brain tumor affecting the right frontal lobe with marked edema , midline shift , and irregular postcontrast enhancement ; a high - grade glioma was suspected ( fig .
mri was not indicated because of the implanted vns and the patient 's mental retardation , restlessness , and anxiety .
only an incomplete tumor removal was possible because of the deep brain structure involvement and infiltrating growth .
pathologic analysis confirmed a high - grade glial tumor with palisading necrosis , some large bizarre and multinucleated cells , and microvascular proliferation ( fig .
glial fibrillary acidic protein was expressed in most of the tumor cells , and diffuse nuclear p53 positivity was observed .
the final diagnosis was glioblastoma multiforme .
necrotizing glioblastoma with a high degree of anaplasia ( original magnification 100 ; hematoxylin and eosin staining ) .
the patient underwent radiotherapy with shortened fractionation to the residual tumor and tumor bed of 19 2.5 gy .
the seizure frequency remained stable after oncologic treatment , and stimulation parameters were not changed .
the first is the adequacy of the presurgical diagnostic work - up and the clinical course after vns implantation , with attention paid to potential earlier tumor detection .
repeated mri studies confirmed isolated hemimegalencephaly with typical findings ( marked hemispheric enlargement , moderate midline displacement , and moderate dilatation or reduction of the lateral ventricles)9
11 without any indications of brain tumor .
the literature provides only limited data about potential early markers of tumorous changes in hemimegalencephaly .
oikawa et al compared diffusion tensor imaging ( dti ) results in three hemimegalencephalic patients ( a 1-month - old , a 2-month - old , and an 18-year - old adolescent ) with findings of fcd , tuberous sclerosis , and gliomas .
they proposed the use of dti parameters , including fractional anisotropy maps and apparent diffusion coefficient , for evaluating the subcortical white matter adjacent to the blurred gray - white matter margins as a potentially valuable tool for distinguishing hemimegalencephaly from other diseases .
t2-weighted white matter hyperintensity in the hemimegalencephalic hemisphere observed in the older adolescent patient was not found in the small children.12
regarding the clinical course after vns implantation and the possible warning symptoms of brain tumor , it is important to underline the good seizure outcome and psychological improvement of the patient , confirmed on multiple visits , before his sudden deterioration .
the second point concerns the causes of hemimegalencephaly and their potential association with malignant changes .
a large variety of asymmetric brain disorders have a genetic background ( e.g. , sturge - weber syndrome , unilateral familial pachygyria , lhermitte - duclos disease , and progressive hemifacial atrophy).8
9 genetic causes were identified in individual patients with syndromic hemimegalencephaly ( proteus syndrome).13 recently lee et al found de novo somatic gene mutations in the resected tissue from a subgroup of patients operated on for intractable epilepsy ( hemispherectomy ) caused by hemimegalencephaly .
the mutations affected defined genes ( pik3ca , akt3 , and mtor ) regulating cell signaling in response to insulin and growth factors and influencing cell size , proliferation , differentiation , and apoptosis .
the mutations were found in 8 to 40% of sequenced alleles in different brain regions .
therefore , hemimegalencephaly is a genetic mosaic disease caused by the functional increase in the signaling pathways of pik3ca , akt3 , and mtor .
although the mutations are known to be associated with malignant tumors ( breast , pancreas ) , the presence of other mutations is needed for tumor development and dissemination.10
14 neither phosphatase and tensin homolog ( pten ) gene mutation ( proteus syndrome ) nor tuberous sclerosis complex genes ( tsc1 or tsc2 ) were detected in the resected specimen of the hemimegalencephalic hemisphere.15 some features of fcds ( cytomegaly , cortical stratification disruption , stem cell marker expression ) can be related to mtor pathway hyperactivity.16 this pathway is a target of specific inhibitors ( e.g. , sirolimus and everolimus).17
trophic factors may also play an important role in hemimegalencephaly development.8
9 neural growth factor ( ngf ) is important for neuronal growth , differentiation , and survival .
the increased tissue levels of ngf , numerous ngf receptor positive cells , and ngf affinity for cerebral blood vessels and nerve fibers in the hemimegalencephalic hemisphere were confirmed,18 and experimental studies proved a slight increase in tumor growth and tumor cell migration after ngf , as well as the role of ngf as a significant promotor of promigratory and proproliferative glioblastoma activities.19
20
the association of mcd and a malignant brain tumor is a rare event.21 padmalatha et al described a young patient with tuberous sclerosis and glioblastoma.22 the development of glioblastoma after subependymal giant cell astrocytoma resection in a patient with tuberous sclerosis was published , but the tumor was probably radiation induced.23
although exceptional , the association of mcd with a brain tumor should attract the attention of the treating physician to early identification of possible tumor signs .
this requirement is necessary because vns , which complicates a mri study , is implanted in patients with unresectable extensive malformation and intractable epilepsy .
the identification of another factor responsible for tumor formation with a background of these lesions or potential factors limiting tumor formation in a high - risk genetic background lesion is a problem for basic research .
the available data about the genetics of mcd , including hemimegalencephaly , suggest a potentially increased risk of malignant glioma growth in the malformed brain .
although exceptional , clinical articles confirming this risk in tuberous sclerosis patients and this case report , presenting so far unpublished glioblastoma formation in the affected hemisphere , indicate the need for meticulous clinical and radiologic follow - up care for mcd patients including those with hemimegalencephaly . | we present an exceptional case of a patient with hemimegalencephaly and secondary intractable epilepsy treated with vagus nerve stimulation ( vns ) and subsequent glioblastoma development in the hemimegalencephalic hemisphere 6 years after surgery .
vns ( at age 18 years ) led to a 60% reduction of intractable seizures .
however , symptoms of intracranial hypertension suddenly occurred 6 years after surgery .
a computed tomography scan revealed a brain tumor in the hemimegalencephalic hemisphere .
pathologic examination confirmed glioblastoma multiforme .
the genetic background of hemimegalencephaly is discussed here , with attention paid to the available data about the malignant transformation of malformations of cortical development ( mcds ) .
the case points to the need for adequate clinical and radiologic follow - up care for patients with mcds including hemimegalencephaly . |
microarray expression analysis has become one of the most widely used techniques for the assessment of gene expression on a genomic scale , allowing tens of thousands of genes to be assayed in a single experiment .
although the results that have emerged from microarray profiling have been impressive , as the technique has become more widespread the proliferation of platforms and reagents has made comparisons of results from disparate experimental groups a significant challenge .
a further , and possibly more important , need is the ability to make comparisons of gene expression patterns between species .
analysis of gene expression in model organisms , particularly mouse and rat , has become a fundamental tool for the study of human development and disease .
the challenge is linking the genes surveyed in these animal models to the corresponding human genes . to address these issues ,
we have developed resourcerer , a database designed to provide annotation for widely used microarray platforms and to allow the genes represented to be compared within and across species .
resourcerer is built as an extension of the tigr gene indices ( tgi ) and toga , the tigr orthologous gene alignment database ( and y.l .
j. white , unpublished ) , and provides information for the most widely used microarray mammalian gene resources , including the research genetics sequence - verified human cdna clone set ( information about which can be found through ) , the brain molecular anatomy project ( bmap ; generated through nimh / ninds contract n01 mh80014 awarded to the university of iowa ; m.b .
soares , pi ) and nia mouse clone sets , the tigr rat gene index cdna collection , human and mouse 70-mer oligonucleotide sets from operon ( information available through ) , and the affymetrix human , mouse , and rat genechip sets .
additional resource sets from these species can quickly be added ; a number have been , based on user requests , including the affymetrix mouse v2 genechip. in addition , users can submit lists of genbank accession numbers from a single species and find corresponding elements and their orthologs in any of the catalogued array resources .
the relationships captured in resourcerer are based on the analysis of est and gene sequences stored in the tgi and toga databases .
the tgi databases provide an analysis of publicly available est and gene sequence data to identify transcripts , to place them into a genomic context , and to identify orthologs and paralogs where possible .
tgi treats ests and coding sequences as elements of a transcriptome shotgun sequencing project and uses them to assemble ' tentative consensus ' ( tc ) sequences .
ests are downloaded daily from dbest , and are cleaned to remove untrimmed vector , linker , ribosomal , mitochondrial , low quality , and poly(t ) sequences .
coding sequence ( cds ) and cds - join ( coding sequences annotated as spanning multiple genbank records ) features are separately parsed from genbank records and stored locally .
gene and cleaned - est sequences are compared pair - wise to identify overlaps using blast ; sequences with a minimum of 95% identity over a 45 base - pair ( bp ) or longer region are grouped into a cluster .
the sequences within each cluster are assembled at high stringency using cap 3 to produce tc sequences , which are loaded into the appropriate species - specific database .
tcs are annotated to provide a provisional functional assignment , and the resulting gene index database is released through the tgi website .
gene indices can be searched by tc number , the genbank accession number of any est contained within the dataset , or any gene used to build the index .
users can perform a tissue - based search in which the library information in est records is used to generate an ' electronic northern blot ' , identifying the tissue - specificity of expression on the basis of relative est abundance .
dna and protein sequences can also be used to search the gene indices using wu - blast , a gapped blast program developed by warren gish .
the tigr gene indices and the component tc assemblies are maintained within sybase relational databases that allow versioning and heritability to be maintained .
each time a new version of the database is created , novel assemblies , caused by either the joining or the splitting of previous tcs , are assigned a new , unique tc identifier .
database queries using a tc identifier from a previous build return the most current version of that assembly , allowing assemblies to evolve while maintaining functional assignments across multiple releases .
we developed the toga database to provide a cross - reference between the eukaryotic species highly sampled by est and genomic sequencing projects .
starting with the assembled est and gene sequences that comprise the 28 tgi databases , we use high - stringency pair - wise sequence searches and a reflexive , transitive closure process to associate sequence - specific best hits , generating 32,652 tentative orthologue groups ( togs ) .
this allows us to identify putative orthologs and paralogs for known genes , as well as those that exist only as uncharacterized ests , and to provide links to additional information including genome sequence and mapping data .
for each human , mouse , or rat microarray resource ( full details of which are included in table 1 ) , including widely distributed clone sets and the commercially available affymetrix genechips , we loaded the clone or feature identifiers , as appropriate , into the resourcerer database , along with the associated genbank accession numbers and other available annotation data , such as unigene cluster ids , if provided by the creators of the primary resources .
the genbank accession numbers are then used as keys to link these resources to the tc sequences in the appropriate tgi database , and through those , to the orthologs captured in toga ; as the tgi and toga databases are updated , annotations based upon them are updated as well , providing the most current annotation possible . as all data are stored in a relational database , we are then able to make a variety of complex queries . for each represented microarray resource
, resourcerer allows creation of a table of tgi - based annotation for each element of the set , including tc numbers , putative functional assignments , and links to orthologous tcs in the other species ( figure 1 ) .
further , one can use resourcerer to make comparisons between two resource sets derived from the same species , including identifying both the intersection and difference between those sets , with comparisons based on the appropriate species - specific tgi database , or unigene identifiers , if available ( see table 2 for details of the relationships between the different array resources accessed through resourcerer ) .
finally , by using toga , orthologous genes represented in these microarray resources can be identified , facilitating comparisons of gene expression patterns between species ( figure 2 ) .
mouse is the premier organism for the study of mammalian genetics and development , while rat has been extensively used for physiological and pharmacological studies .
mouse and rat genome projects , involving genetic and physical mapping , est sequencing , and genomic sequencing , are underway and progressing rapidly .
consequently , there is a tremendous opportunity to understand disease processes in humans by comparing and contrasting gene expression profiles in both mice and rats , and linking these to patterns observed in human patients .
already , resourcerer has been used to facilitate comparisons between patterns of expression observed in rodent models of tumor metastasis and those seen in patients ( n.h .
resourcerer is freely available from the tigr website , which includes a ' readme ' help file .
users can select a single , existing microarray resource and retrieve an annotation based on the tgi and toga , including functional assignments and links to putative orthologs . selecting two resources derived from the same species allows users to identify either common elements shared by the set or those elements that are unique to either .
if resources from two different species are selected , the user is provided with a set of the elements in each that are orthologous to each other as identified by toga .
finally , users submitting a list of genbank accession numbers representing ests from a single species are provided with annotation as well as the corresponding elements and their orthologs in any of the catalogued array resources .
this work was supported by grants from the us department of energy , the national science foundation , and the national heart , lung , and blood institute .
annotation for individual microarray resource sets is provided by the tgi databases , including functional assignments ( where available ) , links to the tcs for the species in question , links to orthologous tcs in other mammalian species , and unigene cluster ids where available .
using resourcerer , one can identify corresponding orthologous elements in various microarray resources , providing the information necessary to facilitate cross - species comparisons .
note that in this comparison between the nia mouse cdna collection and the operon human oligos , redundancy in the clone set is captured by multiple rows in the table .
array resources currently represented in resourcerer , with the total number of elements in each the research genetics human clone set is their sequence - verified collection .
genechips from affymetrix are listed separately for each species , as well as collectively where , for example , ' affymetrix mouse all ' is mu-74a + mu-74b + mu-74c . in mouse
, the bmap clone set was derived through the brain molecular anatomy project , and the nia clone set was developed by m. ko through a survey of mouse developmental stages .
the tigr rat 13k set was produced through an nhlbi funded project to generate a collection of unique , annotated rat cdna clones .
the number of orthologous and/or corresponding genes shared between array resources across and/or within species , based on the toga and tgi databases the array resources are those listed in table 1 . | microarray expression analysis is providing unprecedented data on gene expression in humans and mammalian model systems .
although such studies provide a tremendous resource for understanding human disease states , one of the significant challenges is cross - referencing the data derived from different species , across diverse expression analysis platforms , in order to properly derive inferences regarding gene expression and disease state . to address this problem ,
we have developed resourcerer , a microarray - resource annotation and cross - reference database built using the analysis of expressed sequence tags ( ests ) and gene sequences provided by the tigr gene index ( tgi ) and tigr orthologous gene alignment ( toga ) databases [ now called eukaryotic gene orthologs ( ego ) ] . |
when managing chronic diseases , understanding the patients perspective in terms of expectations , concerns , and beliefs about their disease could result in better patient
physician communications and consequently improve management of the disease.1 personality traits and health care beliefs are likely to affect patient perceptions of care and could in turn influence the understanding between patients and physicians .
these types of patient traits have been defined as patient s engagement and can be quantified using survey instruments , such as the patient activation measure ( pam).2 studies in patients with chronic conditions have shown that greater engagement ( higher pam score ) is associated with an improvement in patient health - related behaviors.3,4 these data suggest that patients who are better engaged with their disease by actively participating in their own care are more likely to have better health outcomes . for example , programs that promote self - management or patient - centered chronic care initiatives in copd have been shown to reduce health care resource utilization , including copd - related hospital admissions.5,6 patient engagement with their disease can also be reflected in reported or measured adherence to prescribed medication .
good adherence to prescribed copd medication has been associated with reduced all - cause mortality and hospital admissions due to copd exacerbations.7,8 however , adherence among copd patients is often poor.913 we hypothesized that copd patients who report lower levels of engagement or medication adherence would report a greater burden of copd in terms of humanistic impact ( health status ) , symptom control , and health care utilization than patients who report greater engagement or adherence .
further , we aimed to identify factors associated with patients level of engagement with copd and adherence with copd treatment .
the study objectives that were explored in the continuing to confront copd international patient survey , have been described previously;14 a detailed description of the survey sampling methods can be found in the online appendix . this was a population - based survey of 4,343 adults who fulfilled a case definition of copd defined as adults aged 40 years and older who reported 1 ) a physician diagnosis of copd / emphysema , 2 ) a physician diagnosis of chronic bronchitis , or 3 ) met a symptom - based definition of chronic bronchitis and were either taking respiratory medication for their condition or had chronic cough with phlegm most days .
a history of smoking was not required as part of the case definition for this study .
the survey was conducted in 12 countries ; brazil , france , germany , italy , japan , mexico , the netherlands , russia , south korea , spain , the uk , and the us .
participation in the survey was entirely voluntary and confidential , and all subject data were anonymous .
the survey protocol and consent procedure were reviewed by the abt srbi institutional review board ( registered with the office for protection from research risks , health and human services ) and granted an institutional review board exemption as the criteria for exemption under 45 cfr 46.101(b ) ( 2 ) of the united states code of federal regulations were met . in countries where face - to - face interviews were conducted in the respondents home , modest incentives may have been offered ,
the value of which was less than us$6 ( eg , mobile phone top - up card , tea , chocolates ) .
in japan , the members of the online panel were compensated by the panel provider directly , typically 11 .
patients completed a structured questionnaire about their copd disease severity , respiratory symptoms , treatment for copd , health care resource use for exacerbations of copd in the prior 12 months ( number of emergency department visits and number of hospitalizations ) , smoking history and toxic exposures , and overall satisfaction with their doctor s management and treatment of copd .
symptom severity was assessed using the modified medical research council ( mmrc ) dyspnea scale,15 and health status with the copd assessment test ( cat).16,17 the primary hypotheses were addressed using the pam-13,2 and morisky medication adherence scale ( mmas)-8.18 validated translations of the patient reported outcome instruments were used and permission for their use was obtained .
the pam-13 was used to measure patients self - confidence in their role in managing their disease and assertiveness in dealing with the health care systems.2 this scale evaluates patients responsibility , attitude , confidence , knowledge , and understanding of their disease .
pam-13 yields a scaled score ranging from 0 to 100 that assigns a patient to one of four levels :
level 1 ( pam-13 score of 47.0 or lower ) : disengaged and overwhelmedlevel 2 ( pam-13 score of 47.1 to 55.1 ) : becoming aware but still strugglinglevel 3 ( pam-13 score of 55.2 to 67.0 ) : taking actionlevel 4 ( pam-13 score of 67.1 or above ) : maintaining behaviors and pushing further .
level 1 ( pam-13 score of 47.0 or lower ) : disengaged and overwhelmed level 2 ( pam-13 score of 47.1 to 55.1 ) : becoming aware but still struggling level 3 ( pam-13 score of 55.2 to 67.0 ) : taking action level 4 ( pam-13 score of 67.1 or above ) : maintaining behaviors and pushing further .
the mmas-8 is an 8-item , self - reported measure of adherence in recent users of medication ( recall period is 14 days).18 each question is given either a dichotomous or likert scale - type response resulting in an overall score which ranges from 1 to 8 , with higher scores indicating greater adherence .
adherence is classified as low ( score 15 ) , medium ( score 67 ) , or high ( score 8) according to the overall score .
analysis of patient adherence was limited to 3,135 respondents who reported taking medication in the past 14 days and thus were eligible to complete mmas-8 .
all analyses were weighted using a summary survey weight variable to address factors of age and sex sampling specific to each country and also to adjust for the proportion of each country s contribution to the study population .
differences in demographic , clinical , and behavioral traits across levels of pam-13 and mmas-8 were tested using weighted chi - square test for categorical variables and proportional odds model for continuous variables .
weighted logistic regression multivariate models ( proc surveylogistics ) were used to determine factors associated with ( a ) poor adherence ( mmas-8 score < 6 ) and ( b ) poor patient engagement ( pam-13 levels 1 and 2 ) using characteristics showing a significant univariate relationship with each respective outcome and country .
the study objectives that were explored in the continuing to confront copd international patient survey , have been described previously;14 a detailed description of the survey sampling methods can be found in the online appendix . this was a population - based survey of 4,343 adults who fulfilled a case definition of copd defined as adults aged 40 years and older who reported 1 ) a physician diagnosis of copd / emphysema , 2 ) a physician diagnosis of chronic bronchitis , or 3 ) met a symptom - based definition of chronic bronchitis and were either taking respiratory medication for their condition or had chronic cough with phlegm most days .
a history of smoking was not required as part of the case definition for this study .
the survey was conducted in 12 countries ; brazil , france , germany , italy , japan , mexico , the netherlands , russia , south korea , spain , the uk , and the us .
participation in the survey was entirely voluntary and confidential , and all subject data were anonymous .
the survey protocol and consent procedure were reviewed by the abt srbi institutional review board ( registered with the office for protection from research risks , health and human services ) and granted an institutional review board exemption as the criteria for exemption under 45 cfr 46.101(b ) ( 2 ) of the united states code of federal regulations were met . in countries where face - to - face interviews were conducted in the respondents home , modest incentives may have been offered ,
the value of which was less than us$6 ( eg , mobile phone top - up card , tea , chocolates ) .
in japan , the members of the online panel were compensated by the panel provider directly , typically 11 .
patients completed a structured questionnaire about their copd disease severity , respiratory symptoms , treatment for copd , health care resource use for exacerbations of copd in the prior 12 months ( number of emergency department visits and number of hospitalizations ) , smoking history and toxic exposures , and overall satisfaction with their doctor s management and treatment of copd .
symptom severity was assessed using the modified medical research council ( mmrc ) dyspnea scale,15 and health status with the copd assessment test ( cat).16,17 the primary hypotheses were addressed using the pam-13,2 and morisky medication adherence scale ( mmas)-8.18 validated translations of the patient reported outcome instruments were used and permission for their use was obtained .
the pam-13 was used to measure patients self - confidence in their role in managing their disease and assertiveness in dealing with the health care systems.2 this scale evaluates patients responsibility , attitude , confidence , knowledge , and understanding of their disease .
pam-13 yields a scaled score ranging from 0 to 100 that assigns a patient to one of four levels :
level 1 ( pam-13 score of 47.0 or lower ) : disengaged and overwhelmedlevel 2 ( pam-13 score of 47.1 to 55.1 ) : becoming aware but still strugglinglevel 3 ( pam-13 score of 55.2 to 67.0 ) : taking actionlevel 4 ( pam-13 score of 67.1 or above ) : maintaining behaviors and pushing further . level 1 ( pam-13 score of 47.0 or lower ) : disengaged and overwhelmed level 2 ( pam-13 score of 47.1 to 55.1 ) : becoming aware but still struggling level 3 ( pam-13 score of 55.2 to 67.0 ) : taking action level 4 ( pam-13 score of 67.1 or above ) : maintaining behaviors and pushing further .
the mmas-8 is an 8-item , self - reported measure of adherence in recent users of medication ( recall period is 14 days).18 each question is given either a dichotomous or likert scale - type response resulting in an overall score which ranges from 1 to 8 , with higher scores indicating greater adherence .
adherence is classified as low ( score 15 ) , medium ( score 67 ) , or high ( score 8) according to the overall score .
analysis of patient adherence was limited to 3,135 respondents who reported taking medication in the past 14 days and thus were eligible to complete mmas-8 .
all analyses were weighted using a summary survey weight variable to address factors of age and sex sampling specific to each country and also to adjust for the proportion of each country s contribution to the study population .
differences in demographic , clinical , and behavioral traits across levels of pam-13 and mmas-8 were tested using weighted chi - square test for categorical variables and proportional odds model for continuous variables . weighted logistic regression multivariate models ( proc surveylogistics )
were used to determine factors associated with ( a ) poor adherence ( mmas-8 score < 6 ) and ( b ) poor patient engagement ( pam-13 levels 1 and 2 ) using characteristics showing a significant univariate relationship with each respective outcome and country . all analyses were conducted in sas v9.3 .
in the population of 4,343 respondents who fulfilled the survey definition of copd , the mean age was 60.7 years ( standard deviation 12.1 years ) , 48% were male , and 64% were current or former smokers.14 distribution of traits in the subsample not completing the mmas-8 was mostly identical or differed nonsignificantly ( data not shown ) .
the majority of respondents with valid pam-13 scores ( n=4,339 ) indicated high pam-13 scores with 51% scoring at the highest level 4 and 22% at level 3 ( table 1 ) .
however , 15% of respondents were disengaged and overwhelmed by their disease ( level 1 ) and 13% described themselves as struggling with their disease ( level 2 ) . weighted mean
univariate analysis showed that patients with low pam-13 scores were more often male , had lower bmi , reported worse copd - specific health status ( higher cat score ) , worse breathlessness on exertion ( mmrc 2 ) , were less likely to have undergone a past spirometry test , and reported taking fewer copd medications ( table 1 ) .
patients with low pam-13 scores were also more likely to report that they were somewhat or very dissatisfied with how their physician manages their disease ( p<0.001 ) ( figure 1 ; table 1 ) and were less likely to report being involved in treatment decisions / having a disease management plan ( p<0.001 ) ( table 1 ) . in the multivariate model ( using characteristics showing a significant univariate relationship with each respective outcome and including country ) , independent factors associated with low levels of engagement ( pam-13 levels 1 and 2 ) included increased breathlessness ( mmrc score 1 ) , lower patient satisfaction with their doctor , low bmi ( < 18.5 kg / m ; underweight ) , and poorer copd - specific health status ( higher cat score ) ( table 2 ) .
patient adherence results were based on 3,135 ( 72% ) of respondents who reported taking medication in the past 14 days and had completed the mmas-8 .
low mmas-8 scores ( poor adherence ) were reported by 39% of patients , with 35% reporting medium and 27% high adherence ( table 3 ) .
patients with low mmas-8 score were younger , more often females , reported poorer copd - specific health status ( higher cat scores ) , were less likely to have undergone a past spirometry test , and were slightly more likely to have attended an emergency department in the previous 12 months ( table 3 ) . patients reporting low or medium adherence
poor adherers were also more likely to report that they were somewhat or very dissatisfied with how their doctors manage their copd ( p<0.001 ) ( figure 2 ; table 3 ) and were less likely to report being involved in treatment decisions / having a disease management plan ( both p<0.001 ) ( table 3 ) .
in the multivariate analysis , independent predictors of low treatment adherence included younger patients , current smokers , less satisfaction with their doctor s care , and 2 comorbidities , but not copd - specific health status or emergency department visits ( table 4 ) .
the majority of respondents with valid pam-13 scores ( n=4,339 ) indicated high pam-13 scores with 51% scoring at the highest level 4 and 22% at level 3 ( table 1 ) .
however , 15% of respondents were disengaged and overwhelmed by their disease ( level 1 ) and 13% described themselves as struggling with their disease ( level 2 ) . weighted mean
univariate analysis showed that patients with low pam-13 scores were more often male , had lower bmi , reported worse copd - specific health status ( higher cat score ) , worse breathlessness on exertion ( mmrc 2 ) , were less likely to have undergone a past spirometry test , and reported taking fewer copd medications ( table 1 ) .
patients with low pam-13 scores were also more likely to report that they were somewhat or very dissatisfied with how their physician manages their disease ( p<0.001 ) ( figure 1 ; table 1 ) and were less likely to report being involved in treatment decisions / having a disease management plan ( p<0.001 ) ( table 1 ) . in the multivariate model (
using characteristics showing a significant univariate relationship with each respective outcome and including country ) , independent factors associated with low levels of engagement ( pam-13 levels 1 and 2 ) included increased breathlessness ( mmrc score 1 ) , lower patient satisfaction with their doctor , low bmi ( < 18.5 kg / m ; underweight ) , and poorer copd - specific health status ( higher cat score ) ( table 2 ) .
patient adherence results were based on 3,135 ( 72% ) of respondents who reported taking medication in the past 14 days and had completed the mmas-8 .
low mmas-8 scores ( poor adherence ) were reported by 39% of patients , with 35% reporting medium and 27% high adherence ( table 3 ) .
patients with low mmas-8 score were younger , more often females , reported poorer copd - specific health status ( higher cat scores ) , were less likely to have undergone a past spirometry test , and were slightly more likely to have attended an emergency department in the previous 12 months ( table 3 ) . patients reporting low or medium adherence
poor adherers were also more likely to report that they were somewhat or very dissatisfied with how their doctors manage their copd ( p<0.001 ) ( figure 2 ; table 3 ) and were less likely to report being involved in treatment decisions / having a disease management plan ( both p<0.001 ) ( table 3 ) .
in the multivariate analysis , independent predictors of low treatment adherence included younger patients , current smokers , less satisfaction with their doctor s care , and 2 comorbidities , but not copd - specific health status or emergency department visits ( table 4 ) .
in our analysis of the continuing to confront copd international patient survey , we report the first data on patient engagement in a large sample of respondents fulfilling the study definition of copd .
we observed that almost a third ( 28% ) of respondents struggled to understand their copd and were not actively engaged in the management of their disease as indicated by low pam-13 scores .
further , a large number of respondents ( 39% ) reported poor adherence with copd medications as indicated by low mmas-8 scores .
copd patient disengagement and lack of adherence to copd medications were associated with greater symptom burden and poorer satisfaction with health care providers . in a survey of a representative general population sample of almost 18,000 adult residents of the us ,
41% of respondents reported the highest level of engagement,19 comparable with our estimate of 50% of respondents reporting the highest level of engagement .
however , in our survey , more than twice as many patients reported the lowest level of engagement ( 15% vs 7% ) .
low engagement has also been reported to be highly prevalent among patients with other chronic debilitating diseases;2023 however , we identified only one other study reporting data on patient engagement in copd.24 this study of 205 copd patients , which focused on retraining of health behaviors , showed a mean pam-13 score at baseline ( 59.0 ) , which is lower than that reported in our study ( 66.75 ) . when considering medication adherence , it has been reported that in developed countries , 50% of patients with chronic disease do not take their medications as prescribed.25 this level of nonadherence has also been reported in copd patients receiving home nebulizer therapy.26,27 george et al28 used a self - administered questionnaire ( the medication adherence report scale ) to assess adherence in copd patients identified through respiratory support groups and from a pulmonary rehabilitation database , and also reported a higher prevalence of nonadherence ( 63% ) than that reported in the current survey .
another recently published study evaluating the adherence of copd patients in a clinical setting using the mmas-4 reported poor adherence among 29.5% of copd patients , an estimate comparable with our survey.12 these examples illustrate the reported variability in the prevalence of adherence to treatment in copd when assessed using a range of methods or instruments in differing populations .
both of these traits , poor patient engagement and adherence , were related to low levels of satisfaction with copd management by health care professionals , poorer copd - specific health status ( cat score ) , and potentially either more severe or less well - controlled disease as indicated by more frequent emergency department visits . in a multivariate model environment ,
satisfaction with their doctors management of copd appeared as the major factor impacting both engagement and adherence .
patients satisfied with their doctors as well as those feeling more actively involved in decisions about their treatment reported higher engagement and adherence scores .
consistent with this , george et al28 reported that the amount of time doctors spent with patients was a key determinant of medication adherence .
patient relationship is necessary for fostering patient engagement in the consultation.29,30 additional factors independently associated with low engagement were poorer copd - specific health status ( cat ) and the level of reported breathlessness as measured with mmrc .
breathlessness has been described as the most troublesome symptom by patients with copd and is a leading cause of disability.31 while poor engagement was associated with poor copd - specific health status and copd symptoms ( breathlessness ) in multivariate modeling , these relationships were not maintained with the medication adherence outcome in multivariate modeling .
similarly , the relationship between prior health care utilization for copd exacerbations ( hospital / emergency department visits ) , although related to both low engagement and poor adherence on univariate testing , was attenuated for both in the multivariate model .
several factors could have contributed to such observations : patients with high engagement level could potentially represent a mixed population of patients from the extremes of the disease , that is , those with a low disease severity as well as those with severe dyspnea and poor health status .
the potential lack of temporality of self - reported prior emergency department visits and hospitalizations for copd and pam-13 and mmas-8 assessments limits the ability to study any mutual relationships .
further , health care utilization patterns significantly differ across regions and the three geographical areas of asia , south america , and us / europe represented in this survey may have introduced heterogeneity .
we also found a relationship between bmi ( underweight , overweight , and obese ) and low patient engagement .
such a relationship was described by fowles et al in a cohort of us employees.32 in their analysis , lower bmi predicted higher activation .
we have treated bmi as a nonlinear variable , based on our a priori knowledge of an association of bmi with patient reported outcomes in copd;33 hence , we have shown that being underweight , often associated with poorer outcomes in copd , is also related to poorer activation .
other factors that were independent predictors of poor adherence were current smokers , younger age ( < 65 years ) , and presence of 2 comorbidities .
a cross - sectional survey of employees from a large us company , using a medical and pharmacy claims database , also showed for a range of chronic conditions that smokers were significantly less adherent to medications than nonsmokers.34 better adherence in older patients with chronic diseases , including copd , has been shown in other studies.11,35 further , others have reported on an association between increased number of comorbidities and poorer adherence.11 this is an important point for treating physicians .
as the numbers of comorbidities increase , so too typically do the number of medications prescribed to a patient .
our data suggest these represent at risk patients and in particular those who are poorly engaged may be even more likely to be nonadherent to complex and frequently expensive drug regimens .
improved patient engagement may be expected to translate into better control of disease and result in lower disease burden .
however , the continuing to confront copd international patient survey provides cross - sectional data so we can not infer the impact of these findings on long - term outcomes in copd patients . in the area of management of diabetes , patient engagement interventions resulted in modest improvements in intermediate outcomes , such as hemoglobin a1c , but the evidence supporting clinically important outcomes was considered as weak.36 one study in copd assessed the impact of repeated training sessions on patient engagement , disease symptom burden , and health - related quality of life.24 although the intervention significantly improved the level of engagement , disease burden and health - related quality of life remained unchanged , highlighting the need for additional research . for patients , this may involve managing their copd more effectively or could also be a case of better management of their comorbidities , which may also result in better overall health and outcomes.37 however , at the highest level of engagement , patients may still struggle to maintain healthy behaviors but report having the skills and confidence to manage their health more proactively , which may in turn reduce the effect of any intervention.19 a limitation of our results and their interpretation is that the survey sampling method recruited patients from the general population which may have resulted in a patient group reporting milder disease than that usually observed in a health care setting .
a quarter of patients had not taken any medications for copd in the 2 weeks prior to the survey which may reflect a milder population but which could also have been related to cultural variation in access to medication .
in addition , selection bias is another potential limitation of this type of population - based survey . while a large international span across three continents increased the representativeness of the results , it is also likely to have introduced heterogeneity with respect to cultural aspects of expected patient and health care provider roles , and differences in access to health care .
in addition , we assessed disease burden using only a limited number of measures , mainly patient self - reported outcomes .
approximately 80% of the population self - reported that they had undergone a past spirometry test but confirmation of spirometric diagnosis of copd by a review of patient records was not within the scope of this survey .
although a third of our patient population reported that they had never smoked , which is traditionally atypical of a diagnosed copd population , a review by zeng et al38 also reported the high burden of copd in nonsmokers , highlighting the variation in its prevalence across regions .
the frequency of nonsmokers in this study is still higher than in any study in the review by zeng et al in western countries ( around 23% ) , but relatively comparable to the us national health and nutrition examination surveys ( ~32% for patients with spirometry results suggestive of airway obstruction).38,39 finally , despite collecting extensive data on patient characteristics , we can not rule out the fact that unmeasured and important confounding factors may have accrued and impacted our findings .
about a third of patients with copd sampled from the general population do not feel engaged or involved with their copd management and often report nonadherence with treatment .
copd patients reporting disengagement and lack of adherence to copd medications also report greater symptom burden and less satisfaction with their copd management .
further research is needed to identify how best to help these patients and whether psychosocial , cultural , and/or biological factors are driving these associations . | background and aimswe used data from the continuing to confront copd international patient survey to test the hypothesis that patients with copd who report less engagement with their disease management are also more likely to report greater impact of the disease.methodsthis was a population - based , cross - sectional survey of 4,343 subjects aged 40 years from 12 countries , fulfilling a case definition of copd based on self - reported physician diagnosis or symptomatology .
the impact of copd was measured with copd assessment test , modified medical research council dyspnea scale , and hospital admissions and emergency department visits for copd in the prior year .
the 13-item patient activation measure ( pam-13 ) instrument and the 8-item morisky medication adherence scale ( mmas-8 ) were used to measure patient disease engagement and medication adherence , respectively.resultstwenty-eight percent of subjects reported being either disengaged or struggling with their disease ( low engagement : pam-13 levels 1 and 2 ) , and 35% reported poor adherence ( mmas-8 < 6 ) . in univariate analyses , lower pam-13 and mmas-8 scores were significantly associated with poorer copd - specific health status , greater breathlessness and lower bmi ( pam-13 only ) , less satisfaction with their doctor s management of copd , and more emergency department visits . in multivariate regression models , poor satisfaction with their doctor s management of copd was significantly associated with both low pam-13 and mmas-8 scores ; low pam-13 scores were additionally independently associated with higher copd assessment test and modified medical research council scores and low bmi ( underweight).conclusionpoor patient engagement and medication adherence are frequent and associated with worse copd - specific health status , higher health care utilization , and lower satisfaction with health care providers .
more research will be needed to better understand what factors can be modified to improve medication adherence and patient engagement . |
although the prevalence of tobacco use is decreasing , one of five adults in the u.s . still smokes , and cigarette smoking continues to be the leading cause of preventable illness and death .
the highest rates of tobacco use occur among people with the lowest levels of income and education .
low socioeconomic status ( ses ) contributes to higher rates of tobacco use and of tobacco - related morbidity and mortality , and , for those in this category , there is limited access to tobacco cessation treatment and prevention .
low ses and tobacco is an issue for children as well as adults , for 26.2 % of children live in households where someone smokes .
moreover , in households below the poverty line , the percentage is 36.9 % .
children in smoking families have substantial exposure to secondhand smoke ( shs ) , to which there is no risk - free level of exposure .
nearly nine million preschool children are exposed to shs , a cause of low birth weight , sids , asthma , bronchitis , pneumonia , middle ear infection , and other diseases .
although smokers with lower levels of education generally have less knowledge about the negative health effects associated with smoking , many are interested in quitting .
a challenge to tobacco control programs is to make evidence - based cessation strategies available to those in greatest need . in this
regard , head start ( hs ) programs have access to low - ses smokers and to the children most vulnerable to shs exposure .
this paper describes the development of the hs tobacco cessation initiative , a program promoted by the american legacy foundation ( legacy ) , to incorporate into existing services , protocols to engage families in discussions about tobacco use , to identify tobacco users in households , to build partnerships with groups providing cessation services , and to educate families about risks associated with exposure to shs .
this study was approved by the institutional review board of louisiana state university health sciences center ( lsuhsc ) . the concept for engaging hs sites in tobacco cessation developed from a partnership between legacy and the mailman school of public health ( msph ) at columbia university .
free to grow ( ftg ) , a community - based initiative of the msph , provided entry to 15 hs sites . of these
, 4 agreed to participate in the formative phase of the initiative . once the four pilot sites were selected , legacy and msph entered into collaboration with the behavioral and community health sciences program of the lsuhsc school of public health .
the experience of this group in initiating systems change in organizations serving high - risk populations was integral to the development of initiative guidelines , which were designed to enable participating sites to incorporate cessation identification and referral protocols into their existing infrastructures [ 7 , 8 ] .
this group developed protocols for implementing the initiative and strategies for incorporating the initiative into hs programs .
figure 1 illustrates the range of relationships developed among stakeholders involved in the initiative . at the national level , stakeholders included the office of head start , the federal agency responsible for programmatic and fiscal oversight for all hs programs ; the national head start association , a membership - based organization representing hs programs and providing advocacy , training , and technical assistance ; and the environmental protection agency , a federal agency emphasizing prevention of exposure to shs . on the state level , stakeholders included state tobacco control programs and agencies responsible for overseeing tobacco cessation and prevention activities , including the provision of services and administration of grant funding to provider organizations ; the state head start collaboration office , where hs staff members facilitated collaboration among hs agencies and state and local entities as charged by the office of head start ; head start associations , the voluntary organizations in each state representing the interests of the hs programs at the state and local levels ; and state offices of public health , which often house the tobacco control and other maternal and child and chronic disease prevention programs . on the local level , organizations that provide tobacco cessation and prevention services and which were appropriate partners for hs programs were also stakeholders.fig .
the role of legacy in the development of relationships among national , state , and local stakeholders in support of the head start tobacco cessation initiative head start tobacco cessation initiative
the role of legacy in the development of relationships among national , state , and local stakeholders in support of the head start tobacco cessation initiative
there were three phases to this project : formative pilot , program implementation , and site expansion .
program development continued in 2006 with an implementation program in pierce county , washington , and , in 2007 , with a more extensive effort in king county , washington .
the goal of this process was to integrate tobacco control strategies into existing hs infrastructure and protocols and to identify strategies for statewide implementation . since all hs children and their families receive a screening for needs assessment , adding tobacco use and shs exposure to hs forms provided a framework for including tobacco control in existing protocols .
the formative pilot ( phase i ) was designed to determine the feasibility of applying , in an hs setting , strategies to integrate , into existing practices , identification and treatment of tobacco use as recommended by the u.s .
public health service ( usphs ) and engagement of tobacco users for referral to local cessation resources .
the 15-month pilot program was launched at four hs sites that reflected a range of demographic and geographic characteristics . these were umatilla
morrow head start ( umhs ) , in hermiston , oregon ; maui economic opportunity ( meo ) , in wailuku , hawaii ; the marathon county child development agency ( mccda ) in wausau , wisconsin ; and the community action project ( cap ) in tulsa , oklahoma .
umhs has a large latino population ; meo serves a large native hawaiian community ; mccda supports a growing hmong population ; and the cap relates to large african american and hispanic groups .
each of the four sites , which received small seed grants from legacy for creation and implementation of their model programs , developed procedures that reflected their community context within an overall framework of standardized steps designed for implementation in hs centers nationwide .
during phase i , a series of surveys was administered to determine the extent to which the four sites focus on addressing tobacco issues with their hs families .
hs directors completed a modified baseline facility survey ( bfs ) used in the public hospital system in louisiana .
the directors of each hs site were asked to report on center practices and policies regarding tobacco use and cessation services , cessation interventions , efforts to monitor tobacco use among parents , budgets for tobacco control activities , tobacco control practices , policies of affiliated health care providers , and strategies and barriers to increase tobacco cessation activities .
the results indicated that directors of the pilot sites recognized the need to change the priority given to addressing tobacco use among hs families ; could identify system and resource barriers to tobacco cessation education , training , and outreach ; could recommend mechanisms to identify tobacco users ; and could educate staff about tobacco cessation and outreach ( table 1).table 1options for implementation of cessation - related activities developed in head start formative pilot sites in oregon , hawaii , wisconsin , and oklahoma , 20042006cessation activitiesoption 1option 2option 3option 4option 5referral to partner for servicesxxxhs provides services ( staff trained in cessation curriculum)xxxfollow - up by family service workersxxxxquit - linexxxxxpharmacotherapyxxxxxsupport by hs staff ( i.e. , hs - sponsored support group)xxxx options for implementation of cessation - related activities developed in head start formative pilot sites in oregon , hawaii , wisconsin , and oklahoma , 20042006 in october 2004 , 15 people , representing the four sites , attended a 2-day training session .
legacy provided information about nicotine addiction , evidence - based cessation resources , and the principles and practice of brief tobacco intervention ( bti ) , which is effective in helping low - income individuals quit smoking .
legacy also presented training in motivational interviewing ( mi ) , a counseling approach that engages intrinsic motivation .
the participants were then able to ( a ) identify common opportunities and challenges to incorporating tobacco cessation activities into hs environments ; ( b ) draft an implementation plan for cessation activities for presentation to their site directors ; ( c ) identify target populations for inclusion in the cessation models ; and ( d ) perform a preliminary survey of community cessation resources .
personnel at each of the four pilot sites developed cessation models that reflected their community context and partnerships with local agencies addressing tobacco issues .
there were 5 different options for implementation of cessation - related activities ( table 1 ) .
option 1 was limited to identification and referral of household tobacco users to external cessation services and option 5 , the most comprehensive , required hs staff members to include tobacco users on their case loads . most often , pilot sites adopted option 2 , a model requiring systemic changes for identification and documentation of household smoking , referral to community partners for counseling and pharmacotherapy , and support from hs staff .
table 2 outlines the 13-month sequence of events for approval , preparation , and implementation of the tobacco intervention at hs sites . following training and organizational assessments ,
participating sites used their enhanced capacity to address tobacco use among their families.table 2start - up timeline for the tobacco cessation initiative identified in the head start formative pilot , 20042006activitiesmonths12345678910111213assess interest of stakeholders in the initiativexxxxxinitiate trainingxxidentify cessation resources and partnersxxxxprovide additional training , revise protocols , create referral processxxdevelop memoranda of understanding with referral organizationsx start - up timeline for the tobacco cessation initiative identified in the head start formative pilot , 20042006 the meo site consisted of 15 centers with 70 staff members serving 298 families .
two hs and eight staff members of partner organizations were trained to provide cessation services .
of the 66 hs households identified as having at least one smoker , 14 individuals accepted a referral , and five of these made a connection with the cessation resource .
the cap served 1262 families , all of whom were queried about household smokers and interest in cessation .
all households with smokers ( n = 325 ) received smoking cessation educational information and referral information .
of these , 45 indicated an interest in attending smoking cessation groups ; 7 participated in one or more sessions ; and 15 reported a contact with the state quit - line .
umhs developed a cessation resource guide and informed their staff members about cessation resources in the community .
parents in selected centers were shown a 5-min video on shs . in conjunction with completing a questionnaire ,
2350 persons who were enrolled in the women , infants and children program received tobacco education .
of the 478 families enrolled in hs centers , 45 had at least one smoker in the household ; seven accepted referral to cessation services ; and 4 connected with the referral resource .
marathon county child development agency used a similar approach , informing 50 staff members about community resources and about referring hs families to community - based cessation providers . in hs households ,
22 were interested in quitting soon ; 28 wanted to quit in the next 3060 days ; 16 wanted to quit within the next year ; and 80 were not interested in quitting .
the phase i formative pilot provided data on the feasibility of using systems change strategies to integrate the identification and treatment of tobacco use recommended in the usphs 2000 clinical practice guideline in an hs setting .
it identified common points of access , existing practices , and personnel most likely to engage families about tobacco use .
these activities identified useful strategies that provided a framework for the next phase of the project , program implementation .
phase ii , program implementation , was conducted in pierce county , washington , at seven hs sites .
all hs families were educated about the health risks associated with exposure to shs , and households with tobacco users were assisted with obtaining cessation services .
strategies , identified in phase i , included staff training , systems change , and the establishment of new partnerships .
staff training , conducted by regional and national personnel , included tobacco education classes , introductions to bti and mi , discussion of local and state cessation resources , and alteration of hs forms to identify tobacco users .
forms were modified to include questions on tobacco use among family members , household rules restricting tobacco use , and children s exposure to shs . in phase ii ,
for tobacco programming to occur in tandem with the hs calendar , staff training and system changes were accomplished in the year prior to program initiation .
one finding in this phase was that , in hs , the months of october through february , during which time new and returning students are enrolled and registered , offered the best opportunity to complete training , change forms , and develop new partners .
in 2007 , the initiative was expanded to additional sites as phase iii to include public health
seattle & king county ( phskc ) in seattle , washington , and 12 hs sites , which included 219 staff members and the capacity for 1,294 child enrollees .
this phase focused on expanding the reach of the initiative and understanding the level of technical assistance and stakeholder involvement needed for implementation .
the majority of these sites were served by an agency that also served the phase ii sites in king county and had been exposed to form changes through this agency before phase iii began .
baseline assessment of new sites was accomplished by interviews with the site directors or their designee between january and march , 2008 . for follow - up , the assessment was re - administered one year later .
as in pierce county , the hs staff in king county received training regarding problems associated with use of tobacco , bti , mi , and local cessation resources .
phskc also made small reimbursement - based grants of $ 2,500 available to sites each of 2 years .
representatives from nine of the sites attended a two - day group training prior to initiation of the effort in december . at all facilities , on - site
training ranged from 2 to 6 h. one site received an introductory training on tobacco issues , while all others had training on bti .
participating in the training sessions were 101 staff members ( 52 % ) ; representatives from six of the twelve sites completed both pre- and post - training assessments .
assessment of attitudes about shs exposure and tobacco interventions before and after training indicated that staff entered training believing that counseling families about shs exposure and tobacco cessation was important .
prior to training , however , few were confident in their skills for treating tobacco use ; after training , there was a fourfold increase in staff confidence . during phase iii , home visits , site - based support ,
educational groups , and meetings with parents provided opportunities to engage parents about tobacco use . at baseline , both resource and system barriers to addressing tobacco use were identified .
these included lack of knowledge and education , competing priorities for resources and time , and the lack of a system for screening and utilizing information on smoking status .
ten sites participated in a 12-month follow up and reported increases in staff training to conduct brief interventions for tobacco use ( from 1 to 10 sites ) , delivery of tobacco interventions ( from 4 to 9 for advising , 6 to 10 for referring ) , systems to document tobacco use and smoke exposure ( from 7 to 9 ) , and use of data regarding family tobacco use and shs exposure to provide resources ( from 6 to 10 ) .
nine sites reported working with 109 families to address tobacco use and exposure to shs , and one site introduced a written plan for addressing tobacco use and shs exposure .
competing priorities and lack of systems persisted as barriers at follow - up , but lack of knowledge did not .
the hs tobacco cessation initiative was grounded in a systems - change approach designed to increase the capacity of hs centers in addressing high rates of tobacco use among low ses families and the exposure of children to shs .
strategies included adding questions about tobacco use to hs standard forms ; enhancing protocols to assess tobacco use ; helping administration and staff understand why tobacco control should be a priority ; and training staff in how to engage family members in discussions about tobacco use , shs exposure risks , and cessation , and to make appropriate referrals to cessation support groups .
protocols and activities associated with the initiative were incorporated into the routine operations of hs centers and their partners . in phase
i , three steps were identified as essential for implementation of cessation support within the hs structure : ( 1 ) training to increase staff knowledge of the effects of tobacco use and skill building in the use of mi and bti ; ( 2 ) establishing relationships with local and state tobacco cessation providers ; and ( 3 ) revising hs protocols to identify , engage , and refer family members who use tobacco to appropriate cessation services .
phase ii confirmed the following : ( 1 ) county health departments will support hs and provide resources to engage families about tobacco use and shs exposure and provide technical assistance to ensure implementation of newly acquired skills , such as mi and bti .
( 2 ) existing assessment protocols and family support practices within hs programs provide a point of access for identifying tobacco users .
embedding tobacco questions in the hs forms allows discussions about tobacco use and permits staff to explore readiness to make a quit attempt and willingness to ban or restrict household tobacco use .
( 3 ) modifying forms and program practices should begin 69 months prior to the start of a school year and should include input from governing entities and site personnel . in phase iii , resource and system barriers to addressing tobacco use
were a key focus , and staff training was identified as an essential component of the initiative .
follow - up assessment found changes in practices to deliver tobacco interventions , including systematic changes in documentation .
previous studies indicate that after participation in an mi counseling session , parents smoked fewer cigarettes and household nicotine levels decreased [ 13 , 14 ] . in this initiative ,
mi was identified as an important skill useful to hs staff for engaging families about tobacco use .
the systems changes observed in this project required the support of administrators and others responsible for shaping programmatic focus and for building staff support and capacity . program directors participated in discussions about the importance of addressing tobacco use among hs families , training staff to engage families about tobacco use , and including tobacco assessment and engagement as a component of staff supervision .
each was considered a catalyst for adoption of the initiative , and for improving the acceptability of engaging families about tobacco use as a part of the commitment to the well - being of the enrolled children .
implementation of the initiative required formation of relationships between hs staff and local health departments , cessation providers , state health departments , and state quit - line providers . as such , system changes will be more likely achieved when the national office of head start adopts performance standards that specifically address tobacco use and shs exposure .
limitations : while aspects of systems change could be directly observed ( e.g. , changes to forms ) , changes in practice ( e.g. , increased advising ) were measured by report of site directors or designees .
direct measurement of these changes and the extent to which they are sustained is warranted . to achieve widespread changes in hs staff and family behaviors
, implementation must focus building a sustainable delivery model that includes training personnel to interact with the priority population and expanding strategically across hs sites .
applying system strategies in non - clinical settings such as hs offers a way to improve health and quality of life of preschool children at risk for exposure to shs .
nationwide application will require broadening the cadre of stakeholders so that national policy can shape practice , and local practices can be supported by state and local entities promoting tobacco control . | tobacco use continues to be the leading cause of preventable illness and death in the united states .
remarkably , more than nine million preschool - aged children are exposed to secondhand smoke , resulting in increased rates of morbidity and mortality .
even more disturbing is that tobacco use is highest among people with the lowest levels of income and education .
thus , reaching these populations is a challenge facing tobacco control programs .
this report describes an innovative pilot project implementing a systems change model that involves multiple stakeholders in integrating evidence - based cessation strategies into federal head start programs , which serve low - income adults and their children .
the tobacco cessation initiative was developed through a partnership between the american legacy foundation , the mailman school of public health at columbia university , and the louisiana state university health sciences center school of public health .
the partnership developed guidelines to fit into the overall mission of head start by enabling participating sites to incorporate tobacco cessation identification and referral protocols into their existing infrastructures .
this program allowed head start sites to incorporate , into their existing family services , protocols for user identification and referral ; build partnerships with groups supporting tobacco cessation ; link families to cessation services ; and educate families about risks associated with exposure to secondhand smoke .
applying system strategies in non - clinical settings such as head start offers a way to improve the health and quality of life of preschool children at the highest risk for exposure to secondhand smoke . |
tumors on the surface of the skin are generally visible and considered to be easily recognizable both for health - care professionals and for the patients themselves . however , people with neglected advanced skin neoplasms are still encountered in dermatological practice in the 21st century .
there can be numerous causes of the delay in the diagnosis : the person may fear the diagnosis and the treatment or become accustomed to the usually slowly - growing tumor .
old age , a low social milieu , and an inadequate hygienic culture may also be factors explaining why some people are not aware of the significance of a delayed diagnosis .
basal cell carcinoma ( bcc ) is the most common cutaneous tumor and one of the most frequent skin diseases observed by dermatologists [ 1 , 2 ] .
most of these tumors arise in the head and neck area , particularly in the elderly , and usually grow slowly .
the metastatic potential is very low and is mainly detected in association with aggressive or long - standing , large neglected tumors [ 14 ] .
the characteristics of bccs suggest that they might well be the ideal candidates for neglected tumors . during the past 10 years
, 5 neglected advanced cases of bcc were diagnosed in our regional center of dermatological oncology .
the main clinical characteristics of the patients and the treatment applied are listed in table 1 .
case 1when a 44-year - old male first sought for medical advice in december 2009 , he had already had a mutilating , horrifying tumor on the right side of his face for 10 months .
he lived alone in a farmhouse in a rural , but quite densely populated area .
two years previously , his own dog had clawed on the right side of the patient 's nose , with the injury leaving a scar .
eleven months before his presentation , he had suffered another minor injury in the same region caused by a splinter of wood .
a gradually growing , ulcerating lesion had subsequently developed on his face ( figure 1 ) .
the clinical diagnosis was bcc , but the possibility of wegener 's granulomatosis also emerged together with a suspicion of leprosy or some other bacterial infection .
the ct scan revealed an extensive bone defect : the maxillary sinus had perished , half of the nasal bone and the zygomatic arch were missing , and the external wall of the frontal sinus was involved .
the tumor was resected at the oral and maxillofacial surgery department and the defect was covered with a frontotemporal rotation flap and a latissimus dorsi musculocutaneous free flap . in the postoperative period ,
the patient suffered a right - sided temporal lobe emollition of the brain , resulting in left - sided hemiplegia .
the skin layer of the flap necrotized , but the muscular layer remained intact , and healed by secondary epithelialization .
after 6 months , recurrences around the mouth necessitated repeated excisions with a forearm fascio - cutaneous free flap reconstruction .
this flap necrotized in full thickness and it had to be removed , and the defect was closed in a direct manner .
the patient is now tumor - free , but his face has not been reconstructed functionally or esthetically ( figure 3 ) .
his nutrition is solved , and physiotherapy has led to a significant improvement in his extremity movements : he can walk alone and use his left hand .
when a 44-year - old male first sought for medical advice in december 2009 , he had already had a mutilating , horrifying tumor on the right side of his face for 10 months .
he lived alone in a farmhouse in a rural , but quite densely populated area .
two years previously , his own dog had clawed on the right side of the patient 's nose , with the injury leaving a scar .
eleven months before his presentation , he had suffered another minor injury in the same region caused by a splinter of wood .
a gradually growing , ulcerating lesion had subsequently developed on his face ( figure 1 ) .
the clinical diagnosis was bcc , but the possibility of wegener 's granulomatosis also emerged together with a suspicion of leprosy or some other bacterial infection .
the ct scan revealed an extensive bone defect : the maxillary sinus had perished , half of the nasal bone and the zygomatic arch were missing , and the external wall of the frontal sinus was involved .
the tumor was resected at the oral and maxillofacial surgery department and the defect was covered with a frontotemporal rotation flap and a latissimus dorsi musculocutaneous free flap . in the postoperative period ,
the patient suffered a right - sided temporal lobe emollition of the brain , resulting in left - sided hemiplegia .
the skin layer of the flap necrotized , but the muscular layer remained intact , and healed by secondary epithelialization .
after 6 months , recurrences around the mouth necessitated repeated excisions with a forearm fascio - cutaneous free flap reconstruction .
this flap necrotized in full thickness and it had to be removed , and the defect was closed in a direct manner .
the patient is now tumor - free , but his face has not been reconstructed functionally or esthetically ( figure 3 ) .
his nutrition is solved , and physiotherapy has led to a significant improvement in his extremity movements : he can walk alone and use his left hand .
case 2a 96-year - old female , living in a small town , presented in november 2007 with a 2-year history of a growing tumorous mass in the right inguinal region .
the tumor was removed and the histopathology confirmed the presence of squamous cell carcinoma ( scc ) .
at the same time , an ulcerated tumor on the right parieto - occipital region of her head was diagnosed clinically as bcc .
excision or irradiation therapy was planned after the removal of the inguinal tumor , but the patient did not continue the treatment . in 2009 , she received neurosurgical treatment and was then referred to dermatology because of her growing cranial tumor ( figure 4 ) .
an incisional biopsy from this tumor confirmed the diagnosis of bcc . in view of her age and
the size and extent of the tumor , the multidisciplinary oncology team decided on irradiation therapy .
this caused the tumor to regress , leaving an ulcer with visible bone at the base .
in the meantime , the scc recurred in the left groin lymph nodes , but no other dissemination was detected and the tumor mass remained stable for several months .
a 96-year - old female , living in a small town , presented in november 2007 with a 2-year history of a growing tumorous mass in the right inguinal region .
the tumor was removed and the histopathology confirmed the presence of squamous cell carcinoma ( scc ) . at the same time , an ulcerated tumor on the right parieto - occipital region of her head was diagnosed clinically as bcc .
excision or irradiation therapy was planned after the removal of the inguinal tumor , but the patient did not continue the treatment . in 2009
, she received neurosurgical treatment and was then referred to dermatology because of her growing cranial tumor ( figure 4 ) .
an incisional biopsy from this tumor confirmed the diagnosis of bcc . in view of her age and the size and extent of the tumor , the multidisciplinary oncology team decided on irradiation therapy .
this caused the tumor to regress , leaving an ulcer with visible bone at the base .
in the meantime , the scc recurred in the left groin lymph nodes , but no other dissemination was detected and the tumor mass remained stable for several months .
case 3a 63-year - old man living in an agricultural town had had a small exophytic skin - colored nodule in the middle of his back for many years .
this had started to grow rapidly and become ulcerated during the past few months . by his first medical visit in september 2009 , suppurative inflammation with abscess formation
consequently , an incisional biopsy and incision of the abscess were initially performed , and systemic antibiotic therapy was administered .
laboratory tests revealed that the patient had previously unrecognized non - insulin - dependent diabetes mellitus . in a second operation , the whole tumor was removed with conservative wound care because of the inflammation .
the patient at first participated in regular surgical followup and treatment of the remaining ulcer , but he later failed to appear for the oncology followup .
a 63-year - old man living in an agricultural town had had a small exophytic skin - colored nodule in the middle of his back for many years . this had started to grow rapidly and become ulcerated during the past few months . by his first medical visit in september 2009 , suppurative inflammation with abscess formation
consequently , an incisional biopsy and incision of the abscess were initially performed , and systemic antibiotic therapy was administered .
laboratory tests revealed that the patient had previously unrecognized non - insulin - dependent diabetes mellitus . in a second operation , the whole tumor was removed with conservative wound care because of the inflammation .
the patient at first participated in regular surgical followup and treatment of the remaining ulcer , but he later failed to appear for the oncology followup .
case 4an 84-year - old male resident in an agricultural village presented in september 2008 with numerous actinic keratoses on his head and neck and with a slowly growing tumorous mass in the presternal area , which he had observed one year previously ( figure 6 ) .
the tumor which proved to be a bcc was removed with free surgical margin and the defect was covered by a mesh - graft skin transplant . at the same time , an in situ superficially spreading malignant melanoma in a melanocytic nevus was removed from his back .
an 84-year - old male resident in an agricultural village presented in september 2008 with numerous actinic keratoses on his head and neck and with a slowly growing tumorous mass in the presternal area , which he had observed one year previously ( figure 6 ) .
the tumor which proved to be a bcc was removed with free surgical margin and the defect was covered by a mesh - graft skin transplant . at the same time , an in situ superficially spreading malignant melanoma in a melanocytic nevus was removed from his back .
case 5a 68-year - old male , living in a village , underwent renal transplantation in 1995 and had subsequently received immunosuppressive therapy . a slowly growing tumor developed on the right side of his neck one year prior to his clinical presentation in 2009 .
additionally , there were two small sccs in the preauricular region and on the right ear ( figure 7 ) .
a 68-year - old male , living in a village , underwent renal transplantation in 1995 and had subsequently received immunosuppressive therapy . a slowly growing tumor developed on the right side of his neck one year prior to his clinical presentation in 2009 .
additionally , there were two small sccs in the preauricular region and on the right ear ( figure 7 ) .
around one - third of giant bccs result from patients ' neglect [ 1 , 2 , 5 ] . there can be numerous reasons for delay in seeking medical advice .
the factors are best documented in malignant melanoma cases [ 68 ] , but nonmelanoma skin cancers and mesenchymal tumors [ 913 ] are also seen in neglected forms from time to time
. a low social milieu , inadequate hygienic culture associated with poverty , and a low level of knowledge about skin tumors may be the explanation in some cases .
patients in these circumstances may not be aware of the possible significance of their growing lesion , though most of our patients live in towns or villages where family members , family doctors or neighbors are easily accessible and media campaigns can reach them .
old age and a slowly growing , not painful neoplasm may also result in a delay in seeking medical advice .
the patients may not see properly or not realize the changing and extremely unpleasant clinical picture or they might accept the slowly , but continuously progressing situation . finally a delay may be caused by an incorrect initial diagnosis , although this occurs mainly with melanocytic tumors .
the organ transplanted and/or immunocompromised individuals comprise a special group . in consequence of the immunosuppression ,
it is interesting , that although the patients themselves are more or less aware of the growing tumor , it is usually some external event that finally impels them to seek medical advice , for example , a sudden change in the lesion ( bleeding or sudden growth ) or encouragement by another person ( a family member or friend ) [ 13 , 6 , 7 ] .
a media campaign or a news article may sometimes stimulate a person to visit a physician [ 68 ] .
numerous possibilities are available for ordinary bccs : surgical excision , mohs micrographic surgery , pdt therapy , cryosurgery , immunotherapy , and radiotherapy are the most frequently used techniques [ 1 , 3 ] .
the therapy of neglected cases , however , demands an individual multidisciplinary approach and teamwork .
the treatment of choice is often surgery ( plastic , craniofacial , or neurosurgery ) alone or combined with radiotherapy , with the help of imaging techniques ( ct , mri , and angiography ) .
reconstruction and a long - term followup are usually needed , with the cooperation of medical experts . despite the choice of the best possible treatment modalities ,
bcc , the most common cutaneous tumor , usually develops in the elderly , grows slowly , and has an extremely low metastatic potential making it an ideal candidate for a neglected tumor .
although there are many possibilities for the treatment of bccs , the therapy of such neglected cases always demands an individual and multidisciplinary approach and teamwork . | although tumors on the surface of the skin are considered to be easily recognizable , neglected advanced skin neoplasms are encountered even in the 21st century .
there can be numerous causes of the delay in the diagnosis : fear of the diagnosis and the treatment , becoming accustomed to a slowly growing tumor , old age , a low social milieu , and an inadequate hygienic culture are among the factors leading some people not to seek medical advice .
the treatment of such advanced neoplasms is usually challenging .
the therapy of neglected cases demands an individual multidisciplinary approach and teamwork .
basal cell carcinoma ( bcc ) , the most common cutaneous tumor , usually develops in the elderly , grows slowly , and has an extremely low metastatic potential ; these factors are suggesting that bccs might well be the
ideal candidates for neglected tumors .
five neglected advanced cases of bcc were diagnosed in our dermatological institute between 2000 and 2009 .
the clinical characteristics and treatment modalities of these neoplasms are discussed , together with the possible causes of the neglect . |
cell contacts with the extracellular matrix ( ecm ) provide both cohesive and functional properties in a variety of tissues , such as epithelia , nerves , muscle , and stroma , through specific interactions with cell membrane receptors [ 1 , 2 ] .
all ecms are made up of collagen fibrils and/or networks , proteoglycans as well as specialized glycoproteins such as fibronectin and laminins that are archetypal of interstitial ecm and basement membrane ( bm ) , respectively [ 3 , 4 ] . cells from multiple origins interact with ecm molecules using a variety of receptors , most of them being members of the integrin superfamily .
over 24 distinct integrin heterodimers have been characterized to date , describing the association between 18 and 8 subunits [ 57 ] .
the fact that integrin - mediated connections between the ecm and the cytoplasm regulate key cell functions such as adhesion , migration , proliferation , apoptosis , and differentiation is well recognized [ 811 ] .
epithelia express a wide variety of typical integrin receptors such as the 11 , 21 , 31 , and 64 integrins that serve as collagen and/or laminin receptors [ 1215 ] .
although less well documented in epithelia , the rgd - dependent integrins are another group of receptors that appears to be involved in epithelial cell homeostasis [ 1517 ] .
rgd - dependent integrins include 51- , 81- , and v - containing integrins and are named as such because they specifically recognize the rgd motif , a sequence of three amino acids ( arg - gly - asp ) found in many ecm molecules such as fibronectin and osteopontin [ 5 , 12 , 14 , 15 ] .
collectively , these interactions are termed the rgd - dependent adhesion system ( figure 1 ) .
interestingly , rgd - dependent cell interactions represent a key role in hierarchical assembly and maturation of adhesion structures including focal complexes ( fxs ) , focal adhesions ( fas ) , and fibrillar adhesions ( fbs ) [ 1 , 2 , 18 ] .
therefore , rgd adhesion can by divided into three distinct components , the extracellular component ( e.g. , fibronectin ) , the membrane receptor ( e.g. , the 51 integrin ) , and the intracellular molecule ( e.g. , vinculin ) . moreover
, each component acts in concert with the others to organize and regulate rgd adhesion dynamics . in this paper
, we will focus on the importance of the rgd - dependent adhesion system for human intestinal crypt cell homeostasis ( section 2 ) .
we chose to elaborate on recent findings from our laboratory related to each of the rgd adhesion components , the 81 integrin ( receptor , section 3 ) , integrin - linked kinase ( ilk ) ( intracellular molecule , section 4 ) , and type vi collagen ( ecm , section 5 ) .
the small intestinal epithelium is a useful model to investigate the relationship between cell state and interaction with the ecm because of the well - defined architecture of its renewing unit , the crypt - villus axis . indeed ,
proliferative cells , differentiating cells , and mature functional cells are topologically restricted to distinct compartments : the lower two - thirds of the crypt , upper third of the crypt , and villus , respectively .
gene expression in intestinal crypt cells must therefore be tightly regulated to efficiently control stemness , proliferation , migration , and differentiation in order to ensure the right equilibrium for the production of functional cells destined to renew the villus epithelium [ 19 , 20 ] .
there is strong evidence that cell - matrix interactions are involved in the regulation of these cell functions in the crypt [ 12 , 21 , 22 ] .
for instance , differential spatial expression of laminins in the epithelial bm and their epithelial integrin receptors were observed along the crypt axis while in vitro studies have revealed functional relationships between laminin - binding integrins and specific intestinal cell functions such as proliferation , migration , and differentiation [ 2330 ] .
a schematic illustration of the human crypt - villus axis and the spatial expression of laminins , laminin receptors of the integrin family , and the two classic rgd components fibronectin and the 51 integrin ( as depicted by dark areas ) is shown in figure 2 . moreover ,
another example is the transient expression of the tenascin and osteopontin receptor 91 integrin in the lower third of the crypt of the immature small intestine as well as in proliferative epithelial crypt cells and its reexpression in colon adenocarcinoma cells .
the rgd archetype fibronectin is another ecm component that was found strongly expressed in the epithelial bm of the crypts in both human and small laboratory animals [ 3336 ] .
synthesis and deposition of fibronectin by proliferating intestinal epithelial cells was confirmed in vitro [ 26 , 34 ] .
furthermore , expression of the fibronectin receptors , 51 and v - containing integrins , was found to be associated with intestinal cell proliferation [ 21 , 29 , 37 ] .
taken together , these observations suggest that fibronectin may significantly contribute to the rgd system regulating intestinal crypt cell functions . to investigate this hypothesis , we used a strategy combining expression studies in the intact human intestine and functional studies using hiec cells , a human intestinal epithelial crypt cell model well - characterized for the expression of typical features of intestinal crypt cells [ 3841 ] .
as summarized in the next sections , this experimental approach has led to the identification and characterization of new components of the rgd - dependent adhesion system that emphasize the importance of this adhesion system in human intestinal crypt homeostasis .
initially characterized in the chicken nervous system [ 42 , 43 ] , integrin 81 represents an important rgd - dependent receptor .
ligand binding to integrin 81 was shown to be important for rhoa gtpase activation and subsequent actin stress fiber assembly in vascular smooth muscle cells [ 4547 ] .
integrin 81 was also recently found to play an important role in microfilament organization which was central to rgd - dependent intestinal epithelial crypt cell adhesion .
8 subunit knockdown experiments , carried out in hiec cells , showed that this integrin is important for proper vinculin recruitment to adhesion structures ( figure 3 ) .
intestinal epithelial crypt cells in which 8 was knocked down exhibited lower numbers of vinculin - positive fas compared to controls , while paxillin localization was not affected .
it is well known that rhoa / rock signalling enhances actin stress fiber assembly and increases cell adhesion [ 4951 ] .
rhoa activity was shown to promote scaffolding protein recruitment , including vinculin , to the developing adhesion structures [ 51 , 52 ] .
thus , the increased rhoa activity displayed by 8 knockdown cells leads to the absence or reduced levels of vinculin observed within these cells [ 48 , 53 ] . based on the scheme of adhesion structures hierarchical assembly
, vinculin recruitment occurs at later stages of fx formation , while paxillin is recruited at early stages .
thus , observations made in intestinal epithelial crypt cells suggest that integrin 81 is essential , at this particular stage of fx maturation into fa , via its role in rhoa activation ( figure 3(a ) ) . a similar function
could also be predicted for the collagen - binding integrin 21 , considering the expression of this receptor in undifferentiated intestinal epithelium cells and its participation in rhoa activation [ 44 , 55 , 56 ] .
interestingly , ectopic expression of the enterocytic differentiation associated factor gata-4 in intestinal epithelial crypt cells caused a depletion of 8 subunit expression [ 39 , 48 ] .
in these same cells , reduced levels of 81 were associated with a decrease in cell growth , marked by cyclin d1 inhibition and accumulation of cells in the g1 phase . similarly , decreased rhoa activity
was observed in differentiated and nonproliferative ht29 cells compared to their undifferentiated and proliferative counterparts . together with the role of integrin 81 in rgd - dependent adhesion , these findings support the concept that cell - ecm interactions are crucial to maintaining a proliferative state in epithelial cells , which is anchorage and cell position dependent , reflecting its exclusive localization in the lower crypt of the intact intestine . due to the role of integrin 81 in rgd - dependent cell adhesion and rhoa gtpase activity ,
this receptor was shown to exert a critical influence on intestinal epithelial crypt cell motility .
alteration of rhoa activity was found to modulate migration in different systems [ 49 , 57 ] .
we recently reported that loss of rgd-81 interactions in intestinal epithelial cells caused increased cell migration . from a physiological perspective , proliferating intestinal epithelial cells must be restricted to the lower two - thirds of the crypt to avoid premature terminal differentiation and loss of proliferative capacity [ 38 , 40 ] .
therefore , without necessarily affecting the expression of differentiation master regulator genes , rgd - dependent adhesion plays a major role in regulating cell migration , which in turn is crucial for wound healing , cell differentiation , and tissue integrity [ 24 , 58 , 59 ] .
indeed , integrin receptors , such as 51 and v integrins , play a central role in controlling anoikis or apoptosis by loss of attachment [ 10 , 11 , 60 ] . specifically ,
engagement of 1 integrins was found to be essential to intestinal epithelial cell survival through fak signalling [ 60 , 61 ] .
as mentioned above , integrin 81 is involved in efficient vinculin recruitment to developing adhesion structures [ 48 , 53 ] .
the presence of vinculin in cell - ecm adhesion structures affects cell survival signal transduction . as previously described , hiec cells share a number of features with intestinal epithelial stem cells , including a proliferative and undifferentiated state as well as the expression of several putative stem cell markers .
interestingly , silencing of vinculin expression in f9 embryonic teratocarcinoma cells , another cell model closely related to stem cells , has shown increased resistance to anoikis , while ectopic reexpression of vinculin restored sensitivity to anchorage - dependent survival .
a similar phenomenon was observed in nonadherent 8 knockdown intestinal epithelial crypt cells . in both studies ,
the absence of vinculin combined with the presence of paxillin in primitive adhesion structures prior to loss of adhesion could explain such a phenomenon ( figure 3 ) . at the molecular level
, it has been shown that paxillin exhibits partially overlapping binding sites for fak and vinculin .
thus , the vinculin tail domain appears to compete with fak for paxillin binding . in the presence of vinculin , fak activation would depend on ecm - integrin binding .
however , absence of vinculin leads to a conformational change in adhesion structures which results in constitutive activation of fak when bound to paxillin where fak activity no longer relies on ecm - integrin interactions [ 53 , 63 ] . additionally , nonadherent 81-depleted intestinal epithelial cells showed increased activity of the pi3
a summary of integrin 81 contribution to anoikis regulation in epithelial intestinal crypt cells is presented in figure 3 .
considering the proliferative and highly adaptive capacities of crypt cells , such as stem and transit amplifying cells , rgd - dependent 81 interactions with ecm are suggested to act as a security switch that keeps the detachment of undifferentiated epithelial cells in check .
it is worth noting that none of the five human colorectal cancer cell lines tested were found to express the integrin 8 subunit and that ectopic expression of this rgd - dependent receptor restored sensitivity of malignant cells to anoikis .
the mechanism by which colon cancer cells repress 8 expression to bypass this checkpoint remains unknown .
however , in normal cells , this security step mediated by 81 occupancy is potentially important to support homeostasis in the human intestinal crypt .
new evidence from the literature has shown that colon cancer may originate from defective crypt stem cells .
therefore , in light of the expression of 81 in the region associated with intestinal stem cells , combined with its role in sensitizing epithelial cells to anoikis , it could be speculated that 8 integrin silencing represents a key step in cancer initiation , in order to escape apoptosis upon modification of the malignant stem cell niche or location . in this context , 81 could promote defective progenitor cell elimination , and consequently prevent the onset of ecto - cryptal proliferative structures
. such specific involvement of rgd - dependent integrins is not without precedent since altered expression of other heterodimers has been reported in colon cancer .
for instance , integrin v3 expression has been found to be specifically decreased in anoikis - resistant caco-2 cells .
the intestinal epithelial cell mediates rgd interactions through expression of specific integrin receptors , as observed with 81 , as well as through the production and deposition of rgd ligands , such as fibronectin .
the efficient deposition of fibronectin into the bm relies upon its recognition by rgd - dependent integrins , which mediate its unfolding to expose specific fibronectin structural domains , which in turn mediates the formation of insoluble fibronectin fibrils .
fibronectin deposition is characterized by the formation of specialized cell - matrix contact structures containing integrins , cytosolic proteins , and actin referred to as fibrillar adhesion ( fb ) points .
the integrin - linked kinase ( ilk ) is a constituent of integrin containing adhesion sites where it mediates multiple cellular processes .
ilk is a pseudokinase and scaffolding protein ubiquitously expressed in mammalian cells forming a trimeric complex with pinch and parvins named the ipp complex [ 6870 ] .
ilk interacts with the cytoplasmic domain of integrin 1 and 3 subunits to create a physical link between integrins and the actin cytoskeleton [ 68 , 71 ] .
interestingly , it has been suggested that ilk regulates fibronectin expression / deposition [ 7274 ] and other studies have placed ipp complex members within fa points [ 75 , 76 ] . in vivo ,
fibronectin expression is restricted to the bm underlying epithelial crypt cells and hiec cells produce copious amount of fibronectin and generate numerous well - defined adhesion structures . the expression and roles of ilk
we first focused on the localization of ilk - related components in the small intestine .
as previously observed for fibronectin and integrin 51 in the intact intestine [ 21 , 29 , 33 ] , ilk , pinch-1 -parvin , and -parvin were found to be predominantly expressed by the proliferative epithelial cells of the crypts . in hiec cells , ilk , pinch-1 , -parvin , and -parvin were all closely associated with fa points ( figure 4(a ) ) .
a sirna strategy was used to knock down ilk expression in hiec cells in order to further investigate the role of ilk in intestinal crypt cells .
interestingly , ilk knockdown in hiec was accompanied by severe disruption of the ipp complex including the loss of pinch-1 and parvins as well as major alterations in fibronectin synthesis and functional matrix deposition ( figure 4(b ) ) .
overexpression of ilk was previously shown to increase fibronectin deposition in rat intestinal cells while ilk knockdown decreases fibronectin expression in mice and human colon cancer cells .
indeed , the fibronectin gene promoter contains response elements that have been shown to be potentially regulated by ilk - mediated signalling [ 68 , 77 ] .
however , in hiec cells , although a reduction of fibronectin was observed at the transcript level , ilk knockdown had no net effect on fibronectin protein amounts found in the culture medium suggesting that it was mainly the ability to process and deposit soluble fibronectin that was altered by the loss of the ipp complex . the exact mechanism by which ilk knockdown impairs fibronectin deposition remains to be elucidated .
expression levels of the fibronectin integrin receptors were not altered in hiec ilk knockdown cells suggesting that the required receptors for fibrillogenesis remain available for binding . however , because of the important scaffolding role of ilk and ipp complexes , the decrease of fibronectin deposition in these ilk - deficient cells may reflect a reduction in the cytoskeletal tension necessary for fibrillogenesis [ 78 , 79 ] . alternatively , alteration in signalization pathways may also be involved .
indeed , key signalling molecules such as src , pi3 k , and erk have been shown to modulate fibronectin deposition in various cell models [ 8082 ] and ilk and the ipp complexes can regulate these signalling molecules [ 8385 ] .
in addition to an alteration in fibronectin deposition , ilk knockdown severely affected basic intestinal crypt cell functions such as cell spreading , migration restitution abilities as well as cell proliferation .
alterations in these functions in ilk - knockdown hiec cells were not surprising since these functions can be stimulated by fibronectin in intestinal epithelial cells [ 8689 ] .
interestingly , exogenously deposited fibronectin was found to fully rescue the ilk - knockdown hiec phenotype with regard to cell proliferation , spreading and migration . taken together , as summarized in figure 4 ,
these data reveal that ilk and , by extension , the ipp complexes , perform crucial roles in the control of human intestinal crypt cell homeostasis , especially as key mediator of fibronectin deposition in the bm , which in turn regulates cell proliferation , migration , and restitution .
type vi collagen is a ubiquitously expressed ecm component . in interstitial ecm , collagen vi acts as an anchoring meshwork bridging collagen fibers to the surrounding matrix [ 91 , 92 ] .
collagen vi has also been shown to directly interact with the bm - specific type iv collagen supporting a key role for this collagen in connecting bm to ecm [ 94 , 95 ] . however , we recently identified collagen vi as a bona fide component of the basal lamina in the intestinal bm and found that it is synthesized in significant amounts by crypt epithelial cells . to investigate the function of type vi collagen in the intestinal epithelial crypt cell
, we used a similar knockdown strategy with hiec cells as described in the previous sections for integrin the 8 subunit and ilk .
surprisingly , abolition of collagen vi expression resulted in a striking increase in cell size and spreading accompanied by a significant increase in the number of stress fibers and tensin recruitment at the fb points .
the observations that removal of collagen vi emphasized features normally associated with fibronectin suggested that collagen vi regulates fibronectin assembly in epithelial cells .
interactions between collagen vi and fibronectin have been previously reported [ 93 , 96 ] .
further investigation in collagen - vi - depleted hiec cells revealed that fibronectin was increased at both protein and transcript levels and was subjected to extracellular rearrangement into long , parallel fibrils .
importantly , exogenous collagen vi , but not collagen i or iv , was able to fully rescue the knockdown phenotype indicating that the effect is specific for type vi collagen . considering that exposure of fibronectin - binding sites is critical for both cell binding and fibrillogenesis [ 67 , 97 ] , one may hypothesize that , under normal conditions , collagen vi acts by limiting cellular accessibility to fibronectin through competition for integrin receptors ( figure 5(a ) ) or by a direct interaction with fibronectin in the ecm ( figure 5(b ) ) .
consistent with this possibility , collagen vi has been reported to be recognized by the rgd - binding 51 and v integrins [ 98100 ] .
furthermore , hiec binding to collagen vi is integrin 1 dependent and it was the fb complexes , specifically enriched in tensin and 51 integrin [ 6 , 54 , 67 ] , that were enhanced in collagen - vi - depleted hiec . to further investigate the mechanism underlying the generation of fb complexes in collagen - vi - depleted intestinal crypt cells , the regulation of actomyosin forces was analyzed .
actin contractility depends on the phosphorylation of the myosin light chain ( mlc ) , which is mainly mediated by the kinases mlc ( mlck ) and rho ( rock ) acting on mlc and myosin phosphatase , respectively [ 101104 ] .
interestingly , mlck - dependent activation of mlc phosphorylation was observed in poor collagen vi / rich fibronectin ecm environments consistent with the observed generation of higher numbers of tensin - enriched fb complexes and extensive fibronectin fibrillar deposition ( figure 5(c ) ) . as summarized in figure 5 ,
these data identified collagen vi as a major regulator of fibronectin synthesis and fibrillogenesis and suggest that collagen vi influences intestinal epithelial crypt cell behaviour by restraining cell - fibronectin interactions and their downstream events .
described as a predominant epithelial bm component in the intestinal crypt more than 3 decades ago [ 3336 ] , fibronectin has been confirmed to play an important role in the rgd system regulating crypt epithelial cell functions .
the recent findings summarized herein further emphasize the crucial importance of this rgd - adhesion system and its regulatory mechanisms . indeed
, intestinal epithelial cells can regulate rgd interactions through expression of specific integrin receptors , as exemplified by 81 , which exerts major regulatory influences on key cell functions such as cell proliferation , migration , and survival [ 48 , 53 ] .
regulation of rgd interactions can also be accomplished by regulating production and deposition of their ligands , such as fibronectin , as illustrated by the finding that ilk / ipp complexes are key mediators of fibronectin deposition into the bm , which in turn regulates cell proliferation , migration , and restitution .
finally , regulation of rgd - dependent cell interactions can also be achieved by interaction with other ecm molecules as shown with type vi collagen , a basement membrane component that regulates epithelial cell - fibronectin interactions .
taken together , these studies define new molecular elements and shed new light on the relative complexity of specific cell - matrix interactions in a well - defined environment such as the intestinal crypt and the critical impact these interactions have on cell function . | interactions between the extracellular matrix ( ecm ) and integrin receptors trigger structural and functional bonds between the cell microenvironment and the cytoskeleton .
such connections are essential for adhesion structure integrity and are key players in regulating transduction of specific intracellular signals , which in turn regulate the organization of the cell microenvironment and , consequently , cell function .
the rgd peptide - dependent integrins represent a key subgroup of ecm receptors involved in the maintenance of epithelial homeostasis . here
we review recent findings on rgd - dependent ecm - integrin interactions and their roles in human intestinal epithelial crypt cells . |
a first depressive episode at older age is defined as late onset depressive symptoms ( lodss ) .
lodss are usually defined by their occurrence after the age of 60 years , while early onset depressive symptoms ( eodss ) appear before .
the prevalence of lods and eods ranges from 10% to 32% [ 14 ] in the elderly population .
patients with eods show a higher rate of family history of depression than patients with lods ; genetic factors appear to be important .
while psychological and genetic factors presumably play an important role in eods , there are probably other nongenetic factors that play a role in lods [ 5 , 6 ] such as structural changes in the brain [ 7 , 8 ] .
population - based neuroimaging studies suggest a possible role for frequently occurring white matter lesions ( wmls ) in the etiology of lods [ 912 ] .
their dominant view is that wmls disrupt white matter tracts connecting cortical and subcortical structures ( e.g. , frontostriatal circuits ) , which result in lods [ 13 , 14 ] .
as wml are part of the cerebral small vessel disease ( svd ) spectrum , also including lacunar infarcts , it could be that the association between wml and lods is driven by lacunar infarcts as they reflect more severe structural damage than wml .
in addition , svd might not fully explain the presence of depressive symptoms in elderly as there are patients with lods without svd .
a functional or structural change in the amygdala may explain the residual depressive symptoms as the amygdala is involved in mood regulation , and structural mri studies showed a lower amygdala volume in patients with both lods and eods than in healthy controls [ 1518 ] .
conversely , none of the population - based studies on svd and lods took amygdala volume into account .
we therefore wanted to investigate the relation between amygdala volume and the presence of depressive symptoms in patients with svd , with adjustment for degree of svd .
the radboud university nijmegen diffusion tensor and magnetic resonance imaging cohort ( run dmc ) study is a prospective cohort study that investigates the risk factors and cognitive , motor , and mood consequences of functional and structural brain changes among elderly with cerebral svd .
symptoms include acute symptoms , such as transient ischaemic attacks ( tias ) or lacunar syndromes , or subacute manifestations , such as cognitive , motor ( gait ) and/or mood disturbances .
as the onset of cerebral svd is often insidious , clinically heterogeneous , and typically with mild symptoms , it has been suggested that the selection of subjects with cerebral svd in clinical studies should be based on the more consistent brain imaging features .
accordingly , in 2006 , consecutive patients who visited the department of neurology , between october 2002 and november 2006 , were selected for participation .
inclusion criteria were ( a ) age between 50 and 85 years ; ( b ) cerebral svd on neuroimaging ( wml and/or lacunar infarcts ) .
subsequently the above - mentioned acute or subacute clinical symptoms of svd were assessed by standardized structured assessments .
patients who were eligible because of a lacunar syndrome were included only > 6 months after the event to avoid acute effects on the outcomes .
were ( a ) dementia and ( b ) parkinson(ism ) according to the international diagnostic criteria [ 2123 ] ; ( c ) life expectancy of less than six months ; ( d ) intracranial space occupying lesion ; ( e ) ( psychiatric ) disease interfering with cognitive testing or followup ; ( f ) recent or current use of acetylcholine - esterase inhibitors , neuroleptic agents , l - dopa , or dopa - a(nta)gonists ; ( g ) wml mimics ( e.g. , multiple sclerosis and irradiation induced gliosis ) ; ( h ) prominent visual or hearing impairment ; ( i ) language barrier ; ( j ) mri contraindications or known claustrophobia .
1004 individuals were invited by letter , 727 were eligible after contact by phone , and 525 agreed to participate . in 22 subjects exclusion criteria
were found during their visit to our research centre ( 14 with unexpected claustrophobia , 1 died before mri scanning , 1 was diagnosed with multiple sclerosis , in 1 there was a language barrier , 1 subject fulfilled the criteria for parkinson 's disease , and 4 met the dementia criteria ) , yielding a response of 71.3% ( 503/705 ) . from these 503
individuals one group had symptoms of tia or lacunar syndrome ( n = 219 ) , and the remaining ( n = 284 ) had cognitive disturbances , motor disturbances , depressive symptoms , or a combination thereof .
imaging was performed on a 1,5 tesla mri scanner ( magnetom , sonata ; siemens medical solutions , erlangen , germany ) .
the protocol included 3d mprage imaging ( tr / te / ti 2250/3.68/850 ms ; flip angle15 ; voxel size 1.0 1.0 1.0 mm ) and fluid attenuated inversion recovery ( flair ) sequences ( tr / te / ti 9000/84/2200 ms ; voxel size 1.0 1.2 5.0 mm , with an interslice gap of 1.0 mm ) .
one investigator , blinded to the clinical and other imaging data ( ivu ) , performed manual segmentation of the amygdala , using the interactive software program
briefly , this program allowed simultaneous viewing of volumes in coronal sagittal and transversal view , thereby permitting a neat handling of anatomical borders while segmenting the regions of interest . left and right amygdalae were manually segmented in the coronal plane , from posterior to anterior .
next , segmentations were reviewed in the sagittal plane , because then boundaries were better visualized [ 2527 ] .
segmentation was performed according to previously published protocols [ 27 , 28 ] , and the correct segmentation of anatomical boundaries was verified with the aid of neuroanatomical atlases [ 28 , 29 ] . in short , the first slice of the amygdala , the posterior border , was identified superior to the hippocampus at the point where the white matter first starts to appear superior to the alveus and laterally to the hippocampal head .
the anterior border of the amygdala was defined at the level where the amygdala no longer has an ovoid shape .
the medial border is marked by the medial margin of the temporal lobe , which borders cerebral spinal fluid ( csf ) .
the lateral / inferior border is the surrounding white matter and the inferior horn of the lateral ventricle .
the amygdala and hippocampus were carefully separated on the sagittal view , moving from the medial to the lateral side of the brain .
segmentations were done in a standardized way by rating the left amygdala first for half of the patients and the right amygdala first for the other half .
volume was calculated for the left and right amygdala separately by summing all segmented areas , multiplied by slice thickness .
intrarater on a random sample yielded an intraclass correlation coefficient for both left and right amygdalae of 0.8 .
white matter signal hyperintensities on flair scans , which were not , or only faintly hypointense on t1-weighted images , were considered wml , except for gliosis surrounding infarcts .
wmls were manually segmented on transversal flair images , by 2 trained raters , ( ivu , lvo ) , blinded for all clinical data and amygdala volumes .
inter - rater variability for total wml volume was determined on a random sample of ten percent yielded an intra - class correlation coefficient of 0.99 .
lacunar infarcts were defined as areas with a diameter > 2 mm and < 15 mm with low signal intensity on flair and t1 , ruling out enlarged perivascular spaces and infraputaminal pseudolacunes . evaluation of infarcts was performed by one person with a good intra - rater variability with a weighted kappa of 0.80 . in ten percent of the scans inter - rater variability was calculated with a weighted kappa of 0.88 .
gray ( gm ) , white matter ( wm ) tissue , and csf probability maps were computed using spm5 routines ( wellcome department of cognitive neurology , university college london , uk ) .
total gm , wm , and csf volumes were calculated by summing all voxel volumes that had a p > 0.5 for belonging to the tissue class .
intracranial volume ( icv ) was taken as the sum of total gm , wm , and csf .
depressive symptoms were assessed with the center of epidemiologic studies depression scale ( ces - d ) .
depressive symptoms were considered present in patients with a ces - d score 16 and/or current use of antidepressive medication , taken for depression , irrespective of their actual ces - d score , because depressive symptoms were considered to be the indication for the medication prescription .
if depressive episodes had occurred , the patients were asked for the age of onset and whether the episodes had prompted them to seek medical advice .
a history of depression was considered present if depressive episodes in the past had required attention of a general practitioner , psychologist , or psychiatrist . according to the literature we used the age of 60 years as cut - off point to distinguish between lods and eods .
patients at the age or older than 60 years with a ces - d 16 and/or current use of antidepressive medication , taken for depression , without a history of depressive episodes before or at the age of 60 , were classified as having lods .
individuals with a cesd < 16 , without a history of depressive symptoms and without the current use of antidepressive medication , formed the reference group .
all others fulfilled the criteria for eods ( first depressive episode < 60 years ) .
we compared the amygdala and wml volumes ( overall , left , right ) between the eods and lods group with the reference using ancova .
adjustments for age , sex , icv , wml ( or amygdala volume with wml being dependent variable ) and presence of lacunar infarcts were made
. the risk of lods and eods per milliliter increases in amygdala volume , wml volume , and presence ( yes / no ) of lacunar infarcts was calculated ( expressed as the odds ratio ( or ) with a 95% confidence interval ; 95% ci ) by means of age , sex , icv , adjusted logistic regression analysis with additional adjustment for the appropriate structural mri measures ( wml volume , amygdala volume , or lacunar infarcts ) .
of the 503 patients one was excluded because of an automatic segmentation problem that could not be solved manually .
two patients did not complete the ces - d questionnaire and of two patients the history of depression was not known .
there were 101 individuals with lods ( 20.3% ) and 108 with eods ( 21.7% ) ; the reference group comprised 289 persons ( 58.0% ) .
mean age of the population was 65.6 years ( sd 8.8 ) , and 56.4% were male .
mean age of the lods group was 71.4 years and of the eods group 59.1 years .
total amygdala volume was 3.4 ml ( sd 0.5 ) , and mean volume of left amygdala was 1.8 ml ( sd 0.3 ) and differed significantly ( p < 0.001 ) , from the right amygdala 1.6 ml ( sd 0.3 ) .
amygdala volume decreased significantly with age ( = 0.339 ; p < 0.001 ) , and women had smaller amygdala ( 3.2 ml ; sd 0.4 ) than men ( 3.5 ml ; sd 0.5 ; p < 0.001 )
.
table 2 shows that patients with lods had a higher wml volume ( 21.8 ml ; sd 20.2 ) than the reference group ( 14.7 ml ; sd 18.0 ) , although not significant ( p = 0.06 ) .
independent of svd , patients with lods had a significant lower left amygdala volume ( 1.6 ml ; sd 0.3 ; p = 0.017 ) than the reference group ( 1.8 ml ; 0.28 ) ; this difference was not found for the right amygdala ( 1.5 ml ; sd 0.3 , p = 0.432 ) .
patients with eods did not differ from the reference group with respect to wml volume , amygdala volume , and the proportion of lacunar infarcts .
we found no significant differences between left , right , and total amygdala volume , wml volume , and presence of lacunar infarcts between patients with lods and eods .
table 3 shows the risk of lods and eods and per ml decrease in total , left , and right amygdala volume , wml volume ( ml ) , and presence of lacunar infarcts .
each decrease of both total and left amygdala volume ( ml ) showed a significant increased risk of the presence of lods ( or = 1.77 ; 95ci 1.023.08 ; p = 0.04 , in total amygdala volume and or 2.92 ; 95ci 1.227.01 ; p = 0.02 in left amygdala volume ) , independent of svd .
in addition , there was a nearly significant ( p = 0.08 ) increased risk for lods per increase of wml volume .
this was not found for eods and decrease of amygdala volume ( or = 0.95 ; 95ci 0.561.61 ; p = 0.86 ) per increase of wml volume , or presence of lacunar infarcts .
in this study of 498 elderly patients with cerebral svd , left amygdala volume was related to lods , independent of wml volume and the presence of lacunar infarcts ; this was not found for eods and amygdala volume ( left , right nor total ) .
before conclusions can be drawn , there are some methodological issues that need to be addressed .
the proportion of patients with depressive symptoms in our study is relatively high ( 42% ) for lods and eods together . in other studies
the proportion of patients with depressive symptoms varies between 9.6%32% [ 14 , 32 ] .
a possible explanation for our relatively high proportion of patients with depressive symptoms could be the fact that we purposely included patients on the basis of presence of svd ; consequently the median degree of wml volume in our study is higher than in population - based studies .
as these lesions are related to lods it seems reasonable to expect a concomitant increased presence of depressive symptoms .
our finding of the ( borderline significant ) association between wml volume and lods is in line with findings from these population - based studies [ 1 , 4 , 34 ] .
another explanation is that we classified patients as suffering from depressive symptoms once they had had a depressive episode in their medical history or when they used antidepressive drugs at baseline examination ( while previous studies usually did not assess detailed information on the use of medication )
. the third explanation could be that we included patients with a history of lacunar stroke and transient ischaemic attacks .
it is known that in this population the prevalence of depressive symptoms is higher compared to the general population . to elucidate the etiological mechanisms of lods
its current widely used definition suffers from a conceptual problem , due to the fact that age during the first depressive episode determines the classification .
it could very well be that recovery after eods occurs while depressive symptoms develop again after sixty years of age .
despite the fact that these patients still fulfil the definition of eods because of their history , they may have developed their lods on the basis of another underlying pathology including svd .
all had consulted a doctor or were at one time treated with antidepressants . by contrast , the lods sample was defined primarily by the ces - d score ( and/or current antidepressant use ) .
another limitation is the cross - sectional nature of our study , which prevents us from proving causality .
the run dmc study has a longitudinal design , and followup is already planned to evaluate the effect of brain changes on depressive symptoms .
strengths of our study include its design of a homogeneous population that covers the whole spectrum of cerebral svd , its size and high response rate of over 70% , and the use of a single expert who segmented the amygdala , blinded to clinical information .
particularly the definition of the anatomic boundaries of the amygdala is a notorious problem in amygdala segmentation .
our use of one single , experienced rater minimized the effect of differential segmentation between several raters thereby limiting the effect misclassification .
our results are in line with those from meta - analyses on amygdala volume in nonclinical samples that found a mean volume of both left and right amygdala in 39 studies of 1.7 ml , with a range from 1.0 to 3.9 ml . although the amygdala is critical to the interpretation of emotion [ 16 , 17 ] and implicated in mood disorders , volumetric studies of the amygdala in patients with mood disorders have provided inconsistent results . studies of chronic or recurrent depressive patients have found identical [ 38 , 39 ] , smaller [ 4042 ] but also larger amygdala volumes compared to controls .
postmortem studies showed a smaller amygdala in depressed patients compared to controls , probably due to fewer glial cells .
our data showed a significant relationship with lods and left amygdala volume ; we did not find this relation with the volume of the right amygdala .
this is concordant with previous neuroimaging and postmortem studies that have reported left lateralized atrophy in the prefrontal cortex and amygdala in mood disorders [ 15 , 41 , 44 , 45 ] ; however previous results are inconclusive as others also report on an association between a decrease in right amygdala volume and mood .
in addition some functional imaging studies have shown lateralization , with activation of the left amygdala , in relation to emotion and emotional information processing [ 46 , 47 ] . a possible explanation for a smaller amygdala in patients with lods could be the coexistent svd , abnormalities in blood flow , metabolism , and neurotransmitter receptors [ 48 , 49 ] which may , either directly or indirectly , lead to amygdala atrophy .
intact connectivity of the frontostriatal circuits is important in mood regulation [ 14 , 50 ] . according to the vascular depression hypothesis svd
, that tends to have a high prevalence in the frontostriatal regions , disrupts fiber tracts within these circuits , probably leading to depressive symptoms [ 11 , 34 ] .
there are two other studies that investigated the role of amygdala morphometry in lods patients .
one showed that , despite insignificant amygdala volumetric findings , variations of amygdala shape can be detected and localized .
a population - based cohort study found a relation between a history of depression , particularly early onset , and an increased risk of for alzheimer 's disease ; however this risk was not mediated by smaller hippocampal or amygdala volumes at baseline .
in contrast to our results they did not find a relation between a history of depression or depressive symptoms at baseline and smaller amygdala volume . as discussed earlier
, this could be because of the difference in degree of svd between this population - based cohort and our study sample in which we included only subjects with some degree of svd .
as amygdala volume is related to the degree of svd , our study sample will probably have smaller amygdalae .
in addition there was a difference in wml segmentation , most studies used semiquantitative methods , and in contrast we manually segmented the wml volume .
this in combination with the higher proportion of depressive symptoms in our study sample ( 42% versus 27% ) can explain the relation we found between amygdala volume and lods in contrast to the findings of this population - based cohort .
finally , the relation between lods and amygdala volume in our cohort was mainly driven by the left amygdala , while this population - based cohort summed both amygdalae in their analysis . in conclusion ,
future research should consist of prospective studies in order to assess whether baseline presence of svd increases the risk of amygdala atrophy at followup and whether this coincides with lods .
innovative mri techniques including diffusion tensor imaging ( dti ) could offer promising tools in order to identify white matter tracts between the amygdala and other parts of the brain and the effects of svd in those tracts with respect to the incidence of lods .
the authors certify that all coauthors have contributed sufficiently to the writing of the paper .
they have read and approved submission of the final version of the paper , and they have taken due care to ensure the integrity of the work . | introduction .
late onset depressive symptoms ( lodss ) frequently occur in elderly with cerebral small vessel disease ( svd ) .
svd can not fully explain lods ; a contributing factor could be amygdala volume .
we investigated the relation between amygdala volume and lods , independent of svd in 503 participants with symptomatic cerebral svd .
methods . patients underwent flair and t1 scanning .
depressive symptoms were assessed with structured questionnaires ; amygdala and wml were manually segmented .
the relation between amygdala volume and lods / eods was investigated and adjusted for age , sex , intracranial volume , and svd .
results .
patients with lods had a significantly lower left amygdala volume than those without ( p = 0.02 ) , independent of svd .
each decrease of total amygdala volume ( by ml ) was related to an increased risk of lods ( or = 1.77 ; 95% ci 1.023.08 ; p = 0.04 ) .
conclusion .
lower left amygdala volume is associated with lods , independent of svd .
this may suggest differential mechanisms , in which individuals with a small amygdala might be vulnerable to develop lods . |
as bariatric surgery becomes one of the most common general surgical procedures , a concomitant increase in revisional bariatric surgery is also being seen .
patients who have had a vertical banded gastroplasty ( vbg ) , non - adjustable gastric banding ( sometimes known as the molina band ) , and laparoscopic adjustable bands with failure of weight loss or weight gain often present for revision to laparoscopic roux - en - y gastric bypass ( lrygb ) .
patients who have had a vbg commonly complain that they have regained all of their presurgery weight and also complain of reflux .
nonadjustable gastric bands ( nagb ) receive similar complaints and can also have erosion of the mesh band into the lumen of the stomach .
laparoscopic adjustable band patients are often frustrated with the slow weight loss and may also have erosion of the band .
all of these patients have legitimate reasons to be considered for lrygb . performing revisional operations from vgb or nonadjustable gastric bands
we hypothesized that the patients undergoing revisional surgery would have a high rate of abnormal findings that could influence our preoperative or operative management , or both .
we conducted a single institution , retrospective chart review of patients undergoing revisional bariatric surgery from 2003 to 2005 .
the endoscopy reports of these patients were reviewed and an excel spreadsheet was used to analyze the data .
the findings included normal , gastritis , esophagitis , band erosions , and gastrogastric fistulae .
an abnormal upper endoscopy was identified in 85% of 46 patients evaluated for revisional bariatric surgery .
all patients with a gastrogastric fistula had previously had a vbg , with disruption of the staple line .
eleven percent of patients had band erosion , 2 from a nonadjustable band , and 5 from vertical banded gastroplasties . based on our findings
all patients went on to successful laparoscopic conversion to roux - en - y gastric bypass . in our series of 46
undertaking a conversion or revision of a previous bariatric surgery to a roux - en - y gastric bypass can be hazardous and demanding .
in nonadjustable gastric bands , the patients often have an intense adhesive reaction to the mesh band , and the left lobe of the liver is stuck down to the stomach .
once the band is removed , it can be difficult to create the upper gastric pouch .
there should be at least 2 cm to 3 cm of length to minimize the chance of an esophagojejunal anastomosis .
for the vbg , we have found that the scar reaction of the stomach to the liver is not as great as with the nonadjustable band , but dividing the previous staple line can be a risky undertaking .
the presence of a gastrogastric fistula usually means that the stomach will be thickened and inflamed . in revisions of both procedures
the findings of esophagitis and gastrogastric fistulae are not surprising in the vbg group ; these complications have been well described .
another finding that was not easy to quantify was the presence of pouch distension after these banding procedures .
this study did not quantify pouch distension , but that information probably would not make a difference in the reoperative approach .
gastritis was also a common finding with resulting treatment with either h2 blockers or proton pump inhibitors .
we were able to successfully remove one nagb , and 2 bands from vbgs endoscopically , but the inability to do so does not preclude reoperation . a gastrogastric fistula can mean that the stomach is thickened and inflamed , and the operation may need to be modified in response .
in particular , staple load size and the type of staple buttressing may change . the main shortcoming of this study is its retrospective nature .
ideally , a control group without endoscopy would be compared in a prospective manner . however , as reoperative surgery has greater inherent risks to the patient , it is unlikely that a prospective , randomized trial will be performed .
we believe that if operating surgeons perform their own preoperative endoscopy , valuable information can be obtained .
we realize that it may not be possible for every surgeon to perform their own endoscopies , but do believe that ideally , the operating surgeon would be the endoscopist .
eroded bands can be problematic , and in 3 instances , we were able to remove them completely endoscopically , as has already been described in the literature .
no complications were encountered from performing upper endoscopy in our series , and upper endoscopy is generally a well - tolerated , low - risk procedure . with the information gathered during endoscopy by the surgeon preoperatively , the operation can be planned and executed in a smooth , safe manner .
in addition to identifying patients who need preoperative medications , the preoperative upper endoscopy also provided valuable information regarding pouch size and anatomy .
preoperative upper endoscopy should be performed by the operating surgeon on every patient undergoing revisional bariatric surgery . | background and objectives : we hypothesized that patients who have previously had bariatric surgery and are undergoing revision to laparoscopic roux - en - y gastric bypass would have abnormal findings detected by upper endoscopy that could potentially influence patient management .
the procedures that are being revised include vertical banded gastroplasty , laparoscopic adjustable gastric bands , nonadjustable gastric bands and previous roux - en - y gastric bypass ( open and laparoscopic).methods : we conducted a retrospective chart review of patients who previously had undergone vertical banded gastroplasty or nonadjustable gastric banding .
we preoperatively performed an upper endoscopy on all patients .
the endoscopy reports were reviewed and the findings entered into a database.results:eighty-five percent of 46 patients undergoing revisional bariatric surgery had an abnormal upper endoscopy .
eleven percent had a gastrogastric fistula .
gastritis and esophagitis were noted in 65% and 37% , respectively .
eleven percent of patients had band erosion , 2 from a nonadjustable band , and 5 from vertical banded gastroplasties . based on our findings , 65% of our patients required
medical treatment.conclusions:preoperative upper endoscopy provides valuable information before revisional laparoscopic bariatric surgery .
in addition to identifying patients who need preoperative medications , the preoperative upper endoscopy also provided valuable information regarding pouch size and anatomy .
preoperative upper endoscopy should be performed by the operating surgeon on every patient undergoing revisional bariatric surgery . |
preferentially expressed antigen of melanoma ( prame ) was initially identified as a tumor - associated antigen recognized by cytotoxic t lymphocytes against a melanoma surface antigen .
this antigen belongs to the cancer - testis antigens , all of which are absent in normal tissues , but are detected in cancers , including melanoma , breast cancer , lung carcinoma , renal cell carcinoma , and leukemia . unlike other cancer - testis antigens , prame shows some expression in normal tissues , such as testis , ovary , and adrenal gland .
prame has emerged as a marker of disease activity and prognosis in acute promyelocytic leukemia , primary osteosarcoma , and head and neck squamous cell carcinoma . in most cases ,
the high expression of prame has been linked to poor prognosis and increased development of metastasis
. however , high expression of prame in childhood acute myeloid leukemia is a maker of favorable prognosis and longer survival .
it has been shown that over - expression of prame blocks retinoid acid receptor - mediated differentiation of normal hematopoietic and leukemic progenitor cells .
knockdown of prame inhibits proliferation and causes cell cycle arrest and apoptosis in leukemia cells .
it has been shown that prame can bind to the retinoic acid receptors and inhibit the target gene transcription , such as the tumor necrosis factor - related apoptosis - inducing ligand ( trail ) , leading to the inhibition cell differentiation .
prame has also been found in lung cancers , but its role in lung cancer cells remains elusive . in our present study , we demonstrate that knockdown of prame increased the proliferation of lung cancer cell lines pc9 and a549 . it was further revealed that the apoptosis of lung cancer cells was decreased when prame was inhibited .
gene expressions were also analyzed using quantitative rt - pcr in lung cancer cells after prame sirna transfection .
lung tissues of 20 normal controls and tumor tissues from 4 lung cancer patients were collected and sectioned .
the paraffin sections were dried in an oven at 65c for 1 h. the paraffin sections were then dewaxed in xylene and rehydrated in a series of ethanol solutions . the endogenous peroxidase activity was blocked through a 10-min pre - incubation with 3% h2o2 .
the paraffin sections were preheated at 100c in antigen retrieval solution containing edta ( ph 8.0 ) for 30 min and blocked by non - immune goat serum at room temperature for 15 min to decrease unspecific staining .
the incubation with mouse polyclonal anti - prame ( 1:1000 ) was performed overnight at 4c .
after being washed 3 times with 1pbs buffer for 3 min , the sections were incubated with the second ( link ) antibody ( biotinylated mouse - anti - human igg ) for 30 min at room temperature . after reacting with the streptavidin - biotin - peroxidase complex for 20 min ,
the immune - reactivity was determined by 3,3-diamino - benzidinetetrahydrochloride and h2o2 at room temperature according to the manufacturer s instructions .
the selected sections were scanned at 400 magnification to visualize the localization and distribution of prame ( prame antibody : sc-6704 ) .
pc9 and a549 cells were cultured in rpmi and mem , both of which were supplemented with 10% fetal bovine serum ( fbs ) , 2 mmol / l glutamine , 100 units / ml penicillin , and 100 g / ml streptomycin .
cells were cultured in a humidified atmosphere of 95% air and 5% co2 at 37c .
for transfection of sirna , lipofectamine rnaimax reagent ( invitrogen ) was mixed with the sirna construct according to the manufacturer s instructions and added to pc9 or a549 cells in a 24-well plate .
pre - designed smartpool on - target plus prame sirna duplexes were designed and synthesized by dharmacon ( lafayette , co ) .
the total rnas from pc9 or a549 cells were prepared using the trizol reagent ( invitrogen , carlsbad , ca ) .
one ug of total rnas was treated with dnase i ( invitrogen ) and the cdna was synthesized in vitro from the mrna template using superscript iii first - strand synthesis kit ( invitrogen ) .
the mrna expression levels of target genes were determined by quantitative real - time pcr by using sybr green ( applied biosystems ) and normalized to that of 18s rrna in each group using the equation : 2 , where ct is the threshold cycle for each gene .
the sequences of primers are as follows : prame forward primer 5-caggacttctggactgtatggt-3 ; prame reverse primer 5-ctacgagcacctctactggaa-3 ; -actin forward primer 5- cgtcatactcctgcttgctg-3 ; -actin reverse primer 5- gtacgccaacacagtgctg.-3 ; bnip3 forward primer 5-cagggctcctgggtagaact -3 ; bnip3 reverse primer 5- ctactccgtccagactcatgc.-3 ; dapk1 forward primer 5-gagtttgtcgctcctgagatagt-3 ; dapk1 reverse primer 5- gcttagtgtctccaagaaatggg.-3 ; p21 forward primer 5-tgtccgtcagaacccatgc -3 ; p21 reverse primer 5- aaagtcgaagttccatcgctc-3 ; bcl10 forward primer 5-tctggacacccttgttgaatct -3 ; bcl10 reverse primer 5- tggaaaaggttcacaactgctac-3 ; bnip3l forward primer 5-ttggatgcacaacatgaatcagg -3 ; bnip3l reverse primer 5-tcttctgactgagagctatggtc -3 ; casp8 forward primer 5-tcatggaccacagtaacatgga -3 ; casp8 reverse primer 5- agtgaactgagatgtcagctcat.-3 ; casp10 forward primer 5-agaaacctgctctacgaactgt -3 ; casp10 reverse primer 5-gggaagcgagtctttcagaag-3 ; igf1r forward primer 5-atgctgacctctgttacctct -3 ; igf1r reverse primer 5-ggcttattccccacaatgtagtt -3 ; pc9 and a549 cells were seeded in 96-well microplates with 2000 cells / well and incubated for 24 h in 100 l culture medium .
the cells were then treated with control or prame sirna for 48 h. mtt was added to the cells , which were then cultivated for another 4 h. following the removal of the supernatant , dmso ( 100 l / well ) was added to the cells , which were agitated for 15 min .
cell apoptosis was determined by use of the annexin v - fitc / pi apoptosis detection kit ( abcam , cambridge , ma , usa ) according to the manufacturer s protocols using flow cytometry .
after control and prame sirna treatments , the cells were harvested , washed 2 times with pre - chilled pbs and resuspended in 1x binding buffer at a concentration of 110 cells / ml .
this solution ( 100 l ) was mixed with 5 l annexin v - fitc and 5 l pi for 15 min , then 400 l 1 binding buffer was added .
whole - cell lysates from pc9 and a549 cells were prepared and separated using 10% sds - page gel . after blocking with tris - buffered saline/0.05% tween 20 containing 5% skim milk or 3% bovine serum albumin ( sigma , st .
louis , mo ) , blots were incubated at 4c overnight with the primary antibodies against human prame protein ( 1:200 ) , p27 ( 1:500 ) , cleaved caspase-8 ( 1:200 ) , igf1r ( 1:200 ) , and actin ( 1:5000 ) , respectively .
horseradish peroxidase conjugated igg was used as secondary antibody according to the manufacturer s instructions .
difference in cell growth between control and prame sirna - treated groups was evaluated by repeated measures analysis of variance ( anova ) .
lung tissues of 20 normal controls and tumor tissues from 4 lung cancer patients were collected and sectioned .
the paraffin sections were dried in an oven at 65c for 1 h. the paraffin sections were then dewaxed in xylene and rehydrated in a series of ethanol solutions . the endogenous peroxidase activity was blocked through a 10-min pre - incubation with 3% h2o2 .
the paraffin sections were preheated at 100c in antigen retrieval solution containing edta ( ph 8.0 ) for 30 min and blocked by non - immune goat serum at room temperature for 15 min to decrease unspecific staining .
the incubation with mouse polyclonal anti - prame ( 1:1000 ) was performed overnight at 4c .
after being washed 3 times with 1pbs buffer for 3 min , the sections were incubated with the second ( link ) antibody ( biotinylated mouse - anti - human igg ) for 30 min at room temperature . after reacting with the streptavidin - biotin - peroxidase complex for 20 min ,
the immune - reactivity was determined by 3,3-diamino - benzidinetetrahydrochloride and h2o2 at room temperature according to the manufacturer s instructions .
the selected sections were scanned at 400 magnification to visualize the localization and distribution of prame ( prame antibody : sc-6704 ) .
pc9 and a549 cells were cultured in rpmi and mem , both of which were supplemented with 10% fetal bovine serum ( fbs ) , 2 mmol / l glutamine , 100 units / ml penicillin , and 100 g / ml streptomycin .
cells were cultured in a humidified atmosphere of 95% air and 5% co2 at 37c .
for transfection of sirna , lipofectamine rnaimax reagent ( invitrogen ) was mixed with the sirna construct according to the manufacturer s instructions and added to pc9 or a549 cells in a 24-well plate .
pre - designed smartpool on - target plus prame sirna duplexes were designed and synthesized by dharmacon ( lafayette , co ) .
the total rnas from pc9 or a549 cells were prepared using the trizol reagent ( invitrogen , carlsbad , ca ) .
one ug of total rnas was treated with dnase i ( invitrogen ) and the cdna was synthesized in vitro from the mrna template using superscript iii first - strand synthesis kit ( invitrogen ) .
the mrna expression levels of target genes were determined by quantitative real - time pcr by using sybr green ( applied biosystems ) and normalized to that of 18s rrna in each group using the equation : 2 , where ct is the threshold cycle for each gene .
the sequences of primers are as follows : prame forward primer 5-caggacttctggactgtatggt-3 ; prame reverse primer 5-ctacgagcacctctactggaa-3 ; -actin forward primer 5- cgtcatactcctgcttgctg-3 ; -actin reverse primer 5- gtacgccaacacagtgctg.-3 ; bnip3 forward primer 5-cagggctcctgggtagaact -3 ; bnip3 reverse primer 5- ctactccgtccagactcatgc.-3 ; dapk1 forward primer 5-gagtttgtcgctcctgagatagt-3 ; dapk1 reverse primer 5- gcttagtgtctccaagaaatggg.-3 ; p21 forward primer 5-tgtccgtcagaacccatgc -3 ; p21 reverse primer 5- aaagtcgaagttccatcgctc-3 ; bcl10 forward primer 5-tctggacacccttgttgaatct -3 ; bcl10 reverse primer 5- tggaaaaggttcacaactgctac-3 ; bnip3l forward primer 5-ttggatgcacaacatgaatcagg -3 ; bnip3l reverse primer 5-tcttctgactgagagctatggtc -3 ; casp8 forward primer 5-tcatggaccacagtaacatgga -3 ; casp8 reverse primer 5- agtgaactgagatgtcagctcat.-3 ; casp10 forward primer 5-agaaacctgctctacgaactgt -3 ; casp10 reverse primer 5-gggaagcgagtctttcagaag-3 ; igf1r forward primer 5-atgctgacctctgttacctct -3 ; igf1r reverse primer 5-ggcttattccccacaatgtagtt -3 ;
pc9 and a549 cells were seeded in 96-well microplates with 2000 cells / well and incubated for 24 h in 100 l culture medium .
the cells were then treated with control or prame sirna for 48 h. mtt was added to the cells , which were then cultivated for another 4 h. following the removal of the supernatant , dmso ( 100 l / well ) was added to the cells , which were agitated for 15 min .
cell apoptosis was determined by use of the annexin v - fitc / pi apoptosis detection kit ( abcam , cambridge , ma , usa ) according to the manufacturer s protocols using flow cytometry .
after control and prame sirna treatments , the cells were harvested , washed 2 times with pre - chilled pbs and resuspended in 1x binding buffer at a concentration of 110 cells / ml . this solution ( 100 l ) was mixed with 5 l annexin v - fitc and 5 l pi for 15 min , then 400 l 1 binding buffer was added .
whole - cell lysates from pc9 and a549 cells were prepared and separated using 10% sds - page gel . after blocking with tris - buffered saline/0.05% tween 20 containing 5% skim milk or 3% bovine serum albumin ( sigma , st .
louis , mo ) , blots were incubated at 4c overnight with the primary antibodies against human prame protein ( 1:200 ) , p27 ( 1:500 ) , cleaved caspase-8 ( 1:200 ) , igf1r ( 1:200 ) , and actin ( 1:5000 ) , respectively .
horseradish peroxidase conjugated igg was used as secondary antibody according to the manufacturer s instructions .
difference in cell growth between control and prame sirna - treated groups was evaluated by repeated measures analysis of variance ( anova ) . a p - value of < 0.05 was considered significantly different .
to study the role of prame in lung cancer cells , we examined the expression of prame in normal human lung tissue and in human lung adenocarcinoma .
immunohistochemical staining shows that prame is expressed in both normal lung and lung cancer tissues . as shown in figure 1 , the prame immunoreactivity in the normal lung tissue was stronger than that in the human lung adenocarcinoma .
the mrna expression of prame was also examined in both tissues using rt - pcr studies .
consistent with the immunohistochemical study , the mrna expression of prame in lung cancer tissue was significantly lower than that in normal lung tissue .
next , we knocked down the expression of prame in lung cancer cells using sirna technique .
as shown in figure 2 , 2 days after the prame sirna transfection , the prame mrna expression was significantly reduced in pc9 and a549 cells compared with control sirna - transfected cells .
the western blot analysis demonstrated that prame protein expression was also dramatically inhibited after sirna transfection .
it was further revealed that after the prame sirna transfection , the cell proliferation of lung cancer cells pc9 and a549 was increased , as evidenced by the increased cell growth 48 h after transfection measured by the mtt assay ( figure 3 ) . the increased cell proliferation was observed between day 2 and day 4 compared with control sirna - treated cells . to further examine the effect of prame on cell growth , cell apoptosis was analyzed using flow cytometry .
as shown in figure 4 , prame knockdown in pc9 cells led to a significant decrease of the percentage of annexin v - positive fractions , with the early apoptotic cells decreased from 7.87% to 1.42% and late apoptotic cells decreased from 6.7% to 4.85% .
consistent with the flow cytometry data , a decreased level of cleaved caspase-8 was also detected in cells treated with prame sirna , suggesting the inhibition of apoptosis induced by prame knockdown .
we asked which genes might be responsible for the effects of prame on cell proliferation and apoptosis . in order to identify potential candidate genes , we performed a quantitative rt - pcr analysis and compared the gene expression profile of lung cancer cells transfected with prame sirna with that treated with control sirna .
we found that several genes are down - regulated , including bnip3 , dapk1 , p21 , bcl10 , casp8 , casp10 , and bnip3l ( figure 5a ) , which cause cell cycle arrest , inhibit proliferation , and promote apoptosis . on the other hand ,
both the mrna and protein expression of insulin - like growth factor receptor 1 ( igf1r ) are increased after prame sirna treatment ( figure 5b ) . to examine the contribution of igf1r to prame - mediated effects
the result shows that prame sirna - induced increase of pc9 cell proliferation is attenuated by igf1r sirna treatment ( figure 5c ) .
to study the role of prame in lung cancer cells , we examined the expression of prame in normal human lung tissue and in human lung adenocarcinoma .
immunohistochemical staining shows that prame is expressed in both normal lung and lung cancer tissues . as shown in figure 1 , the prame immunoreactivity in the normal lung tissue was stronger than that in the human lung adenocarcinoma .
the mrna expression of prame was also examined in both tissues using rt - pcr studies .
consistent with the immunohistochemical study , the mrna expression of prame in lung cancer tissue was significantly lower than that in normal lung tissue .
next , we knocked down the expression of prame in lung cancer cells using sirna technique .
as shown in figure 2 , 2 days after the prame sirna transfection , the prame mrna expression was significantly reduced in pc9 and a549 cells compared with control sirna - transfected cells .
the western blot analysis demonstrated that prame protein expression was also dramatically inhibited after sirna transfection .
it was further revealed that after the prame sirna transfection , the cell proliferation of lung cancer cells pc9 and a549 was increased , as evidenced by the increased cell growth 48 h after transfection measured by the mtt assay ( figure 3 ) . the increased cell proliferation was observed between day 2 and day 4 compared with control sirna - treated cells .
to further examine the effect of prame on cell growth , cell apoptosis was analyzed using flow cytometry .
as shown in figure 4 , prame knockdown in pc9 cells led to a significant decrease of the percentage of annexin v - positive fractions , with the early apoptotic cells decreased from 7.87% to 1.42% and late apoptotic cells decreased from 6.7% to 4.85% .
consistent with the flow cytometry data , a decreased level of cleaved caspase-8 was also detected in cells treated with prame sirna , suggesting the inhibition of apoptosis induced by prame knockdown .
we asked which genes might be responsible for the effects of prame on cell proliferation and apoptosis . in order to identify potential candidate genes
, we performed a quantitative rt - pcr analysis and compared the gene expression profile of lung cancer cells transfected with prame sirna with that treated with control sirna .
we found that several genes are down - regulated , including bnip3 , dapk1 , p21 , bcl10 , casp8 , casp10 , and bnip3l ( figure 5a ) , which cause cell cycle arrest , inhibit proliferation , and promote apoptosis . on the other hand ,
both the mrna and protein expression of insulin - like growth factor receptor 1 ( igf1r ) are increased after prame sirna treatment ( figure 5b ) . to examine the contribution of igf1r to prame - mediated effects
the result shows that prame sirna - induced increase of pc9 cell proliferation is attenuated by igf1r sirna treatment ( figure 5c ) .
prame has been detected mostly in cancers and prame expression correlates with the prognosis of cancers .
consistent with previous studies , our study also showed that prame was present in normal human lung tissue and the human lung adenocarcinoma and lung cancer cell lines pc9 and a549 .
however , in contrast to the expression profile of prame in other tissues , the normal human lung tissue exhibits higher expression level in comparison with that in human lung adenocarcinoma , as evidenced by the immunohistochemical staining and rt - pcr studies . decreased prame expression may promote proliferation and cancer development of lung adenocarcinoma .
it is well known that the balance of proliferation and apoptosis plays important roles in the control of tumor growth .
we demonstrated that knockdown of prame using sirna in these cells promoted cell proliferation and decreased apoptosis .
multiple genes related to proliferation and apoptosis have been demonstrated to contribute to tumor cell growth .
we further characterized the gene expression profiles in the lung cancer cell lines pc9 and a549 after prame inhibition .
the bcl-2 family of proteins is critical for the regulation of apoptosis induced by various stimuli .
bnip3 , a bcl-2 family member , is a pro - apoptotic protein , which has been shown to contribute to hypoxia - induced autophagy and cell death .
it has been shown that bnip3l is induced by the tumor suppressor p53 and contributes to apoptosis under hypoxia . in our study , we demonstrate that inhibition of prame decreased the expression of bnip3 and bnip3l , leading to decreased apoptosis and increased proliferation of lung cancer cells .
some other genes , such as bcl10 and death - associated protein kinase 1 ( dapk1 ) , which have been shown to promote apoptosis , have also been found to be decreased in lung cancer cells after prame sirna transfection .
the down - regulation of 2 apoptosis - related cysteine proteases casp8 and casp10 in lung cancer cells treated with prame sirna further supports that inhibition of prame leads to apoptosis inhibition .
these results suggest that prame regulates the apoptosis of lung cancer cells by modulating the expression of these apoptosis - related genes .
the cyclin - dependent kinase ( cdk ) inhibitor p21 binds to several cdks and inhibits their activities , leading to growth arrest and cellular senescence .
the expression of this gene is under the control of the tumor suppressor protein p53 .
consistent with the role of p21 in cell growth , we found that prame knockdown suppressed the expression of p21 , leading to the increased cell growth of lung cancer cell lines pc9 and a549 .
several lines of evidence demonstrate that the gene expression of igf1r contributes to cell proliferation , and cell proliferation can be inhibited by targeting igf1r [ 2022 ] .
consistent with these studies , we showed increased mrna and protein expression levels of igf1r accompanied with enhanced proliferation of lung cancer cells after prame knockdown .
the attenuation of prame knockdown - induced proliferation by igf1r sirna transfection further supports the dependence of igf1r in prame - mediated effect on lung cancer cell proliferation .
our results demonstrate that prame regulates the apoptosis of lung cancer cells by modulating the expression of selected apoptosis - related genes .
down - regulation of prame promotes proliferation of lung cancer cells in an igf1r - dependent manner , which reduces the expression of pro - apoptosis genes .
prame - mediated effects in lung cancer cells advanced our understanding of the biological roles of prame in different tissues . | backgroundpreferentially expressed antigen of melanoma ( prame ) is known as a tumor - associated antigen that is altered in a variety of malignancies , including lung cancer . however , the role of prame in lung cancer remains unclear.material/methodswe analyzed the expression of prame in human lung adenocarcinomas and studied the function of prame using small interfering rna ( sirna)-induced gene knockdown in lung cancer cell lines pc9 and a549.resultswe found that prame expression is down - regulated in lung adenocarcinomas .
knockdown of prame promoted proliferation and suppressed apoptosis of pc9 and a549 cells.conclusionsin line with its roles in controlling cell growth , rpame regulates multiple critical cell - growth related genes , including igf1r oncogene .
igf1r up - regulation contributes to increase of cell growth upon the knockdown of prame . taken together
, our results suggest that prame has inhibitory roles in lung cancer . |
a 70-year - old male was admitted to our hospital primarily due to pain and swelling of the left knee that had been present for more than 1 month .
he had no specific diseases except for diabetes and was transferred to our institution due to signs of inflammation observed in a fine needle aspiration biopsy performed at a nearby hospital more than 1 month prior to admission .
based on the history of the illness , oral medication was administered to treat the type ii diabetes .
the patient 's vital signs at the time of admission were as follows : blood pressure 130/80 mmhg , pulse rate 95 bpm , respiratory rate 20 breaths / min , and temperature 36.8. in the physical examination , severe swelling of the left knee , minor flare , and local thermal sensations were found as well as passive movements caused severe pain . in the blood test
performed upon admission , the white blood cell count , hemoglobin , platelet count , erythrocyte sedimentation rate and c - reactive protein was 18,500/mm , 11 g / dl , 286,000/mm , 34 mm / hr and 2.4 mg / dl , respectively .
joint fluid analysis showed a red blood cell count , white blood cell count and a glucose level of 4,400/mm , 84,560/mm ( neutrophil 80% , lymphocyte 10% , and monocyte 10% ) and 228 mg / dl , respectively , and no nodes were observed .
no microorganisms were found in the bacterial culture . on the plain radiographs , minor joint space narrowing
was observed in the medial compartment of the left knee but no abnormal findings were noted ( fig .
septic arthritis was suspected based on these findings and an arthroscopic synovectomy and lavage were performed on the 2nd day of admission ( fig .
the pathology examination of the sphacelus revealed non - specific inflammation as well as the deposition of fibrin and hemosiderin . a fine needle aspiration biopsy performed on the day of admission and a bacterial culture carried out during surgery did not reveal any microorganisms .
considering that the antibiotic treatment performed at another hospital resulted in such outcomes , the antibiotic treatment was continued after surgery with the assumed diagnosis of septic arthritis .
however , the knee pain did not disappear even 1 month after surgery and the blood test results showed a postoperative increase in the erythrocyte sedimentation rate and c - reactive protein level .
an arthroscopic synovectomy and lavage were carried out due to signs of synovitis but bacteria were identified .
the 2nd operation did not lead to an improvement in the patient 's condition and the erythrocyte sedimentation rate and c - reactive protein remained high .
accordingly , a fine needle aspiration biopsy was performed again 3 weeks after the 2nd operation .
an organism suspected to be yeast was found in the bacterial culture , which led to an additional fungus culture that identified hansenula anomala .
a single dose of iv amphotericin b ( 500 mg daily ) was administered to the patient for 8 weeks .
however , the treatment was interrupted due to an increase in the blood urea nitrogen and creatine caused by the nephrotoxicity of amphotericin b. therefore , it was replaced with another antifungal agent , fluconazole .
the patient was discharged when the symptoms improved and the erythrocyte sedimentation rate and c - reactive protein became normal after 7 weeks of an intravenous injection of a daily dose of 400 mg of fluconazole .
no signs of relapse were identified until the 6th postoperative month and the patient is currently being followed up on an outpatient basis .
contrary to the assumptions so far , many reports have shed light on the pathogenicity of fungi . among them , candida species are the most common cause of human infections , and fungal infections are on the rise .
the past decades have witnessed the development of treatments that have improved the survival rate of patients with low immunity due to malignant tumors , premature birth , and organ transplants .
these patients are more vulnerable to fungal infections considering that they are immunocompromised and require lengthy hospitalization , intravascular cannulation and extensive antibiotic treatment . fungal infections are a major cause of death and disease in immunocompromised patients .
the most common strains include candida , aspegillus , and phycomycetes species . as choi and choi2 ) reported in 1996 , hansenula anomala is an opportunistic fungus in immunodepressed patients .
hansenula anomala was first introduced by hansen in 1981 and interstitial pneumonia found in a newborn infant by csillag et al . in 1953 was the first case of human infection caused by hansenula anomala . in 1958 ,
according to taylor et al.,6 ) hansenula anomala accounts for 1% of the causes of the pathogenic fungaemia .
the presumed predisposing factors and underlying diseases of hansenula anomala infections include low birth weight , drug addiction , aids , cancer , total parenteral nutrition , and the extensive use of antibiotics .
human infections caused by hansenula anomala are rare and present in a range of patterns .
it can cause severe infections , such as sepsis , pneumonia , endocarditis , and ventriculitis , in patients with hematologic malignancy and immunodepression as well as in premature infants.1 - 4 ) according to choi and choi2 ) fungemia caused death in 64% of infected patients .
hansenula anomala infections in patients with a normal immune system are uncommon and cases of fungal arthritis caused by hansenula anomala are even more rare .
the most common cause of fungal infections of the joint is a direct injection into the joint , such as intraarticular injection and surgery .
infections caused by hematogenous dissemination are prevalent in those addicted to drugs . according to a report on fungal arthritis in 8 patients by vicari et al.7 ) in 2003 , severe leukocytopenia and the use of immunosuppressants and intravascular cannulation
therefore , it is believed that a fungal culture test should accompany a fine needle aspiration biopsy and intraoperative bacterial culture , which are performed under the suspicion of pyogenic arthritis in patients with these risk factors .
in addition , a fungal infection should be considered when the condition becomes chronic without identification of the bacteria or an adequate response to antibiotics and surgery , as in our case .
the patient described in this report was normally healthy and had no risk factors for a fungal infection but was under treatment for diabetes .
therefore , it is believed that the occurrence of hansenula anomala infection in the knee was caused by the trait of the fungus growing well in a high - sugar - containing medium rather than by immunodepression.8 ) in addition , the use of intraarticular injections due to degenerative arthritis performed at another institution prior to the development of the fungal infection might be a possible cause .
diabetic patients are more vulnerable to fungal infections and less responsive to treatment than others .
in addition , considering that an intraarticular injection is the preferred treatment option for degenerative arthritis in korea , the patient 's record of illness documented at other institutions should be monitored closely .
although the proper treatment procedures for hansenula anomala infections have yet to be established , some reports have described it as being susceptible to amphotericin b , flucytosine , and fluconazole.9 ) in this patient , 8 days use of amphotericin b led to changes in the erythrocyte sedimentation rate and c - reactive protein from 57 mm / hr and 0.25 mg / dl to 38 mm / hr and 0.2 mg / dl , respectively .
therefore , hansenula anomala was receptive to amphotericin b , even though the antifugal agent had to be replaced by fluconazole due to adverse drug reactions , such as increased blood urea nitrogen and creatine .
after 7 weeks of iv fluconazole therapy , the erythrocyte sedimentation rate and c - reactive protein became normal confirming its efficacy . according to cuellar et al.,10 )
fungal arthritis can be treated with the proper use of antimicrobial agents and surgery , even though adjustments should be made depending on the species .
it is believed that surgical treatments , such as drainage and synovectomy , accompanying the use of antimicrobial agents are important factors for the treatment of fungal arthritis , and amputation may be required for resistant bacteria and life - threatening fungemia nonresponsive to these treatments . in many cases , fungal arthritis , unlike other infections , is difficult to diagnose early due to the difficulty in identification , resulting in a longer duration of illness and chronic status .
a diagnostic delay also occurred in our case because the culture test was not performed during the initial examination and 1st operation , and the test performed during the 2nd operation did not indicate a fungal infection .
however , it can be concluded that a fungal infection is the cause of the arthritis considering that no notable change was observed in the patient 's clinical condition after surgery and treatment and that the antifungal agent treatment resulted in an improvement in symptoms and normalization of the erythrocyte sedimentation rate and c - reactive protein . as shown in our case ,
important factors for the treatment of fungal arthritis are early diagnosis and the proper use of antifungal agents .
we report a case of fungal arthritis caused by hansenula anomala in a diabetic patient treated by surgery and antifungal agents . | hansenula anomala ( h. anomaly ) is part of the normal flora in the alimentary tract and throat .
it has been reported to be an organism causing opportunistic infections in immunocompromised patients .
however , cases of fungal arthritis caused by h. anomala are rare .
we encountered a case of h. anomala arthritis in a 70-year - old man who was treated with an empirical antibiotic treatment and surgery under the impression of septic arthritis .
however , the patient did not improve after antibiotic therapy and surgery .
consequently , knee joint aspiration was performed again , which identified fungal arthritis caused by h. anomala .
it was treated successfully with amphotericin b and fluconazole . when treating arthritis patients with diabetes , it is important to consider the possibility of septic arthritis by h. anomala and provide the appropriate treatment . |
pancreatic oxidative stress occurs during an early stage of pancreatitis.1 - 3 scavenger therapy for reactive oxygen species ( ros ) showed some success in experimental pancreatitis models , including cerulein
pancreatitis.4,5 in human acute pancreatitis , the increased levels of lipid peroxide in the bile or pancreatic tissue and subnormal levels of antioxidant vitamins in the blood were reported.6 cerulein is an analogue of cholecystokinin ( cck ) and causes the maximum pancreatic secretion of amylase and lipase,7,8 cytoplasmic vacuolization , death of acinar cells , edema formation , and infiltration of inflammatory cells into the pancreas,9,10 which are observed in human pancreatitis .
the mechanism of action of cerulein is suggested to involve production of large amounts of ros , activation of oxidant - sensitive transcription factor nuclear factor-b ( nf-b ) and induction of cytokine expression in pancreas.11,12 nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase components have been detected in pancreatic acinar ar42j
cells.13 ar42j cells are derived from a transplantable tumor of a rat exocrine pancreas and are tumorigenic in nude mice and maintain many characteristics of normal pancreatic acinar cells.14 cerulein - induced nf-b activation and interleukin ( il)-6 expression were inhibited by treatment with the antioxidant rebamipide , diphenylene iodonium ( nonspecific inhibitor for nadph oxidase ) , or by transfection with antisense oligodeoxynucleotides for nadph oxidase subunits p22phox and p47phox in pancreatic acinar ar42j cells .
therefore , nadph oxidase has been considered as a main source of ros during development of pancreatitis induced by cerulein .
both nf-b and janus kinase / signal transducer and activator of transcription ( jak / stat ) are activated in response to ros in pancreas.11,15 although there are reports indicating the involvement of nf-b in the pathogenesis of pancreatitis and pancreatic cancer , only limited data are available on the role of jak / stat in the pathogenesis of these diseases .
it has been reported that inhibition of jak1/stat1 improves the severity of cerulein - stimulated pancreatic injury by inhibiting nf-b activation , indicating that activation of jak1/stat1 is an early event in pancreatic injury.16 since jak / stat mediates cell proliferation and malignant transformation17 as well as inflammatory signaling18,19 in pancreas , we focus our discussion on the possible role of jak / stat in the pathogenesis of pancreatitis and pancreatic cancer in this review .
the jak family kinases consist of four members jak1 , jak2 , jak3 , and tyrosine kinase 2 ( tyk2 ) in mammals , whereas there are seven stat family members such as stat1 , stat2 , stat3 , stat4 , stat5a , stat5b , and stat6 .
the binding of a cytokine to its receptor induces conformational changes of the receptor , which subsequently results in the activation of the associated jaks .
phosphorylation of stats leads to their dimerization and translocation into the nucleus , in which they bind specific dna sequences to activate gene transcription .
stat1 , stat2 , stat3 , stat5 , and stat6 are widely distributed in various tissues , whereas stat4 is restricted mainly to thymus , spleen , testis , myeloid cells , and monocytes.20 in pancreatic tissue and acinar cells , jak1 , jak2 , tyk2 , stat1 , stat2 , stat3 , stat5 , and stat6 are expressed . however ,
expression of stat4 is detected in pancreatic tissue but not in isolated pancreatic acinar cells.21 in pancreatic acinar ar42j cells , tumor necrosis factor- ( tnf- ) stimulates the activation of stat1 , stat3 , and stat422 and stat3 and suppressor of cytokine signaling 3 ( socs3 ) which are all signaling pathways involved in tissue inflammation.23 tnf- and tnf- receptors ( tnfr1 and tnfr2 ) have been shown to be expressed in normal rat pancreatic acinar cells and cerulein upregulated the expression of tnf- receptors24 and activated jak2/stat3 and il-1 in pancreatic acinar cells.25 together these studies suggest that stat3 activation by cerulein is mediated by tnf- signaling in pancreas ( fig .
although various hormones such as growth hormone and prolactin have been reported to activate the jak / stat pathway,26 there have been little studies on the involvement of jak / stat on cck signaling .
a cck analogue cerulein triggers phosphorylation of jak1 , stat1 , and stat3 proteins and induce inflammatory cytokines such as tnf- , il-1 , and il-6 in pancreas.27 cck receptors are a group of g - protein coupled receptors ( gpcrs ) which bind two subtypes of cck , cck1 , and cck2 .
cck2 receptor ( cck2r ) upon binding of cck activated the jak2/stat3 pathway in pancreatic acini in transgenic mice expressing cck2r.17 the mechanism of jak2 activation involves gq proteins and requires the npxxy motif , located at the end of the seventh transmembrane domain of cck2r .
this motif , which is critical for gq - dependent signaling pathways , is also required for stat3 activation by cck2r .
thus , jak / stat signaling is involved in the proliferative effect of cck2r , which contributes to the increase in the growth of pancreas and pancreatic tumor development .
the stat family of transcription factors is known to be activated by various cytokines and growth factors and may be activated by oxidative stress . in epithelial cells and fibroblasts ,
activation of stat3 and stat1 in response to h2o2 occurs within minutes.15 ros act as upstream signaling molecules for jak2 activation in smooth muscle cells.28 the mechanism of h2o2 activation of stat proteins involves activation of the jak2 and tyk2 kinases .
stats are phosphorylated in response to h2o2 subsequent to the phosphorylation of jak2 and tyk2 kinases.15 the possible mechanism for activation of jak2 by h2o2 is inactivation of protein tyrosine phosphatases ( ptps ) .
using ptp inhibitors vanadate and pervanadate results in stat activation.29,30 in human pancreatic cancer mia paca-2 and panc-1 cells , nadph oxidase 4 ( nox4 ) , which produces ros , mediates the sustained phosphorylation of jak2.31 nox4 inhibits ptp , leading to enhanced and sustained phosphorylation of jak2 and suppresses apoptosis of pancreatic cancer cells .
these studies demonstrate that ros mediate activation of jak / stat and inhibit apoptotic cell death of pancreatic cancer cells .
we previously reported that activation of jak2/stat3 results in edematous and inflammatory changes in the pancreas and increased serum levels of il-1 in rats with experimental pancreatitis.19 the maximal lung injury after cerulein - induced acute pancreatitis occurs in stat4- or stat6-deficient mice.32 in pancreatic acinar cells stimulated with tnf- , the activation of jak2/stat3 mediated the development of pancreatic injury.22 inhibition of jak / stat as well as nf-b improved the severity of pancreatitis.27 since ros mediates induction of inflammatory cytokines and nadph oxidase produces ros in pancreas , inhibition of nadph oxidase may be beneficial for the prevention and the treatment of pancreatitis by suppressing jak2/stat3 and mitogen activated protein kinases ( mapks ) and expression of tgf-1 in pancreatic acinar cells.25 lipopolysaccaride ( lps ) , tnf- , and cerulein are potent mediators of stat3 and socs3 expression as well as the induction of il-6 and il-1 in pancreas.23,33 targeting mapks , nf-b , and stat3 pathways by dexamethasone treatment downregulated the expression of chemokines during the course of acute pancreatitis , resulting in decreased severity of the disease in the rats with bile duct ligation.34 administration of cerulein and lps induced an increase in serum amylase and il-6 levels , severe acute pancreatitis , pancreatitis - associated lung injury , and phosphorylation of stat3 in the pancreas . blocking il-6 suppresses stat3 activation in the pancreas and consequently attenuated the severity of pancreatitis by promoting pancreatic acinar cell apoptosis.35 pancreatitis - associated ascitic fluid ( paaf ) which is known to contribute to the progression of acute pancreatitis activated the expression of monocyte chemoattractant protein-1 ( mcp-1 ) and induced the phosphorylation of p38-mapk , degradation of ib , and increases in nuclear level of p65 , and stat3 activity in rat pancreatic acinar cells.36 it was suggested from this study that acinar cells are activated by paaf to produce mcp-1 , mediated mainly by the activation of nf-b and stat3 pathways . in early acute pancreatitis in the rat , oxidant - mediated activation of mapk , nf-b , and stat3 triggers the expression of chemokines in acini but not in non - acinar cells in the pancreas.37 cyclooxygenase-2 ( cox-2)-derived bioactive lipids including prostaglandin e2 are potent inflammatory mediators that promote tumor growth and metastasis by stimulating cell proliferation , invasion and angiogenesis.38 in cox-2 deficient mice , deletion of cox-2 gene prevented the histologic and inflammatory changes associated with pancreatitis compared with the wild - type littermates , indicating that cox-2 is an important regulator of the severity of acute pancreatitis.38 in the rats treated with a jak / stat inhibitor , ag490 , the expression of cox-2 , il-1 , and il-6 induced by cerulein was inhibited by the suppression of stat activation.27 therefore , stat may play an important regulatory role in the expression of inflammatory cytokine il-6 and cox-2 in cerulein - treated pancreatic acini .
jak2/stat3 pathway is activated by the cck2r in pancreatic tumor cells and contributes to cell proliferation.17 targeted expression of cck2r , a gpcr , in mouse pancreatic acinar tissue led to the activation of jak2 and stat3.16 the activation of jak2/stat3 increased growth of the pancreas and resulted in the development of preneoplastic lesions , which is similar to those found in human pancreatic cancers .
deregulation of jak2/stat3 pathway by cck2r represents an early step in pancreatic carcinogenesis , contributing to cell proliferation and pancreatic tumor development.17 recent studies indicate that stat3 controls the development of the earliest premalignant pancreatic lesions , acinar - to - ductal metaplasia and pancreatic intraepithelial neoplasia ( panin).39 stat3 directly regulates vascular endothelial growth factor expression and hence angiogenesis , growth , and metastasis of human pancreatic cancer fg and panc-1 cells.40 on malignant transformation , activated stat3 promotes cellular proliferation by acceleration of g1/s - phase progression and thereby contributes to the malignant phenotype of human pancreatic cancer capan-1 cells.41 the deregulation of jak2/stat3 pathway by cck2r represents an early step contributing to cell proliferation and pancreatic tumor development.17 the transcription factor pancreatic and duodenal homeobox factor 1 ( pdx-1 ) is expressed in pancreatic progenitor cells . in exocrine pancreas , pdx-1 is down - regulated during late development , while re - up - regulation of pdx-1 has been reported in pancreatic cancer and pancreatitis .
the pancreas of pdx-1 expressing transgenic mouse was markedly small with the replacement of acinar cells by duct - like structures ( acinar cell - ductal metaplasia ) , accompanied by activated stat3 .
these results provide a mechanism of pancreatic metaplasia by which persistent pdx-1 expression induces acinar - to - ductal transition through stat3 activation.42 inactivation of il-6 transsignaling or stat3 inhibits panin progression and reduces the development of pancreatic ductal adenocarcinoma ( pdac ) .
aberrant activation of stat3 through homozygous deletion of socs3 in the pancreas accelerates panin progression and pdac development.43 thus , inflammatory mediator stat3 is a critical component of spontaneous and pancreatitis - accelerated pdac precursor formation and contributes to cell proliferation , metaplasia - associated inflammation , and matrix metalloproteinase 7 ( mmp7 ) expression during neoplastic development .
it was also shown that stat3 signaling enforces mmp7 expression in pdac cells and that mmp7 deletion limits tumor size and metastasis in mice .
these studies suggest that stat3 and mmp7 are important mediators for pdac initiation and progression.44 in cultured human pancreatic cancer su 86.86 cells , cox-2 was induced by treatment with tumor - promoting phorbol esters45 and in cox-2-positive pancreatic cancer bxpc-3 cells , cox-2 inhibitor reduced angiogenesis and growth.46 recently , a novel pathway in which cox-2 activates stat3 by inducing il-6 expression has been suggested in non - small cell lung cancer cells.47 together , these studies provide a rationale for the development of stat3 , il-6 , cox-2 , and mmp7 targeted therapy for the treatment of pancreatic cancer .
in addition to nf-b , ros activates jak / stat pathway , which regulates inflammatory gene expression , cell proliferation , and transformation in pancreas .
thus , the activation of nf-b and jak / stat seems to be the molecular mechanisms underlying the pathogenesis of pancreatitis and pancreatic cancer .
inhibition of either jak / stat or nf-b may alleviate inflammation and carcinogenesis of pancreatic tissues .
therefore , jak / stat may serve as the potential therapeutic targets in the development of new drugs in the treatment of pancreatitis and/or pancreatic cancer . | in the pathogenesis of pancreatitis , oxidative stress is involved in the activation of the janus kinase / signal transducer and activator of transcription ( jak / stat ) pathway and cytokine expression .
high serum levels of cholecystokinin ( cck ) have been reported in patients with acute pancreatitis , and treatment with cerulein , a cck analogue , induces acute pancreatitis in a rodent model .
recent studies have shown that cerulein - activated nicotinamide adenine dinucleotide phosphate oxidase elicits reactive oxygen species , which trigger the phosphorylation of the jak1 , stat1 , and stat3 proteins and induce the production of inflammatory cytokines , such as tumor necrosis factor- , interleukin ( il)-1 , and il-6 , in pancreatic acinar cells .
the jak / stat pathway also stimulates cell proliferation and malignant transformation and inhibits apoptosis in the pancreas .
this review discusses the possible role of the jak / stat pathway in the pathogenesis of pancreatitis and pancreatic cancer in response to oxidative stress . |
baboon syndrome or symmetrical drug .- related intertriginous and flexural exanthema . may be induced by systemic administration of substances including contact allergens such as mercury and nickel , and multiple drugs .
baboon syndrome ( or systemically induced allergic contact dermatitis ) is characterized by the occurrence of diffuse and symmetric erythematous maculopapular eruption of the flexural areas , with a v - shaped pattern on the medial thighs and diffuse erythema on the buttocks.[15 ] it appears within a few days after systemic administration of substances including contact allergens such as mercury and nickel , and drugs.[15 ] we report here a rare case of baboon syndrome induced by hydroxyzine .
a 60-year - old man started treatment with hydroxyzine ( atarax ; ucb pharma , france ) and meprobamate ( equanil ; sanofi - aventis , france ) for anxiety .
after 2 days , he developed a pruritic symmetrical erythema with few small pustules on both inner thighs , cubital fossae , axillae , and the gluteal area [ figures 1 and 2 ] .
the patient denied any intake of other medications during the previous weeks and had no history of mercury exposure .
there was no fever and laboratory tests ( complete blood cell count and c - reactive protein ) showed only eosinophilia ( 800/ml ) .
skin biopsy showed a perivascular lymphohistiocytic infiltrate with eosinophils and some neutrophils in the dermis .
the clinical and histopathological findings were consistent with a pustular drug - related baboon syndrome .
the two drugs were discontinued and the lesions resolved within 4 days without any medications .
one week later and despite our recommendations , the patient took again one tablet of hydroxyzine .
one month after complete resolution , the patient was patch tested with european standard series , metals series , ethylenediamine dihydrochloride ( 1% pet . ) , meprobamate ( 30% pet . and
30% in water ) , hydroxyzine ( 30% pet . and 30% in water ) , cetirizine ( 30% pet . and 30% in water ) , and levocetirizine ( 30% pet . and 30% in water ) .
only the patch tests with hydroxyzine were positive at d2 ( + ) and d3 ( + + ) . at d4 , the positive patch test with hydroxyzine ( 30% pet . ) showed pustular formation [ figure 3 ] .
oral provocation tests with cetirizine and levocetirizine were negative . in view of the positive reactions obtained with the patch test and the oral accidental provocation test ,
sharply demarcated v - shaped erythema in the inguinal / perigenital area v - shaped erythema on the higher part of the thighs and buttocks positive ( + + ) reaction with pustules to atarax ( 30% pet . ) at d4
drug - related baboon syndromes are very rare . according to husermann , et al . , about 50 cases of drug - related baboon syndrome have been reported in the literature .
recently , husermann , et al . proposed in 2004 a new acronym : symmetrical drug - related intertriginous and flexural exanthema ( sdrife ) to replace and further refine the old term of drug - related baboon syndrome .
they proposed five diagnostic criteria for sdrife : ( 1 ) exposure to a systemically administered drug either at the first or repeated dose ( excluding contact allergens ) ; ( 2 ) sharply demarcated erythema of the gluteal / perianal area and/or v - shaped erythema of the inguinal / perigenital area ; ( 3 ) involvement of at least another intertriginous / flexural localization ; ( 4 ) symmetry of affected areas ; and ( 5 ) absence of systemic symptoms and signs .
a review of literature identify only 17 reported cases of hydroxyzine - induced drug eruptions.[616 ] they include mainly maculopapular eruption ( eight cases)[78101315 ] and fixed drug eruption ( seven cases ) .
urticaria and acute generalized exanthematous pustulosis have been reported each in one case . despite the structural similarity of the three anti - histamines , hydroxyzine , cetirizine , and levocetirizine ,
patch tests and oral provocation tests with cetirizine and levocetirizine remained negative . to the best of our knowledge
, our case seems to be the first reported case of hydroxyzine - induced sdrife . to the best of our knowledge , | hydroxyzine - induced drug eruptions are very rare . we report here a typical case of drug - related baboon syndrome or symmetrical drug - related intertriginous and flexural exanthema ( sdrife ) which was induced by hydroxyzine in a 60-year - old man .
the diagnosis was confirmed by positive patch and oral accidental provocation tests with hydroxyzine .
patch tests and oral provocation tests with cetirizine and levocetirizine were negative . a review of the literature identified only 17 reported cases of hydroxyzine - induced drug eruptions .
to the best of our knowledge , we report here the first case of hydroxyzine - induced sdrife . |
the association between ebv and human malignancies , including endemic burkitt s lymphoma , hodgkin lymphoma and non - hodgkin s lymphoma ( nhl ) of either b- or t - immunophenotypes , has been reported .
subsequent study revealed the constant association of nktcl with ebv in the world ( fig .
sino - nasal lymphomas are immunophenotypically classified into nk / t-(cd56 ) , t- , and b - cell type with distinctive clinical features .
positivity , therefore nktcl , was closely associated with ebv positivity among sino - nasal lymphomas .
ebv could be subtyped based on the difference in sequence of ebna2 region , i.e. type a and type b .
almost all of the nktcl in korea and japan had type a ebv , which is identical with the previous literature reporting that most cases of ebv - associated malignancies of immunocompetent patients in asia had type a ebv .
predominance of type a ebv was also found in nktcl in malaysia , indicating the predominance of type a ebv in nktcl in asia .
reported that three of six cases of nktcl in switzerland had type b ebv , although no findings suggestive of immunodeficiency were found in these patients .
these findings suggest a geographic difference in the distribution of ebv subtype in the nktcl .
2 in situ hybridization with eber-1 probe reveals positive signals in the nucleus of proliferating celltable 1ebv in nasal nk / t - cell lymphomasourcecountryebv positive rate ( % ) ebv subtype expression of latentfrance7/7 ( 100)na7/7 lmp+china21/21 ( 100)na5/21 lmp-1+japan11/12 ( 92)10/11 typea8/12 lmp-1+korea15/16 ( 94)15/15 typea7/15 lmp-1+indonesia18/20 ( 90)nanaebv epstein barr virus , lmp latent membrane protein , na not availablefresh tissue samples were used in the analyses in situ hybridization with eber-1 probe reveals positive signals in the nucleus of proliferating cell ebv in nasal nk / t - cell lymphoma ebv epstein
barr virus , lmp latent membrane protein , na not available fresh tissue samples were used in the analyses as shown in table 1 , the proliferating cells in nktcl frequently express latent membrane protein ( lmp ) as revealed by immunohistochemistry .
latent infection gene products of ebv , ebna-2 and lmp-1 , serve as target antigens for the elimination of ebv infected cells by host cytotoxic t - lymphocytes ( ctl ) .
shen et al . showed that nktcl cells are able to provide target epitopes of ebv for ctl . in immunocompromised hosts ,
proliferating cells expressing ebna-2 and lmp-1 can escape from immune surveillance by the host ctl , which might result in the development of malignant lymphomas .
however , systemic immunosuppression is not noted in patients with nktcl , thus suggesting an unknown underlying mechanism for escape of lmp-1-expressing tumor cells from the ctl .
several mechanisms such as downregulation of the immunogenic ebv nuclear antigens and preferential selection of the deletion genotype of lmp-1 was reported by chiang et al . [ 33 , 34 ] and expression of il-10 , an immunosuppressive cytokine , was reported by shen et al . .
the cells expressing viral antigens are eliminated primarily by ctl in a mhc - class - i - restricted manner .
it is possible that nktcl patients show lower frequencies of a*02 allele compared with those in the normal population .
indeed high - resolution genetic typing revealed significantly lower frequency of hla - a*0201 in nktcl than in normal population .
these findings suggest that hla - a*0201-restricted ctl responses may function in vivo to suppress the development of nktcl , or in other words , role of ebv for nktcl development .
lymphoma arises from clonal expansion of lymphoid cells that are transformed by the accumulation of genetic lesions affecting oncogenes and tumor suppressor genes . in general , amount of samples from nktcl lesions available for genetical analyses is small , and samples usually contain massive necrotic areas . therefore information for genetical changes in nktcl has been relatively limited until present
. polymerase chain reaction ( pcr)single strand conformation polymorphism ( sscp ) followed by direct sequence method was employed for analyses of gene alterations in nktcl .
the genes analyzed by this method were p53 , k - ras , c - kit , and -catenin on the nktcl cases from asian countries [ 3842 ] and mexico .
p53 is a well - known tumor suppressor gene that causes cells with damaged dna to arrest at the g1 phase of cell cycle or stimulating expression of the bax gene , the protein that promotes apoptosis . in a wide variety of human cancers ,
greenblatt et al . identified 50 studies in which sequencing of the entire coding region of p53 had been reported .
of the 560 mutations reported in those papers , 87% were found in exons 58 , and most of the others were in exon 4 ( 8% ) . in the studies for nktcl in asia ,
exons 48 or exons 58 were examined in one institute ( table 2 ) .
the frequency of p53 mutations was various by district : high in japan and indonesia and low in mexico , korea , and shenyang .
shenyang situates at north china , which is adjacent to the korean peninsula , suggesting that environmental and genetical factors might generate the differences in frequency . transitions ( g : c to a : t ) were the predominant pattern of mutations except for mexico , in which number of cases with mutations was only five , thus the data from mexico seemed to be not conclusive .
the transition pattern of p53 mutations is known to be more susceptible to spontaneous genetic instability than transversion . while genetic instability as revealed by widespread microsatellite instability was not found in the cases with nktcl .
table 2p53 mutations in nasal nk / t - cell lymphomanumber of cases exons examinedfrequency of mutations ( % ) predominance of transition mutationasia japan 584862%yes korea 424831%yes china beijing , chengdu 425848%yes shenyang 204840%yes indonesia 274863%yesmexico
215824%no p53 mutations in nasal nk / t - cell lymphoma quintanilla - martinez et al . reported the association of p53 overexpression with poor prognosis , and p53 mutations with large cell morphology and advanced stage [ 43 , 48 ] .
[ 15 , 38 ] the c - kit proto - oncogene encodes a receptor tyrosine kinase , which is involved in normal hematopoiesis , gametogenesis , and melanogenesis via the c - kit receptor - ligand system . .
because the development of acute leukemia or malignant lymphoma was reported in transgenic mice expressing kit [ 8 , 14 , 50 ] , nktcl in asian countries was examined for the c - kit gene mutations .
frequency of c - kit mutations was significantly higher in china ( beijing , chengdu ) ( 10 of 14 cases : 71.4% ) than in japan ( 9 of 58 cases : 15.5% ) , korea ( 5 of 42 cases:11.9% ) , northeast china ( shenyang ) ( 2 of 20 cases:10% ) , and indonesia ( 3 of 27 cases : 11.1% ) .
these findings suggest that location - specific differences in etiological factors cause specific mutations in c - kit gene .
fas ( apo-1/cd95 ) is a 45 kda membrane protein belonging to the tumor necrosis factor receptor family , and mediates programmed cell death ( apoptosis ) through binding of fas ligand ( fas l ) .
fas consists of 325 amino acids with a single transmembrane domain , including signal peptide .
the 80-amino acid portion in the cytoplasm , designated as a death signaling domain , is essential for the apoptotic signal transduction .
fas gene mutations were reported in about 10% cases with sporadic non - hodgkin s lymphoma .
nktcl frequently co - express fas and fas ligand ( fas l ) , but the tumor cells seldom undergo apoptosis .
some mechanisms for resistance to fas / fas l - induced apoptosis might work in the development of nktcl , thus fas gene mutations could be one of the mechanisms .
two reports support this notion : nktcl cells in 9 of 15 ( 60% ) cases and 7 of 14 ( 50% ) cases showed mutations of fas gene .
mouse t - cell lymphoma cells transfected with mutated fas genes were resistant to apoptosis ( fig . 3 , fig . 4 ) ,
these findings suggest that accumulation of lymphoid cells with fas mutations provides a basis for the development of nktcl .
the shaded rectangles at the cooh - terminus of the protein represents the small peptide added because of the frameshift in the gene encoding fas.tm : transmembrane domainfig .
4the mouse wr19l cell line expressing recombinant human fas protein with ( t1102c , a978 g , 1095 ins a ) or without ( wild type ) mutations were incubated with various concentrations of anti - fas antibody at 37.0c for 16 h. clones expressing fas receptor with any mutations ( a978 g , 1095 ins a , t1102c ) were resistant to apoptosis induced by the anti - fas antibody summary of the fas gene mutations found in patients with nasal nktcl .
the shaded rectangles at the cooh - terminus of the protein represents the small peptide added because of the frameshift in the gene encoding fas.tm : transmembrane domain the mouse wr19l cell line expressing recombinant human fas protein with ( t1102c , a978 g , 1095 ins a ) or without ( wild type ) mutations were incubated with various concentrations of anti - fas antibody at 37.0c for 16 h. clones expressing fas receptor with any mutations ( a978 g , 1095 ins a , t1102c ) were resistant to apoptosis induced by the anti - fas antibody various cytogenetic alterations have been reported , of which deletions of 6q are the common .
polymerase chain reaction ( pcr)single strand conformation polymorphism ( sscp ) followed by direct sequence method was employed for analyses of gene alterations in nktcl .
the genes analyzed by this method were p53 , k - ras , c - kit , and -catenin on the nktcl cases from asian countries [ 3842 ] and mexico .
p53 is a well - known tumor suppressor gene that causes cells with damaged dna to arrest at the g1 phase of cell cycle or stimulating expression of the bax gene , the protein that promotes apoptosis . in a wide variety of human cancers ,
greenblatt et al . identified 50 studies in which sequencing of the entire coding region of p53 had been reported .
of the 560 mutations reported in those papers , 87% were found in exons 58 , and most of the others were in exon 4 ( 8% ) . in the studies for nktcl in asia , exons 48 or exons 58 were examined in one institute ( table 2 ) .
the frequency of p53 mutations was various by district : high in japan and indonesia and low in mexico , korea , and shenyang .
shenyang situates at north china , which is adjacent to the korean peninsula , suggesting that environmental and genetical factors might generate the differences in frequency .
transitions ( g : c to a : t ) were the predominant pattern of mutations except for mexico , in which number of cases with mutations was only five , thus the data from mexico seemed to be not conclusive .
the transition pattern of p53 mutations is known to be more susceptible to spontaneous genetic instability than transversion . while genetic instability as revealed by widespread microsatellite instability was not found in the cases with nktcl .
table 2p53 mutations in nasal nk / t - cell lymphomanumber of cases exons examinedfrequency of mutations ( % ) predominance of transition mutationasia japan 584862%yes korea 424831%yes china beijing , chengdu 425848%yes shenyang 204840%yes indonesia 274863%yesmexico
215824%no p53 mutations in nasal nk / t - cell lymphoma quintanilla - martinez et al . reported the association of p53 overexpression with poor prognosis , and p53 mutations with large cell morphology and advanced stage [ 43 , 48 ] .
[ 15 , 38 ] the c - kit proto - oncogene encodes a receptor tyrosine kinase , which is involved in normal hematopoiesis , gametogenesis , and melanogenesis via the c - kit receptor - ligand system . .
because the development of acute leukemia or malignant lymphoma was reported in transgenic mice expressing kit [ 8 , 14 , 50 ] , nktcl in asian countries was examined for the c - kit gene mutations .
frequency of c - kit mutations was significantly higher in china ( beijing , chengdu ) ( 10 of 14 cases : 71.4% ) than in japan ( 9 of 58 cases : 15.5% ) , korea ( 5 of 42 cases:11.9% ) , northeast china ( shenyang ) ( 2 of 20 cases:10% ) , and indonesia ( 3 of 27 cases : 11.1% ) .
these findings suggest that location - specific differences in etiological factors cause specific mutations in c - kit gene .
fas ( apo-1/cd95 ) is a 45 kda membrane protein belonging to the tumor necrosis factor receptor family , and mediates programmed cell death ( apoptosis ) through binding of fas ligand ( fas l ) .
fas consists of 325 amino acids with a single transmembrane domain , including signal peptide .
the 80-amino acid portion in the cytoplasm , designated as a death signaling domain , is essential for the apoptotic signal transduction .
fas gene mutations were reported in about 10% cases with sporadic non - hodgkin s lymphoma .
nktcl frequently co - express fas and fas ligand ( fas l ) , but the tumor cells seldom undergo apoptosis . some mechanisms for resistance to fas / fas l - induced apoptosis might work in the development of nktcl ,
two reports support this notion : nktcl cells in 9 of 15 ( 60% ) cases and 7 of 14 ( 50% ) cases showed mutations of fas gene .
mouse t - cell lymphoma cells transfected with mutated fas genes were resistant to apoptosis ( fig . 3 , fig . 4 ) ,
these findings suggest that accumulation of lymphoid cells with fas mutations provides a basis for the development of nktcl .
the shaded rectangles at the cooh - terminus of the protein represents the small peptide added because of the frameshift in the gene encoding fas.tm : transmembrane domainfig .
4the mouse wr19l cell line expressing recombinant human fas protein with ( t1102c , a978 g , 1095 ins a ) or without ( wild type ) mutations were incubated with various concentrations of anti - fas antibody at 37.0c for 16 h. clones expressing fas receptor with any mutations ( a978 g , 1095 ins a , t1102c ) were resistant to apoptosis induced by the anti - fas antibody summary of the fas gene mutations found in patients with nasal nktcl .
the shaded rectangles at the cooh - terminus of the protein represents the small peptide added because of the frameshift in the gene encoding fas.tm : transmembrane domain the mouse wr19l cell line expressing recombinant human fas protein with ( t1102c , a978 g , 1095 ins a ) or without ( wild type ) mutations were incubated with various concentrations of anti - fas antibody at 37.0c for 16 h. clones expressing fas receptor with any mutations ( a978 g , 1095 ins a , t1102c ) were resistant to apoptosis induced by the anti - fas antibody
various cytogenetic alterations have been reported , of which deletions of 6q are the common .
it had been reported that nktcl seemed to be relatively common among non - hodgkin s lymphoma in hong kong [ 5658 ] : malignant lymphomas affecting nose and nasopharyngeal region constituted 7.2% of extranodal lymphomas and 45 of 70 cases with malignant lymphomas in the nose , nasopharynx , and larynx had pr morphology .
this disease is occasionally encountered in the hospitals in japan [ 5 , 59 , 60 ] .
when one of the authors ( ka ) visited the usa in 1987 , he noticed that the disease was quite rare in the usa , but they had consultation cases from peru .
because japanese and a part of peruvian belong to mongolian ethnic group , it was postulated that the mongolian group might be much more frequently affected by this disease .
then they started to examine the frequency of nktcl in japan , korea ( seoul ) , and china ( shanghai ) during the period from 1987 to 1993 .
the results are summarized in table 3 [ 6163 ] , in which the frequency of each disease constituting lmg is shown as the frequency per 100,000 patients who visited the ear
throat ( ent ) clinic in 37 university hospitals in japan , ryukyu university hospital in okinawa , japan , yonsei university hospital in seoul , and shanghai medical university hospital .
all of the histological sections were reviewed by one of the authors ( ka ) .
that in the institute of laryngology and otology , london ( 19661987 ) was four , showing two to ten times higher frequencies of the pr in the east asian countries .
the patients with nktcl seem to be clustered also in latin american countries and indonesia [ 66 , 67 ] .
information from other parts of the world such as africa , the middle and near east , and rusia is helpful to elucidate the etiology of this disease .
table 3frequency of lethal midline granuloma in japan , korea ( seoul ) , and china ( shanghai)diseasenumber of patients ( frequency per 100,000 ent patients)japan other than okinawa ( 19651986)okinawa ( 19731991)seoul ( 19791989)shanghai ( 19791990)wegener s granulomatosis64(4)1(3)0(0)1(4)polymorphic reticulosis114(8)9(27.4)56(40.8)73(9.8)malignant lymphoma82(6)11(33.5)15(10.9)54(7.2)others42(3)1(3)6(4.4)0(0)total302(21)22(69.9)77(56)128(17 ) frequency of lethal midline granuloma in japan , korea ( seoul ) , and china ( shanghai ) at the late 1990s , otorhinolaryngologists in both korea and japan had the impression that the frequency of pr appeared to be decreasing .
then the changes in frequency of pr with time among cases from seoul and 59 university hospitals in japan were examined : the frequency rate of pr per 100,000 outpatients of ent clinics in seoul decreased from 40 to 20 between the periods of 19771989 and 19901996 .
epidemiological studies have revealed that the nktcl occurs much more frequently in asian countries than in western countries and it is closely associated with ebv infection .
there are differences in frequencies of p53 and c - kit gene mutations among patients with nktcl in japan , china , and korea .
recently the first case of familial nktcl affecting a father and one of his six children was reported .
an increase in the risk of developing nhl among individuals exposed to pesticides was reported [ 70 , 71 ] .
in addition , a correlation of exposure to certain pesticides and organochlorines with increased titers of antibodies to ebv was reported .
all these findings might suggest a causative role for some genetical , environmental and life style factors in the development of nktcl .
therefore , the epidemiological study to elucidate whether socioenvironmental ambient factors contribute to the development of nktcl was conducted as a collaborative study of japan , korea and china ( table 4 ) .
the odd ratio ( or ) of nktcl was 4.15 ( 95% confidence interval ( ci ) , 1.749.37 ) for farmers , 2.81 ( ci 1.495.29 ) for producers of crops , and 4.01 ( ci 1.998.09 ) for pesticide users .
the ors for crop producers , who minimized their exposure to pesticides by using gloves and glasses , and sprinkling downwind at the time of pesticide use , were 3.30 ( ci 1.288.54 ) , 1.18 ( ci 0.1112.13 ) , and 2.20 ( ci 0.885.53 ) , respectively , which were lower than those for producers who did not take these precautions .
previous studies showed the increased risk of nhl in individuals using pesticides , especially phenoxyacetic acid - type herbicides .
association of pesticides with risk of developing t(14;18 ) positive - nhl , but not t(14;18 ) negative - nhl , was reported .
table 4risk of nasal nk / t - cell lymphoma in relation to cultivation of crops and pesticide useodds ration ( or)number of cases n = 88number of controls
n = 30595% ciloweruppercultivation of crops at present2.8127361.495.29 more than 5 years5.0824192.4710.43pesticides users4.0123231.998.09type of pesticide herbicide3.1713161.367.38 insecticide3.4520211.677.13 fungicide6.051061.9818.46precautions gloves used3.3010111.288.54 gloves not used 4.7613121.9311.72 mask used5.4414102.2013.47 mask not used 2.829131.087.37 glasses used1.18130.1112.13 glasses not used4.5222202.179.42 sprinkling downward attended2.209160.885.53 sprinkling downward not attended8.451473.0123.70ci confidence intervaladjusted for age ( < 40 , 4059 , > 60 ) , sex ( male / female ) and country ( japan , korea and china ) risk of nasal nk / t - cell lymphoma in relation to cultivation of crops and pesticide use ci confidence interval adjusted for age ( < 40 , 4059 , > 60 ) , sex ( male / female ) and country ( japan , korea and china )
epidemiological studies have revealed that the nktcl occurs much more frequently in asian countries than in western countries and it is closely associated with ebv infection .
there are differences in frequencies of p53 and c - kit gene mutations among patients with nktcl in japan , china , and korea .
recently the first case of familial nktcl affecting a father and one of his six children was reported .
an increase in the risk of developing nhl among individuals exposed to pesticides was reported [ 70 , 71 ] .
in addition , a correlation of exposure to certain pesticides and organochlorines with increased titers of antibodies to ebv was reported .
all these findings might suggest a causative role for some genetical , environmental and life style factors in the development of nktcl .
therefore , the epidemiological study to elucidate whether socioenvironmental ambient factors contribute to the development of nktcl was conducted as a collaborative study of japan , korea and china ( table 4 ) .
the odd ratio ( or ) of nktcl was 4.15 ( 95% confidence interval ( ci ) , 1.749.37 ) for farmers , 2.81 ( ci 1.495.29 ) for producers of crops , and 4.01 ( ci 1.998.09 ) for pesticide users .
the ors for crop producers , who minimized their exposure to pesticides by using gloves and glasses , and sprinkling downwind at the time of pesticide use , were 3.30 ( ci 1.288.54 ) , 1.18 ( ci 0.1112.13 ) , and 2.20 ( ci 0.885.53 ) , respectively , which were lower than those for producers who did not take these precautions .
previous studies showed the increased risk of nhl in individuals using pesticides , especially phenoxyacetic acid - type herbicides .
association of pesticides with risk of developing t(14;18 ) positive - nhl , but not t(14;18 ) negative - nhl , was reported .
table 4risk of nasal nk / t - cell lymphoma in relation to cultivation of crops and pesticide useodds ration ( or)number of cases n = 88number of controls n = 30595% ciloweruppercultivation of crops at present2.8127361.495.29 more than 5 years5.0824192.4710.43pesticides users4.0123231.998.09type of pesticide herbicide3.1713161.367.38 insecticide3.4520211.677.13 fungicide6.051061.9818.46precautions gloves used3.3010111.288.54 gloves not used 4.7613121.9311.72 mask used5.4414102.2013.47 mask not used 2.829131.087.37 glasses used1.18130.1112.13 glasses not used4.5222202.179.42 sprinkling downward attended2.209160.885.53 sprinkling downward not attended8.451473.0123.70ci confidence intervaladjusted for age ( < 40 , 4059 , > 60 ) , sex ( male / female ) and country ( japan , korea and china ) risk of nasal nk / t - cell lymphoma in relation to cultivation of crops and pesticide use ci confidence interval adjusted for age ( < 40 , 4059 , > 60 ) , sex ( male / female ) and country ( japan , korea and china )
. therefore clarification of risk factors for disease development is especially important to establish a strategy for disease prevention . because ebv infection and pesticides could be risk factors for nktcl , investigation on effects of pesticides for ebv activation
employment of the similar kind of the epidemiological study is desirable in other areas than east asia .
patients with nktcl cluster in asia and latin american countries , therefore some genetical factors might be involved in the disease development . further studies including hla antigen typing of patients is important to further clarify the mechanism for disease development . | nasal nk / t - cell lymphoma ( nktcl ) is an uncommon disease , but usually shows a highly aggressive clinical course .
the disease is much more frequent in asian and latin american countries than in western countries , and is universally associated with epstein
barr virus ( ebv ) infection .
analyses of gene mutations , especially p53 and c - kit , revealed the different frequencies by district .
epidemiological studies revealed the changes of the disease frequency in korea during the period from 19771989 to 19901996 .
case - control study showed that the exposure to pesticides and chemical solvents could be causative of nktcl .
further studies including hla antigen typing of patients is necessary to further clarify the disease mechanism . |
melioidosis is a disease caused by the pathogen burkholderia pseudomallei and the classical endemic regions are southeast asia and territory of northern australia . outside these regions the disease is uncommon , but
b. pseudomallei is a facultative gram - negative bacillus found in soil and surface water in the endemic regions .
acquisition of the bacterium occurs mainly by inhalation of contaminated dust or percutaneous inoculation of contaminated soil and the majority of the cases occur in the rainy season .
traditional risk factors for more severe disease are excessive alcohol consumption , diabetes , and chronic renal and lung disease
. the microbe is also defined as a category b bioterrorism agent due to its infectious potential and high virulence .
the most common presentation of melioidosis is pneumonia , but a variety of clinical presentations are described , including neurological melioidosis . accounting for approximately 4% of all cases of melioidosis , neurological melioidosis has a high mortality rate of approximately 25% .
on holiday in cambodia , during the rainy season , a 26-year - old previously healthy woman and her boyfriend rented 4-wheel all - terrain vehicles ( atvs ) and went on a trip into more rural areas .
the woman rode behind her boyfriend in the trails , and his bike made whirls of dust in front of her .
six days later she developed a high fever and respiratory symptoms and was admitted to the local hospital .
blood samples showed erythrocyte sedimentation rate ( esr ) 28 mm , c - reactive protein ( crp ) 306 mg / l , white blood cell ( wbc ) count 23 10/mm , neutrophils 18 10/mm , hemoglobin 12.7 g / dl , normal platelets and creatinine .
initial chest x - ray showed a patchy opacity in her left lung , and she was diagnosed with pneumonia .
her condition improved after 10 days of ceftazidime intravenously , and she returned to norway .
two days after returning , she was admitted to hospital with recurrent pneumonia . during this hospital stay , she reported a tingling sensation and numbness in the skin on the left side of her face and body .
two days later she was admitted to oslo university hospital with fever , headache , left sided hemiparesis and localized seizures in the left side of her face and left arm .
blood samples showed esr 28 mm , hemoglobin 12.4 g / dl , crp 11.5 mg / l , wbc count 20 10/mm and neutrophils 17 10/mm .
computer tomography ( ct ) and magnetic resonance imaging ( mri ) scans of the brain showed a lesion in the right frontal lobe , tentatively diagnosed as a glioma or an abscess ( fig .
a non - fermentative gram - negative bacillus was isolated , and given her history , b. pseudomallei was suspected . to avoid laboratory - acquired infections the laboratory personnel
were informed of the possible contagious microbe and further laboratory work was done within biosafety level 3 facilities .
initial identification of the microbe was done from cultured colonies by using matrix - assisted laser desorption ionization - time of flight mass spectrometry ( maldi - tof ms ) .
the results suggested b. thailandiensis , a non - pathogenic species , genetically closely related to b. pseudomallei .
finally 16 rrna pcr gene sequencing from the abscess material confirmed b. pseudomallei . shortly after the brain biopsy , on ceftazidime treatment ( 2 grams three times daily ) , the patient deteriorated .
susceptibility testing of the b .pseudomallei isolate , however , showed no resistance to ceftazidime which was increased to four times daily and sulfamethoxazole / trimethoprim ( sxt ) was added with subsequent improvement .
the patient , who weighed 52 kg , received 4 weeks of treatment with ceftazidime 2 g four times daily and sxt ( 2400 mg/480 mg daily ) .
due to subsequent bone marrow suppression and rash , sxt was switched to oral amoxicillin / clavulanate ( 3500 mg/875 mg daily ) and doxycycline ( 200 mg daily ) for a total of 6 months .
after 12 months of follow - up no relapse had occurred , mri scans showed marked improvement ( fig .
to our knowledge , no previous cases of neurological melioidosis from cambodia have been published .
only 2 previously reported cases of traditional melioidosis in norway have been published . diagnosing neurological melioidosis , far from endemic regions , is challenging , due to lack of clinical experience , low rate of detection and diagnostic challenges .
our patient had no traditional risk factors , except potentially exposure to b. pseudomallei while riding the atv motorbikes .
two australian publications found that 2542% of their patients with neurological melioidosis had no risk factors , .
neurological melioidosis might have a different risk profile than ordinary melioidosis , and may not trigger the clinical suspicion of the disease .
cerebrospinal fluid ( csf ) has shown a low detection rate , and searching for other sites of infection is essential . in general ,
fast , accurate and safe microbe identification is always important , but especially as b. pseudomallei and b. mallei , both are classified as category b bioterrorism agents .
all clinical and microbiological experience with these microbes is useful , due to its effective bioterror potential .
matrix - assisted laser desorption ionization - time of flight mass spectrometry ( maldi - tof ms ) has the potential of rapid and reliable identification of pathogens , including b. pseudomallei
.
the availability of a database containing the validated reference spectra limited the possibility of accurate species identification in our case .
our patient had no signs of sinusitis as a possible link to neurological melioidosis , as seen in other cases . applying case defining guidelines recently published by cheng et al .
, our patient had an inhalational melioidosis , with a probable primary focus in the left lung and secondary dissemination to cns .
it has been suggested that macro abscess formation can occur , particularly in untreated or insufficiently treated cases and this feature carries a poor prognosis .
b. pseudomallei can disseminate rapidly , and the initial delay in diagnosing and adequately treating the condition may have contributed to the development of neurological melioidosis in our patient .
currently recommended initial therapy is intravenous ceftazidime or meropenem , alone or with sxt , , . after returning to norway
she received initial treatment according to treatment recommendations with intravenous ceftazidime and sxt for 4 weeks .
however , the eradication therapy consisted of amoxicillin 3.5 g / day and clavulanic acid 875 mg / day given in an eight hourly regime , combined with doxycycline 200 mg daily for six months .
the concentration of amoxicillin clavulanic acid in csf is < 10% relative to blood , which falls below the mic for b. pseudomallei .
pharmacokinetic and pharmacodynamic studies in plasma concentration conclude that by oral eradication , an eight hourly dosing interval of 1000 mg amoxicillin and 250 mg clavulanic acid is sub - optimal , and a six hourly regimen should be considered . to conclude , this case report demonstrates a successful outcome in a patient with neurological melioidosis , despite challenges in diagnosing the disease and using eradication therapy alternative to that recommended .
it highlights the clinical and diagnostic challenges encountered and shows the importance of awareness in clinicians and laboratory personal of this disease in non - endemic areas , in returning travelers or as a consequence of bioterror .
| neurological melioidosis is a rare condition , as less than 30 cases have been reported in the last 50 years .
we present a case of neurological melioidosis , presenting with a cerebral abscess in a returning traveler from an endemic area .
while traveling in cambodia on holiday , the patient was admitted to local hospital for pneumonia .
her condition improved after antimicrobial treatment , and she returned to norway when discharged .
the patient had several contacts with the health care system after returning to norway , due to recurrent fever and deterioration .
short - term antimicrobial treatment was given with temporary improvement in her condition .
eventually she developed stroke - like symptoms , and a cerebral abscess was found .
cultures from the abscess were positive for burkholderia pseudomallei and the treatment was adjusted accordingly . |
many actin - binding proteins contain calponin homology ( ch ) domains , but the manner in which these domains interact with f - actin has been controversial .
crystal structures have shown the tandem ch domains of -actinin to be in a compact , closed conformation , but the interpretations of complexes of such tandem ch domains with f - actin have been ambiguous . we show that the tandem ch domains of -actinin bind to f - actin in an open conformation , explaining mutations that cause human diseases , and suggesting that the opening of these domains may be one of the main regulatory mechanisms for proteins with tandem ch domains . | |
ischemic preconditioning ( ipc ) is a phenomenon during which transient sub lethal episodes of ischemia before a prolonged ischemia / reperfusion injury provide cardioprotection for subsequent longer duration ischemic events.1 hearts exposed to ipc have a better metabolic and ionic status during prolonged ischemia compared to naive hearts.2 recent studies in surgical models of cardioplegic arrest and reperfusion have suggested that the preconditioned , arrested heart may have an increased tolerance to prolonged ischemia and improved functional recovery after reperfusion.3 the initial ischemic event activates numerous signal transduction pathways , which serve to maintain myocyte contractility and function.4 experimentally , a reduction in myocardium infarct size can be induced by subjecting the heart to episodes of non - lethal myocardial ischaemia and reperfusion prior to the sustained coronary artery occlusion.5 in - hospital risk of adverse events , the risk of death , and non fatal myocardial infarction ( mi ) are reduced significantly in patients experiencing ipc .
failure of ipc production during percutaneous coronary intervention ( pci ) , serves as an independent predictor of future ischemic event.6 different studies have been performed to show different clinical and biochemical aspects of ipc .
also , there are not many studies on the use of 80 lead ecg to evaluate ischemic events . in this case report
, we present the visual evidence of ipc , using heartscape technologies 80 lead ecg device , a body surface mapping modality that converts 80 lead ecg data into a 3-d color coded map .
the secondary objective of this study is to show the ability of 80 lead ecg to identify st - segment elevation and depression during ischemic events .
a 60 year old caucasian male with complaints of chest pain and a positive stress test , underwent pci and possible angiogram .
the patient consented to be enrolled in this study , and the written consent was obtained from the patient .
the use of the 80-lead ecg did not interfere with coronary artery visualization during pci .
an 80 lead ecg was recorded pre - catheterization , 30 seconds after balloon inflation , immediately after balloon deflation , and 30 seconds after stent deployment .
the duration of balloon inflation , balloon deflation , and stent deployment was equal ( 2 minutes each ) .
a green area represents an isoelectric state or no deflection from the isoelectric line ( the isoelectric line indicates no voltage difference between the t and p wave in the subsequent beat ) .
a red colored area indicates a positive deflection or deflection above the isoelectric line and a blue area indicates a negative deflection or deflection below the isoelectric line .
figure 1 represents the st0 filter map which is a variation of the st isopotential map that measures the voltage at the beginning of the st segment or j point .
this specialized st0 filter map displays only the significant st - segment deflections and normalizes any small deflections that are likely artifacts or normal variations .
the thresholds for abnormal st elevation or depression vary depending on the distance from the surface lead to the myocardium .
values exceeding threshold are indicated as 1.5 mm in the anterior , septal and lateral walls , 1.0 mm in the inferior wall , and 0.5 mm in the posterior wall .
the left box below each torso map indicates the maximum positive deflection in the respective recording and the right box below each map indicates the value of the maximum negative deflection . in the pre - catheterization
setting , there is no significant positive or negative deflection from baseline , as seen in figure 1a .
this can be appreciated both numerically by the values in the boxes ( none exceeding threshold values ) and visually by the absence of significant red or blue areas .
1b ) , there is marked significant positive elevation of 2.42 mm , also indicated by the bright red colored area in the upper anterior wall , indicating significant ischemia .
when the balloon was deflated , there is no significant elevation as indicated by the 1.47 mm deviation from baseline and negative deflection of 0.25 mm , seen in figure 1c . when the stent was deployed ( fig .
1d ) , there was a marked decrease in the positive deflection from baseline as compared to when the balloon was inflated .
in fact , the maximum recorded baseline deflection when the stent was deployed was 0.96 mm , a value below significant threshold deviation .
the 12 lead ecg at every phase was in accordance with the data of 80 lead ecg .
this can be evidence that the sublethal ischemic insult provided by the balloon inflation conditioned the myocardium to a subsequent ischemic event , in this case , the deployment of a stent .
it has been proposed that pre - infarct angina provides the sublethal insult which protects the myocardium from the subsequent infarct with respect to the size of infarct , contractile dysfunction , arrhythmia generation and prognosis.6 ipc can be induced for myocardial protection prior to planned cases such as coronary artery bypass graft surgery ( cabg).7 monitoring and comparing the ischemic changes instantaneously during such procedures can provide significant information regarding regional myocardial injury or prognosis . currently , the only device that allows visualization of ischemic changes is heartscape technologies 80 lead ecg device .
in contrast to the 12 leads of data and the limited anterior or front view of the heart from a traditional ekg , an 80 lead ekg utilizes 80 leads placed on both the front and back of the patient to analyze a 360-degree spatial view of the heart .
this system on the computer console displays a recognizable waveform from each single electrode position .
the deviation of st segments or the conduction patterns can be readily appreciated then by single lead representations or by rhythm strips from each and every one of the 80 electrode positions . in addition , the system will configure any measurement of interest ( st segment at j - point , st segment 60 ms , qrs deviations ) as a color - coded precordial reconstitution of the measurement showing the location of elevations or depressions , as color - coded hot spots or cold spots , located specifically in their lead positions relative to a human torso graphic . with this graphic in the actual device , as you point with a mouse towards any single spot , a hot spot or a cold spot , the waveform that measurement is originating from is displayed instantaneously
. being first explained by murry et al,8 ipc has been extremely investigated . in the study of warren
et al it was shown that ipc could be induced in 80% of elective pci cases . in this study
, it was also shown that , the frequency of post - procedural cardiac enzyme elevation , was significantly lower in patients experiencing ipc .
in addition , the risk of death and non - fatal mi at 1 year follow - up were reduced by 85% , and 55% respectively , in patients who manifested ipc.9 recent studies on surgical models of cardioplegic arrest and reperfusion have suggested that , preconditioned arrested heart may have an increased tolerance to prolonged ischemia and improved functional recovery after reperfusion.10 mitochondrial adenosine triphosphate - dependent potassium channel has been suggested as a final common pathway,1113 and numerous agonists are believed to mediate their respective preconditioning effect via this mechanism .
14 to study ipc on humans , pci model of coronary occlusion ( brief myocardial ischemia ) has been extensively used , whereas the use of st segment deviation ( in contrast to myocardial necrosis ) has served as a surrogate marker of ischemic injury.6 to our best knowledge , despite multiple studies on clinical aspects and molecular pathways of ipc , there has been no investigation to focus on the direct visualization of ipc during pci .
in this study , we show that the 80 lead ecg device , can detect instantaneous ischemic changes .
the utility of 80 lead ecg body surface mapping is enormous , when evaluating ischemic events . | ischemic preconditioning ( ipc ) is a well - documented phenomenon .
short episodes of sublethal ischemia provide cardioprotective effects for subsequent longer duration ischemic events . although the exact mechanism of ipc is not yet known , the chemical basis of ipc seems to involve preservation of atp or collateral vascularization recruitment . in this case report , we present visual evidence of ischemic preconditioning using heartscape technologies 80 lead ecg device .
the 80 lead ecg is described as a body surface mapping modality , converting its inputted 80 lead ecg data into a 3-dimensional color coded map .
the 80 lead ecg device can detect instantaneous ischemic changes .
different studies have been performed to show different clinical and biochemical aspects of ipc .
however data regarding direct visual evidence of this phenomenon is lacking .
the secondary objective of this study is to show the ability of 80 lead ecg to identify st - segment elevation and depression during ischemic events .
the utility of 80 lead ecg body surface mapping is enormous when evaluating ischemic events . |
medical treatment is the main strategy to control secondary hyperparathyroidism in patients with end - stage renal disease ( esrd ) .
for this reason , invasive procedures such as intranodular ethanol injection ( percutaneous ethanol injection therapy , peit ) or parathyroidectomy have been proposed [ 2 , 3 ] .
the type of procedure used depends of the intact pth levels , number and size of the glands involved , and their ultrasonographic visibility . in the case of subtotal parathyroidectomy , patient keeps between 1/4 and 1/2 of the gland . over time , if the conditions causing hyperparathyroidism persist , gland may grow and increase again the levels of intact pth . moreover , after surgery a high percentage of patients ( 12 to 30% ) may develop recurrent or persistent hyperparathyroidism .
thus , the patient will suffer the clinical consequences of hyperparathyroidism once again ( i.e. , high morbidity - mortality ) , despite surgery . when the residual nodule is visible with ultrasonography , its destruction is possible with ethanol injection until the desired levels of intact pth and calcium phosphorus product are reached .
we presented a series of patients with recurrent hyperparathyroidism postsubtotal parathyroidectomy who were adequately managed with peit .
the study included six patients with esrd under chronic hemodialysis and diagnosis of recurrent secondary hyperparathyroidism .
all the patients had history of secondary hyperparathyroidism that became refractory to the medical treatment . because , this condition , all patients had undergone subtotal parathyroidectomy with neck exploration searching for the four parathyroid glands and removing the three glands that were macroscopically more affected and the 1/2 or 3/4 part of the gland with healthier aspect .
the indication of the treatment with peit was recurrent secondary hyperparathyroidism with levels of intact pth higher than 300 pg / ml in patients who had undergone a subtotal parathyroidectomy and presence of at least one parathyroid nodule visible in the ultrasonography .
the mean age of the population was 47.4 11.1 years ( median 47 , min 36max 64 ) , 3 patients were female , and the mean time elapsed from the initiation of hemodialysis therapy to the peit was 108.4 58.6 months ( median 89 , min 36max 180 ) .
three patients had esrd secondary to chronic glomerulonephritis , one case was associated to eclampsia , and other two ; the cause of esrd was unknown . before peit ,
medical management for hyperparathyroidism included control of hyperphosphatemia with a low phosphorous diet , oral phosphate binders ( calcium , sevelamer , and aluminum ) , more intensive dialysis and in cases without contraindications oral / iv calcitriol .
similar measures were used after peit in order to maintain an adequate calcium - phosphorus metabolism and to avoid recurrence of hyperparathyroidism .
all injections were administered by the same qualified interventional radiologist and performed under ultrasonographic guidance .
nodular volume and size of all glands treated with peit were larger than 0.1 cm as calculated by ultrasonographic evaluation of their 3 longest axes .
a 95% ethanol solution was used for peit with a total alcohol volume calculated to be at least the same as the nodule volume .
a modified needle for ethanol injection with small side holes , easily recognized under ultrasonography and local anesthesia with lidocaine in an ambulatory facility was used .
the treatment was considered successful when the levels of intact pth decreased from 150 to 300 pg / ml , as suggested by k / doqi guidelines .
biochemical assays were performed immediately before the first peit session ( basal ) and between 1 and 7 days after the last peit session ( final ) .
serum creatinine , calcium , phosphorus , and alkaline phosphatase were measured with an autoanalyzer ( hitachi 917 : hitachi , ltd . ,
tokyo , japan ) , and intact ipth by electrochemiluminescence ( nichol 's institute , san juan capistrano , calif , usa ) .
all patients had a residual parathyroid nodules identified by ultrasonography , and peit was performed 26.4 45.7 months ( median 7 , min 2max 108 ) , after parathyroidectomy ( table 1 ) . in one patient ,
, 3 parathyroid glands were removed , and in the second surgery some months later , glandular tissue was not identified .
the patient did not accept to undergo another surgery when an ectopic parathyroid gland was detected by scintigraphy . in the remaining 5 patients , the ultrasonography detected residual and enlarged parathyroid tissue in the site where
a small portion of parathyroid gland had been left during the surgical procedures . in average ,
1.3 0.8 ethanol injections were made per patient and a mean of 2.8 2.8 cm of ethanol was injected .
the average nodular volume was 1.5 1.7 cm , although the volumes were very different among patients ( 0.2 to 4.5 cm ) ( table 2 ) .
the mean levels of pth had a significant decrease at final control , falling from 1897 754 to 549 863 pg / ml ( p <
the average decrease of intact pth was 72 33% ( range 8,096,6% ) .
there was also a decrease in the levels of serum calcium , phosphorus , and calcium - phosphorus product , being significant in the last two .
a positive and significant correlation was found between the total nodular volume , the volume of ethanol used in each session ( r = 0.85 ; p < .02 ) , and the time from parathyroidectomy ( r = 0.87 ; p < .02 ) ( figure 2 ) . in one patient ,
this patient showed a reduction of 8% in the level of pth and maintained the levels of calcium and phosphorus above the recommended level by k / doqi guidelines after peit .
this procedure was performed on a small nodule of only 0.2 cm , and peit had to be stopped prematurely due to technical problems to visualize and identify the parathyroid nodule .
ectopic gland was not found by a scintigraphy . when analyzing the degree of compliance with the parameters of mineral metabolism recommended by k / doqi guidelines ( intact pth , calcium , phosphorus , and ca p product ) , it was observed that prior to the peit , no patients were in agreement with the 4 parameters ; 2 patients meet 3 criteria , 2 patients fulfill only one , and the remaining 2 patients did not satisfy any of the recommended parameters . at the final control post - peit , one patient meet the 4 criteria , 4 patients fulfill 3 criteria , while the remaining patient did not satisfy any of the parameters recommended by k / doqi .
this last patient was the one who did not properly respond to peit ( table 2 ) .
all the procedures were performed on an outpatient basis , and only one patient required hospitalization after the procedure due to severe hypocalcaemia that reverted with calcium replacement by intravenous administration . in two cases , only local discomfort and temporary mild dysphonia were registered .
in several clinical settings , severe secondary hyperparathyroidism can be controlled quickly and safely by using peit .
this technique is not only an alternative to surgical parathyroidectomy , but also an important adjunct to medical management .
it has proved to be useful for patients either on dialysis or after renal transplantation in circumstances in which the disease is considered to be resistant to medical treatment or when the surgical risk is high [ 810 ] .
secondary hyperparathyroidism is a common complication of the long - term dialysis [ 11 , 12 ] .
the dopps international study has demonstrated that 26.3% of the patients from the participant countries have hyperparathyroidism .
it has been shown to predominate in latin american countries [ 12 , 14 ] .
secondary hyperparathyroidism is managed successfully with medical treatment in most of the patients , but the disease becomes refractory to the therapy in a considerable number of them .
these is more frequent in subjects with severe , long - term hyperparathyroidism and with nodular hyperplasia in enlarged glands .
this glands have a lower - density receptors for calcitriol and calcium both needed to respond to the treatment [ 1 , 15 ] .
therefore , in these patients , it is necessary to consider the possibility of using invasive treatment .
surgical parathyroidectomy is indicated when the patients who do not respond to the medical treatment present signs of osteitis fibrosa , extraosseous calcifications , hypercalcemia or hyperphosphatemia , with more than 2 glands visible with ultrasonography , and dramatically increased levels of intact pth [ 16 , 17 ] . although in most of the patients there
is an important decrease of pth levels , a considerable number of them ranging from 10 to 30% suffer a recurrence of secondary hyperparathyroidism , and it is required , in many cases , to undergo more complicated reoperations .
potential factors related with recurrent postsurgical hyperparathyroidism are the persistence of the conditions causing hyperparathyroidism such as the presence of a residual portion of parathyroid gland , which is present when either a subtotal or a total parathyroidectomy with autotransplantation is performed . in rare cases ,
an ectopic gland that was not obvious in presence of the other activated parathyroid glands may evidence increased size and activity .
once recurrence occurred , the levels of pth will dramatically increase again with their known consequences on the skeleton and cardiovascular system .
these residual nodules are refractory to the medical treatment because they do not have the adequate concentration of both calcium and calcitriol receptors .
a new surgical procedure implies some risks because of the high morbidity of these patients , some technical complications in a sector with a previous surgery that usually presents periglandular fibrosis and with the only possibility of removing all the residual parathyroid tissue , which causes hypoparathyroidism in most of the cases . in the patients of the present series , surgical resection of the remnant parathyroid tissue
was not recommended due to a high risk to produce severe and permanent hypoparathyroidism causing adynamic bone disease with cardiovascular calcifications .
cryopreservation of parathyroid tissue is an option to prevent this complication but the technique is not available in our center . in some cases , lomonte et al .
have described the successful use of cinacalcet inducing the suppression of intact pth secretion by the parathyroid glands .
however , in order to achieve this aim , it is necessary to have an adequate quantity of calcium receptors in the remaining parathyroid tissue , which is not the rules in cases of secondary hyperparathyroidism refractory to the medical treatment .
although cinacalcet represents a valid option for these patients , it is not available for use in many countries , for example , in latin america countries . since the early 1980s
the basis of this therapy is that enlarged parathyroid glands with nodular hyperplasia are destroyed selectively by ethanol injection .
we recently reported in dialysis patients a significant decrease in pth , with improvement in serum calcium , phosphate , and ca p product .
patients under dialysis , with large nodule volume and very high pth levels , obtained good results after peit .
failure to peit could be related to a wrongly selection of gland for ethanol injection .
poor results have been obtained in glands with difficult accessibility , diffuse hyperplasia , ectopic glands , and ultrasonographic poor visibility such as in the case of patient number 6 .
it has also proved to be useful in cases of hyperparathyroidism after renal transplantation , complicated with hypercalcemia and hypophosphatemia with few and minor complications . in this
setting , parathyroidectomy is considered too aggressive for controlling the hyperparathyroidism , and was carries out . at the present , there are no data about the use of peit in patients with recurrent hyperparathyroidism after subtotal parathyroidectomy , so that this is the first series of patients reporting this technique in this setting .
all the patients included in this study suffered from a severe secondary hyperparathyroidism and had previously undergone at least one subtotal parathyroid surgery .
after peit , the level of intact pth showed a significant decrease with a mean rate of 72% .
four patients reached levels of intact pth within the parameters recommended by k / doqi guidelines . in one case , the level was close to the suggested value with 311 pg / ml and in the remaining patient no adequate response was achieved ( table 2 ) . in summary , as it was previously demonstrated for patients undergoing dialysis and transplantation , peit has proved to be a useful technique for the management of recurrent postsurgical secondary hyperparathyroidism .
it was useful to rapidly resolve a common complication of parathyroidectomy at a low cost and with a high level of safety .
results of the present series suggest that peit should be considered for the treatment of recurrent postsurgical secondary hyperparathyroidism particularly when calcimimetic and cryopreservation are not available .
prospective and controlled trials comparing peit with others therapies are needed to confirm their role in the management of this disease . | we evaluated the efficacy of percutaneous ethanol injection therapy ( peit ) as a therapeutic option for recurrence of secondary hyperparathyroidism after subtotal parathyroidectomy in esrd patients .
six patients underwent peit .
a mean of 1.3 0.8 ethanol injections was performed .
nodular volume was 1.5 1.7 cm3 , and 2.8 2.8 cm3 of ethanol was injected per patient . after ethanol injection pth decreased significantly ( 1897 754 to 549 863 pg / ml ( p < .01 ) ) .
there was also a reduction in serum calcium , phosphorus and calcium - phosphorus product .
a positive and significant correlation was found between nodular volume with ethanol injected and time from parathyroidectomy .
only one patient required hospitalization due to severe hypocalcaemia .
in other two cases , local discomfort and temporary mild dysphonia were registered .
peit is an effective treatment to control recurrences of secondary hyperparathyroidism postsubtotal parathyroidectomy . |
sickle cell anemia inherits as an autosomal recessive disorder that was first described by herrick in 1910 and its alleles are frequent in regions where malaria is endemic .
a homozygote a to t transversion results in the substitution of glutamic acid by valine in the sixth amino acid of the human -globin chain .
inheritance of a single mutated allele results in sickle cell trait ( sct ) , while homozygous mutations , one from each parent , cause clinical severity of sickle cell disease ( scd ) ( 1 ) .
the disease is a multi - organ illness characterized by the production of abnormal hemoglobin s ( hbs ) .
the interaction of hbs tetramers results in the formation of polymers that cause red blood cells to become rigid and form sickle in deoxygenate condition ( 1 , 2 ) . repetitions of the situation cause the cells to become fragile and subject to easy lysis , which produces chronic anemia ( 2 , 3 ) .
sickle cell is a major health problem that occurs commonly in people of african , middle eastern , indian and mediterranean backgrounds ( 4 ) .
the prevalence of the gene has been reported in about 40% of tribal groups of india ( 5 ) .
2% on the north african coast and south africa ( 6 ) . about 7 to 9% of african americans ( 5 , 7 ) , and 4.6% of turkish ( 8) are carriers of this mutation .
habibzadeh and colleagues ( 9 ) announced the sickle cell gene frequency of 1.5 % in the south of iran , while this value was reported about 0.01 in pars province of the country ( 10 ) .
genetic factors such as or -globin gene mutations can modulate the hematological diagnostic data and clinical expression of the sickle cell , when co - inherited with the gene ( 11 ) .
it has been reported that co - inheritance of sct and hbd results moderate to severe anemia ( 12 ) .
coexistence of -thalassemia ( ) lowers the mean cell volume ( mcv ) and the mean corpuscular hemoglobin ( mch ) that results in milder anemia . but this condition causes a reduction in hemolysis and an increase in total hemoglobin which makes patients more prone to vaso - oclosive and painful crises of the disease ( 13 ) .
phenotype of the -globin gene defect determines the severity of the co - inherited sickle cell mutation ( 4 ) .
the absence synthesis of -globin chain ( ) results in a severe disease , while the reduced one ( ) cause a milder clinical picture of the disease .
understanding the influence of and -thalassemia ( ) mutations on hematological characteristics of the sct people has been helpful to diagnosis of the disease . in the present study
, we aim to determine the incidence of co - inheritance as well as interaction of sct and / mutations in south and south central of islamic republic of iran .
in a national premarital screening program red cell indices were measured to identify risk for specific hemoglobinopathies ( sickle cell and thalassemia ) .
a group of 179 individuals found microcytic hypochromic ( mcv < 82 and mch < 26 pg ) and positive hbs were examined to confirm the primary diagnosis between may 2006 and february 2011 .
after obtaining a consent sheet , we collected 8 ml whole blood from their brachial vein in tubes containing 200 l edta ( ethylene diamine tetra - acetic acid ) .
genomic dna was isolated from leukocytes of the whole blood using the salt - saturation method as previously prescribed ( 14 ) .
the isolated dna was applied to verify the sickle cell gene defect and to screen for any coexisting / thalassemia mutations .
the sickle cell hemoglobinopathy was confirmed using the pcr followed by restriction fragment length polymorphism ( rflp ) method . to accomplish this ,
a 443bp dna fragment of -globin gene was amplified using a forward primer ( acctcaccctgtggagccac ) and a reverse primer ( gagtggacagatccccaaaggactcaagga ) ( 15 ) .
normally , two restriction sites for ddei exist in the dna sequences of the amplified beta - globin gene fragment .
digestion of the pcr products by the enzyme results a 201bp , a 175bp and a 67bp dna fragment in the wild type gene ( 15 ) .
the sickle cell mutation changes one of the restriction sites , giving a 376bp and a 67bp dna fragment flowing ddei digestion ( fig .
work - up , the 15 most common -globin gene defects were examined by amplification refractory mutations system - polymerase chain reaction ( arms - pcr ) technique ( 16 ) .
suspicious carriers were screened for the common deletion defects , , med and triplication using the gap - polymerase chain reaction ( gap - pcr ) method ( 17 ) . the vienna - lab -globin strip assay kit ( viennalab labor - diagnostika gmbh , vienna , austria ) was used to identify those thalassemia mutations that not covered by the above methods .
they comprised 23 couples and 133 independent individuals who their spouse was not included in this study due to lack of hbs . of the cohort ,
56 patients came from hormozgan as the molecular analyzing laboratory did not exist in their province . from the 23 studied couples 13 were consanguineous . among the studied group ,
combination of sickle cell trait and single -globin gene deletion ( hbs / normal , 3.7/ ) was the most common genotype ( 37.4% ) , while the second most frequent gene defect was sickle cell trait ( 32.4% ) without / mutation ( hbs / normal ) .
two patients with sickle cell trait , hbd and deletion were detected in this survey ( table 1 ) .
the frequency of -globin and sickle cell mutations was 57.5% in overall samples ( table 2 ) .
sickle cell trait and minor mutation ( / ) was found in 6.7% of the referred cases ( table 2 ) .
interaction between these two genotypes reduced hb , hct , mcv , mch , & hb and increased hba2 , hbf , & hbs more than the other single or multiple mutations ( table 3 ) .
the studied cases of kerman province were referred commonly from southern cities of the territory where kahnooj , jiroft , bam , and baft are located ( table 4 ) .
a few subjects were from cities of shahr babak and kerman as the capital of province .
the high co - inheritance of sickle cell trait and -globin gene deletions ( hbs / normal , 3.7/ ) was predictable , since -globin deletion was previously reported as the most common globin gene mutation in kerman province ( 18 ) , other regions of the country ( 1921 ) and what has been reported in other studies around the world ( 22 , 23 ) . as can be seen in table 3 , the interaction of -globin gene deletions with sickle cell mutation did not significantly increase the level of hbs , compared to mutation . in the present study ,
four different types of / mutation were detected ( table 1 ) . among these , ivsi-5 was found to be the commonest mutation , followed by ivsii - i , fr 89 and 88nt .
the incidence of mutations in kerman province was previously reported ( 24 ) the same as what was found in the present study .
therefore , it was not surprising to find the incidence pattern of / similar to that previously detected . coexistence of mutations is a modulating factor that may worsen the clinical and hematologic features of sickle cell patients ( 25 ) .
our data shows that the combination of / decreases levels of hb , hct , mcv , mch , hb and increases levels of hba2 , hbf and hbs more than the other single or multiple globin genes mutations ( table 3 ) .
earlier studies showed that co - inheritance of / studies decrease mcv , mch and hb indices as compared with sct patients ( 26 , 27 ) .
these findings are in agreement with the fact that coinheritance of / will worsen the clinical course of the sickle cell from mild to sickle cell disease . among the detected mutation
, ivsii - i and fr 89 are classified as , while 88 and ivsi-5 considered as . the severity of sickle cell depends on the nature of the co - inherited mutations , hence thalassemia results in a more severe clinical course similar to scd , while hbs- thalassemia is usually associated with a milder clinical course ( 28 ) .
although inheritance of sct and any of the mutations may result the birth of scd children , combination of with them may modulate the severity of the disease .
interaction of sct , , and/or hbd mutations was not possible due to the small number of patients having all of the gene defects together ( table 2 ) . in kerman province ,
the highest cases were from kahnooj and jiroft ( table 4 ) , at the border of hormozgan province where 57 suspicious sct subjects were referred to our laboratory .
this implies that sickle cell mutation was spread by gene flow from hormozgan province to these regions .
thalassemia and sickle cell mutations confer resistance to malaria , and high prevalence of the both gene defects are found in the same areas due to the advantage of heterozygosity .
it is surprising that bam , with the highest incidence rate of and carriers ( 24 ) , was not among the high frequent sickle cell carrier regions .
this agrees with the gene flow phenomenon , since bam is not contiguous to hormozgan province .
no patients were referred to our laboratory from northern cities ( rafsanjan , sirjan , zarand , and ravar ) of kerman territory , since the prevalence of was virtually reported zero for this area ( 24 ) .
co - inheritance of sct with / is mainly frequent in the south parts of kerman province .
since the clinical manifestations of sct are influenced by associated of and/or mutations , the birth of affected people with scd is inevitable .
this disorder imposes a significant burden on health resources and furthermore has psychological effects on relatives .
further investigations in other regions of islamic republic of iran will be helpful for the support of such a program .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | background : we aimed to determine the incidence of co - inheritance as well as interaction of sickle cell trait ( sct ) and thal/thal mutations in south and south central of iran.method:we employed a pcr and restriction fragment length polymorphism techniques to confirm diagnosis of sickle cell trait .
all subjects were screened for any / thalassemia mutations using a gap - polymerase chain reaction and amplification refractory mutations system.results:our results showed combination of sickle cell trait and -globin mutation results in a severe clinical course of similar to sickle cell disease , while coinheritance of -globin gene defects usually modulates the clinical course .
a coexistence of sickle cell trait and -globin gene mutation was the frequent genotype in overall samples ( 57 .
5%).conclusion : sickle cell trait mainly co - inherits with -globin gene mutation in the south and south central region of iran .
this combination modulates hematological indices and interferes with the sct diagnosis . |
first described by hungarian dermatologist kaposi in 1872 , kaposi 's sarcoma ( ks ) is a rare low - grade , vascular tumor associated with the human herpes virus 8 ( hhv-8 ) .
ks is divided into four epidemiological subtypes : ( a ) classic ( indolent cutaneous proliferative disease affecting older men of mediterranean and jewish origin [ 3 , 4 ] ) , ( b ) endemic ( from africa [ 5 , 6 ] ) , ( c ) solid organ transplant associated , and ( d ) epidemic ( acquired immunodeficiency syndrome ( aids ) associated ) .
kaposi 's sarcoma is 15 times more prevalent among men than women and is most common among homosexual males .
risk factors for tumor development include human immunodeficiency virus ( hiv ) infection [ 810 ] , high anti - hhv-8 antibody titers , hhv-8 viremia , inherited variation in immuno - modulating genes , immunosuppression with steroids or other immuno - suppressants , and absence of tobacco use [ 1315 ] .
kaposi 's sarcoma typically presents as cutaneous purplish , reddish - blue , or dark brown / black macules , plaques , and nodules on the lower legs and feet with or without associated extremity lymphedema .
although most cases follow a chronic indolent course [ 1618 ] , ks occasionally presents with a more aggressive , rapid course .
extracutaneous involvement of the mucous membranes , gastrointestinal tract , regional lymph nodes , and respiratory tract can occur during the course of the disease , particularly in the aids - associated subtype .
involvement of the oral cavity occurs in approximately one - third of patients and is the site of initial presentation in roughly 15 percent . in the era
prior to highly active antiretroviral treatment ( pre - haart ) , a higher rate of involvement of the gi tract was reported , with 40 percent at initial diagnosis and 80 percent at autopsy .
the demographics , epidemiology , diagnosis , and treatment for kaposi 's sarcoma have changed significantly over the past 30 years with the spread of the hiv / aids epidemic in the early 1980s , the widespread introduction of combination highly active antiretroviral treatment ( haart ) in the mid-1990s , and the advancing age of the united states population in the 2000s .
the miami beach community had a unique position during this time span ; it served a large group of elderly patients while also serving a population that was one of the epicenters for the hiv / aids epidemic in the united states [ 19 , 20 ] . in order to further understand this rare disease and its corresponding staging , treatment , and prognosis
, we analyzed a large case series at our institution . with the knowledge gained from this study , we hoped to improve the quality of care at our institution
this retrospective study was conducted with prior approval of the mount sinai medical center institutional review board .
we reviewed the tumor registry of mount sinai medical center in miami beach , fl , usa to identify all cases of kaposi 's sarcoma diagnosed between january 1 , 1987 and december 31 , 2007 .
there were 143 cases identified according to the international classification of diseases - oncology , 1st , 2nd , and 3rd editions ( icd - o-1 : 19761989 , icd - o-2 : 19902000 , icd - o-3 : 20012007 ) .
patients ' data included sex , ethnicity , age at diagnosis , date of diagnosis , smoking status , site of ks presentation , stage of disease at diagnosis ( surveillance epidemiology and end results ( seer ) local / regional / distant classification scheme ) , type of treatment received ( chemotherapy , radiation ) , and hiv status ( table 1 ) .
a time - to - event analysis was constructed to evaluate overall survival ( os ) in relation to clinical category .
survival time was defined as the period from date of diagnosis until date of death or date of last visit .
patients were classified into two categories based on their survival status : censored or death .
the kaplan - meier and cox proportional hazards methods were used to estimate the overall survival and create a prognostic factor model based on the significant covariates : age ( > 50 versus 50 ) , year of diagnosis ( 19972007 : post - haart versus 19871996 : pre - haart ) , sex ( male versus female ) , self - designated ethnicity / race ( hispanic whites , non - hispanic whites , black ) , smoking status ( current versus former versus nonsmoker ) , site of presentation ( skin versus nonskin ) , stage ( local versus regional versus distant ) , chemotherapy ( chemotherapy versus no chemotherapy ) , radiation ( radiation versus no radiation ) , and hiv status ( hiv - positive versus hiv - negative ) . the hazard ratios ( hr ) were estimated for risk of death due to various covariates in the model . for the survival curve comparisons ,
the log - rank or wilcoxon - breslow tests were used when the proportional hazards assumption was not violated .
otherwise , the fleming - harrington or peto & peto - prentice tests were used .
all tests were two - sided , and the type i error was considered to be 0.05 .
of the 143 ks patients identified , the majority were males ( 90.2% ) , non - hispanic whites ( 60.1% ) nonsmokers ( 42.7% ) who were diagnosed between 1987 and 1996 ( 57.3% , table 1 ) .
the greatest percentages of patients were diagnosed between ages 2140 ( 45.5% ) , followed by ages 4160 ( 29.4% ) , and > 80 ( 14.0% ) .
the most common site of initial presentation was the skin ( 87.4% ) and an equal percentage of patients had local ( 40.6% ) and distant disease ( 40.6% ) at diagnosis .
most of the patients were hiv - positive ( 52.4% ) and received neither chemotherapy ( 80.4% ) or radiation therapy ( 65% ) .
the kaplan - meier analysis demonstrated an overall survival of 27% at 5 years ( figure 1 ) with a median survival of 24 months .
there was no significant difference in survival among patients based on sex ( 28 versus 23 months , females versus males , resp . ;
p = 0.84 ) , hiv status ( 19 versus 25 months , hiv - positive versus hiv - negative , resp . ; p = 0.91 ) , or radiation therapy ( 23 versus 22 months , no radiation versus radiation , resp .
there was a significant difference in survival based on ethnicity / race ( 20 versus 56 versus 8 , non - hispanic whites versus hispanic whites versus blacks , resp . ;
p = 0.01 ) ( figure 2 ) , date of ks diagnosis ( 14 versus 87 months , 19871996 versus 19972007 , resp . ;
p = 0.004 ) ( figure 3 ) , and site of initial presentation ( 23 versus 9 months , skin versus nonskin , resp . ;
there was a trend toward a significant difference based on smoking status ( 23 versus 17 versus 36 versus 15 months , nonsmoking versus ex - smoking versus current smoking versus unknown , resp . ;
p = 0.32 ) , age at diagnosis ( 22 versus 18 versus 38 versus 32 months , 2140 versus 4160 versus 6180 versus > 80 , resp . ; p = 0.34 ) , stage at diagnosis ( 32 versus 22 versus 17 months , local versus regional versus distant , resp . ;
p = 0.17 ) , and chemotherapy ( 23 versus 14 versus 9 months , no chemotherapy versus single - agent chemotherapy versus multiple - agent chemotherapy , resp . ; p = 0.26 ) .
multivariate analysis revealed hispanic whites were 45% less likely to die than non - hispanic whites when controlling for year of diagnosis ( table 3 ) .
patients diagnosed between 1997 and 2007 were 67% less likely to die than the patients diagnosed between 1987 and 1996 when controlling for ethnicity .
as with earlier case series and reported epidemiological data [ 2740 ] , this study found that while men were nine times more likely than women to develop ks , the five - year survival for men and women was essentially the same . compared to those ks patients who never smoked , there was a trend toward improved survival among current or former smokers , irrespective of age at diagnosis .
this finding supports a putative protective effect for cigarette smoking in ks patients , as has previously been reported [ 1315 ] .
based on this study , newly diagnosed ks patients should have clear documentation in the medical records regarding their smoking status , as this may have prognostic value .
an unexpected finding in our series was the higher five - year survival rate among the hispanic white population .
we initially hypothesized this difference was due to an older non - hispanic white population with multiple comorbidities and a hispanic white population with greater access to healthcare , supportive services , and community resources . upon further data analysis , as opposed to non - hispanic white patients , a significant majority of the hispanic white patients were less than 50 years old . despite a relatively small patient population , we suspect the difference in five - year survival was , in part , due to a younger , healthier hispanic white ks population .
however , an underlying genetic polymorphism contributing to improved survival must be considered , as there is evidence that differences in ks survival among ethnic groups can be explained by a tp53 polymorphism at codon 72 .
future studies should continue to investigate a genetic predisposition for improved survival among hispanic white patients . in terms of patient care
, it seems reasonable to incorporate more intensive treatment regimens for distant disease , particularly in the non - hispanic white population . from both quality of care and genetic research perspectives
, it will be important for physicians and researchers to document specific patient ethnic backgrounds in the medical records .
consistent with previous literature [ 3 , 4 , 7 ] , we observed a bimodal distribution pattern based on hiv status and age at ks diagnosis .
the majority of patients fit into one of two categories , young hiv - positive men and elderly hiv - negative men .
we attempted to correct for this by dividing patients into two age groups , younger than or equal to age 50 and older than age 50 .
there was a trend toward improved survival among hiv - negative patients greater than 50 years old , suggesting that these patients had the classic - endemic subtype of ks .
these patients would likely die from disease unrelated to ks and could be managed with less aggressive therapy .
however , those patients diagnosed before age 50 were generally hiv - positive , had widespread disease at presentation , received multiple treatment regimens , and would likely to die from ks or other aids - related diseases .
although larger studies are needed for validation , this study supports the need to treat younger , endemic ks patients more aggressively than older , classic ks patients .
similar to earlier studies , the majority of patients in our study were diagnosed between 1987 and 1996 , corresponding with the peak of the hiv epidemic . in our study population
, there was a significant difference in five - year survival based on date of diagnosis , supporting the widely recognized observation of multiagent haart therapy revolutionizing the treatment of hiv / aids and aids - related illnesses [ 3340 ] . based on the results of our study , it is imperative that patients with hiv - related ks be treated with haart .
future studies of ks will need to incorporate specific haart regimens and degree of immunosuppression , as measured by cluster of differentiation 4 ( cd4 ) counts and hiv viral loads , in order to study the effects of particular treatment regimens and determine the relationship between immunosuppression and survival .
the patients in our study population with distant disease at diagnosis had a significantly shorter survival compared to patients with local and regional disease at diagnosis .
however , patients with regional disease had essentially the same survival as those with local disease only .
these findings reflect the strengths and limitations of the seer local / regional / distant ks classification scheme .
all of our patients were classified based on this system , which was amended twice during the course of our study period . using the seer staging adjustments table
meanwhile , ks staging has proven difficult over the past 30 years due to the lack of a widely accepted standard staging system .
several classification systems have been proposed including one describing the cutaneous presentation of the disease : stage i ( macular nodular stage ) , stage ii ( infiltrative stage ) , stage iii ( florid stage ) , and stage iv ( disseminated stage ) . another proposed staging system for aids - related ks subdivided patients into low- and high - risk groups based on the extent of the tumor , immune status , and severity of systemic illness .
future studies should attempt to incorporate all proposed classifications systems and produce a standard staging system that accurately characterizes disease severity .
this unusual finding may in part be explained by the fact that patients receiving chemotherapy were more likely to have advanced and bulky disease at diagnosis .
since there were no national comprehensive cancer network ( nccn ) guidelines for disease management , decisions to treat patients with chemotherapy were left to physician 's discretion . similar to several other malignancies , the major goals of ks treatment involve symptom palliation , prevention of disease progression , and attempts to improve survival .
this approach has been implemented due to the inability to fully eradicate latent hhv-8 infection ( the main risk factor for the tumor [ 2631 ] ) . unlike chemotherapy
, radiation is a local therapy often administered for control of symptoms for both local and advanced diseases .
therefore , although all patients were staged for extent of disease , patients with localized , nonbulky disease were more likely to be treated with radiation alone .
another possible explanation for the lack of significant survival benefit with chemoradiation techniques was the difference in chemotherapy treatment and radiation techniques offered to the patient population .
treatment for ks changed over the past 30 years and patients diagnosed and treated in the 2000s were treated much differently than those in the 1980s and 1990s .
currently , treatment options for localized cutaneous ks lesions include surgery , radiation [ 48 , 49 ] , cryotherapy / laser therapy [ 5052 ] , intralesional injection of chemotherapy ( vinblastine ; [ 53 , 54 ] ) , topical therapy ( cis - retinoic acid ) , and ( imiquimod ) . highly active antiretroviral treatment ( haart )
is recommended for all patients with aids - related ks [ 5759 ] , despite the finding that its initiation is associated with temporary progression of ks lesions within the first three to six weeks , corresponding with the well - described immune reconstitution syndrome [ 60 , 61 ] . despite this observation ,
haart is recommended for all patients with ks , as the benefits are thought to strongly outweigh the risks .
currently accepted indications for systemic chemotherapy for ks include widespread skin involvement , extensive skin involvement unresponsive to other therapies , extensive extremity edema , symptomatic visceral organ involvement , and immune reconstitution syndrome .
pegylated liposomal doxorubicin and liposomal doxorubicin have been established as first - line treatments for ks , unless there is a cardiac contraindication .
highly active antiretroviral treatment ( haart ) plus chemotherapy has a significant advantage in treating aids - associated ks .
one study found that only 20 percent of patients responded to haart alone , whereas haart plus pegylated liposomal doxorubicin produced response rates ranging from 50 to 70 percent .
although paclitaxel has been thought to be potentially more toxic than liposomal doxorubicin , it has been established as a second - line treatment for ks [ 6471 ] .
recombinant interferon alpha is another agent approved for the treatment of aids - related ks and has produced beneficial responses in 2040 percent of patients [ 72 , 73 ] .
based on the results of our study , we believe that each patient 's treatment should be individualized , taking into account immune status , tumor bulk , ethnic status , comorbidities , and quality - of - life measures .
in addition to survival studies incorporating new treatment guidelines , the development of specific nccn guidelines regarding disease management may be of value in limiting treatment variability .
one of the major limitations of our study was the inability to obtain cd4 counts and hiv viral loads for hiv - positive patients .
due to these limitations , we were unable to reach conclusions regarding ks survival and degree of immunosuppression from hiv / aids . from the data obtained from this study , we believe that tumor databases , when dealing with hiv - associated malignancies , need to include information regarding patient 's hiv status and treatment .
this information will be useful not only for future ks studies , but also for the treatment planning of patients .
another limitation of our study was our inability to determine cause of death of our patients . due to this limitation
, we were unable to draw conclusions regarding whether patients died from ks versus other disease processes .
this information would have been useful in the elderly and post - haart hiv patients where we suspect many succumbed to disease processes unrelated to ks .
the united states federal drug administration approved the first protease inhibitor , saquinavir , on december 6 , 1995 .
although approved in late 1995 , the drug , and other new protease inhibitors , was not widely accepted or used until mid-1996 .
it was at this time that patients began receiving the current standard of care , what we commonly refer to as triple therapy haart .
therefore , although not exact , we believed that the use of 1997 as a starting point for post - haart therapy was appropriate .
we were unable to report on the type of chemotherapy or radiation used in the treatment of our ks patients .
these data were not recorded in the cancer database during the 1980s and 1990s . as was previously mentioned ,
our study did not distinguish between subtypes of ks , including those associated with organ transplants .
however , we assumed that the total number of patients from this group was negligible , because our hospital did not perform solid organ or stem cell transplants .
this large retrospective study provides further insight into the epidemiology , staging , treatment , and prognosis of ks .
the majority of ks patients identified were young , nonsmoking , hiv - positive , non - hispanic white males diagnosed during the peak of the hiv epidemic .
there were no significant differences in survival among patients based on sex , hiv status , or radiation received .
there was a trend towards an improved survival among patients who were older , currently smoking , had localized stage at diagnosis , and had received no chemotherapy .
patients diagnosed from 1997 to 2007 had superior outcomes compared to those diagnosed from 1987 to 1996 . | purpose .
kaposi 's sarcoma ( ks ) is a rare low - grade vascular tumor associated with the human herpes virus 8 . by analyzing the epidemiology , staging , and treatment of ks
, we hoped to improve the quality of care at our institution . methods .
review of the mount sinai medical center tumor registry database in miami beach , fl , usa , identified 143 cases of ks between january 1 , 1987 and december 31 , 2007 .
results .
the majority of patients were non - hispanic whites , non smoking males diagnosed between 1987 and 1996 .
most of the patients were hiv positive , with an equal percentage diagnosed with local or distant disease .
most patients received no chemotherapy or radiation .
there were no significant differences in patient survival based on sex , hiv status , or radiation received .
there was a trend toward improved survival among older patients who smoked , received no chemotherapy , and had localized stage at diagnosis .
multivariate analysis revealed that non - hispanic whites had a significant worse survival than hispanic whites ( hr = 0.55 , 95% ci ( 0.33 , 0.90 ) , p = 0.02 ) . patients diagnosed between 1987 and 1996 had a worse survival than those between 1997 and 2007 ( hr = 0.33 ( 95% ci 0.19 , 0.55 ) , p < 0.0001 ) .
conclusion .
this large retrospective study provides further insight into ks .
ethnicity and date of diagnosis are important predictors of long - term survival . |
ever since the first human cardiac transplant was performed in1967 by christian bernard , now , the average frequency of this procedure is approximately 1% of the population with heart failure . with improved graft function and survival , these patients are now presenting to hospitals for various non - cardiac procedures .
the information regarding the physiological and pharmacological interactions in a denervated allograft heart , the side - effects of immunosuppression , the risk of infection and the potential for rejection is essential to the anaesthetist managing such patients in hospitals that are not otherwise involved in transplantation procedures . following these lines
, we now describe the perioperative management of a patient with cardiac transplant who came to our hospital for bipolar haemiarthroplasty .
a 57-year - old male patient of average height and built , weighing 65 kg , sustained intertrochantric fracture of the left femur and was posted for bipolar haemiarthroplasty .
other than the current orthopaedic problem , he was diabetic type-2 for 5 years on nphinsulin with good control .
he was a documented carrier of hepatitis - b antigen , on chronic lamivudine ( hepatovir ) therapy .
fk-506 ( prograf - tacrolimus ) and mycophenolate ( cellcept ) in addition to diltiazem and pantoprazole . on admission , a complete haemogram , coagulation profile and
all biochemical parameters ( including hepatic and renal functions , lipid profile , electrolytes ) were checked and found to be normal .
his echocardiogram showed ejection fraction of 55% with mild diastolic dysfunction and no post - transplant complication like tricuspid regurgitation .
he was undergoing regular myocardial biopsies , the last being done 3 months back , with no documented evidence of graft rejection . on the day of surgery
after a standard fasting period of 8 h , he was premedicated with alprazolam 0.25 mg and pantoprazole 40 mg orally .
standard monitoring with electrocardiogram ( ecg ) , pulse oximetry and end tidal carbondioxide ( etco2 ) was established . for beat to beat blood pressure and central venous pressure monitoring , the radial artery and subclavian vein , respectively , were cannulated .
bis monitoring was also undertaken to ensure early recovery from anaesthesia and to keep tight control over the use of anaesthetic drugs .
pre - induction , his opening cvp was 4 mmhg , heart rate ( hr ) was 85/min and blood pressure ( bp ) was 142/80 mmhg .
cvp was built - up to 8 mmhg after preloading with infusion of 1 l normal saline .
after administration of morphine ( 0.10 mg / kg ) , fentanyl ( 3 g / kg ) and midazolam ( 0.02 mg / kg ) , anaesthesia was induced with titrated doses of inj propofol ( 1 mg / kg ) and maintained with isoflurane ( 0.20.6% ) , nitrous oxide and oxygen mixture ( 60:40 ) .
vecuronium ( 0.15 mg / kg ) and put on ippv and surgery commenced in the right lateral position . throughout the surgery
the first was immediately post induction , when the hr decreased to 74/min and the bp fell to 108/76 mmhg .
mephentermine 6 mg , but its effect became apparent only after 90 s. the second episode occurred with blood loss during long bone reaming , which was managed with an infusion of crystalloid and colloid without vasopressor .
the surgery lasted for 3.5 h. hr strictly remained in the range of 7476 beats / min and no dysarrythmias were noted perioperatively .
cvp was maintained between 8 and 10 mmhg , bispectral index was kept within the range of 4060 , with isoflurane titration and intermittent fentanyl boluses ( 1 g / kg ) .
, the patient was reversed with neostigmine ( 0.05 mg / kg ) and atropine ( 0.02 mg / kg ) and extubated after return of airway reflexes .
morphine 3 mg was again given , through an epidural catheter , 10 h after the first dose for post - operative analgesia .
the patient was kept in the intensive care unit for 24 h and discharged after 7 days of uneventful stay in hospital .
pre - operative assessment of any transplant recipient undergoing non - cardiac surgery should focus on graft function and rejection , risks of infection and function of other organs , particularly those that may be compromised due to either immunosuppressive therapy or dysfunction of the transplanted organ itself and drug interactions .
the patient was assessed for any evidence of late graft rejection , as high morbidity has been noted if surgery is performed during the rejection period .
echo showed a well - functioning graft with good lv function and no regional wall motion abnormality thus ruling out any late - onset vasculopathy .
there was no post - transplant complication like tricuspid regurgitation , which is reported to be as high as 4798% following heart transplantation .
dysrrhythmias , probably due to a lack of vagal tone , rejection and increased endogenous catecholamine concentrations , can occur in over 50% of the patients .
the sinus node may have an increased refractory period and atrial conduction may be prolonged .
thus , first - degree atrioventricular block and right bundle - branch block are common .
as many as 20% of the heart - transplant patients may require a pacemaker for bradyarrhythmias .
a brief review of the pathophysiology of heart transplant would be necessary to understand its anaesthetic management .
the transplanted heart has no sympathetic , parasympathetic or sensory innervation , and the loss of vagal influence results in a higher than normal resting hr .
unlike the normal heart , which increases cardiac output via neural stimuli causing increased hr and contractility , the denervated heart lacks the ability to respond acutely to hypovolaemia or hypotension with reflex tachycardia but responds to stress primarily by an increase in stroke volume by circulating catecholamines .
the increase in cardiac output is dependent on venous return , with an initial increase in left ventricular end - diastolic volume , which mediates an increase in stroke volume and ejection fraction by means of the frank - starling mechanism .
keeping this goal of avoiding acute vasodilatation , hypotension and hypovolemia , sole central neuraxial blockade was avoided and general anaesthesia was preferred , although a variety of anaesthetic techniques ( general , regional , neuroleptic ) have been successfully used in patients with a transplant history .
slow induction and titrated doses of anaesthetic agents and fluid pre - loading also helped in smooth induction of anaesthesia .
although an epidural catheter was inserted , no local anaesthetic bolus was administered , for obvious reasons .
only two episodes of hypotension ( post - induction and during femur reaming ) were noticed , which responded well to intravenous fluids and mephentermine bolus .
another implication of loss of neural control is blunted chronotropic response due to sympathetic stimulation secondary to hypoxia , hypercarbia , hypotension , laryngoscopy and inadequate anaesthetic depth .
in the transplanted heart , the hr shows no response to drugs like muscle relaxants ( pancuronium , gallamine ) , anticholinergics ( atropine , glycopyrrolate and scopolamine ) and anticholinesterases ( neostigmine , edrophonium , pyridostigmine , physostigmine ) .
our patient 's awake hr was 8285/min and , under anaesthesia , it remained 7476/min because vagolytic drugs such as atropine are ineffective in increasing hr , other positive chronotropic and direct beta - adrenergic stimulating ( ephedrine , isoproterenol ) drugs should be readily available .
epinephrine and norepinephrine have an augmented inotropic effect in heart transplant recipients . in transplant recipients , immunosuppressive drugs in common use
newer drugs such as tacrolimus ( fk506 ) and mycophenolate mofetil are replacing cyclosporine a and azathioprine , respectively .
the side - effects of immunosuppressives that have a direct impact on anaesthetic and perioperative management are anaemia , leucopaenia , thrombocytopaenia , hyperkalaemia , hypomagnesaemia , hypertension , diabetes , neurotoxicity , renal insufficiency , anaphylaxis and fever .
immunosuppressed patients are at risk of infections that may be bacterial , viral , fungal or protozoal .
it is imperative to realize that the immunosuppressed patient does not present with the typical signs and symptoms of sepsis fever and leucocytosis . a very high index of suspicion is therefore required .
our patient was a carrier of hepatitis b , but was on chronic lamivudine therapy .
lamivudine is a nucleoside reverse transcriptase inhibitor and it works by acting as a chain terminator of dna synthesis , thereby stopping the spread of hepatitis b virus . the high incidence of fatal infections with invasive lines outweighs the benefits derived from invasive monitoring .
but , our surgical procedure involved major blood loss and large volume shifts and chances of air or fat embolism during long bone reaming ; hence , such invasiveness was warranted for haemodyamic management .
our post - operative care included aggressive respiratory care , aseptic wound handling and early post - operative removal of cvp / arterial lines , epidural and urinary catheters .
in general , if the transplanted heart is functioning satisfactorily , these patients present few problems in elective , acute or even emergency non - cardiac surgery , provided the anaesthetist has some understanding of the pathophysiology of the transplanted and denervated heart . | cardiac transplantation has become the standard therapy for idiopathic dilated cardiomyopathy and end - stage ischaemic heart disease . with the introduction of newer immunosuppressants , together with better patient selection ,
improved perioperative monitoring and care , the overall survival of recipients has improved . an increasing number of patients who received a transplant present for either elective or emergency non - cardiac surgery .
we hereby discuss the perioperative management of such a patient who came to our set - up for bipolar haemiarthroplasty . |
a 28-year - old female patient presented to the department of oral medicine and radiology of the institute for technology and sciences dental college , muradnagar , ghaziabad , india with a chief complaint of inability to open her mouth for 23 years .
the patient 's history revealed that ulceration on the tongue occurred when she was five years of age , in association with a fever .
the ulcer quickly expanded to involve the adjacent structure of the jaw , cheek , and face , perforating the skin and exposing the internal structures .
although the wound healed within one to two months , a severe scar was left during the healing of the soft tissue defect , and gradually she became unable to open her mouth due to the fusion of both jaws on one side .
she also reported swallowing her exfoliated deciduous teeth , as she was unable to spit .
the patient lived in a remote village and had not undergone any prior medical check - ups .
her personal history revealed that she had always been on a semi - solid or a liquid diet through a straw placed into small openings between the teeth on the right side of her mouth .
the patient was poorly built and poorly nourished , with a normal gait , and all her vital signs were within normal limits .
an extra - oral examination revealed facial asymmetry that became more pronounced with age ( fig .
her mouth opening was completely restricted , with no movements of the jaw possible on either side . on inspection , a single ,
roughly oval shaped scar was present on the right lower third of the face , measuring approximately 2 cm3 cm , extending anteroposteriorly 2 cm behind the right lip commissure to 4 cm in front of the right tragus , and superoinferiorly 5 cm below the outer canthus to the lower border of the mandible on the right side ( fig .
the scars were completely adherent to the mandible . no lateral motion of her temporomandibular joints was observed .
an intraoral examination demonstrated that her lips parted and that the opening of her mouth was completely restricted .
the labial and buccal mucosa and vestibule were completely adherent to the alveolar ridges on both sides .
the remaining teeth visibly present were the lower central and lateral incisors , canine , and premolar , which were grossly decayed ( fig .
on the basis of the clinical findings , a provisional diagnosis of severe trismus was made , with a differential diagnosis of intra - articular fusion , extra - articular fusion with superadded infection , and congenital syngnathia .
the patient was then further assessed with a blood examination , a liver and renal function test , an ultrasound of the neck , and a radiological examination , including a panoramic radiograph and three - dimensional computed tomography scan . the complete blood profile and
the ultrasound of the neck revealed normal bilateral parotid and submandibular lymph nodes , and no lymph nodes were seen along levels ii , iv , and v. the panoramic radiograph showed that the fusion of the maxilla and mandible extended from the right upper second premolar to the tip of the coronoid process of mandible .
the second maxillary molar and the first and second premolars were merged in the bony fusion on the right side . the panoramic radiograph clearly demonstrated the absence of a union of the head of the condyle with the temporal fossa .
2 ) . a non - contrast multi - detector computed tomography scan of the head and neck was carried out .
the multi - detector computed tomography scan showed a bony fusion of the right lateral half of the maxilla with the mandible , extending medially up to the right second premolar and laterally to the base of the proximal aspect of the coronoid process .
the central portion of the fused area was mildly radiolucent ( low density ) , and the outer margins were dense .
( figs . 3 and 4 ) based on these findings and the patient 's history of illness , the final diagnosis was fusion of the maxilla and mandible on the right side as a sequelae of noma .
surgical treatment was performed to completely excise the bony fusion of the right arch through an extra - oral approach .
a single extra - oral incision was made from behind the ear and angle of the mandible , splitting the lower lip on the right side .
the bony fusion was removed and the right side was closed with a galea flap that was introduced intra - orally by making a tunnel over the zygomatic arch and sutured to make buccal mucosa . a lateral tongue flap was used to make the buccal and lingual vestibules .
the decayed anterior and posterior teeth , along with bone and calculus , were removed .
the recovery was uneventful , and the patient was satisfied with the surgical goal of increasing the size of the pathway for eating .
the triad of malnutrition , poor oral hygiene , and debilitating disease contributes to its continued presence .
although the precise prevalence of noma is unknown , it ranges from 30,000 to 140,000 cases.8 in high - income countries , noma is now extremely rare .
in contrast , noma still persists in the poorest developing countries , predominantly in africa.3 the epidemiology of noma shows a similar pattern , although the mortality rate has been drastically reduced from 90% to approximately 8%-10% due to modern antibiotics.9 although noma can affect infants , children , and adults,1 a slight predilection may exist for females over males.6 the direct cause of noma remains a mystery.8 it has been postulated that the disease is triggered by a consortium of microorganisms , of which fusobacterium necrophorum is a key component.10 the most common predisposing factors are poor oral hygiene , dehydration , malnutrition , and concomitant illnesses , such as measles , scarlet fever , or tuberculosis , malignancies , especially leukaemia , and immunodeficiency disorders , such as aids.11 the infection may begin as acute necrotizing ulcerative gingivitis.6 the lesion may then ulcerate and spread to the buccal or lingual sulcus and to the mucosa of the lip or cheek . the progression of the destructive process results in extension to the skin
. the greater involvement of the interior of the oral cavity with lesser involvement of the overlying skin has resulted in the lesion being described as a ' cone gangreneux ' .
the process of defect formation is rapid and is typically well - defined.12 gangrene of the soft tissues may then be gradually followed by scar tissue repair of the resulting defect .
fibrous ankylosis often sets in before the oral wound is completely healed , due to the contraction of scar tissue in the periphery of the defect .
the fibrosis progresses in some patients to true bony fusion between the mandible and maxilla , and sometimes also to the temporomandibular joint.7 the facial bones , jaws , and teeth may be affected to varying degrees.10 the presenting clinical features are similar to those reported by our patient .
the site of the cancrum oris ulcer can be identified as a dimple in the smooth contour of the cheek due to ulcer scarring.11 oluwasanmi et al.7 reported 15 patients with cheek defects , of whom eight had a tell - tale cheek scar overlying the area of the defect , similar to what was found in our patient .
several studies have shown that the clinicopathological features of cancrum oris are complicated by trismus .
if the ankylosis of the jaws is intra - articular , the bony fusion is situated at the temporomandibular joint , and if it is extra - articular , the bony fusion involves the jaws.11 however , the ankylosis in our case involved the maxilla and mandible rather than the temporomandibular joint , which is a rare finding in noma cases .
bony fusion of the mandible is serious and is the most disabling type of fusion .
difficulty with mastication , impairment of speech , poor oral hygiene , and facial asymmetry result in physical and psychological disabilities , particularly in young children with a complete inability to open the mouth.713 these problems were observed in our case .
oluwasanmi et al.7 reported changes in the temporomandibular joint in two patients who had diminished joint space , whereas in two patients , widening was observed in one plane and narrowing in another plane . in our case ,
no fusion of the condyles was observed , but a reduced joint could be clearly seen in the coronal section of the computed tomography scan
. diseases occasionally confused with noma that could have been considered in the differential diagnosis of this case include visceral leishmaniasis , yaws , gangosa , syphilis , midline lethal granuloma , tuberculosis , leprosy , lupus erythematous , mucormycosis , agranulocytic ulceration , clostridia gangrene , some tropical fungal infections , oral cancer , and physical trauma
. however , these diseases do not generally occur in young children , do not have a rapid progression that would fit the history described by our patient , or do not produce the extent of tissue destruction seen here.614 eating is a major problem for patients with ankylosis . in a series of 17 patients , 57% were found to be anaemic , with haemoglobin levels of under 75% of normal ( 12 g / dl ) ; levels as low as 19%-30% of normal were not uncommon .
malnutrition and undernutrition occur in many cases ; growth retardation may be so severe that an adolescent of 15 years may have the stature of a child of eight years.7 this dynamic was observed in our patient .
although the age of our patient was 28 years , she weighed 37.1 kg , had a height of 146 cm , and had a very low basal metabolic rate of 975 calories . in
extra - articular ankylosis due to cancrum oris , the bony changes are associated with the destruction of the maxilla , the malar bone , and a portion of the mandible .
the remaining bone is characterized by areas of sclerosis or rarefaction and the distortion of the normal configuration with loss of the trabecular pattern.13 further three - dimensional computed tomography imaging in our case was a step forward in being able to clearly visualize the exact architecture of the area of ankylosis prior to surgery , making a much better surgical plan possible .
antibiotics are mainly indicated for the acute and fulminating early stage of the disease , while surgical intervention is required for the chronic and disfiguring late stage .
the eventual plastic and reconstructive operations are designed to reflect individual needs . in order to improve the overall health status of the patients during the acute stage , vitamins can be administered and ionic and acid - base imbalances can be corrected .
the surgical correction of noma deformities can be challenging due to the unique patterns of destruction in each case .
hence , no standard surgical procedure is common to all noma cases.115 the fused bridges are identified and excised by extra - oral approaches , and scars on the mucosa and the skin are also excised and removed using the same approach.4 this patient presented to us after 23 years of suffering .
she could not preserve data relevant to the diagnosis of her illness or information that would establish which infection led to complete trismus and the bony fusion of the maxilla and mandible .
we were not able to establish the nature of the infection that she suffered from . however , based on the history , oral examination , radiologic examination , and the literature , bony fusion of the maxilla and mandible was considered to be a sequelae of noma .
we hypothesized that the massive soft tissue necrosis probably extended into the periosteum and bone , leading to bony fusion of the maxilla and mandible , which is a rare sequelae of noma . even in a developing country like india
, cases of noma may arise in remote areas , and complications involving fusion may occur due to a lack of awareness , misdiagnosis , and negligence .
the oral diagnostician should take the necessary steps after diagnosing cases of noma and provide a level of follow - up appropriate for avoiding complications like those observed in this case . | noma is a gangrenous disease of the orofacial region that leads to severe facial tissue destruction and is a significant cause of death among children . with the advent of modern antibiotics and
improved nutrition , children with noma may survive into adulthood , but must face the challenge of undergoing repair of the sequelae of noma .
this report describes a case of bony fusion of the maxilla and mandible in a 28-year - old female patient , which was a sequelae of a childhood case of noma . |
the
conformational analysis of glycosidases affords a route to
their specific inhibition through transition - state mimicry .
inspired
by the rapid reaction rates of cyclophellitol and cyclophellitol aziridine both
covalent retaining -glucosidase inhibitors we postulated
that the corresponding carba cyclopropyl
analogue
would be a potent retaining -glucosidase inhibitor for those
enzymes reacting through the 4h3 transition - state
conformation .
ab initio metadynamics simulations
of the conformational free energy landscape for the cyclopropyl inhibitors
show a strong bias for the 4h3 conformation ,
and carba - cyclophellitol , with an n-(4-azidobutyl)carboxamide
moiety , proved to be a potent inhibitor ( ki = 8.2 nm ) of the thermotoga maritimatmgh1 -glucosidase .
3-d structural analysis and comparison with
unreacted epoxides show that this compound indeed binds in the 4h3 conformation , suggesting that conformational
strain induced through a cyclopropyl unit may add to the armory of
tight - binding inhibitor designs . | |
the surface cap - sular polysaccharide of s. pneumoniae initiates a type - specific protective immune response and provides the basis for serotyping of this organism .
currently , more than 90 different pneumococcal serotypes have been identified . among the various serotypes and according to 60 - 80 percent of the worldwide reported infections , the 6 , 14 , 18 , 19 , and 23 are the most prevalent ones ( 1 ) .
nasopharyngeal colonization of s. pneumoniae varies according to age and health status ( 2 ) . in the industrial world
, the expected annual rate of pneumonia is about 14.5 per 10,000 in children under age 16 years old ( 3 ) .
the mortality rate due to s. pneumoniae in developed countries is low ( 4 ) . on the contrary , in developing countries ,
respiratory tract infections are more common and more severe , accounting for more than 2 million deaths annually ; pneumonia infections are the number one killer of children in these societies(5 ) .
lower socioeconomic groups have a higher prevalence of lower respiratory tract infection , which correlates best with family size , as a reflection of environmental crowding ( 6 ) . in spite of the availability of a vaccine covering 23 different serotypes ,
s. pneumoniae is currently the major invasive pathogen of children and adults and is a principal cause of otitis media , pneumonia , bacteremia , and meningitis(7 ) .
information about the distribution of pneumococcal serotypes and demographic characteristics related with s. pneumoniae colonization , are essential for the proposing of strategies to prevent and control these infections ( 7 ) .
the distribution of serotypes also varies between carriage isolates and invasive disease and antibiotic resistance is most common in pneumococcal serotypes ( types 6 , 9 , 14 , 19 , and 23 ) that are carried by children ( 8) . on the other hand , the pnenmococcal vaccination is not presently a part of the childhood immunization plan in iran , and data about the serotype distribution and prevalence of s. pneumoniae colonization , antibiotic susceptibility and risk factors of nasopharyngeal colonization of s. pneumoniae in healthy school - age children is scarce .
the objectives of this study were to determine the nasopharyngeal colonization rate , serotyping , antibiotics susceptibility and risk factors for nasopharyngeal colonization with s. pneumoniae from students in kashan , iran .
overall , 2100 students enrolled in this study sampled from december 2011 to november 2012 in 22 schools in kashan , iran . we excluded children showing symptoms or signs of respiratory infection , as well as those who received at least one dose of any antibiotic treatment during the previous 15 days .
one of the children s parents signed informed consent and provided clinical and demographic information , such as age , sex , crowding ( two or more people sleeping in the same room ) , smokers at home , and socioeconomic status .
detailed medical information such as previous diagnosis of asthma , allergic rhinitis and history of hospitalization in previous 6 months , and antibiotic treatment in previous 3 months were recorded .
specimens from nasopharynx of the students were obtained by using a sterile cotton - tipped swab .
swabs were plated immediately onto brain heart infusion agar plates with 5% sheep blood and 4g / ml of gentamycin .
s. pneumoniae isolates were identified by gram staining , colony characteristics , susceptibility to optochin , and bile solubility .
s. pneumoniae strains were investigated for the presence of the most common pneumococcal serotypes using a multiplex polymerase chain reaction ( pcr ) assay as described previously(9 ) .
the susceptibility pattern of s. pneumoniae strains to rifampin ( 5 g ) , erythromycin ( 15 g ) , oxacillin ( 1 g ) , linezolid ( 30 g ) , clindamycin ( 2 g ) , levofloxacin ( 5 g ) , vancomycin ( 30 g ) , tigecycline ( 15 g ) , and tetracycline ( 30 g ) were determined by disk diffusion method according to clinical and laboratory standards institute ( clsi ) guidelines(10 ) .
the study population included 2100 healthy school - age children aged 7 to 19 years ( 13.08 3.284 years ) , of which ( 1275 ) 60.7% were male .
the distribution of age was as follows : 7 - 11 years : 730 ( 34.8% ) students ; 12 - 15 years : 909(43.2% ) students ; and 16 - 19 years : 461(22% ) students .
the demographic and clinical characteristics of the students enrolled in this study are listed in table1 .
the percentage of s. pneumoniae colonization showed a peak ( 144 out of 909 ) at the age of 12 - 15 years old ( 15.8% ) ( p < 0.009 ) and a low prevalence of 9.8% was observed in 16 - 19 years old students .
as mentioned above , the highest rates of s. pneumoniae colonization were observed among children with age 12 - 15 years old ( 15.8% ) , male sex ( 18.8% ) , rhinorrhea ( 21.4% ) with previous history of respiratory infections ( 18.9% ) .
the occurrence of s. pneumoniae colonization was not statistically differs between children with asthma , frequent respiratory infection , and crowding ( table 1 ) .
the s. pneumoniae strains isolated in this study showed 8 different pneumococcal serotypes , of which 19f ( 30% ) , 6a / b ( 18.9% ) , 15a ( 16.5% ) , 11 ( 11.3% ) 23f ( 8.2% ) , 1(6.2% ) , 19a ( 3.4% ) and 35b ( 2.4% ) were the most common ones .
the risk factors for pneumococcal carriage among students in kashan , iran the most resistance rate among isolated s. pneumoniae strains was tetracycline ( table 2 ) .
the various observed serotypes among the 43 penicillin - non susceptible s. pneumoniae_strains were as follow : 6a / b ( 25.6% ) , 11(18.6% ) , 19f ( 18.6% ) , 15a ( 14% ) , 1(9.3% ) , 23f ( 4.6% ) , and non - typeable ( 9.3% ) . the most resistance rate to oxacillin observed in serotypes 11(24.2% ) , 1 ( 22.2% ) , and 6a / b ( 20% ) .
the serotypes observed among the 74 tetracycline resistance s. pneumoniae strains were 19f ( 27% ) , 15a ( 18.9% ) , 6a / b ( 17.6% ) , 1(9.4% ) , 11(9.4% ) , 23f ( 8.1% ) , 19a ( 5.4% ) , 35b ( 1.4% ) and non - typeable ( 2.7% ) . the most resistance rate to tetracycline detected in serotype 19a ( 40% ) , 1(38.8% ) , 15a ( 29.2% ) , 23f ( 25% ) , 6a / b ( 23.6% ) , 19f ( 23% ) , 11(21.2% ) and 35b ( 14.3% ) .
frequency rates of antimicrobial resistance among 291 s. pneumoniae strains isolated from students in kashan , iran according to serotypes
in the present study , we observed a pneumococcal colonization prevalence of 13.9% in kashan , iran .
the prevalence of s. pneumoniae colonization described in different parts of the world has changed widely .
a variety of demographic and clinical characteristics have been explained to be related with an increase in s. pneumoniae colonization , for example age , society , family size , crowding , siblings , smoking at home , recent antibiotic use , and socioeconomic status of study population regarding variations in sampling and isolation techniques ( 2 , 11 , 12 ) . in our study
previous history of upper respiratory tract infection within the last month , hospitalization , antibiotic usage during last two weeks , rhinorea , male sex and passive smoking have been determined to be risk factors for s. pneumoniae _ carriage .
cigarette smoking compromises natural pulmonary defense mechanisms by disrupting both muco - ciliary function and macrophage activity .
exposure to cigarette smoke , especially in smoking mothers increases the risk of pneumonia in infants younger than one year of age .
we did not observe statistical differences in the prevalence of s. pneumonia colonization between children with asthma and children without respiratory distresses .
s. pneumoniae _ colonizes at the upper respiratory tract and plays role as normal flora of healthy individuals .
a particular serotype can be carried for many months before being eradicated or replaced by a different serotype .
carriage increases in the first few months of life and the highest asymptomatic colonization rates ( > 40% ) observed in young children .
factors associated with increased carriage including winter season , day care crowding , and living in crowded conditions .
carriage in adults is approximately 10 - 20% and the duration of carriage is generally shorter .
antibiotic resistant serotypes most frequently related to pneumococcal strains which carried by children ( types / groups 6 , 9 , 14 , 19 , and 23 ) ( 8) . resistance to tetracycline was observed in 25.4% of the strains .
we did not find any s. pneumoniae_strains showing resistance to levofloxacin , linezolid , and vancomycin .
therefore , exposure of these serotypes to antimicrobial drugs , may leads to a selective advantage of resistant mutants(13 ) .
most of these factors have a unity in exposure to the drugs that select the resistance .
macrolide resistance is also a function of exposure , particularly for a long - acting drug such as azithromycin ( 13 ) .
the macrolides have been used extensively to treat community - acquired respiratory tract infections around the world , and in recent years macrolides resistance in s. pneumoniae has been raised considerably .
macro - lide - resistant s. pneumoniae _ are now more common than penicillin - resistant s. pneumoniae_in many parts of the world(14 ) .
the selection of resistant strains is complicated by multiple resistances where macrolides appear to be better selectors of multi - resistant strains than -lactam drugs do ( 15 ) .
fluoroquinolone resistance in s. pneumoniae relatively remains low around the world ( less than1% ) , but it tends increasing , particularly in some countries .
studies carried out over the past decade recommended that the prevalence of levofloxacin - resistant strains in the north america remains less than 2% ( 1618 ) .
upper rates have been reported in spain ( 7% ) , sri lanka ( 9.5% ) , the philippines ( 9.1% ) , korea ( 6.5% ) and hong kong ( 15.2%)(1922 ) .
the prevalence of rifampin resistance among pneumococcal isolates is low at the present time , and reported rates vary between 0.1 and 1.5% ( 23 ) . in our study
the prevalence of penicillin resistance among s. pneumoniae _ isolates ranged from 18.2 to 22.1%(24 , 25 ) .
reported the prevalence of antimicrobial resistance among s. pneumoniae _ strains to erythromycin 38% , penicillin 34% ( intermediate 20% and high level resistance 14% ) , tetracycline 34% , and clindamycin 29%.(1 ) .
resistance to penicillin is associated with some degree of non - susceptibility to all -lactam antibiotics .
resistance rates reported for amoxicillin are relatively low ( less than 5% ) ( 26 , 27 ) .
tigecycline is the prototype compound of a new class of antimicrobial agents known as glycylcyclines .
this derivative of minocycline provides clinicians with a novel , expanded broad - spectrum antibiotic with activity against difficult - to - treat pathogens .
worldwide , serotypes 6b , 6a , 9v , 14 , 15a , 19f , 19a , and 23f have shown the highest rates of resistance to penicillin and erythromycin , with the highest rates in respiratory isolates reported in south africa ( 74% ) , asia ( 63% ) and the middle east ( 54%)(28 ) .
the data from molecular typing upon numerous studies has shown that there is considerable diversity among resistant strains within most serotypes(29 ) .
mcgee et al . found 30.5% of erythromycin - resistant pneumococci and showed that 83% of these isolates were associated to a serotype 19f strain originating in taiwan(30 ) .
monitoring the changes in pneumococcal nasopharyngeal carriage in children is important , and may provide relevant information on the identification of serotypes that may significantly contribute to pneumococcal diseases . in this research 57%
( 166 out of 291 ) of the isolated serotypes were identified as 19f , 6a / b and 23f .
though there are at this time over 90 distinct serotypes , definite serotypes commonly account for the majority of s. pneumoniae_nasopharyngeal isolates , but the circulation of serotypes differs in relation to geographic position . though serological determination by a quelling reaction of pneumococcal cells with anti - polysaccharide sera is the presently used method for pneumococcal serotyping the high cost of antiserum , the requirements for technical proficiency and bias in interpretation of results are major limitations of the procedure .
multiplex pcr has the likely to overcome these problems and has been reported to have higher sensitivity and specificity than conventional quelling reaction techniques ( 9 , 3133 ) .
the serotype distribution between carriage isolates is frequently used as an indicator for hypothetical vaccine coverage .
vaccination could potentially reduce the carriage rate of antibiotic - resistant pneumococci . at the present time the pneumococcal vaccination is not a part of the childhood immunization program in iran .
the best to our knowledge , there are few data on nasopharyngeal pneumococcal colonization and serotyping among children in iran .
a high prevalence of s. pneumonia colonization in the nasopharynx in students was observed and a high rate of resistance to -lactams and tetracycline of isolates was confirmed .
we found that pneumococcal serotypes 19f , 6a / b were the most common carried serotypes in our studied population . for increase protection against s. pneumonia , it is recommended to vaccinate infants and young children with pneumococcal vaccines .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | abstractbackgroundstreptococcus pneumoniae is an important problem worldwide and nasopharyngeal colonization plays significant role in pneumococcal infections .
the aims of this study were to determine the nasopharyngeal colonization rate , serotyping , antibiotics susceptibility and study the risk factors for nasopharyngeal colonization with s. pneumoniae in students in kashan , iran.methodsa cross - sectional study was conducted on children aged 7 to 19 years from december 2011 to november 2012 .
nasopharyngeal swabs were plated onto brain heart infusion agar plates with 5% sheep blood and 4g / ml of gentamycin .
antimicrobial susceptibility profiles were determined on mueller - hinton agar in accordance with clsi .
s. pneumoniae strains were investigated for the presence of the most common pneumococcal serotypes using a multiplex polymerase chain reaction.results13.9% were found to be carriers .
the most prevalent serogroups were 19f ( 30% ) , 6a / b ( 18.9% ) , 15a ( 16.5% ) , 11 ( 11.3% ) , 23f ( 8.2% ) , 1 ( 6.2% ) , 19a ( 3.4% ) , and 35b ( 2.4% ) .
nine strains ( 3.1% ) were non - typeable .
the carrier rate was significantly higher in 12 to15 year old age group .
upper respiratory tract infections within the last month ( or=1.5 , p<0.011 ) , previous hospitalization ( or=1.6 , p<0.001 ) , previous antibiotic usage last two weeks ( or=1.89 , p<0.001 ) , rhinorea ( or=1.9 p<0.001 ) , male sex ( or=3.5 p < 0.001 ) and passive smoking ( or=1.56 , p < 0.001 ) have been determined to be risk factors for s. pneumoniae carriage .
the highest pneumococcal resistance was to tetracycline ( 25.4% ) .
all strains were susceptible to linezolid and levofloxacin.conclusionour information leads to an important source to screen the future impact of pneumococcal vaccination on bacterial colonization . |
graves disease is a prevalent autoimmune disease that affects approximately 0.5% of the population and is the most common cause ( 50% to 80% ) of hyperthyroidism .
antithyroid drugs have been used as standard therapy for graves disease and interfere with thyroid hormone synthesis .
these drugs , however , have various side effects , including rash , joint pain , hepatic inflammation , and agranulocytosis .
use of thionamides , either propylthiouracil or methimazole , causes agranulocytosis in 0.1% to 0.3% of treated patients .
guillain - barre syndrome ( gbs ) is an acute paralytic illness that affects children and adults of all ages .
the incidence of the disease worldwide is 0.6 to 4 cases per 100,000 . about two - thirds of cases
have been associated with infection occurring 1 to 13 weeks prior to symptom onset , particularly respiratory infection and gastroenteritis .
we describe a 57-year - old female patient with graves disease who suffered from methimazole - induced agranulocytosis and postinfectious gbs .
a 57-year - old female presented with fever , abdominal pain , and diarrhea for 3 days .
she had been diagnosed with graves disease 25 years prior and was taking methimazole , the dose of which had been increased from 5 to 20 mg twice a day , as of 10 weeks prior .
when the patient visited a primary care hospital , her laboratory findings revealed leukopenia and anemia with a white blood cell ( wbc ) count of 570/ml , absolute neutrophil count of 10/ml , hemoglobin of 9.4 g / dl , and platelet count of 161,000/ml .
the physician diagnosed her with methimazole - induced agranulocytosis and stopped methimazole . during the neutropenic period , the patient developed fever and cough .
the pathogen of infection was not confirmed , and she took empirical antibiotics for pneumonia .
clinical features were not improved , and the physician considered fungal pneumonia based on the findings of chest computed tomography .
ten days after onset of respiratory symptoms , she suddenly presented with symmetric weakness of the lower extremities , which progressed to the upper extremities . a nerve conduction study ( ncs ) showed axonal - type motor polyneuropathy .
intravenous immunoglobulin ( ivig ) was started for probable gbs , and she was referred to our hospital for further management . when the patient first came to our emergency room , a neurologic examination showed quadriplegia , flaccid dysarthria , and aflexia , all of which were worse than 5 days before .
the findings of spinal tap were 218.9 mg / dl protein and 10/ml wbc in the cerebral spinal fluid , known as albuminocytologic dissociation , which supported gbs .
the patient showed maximum weakness during the first 2 weeks after admission to the intensive care unit , but artificial ventilation was not needed .
neurologic examination and follow - up ncs improved a month after the onset of weakness ( fig .
the patient faced an impending thyrotoxic crisis with free thyroxine of 6.59 ng / dl ( reference range , 0.89 to 1.8 ) , thyroid - stimulating hormone ( tsh ) of 0.01 miu / ml ( reference range , 0.35 to 5.5 ) , and tsh receptor antibody of 107
the patient had been admitted for 40 days and received physical rehabilitation . with gradual neurologic improvement , she could ambulate using a wheelchair when discharged . after discharge , she maintained rehabilitation therapy for 6 months .
the patient could walk without orthotics ; however , she felt fatigue after a long distance walk .
gbs is an acute flaccid paralysis syndrome characterized by ascending weakness and sensory loss , usually provoked by antecedent infection , vaccination , and/or surgery .
about two - thirds of patients have symptoms of an infection in the 6 weeks prior to the onset of gbs . in most studies ,
although the pathogen of infection is not often identified , the most frequently reported agents are campylobacter jejuni , epstein barr virus , cytomegalovirus , and mycoplasma pneumoniae . among these , c. jejuni is the most common cause of infection , reported in 30% to 40% of cases .
molecular mimicry seems to be related to gbs development after infection , through the synthesis of autoantibodies against gangliosides of nerves .
autoimmune reactions are found only in a small proportion of all exposed individuals , depending on host factors .
host factors , including genetic polymorphisms , might influence the severity of gbs ; however , neither human leukocyte antigen class ii alleles nor single nucleotide polymorphisms have shown a consistent association with gbs .
then , patients experience a plateau phase , which varies from days to several weeks or even months .
the clinical outcome is usually favorable with a spontaneous and complete recovery , although 10% to 20% of patients show residual motor deficits .
even 3 to 5 years after onset of gbs , about one - third of patients have to change their lifestyle due to residual disabilities .
careful monitoring and control of vital signs are essential , and infections have to be prevented .
van der meche and schmitz showed that treatment with ivig was at least as effective as plasmapheresis in acute gbs .
currently , the american academy of neurology practice guidelines recommend that either plasmapheresis or ivig be applied for the treatment of immobile patients with gbs .
two infectious events , which are considered precipitating factors for gbs , occurred within 3 weeks before the onset of weakness , and no pathogen was indentified .
we presume that methimazole - associated agranulocytosis induced an opportunistic infection , which may have evoked gbs .
the patient showed maximum weakness during the first 2 weeks , and neurologic signs improved after 4 weeks . even after her recovery for over a year , she still felt fatigue with daily activities .
to our knowledge , there is no other case report of postinfectious gbs in a patient with graves disease . | both graves disease and guillain - barre syndrome ( gbs ) are autoimmune disorders caused by impaired self - tolerance mechanisms and triggered by interactions between genetic and environmental factors .
gbs in patients who suffer from other autoimmune diseases is rarely reported , and the development of postinfectious gbs in a patient with graves disease has not been previously reported in the literature . herein , we report a patient with graves disease who developed postinfectious gbs during a course of methimazole - induced agranulocytosis . |
asthma , a chronic inflammatory respiratory disease , is highly prevalent in the us and associated with major health burden worldwide .
the goal of therapy is to achieve long - term control of asthma symptoms while minimizing treatment side effects .
current guidelines recommend a stepwise approach to pharmacologic therapy with several classes of medications in which treatment is initiated and adjusted based on an ongoing assessment of the patient s level of asthma control.1,2 long - acting beta2-agonist ( labas ) are bronchodilators that improve the airflow in patients with asthma .
the us food and drug administration ( fda)-approved laba products for asthma include 1 ) fixed - dose combination ( fdc ) inhaled corticosteroids ( icss ) and laba ( fdc - ics / laba ) products and 2 ) single - ingredient laba ( si - laba ) products . a list of laba products is provided in supplementary materials , table s1 .
safety concerns associated with laba have led to fda regulatory activities by the us fda since 2003 , including several advisory committee meetings , drug safety communications ( dscs ) , and label changes .
the fda - approved label is the official description of a drug , including indication and safety information,3 and the dsc delivers updated information about medical products new safety issues.4 key fda regulatory activities include :
in 2003 , a boxed warning was added to salmeterol product labels for severe asthma exacerbations and death , which were observed in the salmeterol multicenter asthma research trial ( smart).5,6 in july 2005 , a pulmonary and allergy drugs advisory committee recommended that the boxed warning be expanded to include formoterol laba products.7two more advisory committee meetings included discussions on laba in november 2007 and december 2008 .
the committee stressed that the appropriate use of laba is in combination with a long - term asthma controller medication ( acm).8 in 2010 , the fda issued two dscs to patients and providers , providing new recommendations for the safe use of laba ( box s1 ) ; and these recommendations were incorporated into the laba product labels.9these three recommendations in the fda s 2010 dscs focused on ways to ensure the safe use of laba products for adult asthma treatment : 1 ) contraindicated use of si - laba ; 2 ) a laba should only be used when asthma is not adequately controlled on ics or acm ; and 3 ) discontinue laba when asthma control is achieved .
previously , the fda examined laba dispensing patterns to see whether the fda s recommendations specifically targeted at young ( < 18 years old ) asthma patients were being followed.10 this study examines the impact of multiple fda laba - related regulatory activities on the initiation of laba - containing products for asthma treatment , particularly the impact of the three key fda recommendations made in the 2010 dscs , using 20032010 as baseline ( pre - dscs ) dispensing patterns . in 2003 , a boxed warning was added to salmeterol product labels for severe asthma exacerbations and death , which were observed in the salmeterol multicenter asthma research trial ( smart).5,6 in july 2005 , a pulmonary and allergy drugs advisory committee recommended that the boxed warning be expanded to include formoterol laba products.7 two more advisory committee meetings included discussions on laba in november 2007 and december 2008 .
the committee stressed that the appropriate use of laba is in combination with a long - term asthma controller medication ( acm).8 in 2010 , the fda issued two dscs to patients and providers , providing new recommendations for the safe use of laba ( box s1 ) ; and these recommendations were incorporated into the laba product labels.9
the ims lifelink health plan claims database was used to construct a cohort of adult asthma patients from january 2002 through december 2012 .
this database consisted of medical and pharmaceutical claims for ~70 million de - identified patients , from more than 86 health plans across the us .
the claims are captured from doctor s offices , pharmacies , specialists , hospitalizations , emergency department ( ed ) visits , tests , procedures , and injections .
the database is nationally representative of the commercially insured population of the us based on age and gender .
the us fda s research in human subjects committee ( rihsc ) approved the current retrospective study .
the us fda s rihsc deemed patient consent not necessary as patients are de - identified .
we identified adult asthma patients who had an incident dispensing of laba between january 2003 and december 2012 .
is defined as having no laba prescription filled in the 6 months prior to the initiation date ( index date ) .
patients were included if they had continuous commercial insurance enrollment and had a diagnosis of asthma in the 12 months prior to the index date and were aged between 18 and 64 years .
asthma was defined by the international classification of diseases , 9th revision , clinical modification ( icd-9 cm ) code 493.xx , including an asthma - related ed visit or hospitalization . since the dscs and labeling changes targeted asthma patients ,
we excluded patients with diagnoses of chronic obstructive pulmonary disease ( icd-9-cm codes 491.xx , 492.xx , 496.xx ) , cystic fibrosis ( icd-9-cm code 277.0x ) , bronchiectasis ( icd-9-cm code 494.xx ) , pulmonary hypertension or embolism ( icd-9-cm codes 416.0 , 415.1 ) , bronchopulmonary dysplasia ( icd-9-cm code 770.7 ) , or congestive heart failure ( icd-9-cm code 428.xx ) during the 12 months prior to or on the index date ( 19% of patients were excluded ) .
we further excluded patients where there was missing information on age , gender , days supply , and patients with > 100 days supply for laba prescription during the study period ( 5% of patients were excluded ) .
the 100-day cutoff was used since many health insurance companies do not cover the cost of prescriptions that exceed 100 days supply in the us .
we used a longitudinal new user cohort design to examine the changes in laba dispensing patterns over a 10-year study period . to assess the alignment with fda s safe use recommendation i ( i.e. , contraindicated use of si - laba products ) , we calculated the proportion of incident si - laba dispensing among all incident laba dispensings . for those who also had a non - laba acm dispensed on the same date as the incident laba
, we consider the dispensing consistent with the dsc recommendation for the adult asthma patient population . for patients who only initiated an si - laba or an si - laba together with an acm dispensing on the same date
, we determined the concurrent treatment status , as having overlapping days of si - laba treatment with any long - term non - laba acm , including ics , leukotriene modifier , chromones , oral systemic corticosteroids , immunomodulators , and methylxanthines . the medication concurrency ratio ( mcr )
was calculated as the ratio of the number of days a patient was on concurrent medications to the total number of days that patient was on an si - laba treatment . to assess fda recommendation ii ( i.e. , add - on therapy , a laba
should only be used when the asthma is not adequately controlled on icss or acm ) , we identified patients with claims for an ics or other acm in 3 or 6 months prior to initiating laba treatment .
the criteria for identifying patients with poorly controlled asthma in claims data are constructed from a surrogate measure using prescriptions or asthma - related ed visits or hospitalizations .
the details for these criteria are described in figure 1.1113 to assess fda recommendation iii ( i.e. , step - down strategy , discontinue laba when asthma control is achieved ) , we calculated the duration of first continuous treatment , defined as starting from the index date of the laba dispensing until there is a gap of > 25% of the prior prescription days supply .
for this analysis , after the assessment of continuous treatment , we excluded patients who initiated a laba in 6 months prior to the end of the study period ( i.e. , july december 2012 ) to ensure that episodes were not truncated by the end of the data collection period .
we calculated mean and median duration ( in days ) of continuous treatment and then estimated the proportion of patients who had longer than 2 or 4 months of continuous treatment on a laba .
we used interrupted time series ( its ) to model the changes in the levels and trends of laba initiation associated with fda regulatory activities .
seasonality and autocorrelation were controlled using autoregressive integrated moving average models.14 since fda regulatory activities and asthma treatment guideline changes were undertaken intermittently across different time points , the study time was divided into three segments : post first labeling change ( 20032004 ) ; post 2005 regulatory activities , pre 2010 dscs ( 20052009 ) ; and post 2010 dscs ( 20102012 ) .
the estimation of the prior acm dispensing and appropriate laba initiation was also based on these three periods .
the bonferroni method was used to adjust for multiple comparisons by dividing the overall a level by the number of implied comparisons .
all analyses were performed using sas v.9.4 software ( sas institute , inc . , cary , nc , usa ) .
the ims lifelink health plan claims database was used to construct a cohort of adult asthma patients from january 2002 through december 2012 .
this database consisted of medical and pharmaceutical claims for ~70 million de - identified patients , from more than 86 health plans across the us .
the claims are captured from doctor s offices , pharmacies , specialists , hospitalizations , emergency department ( ed ) visits , tests , procedures , and injections .
the database is nationally representative of the commercially insured population of the us based on age and gender .
the us fda s research in human subjects committee ( rihsc ) approved the current retrospective study .
the us fda s rihsc deemed patient consent not necessary as patients are de - identified .
we identified adult asthma patients who had an incident dispensing of laba between january 2003 and december 2012 .
is defined as having no laba prescription filled in the 6 months prior to the initiation date ( index date ) .
patients were included if they had continuous commercial insurance enrollment and had a diagnosis of asthma in the 12 months prior to the index date and were aged between 18 and 64 years .
asthma was defined by the international classification of diseases , 9th revision , clinical modification ( icd-9 cm ) code 493.xx , including an asthma - related ed visit or hospitalization . since the dscs and labeling changes targeted asthma patients , we excluded patients with diagnoses of chronic obstructive pulmonary disease ( icd-9-cm codes 491.xx , 492.xx , 496.xx ) , cystic fibrosis ( icd-9-cm code 277.0x ) , bronchiectasis ( icd-9-cm code 494.xx ) , pulmonary hypertension or embolism ( icd-9-cm codes 416.0 , 415.1 ) , bronchopulmonary dysplasia ( icd-9-cm code 770.7 ) , or congestive heart failure ( icd-9-cm code 428.xx ) during the 12 months prior to or on the index date ( 19% of patients were excluded ) .
we further excluded patients where there was missing information on age , gender , days supply , and patients with > 100 days supply for laba prescription during the study period ( 5% of patients were excluded ) .
the 100-day cutoff was used since many health insurance companies do not cover the cost of prescriptions that exceed 100 days supply in the us .
we used a longitudinal new user cohort design to examine the changes in laba dispensing patterns over a 10-year study period . to assess the alignment with fda s safe use recommendation i ( i.e. , contraindicated use of si - laba products ) , we calculated the proportion of incident si - laba dispensing among all incident laba dispensings . for those who also had a non - laba acm dispensed on the same date as the incident laba
, we consider the dispensing consistent with the dsc recommendation for the adult asthma patient population . for patients who only initiated an si - laba or an si - laba together with an acm dispensing on the same date
, we determined the concurrent treatment status , as having overlapping days of si - laba treatment with any long - term non - laba acm , including ics , leukotriene modifier , chromones , oral systemic corticosteroids , immunomodulators , and methylxanthines . the medication concurrency ratio ( mcr )
was calculated as the ratio of the number of days a patient was on concurrent medications to the total number of days that patient was on an si - laba treatment . to assess fda recommendation ii ( i.e. , add - on therapy , a laba
should only be used when the asthma is not adequately controlled on icss or acm ) , we identified patients with claims for an ics or other acm in 3 or 6 months prior to initiating laba treatment .
the criteria for identifying patients with poorly controlled asthma in claims data are constructed from a surrogate measure using prescriptions or asthma - related ed visits or hospitalizations .
the details for these criteria are described in figure 1.1113 to assess fda recommendation iii ( i.e. , step - down strategy , discontinue laba when asthma control is achieved ) , we calculated the duration of first continuous treatment , defined as starting from the index date of the laba dispensing until there is a gap of > 25% of the prior prescription days supply . for this analysis , after the assessment of continuous treatment , we excluded patients who initiated a laba in 6 months prior to the end of the study period ( i.e. , july december 2012 ) to ensure that episodes were not truncated by the end of the data collection period .
we calculated mean and median duration ( in days ) of continuous treatment and then estimated the proportion of patients who had longer than 2 or 4 months of continuous treatment on a laba .
we used interrupted time series ( its ) to model the changes in the levels and trends of laba initiation associated with fda regulatory activities . seasonality and
autocorrelation were controlled using autoregressive integrated moving average models.14 since fda regulatory activities and asthma treatment guideline changes were undertaken intermittently across different time points , the study time was divided into three segments : post first labeling change ( 20032004 ) ; post 2005 regulatory activities , pre 2010 dscs ( 20052009 ) ; and post 2010 dscs ( 20102012 ) .
the estimation of the prior acm dispensing and appropriate laba initiation was also based on these three periods .
the bonferroni method was used to adjust for multiple comparisons by dividing the overall a level by the number of implied comparisons .
all analyses were performed using sas v.9.4 software ( sas institute , inc . , cary , nc , usa ) .
there were 477,922 adults with asthma who met the eligibility criteria for initiators of laba treatment over the study period ( 20032012 ) ; 50% were 1845 years old and 67.5% were female .
for recommendation i , among asthma patients who initiated any laba treatment , the percentage of patients initiating an si - laba who did not have an acm dispensed on the same date decreased . for 1845 years old
, the trend decreased from 9.6% ( percentage points ) in 2003 ( the initial labeling change ) to < 1% post 2010 dscs , with a baseline decreasing trend ( -1.2% per 6 months [ 1.2% decreasing slope ] , p - value < 0.0001 in the segmented regression model ) .
there was a 1.1% significant decrease in si - laba initiation following 2005 regulatory activities ( p - value < 0.0001 ) ; then , the trend continuously decreased with a 0.3% decreasing slope after 2005 ( the sum of the baseline trend , 1.2% , and the change in trend after 2005 , 0.9% ) and a 0.1% decreasing slope after 2010 regulatory activities .
the decreasing trends and patterns were similar for the two age groups ( table 1 and figure 2 ) .
in addition to the declining si - laba initiation ( as a proportion of all laba initiators among asthma patients ) over the study period ( 20032012 ) , we observed increased concurrent dispensing of acm and si - laba therapy . in table 2 ,
si - laba columns show the mcr for those who initiated an si - laba only ( no other acm dispensed on the same date ) during the three time periods .
the median mcr increased from 0% in 20032004 , to 12.7% in 20052009 and to 33.3% in the 20102012 period .
the proportion in the high concurrency category ( mcr > 75% ) increased from 21.0% to 27.9% , and to 34.5% over the three time periods , respectively ( p - value < 0.001 for linear trend ) .
si - laba and acm columns show the mcr for those who initiated an si - laba and had a dispensing of a non - laba acm on the same date .
the mcrs were high ( the median mcr was 100% for all the three periods ) and the high concurrency category also increased over the three time periods ( table 2 ) . with regard to fda s safe use recommendation ii , add - on therapy , figure 1 illustrates the proportion of asthma patients who were dispensed an acm ( first three sets of bars ) or who had poor asthma control ( last set of bars ) , before initiating any laba in the three periods : 20032004 , 20052009 , and 20102012 .
the proportion of these adult asthma patients who were dispensed an ics in the 6 months before initiating a laba decreased from 11.6% in 20032005 , to 7.3% and 7.4% in the last two periods , respectively .
figure 1 shows that the proportion of patients with 1 dispensing of an ics within 3 months was < 10% .
there were no statistically significant changes in the proportion of asthma patients dispensed an acm product prior to initiating laba treatment across the three time segments ( 40.1% , 39.4% , and 40.4% , respectively ) .
the proportions of asthma patients dispensed an acm did not increase much when using a 6- versus 3-month look - back window for identifying ics or acm dispensing prior to initiating any laba treatment ( the proportion with upward diagonal pattern ) .
there were 34% of the laba initiators identified as having poorly controlled asthma prior to initiating laba treatment between 2003 and 2004 , but this proportion was closer to 31% during 20052009 and 20102012 .
for fda s recommendation iii , step - down strategy , the median for the first continuous laba treatment was 30 days .
there were > 95% of patients who had a treatment duration shorter than 6 months over the 10-year period
95% of patients had a duration shorter than 4 months in 2003 and 95% of patients had a duration shorter than 5.5 months in 2011 ( table s2 ) . during the 10-year study period ,
the proportion of laba initiators among asthma patients in each year who had longer laba dispensing did not decrease ( figure 3 ) .
in fact , the proportion of laba initiators who had longer than 2 months of continuous laba treatment increased from 17.6% in 2003 to 25.4% in 2012 ; the proportion of laba initiators increased from 5.4% in 2003 to 6.5% in 2012 with a 0.1% slope ( p - value=0.009 for linear trend ) for those with longer than 4 months of continuous days supply of a laba dispensing ( figure 3 ) .
the most encouraging results of the current study are that the proportion of patients starting si - laba declined significantly over the 10-year study period and the new si - laba initiators had significantly increased concurrent acm laba use .
these findings align with fda s safe use recommendation i. however , the evidence on adherence to recommendation ii ( laba only as add - on therapy ) and recommendation iii ( step - down strategy ) is not as encouraging .
we observed low proportions of new laba users having prior ics or acm use ; and the proportions of incident laba users with longer continuous laba treatment increased over the 10-year period .
the 2003 boxed warning and results from smart may have contributed to the sharp decline of the initiation of si - laba after 2003 , and then the trend continuously declined over the 10-year study period .
similar patterns were also reported in the mini - sentinel laba study using different data sets with a shorter study period , 20052011.15 in addition , the new si - laba users had significantly increased concurrent acm
these findings align with fda s multiple regulatory activities and asthma treatment guidelines.2,9 for recommendation ii , the low proportions of new laba users having prior ics or acm dispensing ( ~7% and 40% , respectively , throughout 20032012 ) in the 6 months prior to initiating laba treatment in the adult population were also observed in other studies .
friedman et al16 reported that only 6.3% of laba initiators had received an ics , and 30% of new laba users had either pre - index ics use or an indication of moderate or severe asthma when using a different us commercial insurance database .
even though hartung et al17 reported a small increase in the proportion of new laba users having prior acm within 3 months before initiating a laba , after the fda s 2010 dsc , the overall proportion remained < 40% over the entire study period ( july 2008december 2012 ) .
similar results were also seen in the mini - sentinel laba study.15 the low prevalence of ics / acm dispensing prior to laba initiation suggests that many patients were prescribed a laba without a trial of ics / acm .
we also identified only one - third of the patients aged 1864 years with laba initiation having evidence of preceding poorly controlled asthma ( figure 1 , last set of bars ) .
similar low proportions of patients who had poorly controlled asthma were reported : 39.2% among study patients aged 1264 years by blanchette et al12 and 37.6% among study patients aged > 12 years by ye et al.13 these results may portray a prescribing behavior in the us that is inconsistent with recommendation ii of the fda 2010 dscs . for recommendation
iii ( step - down therapy in asthma treatment ) , it is less measurable in the available claims data .
the laba duration was constructed by linking the days supply of subsequent prescriptions for the same patient if there was no big gap ( < 25% of the prior days supply ) .
our finding provided some evidence that most of the patients ( 95% ) did not stay on a laba for > 6 months . however , the proportions of incident laba users with longer continuous laba treatment ( > 4 months ) increased over the 10-year period .
we do not know whether patients discontinued laba because they had achieved good control over their asthma symptoms or for other reasons . for confirmation of appropriate step - down therapy , more granular clinical data ( e.g. , symptoms and pulmonary function and safety outcomes ) and careful evaluation of long - term stability are needed;1821 however , these data were not available in this current us claims database .
overall , risk communications of medical products are important for patients using the products as well as for physicians prescribing them , yet such communications are rarely fully evaluated.22,23 there are many factors that could have had an impact on the laba dispensing patterns in adult asthma patients over the 10-year study period . there were multiple important fda laba regulatory activities , worldwide asthma treatment guideline modifications , and relevant research publications during this time period . clinical practice and patient preferences could have been influenced by these factors and others , such as overall acm effectiveness , adverse event experience , medication formulary changes , product advertising , insurance coverage , over - the - counter availability , out - of - pocket , and overall cost.2428 of note , the cost of asthma medications is increasing dramatically in the us over the years;29,30 and the centers for disease control and prevention found that 15% of the population under the age of 65 years was uninsured during the first quarter of 2014 in the us.31 the high cost might be a barrier to choose asthma drugs and compliance with treatment guidelines and recommendations .
studies of laba - related safety outcomes as well as how to achieve effective long - term asthma control may worth further investigation.20,32 in view of this multitude of potentially influential factors during the study period , we evaluated the segmented temporal trends with the expectation of continuous changes during the study period .
first , this commercially insured claims data in the us capture dispensing as a surrogate for patients medication use ; actual medication intake is unknown ; no information on clinical details , such as asthma severity ; and the same person could gain and lose insurance coverage .
therefore , the data and methodology were more robust for evaluating the first dsc recommendation , but less robust for the second and third recommendations .
second , even though the data are nationally representative of the commercially insured population of the us , this is still a small proportion of the population that is affected by the fda s recommendations , and the results may not be generalizable to the uninsured or publically insured population .
studies have shown that physicians who provide samples are more likely to prescribe the drug that may be more expensive and not the first - line therapy drugs.33,34 claims data do not capture these samples , which may lead to an incomplete asthma drug dispensing .
however , there is no evidence that these samples would have systematic change over the years .
newer data may reveal more recent changes and impact on prescriber practice ; therefore , continuous laba monitoring is needed .
the significant decrease in si - laba initiation is consistent with fda s regulatory activities and asthma treatment guidelines .
however , the low ics and acm dispensing , as well as the low proportion of patients having poorly controlled asthma before laba initiation , are not consistent with fda s laba safe use recommendations .
additional analyses from the perspective of patients and prescribers may provide useful insight into the reasons for the low acm use.22 for the assessment of step - down therapy , more granular clinical data are needed . such future studies could inform approaches to improve adherence with the latest laba safe use recommendations for asthma patients .
laba products approved for asthma in the us before 2010 abbreviation : laba , long - acting beta2-adrenergic agonist ; hfa , hydrofluoroalkane . duration of continuous days supply ( based on continuous treatment of the first treatment episode ) among any laba initiators over the 10-year period , 20032012 * excluded patients whose index date was in the last 6 months of the study period ( july 2012december 2012 ) to allow minimum 6 months of follow - up . abbreviation : laba , long - acting beta2-adrenergic agonist ; sd , standard deviation .
box s1the us fda s dscs on february 18 , 2010 , and june 2 , 2010 , stated , to ensure the safe use of laba products in adult asthma patients.the use of a laba alone without the use of a long - term acm , such as an ics , is contraindicated ( absolutely advised against ) in the treatment of asthma ( i.e. , contraindicated use of si - laba).labas should not be used in patients whose asthma is adequately controlled on low- or medium - dose icss ; should only be used as additional therapy for patients with asthma who are currently taking but are not adequately controlled on a long - term acm , such as an ics ( i.e. , add - on therapy).once asthma control is achieved and maintained , patients should be assessed at regular intervals and step - down therapy should begin ( e.g. , discontinue laba ) , if possible without the loss of asthma control , and the patient should continue to be treated with a long - term acm , such as an ics ( i.e. , step - down strategy).abbreviations : acm , asthma controller medication ; dscs , drug safety communications ; fda , food and drug administration ; ics , inhaled corticosteroid ; laba , long - acting beta2-adrenergic agonist ; si - laba , single - ingredient - laba .
the use of a laba alone without the use of a long - term acm , such as an ics , is contraindicated ( absolutely advised against ) in the treatment of asthma ( i.e. , contraindicated use of si - laba ) .
labas should not be used in patients whose asthma is adequately controlled on low- or medium - dose icss ; should only be used as additional therapy for patients with asthma who are currently taking but are not adequately controlled on a long - term acm , such as an ics ( i.e. , add - on therapy ) .
once asthma control is achieved and maintained , patients should be assessed at regular intervals and step - down therapy should begin ( e.g. , discontinue laba ) , if possible without the loss of asthma control , and the patient should continue to be treated with a long - term acm , such as an ics ( i.e. , step - down strategy ) .
abbreviations : acm , asthma controller medication ; dscs , drug safety communications ; fda , food and drug administration ; ics , inhaled corticosteroid ; laba , long - acting beta2-adrenergic agonist ; si - laba , single - ingredient - laba . | backgroundemerging safety issues associated with long - acting beta2-agonist ( laba ) have led to multiple regulatory activities by the us food and drug administration ( fda ) since 2003 , including drug safety communications ( dscs ) in 2010 .
these dscs had three specific recommendations for the safe use of laba products in adult asthma treatment.methodswe examined the initiation of laba - containing products for adult asthma treatment using an intermittent time series approach in a claims database from 2003 to 2012 .
we assessed the alignment of dispensing patterns with the following 2010 fda recommendations : 1 ) contraindicated use of single - ingredient ( si)-laba without an asthma controller medication ( acm ) ; 2 ) a laba should only be used when asthma is not adequately controlled on inhaled corticosteroids ( icss ) or acm ; and 3 ) step - down asthma therapy ( e.g. , discontinue laba ) when asthma control is achieved.resultsthere were 477,922 adults ( 1864 years old ) dispensed a new laba during 20032012 . among laba initiators , patients who initiated an si - laba and who did
not have an acm dispensed on the same date decreased from > 9% in 2003 ( the initial labeling change ) to < 2% post 2010 dscs ( p - value < 0.0001 in the segmented regression model ) .
the proportion of asthma patients dispensed an ics in 6 months prior to initiating laba treatment did not increase .
the proportion of patients with longer than 4 months of continuous treatment did not decrease over the study period.conclusionalthough the decrease in si - laba initiation is consistent with fda s recommendations , low ics dispensing before initiating a laba and laba continuation practices require further efforts to move toward the recommended safe practices . |
for many patients , chronic kidney disease ( ckd ) is a progressive condition marked by deteriorating renal function ultimately leading to end - stage renal disease ( esrd ) .
ckd is reported to affect 15.1% of the population and is associated with a substantial disease burden as evidenced by increased morbidity and mortality and reduced quality of life.14 treatments to slow or prevent the progression of ckd have focused primarily on the management of the comorbidities leading to ckd , including hypertension and diabetes , as well as measures to reduce proteinuria and progressive glomerular and interstitial fibrosis with inhibitors of the renin
aldosterone system.5 however , other treatments ( such as inhibitors of profibrotic cytokines and oxidative stress ) that directly target the underlying pathophysiology that contributes to the progressive decline in renal function in patients with ckd are in development .
in addition , preventing inadequate renal clearance subsequent to an initial insult and resulting nephron loss would avoid an overall increase of retained circulating uremic toxins .
the accumulation of uremic toxins , such as indoxyl sulfate and p - cresyl sulfate , is implicated in the progression of renal failure and cardiovascular disease.6,7 data indicate that serum indoxyl sulfate levels are markedly increased in patients with renal disease and are related to disease severity.7,8 for example , a trial involving 139 patients at various stages of ckd found that indoxyl sulfate levels were inversely related to renal function ( figure 1)8 and directly related to aortic calcification and pulse wave velocity.8 furthermore , elevated indoxyl sulfate levels were associated with increased mortality , even after adjustment for multiple variables ( age , albumin and hemoglobin levels , aortic calcification , gender , diabetes status , phosphate levels , and pulse wave velocity).8 elevated uremic toxins , such as indoxyl sulfate , promote the progression of ckd via a cycle of toxic accumulation and nephron loss.6 organic anion transporters in the proximal tubule permit indoxyl sulfate uptake where it stimulates transforming growth factor beta 1 , a profibrotic cytokine , in the renal parenchyma , ultimately leading to glomerulosclerosis and interstitial fibrosis.6 indoxyl sulfate also induces oxidative stress via the promotion of free radical production , and the reduction of superoxide scavenging activity , resulting in tubular cell injury.6 further pathways involved in tubular damage and deterioration of kidney function are : genetically mediated intracellular inflammation;9 epithelial - to - mesenchymal transition resulting in kidney fibrosis,1013 which might be linked to stimulation of the renin
aldosterone system;10,14 activation of nuclear factor kappa - b and monocyte chemoattractant protein-1;15,16 and decreased klotho expression.17,18 given this role of uremic toxins in the pathophysiology of ckd progression , therapeutic approaches that decrease the level of uremic toxins are a rational method for inhibiting this progression . in this article
, the clinical data supporting the role of ast-120 for slowing the progression of ckd will be reviewed .
ast-120 is an oral intestinal spherical carbon adsorbent consisting of porous carbon particles that are 0.20.4 mm in diameter and insoluble in water and common organic solvents.19 it adsorbs indole , a precursor of indoxyl sulfate derived from the metabolism of tryptophan by bacteria within the gastrointestinal tract , thereby attenuating indoxyl sulfate accumulation in patients with ckd.19 it differs from activated charcoal in its uniform composition , and it has a lower adsorption ability for amylase , pepsin , lipase , and chymotrypsin than charcoal.20 ast-120 decreases serum indoxyl sulfate levels in both dialyzed and undialyzed patients with ckd . in hemodialyzed patients with elevated levels of serum indoxyl sulfate ( n = 26 ) , administration of ast-120 ( 6 g / day ) decreased serum indoxyl sulfate levels relative to untreated control patients at weeks 2 , 4 , 8 , and 12 of the study ( p < 0.05).19 in 22 undialyzed patients with chronic renal failure , 1 month of treatment with ast-120 ( 6 g / day ) resulted in a reduction from baseline in both serum indoxyl sulfate ( from 2.52 0.43 mg / dl to 1.55 0.33 mg / dl ; p < 0.01 versus baseline ) and urine indoxyl sulfate ( from 75.3 11.0 mg / day to 40.8 7.2 mg / day ; p < 0.01 versus baseline).21 in this study , there was no control group.21 in another trial , in 25 undialyzed patients with chronic renal failure , 6 months of ast-120 ( 6 g / day ) resulted in a significant reduction from baseline of both serum and urine indoxyl sulfate ( from 2.02 0.28 mg / dl to 1.70 0.35 mg / dl [ p < 0.05 versus baseline ] and from 66.8 6.2 mg / day to 43.4 9.2 mg / day [ p < 0.05 versus baseline and control patients ] , respectively).22 this effect was evident within 1 month of treatment ( p < 0.05).22 in contrast , serum and urine indoxyl sulfate levels were unchanged from baseline among control patients during the 6-month treatment period.22 ast-120 was approved in japan in 1991 for prolonging the time to initiation of hemodialysis therapy and for improvement of uremic symptoms in patients with ckd .
ast-120 was subsequently approved in korea ( 2005 ) and the philippines ( 2010 ) for prolonging the time to initiation of hemodialysis and for improvement of uremic symptoms in patients with ckd .
currently ast-120 is undergoing phase iii evaluation in north america / latin america and europe for the prevention of ckd progression .
ast-120 has been evaluated in patients with ckd in a number of prospective clinical trials over the last 20 years ( table 1).2328 in an open - label , randomized trial evaluating the effect of ast-120 ( 6 g / day ) on glomerular filtration rate ( gfr ) directly measured by iothalamate clearance , patients with gfr of 2070 ml / minute were enrolled in a 12-month observation period ( n = 43 ) during which patients received dietary and blood pressure ( bp ) management.23 patients whose gfr declined by 5 ml / minute during the observation period ( n = 27 ) were eligible for inclusion in a 12-month treatment period .
thirteen patients continued receiving dietary and bp management alone ( control group ) , while 14 patients added ast-120 to their regimen ( ast-120 group ) . the mean change in gfr was not significantly different between the ast-120 and the control group following 12 months of treatment ( primary outcome ) .
however , when the mean change in gfr was compared between the treatment and observation periods , the rate of decline in gfr was significantly lowered in the ast-120 group ( 0.12 0.15 ml / minute / month versus 1.11 0.13 ml / minute / month in the treatment and observation periods , respectively ; p < 0.001 ) , but not in the control group ( 0.34 0.33 ml / minute / month versus 1.33 0.22 ml / minute / month).23 another trial evaluated the effect of treatment with ast-120 on progression of ckd as measured by changes in proteinuria , serum creatinine ( scr ) , and estimated gfr ( egfr ) in 50 patients with chronic renal failure.24 patients were assigned , without randomization , to either ast-120 ( 6 g / day ) in addition to conventional therapy with antihypertensive , antihyperlipidemic , and antiplatelet agents or conventional therapy alone ( control group ) .
after 12 months , ast-120 treatment inhibited the increase in scr and reduced proteinuria , urinary 8-hydroxydeoxyguanosine , urinary l - fatty acid - binding protein , and serum interleukin-6 levels compared with the control ( p < 0.01 for all ) .
however , the difference in scr between ast-120-treated patients and control patients was only 0.4 mg / dl after 12 months of treatment .
furthermore , the addition of ast-120 did not significantly affect the decline in egfr compared with control patients following 12 months of treatment.24 an open - label , randomized trial evaluated the efficacy of the addition of ast-120 ( 6 g / day ) to conventional therapy in patients with early - stage diabetic nephropathy ( n = 16).25 at baseline , the ast-120 and control groups were comparable with regard to clinical characteristics .
after 12 months of treatment with ast-120 , there was a significant reduction in scr and urinary indoxyl sulfate levels in the ast-120 group compared with the control group ( p < 0.001 and p < 0.01 , respectively ) .
these effects correlated to seven patients in the control group experiencing an increase in scr > 2 mg / dl compared with only one patient in the ast-120 group .
furthermore , four patients in the control group initiated hemodialysis during this trial compared with only one patient in the ast-120 group .
overall , these results support the beneficial effects of ast-120 with regard to preserving renal function specifically in patients with early - stage diabetic nephropathy.25 the carbonaceous oral adsorbent s effects on progression of ckd ( cap - kd ) study was a randomized trial conducted to evaluate the efficacy and safety of ast-120 in 460 patients with ckd ( scr < 5.0 mg / dl).26 patients were randomized to ast-120 ( 6 g / day ) in addition to conventional treatment ( low - protein diet plus angiotensin - converting enzyme inhibitor or angiotensin ii receptor blocker ) or conventional treatment alone.26 the primary composite endpoint was doubling of scr , increase in scr to 6.0 mg / dl , esrd ( need for hemodialysis or transplantation ) , or death .
after 56 weeks of treatment , there was no difference between the ast-120 and control group with regard to the primary endpoint ( 42 patients in the ast-120 group versus 43 in the control group ) .
however , the egfr declined significantly less in the ast-120 group compared with the control group ( p < 0.001 ; figure 2 ) .
further , the estimated creatinine clearance ( ccr ) decreased significantly less relative to baseline in the ast-120 group ( 0.12 ml / minute / day ) compared with the conventional treatment group ( 0.15 ml / minute / day ; p = 0.001).26 in north america , a small double - blind , placebo - controlled , cross - over trial evaluated the effect of ast-120 on markers of renal function in patients with mild stable ckd ( scr 1.56.0 mg / dl).27 patients ( n = 20 ) received ast-120 ( 9 g / day ) or placebo for 7 days followed by a 9-day washout period before switching to the alternative treatment . throughout the study , patients followed a controlled diet .
after 7 days of treatment , no significant difference in scr , 24-hour urine creatinine , or ccr was noted between the ast-120 and placebo groups .
these data suggest that ast-120 has no acute impact on creatinine balance , which supports the use of these parameters as acceptable measures of assessing renal function in patients receiving ast-120.27 a larger , double - blind , placebo - controlled trial evaluated the effect of various doses of ast-120 ( 2.7 , 6.3 , and 9.0 g / day ) on serum indoxyl sulfate levels following 12 weeks of treatment in 157 patients with moderate to severe ckd.28 at baseline , patients had an scr level of 3.06.0 mg / dl , a serum indoxyl sulfate level 0.50 mg / dl , and were following an adequate protein - intake diet .
the primary endpoint was the change in serum indoxyl sulfate level from baseline with secondary endpoints including assessments of renal function ( scr levels , 1/scr , proteinuria , creatinine excretion , and ccr ) and symptoms of uremia ( malaise , nausea , anorexia , pruritus , halitosis , or neuropathy ) .
indoxyl sulfate levels were reduced in a dose - dependent manner following 12 weeks of treatment with ast-120 ( figure 3 ) .
the change in indoxyl sulfate was significant versus baseline and placebo ( p < 0.05 ) for the ast-120 6.3 and 9.0 g / day groups.28 during the 12-week trial , there were no significant changes in measures of renal function although patients in the ast-120 6.3 and 9.0 g / day groups experienced a dose - dependent decrease in malaise compared with placebo.28 several retrospective analyses have been performed , primarily in japan , of patients with varying stages of ckd.2933 one matched - control analysis followed 112 patients with ckd until initiation of hemodialysis.29 the effect of ast-120 treatment on the progression of ckd and initiation of hemodialysis was evaluated by retrospectively comparing the rate of egfr reduction before and after initiation of ast-120 treatment ( baseline ) . at baseline , proteinuria was higher and serum albumin was lower in the control group ; however , an adjustment was made in the analysis for the degree of proteinuria . prior to baseline
, there was no significant difference between the ast-120 and control group in the rate of egfr reduction .
however , the rate of reduction in egfr was significantly decreased in the ast-120 group ( from 1.041 1.177 ml / minute / month [ before baseline ] to 0.338 0.317 ml / minute / month [ after baseline ] ; p <
0.001).29 in contrast , there was no significant difference in the control group in the rate of egfr before ( 0.722 0.885 ml / minute / month ) and after baseline ( 0.859 0.978 ml / minute / month ) .
after 24 months , the percentage of patients who had initiated hemodialysis was significantly lower in the ast-120 group compared with the control group ( 64.3% versus 94.5% ; p < 0.001).29 another retrospective pairwise - matching analysis evaluated the efficacy of ast-120 ( 6 g / day ) plus conventional therapy for slowing the progression of ckd among patients admitted to hospital for ckd and later initiated on hemodialysis.30 patients receiving ast-120 in combination with conventional therapy ( n = 78 ) were compared with a control group ( n = 78 ) who received conventional therapy alone .
after 24 months , the hemodialysis - free rate was significantly higher in the ast-120 group relative to the control group ( 21.8% versus 1.3% , respectively ; p < 0.001 ) .
the 50% hemodialysis - free period was also longer for the ast-120 group compared with the control group ( 9.0 months versus 4.1 months ) .
similar benefits of ast-120 with regard to hemodialysis - free rate and 50% hemodialysis - free period were observed in a subanalysis of diabetic versus nondiabetic patients .
furthermore , benefits were evident at early stages of renal disease : among patients with baseline scr < 3 mg / dl , the 24-month hemodialysis - free period was significantly greater in the ast-120 group compared with the control group ( 57.1% versus 7.7% , respectively ; p 0.001).30 more than 50% of the patients in the scr < 3 mg / dl subgroup who were treated with ast-120 remained hemodialysis - free after 24 months .
in contrast , 50% of the patients in the control group had initiated hemodialysis by 16.2 months.30 these results suggest that the addition of ast-120 to conventional therapy early in the treatment of ckd is beneficial for reducing disease progression . however , the criteria for initiating hemodialysis were not strictly defined and therefore may have been prone to bias . in addition , the proportion of patients with a baseline scr level < 3 mg / dl ending on hemodialysis after 2 years was relatively high ( close to 50%).30 another analysis evaluated whether treatment with ast-120 prior to initiation of hemodialysis influences disease prognosis after initiation of hemodialysis.31 this analysis compared survival and cause of death between 101 patients who received ast-120 and 91 patients who did not .
the 5-year survival rate in the ast-120 group was 72.6% compared with 52.6% in the control group ( p = 0.018 ) , corresponding to a 1.9-fold greater risk of death in the control group .
furthermore , the total number of deaths was significantly decreased in the ast-120 group compared with the control group ( 22 versus 32 ; p = 0.036).31 in a retrospective analysis of 100 patients with ckd who had not previously undergone hemodialysis , 12 months of treatment with ast-120 ( 6 g / day ) improved the mean 1/scr slope from 0.012 0.013 before treatment to 0.006 0.006 after treatment ( p < 0.001).32 benefit was observed regardless of the primary cause of renal dysfunction , age , or baseline scr , and the greatest benefit was observed among patients who were treated with ast-120 for the longest duration.32 a potential bias of uncontrolled studies that are based on scr or 1/scr slope is that the seeming improvement in renal function during the course of the observation period may be due as much to loss of muscle mass as to preserved renal function .
recently , a large , retrospective pair - matched analysis was conducted in 560 patients stratified according to whether or not they received ast-120 prior to initiation of hemodialysis.33 overall , there was a significant difference in the 12-month and 24-month hemodialysis - free rates favoring the ast-120 group over the control group ( 25.0% versus 10.5% , respectively [ 12-month ] and 13.7% versus 5.7% , respectively [ 24-month ] ; p < 0.001 for both ) .
in addition , subgroup analyses showed that the 12-month and 24-month hemodialysis - free rates were higher in the ast-120 group irrespective of the presence of diabetic nephropathy or cardiovascular disease .
however , comparison of 3-year , 5-year , and 10-year survival rates found no difference in overall survival between patients treated with ast-120 and those who were not treated with ast-120.33 most adverse events associated with ast-120 treatment are , as expected , related to gastrointestinal function ( eg , constipation , abdominal distension , nausea , flatulence , and diarrhea ) and primarily mild to moderate in severity.2628 overall , the number and type of nongastrointestinal adverse events reported in placebo - controlled trials were similar between the ast-120 and control groups.26,28 one trial reported that ast-120 had no significant effect on the absorption of fat - soluble vitamins ( ie , vitamins d and k).28 discontinuation of treatment due to adverse events was reported in one trial ( for both ast-120 and placebo patients),28 but other trials reported no discontinuations due to adverse events related to ast-120.23,27 there are several limitations to the trials conducted to date .
open - label studies and retrospective analyses have the methodological deficiencies of non - blinding and/or lack of a placebo control .
the primary limitation of the largest randomized , double - blind trial conducted in japan ( cap - kd ) was that only a small proportion of patients in either group reached the primary endpoint.26 other limitations of cap - kd included a short duration , a lower than expected percentage of patients with diabetic nephropathy , and a low percentage of patients with severe kidney disease.26 furthermore , the initial randomized , double - blind trial conducted in the united states was not designed to assess clinical outcomes , as the primary endpoint was the change from baseline in serum indoxyl sulfate levels.28 a limitation of ast-120 treatment is the need for 30 pills daily .
unfortunately , compliance was not reported in most of the clinical trials that evaluated the efficacy and safety of ast-120 .
therefore , it is difficult to ascertain the implications for treatment compliance resulting from the significant pill burden associated with ast-120 .
based on the promising results of initial trials and the need for more definitive clinical outcome data , large clinical trials have been initiated in north america / latin america and europe to evaluate the efficacy of ast-120 for the prevention of ckd progression .
the evaluating prevention of progression in ckd ( eppic ) trials are two double - blind , placebo - controlled trials to evaluate the efficacy of ast-120 for preventing progression of ckd in patients with moderate to severe disease who are not anticipated to require hemodialysis or renal transplant within 6 months of study entry .
patients were randomized to ast-120 ( 9 g / day ) , requiring ingestion of 30 capsules / day , or placebo .
the primary endpoint of the eppic trials is the time to the triple composite endpoint of a doubling of scr , initiation of hemodialysis , or kidney transplant . over 2000 subjects
ast-120 has been evaluated in patients with ckd in a number of prospective clinical trials over the last 20 years ( table 1).2328 in an open - label , randomized trial evaluating the effect of ast-120 ( 6 g / day ) on glomerular filtration rate ( gfr ) directly measured by iothalamate clearance , patients with gfr of 2070 ml / minute were enrolled in a 12-month observation period ( n = 43 ) during which patients received dietary and blood pressure ( bp ) management.23 patients whose gfr declined by 5 ml / minute during the observation period ( n = 27 ) were eligible for inclusion in a 12-month treatment period .
thirteen patients continued receiving dietary and bp management alone ( control group ) , while 14 patients added ast-120 to their regimen ( ast-120 group ) . the mean change in gfr was not significantly different between the ast-120 and the control group following 12 months of treatment ( primary outcome ) .
however , when the mean change in gfr was compared between the treatment and observation periods , the rate of decline in gfr was significantly lowered in the ast-120 group ( 0.12 0.15 ml / minute / month versus 1.11 0.13 ml / minute / month in the treatment and observation periods , respectively ; p < 0.001 ) , but not in the control group ( 0.34 0.33 ml / minute / month versus 1.33 0.22 ml / minute / month).23 another trial evaluated the effect of treatment with ast-120 on progression of ckd as measured by changes in proteinuria , serum creatinine ( scr ) , and estimated gfr ( egfr ) in 50 patients with chronic renal failure.24 patients were assigned , without randomization , to either ast-120 ( 6 g / day ) in addition to conventional therapy with antihypertensive , antihyperlipidemic , and antiplatelet agents or conventional therapy alone ( control group ) .
after 12 months , ast-120 treatment inhibited the increase in scr and reduced proteinuria , urinary 8-hydroxydeoxyguanosine , urinary l - fatty acid - binding protein , and serum interleukin-6 levels compared with the control ( p < 0.01 for all ) .
however , the difference in scr between ast-120-treated patients and control patients was only 0.4 mg / dl after 12 months of treatment .
furthermore , the addition of ast-120 did not significantly affect the decline in egfr compared with control patients following 12 months of treatment.24 an open - label , randomized trial evaluated the efficacy of the addition of ast-120 ( 6 g / day ) to conventional therapy in patients with early - stage diabetic nephropathy ( n = 16).25 at baseline , the ast-120 and control groups were comparable with regard to clinical characteristics .
after 12 months of treatment with ast-120 , there was a significant reduction in scr and urinary indoxyl sulfate levels in the ast-120 group compared with the control group ( p < 0.001 and p < 0.01 , respectively ) .
these effects correlated to seven patients in the control group experiencing an increase in scr > 2 mg / dl compared with only one patient in the ast-120 group .
furthermore , four patients in the control group initiated hemodialysis during this trial compared with only one patient in the ast-120 group .
overall , these results support the beneficial effects of ast-120 with regard to preserving renal function specifically in patients with early - stage diabetic nephropathy.25 the carbonaceous oral adsorbent s effects on progression of ckd ( cap - kd ) study was a randomized trial conducted to evaluate the efficacy and safety of ast-120 in 460 patients with ckd ( scr < 5.0 mg / dl).26 patients were randomized to ast-120 ( 6 g / day ) in addition to conventional treatment ( low - protein diet plus angiotensin - converting enzyme inhibitor or angiotensin ii receptor blocker ) or conventional treatment alone.26 the primary composite endpoint was doubling of scr , increase in scr to 6.0 mg / dl , esrd ( need for hemodialysis or transplantation ) , or death .
after 56 weeks of treatment , there was no difference between the ast-120 and control group with regard to the primary endpoint ( 42 patients in the ast-120 group versus 43 in the control group ) .
however , the egfr declined significantly less in the ast-120 group compared with the control group ( p < 0.001 ; figure 2 ) .
further , the estimated creatinine clearance ( ccr ) decreased significantly less relative to baseline in the ast-120 group ( 0.12 ml / minute / day ) compared with the conventional treatment group ( 0.15 ml / minute / day ; p = 0.001).26 in north america , a small double - blind , placebo - controlled , cross - over trial evaluated the effect of ast-120 on markers of renal function in patients with mild stable ckd ( scr 1.56.0 mg / dl).27 patients ( n = 20 ) received ast-120 ( 9 g / day ) or placebo for 7 days followed by a 9-day washout period before switching to the alternative treatment . throughout the study , patients followed a controlled diet .
after 7 days of treatment , no significant difference in scr , 24-hour urine creatinine , or ccr was noted between the ast-120 and placebo groups .
these data suggest that ast-120 has no acute impact on creatinine balance , which supports the use of these parameters as acceptable measures of assessing renal function in patients receiving ast-120.27 a larger , double - blind , placebo - controlled trial evaluated the effect of various doses of ast-120 ( 2.7 , 6.3 , and 9.0 g / day ) on serum indoxyl sulfate levels following 12 weeks of treatment in 157 patients with moderate to severe ckd.28 at baseline , patients had an scr level of 3.06.0 mg / dl , a serum indoxyl sulfate level 0.50 mg / dl , and were following an adequate protein - intake diet .
the primary endpoint was the change in serum indoxyl sulfate level from baseline with secondary endpoints including assessments of renal function ( scr levels , 1/scr , proteinuria , creatinine excretion , and ccr ) and symptoms of uremia ( malaise , nausea , anorexia , pruritus , halitosis , or neuropathy ) .
indoxyl sulfate levels were reduced in a dose - dependent manner following 12 weeks of treatment with ast-120 ( figure 3 ) .
the change in indoxyl sulfate was significant versus baseline and placebo ( p < 0.05 ) for the ast-120 6.3 and 9.0 g / day groups.28 during the 12-week trial , there were no significant changes in measures of renal function although patients in the ast-120 6.3 and 9.0 g / day groups experienced a dose - dependent decrease in malaise compared with placebo.28
several retrospective analyses have been performed , primarily in japan , of patients with varying stages of ckd.2933 one matched - control analysis followed 112 patients with ckd until initiation of hemodialysis.29 the effect of ast-120 treatment on the progression of ckd and initiation of hemodialysis was evaluated by retrospectively comparing the rate of egfr reduction before and after initiation of ast-120 treatment ( baseline ) . at baseline , proteinuria was higher and serum albumin was lower in the control group ; however , an adjustment was made in the analysis for the degree of proteinuria .
prior to baseline , there was no significant difference between the ast-120 and control group in the rate of egfr reduction .
however , the rate of reduction in egfr was significantly decreased in the ast-120 group ( from 1.041 1.177 ml / minute / month [ before baseline ] to 0.338 0.317 ml / minute / month [ after baseline ] ; p
< 0.001).29 in contrast , there was no significant difference in the control group in the rate of egfr before ( 0.722 0.885 ml / minute / month ) and after baseline ( 0.859 0.978 ml / minute / month ) .
after 24 months , the percentage of patients who had initiated hemodialysis was significantly lower in the ast-120 group compared with the control group ( 64.3% versus 94.5% ; p < 0.001).29 another retrospective pairwise - matching analysis evaluated the efficacy of ast-120 ( 6 g / day ) plus conventional therapy for slowing the progression of ckd among patients admitted to hospital for ckd and later initiated on hemodialysis.30 patients receiving ast-120 in combination with conventional therapy ( n = 78 ) were compared with a control group ( n = 78 ) who received conventional therapy alone . after 24 months , the hemodialysis - free rate was significantly higher in the ast-120 group relative to the control group ( 21.8% versus 1.3% , respectively ; p < 0.001 ) .
the 50% hemodialysis - free period was also longer for the ast-120 group compared with the control group ( 9.0 months versus 4.1 months ) .
similar benefits of ast-120 with regard to hemodialysis - free rate and 50% hemodialysis - free period were observed in a subanalysis of diabetic versus nondiabetic patients .
furthermore , benefits were evident at early stages of renal disease : among patients with baseline scr < 3 mg / dl , the 24-month hemodialysis - free period was significantly greater in the ast-120 group compared with the control group ( 57.1% versus 7.7% , respectively ; p 0.001).30 more than 50% of the patients in the scr < 3 mg / dl subgroup who were treated with ast-120 remained hemodialysis - free after 24 months .
in contrast , 50% of the patients in the control group had initiated hemodialysis by 16.2 months.30 these results suggest that the addition of ast-120 to conventional therapy early in the treatment of ckd is beneficial for reducing disease progression . however , the criteria for initiating hemodialysis were not strictly defined and therefore may have been prone to bias .
in addition , the proportion of patients with a baseline scr level < 3 mg / dl ending on hemodialysis after 2 years was relatively high ( close to 50%).30 another analysis evaluated whether treatment with ast-120 prior to initiation of hemodialysis influences disease prognosis after initiation of hemodialysis.31 this analysis compared survival and cause of death between 101 patients who received ast-120 and 91 patients who did not .
the 5-year survival rate in the ast-120 group was 72.6% compared with 52.6% in the control group ( p = 0.018 ) , corresponding to a 1.9-fold greater risk of death in the control group .
furthermore , the total number of deaths was significantly decreased in the ast-120 group compared with the control group ( 22 versus 32 ; p = 0.036).31 in a retrospective analysis of 100 patients with ckd who had not previously undergone hemodialysis , 12 months of treatment with ast-120 ( 6 g / day ) improved the mean 1/scr slope from 0.012 0.013 before treatment to 0.006 0.006 after treatment (
p < 0.001).32 benefit was observed regardless of the primary cause of renal dysfunction , age , or baseline scr , and the greatest benefit was observed among patients who were treated with ast-120 for the longest duration.32 a potential bias of uncontrolled studies that are based on scr or 1/scr slope is that the seeming improvement in renal function during the course of the observation period may be due as much to loss of muscle mass as to preserved renal function .
recently , a large , retrospective pair - matched analysis was conducted in 560 patients stratified according to whether or not they received ast-120 prior to initiation of hemodialysis.33 overall , there was a significant difference in the 12-month and 24-month hemodialysis - free rates favoring the ast-120 group over the control group ( 25.0% versus 10.5% , respectively [ 12-month ] and 13.7% versus 5.7% , respectively [ 24-month ] ; p < 0.001 for both ) .
in addition , subgroup analyses showed that the 12-month and 24-month hemodialysis - free rates were higher in the ast-120 group irrespective of the presence of diabetic nephropathy or cardiovascular disease .
however , comparison of 3-year , 5-year , and 10-year survival rates found no difference in overall survival between patients treated with ast-120 and those who were not treated with ast-120.33
most adverse events associated with ast-120 treatment are , as expected , related to gastrointestinal function ( eg , constipation , abdominal distension , nausea , flatulence , and diarrhea ) and primarily mild to moderate in severity.2628 overall , the number and type of nongastrointestinal adverse events reported in placebo - controlled trials were similar between the ast-120 and control groups.26,28 one trial reported that ast-120 had no significant effect on the absorption of fat - soluble vitamins ( ie , vitamins d and k).28 discontinuation of treatment due to adverse events was reported in one trial ( for both ast-120 and placebo patients),28 but other trials reported no discontinuations due to adverse events related to ast-120.23,27
open - label studies and retrospective analyses have the methodological deficiencies of non - blinding and/or lack of a placebo control .
the primary limitation of the largest randomized , double - blind trial conducted in japan ( cap - kd ) was that only a small proportion of patients in either group reached the primary endpoint.26 other limitations of cap - kd included a short duration , a lower than expected percentage of patients with diabetic nephropathy , and a low percentage of patients with severe kidney disease.26 furthermore , the initial randomized , double - blind trial conducted in the united states was not designed to assess clinical outcomes , as the primary endpoint was the change from baseline in serum indoxyl sulfate levels.28 a limitation of ast-120 treatment is the need for 30 pills daily . unfortunately , compliance was not reported in most of the clinical trials that evaluated the efficacy and safety of ast-120 .
therefore , it is difficult to ascertain the implications for treatment compliance resulting from the significant pill burden associated with ast-120 .
patient education may be important to ensure compliance with ast-120 treatment in clinical practice . based on the promising results of initial trials and the need for more definitive clinical outcome data ,
large clinical trials have been initiated in north america / latin america and europe to evaluate the efficacy of ast-120 for the prevention of ckd progression .
the evaluating prevention of progression in ckd ( eppic ) trials are two double - blind , placebo - controlled trials to evaluate the efficacy of ast-120 for preventing progression of ckd in patients with moderate to severe disease who are not anticipated to require hemodialysis or renal transplant within 6 months of study entry .
patients were randomized to ast-120 ( 9 g / day ) , requiring ingestion of 30 capsules / day , or placebo .
the primary endpoint of the eppic trials is the time to the triple composite endpoint of a doubling of scr , initiation of hemodialysis , or kidney transplant . over 2000 subjects
ast-120 has a long history in japan and asia for use in patients with ckd to prolong the time to initiation of hemodialysis and to improve uremic symptoms .
the efficacy of the drug is supported by the results of clinical trials that demonstrate that ast-120 decreases serum indoxyl sulfate in a dose - dependent fashion , ameliorates the decline in renal function , and improves at least some symptoms of uremia . | uremic toxins such as indoxyl sulfate contribute to the pathogenesis of chronic kidney disease ( ckd ) by promoting glomerulosclerosis and interstitial fibrosis with loss of nephrons and vascular damage .
ast-120 , an orally administered intestinal sorbent , adsorbs indole , a precursor of indoxyl sulfate , thereby reducing serum and urinary concentrations of indoxyl sulfate .
ast-120 has been available in japan since 1991 , and subsequently korea ( 2005 ) , and the philippines ( 2010 ) as an agent to prolong the time to initiation of hemodialysis and for improvement of uremic symptoms in patients with ckd .
a medline search was performed to identify data supporting clinical experience with ast-120 for managing ckd .
prospective open - label and double - blind trials as well as retrospective analyses were included . in prospective trials and retrospective analyses ,
ast-120 has been shown to prolong the time to initiation of hemodialysis , and slow decline in glomerular filtration rate and the increase serum creatinine . in an initial randomized ,
double - blind , placebo - controlled trial in the united states , ast-120 was associated with a significant dose - dependent reduction in serum indoxyl sulfate levels and a decrease in uremia - related malaise .
the evaluating prevention of progression in ckd ( eppic ) trials , two double - blind , placebo - controlled trials undertaken in north america / latin america and europe , are evaluating the efficacy of ast-120 for preventing the progression of ckd .
the results of the eppic trials will further define the role of ast-120 in this debilitating condition . |
prostacyclin synthase ( pgis ) is an atypical cytochrome p450 enzyme , which generates prostacyclin ( pgi2 ) from prostaglandin h2 ( pgh2 ) , provided by cyclooxygenase-1 ( cox1 ) or cox2 .
prostaglandin - i synthase is expressed constitutively , consistent with its tata - less and gc - rich promoter .
however , in vitro studies have failed to identify specific factors that induce consistently pgis - protein expression .
prostacyclin , which has a half - life of 30 sec in vivo , activates adenylate cyclase through interaction with its g - protein - coupled receptor , dubbed ip .
in contrast to certain synthetic and stable prostacyclin analogues , known to activate the nuclear receptor peroxisome proliferator - activated receptor , / ( ppar-/ ) , there remains controversy over whether this is also true for endogenous prostacyclin [ 6 , 7 ] .
development of severe glomerular , vascular , and interstitial abnormalities in pgis - knockout - mice only serves to confirm the critical role that prostacyclin plays in normal renal development .
such defects are not observed in the ip - knockout - mice , fitting with the notion of a second pgi2-receptor , possibly ppar-/. numerous glomerular actions of pgi2 have been reported , including effects on local hemodynamics , renin secretion , cell proliferation , and matrix turnover .
the potential beneficial effects of various synthetic ligands on slowing progression of renal disease have been observed in experimental animal models as well as in humans . despite the fact that prostacyclin has been shown to play several roles in the kidney ,
the pattern of pgis expression in humans during renal development and in glomerular disease is virtually unknown .
there are also few studies describing the in vitro expression of prostacyclin synthase . in human endothelial cells ,
biosynthesis of prostacyclin is controlled primarily through the induction of cyclooxygenase by growth factors or mitogens whereas expression of pgis remains unchanged .
others have shown that bovine endothelial cells translate tumour necrosis factor ( tnf ) binding into an increase of cox2 enzyme expression and subsequently into the induction of prostacyclin synthase mrna .
finally , incubation of human endothelial cells with acidic fibroblast growth factor in the presence of heparin resulted in a marked diminution in pgi2 synthesis caused by a decrease in expression of both prostacyclin synthase and cyclooxygenase protein .
most studies that have reported on prostacyclin synthesis in the scientific literature have focused on expression and regulation of cyclooxygenases , the enzymes that provide pgh2 and thus cyclooxygenases are considered to be the rate - limiting step during prostanoid synthesis .
two isoforms of cyclooxygenase have been identified : a constitutive cox1 that is thought to be involved in housekeeping functions of prostaglandins and an inducible cox2 that is believed to be involved in the synthesis of high amounts of prostaglandins under pathological conditions .
the present series of studies were conducted under various different circumstances in order to gain further insight into the regulation of prostacyclin synthase .
we analyzed the mrna and protein expression of prostacyclin synthase in normal developing and adult human kidneys , as well as in glomerular disease .
the current work was conducted with permission of our institution 's local medical ethics committee . during the course of normal clinical practice
, renal tissue was obtained from the unaffected poles of kidneys surgically removed as part of treatment of renal carcinoma ( n = 5 patients ) .
unused paraffin - embedded renal biopsy tissue samples remaining after sectioning were also identified for study . in total 21 patients , 12 patients with iga - nephropathy ,
seven patients undergoing routine renal biopsy , one patient with chronic renal transplant rejection , and one patient with focal segmental glomerulosclerosis provided consent for their biopsy samples to undergo the study .
specificity of all primary antibodies has been rigorously tested and confirmed by colocalization studies of the respective mrna using radioactive in situ hybridization [ 15 , 16 ] .
primary anti - cyclooxygenase antibodies were obtained from santa cruz ( santa cruz , ca : cox1 , c20 : sc#1752 , and cox2 : c-20 , sc#1745 ) .
the characterization of the monoclonal antibodies for prostacyclin synthase has been published previously . in brief , approximately 5 m tissue sections were sliced from snap - frozen samples , thaw - mounted on poly - l - lysine - coated glass slides , air - dried , and fixed in acetone for 10 min at 4c .
the presence of primary antibodies was confirmed with the alkaline phosphatase antialkaline phosphatase method using rabbit anti - mouse or mouse anti - rabbit antibodies .
antisense and sense probes for human prostacyclin mrna were prepared as follows . a polymerase chain reaction ( pcr )
fragment ( 420 base pairs ) generated the amplification of mesangial mrna with the primer pair depicted below that was ligated and cloned in a pcr 2.1 plasmid ( invitrogen , usa ) .
the following primers were used to generate a murine - pgis riboprobe : forward - ggctggctgggttgagaatc and reverse - gaccgtgcgaaggttggtat .
cloned cdna fragments were sequenced according to the dideoxy method to confirm the identity and orientation of the inserts . in situ hybridization
glomeruli were obtained from different donors by passage through serially graded sieves and incubated in growth medium which consisted of rpmi-1640 supplemented with insulin ( 5 g / ml ) , transferrin ( 5 g / ml ) , sodium selenite ( 5 g / ml ) , l - glutamine ( 1% ) , penicillin ( 100 u / ml ) , and streptomycin ( 100 g / ml ) containing 10% fetal calf serum and hepes ( 20 mm ) . cellular outgrowths of mesangial appearance were subcultivated and characterized as follows : ( a ) morphological criteria with elongated appearance ; ( b ) staining with antivimentin ; ( c ) staining with smooth muscle cell actin ; and ( d ) absence of staining with anti(factor viii ) and antidesmin . cells were grown to confluence and growth was arrested by low serum conditions ( 0.5% fetal calf serum ) in the absence of supplements for 2436 h. all experiments were performed using cells between the third and sixth passages .
recombinant human ( rh ) interleukin ( il ) types 1 i-1 and rh - tnf were purchased from endogene ( ma , usa ) .
a commercial enhanced chemiluminescence detection kit with nitrocellulose membranes ( hybond - c ) was obtained from amersham ( braunschweig , frg ) .
primers were synthesized by mwg - biotech ( ebersberg , frg ) ; amplitaq polymerase was obtained from perkin - elmer ( weiterstadt , frg ) and superscript reverse transcriptase from gibco ( eggenstein , frg ) .
insulin , transferrin supplements , and recombinant human interferon ( ifn ) type- rh - ifn- were from boehringer ( mannheim , frg ) .
primary antibodies to characterize cellular cultures were obtained from dako ( ca , usa ) ; secondary antibodies were from dako and dianova ( hamburg , frg ) .
analysis of prostacyclin synthase expression was performed on human mesangial cells . in brief , lysates ( 80 g ) of cells stimulated for 20 h with rh - tnf ( 100 ng / ml ) , ifn- ( 350 u / ml ) , il-1 ( 1 nm ) , or control were solubilized in phosphate buffered saline containing 1% triton x-100 .
total rna was isolated from mesangial cells using the guanidinium thiocyanate method with acidic phenol .
reverse transcription and pcr were performed as described recently for cox1 , cox2 , -actin , and thromboxane synthase .
accordingly , for prostacyclin synthase , 1 g of total rna was used for target - specific reverse transcription with reverse transcriptase and the primer ( 5-atgcggtagcggacgacgggcacg-3 ) .
polymerase chain reaction amplification was performed using the cdna with the antisense ( 5-ctgcatcagaccgaagccc tacctg-3 ) and sense primer ( 5-tgctgagtgagagcctcaggctta-3 ) .
reactions were cycled 30 times ( 30 sec at 94c , 30 sec at 56c , and 30 sec at 72c following a 5 min denaturing step at 95 ) .
samples were assayed at various dilutions to ensure proportionality in the yield of pcr products .
prostanoids in the supernatant of mesangial cells were measured by gas chromatography coupled to dual mass spectrography ( gc / ms / ms ) as described previously .
nephrogenesis . in the developing human kidney , intense expression of pgis was observed in mesenchymal cells of the nephrogenic cortex ( figure 1(a ) ) .
epithelial structures corresponding to various stages of renal development and tubular structures were not labeled ( figure 1(b ) ) . an identical pattern was observed when analyzing prostacyclin synthase mrna expression in the mouse ( figure 1(c ) , low power view ) . in situ
hybridization revealed strong cortical labeling in kidneys on postnatal day 0 . within the exception of vascular structures ,
high power views confirmed labeling over interstitial cells and sparing of epithelial structures ( figure 1(d ) , high power view ) .
normal adult kidney .
radioactive in situ hybridization revealed specific signals for prostacyclin synthase in the mesangial region of glomeruli ( figure 2(a ) ) and over arterial endothelial cells ( figure 2(b ) ) . as expected from biological and pharmacological studies ,
pgis immunoreactivity was detected in endothelial cells of blood vessels ( figure 2(c ) ) of normal kidney as well as in the smooth muscle cells of arteries .
note pgis immunoreactivity in cells of the juxtaglomerular apparatus adjacent to cells of the macula densa ( figure 2(d ) ) .
glomerular expression of pgis - immunoreactive protein varied considerably in tissues from children with renal disease ranging from completely absent to strong and localized primarily to endothelial cells . however , there was no evidence that would link expression with a particular disease . shown
are high power views from a patient with iga - nephropathy ( figure 3(a ) ) , minimal change disease with focal segmental glomerulosclerosis ( figure 3(b ) ) , and chronic transplant rejection ( figure 3(b ) ) .
strong capillary expression of prostacyclin synthase in renal medulla was observed in the same biopsy ( figure 3(d ) ) .
in vitro studies .
the profile of prostanoid synthesis in our cultured human mesangial cells ( hmcs ) is shown in figure 4 . under basal conditions , mesangial cells produced predominantly pgi2 determined as 6-keto - pgf1 , the primary product of pgi2 metabolic breakdown .
considerably smaller amounts of pge2 and pgf2 were observed and thromboxane ( tx ) type b2 , the stable product of tx type a2 , was only barely detectable .
incubation of growth - arrested hmc from different donors with cytokines consisting of il-1 ( 1 nm ) , tnf ( 10 ng / ml ) , and ifn- ( 250 u / ml ) resulted in increased expression of prostacyclin ( 24-fold ) and pge2 ( 65-fold ) .
coincubation of stimulated hmc with the nonsteroidal anti - inflammatory drug , diclofenac ( 1 m ) , resulted in a complete inhibition of prostanoid synthesis .
in contrast , addition of the glucocorticoid dexamethasone ( 1 m ) lowered cytokine - stimulated prostaglandin production to the same levels as seen under control conditions .
the profile of exogenously added arachidonic acid metabolism is shown in table 1 . in a concentration - dependent manner ,
once again , the levels of txb2 and pgf2 , prostanoids known to exert vasoconstrictive actions , were hardly detectable , even when the hmcs were challenged with arachidonic acid ( 20 m ) . to gain further insight into the regulation of prostacyclin synthase activity following cytokine stimulation ,
the cyclooxygenase step was bypassed by the addition of exogenous pgh2 , the immediate substrate for pgis . as can be seen from the data in table 2 , compared to control
, there was no significant difference in the conversion of pgh2 to 6-keto - pgf1 in any of the cytokine or glucocorticoid treated samples .
these data point towards a constitutive activity of prostacyclin synthase . to investigate this aspect at the protein level ,
the authenticity of the observed single band of approximately 52 kd was evidenced using the purified bovine enzyme as a positive control ( figure 5(a ) ) .
similar results , confirming the constitutive nature of the enzyme , were obtained addressing the corresponding mrna expression ( figure 5(b ) ) .
messenger rna expression for both pgis and cox1 was unaffected by cytokine stimulation , whereas expression of cox2 mrna was markedly induced .
interestingly , rt - pcr analysis failed to detect mrna for txs and suggested a negligible role for txa2 as mesangial cell derived prostanoid .
the extensive increase of inducible nitric oxide synthase mrna under identical conditions was reported in hmc and served as a control for cytokine activity .
in the present study , it appear to be a strong expression of pgis mrna and immunoreactive protein in mesenchymal cells of developing human and mouse kidney , respectively .
the greatest expression appeared to be subcortical , in the most immature part of the kidneys , namely , the nephrogenic cortex , in mesenchymal cells adjacent to ureteric buds .
previously , the regulation of pgis expression during development has been shown during uterine development , with high levels of expression occurring in the most immature cells .
the strong expression of pgis suggests that promoters of pgis gene expression that have yet to be identified must be involved .
further studies , possibly including the investigation of mirnas as potential regulators , are needed to identify the mechanisms leading to the upregulation of pgis expression .
considering the multiple defects in renal development in pgis - ko mice , including increased interstitial fibrosis , leads to speculation that prostacyclin plays an important role in the prevention of fibrosis and that this process may be modulated via ppar-/ ( given the normal renal phenotype in ip - ko - mice ) .
our study describes for the first time the intrarenal localization of prostacyclin synthase mrna and immunoreactive protein in the healthy adult human kidney .
expression of pgis mrna and immunoreactive protein in vascular structures appears to confirm pharmacologic findings and is consistent with a role for prostacyclin as a vasodilator and inhibitor of platelet activation .
expression of pgis in the juxtaglomerular apparatus is in accordance with prostacyclin as mediator of renin release .
expression of pgis mrna and immunoreactive protein was less prominent and discernible over mesangial fields .
this agrees with the findings of earlier studies which did not show a role of endogenous prostacyclin on tubular transport .
we investigated whether pgis , like other developmentally regulated genes , is upregulated in glomerular disease .
we observed variable degrees of pgis expression in human kidney disease , though the expression was frequently higher than that seen in samples from healthy tissue controls .
the interpretation of these observations was limited by the number of biopsies available for study and the multiple underlying diseases , precluding any correlation of pgis expression with a particular glomerulopathy .
the majority of cases showed upregulation of pgis in glomerular and peritubular endothelial cells , which suggests a common inducer ( figures 3(a ) and 3(b ) ) . in some biopsies , however , inter- ( figure 3(c ) ) and intraglomerular ( figure 3(d ) ) expression was quite variable , possibly altered by local hemodynamics .
serial sections stained for cox1 and cox2 ( data not shown ) did not reveal coexpression with pgis , arguing for differential modes of regulation ( of cox1 , cox2 , and pgis , resp . ) . as endothelial cells , for instance ,
are known to synthesize prostacyclin , absence of cox1 or cox2 costaining with pgis may simply reflect high specificity and reduced sensitivity of our immunostaining procedure .
our observations with cultured human mesangial cells appear to confirm that prostacyclin is the predominant mesangial prostanoid both under basal conditions and following cytokine stimulation .
similarly to pgi2 , pge2 is a potent vasodilator , dependent on specific receptors located on target cells .
despite using highly selective and sensitive gc / ms / ms , we could only detect trace amounts of the vasoconstricting prostanoids , txa2 and pgf2 , from hms .
in contrast to cytokine induced pge2 and pgi2 formation , we did not observe changes in txa2 and pgf2 synthesis .
there is evidence that these prostanoids are predominately formed products of human glomerular epithelial cells ( unpublished observations ) .
thus , we suggest that the previously reported formation of txa2 or pgf2 from human mesangial cells is possibly a consequence of contamination of the previous authors ' work with visceral epithelial cells .
the predominance of the vasodilatory prostanoids pge2 and pgi2 suggests that mesangial prostanoid formation exerts a tonic vasodilatory effect on the glomerular capillary network . in a different set of experiments
exposure of hmc to cytokines resulted in a 24-fold increase of pgi2 synthesis , but there was no evidence of pgis mrna and protein having been induced . in contrast , there was a marked induction of cox2 mrna and protein .
these results are in agreement with previous studies and suggest that the limiting step in hmc - derived pgi2 synthesis is the regulation of cox2 expression . to substantiate the concept that cox2 levels regulate prostanoid synthesis in hmcs ,
we investigated the effect of dexamethasone on cytokine induced pgi2 prostaglandin formation . dexamethasone is known to inhibit stimulated expression of both cox2 protein and mrna through its action on transcriptional and posttranslational mechanisms . in cytokine - stimulated hmc ,
dexamethasone repressed cox2 mrna and protein expression in parallel with a decrease in prostanoid formation to levels seen inside control .
as dexamethasone failed to affect expression of the pgis gene , our data appears to additionally support the concept that cox2 is the key step in controlling prostanoid formation in hmcs .
exposure of cytokine - stimulated hmcs to the nonsteroidal anti - inflammatory drug diclofenac , which inhibits both cox1 and cox2 activities , reduced prostanoid synthesis to levels below those seen in controls .
these findings appear to suggest that cox1 contributes to basal hmc - derived prostanoid formation .
our data appear to be in contrast with the observations made in bovine aortic endothelial cells , which has demonstrated the upregulation of prostacyclin mrna following tnf stimulation .
however , our findings are in line with those from experiments conducted in human venous umbilical endothelial cells .
therefore , we propose that cell - specific regulation of prostacyclin synthase may occur under certain conditions or that the apparent difference in finding is a consequence of species differences .
this notion is a supported pattern of organization of the human prostacyclin synthase gene , which was recently determined and uncovered consensus sequences for sp-1 , ap-2 , and , interestingly , nf-b in the promoter region .
nf-b is known as a transcriptional activator involved in the transmission of proinflammatory responses and could be a target for pgis transcriptional regulation .
the signalling pathway triggering pgis induction in human systems therefore seems to be more complex and may involve a complex cytokine network ( in a fashion similar to that recently proposed for nitric oxide synthase ) or the presence of yet unknown mediators .
nevertheless , our data appear to demonstrate clearly that regulation of pgi synthesis is regulated predominantly by cox2 activity , which serves to provide pgh to the constitutively expressed pgis .
when considering our current findings in conjunction with what is already known about prostacyclin synthase , it appears that our data shows it to be under the influence of a developmentally regulated gene which is often reexpressed in glomerular disease .
these in vivo findings appear to be in contrast with the constitutive expression of pgis in primary human mesangial cells . nevertheless , our data point to hitherto unknown regulators of prostacyclin synthase expression . | prostacyclin ( pgi2 ) plays a critical role in nephrogenesis and renal physiology . however , our understanding of how prostacyclin release in the kidney is regulated remains poorly defined .
we studied expression of prostacyclin synthase ( pgis ) in developing and adult human kidneys , and also in selected pediatric renal diseases .
we also examined pgi2 formation in human mesangial cells in vitro .
we observed abundant expression of pgis in the nephrogenic cortex in humans and in situ hybridization revealed an identical pattern in mice . in the normal adult kidney ,
pgis - immunoreactive protein and mrna appear to localize to mesangial fields and endothelial and smooth muscle cells of arteries and peritubular capillaries . in kidney biopsies taken from pediatric patients ,
enhanced expression of pgis - immunoreactive protein was noted mainly in endothelial cells of patients with iga - nephropathy .
cultured human mesangial cells produce primarily pgi2 and prostaglandin e2 , followed by prostaglandin f2 cytokine stimulation increased pgi2 formation 24-fold . under these conditions expression of pgis mrna and protein remained unaltered whereas mrna for cyclooxygenase-2 was markedly induced .
in contrast to its constitutive expression in vitro , renal expression of prostacyclin - synthase appears to be regulated both during development and in glomerular disease .
further research is needed to identify the factors involved in regulation of pgis - expression . |
all three cases were transferred to our hospital after elective spine surgery under general anesthesia in a local hospital .
after induction of anesthesia with propofol and vecuronium , orotracheal intubation was performed without any difficulty ( cormack 1 , 1st attempt ) using a single lumen internal diameter ( i d ) 7.0 mm cuffed reinforced tracheal tube ( mallinckrodt medical , athlone , ireland ) by an experienced anesthesiologist .
spine surgery proceeded without a specific event in prone position . at the end of the surgery ,
the endotracheal tube was removed when the patient responded to verbal commands and showed sufficient spontaneous respiration .
the duration from intubation to extubation was 170 , 215 and 185 minutes , respectively , for the three cases . a 77-year - old woman ( height , 150 cm ; weight , 50 kg ) received spine surgery under general anesthesia in a local hospital .
no other medical history and specific abnormal laboratory results were recorded except the arterial hypertension for about 20 years .
on postoperative day 2 , the patient complained of discomfort on the anterior chest and neck with dyspnea .
the chest x - ray showed pneumomediastinum and subcutaneous emphysema . the patient was then referred to our hospital . a computed tomography ( ct ) scan of the chest visualized the injury of the posterior tracheal wall due to the rupture of the pars membranosa ( fig .
1 ) . an emergent operation was decided , and was initiated as induction of anesthesia by propofol and remifentanil target controlled infusion ( tci ) . before tracheal intubation , a fiberoptic bronchoscopy revealed a longitudinal hole with sharp margins at the posterior part of the membranous portion , with a total length of 6 cm approximately 3 cm from the carina .
tracheal laceration was repaired without any specific event . a 52-year - old woman ( height , 158 cm ; weight , 60 kg ) underwent spine surgery due to spinal stenosis at the same hospital as case 1 .
she was transferred to our er due to dyspnea and subcutaneous emphysema approximately 3 hours after the operation .
her medical history was recorded as arterial hypertension and diabetes 18 years ago , and she was treated by administration of angiotensin receptor antagonist and insulin pump . when she was admitted at our hospital , pneumomediastinum , subcutaneous
bronchoscopy confirmed a linear laceration of 3 - 4 cm in length on the posterior membranous wall of the mid - trachea ( fig .
anesthesia was induced by propofol and remifentanil tci , and tracheal intubation was taken by an i d 7.5 mm reinforced tube through the injured mid - trachea .
the tube was advanced into the left main bronchus by fiberoptic bronchoscopy for one lung ventilation after the operation had begun .
the trachea was repaired successfully , and the patient was discharged in good condition from the hospital . a 73-year - old woman ( height , 153 cm ; weight , 53 kg ) , who underwent spine surgery at the same hospital as case 1 and 2 , had mild subcutaneous emphysema on postoperative day 2 .
chest ct revealed a laceration on the posterior membranous wall of the mid - trachea ( fig .
however , the patient 's symptoms were mild enough to recover by close observation with conservative treatment .
a 77-year - old woman ( height , 150 cm ; weight , 50 kg ) received spine surgery under general anesthesia in a local hospital . no other medical history and specific abnormal laboratory results
on postoperative day 2 , the patient complained of discomfort on the anterior chest and neck with dyspnea .
the chest x - ray showed pneumomediastinum and subcutaneous emphysema . the patient was then referred to our hospital .
a computed tomography ( ct ) scan of the chest visualized the injury of the posterior tracheal wall due to the rupture of the pars membranosa ( fig .
1 ) . an emergent operation was decided , and was initiated as induction of anesthesia by propofol and remifentanil target controlled infusion ( tci ) . before tracheal intubation , a fiberoptic bronchoscopy revealed a longitudinal hole with sharp margins at the posterior part of the membranous portion , with a total length of 6 cm approximately 3 cm from the carina .
a 52-year - old woman ( height , 158 cm ; weight , 60 kg ) underwent spine surgery due to spinal stenosis at the same hospital as case 1 .
she was transferred to our er due to dyspnea and subcutaneous emphysema approximately 3 hours after the operation .
her medical history was recorded as arterial hypertension and diabetes 18 years ago , and she was treated by administration of angiotensin receptor antagonist and insulin pump . when she was admitted at our hospital , pneumomediastinum , subcutaneous
bronchoscopy confirmed a linear laceration of 3 - 4 cm in length on the posterior membranous wall of the mid - trachea ( fig .
anesthesia was induced by propofol and remifentanil tci , and tracheal intubation was taken by an i d 7.5 mm reinforced tube through the injured mid - trachea .
the tube was advanced into the left main bronchus by fiberoptic bronchoscopy for one lung ventilation after the operation had begun .
the trachea was repaired successfully , and the patient was discharged in good condition from the hospital .
a 73-year - old woman ( height , 153 cm ; weight , 53 kg ) , who underwent spine surgery at the same hospital as case 1 and 2 , had mild subcutaneous emphysema on postoperative day 2 .
chest ct revealed a laceration on the posterior membranous wall of the mid - trachea ( fig .
however , the patient 's symptoms were mild enough to recover by close observation with conservative treatment .
these factors may be divided into mechanical factors that include trauma during intubation , overinflation of the cuff and vigorous coughing etc . , and anatomical factors .
overinflation of cuff and sudden movement of the tube are the two most common reasons , and direct tear caused by the tube itself is rare .
we suspect that the cause of tracheal injury is overinflation of the cuff because of the following reasons .
although the cause of tracheal rupture may be an injury by stylet or tube tip , endotracheal intubation was not difficult at all in our three cases , and the stylet was removed when the tube was passed through the vocal cord .
moreover , tracheal injury by stylet damages the anterior mucosal layers of the trachea because the stylet is curved anteriorly .
however , two cases confirmed by fiberoptic bronchoscopy showed longitudinal rupture of the posterior membranous wall of the trachea .
the posterior part of the trachea lacks cartilaginous support . secondly , many patients had higher pressure of cuff according to the retrospective survey of the hospital , where the operations of our cases were performed .
most cases presented over 50 cmh2o , and some even showed more than 100 cmh2o .
endotracheal tube cuff pressure should be in the range of 15 - 22 mmhg to avoid complications related to underinflation ( aspiration and leakage ) and overinflation ( tracheal wall ischemia , stenosis and tracheo - esophageal fistulae ) .
previous studies have suggested that the cuff pressure is usually under - estimated by manual palpation .
observed cuff pressure exceeding 40 cm h2o in 91% of pacu patients after anesthesia with nitrous oxide , 55% of icu patients .
overinflation of an endotracheal tube ( ett ) cuff may be prevented by use of a manometer to directly measure inflation pressure .
nitrous oxide lead to increased volume , and accidental overinflation can result from its diffusion in the cuff .
fourthly , risk of tracheal injury increased more when overinflated cuff moved in the trachea .
all cases had spine surgery in prone position , such that abrupt head and neck movement could not be ruled out because of two positional changes from intubation to extubation . in the previous literatures published , the majority of case series showed not only female predominance , but the mean age over 50 years [ 3 - 5,10,11 ] .
some authors have suggested that post - intubation tracheal rupture may present more frequently in women because the pars membranosa is weaker in women than in men , and female tracheal diameters might be smaller in diameter than those of male , which makes women more vulnerable to cuff overinflation .
short stature could also be a predisposing factor for tracheal rupture . in our case series ,
all patients were female and older than 50 years , and their height was shorter than 160 cm .
the clinical manifestations of tracheal injury include subcutaneous emphysema , mediastinal emphysema , pneumothorax , respiratory distress , and hemoptysis .
usually , they appear during surgery or in the immediate postoperative period . sometimes it does not occur till many hours later .
some authors reported that the time elapsed between the occurrence of the injury and the diagnosis was over 100 h .
it is interesting to note that the subcutaneous emphysema is not only the most common symptom , but also a protective factor .
its presence alerts to the possible existence of tracheal rupture , consequently accelerating the procedures for its definitive diagnosis and the initiation of the appropriate treatment .
it is believed that delayed emphysema occurred with a possible small tear of the tracheal mucosa , allowing a slow and gradual leakage of a small amount of air . in one of our cases ,
fiberoptic bronchoscopy is believed to be the best subsequent method to confirm diagnosis and to determine the exact location and extent of the lesion .
it should be done immediately after observing unexplained subcutaneous emphysema , which could indicate tracheal laceration .
traditionally , early surgical repair has been the mainstay of treatment . however , recently there are more authors who opt to conservative treatment in patients with small ruptures , less than 2 cm , and in selected patients with minimal , non - progressive symptoms and with no air leakage on spontaneous breathing [ 3 - 5,15 ] .
therefore , length and size of the lesion and clinical symptoms of the patient should be considered when planning a therapeutic option . in our first two cases ,
surgical repair was chosen for treatment because the length of the lesion was more than 2 cm and symptoms were progressive . in the last case ,
conservative treatment was chosen because the symptoms were non - progressive and mild . in summary
, we presume that the tracheal injuries of 3 cases were caused by over - inflation of cuff and sudden movement of the tube by positional change . therefore , to prevent overinflation , subtle management of cuff pressure by a manometer and minimized movement of the tube at positional change are necessary . | tracheal rupture is a rare but serious complication that occurs after endotracheal intubation .
it usually presents as a linear lesion in the membranous wall of the trachea , and is more prevalent in women and patients older than 50 years .
the clinical manifestations of tracheal injury include subcutaneous emphysema and respiratory distress .
we report the cases of three female patients of old age presenting tracheal rupture after endotracheal intubation .
two cases received surgical repair without complication and one recovered uneventfully after conservative management .
we presume that the tracheal injuries were caused by over - inflation of cuff and sudden movement of the tube by positional change .
therefore , we recommend cuff pressure monitoring during general anesthesia and minimized movement of the head and neck at positional change . |
over the past several decades , research on health literacy has become increasingly relevant to gerontologists , as studies have shown that older adults ' health literacy is an important factor in their health status and service utilization [ 14 ] .
health literacy has been defined as the degree to which individuals have the capacity to obtain , process , and understand basic health information and services needed to make appropriate health decisions and
studies have shown that level of health literacy is related to use of health services and measures of disease control [ 1 , 6 ] .
it has also been related to increased risk for hospitalization in medicare beneficiaries and even to greater risk of death [ 8 , 9 ] .
several studies have found that individuals 65 years of age and older perform at lower levels on measures of health literacy compared to younger individuals [ 10 , 11 ] .
the national assessment of adult literacy ( naal ) was a population - based study of literacy that included a health literacy scale .
age comparisons showed that those 65 years of age and older performed at lower levels compared to participants who were younger .
studies with other measures , including the widely - used test of functional health literacy in adults or tofhla , have also found age - related decrements in performance . on the other hand ,
some studies with another widely - used measure of health literacy , the rapid estimate of adult literacy in medicine , or realm , have not found age - related differences [ 9 , 1517 ] . given the link between health literacy and health , a better understanding of reasons underlying older individuals ' poorer performance on some but not all measures of health literacy might yield information that could inform the development of interventions to improve it .
one possible source of age - related differences in performance on tests of health literacy is the type of response required by the measure .
the tofhla , for example , uses the cloze procedure to evaluate comprehension of health - related written material [ 18 , 19 ] . with the cloze procedure
, the person evaluated is asked to read a text passage and supply words that have been deleted and replaced with a blank ( e.g. , the sky is ) . in the case of the tofhla
the authors deleted every 5th to 7th word from three passages which progressively increased in level of difficulty .
although the cloze procedure was created to assess text readability , it has been widely used as a device for measuring comprehension and is incorporated in other health - related measures , although it has been criticized as inappropriate for use with low literacy individuals [ 22 , 23 ] and for routine use in healthcare settings .
the cloze format may be difficult for older adults due to its demands on cognitive abilities that decline with age , including verbal fluency and working memory .
studies have shown that cloze performance may depend on working memory and that it modifies the relation between age and general cognitive ability in cognitive task performance [ 18 , 26 ] .
other authors have also demonstrated that working memory may differentially affect reading comprehension in older individuals [ 27 , 28 ] , still further implicating it as a factor in performance on tests that use the cloze procedure . finally , a previous study showed age - related differential item functioning ( dif ) on several tofhla items in individuals over 50 years of age who were treated for hiv infection , suggesting that some tofhla items may be harder for older individuals than younger individuals even when they have the same overall level of health literacy .
this study 's small sample size and the existence of disease - related cognitive deficits in study participants , however , make it difficult to generalize its results to other groups .
using the cloze procedure to assess comprehension may thus inadvertently create a test with items that are differentially more difficult for elders , confounding the assessment of health literacy with age - related changes in cognition .
apparent age - group differences may result that suggest that elders ' health literacy skills are lower than they actually are .
this possibility can be tested by assessing whether test items display differential item functioning or dif related to age .
a test item is said to exhibit dif when it is more difficult for a member of one group than another ( e.g. , men versus women , blacks versus whites , or older versus younger ) even though each person 's underlying overall ability is the same .
if age - related dif is present in the items of the tofhla , some items would be more difficult for older than younger individuals even though they have the same overall ability .
this could occur because the dif - related items make demands on a cognitive ability such as working memory that declines with increasing age .
in essence , items with age - related dif would thus evaluate two abilities in older individuals ( health literacy and working memory ) while ostensibly assessing only one ( health literacy ) .
the purpose of these analyses was therefore to evaluate whether items on the tofhla show age - related dif using a nonparametric approach to identify dif due to our sample size .
we also chose to explore the possibility that working memory would be related to performance on items showing dif using standard parametric regression analysis and test whether taking age - related dif into account would explain age - group differences in performance on the tofhla by comparing the performance on age - based groups on the measure with and without items that show age - related dif .
in this study we drew on data collected in a larger study whose purpose was to develop and validate a new measure of health literacy [ 31 , 32 ] .
participants whose ages ranged from 18 to 86 provided demographic information and completed the tofhla and a battery of cognitive and academic measures .
these data thus provided the basis for an assessment of differences in tofhla performance between those 65 years of age and older compared to those who were younger while taking into account potential confounders that included education , general verbal ability , and basic reading skills .
age - related dif was first assessed in the items of the tofhla as described below . as we hypothesized that working memory might be a factor in age - related dif , the relation of performance on a measure of working memory ( digit span backward ) to performance on the dif - related items
was evaluated in younger and older individuals . finally , to evaluate the relevance of dif to age group differences on total tofhla reading scores
, differences between groups were tested on the sum of all tofhla comprehension items and a recalculated total score with dif - related items was eliminated .
participants were community - dwelling volunteers aged 18 and older recruited through flyers in community centers , word of mouth , and from previous studies .
as the purpose of the parent study was to develop a new measure of health literacy and to provide preliminary norms for it , participants were selected to represent a wide range of ages and educational levels and to be distributed across gender and race [ 31 , 32 ] .
of the 167 participants who were younger than 65 , 70 were white and 97 were black and 75 were men and 92 were women . of the 69 participants who were 65 years of age or older , 54 were white and 15 were black and 19 were men and 50 were women .
it can be seen that the average age of the younger group was approximately 43 while that of the older group was approximately 74 years .
figure 1 shows the number of individuals at each age in the two age groups and additional descriptive information is provided in table 1 . as part of a battery of ability and skill measures , the complete tofhla , including 50 reading comprehension items , was administered .
the reading comprehension portion of the tofhla requires the person assessed to read three paragraphs of health - related material whose difficulties progressively increase .
the first paragraph is based on simple instructions on how to prepare for an x - ray , the second focuses on patient rights and responsibilities in a government - supported health insurance program , and the third is drawn from an informed consent form for a surgical procedure .
every fifth to seventh word is removed from the text and indicated by a line ; under the line , several options , one of which is correct , are presented .
participants were tested according to the standard directions for the measure and were allowed 20 minutes to complete the reading comprehension questions .
their responses were categorized as right or wrong according to the test 's administration instructions .
general verbal ability was assessed using the verbal composite score of the woodcock - johnson psycho - educational battery .
this measure evaluates word knowledge , general information , and verbal reasoning in a series of tasks that yields a single score .
basic reading skills were assessed with the passage comprehension subtest of the woodcock - johnson battery .
this subtest uses items based on one or two sentences to evaluate a person 's ability to understand what is read .
working memory was assessed with the digit span backward subtest of the wechsler adult intelligence scale , 3rd edition .
participants completed individually - administered cognitive measures in a single session while completing a group of self - report measures in a second session .
sessions were randomized to minimize order effects ( i.e. , some participants completed self - report measures first and then cognitive measures , while other completed cognitive measures first ) .
the digit span test was administered first in the battery because of its simplicity ; it was judged as a good warm - up task compared to later measures that included the tofhla .
standard approaches to evaluate dif typically employ tests of group - based differences based on large - sample parametric statistics .
some experts suggest that the sample size for this type of analysis should be at least 1,000 and a simulation study showed that dif detection rates may be suboptimal even with a sample of 500 when comparison groups are unequal in size . as the available sample was substantially smaller than required for these techniques , an alternate approach to item assessment
age - related dif was assessed with the beta index provided in testgraf , a free nonparametric irt program .
testgraf produces item characteristic curves which provide a graphic representation of the probability of individuals in different groups obtaining a correct score on an item in relation to their overall ability . if dif is not present , the curves for each group should be congruent or nearly so , but if dif is present , the two curves will diverge ( see figure 2 ) .
the beta index is a numeric representation of the area between item response curves for two groups .
cutoff scores for the beta index to identify dif for small sample sizes have been provided in a simulation study by zumbo and witarsa , who also showed that standard approaches such as the mantel - haenszel chi - square test have inadequate power to reliably detect dif in small samples .
the free software package jmetrik ( http://www.itemanalysis.com/ ) was used to calculate item difficulties , standard deviations , and discriminations ( defined as the correlation of each item with the total scale score ) .
the sample was divided into two groups based on age less than or greater than or equal to 65 years .
age 65 was used for comparison as it has most often been used in research on age - related cognitive abilities and is linked to both age - related changes in working memory and reports of older individuals ' lower levels of health literacy [ 3 , 13 ] .
items that exceeded the critical value of beta for the available sample size , thus indicating at a probability of less than 0.05 that dif was present , were tabulated . although we used a nonparametric strategy to evaluate age - related dif , our sample size was sufficient to allow us to assess the overall effect of dif on group scores with a standard parametric strategy , analysis of covariance ( ancova ) .
this strategy enabled us to correct for between - group differences in important covariates ( e.g. , education and reading skill ) while comparing group mean performances .
each group 's scores for all tofhla reading items and the corrected total with dif - related items removed were calculated and compared in analyses that controlled for general verbal ability and reading skills . the possibility that observed age group based differences resulted from older participants ' inability to complete all items of the tofhla was evaluated using chi - square analyses ; we followed up this assessment with a similar analysis of the relation educational achievement less than high school level and failure to complete the tofhla . as it was hypothesized that working memory would account for group differences on items , its effect on between - group differences
was also evaluated using another parametric strategy by assessing its relation to performance on the dif - related items in both age groups in regression analyses . as the focus of these analyses was on the possibility that items using the cloze procedure were differentially more difficult for individuals aged 65 and older , tofhla numeracy items were not included as they do not utilize the cloze procedure .
all study procedures were completed under a protocol approved by the nova southeastern university institutional review board .
it should also be noted that each of group 's scores on the tofhla reading is similar , in spite of previous reports of significantly lower performance among older individuals .
this fact can be attributed to the overall higher levels of education and basic reading skill in the older group , an issue that we addressed in group comparisons ( reported below ) by taking these factors into account in analysis of covariance ( ancova ) models .
item difficulties ( percent answering correctly ) , discriminations ( item - total correlations ) , and dif analyses ( beta values representing the area between item response curves for age groups ) are presented in table 2 .
items with beta values greater than the p < 0.05 cut point of 0.0421 are in bold font .
eleven of the 50 items ( 22% of the total ) showed evidence of age - related dif .
an example of a nonparametric item characteristic curve for an item with dif ( item 41 in tofhla paragraph c ) is presented in figure 2 .
the figure includes item curves for younger and older individuals ; each curve shows the probability of a participant answering the item correctly ( left axis , ranging from 0 to 1 ) in relation to his or her overall ability .
as figure 2 shows , older individuals have a lower probability of answering this item correctly even when their total score was the same as a younger person 's total score .
older individuals would thus have lower overall scores on the tofhla as a result of age - related dif on these 11 items .
table 3 presents regression models assessing factors related to performance on the sum of the dif - related items for younger and older participants . for younger individuals , general verbal ability , reading skills , and years of education
the addition of working memory to the model ( model 2 ) did not significantly improve its relation to performance on the items ( change in r = 0.01 , f ( 1,149 ) = 1.86 , p = 0.18 ) .
for individuals 65 or older , reading skills and education , but not general verbal ability , were related to performance on the dif items .
the addition of working memory ( model 2 ) resulted in a significant improvement in the model 's relation to performance on the dif items ( change in r = 0.04 , f ( 1,57 ) = 5.82 , p = 0.02 ) .
these results suggest that while working memory may not have been an important determinant of performance on the dif - related items for younger individuals , it was significant for older participants .
we evaluated the possibility that between - group differences on the tofhla resulted from older individuals not completing the test , as the standard directions for the tofhla reading section specify a time limit for its completion .
nineteen participants did not finish the tofhla because of the time limit , 14 in the younger and 5 in the older groups .
we assessed the relation of not completing the tofhla to age group and level of education ( having completed high school compared to less than high school education ) via chi - square analyses .
the relation between age group and not completing the tofhla was not statistically significant ( ( df = 1 ) = 0.09 , p = 0.77 ) , but the relation between less than high school educational attainment was ( ( df = 1 ) = 4.46 , p = 0.04 ) .
finally , the impact of dif on overall performance on the tofhla reading scale was evaluated by testing between - group differences on the tofhla scores with and without the dif items .
differences were evaluated in ancova models that included general verbal ability , reading skill , and education as covariates .
there was a significant difference between older and younger participants for the score on all 50 reading items ( mean score for younger = 46.5 ; mean for older 43.8 for a mean difference of 2.4 points ; f ( 1,231 ) = 17.26 , p < 0.001 ) .
this difference was no longer significant after removal of the 11 items with dif ( mean score for younger = 39.6 ; mean for older 39.0 for a mean difference of 0.6 points ; f ( 1,206 ) = 2.62 , p = 0.11 ) .
these results thus suggest that a portion of age - related differences on the tofhla reading scale resulted from the older group 's performance on dif - related items .
these results confirm a previous report of age - related dif in a potentially clinically relevant number of items of the tofhla reading scale and extend this finding by investigating the extent to which working memory may be a factor in age - related dif and testing its impact on age - related differences in tofhla scores .
more than 20% of tofhla reading items showed age - related dif ; seven of these 11 items also were found to display age - related dif in a previous study with hiv - infected patients younger or older than 50 years of age . in the present study , working memory as measured by digit span backwards was significantly related to older participants ' performance on these items not to that of younger participants .
further , when the 11 dif - related items were removed from the total tofhla reading score , a significant age group difference was no longer present .
since working memory declines with age , an implication is that at least a portion of reported age differences in health literacy , at least for studies that used the tofhla , may be the result of its reliance on the cloze procedure that is related to working memory rather than health literacy itself .
the finding of age differences on some health literacy measures while not on others also raises an important issue about how health literacy should be operationally defined .
suggest that health literacy should be defined as a combination of basic cognitive abilities , reading skills , and health knowledge . within this framework ,
our findings can be interpreted as showing that working memory may be a more important aspect of health literacy for older than younger individuals . to the extent that working memory is integral to health literacy
, individuals 65 and older can be said to have lower levels of health literacy . when health literacy is defined as the ability to read health - related words aloud , however , ( as in the realm ) it appears likely that older individuals may not be at a disadvantage .
another study also showed that specific cognitive abilities may have a differential impact on s - tofhla performance , similar to the finding reported here .
this finding may also reflect the fact that sight word recognition skills such as those assessed in the realm are often considered resistant to age - related change [ 42 , 43 ] .
the definition of health literacy most commonly used inherently assumes that a patient has necessary basic cognitive abilities and academic skills ; these findings emphasize the importance of explicitly recognizing their impact on performance on health literacy measures .
a further study is needed to determine which approach to defining and measuring health literacy has the greatest usefulness
. limitations of these analyses include the relatively small sample size used to assess dif in the tofhla .
as discussed above , traditional approaches to assessing dif may require much larger samples and the approach used in these analyses ( nonparametric irt ) is less well established .
the selection of working memory as a possible mechanism for observed age - related dif , while supported by previous work on the cloze procedure and cognitive aging , neglects the possibility that some other factors not included in analyses may have been responsible for observed differences in item functioning among older individuals .
still another possibility is that older participants might have become more easily fatigued during assessment activities , thus affecting their responses on the tofhla .
since our finding of dif was not consistent across all items of the tofhla , however , this possibility appears unlikely .
our participants completed the study in two sessions , randomized to reduce the possibility of order effects .
since order of administration of the test battery was randomized between mornings and afternoons , we believe that fatigue is an unlikely explanation for the finding of dif , although it must be acknowledged that the majority of the items that show dif are in the last third of the test .
the finding of age - related dif on the tofhla reading items raises the question as well of alternative explanations for the finding .
it is possible , for example , that the content of sections b and c of the tofhla reading scale is less familiar to older compared to younger individuals .
we thus acknowledge that other explanations , either instead of or in addition , to age - related cognition might account for these findings .
another important issue that is raised by these findings is the question of why older individuals perform more poorly on other health literacy tests that do not use the cloze procedure .
a study discussed above with the newest vital sign , or nvs , found age differences in performance on it but not on the realm . in the nvs
, individuals ' health literacy is assessed through their ability to respond to a series of questions about a nutrition label .
perhaps the largest study of health literacy ever done , the national assessment of adult literacy , included items assessing health literacy and found that it was significantly lower in participants 65 and older .
one possible explanation for these findings also involves the response format of these measures , all of which require verbal fluency and executive functions in addition to reading and health knowledge for responding correctly .
in contrast to the realm , the nvs and naal surveys require the person assessed to produce a new verbal response to questions ( compared to the realm which only requires reading words aloud , a skill that is often highly practiced among older individuals ) .
since verbal fluency and executive functions , like working memory , may decline with age , it can be speculated that findings of age - related decrements on these measures may also reflect at least in part their response formats . in this connection it is also worth noting that others have reported that executive functions are related to performance on the s - tofhla [ 46 , 47 ] .
it is thus possible that age - related cognitive changes in addition to working memory may have an impact on older individuals ' performance on these measures .
it will thus be important to further evaluate the cognitive abilities related to health literacy in individuals across age groups in order to better understand what health literacy tests actually measure .
investigations in this area might also inform efforts to create age - appropriate health education materials for older individuals .
for example , cognitive load theory [ 48 , 49 ] would dictate that taking older individuals ' level of working memory into account would be important in the design of instructional materials .
these finding have implications for the assessment of health literacy not only in english but also in other languages .
the cloze procedure , for example , has been used to assess reading comprehension in languages other than english , such as japanese , and there is considerable interest in measuring health literacy in countries outside north america , for example , sorensen et al . .
these findings may thus be relevant for the assessment of health literacy in languages other than english .
an additional practice implication is that it may be more appropriate to use measures less sensitive to cognitive aging when evaluating health literacy in individuals 65 and older , especially as other analyses have shown that performance on the tofhla is closely related to cognitive abilities that show age - related cognitive decline , such as fluid cognitive abilities like nonverbal reasoning . in this study ,
the realm was shown to be less dependent on general cognitive abilities and more closely related to reading and health knowledge .
this suggests that the realm may be a better tool than the tofhla for assessing the skills needed to understand health - related material . a new measure of health literacy , flight / vidas ( developed as part of the study reported here ) ,
was created to explicitly exclude items that showed age - related dif during initial development and testing .
several other approaches are available that allow for an approximation of older individuals ' health literacy while not requiring the same cognitive skills as does the tofhla .
the brief health literacy screen allows an assessment of a person 's health literacy skills by self - report ; the individual to be assessed is asked about the degree of difficulty he or she experiences with several forms of written health information . while this approach has the advantage of providing an estimate of an individual 's subjective perception of his or her health literacy , it is not a direct assessment of an individual 's performance with health - related materials and does not take into account factors beyond health literacy that might affect a patient 's self - report .
it should be noted that the correlation between standard measures of health literacy and the brief health literacy screen questions is substantially smaller than that between direct assessments of health literacy [ 31 , 54 ] .
the demographic assessment for health literacy provides an estimate of a person 's score on the short version of the tofhla based on his or her demographic characteristics .
this measure 's regression - based approach may be useful in large group analyses ( as was intended by its developers ) but it is not a direct individual assessment of a person 's performance
. it may be reasonable to conclude , as have others , that it is important to consider cognitive task demands and purpose when selecting a health literacy measure .
these results thus further support others ' observations of the variable relations of common measures of health literacy with age and the importance of specific cognitive abilities for performance on measures of health literacy .
given the evidence of age - related dif on a substantial number of items in the reading comprehension subtest of the tofhla , it may be incorrect to interpret findings from it alone as proof that older individuals have lower levels of health literacy .
the tofhla and any measure using the cloze procedure to assess comprehension should be used cautiously in older individuals ; the realm or flight / vidas may be more appropriate . | health literacy has received increasing attention because of its importance for older individuals ' health , as studies have shown a close relation between older individuals ' health literacy and their health .
research also suggests that older individuals have low levels of health literacy , but this finding is variable and may depend on which health literacy test is used .
older individuals assessed with the test of functional health literacy ( tofhla ) score lower than younger individuals , but a previous study suggested that this may result from age - related differential item functioning ( dif ) on the tofhla .
the study reported here assessed age - related dif in a sample of community - dwelling volunteers .
twenty - two percent of items were differentially more difficult for older individuals independent of their overall ability , and when these items were eliminated from the total score , age differences were no longer found .
performance on a working memory task predicted older but not younger individuals ' performance on the age - related items .
at least part of older individuals ' apparent deficits in health literacy when assessed by the tofhla may be related to dif on its items .
the tofhla , and any measure that employs the cloze procedure to evaluate reading comprehension , should be used cautiously in older individuals . |
dentures as an indwelling medical device in an individual s mouth , prepare an optimal environment for adhesion and colonization of both pathogenic and non - pathogenic organisms , and can cause inflammatory lesion of the oral mucosa ( 1 ) .
denture stomatitis known as a chronic inflammatory condition of the palatal and alveolar mucosa underlying removable dental prostheses is seen in 15% to 65% of individuals ( 2 ) and is even more significant in the institutionalized denture wearing population with a rate of up to 72% ( 3 , 4 )
. however denture stomatitis is usually asymptomatic and can be associated with burning , bleeding and unpleasant taste in denture users ( 5 ) .
candida species , particularly c. albicans , which are a part of the human oral microbiota , have been reported as the main etiological agents responsible for the development of this inflammatory infection ( 6 ) .
adherence of c. albicansto the host mucosal tissues ( 7 ) and also on the acrylic denture surfaces prepares reservoirs that produce proteolytic enzymes and damage mucosal tissues resulting in denture stomatitis ( 8) .
in addition to candida , most cariogenic bacteria especially streptococcus mutants are also known as major etiological agents of dental caries , which adhere and accumulate on teeth surfaces , lead to plaque formation ( 9 ) .
it is believed that the attachment between microorganisms and the denture surface is due to electrostatic and hydrophobic interactions .
poor oral hygiene in patients with denture especially in case of badly fitted dentures promotes denture stomatitis .
regular cleaning and removal of microbial biofilm from denture surfaces is necessary for prevention and control of denture stomatitis in edentulous patients ( 10 ) .
there are numerous investigations in the dentistry literature advising the use of chemical solutions for denture disinfection ( 11 - 13 ) ; unfortunately these products cause mucosal allergic reactions , damage the acrylic resin and metal alloys of the dentures ( 14 , 15 ) .
the use of natural antimicrobials such as herbal mouthwashes has been recently increased as investigations have indicated their potential to prevent oral diseases such as plaque - related diseases , particularly dental caries ( 16 - 18 ) .
natural substances have been shown to possess antibacterial action mainly because most plants used in alternative medicine are composed of carvacrol and thymol , which act on bacterial cells disrupting their cytoplasmatic membrane and inhibiting their enzymatic activity ( 19 , 20 ) .
the specie zataria multiflora ( zm ) with the persian name of avishane shirazi , has been used in traditional medicine for treatment of respiratory tract infections and managing irritable bowel syndrome ( 21 ) , and as an antispasmodic , anesthetic , antinociceptive agent ( 22 , 23 ) .
more recently its antibacterial and antifungal activities have also been demonstrated ( 19 , 24 , 25 ) .
the antifungal activity of zataria multiflora essence against several dermatophytes such as trichophyton rubrum , trichophyton mentagrophytes , epidermophyton floccosum and saprophytes like aspergillus flavus was reported by effatpanah et al .
the purpose of the present study was to evaluate the antimicrobial effect of zataria multiflora essence on experimentally produced c. albicans biofilms on resin acryl plates .
this study was conducted to evaluate the antifungal effect zataria multiflora essence in removing candida albicans biofilm from experimentally contaminated resin acryl plates .
in order to reach a minimum of six unit difference in the average candida colony counts between tested groups , a significance level of 5% , = 5% , = 2% , s = 80% and based on the following formula , 20 samples were chosen for each test and control groups . in the present experimental study , 160
square shaped ( 10 10 1 mm ) resin acrylic plates ( acropars , marlic , iran ) were prepared ( 20 samples for each group ) using thermally activated resin acrylic according to the manufacturer s instructions ( figure 1 ) .
the specimens were kept in a flask containing physiological serum ( nacl 0.85% ) , sterilized in an autoclave ( labtron , iran ) at 121c for 15 minutes ( was calibrated based on manufactured instruction ) and incubated at 4c for further adherence testing .
clinical isolates of c. albicans ( atcc 10231 ) , cultured on sabouraud dextrose agar plates ( merck , germany ) and incubated at 37c for 24 hours , were used as test organisms for the current experimental study .
an isolated fresh single colony was used for preparing candida suspensions containing 1 10 viable cells per milliliter in sterile saline solution ( nacl 0.85% ) using a hemocytometer .
the experimental biofilm was created by immersing all acrylic resin plates in c. albicans suspension and incubating on a reciprocal shaker ( 100 rpm ) at 37c for 24 hours .
twenty resin plates were randomly selected , washed three times with sterile pbs , and transferred separately to a 50 ml sterile falcon tube containing 5 ml of sterile pbs and glass pearls ; the tubes were then agitated in a sonicator ( elma , germany ) for five minutes ( 45 kh/5 minutes ) to remove viable attached cells .
next , 10 l of each suspension was added to 90 l of sterile physiological solution and inoculated on sabouraud dextrose agar ( merck , germany ) plates to evaluate attached viable cells before initiation of the disinfection protocol as a variable in the present study .
each group of plates were separately immersed in zataria essence dilutions of 50 to 3.125 mg / ml ( baridge - essence , kashan , iran ) and 100000 iu nystatin solutions ( gold standard ) as test groups , as well as sterile physiologic solution ( nacl 0.85% ) as the negative control group , in sterile falcon tubes .
all falcon tubes were incubated on a reciprocal shaker ( 100 rpm ) at 37c for two hours , washed three times as explained previously .
each single resin plate from all groups were then transferred to another sterile falcon tube containing 5 ml of sterile pbs and glass pearls , agitated in a sonicator ( elma , germany ) for five minutes ( 45 kh/5 minutes calibrated based on the manufactured instructions ) to remove the adhered viable candida cells .
finally , 10 l of each washed solution was mixed with 90 l of sterile physiological solution and inoculated on sabouraud dextrose agar plates in order to enumerate the attached viable candida cells after the disinfection procedures .
the mean isolated candida colonies ( cfu / ml ) showed mean attached viable candida cells in the seven groups , which were compared using the kruskal - wallis test .
wilcoxon statistical test was also used to compare the average counts of isolated candida colonies before and after disinfection .
differences in the candida removing ability of the tested solutions were considered significant if p < 0.05 .
in order to reach a minimum of six unit difference in the average candida colony counts between tested groups , a significance level of 5% , = 5% , = 2% , s = 80% and based on the following formula , 20 samples were chosen for each test and control groups .
in the present experimental study , 160 square shaped ( 10 10 1 mm ) resin acrylic plates ( acropars , marlic , iran ) were prepared ( 20 samples for each group ) using thermally activated resin acrylic according to the manufacturer s instructions ( figure 1 ) .
the specimens were kept in a flask containing physiological serum ( nacl 0.85% ) , sterilized in an autoclave ( labtron , iran ) at 121c for 15 minutes ( was calibrated based on manufactured instruction ) and incubated at 4c for further adherence testing .
clinical isolates of c. albicans ( atcc 10231 ) , cultured on sabouraud dextrose agar plates ( merck , germany ) and incubated at 37c for 24 hours , were used as test organisms for the current experimental study .
an isolated fresh single colony was used for preparing candida suspensions containing 1 10 viable cells per milliliter in sterile saline solution ( nacl 0.85% ) using a hemocytometer .
the experimental biofilm was created by immersing all acrylic resin plates in c. albicans suspension and incubating on a reciprocal shaker ( 100 rpm ) at 37c for 24 hours .
twenty resin plates were randomly selected , washed three times with sterile pbs , and transferred separately to a 50 ml sterile falcon tube containing 5 ml of sterile pbs and glass pearls ; the tubes were then agitated in a sonicator ( elma , germany ) for five minutes ( 45 kh/5 minutes ) to remove viable attached cells .
next , 10 l of each suspension was added to 90 l of sterile physiological solution and inoculated on sabouraud dextrose agar ( merck , germany ) plates to evaluate attached viable cells before initiation of the disinfection protocol as a variable in the present study .
each group of plates were separately immersed in zataria essence dilutions of 50 to 3.125 mg / ml ( baridge - essence , kashan , iran ) and 100000 iu nystatin solutions ( gold standard ) as test groups , as well as sterile physiologic solution ( nacl 0.85% ) as the negative control group , in sterile falcon tubes .
all falcon tubes were incubated on a reciprocal shaker ( 100 rpm ) at 37c for two hours , washed three times as explained previously .
each single resin plate from all groups were then transferred to another sterile falcon tube containing 5 ml of sterile pbs and glass pearls , agitated in a sonicator ( elma , germany ) for five minutes ( 45 kh/5 minutes calibrated based on the manufactured instructions ) to remove the adhered viable candida cells .
finally , 10 l of each washed solution was mixed with 90 l of sterile physiological solution and inoculated on sabouraud dextrose agar plates in order to enumerate the attached viable candida cells after the disinfection procedures .
the mean isolated candida colonies ( cfu / ml ) showed mean attached viable candida cells in the seven groups , which were compared using the kruskal - wallis test .
wilcoxon statistical test was also used to compare the average counts of isolated candida colonies before and after disinfection .
differences in the candida removing ability of the tested solutions were considered significant if p < 0.05 .
the average number of viable c. albicans cells ( cfu / ml sd ) , which adhered to the acrylic resin plates before and after disinfection , as well as the removing percentage are illustrated in table 1 .
zataria essence solutions at concentrations of 50 and 25 mg / ml as well as 100000 iu nystatin completely removed all adhered candida cells from resin acryl plates as there were no isolated c. albicans colonies in the culture of their washing solutions .
concentration of 25 mg / ml of zataria essence was determined as the minimum fungicidal concentration ( mfc ) in the present study .
concentration of 12.5 mg / ml of zataria essence removed about 90% of attached candida viable cells and
this concentration was considered as the minimum inhibitory concentration ( mic90 ) in the present study ( table 2 ) .
there was no statistically significant difference between the average candida colonies isolated from cultures of resin acryl plates incubated with 50 and 25 mg / ml zataria , and 100000 nystatin solutions ( p = 0.00001 ) .
abbreviation : mfc , minimum fungicidal concentrations ; mic , minimum inhibitory concentration , candida viable cells .
there are different chemical mouth washes , which are commonly used for controlling various plaque formations on teeth and dentures ; they may cause an allergic response and probable mucosal alterations ( 27 ) .
there are many reports that discourage patients to use these mouthwashes as a result of their several side effects such as undesirable tooth and denture discoloration , unpleasant taste , dryness and burning sensation in the mouth ( 14 , 28 ) .
however in the general worldwide population , herbal medicines are popular , many modern medicines are still derived from herbs ( 29 ) .
zataria multiflora , which grows naturally in central and southern parts of iran , is used in traditional herbal medicines for its antiseptic , analgesic and carminative properties ( 22 , 30 ) .
the antimicrobial activity of z. multiflora essence against c. albicans on experimentally contaminated acryl resin plates was evaluated in the present study .
a standard broth macrodilution method introduced by the clinical and laboratory standard institute ( clsi ) was employed in the current study ( 31 ) . as indicated in table 1 , concentrations of 50 and 25 mg / ml of zataria essence completely cleaned contaminated acryl resin plates ( 100% ) since there were no viable candida cells , in the culture of their washing solution .
concentration of 25 mg / ml of zataria essence was also determined as the minimum fungicidal concentration ( mfc ) in the present study .
results of the current study was supported by the study of zia et al.which showed the anti - candida properties of zataria extract against c. albicans isolated from patients with oral candidiasis ( 32 ) .
akbari also reported antifungal ranges of 0.5 to 125 mg / ml for aqueous extracts of zataria against different candida species ( 33 ) .
this wide range of effective zataria concentrations in akbari s study unlike the outcome of present study may results from difference in methods , as they used disk diffusion , whereas the broth dilution method was used in the current study .
mahmoudabadi et al . in an in vitro study for anti - candida activity of methanolic z. multiflora boiss reported the concentration of 70.7 mg / ml as the mic , which is more than the mic of the present study ( 24 ) .
different chemical compounds including thymol , carvacrol , p - cymene and linalool were isolated from the aerial parts of this plant ( 28 , 34 ) and the anti - candida activity of aqueous essence of z. multiflora on contaminated resin acryl is probably due to the above - mentioned essential oils .
anti - erythema effect of z. multiflora essence in comparison with miconazole gel in denture stomatitis was reported by amanlou et al .
however in their study z. multiflora extracts did not reduce the colony count of candida albicans on denture surface as efficiently as miconazole ; concentrations of 50 and 12.5 mg / ml of zataria essence in the current study showed reduction in the colony counts of c. albicans on resin acryl plates as efficiently as nystatin . besides antifungal effects ,
asignificant antibacterial efficiency for z. multiflora essential oils against clinical isolates of s. aureus , especially mrsa was also reported ( 25 ) .
antiviral activity of z. multiflora extracts was also reported against herpes simplex type 1 virus at concentrations of 800 and 1000 g / ml by arabzadeh et al .
since z. multiflora increased ifn- , decreased il-4 , and enhanced the ratio of ifn- to il-4 ( th1/th2 balance ) , it may have a therapeutic value in inflammatory responses such as allergies , autoimmunity and infectious diseases associated with th1/th2 imbalance ( 36 ) .
the immunomodulatory activity of the z. multiflora on dendritic cells and t cell responses was also shown , which resulted from decreasing proliferation of mitogen - stimulated lymphocytes ( 37 ) . in the present in vitro study ,
concentrations of 50 and 25 mg / ml of zataria essence effectively removed candida cells from experimentally contaminated resin acryl plates as efficiently as 100000 iu nystatin . | background : adherence and colonization of candida species particularly c. albicans on denture surfaces , forms a microbial biofilm , which may result denture stomatitis in complete denture users.objectives:the purpose of the present study was to evaluate the antifungal effect zataria multiflora essence in removing of candida albicans biofilms on experimentally contaminated resin acryl plates.materials and methods : in the present experimental study , 160 resin acrylic plates ( 10 10 1 mm ) were contaminated by immersion in 1 103 c. albicans suspension for 24 hours to prepare experimental candida biofilms .
the total number of candida cells , which adhered to 20 randomly selected acryl resin plates was determined as the candia load before cleaning .
the remaining 140 plates were divided to seven groups of 20 and immersed in five concentrations of zataria multiflora essence from 50 to 3.125 mg / ml as test , 100000 iu nystatin as the positive and sterile physiologic serum as the negative control .
the remaining candida cells on each acryl plate were also enumerated and data were analyzed using the spss 16 software with kruskal - wallis and wilcoxon tests.results:zataria essence at concentrations of 50 and 25 mg / ml removed 100% of attached candida cells similar to nystatine ( mfc ) , while weaker zataria essence solutions cleaned 88% , 60.5% and 44.7% of attached candida cells .
kruskal - wallis test showed a statistically significant difference between all test groups ( p = 0.0001 ) . in this study 12.5 mg / ml concentration of zataria multiflora
was considered as the minimum inhibitory concentration ( mic90).conclusions : zataria essence , at concentrations of 50 and 25 mg / ml , effectively removed candida cells that had adhered to the denture surface , similar to the level of removal observed for 100000 iu nystatin . |
the importance of the morphological properties of materials can be evidenced by the large number of publications on their synthesis .
the development of new synthesis methods may lead to materials , such as catalysts , with superior performance .
it is interesting to produce materials with nanometric - scale structures to obtain specific properties .
this oxide has been used in a large range of technological applications , including sensors , catalysts , and electrocatalytic materials .
it is well known that semiconductor oxides , such as sno2 , have an excellent potential for these applications due to their high capacity to adsorb gaseous molecules and promote their reactions [ 1 - 8 ] .
we recently showed that the modification of the nanometric - scale structure and the composition of particles led to interesting selectivity changes for the methanol decomposition and aldolization reaction between acetone and methanol [ 2 - 4 ] .
however , the influence of the nature of the active sites ( the surface basicity of the oxide ) on the performance of the catalysts was not totally investigated .
the study of basicity , in more sensitive reactions , is very important as a source of information on the different kinds of active sites . in order to investigate the catalytic properties of the tin oxide samples prepared
this reaction is promoted not only by basic sites but also by acidic sites of the oxide catalysts .
thus , it may be suggested that the control of surfaces and modifications of the nanostructures of the tin oxide particles , undoped and doped with rare earths used as catalysts in this reaction , can be used to obtain additional information on the catalytic properties and application of these nanostructured materials .
nowadays , this process has gained increasing attention due to the possibility of obtaining hydrogen for fuel cell applications , as well as ethylene which is considered a valuable raw material in the polymeric industry [ 9 - 11 ] .
this method is based on the chelation of cations ( metals ) by citric acid , in aqueous solution containing tin citrate , in the present case .
the aqueous tin citrate solution was prepared from sncl2 h2o ( mallinckrodt baker , usa , purity > 99.9% ) and citric acid ( merck , germany , purity > 99.9% ) with a citric acid : metal molar ratio of 3:1 . for the synthesis of the rare earth - doped sno2samples ,
an aqueous solution of a rare earth citrate was prepared from a rare earth nitrate ( y and ce - nitrates , alfa aesar , usa , purity > 99.9% ) and citric acid with a citric acid : metal molar ratio of 3:1 .
the aqueous rare earth citrate solution was added to the aqueous tin citrate solution in the appropriate amount to obtain a doping level of 5 mol% in all cases .
ethylene glycol was then added to the citrate solutions , at a mass ratio of 40:60 in relation to citric acid , to promote the polymerization reaction .
after several hours of polymerization at approximately 100 c , the polymeric precursors were heat - treated in two steps , initially at 300 c for 6 h in air to promote the pre - pyrolysis , and then at several temperatures ( 5501,100 c ) for 2 h , also in air , to allow the organic material to be completely oxidized and to promote the crystallization of the sno2phase .
the specific surface area of the samples was determined by n2adsorption / desorption isotherms ( bet method ) at liquid nitrogen temperature in an quantachrome autosorb-1c instrument .
the amount of irreversible co2uptake was obtained from the difference between the total adsorption of co2on the catalyst and a second adsorption series of co2determined after evacuation of the catalyst sample for 20 min .
x - ray diffraction ( xrd ; siemens , d5000 , equipped with graphite monochromator and cu k radiation ) was used for the crystal phase determination .
the x - ray photoelectron spectra were taken using a commercial vg esca 3000 system .
the spectra were collected using mg k radiation and the overall energy resolution was around 0.8 ev .
the concentration of the surface elements was calculated using the system database after subtracting the background counts .
catalytic performance tests were conducted at atmospheric pressure with a quartz fixed - bed reactor ( inner diameter 12 mm ) fitted in a programmable oven , at a temperature of 500 c .
the catalysts ( undoped sno2sample calcined at 1,000 c , sn#1000 , y - doped sno2samples calcined at 550 and 1,000 c , sny#550 and sny#1000 , respectively , and ce - doped sno2samples calcined at 550 and 1,000 c , snce#550 and snce#1000 , respectively ) were previously treated in situ under nitrogen atmosphere at 500 c for 2 h. the water : ethanol mixture ( molar ratio 3:1 ) was pumped into a heated chamber and vaporized . the water ethanol gas ( n2 ) stream ( 30 ml / min ) was then fed to the reactor containing 150 mg of the catalyst .
the reactants and the composition of the reactor effluent were analyzed with a gas chromatograph ( shimadzu gc 8a ) , equipped with a thermal conductivity detector ( tcd ) , porapak - q , and a 5a molecular sieve column with ar as the carrier gas .
this method is based on the chelation of cations ( metals ) by citric acid , in aqueous solution containing tin citrate , in the present case .
the aqueous tin citrate solution was prepared from sncl2 h2o ( mallinckrodt baker , usa , purity > 99.9% ) and citric acid ( merck , germany , purity > 99.9% ) with a citric acid : metal molar ratio of 3:1 . for the synthesis of the rare earth - doped sno2samples ,
an aqueous solution of a rare earth citrate was prepared from a rare earth nitrate ( y and ce - nitrates , alfa aesar , usa , purity > 99.9% ) and citric acid with a citric acid : metal molar ratio of 3:1 .
the aqueous rare earth citrate solution was added to the aqueous tin citrate solution in the appropriate amount to obtain a doping level of 5 mol% in all cases .
ethylene glycol was then added to the citrate solutions , at a mass ratio of 40:60 in relation to citric acid , to promote the polymerization reaction .
after several hours of polymerization at approximately 100 c , the polymeric precursors were heat - treated in two steps , initially at 300 c for 6 h in air to promote the pre - pyrolysis , and then at several temperatures ( 5501,100 c ) for 2 h , also in air , to allow the organic material to be completely oxidized and to promote the crystallization of the sno2phase .
the specific surface area of the samples was determined by n2adsorption / desorption isotherms ( bet method ) at liquid nitrogen temperature in an quantachrome autosorb-1c instrument .
the amount of irreversible co2uptake was obtained from the difference between the total adsorption of co2on the catalyst and a second adsorption series of co2determined after evacuation of the catalyst sample for 20 min .
x - ray diffraction ( xrd ; siemens , d5000 , equipped with graphite monochromator and cu k radiation ) was used for the crystal phase determination .
the x - ray photoelectron spectra were taken using a commercial vg esca 3000 system .
the spectra were collected using mg k radiation and the overall energy resolution was around 0.8 ev .
the concentration of the surface elements was calculated using the system database after subtracting the background counts .
catalytic performance tests were conducted at atmospheric pressure with a quartz fixed - bed reactor ( inner diameter 12 mm ) fitted in a programmable oven , at a temperature of 500 c .
the catalysts ( undoped sno2sample calcined at 1,000 c , sn#1000 , y - doped sno2samples calcined at 550 and 1,000 c , sny#550 and sny#1000 , respectively , and ce - doped sno2samples calcined at 550 and 1,000 c , snce#550 and snce#1000 , respectively ) were previously treated in situ under nitrogen atmosphere at 500 c for 2 h. the water : ethanol mixture ( molar ratio 3:1 ) was pumped into a heated chamber and vaporized . the water ethanol gas ( n2 ) stream ( 30 ml / min ) was then fed to the reactor containing 150 mg of the catalyst .
the reactants and the composition of the reactor effluent were analyzed with a gas chromatograph ( shimadzu gc 8a ) , equipped with a thermal conductivity detector ( tcd ) , porapak - q , and a 5a molecular sieve column with ar as the carrier gas .
the characterization of undoped and rare earth - doped tin oxide nanoparticles has been previously reported .
figure 1 illustrates the xrd patterns of the phase evolution of the undoped and doped ( ce and y ) sno2 particles annealed at different temperatures .
diffraction peaks related to a secondary phase formation ( sn2y2o7 ) for y - doped sno2 were observed above a 900 c heat - treating temperature . a secondary phase formation was also observed for ce - doped sno2 samples ; however , the ceo2 phase was detected at an annealing temperature of 1,100 c .
on the other hand , for the samples annealed at temperatures lower than this , only the tetragonal sno2 phase was observed , suggesting the formation of a solid solution for the different dopants .
the heat treatment promotes a segregation process , resulting in a surface with a different chemical composition .
the x - ray diffraction patterns , associated with the rietveld refinement method , were used to determine the crystallite size of the tin oxide samples ( table 1 ) , where it can be seen that the doping effect on the stability in terms of particle growth at high temperatures was remarkable .
the results observed in the xrd analysis , secondary phase formations ( sn2y2o7 and ceo2 ) depending on the annealing temperature , suggest that a de - mixing process occurs at higher temperatures . in order to obtain more information on this de - mixing process
figure 2a and b shows the x - ray photoemission spectroscopy results ( [ rare earth]/[sn ] ratio ) for the y- and ce - doped sno2 samples subjected to different thermal treatment temperatures .
there is a general tendency for the concentration of y on the surface of the samples to increase with an increase in annealing temperature . both y - doped samples , shown in fig .
2a , present the 3d y profile , indicating the presence of a secondary phase ( sn2y2o7 ) , which was detected in the xrd measurements .
the results for the ce - doped sno2 reveal a thermal behavior differing from that of the y - doped samples .
the [ ce]/[sn ] concentration increases up to 900 c , after which it decreases considerably as the annealing temperature rises .
this behavior agrees with the shape of the ce xps pattern suggesting a non - homogenous covering of ceo2 on the surface of the ce - sno2 particles , in contrast to the homogenous covering of rare earth stanate observed in the y - doped sno2 .
it is clear , from the xps results , that a surface rich in foreign cations is formed during the heat treatment .
the de - mixing process observed for the y - doped sno2 differs from that of ce - doped sno2 .
these results are in agreement with the xrd data and show the formation of stanate during heat treatments . as mentioned above , the heat treatment promotes a segregation process , resulting in a surface with different chemical compositions . for the y - doped sno2 samples
the ratio between [ y ] and [ sn ] increased with the heat treatment temperature , indicating that the dopant migrated toward the surface . on the other hand , the ratio between [ ce ] and [ sn ] decreased above 900 c , suggesting that the dopant was expelled from the matrix .
x - ray diffraction results showing the phase evolution of the undoped sno2 , ce - sno2and y - sno2 systems as a function of the heat - treatment temperature the xps results of [ rare earth]:[sn ] ratio for y- and ce - doped sno2 samples subjected to different treatment temperatures crystallite sizes measured by the rietveld refinement and specific surface areas determined by n2adsorption ( bet ) , as a function of the annealing temperature annealing temperature ( c ) in order to investigate the catalytic activity of the synthesized samples , the steam reforming of ethanol ( eq .
1 ) was carried out.(1 ) the effects of the process of segregation and de - mixing of these rare earths on the sno2 catalytic properties were studied and compared . in spite of the relatively low specific surface areas presented , the catalysts achieved significant ethanol conversion values at the beginning of the test .
the conversion of ethanol for the snce#550 catalyst was higher than for the sn#1000 catalyst , indicating the positive effect of rare earth doping . from the results in fig .
3 , it can be seen that hydrogen , ethylene and acetaldehyde were the only products detected during the ethanol steam reforming process . however , it is interesting to observe that the catalysts presented a distinct behavior in terms of product selectivity .
acetaldehyde was the major product formed , with lower amounts of hydrogen and ethylene , indicating that ethanol dehydrogenation and dehydration reactions ( eqs . 2 and 3 , respectively )
are promoted over the catalyst surfaces.(2)(3 ) catalytic performances of undoped and y- and ce - doped sno2 samples in the steam reforming of ethanol .
legends : = c2h5oh conversion ; = h2 ; = c2h4 ; = ch3cho selectivity , respectively according to the results , it can be seen that dehydration and dehydrogenation reactions are promoted over the undoped sno2 catalyst .
sno2 is known as an amphoterous oxide , with a slightly acid character ; thus , a combination of catalytic properties could be observed on the surface of this catalyst , indicating that this particular catalyst has a great ability for dehydration and dehydrogenation of ethanol .
nevertheless , the decrease in the production of ethylene over time , observed for the doped samples , may be indicative of a moderate modification of the material surface due to the doping with rare earths .
one of the most common ways to modify the characteristics of a material is by introducing dopants .
when introduced into a powder , they may follow different paths : diffuse into the bulk of the particle , form a new crystallographic structure or a solid solution , migrate to the surface ( surface additives ) , or nucleate a second phase .
previous studies have evaluated the effect of different dopants on the morphology and properties of tin oxide .
rare earth cations have , as yet , been little explored as tin oxide dopants for catalytic purposes . however , the consensus is that their influence on the catalytic properties of sno2 is associated with the acid / base characteristics of the oxides involved .
the surface modifications , due to doping process , change some macroscopic properties of the tin oxide , such as the isoelectric point .
the isoelectric point of the pure sno2 can be shifted to basic ph values due to the introduction of a basic surface oxide in the sno2 matrix .
thus , the basic characteristics of rare earth oxides may favor some catalytic aspects such as the presence of adsorbing centers [ 6,12 - 15 ] .
the reactions over snce#550 and sny#550 start with h2 , c2h4 , and ch3cho as the main products ; however , the selectivity toward c2h4 decreases with a concomitant ch3cho production as the reaction progresses .
the y - doped sno2 sample annealed at 1,000 c showed a similar catalytic behavior , in terms of product selectivities , comparatively to the ce- and y - doped sno2 samples annealed at 550 c . on the other hand ,
the snce#1000 catalyst presented a distinct behavior , displaying a higher value of selectivity toward c2h4 .
these reactions are more or less promoted depending on the nature of the catalyst , the type of interaction with the surface of the solid material , and the different reaction conditions .
ethylene and acetaldehyde seem to be primary products formed in the ethanol steam reforming , and the selectivity of this reaction can be influenced by the acidic basic properties on the catalyst surface .
ethanol dehydration into ethylene is essentially catalyzed by the acidic sites while basic sites are predominant in the ethanol dehydrogenation into acetaldehyde .
in addition , the strength of the acidic and basic sites is a determining factor in the reaction kinetics . with the aim of obtaining more information on the surface properties of the catalysts prepared ,
carbon dioxide was the probe molecule used to determine the basic properties of the catalysts .
the co2 adsorption isotherms are very sensitive to the presence of polar groups or ions on the surface of the solid .
it was evident that the co2 adsorption capacity of undoped sno2 samples can be significantly affected by the doping chemical species and by the annealing treatment .
in the samples treated at 550 c , it was observed that the total amount of co2 adsorbed ( at 27 c ) for the y - doped sno2 sample was around six times higher than that of the undoped sample .
it is observed that the increase in the annealing temperature leads to significant changes in the basic sites in sno2 .
it is important to point out the irreversible co2 adsorption uptake at 300 c for the undoped and y - doped sno2 samples .
these results suggest that a higher annealing temperature promotes an increase in the stronger basic sites .
on the other hand , for the ce - doped sno2 sample treated at 1,000 c , the isotherms taken at 300 c did not present an irreversible co2 adsorption . therefore , a basic oxide , such as yttrium oxide , introduced in the sno2 matrix promotes the basicity of the surface .
the lower ethylene selectivity observed on the doped catalysts ( snce#550 and sny#550 ) is in agreement with the increase in surface basicity detected in the co2 adsorption analysis , with respect to the undoped sno2 . with the rare earth doping and the increase in the annealing temperature of the sno2 samples to 1,000 c ,
another catalytic behavior was observed , probably as a result of the modification of the nanostructure and the basic sites of the particles .
another phenomenon starts to occur on the surface of doped samples , a segregation process of particles of metastable solid solution , promoted by the increase in the annealing temperature that may be related to the change in the catalytic behavior .
this may be associated with the high amount of secondary phases ( sn2y2o7 and ceo2 , respectively ) which are formed on the surface of sno2 samples , as the annealing temperature increases .
the y - doped sample annealed at 1,000 c exhibited a dopant - rich surface , with the formation of sn2y2o7 , as shown above .
as the annealing temperature increased , a surface area reduction took place , and the formation of a segregation layer increased the external foreign cation concentration and the stronger basic sites on the surface of the y - doped samples .
this may be directly associated with the specific characteristics of the catalytic process observed in these sno2 samples .
such behavior was not observed for the catalytic activity of the ce - doped sample annealed at 1,000 c .
the ceo2 de - mixing process did not seem to interfere with its catalytic properties , probably because ceo2 , which is segregated on the sno2 surface , is a known catalyst with redox properties used to promote oxidation reactions . the total and irreversible co2adsorption capacity , uptake at 27 and 300 c , of undoped and doped samples of tin oxide annealing temperature ( c ) isotherm temperature adsorption ( c )
the sno2-based nanoparticles were shown to be active catalysts for the ethanol steam reforming reaction .
the surface properties , such as surface area , basicity / base strength distribution , and catalytic activity / selectivity , were influenced by the rare earth doping of sno2and also by the annealing temperatures .
doping led to chemical and micro - structural variations at the surface of the sno2particles .
also , changes in the catalytic properties of the samples , such as selectivity toward ethylene , may be ascribed to different dopings and annealing temperatures .
this suggests a new pathway to produce catalysts by means of controlling their surface . a super - saturated solid solution yields a nanostructured metastable material that will undergo foreign cation segregation to the outer surface and then a de - mixing process .
this process can effectively be used to control the surface chemistry . in the present study ,
the effect of the different operational conditions , such as reaction temperature and water : ethanol molar ratio , on the catalytic behavior was not determined . however
, this study is under way , and it will be the subject of future reports .
| nanoparticles of tin oxide , doped with ce and y , were prepared using the polymeric precursor method .
the structural variations of the tin oxide nanoparticles were characterized by means of nitrogen physisorption , carbon dioxide chemisorption , x - ray diffraction , and x - ray photoelectron spectroscopy .
the synthesized samples , undoped and doped with the rare earths , were used to promote the ethanol steam reforming reaction .
the sno2-based nanoparticles were shown to be active catalysts for the ethanol steam reforming .
the surface properties , such as surface area , basicity / base strength distribution , and catalytic activity / selectivity , were influenced by the rare earth doping of sno2and also by the annealing temperatures .
doping led to chemical and micro - structural variations at the surface of the sno2particles .
changes in the catalytic properties of the samples , such as selectivity toward ethylene , may be ascribed to different dopings and annealing temperatures . |
the phosphorylation of specific protein residues is a crucial event in the regulation of several cellular processes , operating on activation , deactivation or recognition of the target protein .
a great deal of eukaryotic proteins ( 30% in the human genome ) undergo this reversible post - translational modification ( 1 ) .
phosphorylation on serine / threonine or tyrosine residues is accomplished by protein kinases ( pks ) , one of the largest protein families , comprising 1.52.5% of all eukaryotic genes ( 2 ) .
although the amount of data produced in various screening assays is steadily growing ( 36 ) , experimental identification of phosphoproteins and the determination of individual phosphorylation sites remains a difficult and time - consuming task .
hence , the implementation of computational tools proves to be very useful for collecting and analysing experimental data .
several sequence - based methods to predict phosphorylation sites were developed using different computational approaches such as regular expressions with context - based rules ( 7 ) , position - specific scoring matrices ( pssms ) ( 8) , artificial neural networks ( 9,10 ) , support vector machines ( svms ) ( 11,12 ) , hidden markov models ( 13 ) and iterative statistical methods ( 14 ) .
all these methods are based on the hypothesis that the sequence surrounding the phosphorylated residue represents the main determinant for kinase specificity .
however , the specificity determinants and rules remain elusive for a large number of protein kinases that display a number of substrates sharing little or no sequence similarity in the known phosphopeptides . we propose that
, at least in some cases , the rules of kinase specificity may reside in the presence of structural determinants which only occasionally overlap with sequence consensi and which might be independent of the residue order in protein sequences . here
it collects information retrieved from the phospho.elm database ( 15 ) and is enriched with structural information and diverse annotations at the residue level .
in addition , the database stores the results of a large - scale local structural comparison which suggest functional annotation of phosphorylation sites by 3d similarity . cases of significant structural similarity between phosphorylation sites may indicate that they are phosphorylated by the same kinase .
the phospho3d database was constructed by collecting data from the phospho.elm database which gathers experimentally verified phosphorylation sites manually extracted from the literature .
the phospho.elm dataset used in this work ( version 4.0 ) contains 5314 phosphorylation sites , or instances , belonging to 1805 different sequences .
the correspondence between phospho.elm sequences and the protein data bank ( pdb ) chains was established via the seq2struct resource ( 16 ) , an exhaustive collection of annotated links between swissprot - trembl and pdb sequences .
links are based on sequence alignment using pre - established highly reliable thresholds . from a list of 4530 sequence
structure links ( for further details see website documentation ) , only the ones having the phosphorylable residue in the alignment region were retained , this resulting in 2726 instances ( 166 unique phospho.elm instances on 1219 protein chains ) . the basic information stored in phospho3d consists of the instance , its flanking sequence ( 10 residues ) and any residue whose distance from the instance does not exceed 12 thus defining a 3d neighbourhood which we define as zone .
for each zone , annotation at the residue level is provided , namely solvent accessibility supplied by the naccess program ( 17 ) , secondary structure assignment given by the dssp program ( 18 ) and residue conservation as from the consurf - hssp database ( 19 ) .
users can also retrieve information extracted from the phospho.elm dataset ; for instance , the medline reference pmid and , when available , the kinase(s ) that phosphorylate(s ) the given site .
in addition , for each zone the results of a large - scale local structural comparison versus a representative dataset of pdb ( 20 ) protein chains from eukaryotic organisms are also given .
the comparison was carried out using the query3d sequence / fold independent algorithm ( 21 ) .
the structural similarity demands that matching residues have a root mean square deviation ( r.m.s.d . )
lower than a given threshold , whereas the biochemical similarity is evaluated using a dayhoff substitution matrix ( 22 ) .
the score of the match is the number of matching residues which fulfil the similarity criteria .
the significance of the score is evaluated by calculating the z - score over the score distribution of the query zone comparison to the whole dataset .
the phospho3d database can be searched by kinase name , by pdb identification code or keyword . a browsing function has been also implemented .
the information returned to the user consists of a brief description of the pdb structure(s ) which fulfil the search criterion and of a list of instances presented along with associated information ( figure 1 ) . for each instance , the user can select three options related to the surrounding structural zone : a graphical view using the jmol java applet ( ) ; a tabular view reporting the zone annotation at the residue level ; a list of 3d matches identified by local structural comparison .
a tabular view of the matching residues is also presented ( figure 1 ) . in the central panel a list of instances for the pdb file 1a52 is shown . for each of them
, users can visualize the corresponding zone via the jmol viewer , the annotation at the residue level and the results of the large - scale local structural comparison . for each structural match the score , the z - score , and the rmsd are reported along with the scop fold ( 27 ) of the matching pdb files .
the phospho3d database is a useful tool for the analysis of the structural features of experimentally verified phosphorylation sites .
moreover , it provides the results of a large - scale local structural comparison between the zones and a representative set of eukaryotic protein chains .
the results of such a comparison identify new putative phosphorylation sites and suggest the kinase(s ) responsible for phosphorylation .
the annotations will be integrated as a feature in the pdbfun server ( 23 ) .
we are also planning to identify and annotate those sites which are recognized by protein phosphatases and phosphoresidues - binding modules ( 2426 ) .
the phospho3d dataset ( annotations at the residue level and structural comparison results ) is available upon request . | phosphorylation is the most common protein post - translational modification .
phosphorylated residues ( serine , threonine and tyrosine ) play critical roles in the regulation of many cellular processes . since the amount of data produced by screening assays is growing continuously , the development of computational tools for collecting and analysing experimental data has become a pivotal task for unravelling the complex network of interactions regulating eukaryotic cell life .
here we present phospho3d , , a database of 3d structures of phosphorylation sites , which stores information retrieved from the phospho.elm database and is enriched with structural information and annotations at the residue level .
the database also collects the results of a large - scale structural comparison procedure providing clues for the identification of new putative phosphorylation sites . |
the first four knees in three patients received a press fit condylar ps implant ( depuy inc . ,
warsaw , in , usa ) ; the remainder of the cohort was implanted with a nexgen legacy ps prosthesis ( zimmer inc . ,
knee rom data included passive flexion contracture , further flexion , and total knee arc rom ( knee flexion minus flexion contracture ) .
these values were collected at the preoperative visit , as well as at approximately twelve and twenty - four months postoperatively .
knee motion gain was measured by subtracting knee arc at the preoperative time from the knee arc at twelve and twenty - four months , respectively . finally , both preoperative ( fig
patient demographics , gender , age , duration of symptoms , and prior orthopedic surgeries were recorded .
student 's t - test was used to compare outcomes and rom parameters at various follow - up time points .
key differences exist for the surgical management of hemophilia patients compared to the general population .
these patients oft en have contracted and atrophied quadriceps as well as extensive intra - articular knee adhesions which compromise exposure .
release of intra - articular adhesions combined with tibial external rotation and a generous medial subperiosteal release diminishes tension on the patellar tendon and allows less forceful exposure minimizing the risks of fracture of the thin and osteopenic diaphysis often present in these patients .
an extensive synovectomy , posterior capsular release , and medial and lateral gutter releases is generally required .
a lateral retinacular release is often useful to minimizes tension on the patellar tendon during exposure and allow appropriate tracking and improved flexion postoperatively .
although a quadriceps snip is rarely necessary , we prefer to avoid tibial tubercle osteotomies in these patients due to concern for increased bleeding and compartment syndrome .
joint contracture , fibrosis of muscles from intramuscular hematomae , and synovial hypertrophy may all affect the soft tissues and resulting soft - tissue balance .
indeed , arthrofibrosis , rather than instability , is generally the main challenge with hemophiliac arthropathy .
the suprapatellar adipose tissue covering the distal femur should be preserved because it is a barrier to quadriceps adhesion . in patients in whom it has been replaced by fibrous tissue , restoration of motion
bony erosion and periarticular cysts compromise bonestock , and may lead to intra - operative fracture with aggressive maneuvers .
epiphyseal hyperemia and synovial hypertrophy may cause widening of the distal femur compared to relatively narrow diaphyses .
angular deformity is quite common in advanced stages of disease , and tibial slope may be affected by long - standing flexion contractures .
the surgeon may consider antibiotic - impregnated cement , as well as the use of surgical drains .
a compressive wrap is utilized in the operative dressings , and a posterior splint may be used for the first couple postoperative days to protect a fragile soft tissue envelope . a careful series of postoperative examinations is important , as nerve palsy is a theoretical concern .
mechanical deep venous thromboembolic prophylaxis is used in light of the propensity for postoperative bleeding .
a careful preoperative assessment must be performed by a hematologist , including a pre - screen for neutralizing antibodies / factor inhibitors versus the potential recommendation for recombinant therapy .
ideally , this hematologist is familiar with the perioperative needs of the hemophiliac patient and will be available for inpatient consultation . the surgical team must also confirm that adequate factor stores are available at the inpatient pharmacy .
appropriate anesthesia consultation , including appropriate postoperative pain management , should be carefully planned and preoperative consultation with a pain management specialist is useful .
medical co - management of concomitant diseases like hiv and hepatitis c proves important , and patients with these diseases should be counseled on the increased risks of postoperative infections . for maintenance of appropriate factor levels , home infusion monitoring may be needed for up to two weeks postoperatively .
all patients in this study met with the hemophilia treatment center physical therapist before and after surgery .
therapy sessions were carefully coordinated with factor replacement , and each session was matched to the patient to avoid exacerbation of pain or wound condition / hemostasis .
individualized home exercise programs were then provided upon discharge , and , in some cases , outpatient pt was initiated .
outpatient physical therapy was initially prescribed for four to six weeks postoperatively and tailored to the specific patient 's needs and rom .
the patients attended regular visits with an outpatient therapist with extensive experience in managing hemophiliac patients and were followed periodically with this therapist for up to two years postoperatively .
physical therapy exercises typically included isometrics for the quadriceps , hamstrings and gluteal muscles , active and passive knee rom exercises , and progressive resistive lower extremity exercises as the patient progressed .
in addition , patients were instructed in adjuvant self - patellar mobility and scar management techniques in most cases .
functional mobility was also addressed , including the appropriate use of gait aids and adaptive equipment as necessary . while the therapy program used in this study
has similarities to those employed in other studies , a particular difference may lie in the frequent follow - up , and the focus on quadriceps stretching / extrinsic tightness undertaken by a physical therapist experienced in hemophiliac arthropathy and post - surgical care .
key differences exist for the surgical management of hemophilia patients compared to the general population .
these patients oft en have contracted and atrophied quadriceps as well as extensive intra - articular knee adhesions which compromise exposure .
release of intra - articular adhesions combined with tibial external rotation and a generous medial subperiosteal release diminishes tension on the patellar tendon and allows less forceful exposure minimizing the risks of fracture of the thin and osteopenic diaphysis often present in these patients . an extensive synovectomy , posterior capsular release , and medial and lateral gutter releases is generally required .
a lateral retinacular release is often useful to minimizes tension on the patellar tendon during exposure and allow appropriate tracking and improved flexion postoperatively .
although a quadriceps snip is rarely necessary , we prefer to avoid tibial tubercle osteotomies in these patients due to concern for increased bleeding and compartment syndrome .
joint contracture , fibrosis of muscles from intramuscular hematomae , and synovial hypertrophy may all affect the soft tissues and resulting soft - tissue balance .
indeed , arthrofibrosis , rather than instability , is generally the main challenge with hemophiliac arthropathy .
the suprapatellar adipose tissue covering the distal femur should be preserved because it is a barrier to quadriceps adhesion . in patients in whom it has been replaced by fibrous tissue ,
bony erosion and periarticular cysts compromise bonestock , and may lead to intra - operative fracture with aggressive maneuvers .
epiphyseal hyperemia and synovial hypertrophy may cause widening of the distal femur compared to relatively narrow diaphyses .
angular deformity is quite common in advanced stages of disease , and tibial slope may be affected by long - standing flexion contractures .
the surgeon may consider antibiotic - impregnated cement , as well as the use of surgical drains .
a compressive wrap is utilized in the operative dressings , and a posterior splint may be used for the first couple postoperative days to protect a fragile soft tissue envelope . a careful series of postoperative examinations is important , as nerve palsy is a theoretical concern .
mechanical deep venous thromboembolic prophylaxis is used in light of the propensity for postoperative bleeding .
a careful preoperative assessment must be performed by a hematologist , including a pre - screen for neutralizing antibodies / factor inhibitors versus the potential recommendation for recombinant therapy .
ideally , this hematologist is familiar with the perioperative needs of the hemophiliac patient and will be available for inpatient consultation . the surgical team must also confirm that adequate factor stores are available at the inpatient pharmacy .
appropriate anesthesia consultation , including appropriate postoperative pain management , should be carefully planned and preoperative consultation with a pain management specialist is useful .
medical co - management of concomitant diseases like hiv and hepatitis c proves important , and patients with these diseases should be counseled on the increased risks of postoperative infections . for maintenance of appropriate factor levels , home infusion monitoring may be needed for up to two weeks postoperatively .
all patients in this study met with the hemophilia treatment center physical therapist before and after surgery .
therapy sessions were carefully coordinated with factor replacement , and each session was matched to the patient to avoid exacerbation of pain or wound condition / hemostasis .
individualized home exercise programs were then provided upon discharge , and , in some cases , outpatient pt was initiated .
outpatient physical therapy was initially prescribed for four to six weeks postoperatively and tailored to the specific patient 's needs and rom .
the patients attended regular visits with an outpatient therapist with extensive experience in managing hemophiliac patients and were followed periodically with this therapist for up to two years postoperatively .
physical therapy exercises typically included isometrics for the quadriceps , hamstrings and gluteal muscles , active and passive knee rom exercises , and progressive resistive lower extremity exercises as the patient progressed .
in addition , patients were instructed in adjuvant self - patellar mobility and scar management techniques in most cases .
functional mobility was also addressed , including the appropriate use of gait aids and adaptive equipment as necessary . while the therapy program used in this study
has similarities to those employed in other studies , a particular difference may lie in the frequent follow - up , and the focus on quadriceps stretching / extrinsic tightness undertaken by a physical therapist experienced in hemophiliac arthropathy and post - surgical care .
the mean patient age was 46 years old ( range , 27 to 68 years ; standard deviation [ sd ] , 11 ) .
the average follow - up for patients was 50 months ( range , 24 to 179 years ; sd , 42 ) .
when analyzing rom data for all patients collectively , there was no difference between preoperative flexion / arc ( flexion minus flexion contracture ) rom and flexion / arc rom at final follow - up .
there was a significant difference between flexion contracture preoperatively and flexion contracture at final follow - up ( p = 0.02 ) .
flexion contracture , on average , improved from -10.5 degrees preoperatively ( range , -30 to 2 degrees ; sd , 10.2 ) to -5.1 degrees at final follow - up ( range , -25 to 0 degrees ; sd , 6.1 ) ( table 1 ) .
knees were further stratified into two groups : knees with preoperative flexion less than 90 degrees ( 11 knees in 8 patients ; mean , 73 degrees ) and knees with preoperative flexion greater than 90 degrees ( 13 knees in 9 patients ; mean , 111 degrees ) ; there was a significant difference between the means of the preoperative flexion between these two groups ( p = 0.004 ) . in those patients with preoperative flexion less than 90 degrees ( mean , 73 degrees )
, there was a significant improvement in flexion from preoperative evaluation ( range , 30 to 90 degrees ; sd , 22.2 ) to final follow - up ( mean , 88 degrees ; range , 50 to 122 degrees ; sd , 23.6 ; p = 0.02 ) ( table 2 ) .
table 3 presents the specific rom values for those patients with preoperative flexion greater than 90 degrees . for those patients with specific twelve - month and final follow - up data points ( 9 knees in 7 patients )
, there was a significant gain in flexion between twelve months and final follow - up ( p = 0.02 ) .
a 53-year - old african - american male experienced a periprosthetic joint infection in one of the two tkas that had been performed .
he underwent replantation 10 months later in a two - stage process . at 59 months
follow - up status post the second stage of reimplantation , there were no clinical issues or persistent infection .
the knee is the most commonly affected joint in hemophiliac bleeds,2 ) and the use of tka in hemophiliac patients has shown great promise in reducing disability2,4,5,7,8 ) since the first tka was performed on a hemophiliac in 1973.11,12 ) for the majority of hemophiliac patients who have undergone tka , results have been described as favorable.13 ) however , many authors have reported a high rate of early and late complications , oft en related to infection and aseptic loosening.7,13,14 ) restricted rom is also a common concern seen in hemophiliac tka .
this study aimed to characterize the mid - term rom results in this population , and to explore whether intensive physical therapy and stretching of the quadriceps mechanism could affect late postoperative rom results .
studies have noted much success with joint replacement surgery in patients with hemophilia.2,7,8,13 ) silva and luck13 ) evaluated 90 tkas in 68 patients and found that 97% of patients had good or excellent knee society functional scores . the average flexion arc improved from 59 degrees to 69 degrees in the early postoperative phase , and then to 75 degrees at the latest follow - up of two years.13 ) flexion contracture also improved from 18 degrees preoperatively to 9 degrees in the early postoperative phase and 8 degrees later.14 ) similarly , chiang et al.7 ) looked at 35 tkas in 26 patients with mean preoperative rom at 63.2 degrees and mean flexion contracture of 15 degrees .
these variables improved to a mean postoperative rom of 79.8 degrees and mean flexion contracture of 5.5 degrees.7 ) the patients in our study saw a comparable improvement with both flexion contracture and further flexion rom gains .
however , despite these obvious improvements in knee function , many authors cite the complications seen with tka surgery in the hemophiliac patient . in the study of chiang et al.,7 ) a failure rate of 14.3%
if inadequate rom was included in the definition of failure , the failure rate jumped to 22.9% .
in fact , many authors consider inadequate rom as one of the largest challenges in hemophiliac tka.4,5,7,8,13 ) in the case of functional outcomes , restrictions in rom were the most limiting factor in the knee society scores recorded in hemophiliac tka patients.13,15 ) increased stiffness seen in hemophiliacs has contributed to unsatisfactory gains in rom following tka.16 ) this stiffness tends to be the result of both intra- and extra - articular contractures associated with the recurrent bleeding and subsequent fibrosis that occurs in the joints and muscles of the lower extremity.17 - 19 ) many techniques have been incorporated into the tka of hemophiliacs in order to overcome rom shortcomings .
many focus on the knee joint itself : the structures posterior to the axis of knee rotation , such as the posterior capsule , posterior cruciate ligament , and hamstring tendons are often released to address contractures.4 ) while these structures are responsible for the flexion deformity seen in hemophiliac knees , their release and removal alone are not effective.20 ) knees with hemophiliac arthropathy are characterized by the presence of arthrofibrosis that limits rom by forming bands of scar tissue between the quadriceps mechanism and the distal femur.17 ) as such , it is not always the knee joint itself that contains the limiting factor .
oft en , the musculature of the upper leg limits rom , and quadricepsplasty has been employed to address this extrinsic tightness .
rehabilitation after surgery is , in fact , a key component to a patient 's success .
incorporating a rigorous and appropriate physiotherapy for hemophiliac patients undergoing tka is important to the success and gains in their rom .
however , the use of rehabilitation therapy is one of the least studied aspects of perioperative management in tka.17 ) this lack of research hinders the surgeon 's ability to facilitate the direction of physiotherapy after tka.21 ) historically , the preoperative rom for patients undergoing tka was the best predictor of their postoperative rom.9 ) patients with a preoperative flexion of less than 50 degrees often achieved a maximum flexion range of only 90 degrees , whereas those with a preoperative flexion greater than 65 degrees achieved between 100 - 130 degrees of flexion postoperatively.22 ) lobet et al.17 ) found that a deficit in extension postoperatively was more likely present in knees with significant flexion contracture preoperatively .
in contrast , mockford et al.10 ) found that patients tended to migrate towards a " middle range , " where those with poor preoperative flexion gained flexion after tka , while those with satisfactory preoperative flexion lost theirs .
similarly , lizaur et al.23 ) found that patients with the stiffest knees were afforded the greatest improvements . in our study , those patients with the poorest flexion benefited the greatest from an intense postoperative rehabilitation course , with a focus quadriceps stretching performed by a therapist familiar with the hemophiliac population .
although limited in number , previous studies looking at pt regimens have shown positive rom gains in patients .
a study by shoji et al.24 ) found that patients who underwent organized daily pt for one month after tka had better knee flexion at two to nine years follow - up than patients with only two weeks of organized physiotherapy .
similarly , moffet et al.25 ) emphasized the effectiveness of intensive functional rehab , with those receiving twelve sessions between two and four months showing less pain and stiffness in comparison to those who did not .
results such as these have led some authors to suggest that long term rehabilitation protocols be recommended for all hemophiliacs with a tka .
it should focus on restoring rom in flexion and extension , muscular strengthening , and proprioceptive performance.17 ) while flexion contracture in osteoarthritic patients may be best improved at the time of surgery,23 ) hemophiliacs may also benefit from soft tissue stretching post - surgery .
it is of critical importance that surgeons be aware of the potential for later improvements in rom in long - standing extrinsic knee contracture .
this data may suggest an increased threshold prior to considering a quadricepsplasty , which acutely lengthens the quadriceps at the expense of either quadriceps weakness or an extensor lag . instead of quadricepsplasty as a first - line treatment
, hemophiliac patients may rather undergo tka alone with aggressive but appropriate postoperative rehabilitation to realize increased rom benefits . while not directly studied here , these improvements in rom may also occur in juvenile idiopathic arthritis or other childhood onset conditions where extrinsic muscle shortening limits rom .
this retrospective study involves a relatively small patient cohort given the low numbers of hemophilic tka versus the general population .
moreover , this condition and its management is generally limited to institutions that have hemophilia treatment centers that are adequately equipped to provide coordinated , multidisciplinary care . while tka in hemophiliacs is not common in community - based practices , the pt principles and postoperative gains in motion - and
the intra - operative and postoperative distinctions from the osteoarthritic or rheumatoid population - are important .
more study in larger numbers is needed to confirm this initial observation in hemophiliac arthropathy , along with other conditions with extrinsic tightness , including juvenile idiopathic arthritis . in conclusion ,
hemophiliacs may experience rom improvements with intensive stretching of the quadriceps mechanism and hamstrings to a more functional length .
those patients with the poorest preoperative flexion ( less than 90 degrees ) realized the greatest gains .
importantly , this study provides motivation for hemophiliac patients in terms of long - term improvements after total knee arthroplasty . | backgroundhemophiliacs have extrinsic tightness from quadriceps and flexion contractures .
we sought to examine the effect of a focused physical therapy regimen geared to hemophilic total knee arthroplasty.methodstwenty-four knees undergoing intensive hemophiliac - specific physical therapy after total knee arthroplasty , at an average age of 46 years , were followed to an average 50 months.resultsfor all patients , flexion contracture improved from -10.5 degrees preoperatively to -5.1 degrees at final follow - up ( p = 0.02 ) .
knees with preoperative flexion less than 90 degrees were compared to knees with preoperative flexion greater than 90 degrees .
patients with preoperative flexion less than 90 degrees experienced improved flexion ( p = 0.02 ) , along with improved arc range of motion ( rom ) and decreased flexion contracture . for those patients with specific twelve - month and final follow - up data points ,
there was a significant gain in flexion between twelve months and final follow - up ( p = 0.02).conclusionshemophiliacs with the poorest flexion benefited most from focused quadriceps stretching to a more functional length , with gains not usually seen in the osteoarthritic population .
this data may challenge traditional views that rom gains are not expected beyond 12 - 18 months . |
salinity continues to be a major factor in reduced crop productivity and profit in many arid and semi - arid regions , despite the advanced management techniques developed in recent decades .
for example , yeo ( 1999 ) estimates that > 20% of the irrigated land worldwide has been seriously affected by salinity .
attempts to increase salinity tolerance of sensitive crops by traditional breeding have not been very successful due to the physiological and genetic complexity of salt tolerance in plants ( flowers , 2004 ) . in the last few decades
, major attempts at dealing with this problem have included the generation of transgenic plants with novel introduced genes or altered expression levels of existing genes ( yamaguchi and blumwald , 2005 ) . while these efforts await implementation under field conditions , it is important to develop more conventional methods , which will enable high crop production under saline conditions in the near future .
one such method consists of grafting salt - sensitive species onto more tolerant rootstocks . in tree crops , grafting is a well - established and commonly used practice .
for example in citrus , cleopatra mandarin rootstock was found to be a highly salt - tolerant rootstock which could transmit its salt - tolerant traits to more sensitive species via grafting ( moya et al . , 2002 ) .
the chloride toxicity tolerance of cleopatra mandarin rootstock was attributed to its exclusion by the roots ( banuls and primo - milo , 1991 ) and to reduction of transpiration and water and salt uptake by the plant ( moya et al . , 2002 ) .
in addition , pears grafted on quince and irrigated with saline water accumulated a substantial amount of cl in their leaves , while the absorbed na was mostly stored in the roots ( musacchi et al . , 2006 ) .
recently , the grafting of vegetable plants has become more common , and various methods and machines for vegetable grafting have been developed .
although the main purpose of vegetable grafting has been to control soilborne diseases and nematodes , improved tolerance to environmental stresses such as low soil temperatures ( okimura et al . ,
1986 ) , flooding ( liao and lin , 1996 ) , salinity ( romero et al . , 1997 ) , and high b concentrations ( edelstein et al . , 2005 , 2007 ) has been shown .
grafting tomato plants for increased salinity tolerance is the most common grafting practice among vegetables .
exposure of tomato cultivars fanny and goldmar grafted on tomato hybrid ar-9704 to high nacl concentrations ( up to 75 mm ) resulted in lower cl and na concentrations in the leaves as compared with non - grafted plants ( fernandez - garcia et al . , 2002 , 2004 ) .
( 2001 ) also found an increase in fruit yield when a salt - sensitive tomato cultivar was grafted on a tolerant rootstock and irrigated with water containing 50 mm nacl as compared with self - grafted plants . here as well , the concentrations of na and cl in the leaves of the plants grafted on the tolerant rootstock were lower than in the self - grafted plants .
( 2008 ) also showed that grafting of a commercial tomato hybrid onto rootstocks having the potential to exclude saline ions reduced the concentration of both na and cl in the leaves of the scion .
moreover , they observed a high negative correlation between fruit yield and leaf na and cl concentrations in salt - treated plants , suggesting that grafting could be effective for overcoming salinity stress in tomatoes .
ruiz et al . ( 2006 ) found that grafting salt - sensitive tobacco cultivars on a more tolerant cultivar increases biomass production and yield quality of the grafted plants under conditions of saline stress .
although the mechanism of salt tolerance transmission in the grafted tobacco plants was not known , ruiz et al .
( 2006 ) showed that the foliar concentrations of na and cl were lower in the grafted compared with the non - grafted cultivars .
( 2005 ) in melon and watermelon plants that were grafted on salt - tolerant cucurbit rootstocks , resulting in higher fruit yield in the grafted plants .
several factors may be responsible for the salt sensitivity of non - halophytes , one being the uptake and accumulation of salt ions in the plant tissue .
chloride influx may require energy , and is probably catalysed by a cl/2h symporter ( munns and tester , 2008 ) . however , it is mostly taken up freely with water , and may thus accumulate in the leaves according to the transpiration rate ( wahome , 2003 ) .
na can be absorbed by the root cell symplast or loaded into the xylem by two main transport mechanisms : ( i ) passive diffusion through the lipid bilayer ( harvey , 1985 ; davenport et al . , 1997 ) ; or ( ii ) passage through proteinaceous channels in the cell membrane ( plett and moller , 2010 ) .
for example , na permeability coefficients of purified plasma membrane vesicles obtained from cucurbita pepo l. ( squash ) roots were six times greater than those of microsomal vesicles .
na uptake by intact c. pepo plants was reduced by 4090% following administration of channel transport inhibitors , and other non - electrolytes similar in molecular size to boric acid competed with b , thereby decreasing its uptake rate ( dordas and brown , 2000 ) .
the membrane potentials of other channels may , however , be depolarized and less selective , thereby allowing na to enter ( maser et al . , 2002 ) .
na may also enter cells via the kup / hak / kt potassium transporters , glutamate - activated channels , lct transporters and cyclic nucleotide - gated channels ( maser et al .
na uptake by the plant does not ensure its further transport and distribution , as it may be retained in the roots or lower plant parts .
( 1998 ) showed a gradient in na concentration along the xylem and pith cells of sweet pepper plants , such that na was mainly located in the basal pith cells .
the long - distance transport of na in the plant takes place mainly in the xylem , similar to other alkaline ions ( zeller and feller , 2000 ; plaut et al . , 2004 ) , and thus may depend , to some extent , on transpiration rate .
as mentioned above , grafting of vegetable plants markedly decreases leaf na concentration in leaves of grafted plants ( colla et al . , 2006a ) ; however , the mechanism responsible for low na concentration in the leaves of grafted plants is not completely known .
mechanisms that could potentially decrease na concentration in the leaves of grafted vegetable plants are : ( i ) the graft itself acting as a barrier that limits na transport from the rootstock to the scion ; ( ii ) the rootstock excluding na , which , in turn , decreases its uptake rate by the plant ; and ( iii ) the rootstock retaining and accumulating na in its tissues , and consequently decreasing its movement to the plant shoot .
the objective of the present work was to study and quantify the effects of grafting salt - sensitive melon plants on salt - tolerant cucurbita rootstocks on the plants uptake of na and cl and their distribution within the plant organs .
arava ) and commercial cucurbita maxima duchesnecucurbita moschata duchesne rootstock tz-148 ( pumpkin ) plants were used in this study .
the melon and pumpkin plants were grown as non - grafted plants , self - grafted plants , melon grafted on pumpkin , and pumpkin grafted on melon .
all of the plants were planted on 30 january 2006 in 10.0 l pots containing perlite no .
2 ( agrical , habonim , israel ) , one seedling per pot , in a heated greenhouse at the newe ya'ar research center of the aro , in northern israel .
the plants were irrigated to excess with fresh water ( table 1 ) five times a day by a drip system so that 35% of the irrigation water drained as leachate to allow leaching of excess salts from the pot .
plants were fertilized with shefer ( fertilizers & chemicals , haifa , israel ) containing n , p , k ( 7:1.4:5.8 , weight percentages ) , and microelements ( fe , mn , zn , cu , and mo ) .
the fertilizer was applied via the irrigation system , with a concentration in the irrigation water of 0.2% ( v / v ) .
the experiment was conducted in a completely randomized design , with four replicates ( four pots ) for each treatment ( plant type ) .
values of ph and electrical conductivity ( ec ) and concentrations of cl , na , and k in the water used for irrigation the shoot ( stems and leaves ) and roots of each plant were harvested separately immediately after the last irrigation event at 30 d after planting , before bearing fruits . after the harvest , the shoot and roots of each plant were weighed , washed gently in deionized water , dried at 60 c for 48 h , reweighed , and stored pending chemical analysis . at the time of harvest , the stem of each plant was cut 5 cm above the substrate surface in the pot , 1 cm below the graft in the grafted plants .
the xylem sap exudates from the cut stem were collected for 2 h into plastic tubes ; their quantity was recorded , and they were then immediately frozen at 20 c until chemical analysis . in three of the four replications of each treatment , the total concentration of na and soluble cl in the plant shoot and root tissues was determined . for this chemical analysis ,
the whole dry shoot and root system of each plant were separately ground to 2 mm mesh , and representative subsamples of the ground material were analysed .
the na content was determined by ashing 0.25 g of each subsample in a furnace at 600 c for 5 h , and then adding 5 ml of 1 m hcl to the cooled ash ; the solution was filtered after 15 min and analysed .
the concentration of na was determined by flame photometery ( lachica et al . , 1973 ) .
the concentration of soluble cl in the plant organs was analysed after aqueous extraction of 0.25 g of the plant subsamples in 25 ml of distilled water .
the cl concentration in the infiltrated solution was measured by titration with agno3 according to koltoff and kuroda ( 1951 ) .
the concentrations of na and cl in the xylem sap exudates were determined similarly after the exudates had reached room temperature .
the data were subjected to analysis of variance ( anova ) ( sas institute , cary , nc , usa ) .
separation of means was subjected to tukey 's honestly significant difference test , with a significance level of 0.05 .
arava ) and commercial cucurbita maxima duchesnecucurbita moschata duchesne rootstock tz-148 ( pumpkin ) plants were used in this study .
the melon and pumpkin plants were grown as non - grafted plants , self - grafted plants , melon grafted on pumpkin , and pumpkin grafted on melon .
all of the plants were planted on 30 january 2006 in 10.0 l pots containing perlite no .
2 ( agrical , habonim , israel ) , one seedling per pot , in a heated greenhouse at the newe ya'ar research center of the aro , in northern israel .
the plants were irrigated to excess with fresh water ( table 1 ) five times a day by a drip system so that 35% of the irrigation water drained as leachate to allow leaching of excess salts from the pot .
plants were fertilized with shefer ( fertilizers & chemicals , haifa , israel ) containing n , p , k ( 7:1.4:5.8 , weight percentages ) , and microelements ( fe , mn , zn , cu , and mo ) .
the fertilizer was applied via the irrigation system , with a concentration in the irrigation water of 0.2% ( v / v ) .
the experiment was conducted in a completely randomized design , with four replicates ( four pots ) for each treatment ( plant type ) .
values of ph and electrical conductivity ( ec ) and concentrations of cl , na , and k in the water used for irrigation the shoot ( stems and leaves ) and roots of each plant were harvested separately immediately after the last irrigation event at 30 d after planting , before bearing fruits . after the harvest , the shoot and roots of each plant were weighed , washed gently in deionized water , dried at 60 c for 48 h , reweighed , and stored pending chemical analysis . at the time of harvest , the stem of each plant was cut 5 cm above the substrate surface in the pot , 1 cm below the graft in the grafted plants .
the xylem sap exudates from the cut stem were collected for 2 h into plastic tubes ; their quantity was recorded , and they were then immediately frozen at 20 c until chemical analysis .
in three of the four replications of each treatment , the total concentration of na and soluble cl in the plant shoot and root tissues was determined . for this chemical analysis ,
the whole dry shoot and root system of each plant were separately ground to 2 mm mesh , and representative subsamples of the ground material were analysed .
the na content was determined by ashing 0.25 g of each subsample in a furnace at 600 c for 5 h , and then adding 5 ml of 1 m hcl to the cooled ash ; the solution was filtered after 15 min and analysed .
the concentration of na was determined by flame photometery ( lachica et al . , 1973 ) .
the concentration of soluble cl in the plant organs was analysed after aqueous extraction of 0.25 g of the plant subsamples in 25 ml of distilled water .
the cl concentration in the infiltrated solution was measured by titration with agno3 according to koltoff and kuroda ( 1951 ) .
the concentrations of na and cl in the xylem sap exudates were determined similarly after the exudates had reached room temperature .
the data were subjected to analysis of variance ( anova ) ( sas institute , cary , nc , usa ) . separation of means was subjected to tukey 's honestly significant difference test , with a significance level of 0.05 .
the dry weights of the whole plant , shoot , and roots of the six different grafting combinations : non - grafted pumpkin , non - grafted melon , melon or pumpkin grafted on their own rootstocks , melon grafted on pumpkin , and pumpkin grafted on melon , are presented in table 2 . in some cases ,
the grafting had effects on the development and growth of the scions , rootstocks , and whole plant , as evidenced by the dry weight of their biomass ( table 2 ) .
for example , the dry weight of the roots of melons grafted on pumpkin rootstocks ( m / p ) was significantly lower than those of the non - grafted pumpkins ( p ) or pumpkins grafted on their own rootstocks ( p / p ) ( table 2 ) .
moreover , the dry weight of the roots of pumpkin grafted on melon rootstock ( p / m ) was significantly higher than those of the non - grafted melon ( m ) or melon grafted on its own rootstock ( m / m ) ( table 2 ) .
these effects of grafting on the development and growth of the scions and rootstocks were probably the result of physiological relationships existing between the scions and rootstocks in the different grafting plants ( oda , 2002 ) .
dry weight of whole plant , shoot , and root of the six different plant combinations : non - grafted pumpkin ( p ) , self - grafted pumpkin ( p / p ) , melon grafted on pumpkin rootstock ( m / p ) , non - grafted melon ( m ) , self - grafted melon ( m / m ) , and pumpkin grafted on melon rootstock ( p / m ) for each column , different letters indicate statistically significant ( at the 0.05% level ) differences between the plant types .
total na and soluble cl concentrations in the shoots of plants from the six different grafting combinations are presented in fig .
1a and b , respectively . a high concentration of na , ranging from 390 mmol kg to 414 mmol kg , was found in the shoots of plants with melon rootstocks , regardless of the scion type ( fig .
in contrast , very low na concentrations ( 4162 mmol kg ) were found in the shoots of plants with pumpkin rootstocks , with either melon or pumpkin scions ( fig .
the shoot cl concentrations were generally quite similar among the six different grafting combinations ( fig .
total na ( a ) and soluble cl ( b ) concentrations in the shoots of non - grafted pumpkins ( p ) , non - grafted melons ( m ) , self - grafted melons ( m / m ) , self - grafted pumpkins ( p / p ) , melons grafted on pumpkins ( m / p ) , and pumpkins grafted on melons ( p / m ) .
different letters indicate statistically significant ( at the 0.05% level ) differences between plant types for each element .
arava ) and melons grafted on pumpkin rootstocks ( tz-148 ) irrigated with fresh water ( ec 1.8 ds m , 5.1 mm na , 7.3 mm cl ) or saline water ( ec 4.5 ds m , 15.5 mm na , 34 mm cl ) . in that study ,
the total na and soluble cl concentrations were determined in old leaves in the lower third of the plant after fruit harvest .
the na concentrations in the leaves of the melon plants irrigated with fresh or saline water were 610 mmol kg and 740 mmol kg , respectively , in non - grafted plants and 200 mmol kg and 270 mmol kg , respectively , in the grafted plants ( edelstein et al . , 2005 ) .
in contrast , the cl concentrations in the leaves of the melon plants that were irrigated with fresh or saline water were 570 mmol kg and 1510 mmol kg , respectively , in non - grafted plants , and 670 mmol kg and 1380 mmol kg , respectively , in grafted plants .
those results indicated that the relative effect of grafting melons on pumpkin rootstocks on the decrease of na accumulation in the plant shoots was similar under irrigation with low- and high - salinity water .
( 2006a , b ) with non - grafted melon and watermelon plants and their counterparts grafted on cucurbita rootstocks .
the plants were irrigated with water at various ecs , ranging from 2 ds m to 9.7 ds m. in both melon and watermelon plants , grafting reduced the concentration of na , but not cl , in the leaves the results in fig . 1 and those in edelstein et al .
( 2006a , b ) indicate that the presence of a pumpkin rootstock leads to a reduction in na accumulation in the plant shoot , while cl accumulation in the plant shoot is not affected .
the low concentrations of na in the shoot of plants with pumpkin rootstocks ( fig .
1a ) could result from three main mechanisms : ( i ) the graft itself acts as a selective barrier that limits na movement from the rootstock to the scion ; ( ii ) various rootstocks have different selectivities for na absorption , and the pumpkin rootstock excludes na ; or ( iii ) accumulation and binding of na in the tissues of pumpkin rootstock , which would limit its movement toward the shoot , as reported for some fruit trees ( elmotaium et al .
the na concentrations in the shoots of the non - grafted and self - grafted pumpkins were similar ( fig .
similarly , the na concentrations in the shoots of the non - grafted and self - grafted melons were similar ( fig .
these results suggested that the graft itself does not act as a selective barrier limiting na movement from the rootstock toward the scion in the grafted plants .
the effects of grafting on the absorption of na and cl by the rootstock and their movement toward the shoot were also studied by analysing the exudates from a cut made in the shoot .
the steady flow rates of the exudates from the stems of the six different combinations of melon and pumpkin rootstocks and scions during 120 min of sampling ranged from an average 9.18 ml h in self - grafted melons to 24.84 ml h in non - grafted pumpkins ( fig .
2 ) . these exudate flow rates may represent the flow rate of the solutes through the xylem of the different plants .
average steady - flow rates of exudates during 120 min of sampling from non - grafted pumpkins ( p ) , non - grafted melons ( m ) , self - grafted melons ( m / m ) , self - grafted pumpkins ( p / p ) , melons grafted on pumpkins ( m / p ) , and pumpkins grafted on melons ( p / m ) .
different letters indicate statistically significant ( at the 0.05% level ) differences between plant types .
the concentrations of na and cl in the exudates and their amounts exuding from the cut stem per unit time for the six different melon and pumpkin combinations are presented in fig .
while the concentration of na in the exudates of plants with pumpkin rootstocks was very low ( < 0.18 mm ) ( fig .
3a ) , its concentration in the exudates of plants with melon rootstocks was high , ranging from 4.7 mm to 6.3 mm , and quite similar to its concentration in the irrigation water ( fig . 3a and table 1 ) .
although the steady flow rates of the exudates from the plants with pumpkin rootstocks were nearly twice as high as those from the plants with melon rootstocks ( fig .
2 ) , the amount of na flowing out of the xylem per unit time in the latter plants was > 30 times higher on average than that from plants with pumpkin rootstocks ( fig .
3b ) . since the shoot was cut for exudate collection below the graft in the grafted plants , the results in figs .
2 , 3a , b indicate that the reason for the low na concentration in the shoots of plants with pumpkin rootstocks is related mainly to the behaviour of the rootstock and not of the graft itself or the plant shoots .
concentrations of na ( a ) and cl ( c ) in the exudates and the amounts of na ( b ) and cl ( d ) flowing out from the cut stem per unit time for non - grafted pumpkins ( p ) , non - grafted melons ( m ) , self - grafted melons ( m / m ) , self - grafted pumpkins ( p / p ) , melons grafted on pumpkins ( m / p ) , and pumpkins grafted on melons ( p / m ) .
different letters indicate statistically significant ( at the 0.05% level ) differences between plant types for each panel .
the lateral , dashed lines in a and c indicate the average elements concentration in the irrigation water .
the concentrations of cl in the exudates of plants with pumpkin rootstocks were somewhat lower than those in plants with melon rootstocks ( fig .
the amounts of cl exuded from the xylem through the cut stem per unit time ( fig .
3d ) were similar , in general , among the plants irrespective of scion or rootstock , except for melons grafted on pumpkin rootstocks ( fig 3d ) .
the higher exudate flow rates from the plants with pumpkin rootstocks relative to those with melon rootstocks ( fig .
2 ) compensated for the lower cl concentrations in the former 's exudates ( fig .
3d ) , and cl concentrations were similar in the plant shoots of all plant types ( fig .
elements that are absorbed by the plant roots can accumulate to higher levels in the root compared with shoot tissues , be distributed uniformly throughout the plant , or accumulate to higher levels in the shoot compared with root tissues , mainly as a result of transpiration .
thus , another mechanism that could decrease the concentration of na in the shoots of plants with pumpkin rootstocks ( fig .
the total na and soluble cl concentrations in the roots of the six different plant combinations are presented in fig .
na concentrations were significantly higher than in the shoot ( compare figs 1a and 4a ) , by on average 11.7-fold .
in contrast , in the plants with melon rootstocks , the na concentrations in the roots and shoots were similar ( compare figs 1a and 4a ) .
the cl concentration in the roots was 1.4 and 0.74 times higher on average than in the shoot for plants with pumpkin and melon rootstocks , respectively ( compare figs 1b and 4b ) .
these results indicate that pumpkin rootstocks have a high capacity to retain na in their tissues , while the distribution of cl between roots and shoots in the plants with pumpkin rootstocks was much more uniform , despite a slight retention of cl in the roots .
the total na and soluble cl concentrations in the roots of non - grafted pumpkins ( p ) , non - grafted melons ( m ) , self - grafted melons ( m / m ) , self - grafted pumpkins ( p / p ) , melons grafted on pumpkins ( m / p ) , and pumpkins grafted on melons ( p / m ) .
different letters indicate statistically significant ( at the 0.05% level ) differences between plant types for each element .
two possible mechanisms could explain the decrease in leaf na concentrations in the plants grafted on pumpkin rootstocks ( fig 1a ) : ( i ) na exclusion by the pumpkin rootstock ; and ( ii ) na retention and accumulation in the tissue of the pumpkin rootstock .
all of the plants in this study were grown in pots filled with perlite , an inert material .
as irrigation was in excess and with high frequency ( five times a day ) , it is highly likely that the cl and na concentrations in the irrigation water were similar to their concentrations in the solution near the roots .
although chloride uptake is probably catalysed by a cl/2h symporter ( munns and tester , 2008 ) , the high irrigation frequency most probably caused a constant external cl concentration and a fixed point in the michaelis menten curve , and therefore , the cl uptake rate can be considered as a constant . under the present experimental conditions , for an element that is taken up freely by the plant and
is not excluded by the plant rootstock , such as cl ( wahome , 2003 ; colla et al .
, 2006a , b ) , the relationship between the average concentration of cl in the irrigation water and in the tissue of the whole plant is defined by equation 1 : where t is the total transpiration of the plant during the growth period , cfw ( mm ) and cfp ( mmol kg ) are the average concentrations of cl in the irrigation water and in the tissues of the whole plant , respectively , and m ( kg ) is the total dry biomass of the plant .
equation 1 can be converted to equation 2 . under the same conditions , for an element that is excluded by the plant rootstock , such as na ,
the relationship between the element 's concentration in the irrigation water ( cew ) ( mm ) and in the tissues of the whole plant ( cep ) ( mmol kg ) is defined in equation 3 and this equation can be converted to equation 4 the absorption factor ( af ) of an excluded element for a given plant , as a percentage of the absorption of a non - excluded element by the same plant under the same growing conditions for the same period , can be calculated by equation 5 , which is a combination of equations 2 and 4 : the af values of na , given as percentages of the non - excluded cl and calculated by equation 5 for the various melon and pumpkin grafting combinations , are presented in table 3 .
the cfp and cfw values for cl , and the cep and cew values for na which were used to calculate the af values are presented in tables 13 .
the af values of na in the plants with pumpkin rootstocks averaged 25.9% , while the af values of na in the plants with melon rootstocks averaged 98.6% ( table 3 ) .
these results indicate that the pumpkin rootstock excludes on average 74% of the potential amount of na available for absorption , while there is nearly no na exclusion by the melon rootstock .
average concentration of total na and soluble cl in the whole plant and values of na absorption ( af ) and retention ( rf ) factors for the six different plant combinations : non - grafted pumpkin ( p ) , self - grafted pumpkin ( p / p ) , melon grafted on pumpkin rootstock ( m / p ) , non - grafted melon ( m ) , self - grafted melon ( m / m ) , and pumpkin grafted on melon rootstock ( p / m ) for each column , different letters indicate statistically significant ( at the 0.05% level ) differences between the plant types .
it is well accepted that nearly all of the na which is transported to the foliage accumulates there , because its circulation from the foliage to the roots via the phloem is negligible ( munns and tester , 2008 ) .
therefore , the accumulation of na in the shoot is a result of its transport via the xylem ; accordingly , restriction of its accumulation to the roots , as found here in the plants grafted on pumpkin rootstocks ( figs 1 , 4 ) , should be due to a decrease in its transfer to the xylem .
this transfer depends on na influx into the root epidermis and cortex cells , and its efflux back into the soil solution , the combination of these two processes being defined as exclusion in this study .
it has been suggested that the initial entry of na from the soil solution into the root cortex cytoplasm via non - selective cation channels is passive , and is favoured by differences in concentration and voltage ( cheeseman , 1982 ) .
the rate of this influx must be high , as na accumulation may reach an external concentration of 50 mm within a matter of minutes ( tester and davenport , 2003 ) .
even if the rate of such unidirectional influx were much lower , giving the presently observed external concentration of 5.9 mm , it is highly feasible that most of the na which enters the outer part of the root is pumped back via the plasma membrane by na / h antiporters , rather than by passive transport ( tester and davenport , 2003 ) .
efflux of na could potentially also take place to some extent by na - translocating atpases ( mennen et al . ,
. however , the thermodynamic cost of moving na from the cytosol to the soil solution by this mechanism would be very high , namely 1 atp per 1 na extruded .
tester and davenport ( 2003 ) claimed that the energy cost for moving na to the external solution is much lower and depends on the na concentration in the external solution .
some genes encoding na efflux proteins have been detected ( pardo et al . , 2006 ) , mainly in arabidopsis .
although no such information is available on cucurbit plants , it is possible that the activity of na / h antiporters in pumpkin roots is encoded to a lesser extent or that they are less active than in melon , resulting in lower exclusion of na .
several cation channels have a higher selectivity for k than for na , such as the potassium inward - rectifying channel , which selectively accumulates k over na ions .
another possibility is the histidine kinase transporter ( hkt ) , which has a low affinity for na transporter and blocks na entry into the cytosol ( tuteja , 2007 ) .
these mechanisms may also be operating to increase the exclusion of na in pumpkins , although direct evidence is not available . the limited na accumulation in plant shoots grafted on pumpkins
was clearly reflected in its low concentration in the exudate , indicating that the concentration of na in the xylem sap must also be low .
this implies that transport of na from the root symplast into the xylem of pumpkin roots was reduced , or that there was a marked retrieval of na back from the xylem before it could be transported by the transpiration stream .
the possibility that ions in the cytosol may not be loaded into the xylem , but rather retained in the roots , extruded , and sequestered in vacuoles of root cells , has been raised by several investigators ( blumwald and poole , 1987 ; gaxiola et al . , 2001 ) .
this may restore ionic homeostasis and keep the cytosol nearly free of na ; it would also allow growth of young cells ( hasegava et al . , 2000 ) .
the sequestration of na within vacuoles is achieved by tonoplast na / h antiporters similar to those of the na / h exchanger , which allows coupling of h movement inside the cytosol along an electrochemical gradient and retrieval of na out of the cytosol ( tuteja , 2007 ) .
the effect of element retention in the roots of a particular plant on reducing its concentration in the plant shoots can be quantified by a retention factor ( rf ) , defined in equation 6 . in this equation ,
the accumulation and retention of the element in the roots of the plant are related to the concentration of the element in the entire plant , provided its distribution in the tissues of the whole plant is uniform . in
which cr is the element 's concentration ( mmol kg ) in the root system , ca is the average concentration ( mmol kg ) of the element in the whole plant , and mr and mf are the dry weights ( kg ) of the roots and shoot of the plant , respectively .
the rf values for na in the different plant combinations , calculated by equation 6 , are presented in table 3 .
the cr , ca , mr , and mf values used to calculate the rf values were taken from tables 2 and 3 and fig .
the rf values for na in the plants grafted on pumpkins averaged 46.9% ( table 3 ) , indicating that from the total amount of na absorbed by the plants with pumpkin rootstocks , the retention of na in the pumpkin rootstock decreased the amount of na in the shoot by 46.9% as compared with its amount when uniformly distributed in the whole plant .
in contrast , the rf values for na in the plants grafted on melons were 0 ( table 3 ) , suggesting that , in practice , there is no retention of na by melon roots .
na ions that are available for xylem loading will move through the symplast , cross the endodermis , enter the apoplast of the stele , and move into the xylem .
this loading is active , namely driven by a pump , rather than being a passive leak ( tester and davenport , 2003 ) .
the gene sos1 encoding the na / h antiporter has been reported to be expressed at the xylem symplast boundary in arabidopsis ( shi et al . , 2002 ) ; however , it is not known whether such a system exists in the plants used in the present study .
the na concentration in the exudate was 0.10.2 mm in pumpkins and 4.76.3 mm in melons .
provided the exudate indeed represents the xylem sap , this indicates that either xylem loading of na was inhibited in pumpkin roots , or that its concentration in the cytosol had already been reduced by its sequestration in vacuoles .
both cases would result in na retention in the roots rather than its moving to the foliage . | the effects of grafting on na and cl uptake and distribution in plant tissues were quantified in a greenhouse experiment using six combinations of melon ( cucumis melo l. cv .
arava ) and pumpkin ( cucurbita maxima duchesnecucurbita moschata duchesne cv .
tz-148 ) : non - grafted , self - grafted , melons grafted on pumpkins , and pumpkins grafted on melons .
total na concentration in shoots of plants with pumpkin or melon rootstocks was < 60 mmol kg1 and > 400 mmol kg1 , respectively , regardless of the scion .
in contrast , shoot cl concentrations were quite similar among the different scion rootstock combinations .
na concentrations in exudates from cut stems of plants with a pumpkin rootstock were very low ( < 0.18 mm ) , whereas those in the exudates of plants with melon rootstocks ranged from 4.7 mm to 6.2 mm , and were quite similar to the na concentration in the irrigation water .
root na concentrations averaged 11.7 times those in the shoots of plants with pumpkin rootstocks , while in plants with melon rootstocks , values were similar .
two mechanisms could explain the decrease in shoot na concentrations in plants with pumpkin rootstocks : ( i ) na exclusion by the pumpkin roots ; and ( ii ) na retention and accumulation within the pumpkin rootstock .
quantitative analysis indicated that the pumpkin roots excluded 74% of available na , while there was nearly no na exclusion by melon roots .
na retention by the pumpkin rootstocks decreased its amount in the shoot by an average 46.9% compared with uniform na distribution throughout the plant .
in contrast , no retention of na could be found in plants grafted on melons . |
cosmetics refer to all of the products used to care for and clean the human skin and make it more beautiful .
the intentions of using cosmetic products is to maintain the body in a good condition , protect it from the effects of the environment and aging processes , change the appearance , and make the body smell nicer .
cosmetic products are widely used by every socioeconomic class of human beings to cleanse , perfume , protect , and change the appearance of skin .
public observations and reviewing of the relevant literatures indicated that most of the cosmetic users were not seriously concerned about the effect of usage of products to their skin and focus on the short term result of skin appearance rather than the long - term effects to the whole body .
generally , consumers assume that cosmetic products are safer and pose no risk to the human health .
some consumers did not read the label to identify the ingredients and other useful information of the cosmetic products before they decide to use them .
the cosmetics sector grows tremendously , driven by demands from consumers but some users are not very concerned about the implications of cosmetics to their healthy body such as skin and physical outlook [ 2 , 3 ] . in ethiopia ,
cosmetics do not need marketing authorization unlike that of medicinal products which can only be marketed if marketing authorization is granted .
daca do not spend little or no time to protect the public against the harmful effects emanating from these products as it is true also in many other countries [ 47 ] .
it is the companies ' responsibility to check the safety of the cosmetic products and these firms are business oriented and give little or no attention to the cosmetics safety because of many reasons .
some of them are the requirement to change test methods , formulations , packaging , and advertising could increase costs for the sector .
these things create a gap in the event of defective product release in to the market .
labeling is required for all cosmetic products and safety information must appear on cosmetic containers or packaging . according to health science authority , labels on cosmetics should contain the function of the cosmetic product , instruction for use , list of all ingredients , country of manufacture , content ( weight / volume ) , batch number , and manufacturing and expiry dates .
cosmetics and personal - care products may contain ingredients whose safety is unclear or which are known to pose health risks .
adverse reactions to cosmetics are the commonest single reason for hospital referrals with allergic contact dermatitis [ 12 , 13 ] . most chemicals are added to cosmetic product in the form of preservatives and fragrances to increase the shelf life of the product and to have a good odor and appearance to the users .
these additive chemicals are the most common cause of skin problems such as skin irritation , photo toxicity , contact allergy , and other dermatological problems [ 1517 ] .
documents indicate that in the previous times extracts of natural materials were used but currently synthetic ingredients are often used in the cosmetic products
estrogenic chemicals of body care cosmetics to the underarm and breast area are being investigated as a possible cause of breast cancer .
literatures indicate that the concentration of lead in the candy lipstick cosmetic product is 2.8 times higher than the american fda recommended concentration of lead .
another problem associated with cosmetic use is the clarity of the labels on the cosmetic containers .
the tanzanian food and drug authority have found that every container of any product shall be affixed with a label bearing legible and indelible letters in kiswahili or kiswahili and english : name of a cosmetic ; form of a cosmetic ; intended use ; instructions on use of the cosmetic ; net content given by weight or volume , in metric system ; name and address of the manufacturer , including country of origin ; dates of manufacture and expiry of a cosmetic in clear terms ; list of ingredients in alphabetical order ; batch or lot number ; precautions and warnings ; storage conditions where applicable .
studies conducted somewhere else by the environmental defense in canada have identified , using laboratory analysis , that heavy metals such as lead , arsenic , and antimony were found as ingredients which were not listed on the product label .
a study done in nigeria also found an elevated level of lead in facial talcum powders and other metals in personal care products [ 25 , 26 ] .
many of them are toxic and prohibited from usage as ingredients because they can cause cancer , mutation , reproductive toxicity , and endocrine disruption .
preservatives added to skin cream products have been found above the maximum allowed concentration and do not comply with european cosmetics directives .
cosmetics used for body care should be evaluated for irritancy potential to human skin of any chemical or formulation is a necessity .
the most commonly used test is the rabbit skin irritation test as described in the oecd test guideline 404 and in the european chemicals bureau [ 2830 ] .
the nonmedicated cosmetics in ethiopia are used without passing through structured safety evaluation and laboratory assessments .
this might possibly lead to the presence and use of unsafe cosmetic products which could pose public health risk to the consumers .
hence , this study has been conducted to identify the safety of cosmetic products commonly used in urban communities considering jimma as the case in point .
this study helps the federal government of ethiopia to formulate rules over the cosmetic products to protect the public safety and aware consumers .
therefore the main aim of this study was to assess the skin irritation of cosmetics most commonly used in jimma town using rabbit as a test animal whose result can be directly predicted for human skin irritation for both erythema and edema .
the study was conducted in jimma town southwest ethiopia from april to june , 2011 . according to the central statistics agency
according to the town trade and industry office , there are above 350 shops in which cosmetics are being sold
. however , the popular shops in which majority of the consumers could buy cosmetics are about 15 . for the purpose of this study ,
shops keepers from these shops were interviewed to identify the most commonly used cosmetic products . in addition , one working day ( saturday ) onsite observation was done at each shop to verify consumer preferences to cosmetics and interview them for labeling and content of the product .
saturday was preferred because it is major shopping day in ethiopia and therefore many consumers could be surveyed . for comparative purpose , the ethiopian - made products , kris ( kri ) and victoria ( vic ) lotions , and one face make - up called sweet heart ( swe ) were selected to be included in the study .
six new zealand white rabbits were bought from ethiopian health and nutrition research institute in addis ababa .
the rabbits were acclimatized to the laboratory environment prior to the experiment for a period of five days to normalize the animal 's physiological status during transportation and adopt them to the environment .
each rabbit was given a number unique within the study written with a black indelible marker pen on the inner surface of the ear and on the cage label .
the animals were individually housed in cages and kept at ambient temperature and relative humidity .
rabbit is a suitable model for this test of study since the results can be of value in predicting the likely skin irritancy potential of the test material to human .
one day before the test , six quadrants , 2.5 cm 2.5 cm in dimension of each rabbit skin was clipped free of fur from the dorsal and flank area using shaving machines on five places for the selected cosmetics and one for the untreated control which was treated with distilled water .
only animals with healthy intact epidermis by gross observation were used for the study , and three rabbits were used per test .
a quantity of 0.5 g test material , moistened with 0.5 ml of physiological saline , was put onto a piece of cotton gauze patch and placed in position on the assigned quadrant on shorn skin .
0.5 ml physiological saline was mixed with the test material so as to make the product moistened and to be attached well to the rabbit skin .
the patches were secured in position with a strip of surgical adhesive tape . to prevent
the rabbit removing the patches , the trunk of each rabbit was wrapped in a corset , and the animals were kept in individual cages for the duration of the exposure period .
four hours after application , the corset and patches were removed from each animal and any residual test material , gently swabbed away with cotton wool soaked in distilled water .
the test quadrants were examined for evidence of primary irritation both erythema ( redness ) and edema ( swelling ) at 24 , 48 , and 72 hours after removal of the cosmetic material .
the standard procedure of the united states testing company , oecd , and european chemicals bureau for the cosmetic product uses similar procedures as it has been initially described by draize and his colleagues in 1944 [ 31 , 34 ] .
table 1 indicates erythema and edema scale based on united states testing company ( ustc ) scale .
this test simulated the condition where the skin bears wound such as pimples and scratches .
the same procedure as for the intact skin was used except that the shaved skin was rubbed with a fine abrasive paper five times .
the intention of this test was to determine the effect of sun light on cosmetic products whether the sun light can activate the chemical species present in the products and cause irritation effect on the skin .
this test is similar to test 1 except that the cosmetics were applied on the bare rabbit skin for five consecutive days , and the rabbits were exposed to the sun or kept under shade for four hour per day .
the duration of observation was three days for single topical application on intact and abraded skin but up to five days for repeated application .
the primary irritation index ( pii ) for each treatment was calculated using the following formula :
( 1)pii= erythema grade at 24 , 48 and 72
hr + edema grade at 24 , 48 and 72 hrtotal number of observations .
the scores for erythema and edema at 24 , 48 , and 72 hours readings were totaled for the three test rabbits after the patch is removed and then divided by 18 to obtain the primary irritation index of the test material .
the denominator 18 represents the number of rabbits used ( three ) multiplied by two types of observations ( erythema and edema ) multiplied by the three observation times ( 24 , 48 , and 72 hr ) , and the result was interpreted against the skin irritation category . according to draize ( 1959 ) , if the calculated pii is 00.4 , 0.51.9 , 2.04.9 , and 5.08.0 , the irritation category is , respectively , negligible , slight irritation , moderate irritation , and severe irritation .
the cosmetic products identified in the survey as the most commonly bought by 433 consumers are given in table 2 .
top five cream cosmetic products most commonly used in jimma town were dove ( dov ) , glysolid ( gly ) , college ( col ) , top society ( top ) , and fair & lovely ( fai ) while the top five hand and body lotions were body talk ( bod ) , nivea ( niv ) , solea ( sol ) , lux ( lux ) , and magic fruit world ( mag ) .
consumers were asked whether they read the label on the container while buying the cosmetic product from the source ( wholesalers ) and nearly all of them ( 99.2% ) do not pay attention to what is written on the labels of cosmetic products . however , about 98% of the consumers interviewed were aware and curious about the expiry date but other label information such as ingredients from which the product is made was not considered . many consumers ( 78% )
do not like to buy the chinese , indonesian , indian , and ethiopian products because they were not sure about the quality of the product and might not be safe to human health .
in addition , most consumers ( 81% ) do not trust products imported from china as well .
we have identified that the main criteria that the shopkeepers were bringing the cosmetic products to sale were only based on customer preferences and the shelf life marked on the label .
based on the investigation made on the product labels , the different ingredients were identified .
most of the products those are commonly sold in jimma town cosmetic shops contain prohibited ingredients due to their possible health effects .
the ingredients were parabens , linalool , limonene , disodium edta , sodium lauryl sulphate , and triethanolamine ( table 5 ) .
for some of the products , such as col , niv , mag , and kri , no expiry dates were mentioned . after a single application on intact and abraded rabbit skin
, dov did not show any skin edema or erythema as the calculated pii score was zero under shade or under sun conditions .
all creams except gly and all lotions and creams showed higher pii when the cosmetics are applied under sun exposed skin ( table 3 ) .
mann - whitney u test indicated no significant difference between the creams applied once on intact and abraded skin ( p = 0.71 ) .
for all creams , except dove , the erythema appeared after 24 h and disappeared after 72 h. the untreated control group showed no erythema and edema . regarding the lotions , bod and holly ( hol ) caused pii of 0.06 on intact and pii of 0.1 to 0.17 on abraded skin .
pii of lotions significantly differed between applications on intact and abraded skin ( p = 0.0021 ) .
however , no significant difference was observed between the pii under shade and under sun .
this test was conducted to determine any adverse skin reaction to creams when used continuously for five days with or without exposure to direct sunlight .
the results showed that all creams tested caused a maximum pii of 0.17 without direct sunlight exposure and pii of 0.45 under direct sunlight .
dov could not show any sign of irritation when applied for five consecutive days except for abraded skin under sunlight . among lotions ,
in general maximum pii was observed for cosmetics applied on abraded skin under direct sunlight ( figure 1 ) .
statistically significant difference has been observed between pii of abraded skin and intact skin ( p = 0.012 ) .
strong significant difference of pii was abserved for cosmetics applied under shade and under direct sunlight ( p = 0.000 ) .
post hoc analysis was made to compare the irritation index between cosmetics applied between intact and abraded skin under shade or sun - exposed conditions .
irritation index was higher for the cosmetics applied on abraded skin under sun exposed ( absun ) than the rest of the applications .
figure 2 compares the four groups of cosmetic applications using pii of 95% confidence interval .
pii resulted from application of cosmetics on intact skin under shade ( intshade ) was significantly ( p < 0.0001 ) lower than pii of cosmetics applied on both intact and abraded skin under sun exposed conditions .
no significant difference ( p = 0.08 ) was observed between pii of cosmetics applied on intact skin under shade ( intsun ) and abraded skin under shade ( intshade ) . according to the mann - whitney u test , the pii calculated from cosmetics applied
just once significantly differed from the application of five consecutive days ( p value = 0.038 ) . with similar statistical test ,
the pii calculated under shade significantly differed from the pii under sun ( p = 0.000 ) .
significant difference of pii also observed between intact and abraded skin ( p = 0.006 ) .
cosmetics and personal care products should be nontoxic , nonirritating , and must be safe for the consumers .
the people use these products every day without knowing or being aware of the side effects of cosmetic products specifically in countries like ethiopia where the literacy rate is very low .
therefore , in this study , an effort had been made to assess the possible skin irritation ( dermal reaction ) , using rabbit as a model animal , that may result from the daily usage of these products in order to protect the consumers by educating the community and if necessary to call the attention of government about the need to regulate production and import of cosmetic products in the country .
our study has identified most cosmetics used by communities in jimma town were unsafe for daily use .
the absence strict safety regulation governing nonmedicated cosmetics by daca most probably has lead to the presence of unsafe cosmetic products in shops .
but some african countries like tanzania have their own cosmetics directives similar to the european and australian cosmetics directives . among the 14 cosmetic products selected
, those who have no expiry date ( col , niv , mag , and kri ) could pose public health risk as consumers could use them at any time due to absence of shelf life . in developed countries , such as developed ec member countries
the european directive for cosmetics ( directive number 76/768/eec ) insists that products should have a clear label specifying the ingredient composition , country of manufacture , and expiry date of the products .
almost all of the products commonly used by consumers in jimma town contain at least two ingredients that were prohibited from usage [ 36 , 37 ] .
almost all of the examined cosmetics in our study contain paraben or parabenzoic acid ( methyl paraben , propyl paraben ) which is suspected of causing endocrine disruption and breast cancer [ 19 , 38 ] .
darbre and harvey ( 2008 ) in their review of resent studies have confirmed that parabens were found in urine after topical application of skin care products on healthy human skin .
therefore , those products identified in our study may not be safe for human health .
a similarly study conducted by ewg ( 2009 ) indicated that 833 name - brand sunscreens were found unsafe due to unhealthy ingredients .
another risk identified in our study was the absence of list of ingredients on swe and vic which makes someone to suspect that there might be some toxic chemical component .
these products do not meet the safety requirements for cosmetics and should not be allowed for public marketing .
table 5 explains the ingredients and the possible health effects along with each cosmetic product .
regarding the erythema and edema , creams showed the least pii compared to other cosmetics for both single- and five - day application . among creams ,
dov was found to be the safest which has no skin irritation except for five - day application on abraded skin under sun exposure .
this also could indicate that the product may have no skin irritating chemicals in the products formula , and the manufacturing company could have been complied with the usfda standards which urge that cosmetic products should be nonirritating .
however , the harmful ingredient found in dov ( table 5 ) has to be replaced by safest ones .
the other cream cosmetics , col , top , and fai , produce erythema and edema which were rated as pii of 0.06 to 0.18 for a single application .
these products have negligible skin irritation and could be safe to be used by consumers as the pii ranges between 00.4 provided that the ingredients are also safe .
however , top may not be safe on repeated application when used on abraded skin under sun exposure as the pii score was found to be greater than 0.4 .
the pii of niv , lux , mag , sol , and bod lotions was between 0.0 and 0.27 with single application under shade , indicating that the products have negligible skin irritancy and safe to use as topical application . however , based on single application under sun exposure , magic fruit may not be safe when used on abraded skin .
on the basis of five - day application , lux , sol , kri , and hol may not be safe to human skin when used continuously under sun exposure , and the effect could be worse when used on abraded skin .
this study has revealed that continuous application of those cosmetics on abraded skin under sun exposure could be dangerous for skin health .
hence individuals with abraded skin better not to use cosmetic products unless otherwise advised by their physicians .
this study has identified that the cosmetics used may not be safe for topical application on human skin due to the ingredients found in them , absence of expiry date , and the skin irritation posed by them .
hence consumers have to be very curious and clearly know what they are using for their skin care .
we have identified cosmetics containing chemical ingredients that could cause public health problem such as cancer , endocrine disruption , or low sperm count in males [ 36 , 37 ] .
similarly , study done in denmark has indicated that the prevalence of allergic contact sensitization to cosmetic haptens among younger adults in the general population was a public health problem .
strategic followup and screening of body care products that are imported from abroad and produced in ethiopia could help to partly safeguard consumers ' health .
at least each product should have labels , and the ingredients should not have a suspected effect on human health .
in addition , public health personnel should work on awareness creation related to use of body care products .
cosmetics and personal care products should be nontoxic and should pose no risk under normal use .
all the products tested for their skin reaction showed negligible skin irritancy but dove had zero irritancy under the entire test conducted .
but , there are prohibited ingredients in all of the products tested which made the products unsafe for the intended use .
some products have no appropriate label claims according to legislation set by usfdca as well as the european cosmetic directives , and the products sold openly on the market are misbranded .
therefore , consumers have to be aware about the side effects related to cosmetic products , and they should be informed to read the labels on the products ' container .
similarly , cosmetic industries , importers , distributors , and retailers should consider whether the product they sale to the consumer meets appropriate label requested by the daca or not .
further study is suggested to know the chronic effect of those cosmetics in this study as well as laboratory analysis of the ingredients to identify mainly heavy metals . | background . rabbit skin model was used to test skin irritation of the most commonly used cosmetic products in jimma town , southwestern ethiopia .
the most commonly used cosmetics were dove , glysolid , college , top society , fair and lovely , nivea , lux , magic fruit world , solea , body talk , kris , holly , victoria , and sweet heart . methods .
intact and abraded rabbit skins were tested for erythema and edema under shade and under sun exposure .
draize primary irritation index ( pii ) was used to calculate skin irritation of each cosmetic .
cosmetic ingredients were analyzed from the labels .
results and discussion . only dove cream caused no skin irritation except for an abraded skin under sun exposure for five consecutive days .
it has been identified that application of cosmetics on abraded skin under sunny condition worsens the irritation .
cosmetic labels revealed that most ingredients used in all products were those restricted chemicals due to their adverse health effects .
conclusion .
this study has concluded that use of cosmetics under sunshine and also on abraded skin increases skin irritation .
hence , those users who have abraded skin are advised not to apply those cosmetics on continuous basis specifically under sun exposure . |
in malaysia , up to 60% of schooling adolescents suffer from different degrees of anemia based on hemoglobin concentration ( 1 ) . in respect to the escalating trend of anemia among adolescents in this country , and scanty data on this nutritional problem among this age group ,
thus , this interventional study was carried out aiming at comparing the effectiveness between a multimedia nutrition education intervention and non - nutrition education intervention ( provision of supplement alone ) in improving awareness level regarding iron deficiency among anemic adolescents .
the awareness components assessed include the causes , symptoms and preventive measures of iron deficiency .
this study was carried out in 2 phases ; but this paper includes results of those obtained from the intervention phase only . in the first phase , 855 adolescents from 8 secondary schools in rural areas of tanah merah were sampled using multistage cluster sampling technique . the assessment which took place in early 2010 resulted in 59.6% ( n=510 ) of anemia prevalence ( 1 ) .
the second phase of the study was a trial , in which only those who met the specified hemoglobin cut - off points ( 7 to 11.9 g / dl ( female ) and 7 to 12.9 g / dl ( male ) were recruited .
two hundred and eighty anemic adolescents were finally recruited and randomly assigned into 2 groups ; nutrition education receiver ( ne , n=156 ) and non - nutrition education receiver ( nne , n=124 ) . during the 3 months trial , the ne respondents attended scheduled nutrition education activities for one hour per week .
the education consisted of introduction to iron deficiency anemia and its prevention via healthy nutrition .
, iron deficiency anemia : symptoms and risk factors , iron deficiency anemia : prevention and treatment and prevent iron deficiency anemia nutritionally .
the activities comprised of lecture with question and answer session , video viewing and group discussions . in addition , they were also provided with brochures of similar topics as conveyed via lectures and videos once weekly .
whereas in the nne group , the respondents were given capsule form supplement containing 250 mg ferrous gluconate , 1 mg folic acid and 50 mg vitamin c once daily .
the compliance of supplementation was observed using a calendar - like consumption reminder sheet self - ticked by respondents and handed over at the end of intervention period .
the evaluation of the respondents awareness level was done using a self - developed multiple choices questionnaire at pre- and post - intervention .
the questionnaire comprised of 50 knowledge questions with yes and no answer options .
it has been tested for reliability and validity prior usage . as part of reliability testing process
, a pilot test was conducted involving 30 adolescent students from a school located in other district .
the students were asked to answer the questionnaire and give comment on the appropriateness , clarity and interpretability of the questionnaire .
cronbach ( ) value of 0.9762 was obtained showing the internal consistency of the questionnaire ( 2 ) .
the knowledge item analysis was then carried out by computing the percentage of correct responses , whereby the effectiveness of intervention on awareness level was compared between the two groups ( ne vs. nne ) using one - way anova analysis .
majority of respondents were malays ( n=254 ) followed by small number of chinese ( n=22 ) and indian ( n=4 ) .
as regards to economic status , more than half ( 68% ) were earning below the poverty line ( monthly income of rm720 ) ( 3 ) , with most of the fathers were self - employed , while the mothers were predominantly housewives .
more than 50% of total respondents had correctly defined anemia , with 87% of them agreed that iron deficiency anemia is the commonest type of anemia . besides , over 70% correctly recognized anemia symptoms as tiredness , dizziness and pale complexion . among the source of information on anemia reported by respondents were electronic media ( 51% ) , health provider ( 31% ) , peer ( 27% ) , mass media ( 20% ) , teacher or school ( 18% ) , family ( 15% ) and hospital or clinic ( 11% ) .
table 1 illustrates the between - group comparison ( ne vs. nne ) of correct response percentage at pre and post - intervention .
one - way anova results in table 2 reveals significant differences in mean of knowledge scores between both groups .
it shows that mean knowledge score of ne group had outperform nne group ( ne nne = 18.3 , p < 0.001 ) at post - intervention .
this study indicated that most of the respondents ( 87.9% ) agreed with the statement ida is preventable through intakes of iron - rich food / diet . yet , quite a few of them failed to identify local foods , which are rich in iron and vitamin c. as regards to role of iron inhibitor and enhancer , up to 77.5% of them agreed that tea and coffee are not good for iron absorption . other knowledge on iron deficiency anemia prevention strategies such as
between 71 to 91% of the respondents had correctly identify at least three signs or symptoms of anemia , whereas 50% , 64.3% , and 88.9% of them could specify the causes of anemia as insufficient dietary iron intake , reduced iron absorption , and excessive blood loss respectively .
besides , greater part of respondents ( 90.4% ) agreed that adolescent particularly the females are at risk of iron deficiency anemia .
poor awareness on iron deficiency has been also reported among adolescents elsewhere ( 4 , 5 ) .
the electronic media primarily the internet has become the most important medium for information transmission in this country and much effort in education has been focused on making the nation it - literate , beginning in school setting ( 6 ) . according to the world development indicators presented by world bank ( 7 ) , the internet users as percentage of population in malaysia in 2009 were 57.6% .
the rising trend in internet usage in this country is consistent with the finding where electronic media was ranked the highest information source among study respondents .
the nutrition education package provided to the respondents in ne group has been evidenced to enhance effectively the respective respondents awareness level ( pre 33.3 vs. post 48.6 ) .
comparable results have been reported ( 8) among primary school children in selangor and kuala lumpur , where not only awareness improved but also their practice on healthy eating ( 8) . in an earlier study done among overweight schoolchildren in kuala lumpur , video viewing has been proven effective in educating overweight children about obesity ( 9 ) .
this was supported by a study done in indiana , usa ( 10 ) which indicates that the addition of video to a nutrition education lesson enhances nutrition knowledge due to its attractiveness and attention captivating properties . besides , the potential of video as effective nutrition education tool has been also evidenced in enhancing young people s health and physical fitness ( 11 ) , as well as for education and management of specific diseases or health problems such as diabetes ( 12 ) , renal disease ( 13 ) and metabolic syndrome ( 14 ) .
the nutrition education package utilized in study had effectively enhanced awareness among anemic adolescents towards iron deficiency anemia and the role of healthy dietary practice as preventive measure .
we may propose the health authority to incorporate nutrition education intervention along with the supplementation program since both play important role , particularly in correcting iron status and preventing reoccurrence of iron deficiency among adolescents .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | backgroundthis study was carried out to compare the effect between nutrition education intervention and non - nutrition education intervention on awareness regarding iron deficiency among schooling adolescents in tanah merah , one of rural district in kelantan , malaysia.methods:this study which was started in year 2010 involved 280 respondents ( 223 girls , 57 boys , age : 16 yr ) from schools in tanah merah .
the selection criteria were based on hemoglobin level ( hb = 7 11.9 g / dl for girls ; hb = 7 12.9 g / dl for boys ) .
they were divided into 2 groups .
the first group received nutrition education package ( nutrition education , ne ) , whereas another group was entitled to receive non - nutrition education intervention ( non - nutrition education , nne ) ( supplement only ) .
both interventions were implemented for 3 months .
the changes in awareness among respondents of both groups were evaluated using multi - choices questionnaire.results:nutrition education receiver group ( ne ) demonstrated improvement in awareness at post - intervention .
no substantial improvement was demonstrated by the counterpart group ( nne).conclusion : multimedia nutrition education program conducted at school setting was in fact practical and effective in improving awareness on iron deficiency among anemic adolescents . |
posttranslational modification of proteins by phosphorylation plays a complex and critical role in the regulation of numerous biological processes . in recent years
, large efforts have been devoted to global - scale analysis of protein phosphorylation sites using various phosphoproteomics methodologies [ 1 , 2 ] .
these phosphoproteomics studies have focused chiefly on large - scale characterization of the phosphoproteomes in cultured cells or tissues .
in contrast , investigation of the phosphoproteomes in biological fluids is an emerging area , and studies of this type are relatively scarce .
phosphoproteins released into the fluid are diluted and mostly of low abundance , and they are present in a highly complex mixture , that is composed predominantly of nonphosphorylated proteins .
the issue is often compounded by overabundance of certain proteins such as albumin and immunoglobulins .
highly advanced bioanalytical strategies that have been developed and applied successfully in the context of cell and tissue phosphoproteomics are now being tailored for biological fluid phosphoproteomics .
recent studies of phosphoproteomics of biological fluids include serum and plasma [ 35 ] , csf [ 6 , 7 ] , saliva , and urine .
in particular , examination of phosphoproteomes in biological fluids obtained from sites proximal to specific organs represents a potential route to important mechanistic information as well as to biomarker discovery .
human bronchoalveolar lavage fluid ( bal ) is a proximal fluid commonly used for diagnosis of lung diseases including chronic obstructive pulmonary disease ( copd ) and lung cancer .
procurement of clinical bal specimens involves washing of the epithelial lining of the lung with saline using a fiberoptic bronchoscope .
molecular composition of bal reflects the status of the respiratory tract , and analysis of human bal composition at the molecular level therefore provides an attractive way towards improved understanding of disease mechanisms or discovery of biomarker signatures that are directly relevant to specific lung diseases .
the proteome of human bal has been studied numerous times in the context of various lung diseases [ 1014 ] .
in contrast , the phosphoproteome of human bal has not been characterized yet . in this study
our ongoing research program focuses on proteomics of human bal , and we aim to expand this program to encompass studies of posttranslational modifications .
initially , we set out to determine if phosphorylated proteins can be characterized in human bal using a mass spectrometry - based analytical platform , and to obtain a first description of the bal phosphoproteome , including assignments of the sites of phosphorylation .
the human bal specimens were provided by chiesi farmaceutici , parma italy ; the project was approved by the irb at the university of tennessee health science center .
the human bal samples were obtained from subjects without clinical diagnosis of copd or lung cancer .
the lavage was performed with four aliquots of 50 ml of saline delivered via a fiberoptic bronchoscope .
after centrifugation , the liquid component of bal was aliquoted and stored at 80c until analysis . to provide sufficient amount of protein ,
two separate pools of 3 ( pool 1 ) and 7 samples ( pool 2 ) , respectively , were analyzed in two independent experiments .
desalting was performed by ultrafiltration with spin concentrators ( mw cutoff of 5,000 da ) .
the samples in the concentrators were centrifuged ( 25 min ; 5,000 g ; 4c ) to produce ca .
after the first concentration step , water ( 4 ml ) was added to the retentate and the concentration step was repeated for a total of three times .
albumin and five other high - abundance proteins were removed with the hu-6 multiple affinity removal system ( mars ) spin cartridge ( agilent ) following procedure provided by the manufacturer .
protein concentration before and after mars depletion was determined with the micro bca assay ( pierce ) . after pooling
, the final protein content was 450 g ( pool 1 ) and 900 g ( pool 2 ) .
briefly , the dried proteins in each pooled sample were redissolved in 45 l of 400 mm ammonium bicarbonate buffer containing 8 m urea ( ph 8) .
prior to digestion , the proteins were reduced with dtt ( 5 l of 50 mm solution , incubation for 1 h at 56c ) followed by alkylation with iodoacetamide ( 5 l of 200 mm solution , incubation for 45 min at room temperature in the dark ) .
the sample was diluted with water to 2 m final urea concentration , and 20 g of sequencing - grade trypsin ( promega ) were added .
the mixture was acidified with tfa and subjected to solid phase extraction using a home - made spe minicolumn packed with c18 stationary phase .
after elution from the minicolumn , the sample was dried and the redissolved in 90% water/10% acetic acid , as required for immobilized metal ion affinity chromatography ( imac ) .
the imac procedure , which serves to enrich the proteolytic digests for phosphopeptides , was performed with the phosphopeptide isolation kit ( gallium / ida , pierce ) .
each bal peptide digest was applied to the column , and the phosphopeptides were bound by incubation at room temperature for 1 h. the column was washed with the following solutions : 40 l of 0.1% acetic acid ( 2 washes ) , 40 l of 0.1% acetic acid/10% acn ( 2 washes ) , and 40 l of water ( 2 washes ) .
the phosphopeptides were eluted from the imac column with two 40 l - aliquots of 200 mm sodium phosphate ( ph 8.4 ) , followed by a single elution with 40 l of 100 mm sodium phosphate/50% acn .
the eluates were combined , the resulting sample was acidified , and its volume was reduced to ca 25 l in a vacuum centrifuge . prior to lc - ms / ms analysis , the imac - enriched phosphopeptides were desalted with ziptipc18 ( millipore , billerica , ma , usa ) , using the procedure provided by the manufacturer .
the phosphopeptides bound to the ziptipc18 column were eluted with 4 l of 50% acn/0.1% formic acid and diluted with 6 l of 0.5% formic acid ; aliquots of these samples were injected onto the lc - ms / ms instrument .
the lc - ms / ms analyses were performed with an ltq linear ion trap mass spectrometer ( thermo electron ) that was interfaced with a nano - lc system ( dionex ) .
the imac - enriched peptide digests were loaded onto a fused - silica microcapillary column / spray needle ( picofrit , 15 cm length , 75 m i.d . ; new objective ) packed in - house with c18 stationary phase ( michrom bioresources ) .
the peptides were separated using a 90-min linear gradient from 0% to 90% mobile phase b. mobile phase b was 10% water/90% methanol/0.05% formic acid ; mobile phase a was 98% water/2% methanol/0.05% formic acid .
the lc - ms / ms data were acquired in the data - dependent mode .
each of the pooled samples ( pool 1 and pool 2 ) was analyzed in triplicate .
the lc - ms / ms datasets were used to search the uniprot database ( subset of human proteins ) using turbosequest search engine that was part of bioworks 3.2 ( thermo electron ) .
the following parameters were used in the searches : full - trypsin specificity , dynamic modifications of phosphorylated s , t , and y ( + 80.0 ) , and dynamic modifications of oxidized m ( + 16.0 ) .
the search results were filtered to include peptides retrieved xcorr values 2.00 , and 3.50 for doubly and triply charged precursor ions , respectively .
all ms / ms spectra for the individual phosphopeptides that passed this initial filtering were inspected manually .
this manual validation checked for the presence of a product ion that corresponds to the neutral - loss of phosphoric acid ( [ m+2h-98 ] for doubly charged ions or [ m+3h-98 ] for triply charged ions ) ; and for coverage of the phosphopeptide sequence by the b- and/or y product - ion series .
assignments of the sites of phosphorylation were verified by inspecting the b- and/or y - product ions that flanked the phosphorylation site assigned by the search engine .
data from analyses of pool 1 and pool 2 were combined to produce the final phosphoprotein panel .
additional information about the phosphorylation sites / phosphoproteins was obtained from the uniprot annotations , the phosphosite knowledgebase ( http://www.phosphosite.org/ ) , the human protein atlas knowledgebase ( http://www.proteinatlas.org/ ) , the ingenuity pathway analysis tool ( ipa ) , and from searches of primary literature .
for this pilot study , a simple gel - free bioanalytical strategy was employed .
specific characteristics of human bal have to be taken into account for sample processing and protein extraction .
first , proteins in bal are diluted in saline , and therefore sample concentration and desalting are needed .
second , high background created by overabundant plasma proteins would interfere with analysis of low - level phosphoproteins , and removal of these proteins must be accomplished . in our study , to process the bal samples for phosphoproteome analysis , salts were removed by ultrafiltration , and overabundant plasma proteins were depleted using immunoaffinity capture .
proteins in the depleted bal samples were digested with trypsin , and the digests were subjected to immobilized metal ion affinity chromatography ( imac ) enrichment for phosphopeptides .
the enriched digests were analyzed by lc - ms / ms on an ltq ion trap mass spectrometer to obtain ms / ms data that indicate the phosphopeptide sequences and phosphosite locations in these peptides .
manual inspection of all phosphopeptide search results and of the corresponding ms / ms data was performed to confirm the validity of the phosphopeptide matches . of diagnostic value in the context of ms / ms fragmentation
was the neutral loss of the elements of phosphoric acid from the phosphopeptide molecular ions .
this fragmentation pathway , which is prominent in the ion trap mass spectrometer , leads to the appearance of a characteristic product ion in the ms / ms spectrum of a phosphopeptide .
this well - known scenario is illustrated in figure 2 , which shows the ms / ms spectrum for the phosphopeptide iedvgpsdeeddsgkdk .
this spectrum displays a prominent product ion at m / z 860.7 , which corresponds to the loss of the elements of phosphoric acid from the doubly charged precursor ion .
in addition , a number of product ions from the b- and y - series are present that determine the amino acid sequence of the phosphopeptide . peaks at m / z 682 ( b6 ) and m / z 1137 ( y10 ) indicate the exact location of the phosphorylation site on ser 255 of human heat shock hsp 90-beta .
each of the two pooled bal samples that were analyzed produced a set of 13 phosphoproteins .
five of these phosphoproteins were common to both samples ; in addition , each sample yielded a unique group of phosphoproteins .
this is not unexpected given the large biological variability associated with clinical specimens , and variable phosphoprotein signatures have been also observed for other clinical samples .
overall , interrogation of the imac - enriched digests of depleted bal samples with lc - ms / ms resulted in the characterization of 36 unique phosphopeptides that contained a total of 26 phosphorylation sites and mapped to 21 proteins .
our results demonstrate that characterization of bal phosphoproteome is feasible , and the phosphoprotein panel represents new findings that expand our knowledge of the molecular characteristics of bal proteins .
since the focus of our pilot study reported here was on first description of the human bal phosphoproteome , the scope of the study was limited to qualitative analyses of a small number of specimens from female donors only .
this initial examination was not intended to characterize phosphoprotein biomarkers associated with a specific lung disease but to initiate the building of a detailed phosphoprotein / phosphosites catalog as a starting point for future differential phosphoproteomics efforts . in terms of the size of our initial bal phosphoprotein panel , our results are comparable , for example , to a csf phosphoproteome study that revealed 44 phosphoproteins , or to a recently published catalog of the urine phosphoproteome that included 45 phosphopeptides from 31 proteins .
our initial exploration of the bal phosphoproteome was not expected to yield a complete description of all bal phosphoproteins , and it is possible that some phosphoproteins escaped detection due to their low abundance , unfavorable properties of the corresponding phosphopeptides influencing their behavior during analyses , and other issues . clearly , these pilot results can be expanded in future efforts to enhance the bal phosphoproteome coverage through modifications of the bioanalytical workflow such as incorporation of additional separation / enrichment dimensions .
bronchoalveolar lavage samples components of the epithelial lining fluid , and proteins that are found in bal are of diverse origin .
they may be released by different types of resident and/or infiltrating cells ; many plasma proteins are also identified in bal . to supplement our experimental findings on the phosphorylation status of bal proteins , we compiled additional information on protein localization from several protein knowledgebases , including ingenuity and the human protein atlas , hpa ( see table 3 and figure 3 ) .
regarding tissue - specific protein expression , inspection of protein expression profiles in hpa showed that the majority of proteins from our dataset are expressed in the lung and in other tissues / organs .
analysis of subcellular compartment categories for proteins from our panel showed a strong representation of cytoplasmic proteins ( 52% ) ; four proteins ( 19% ) were classified as extracellular and include plasma proteins kininogen-1 and alpha-2-hs - glycoprotein whose phosphorylated counterparts have also been characterized in human plasma / serum phosphoproteome [ 3 , 5 ] .
the bal phosphoprotein panel ( table 2 ) includes proteins with diverse functional characteristics , including structural proteins ( vimentin , plastin-2 ) , transcriptional regulators ( splicing factor 1 , hepatoma - derived growth factor ) , chaperones ( heats shock protein hsp 90-alpha and -beta ) , and others .
several of the proteins whose phosphorylation was characterized here have known connection to lung function and perturbations due to environmental stresses including smoking , and/or to lung disease .
for example , ferritin is an important mediator of iron homeostasis , and increased levels of ferritin have been found in the lavage of smokers .
the rationale for this increase is , at least is part , that smoke particles cause iron accumulation in the respiratory tract , and increased expression of ferritin is part of the host response , aimed to sequester the iron .
phosphorylation of plastin-2 modulates its function in the assembly of actin networks , and it is associated with leukocyte activation in response to various stimuli [ 19 , 20 ] .
recently , plastin-2 has been identified in human bal proteome as a component of a pulmonary disease marker profile . in conclusion , this study presents novel findings towards description of the human bal phosphoproteome . since aberrant protein phosphorylation associated with specific lung diseases
could potentially be reflected as alterations in bal phosphoproteins , this study lays an important foundation for future differential phosphoprotein profiling for biomarker discovery . | global - scale examination of protein phosphorylation in human biological fluids by phosphoproteomics approaches is an emerging area of research with potential for significant contributions towards discovery of novel biomarkers . in this pilot work
, we analyzed the phosphoproteome in human bronchoalveolar lavage fluid ( bal ) from nondiseased subjects .
the main objectives were to assess the feasibility to probe phosphorylated proteins in human bal and to obtain the initial catalog of bal phosphoproteins , including protein identities and exact description of their phosphorylation sites .
we used a gel - free bioanalytical workflow that included whole - proteome digestion of depleted bal proteins , enrichment of phosphopeptides by immobilized metal ion affinity chromatography ( imac ) , lc - ms / ms analyses with a linear ion trap mass spectrometer , and searches of a protein sequence database to generate a panel of bal phosphoproteins and their sites of phosphorylation .
based on sequence - diagnostic ms / ms fragmentation patterns , we identified a collection of 36 phosphopeptides that contained 26 different phosphorylation sites .
these phosphopeptides mapped to 21 phosphoproteins including , for example , vimentin , plastin-2 , ferritin heavy chain , kininogen-1 , and others .
the characterized phosphoproteins have diverse characteristics in terms of cellular origin and biological function . to the best of our knowledge , results of this study represent the first description of the human bal phosphoproteome . |
knee oa is one of the most common joint disorders and causes considerable pain and immobility .
the initial treatment is nonoperative and consists of patient education , weight reduction , physical therapy , and , if needed , medication . drugs rarely relieve the symptoms entirely and mainly act as a palliative agent .
other rehabilitative interventions are based on altering knee biomechanics , which may influence the development and progression of knee oa [ 4 , 23 ] . in selected patients with oa of the medial compartment , improvements in pain , function , and loading forces reportedly occur with valgus unloader knee braces .
one randomized controlled trial ( rct ) suggested knee bracing resulted in better knee function compared with no brace in patients with oa with varus malalignment .
many patients in that study , however , did not adhere to brace treatment , mainly because of skin irritation and bad fit .
however , whether bracing corrects malalignment remains controversial [ 10 , 15 , 20 , 21 ] .
like knee bracing , laterally wedged insoles may unload the diseased compartment , and two studies suggest wedges may correct varus malalignment [ 16 , 26 ] . one crossover study showed no effect of wedged soles in an elderly population with advanced stages of oa .
however another study reported an improvement of symptoms in patients with mild to moderate oa treated with laterally wedged insoles .
another study reported a similar effect while observing decreased nsaid intake when foot orthoses were used to treat knee oa .
a cochrane review concluded there is some evidence that foot orthoses have additional beneficial effects in the treatment of symptomatic knee oa .
laterally wedged soles may represent a substantial potential in the treatment of symptomatic knee oa because they are safe and generate fewer costs than knee bracing .
furthermore , foot orthoses are easy to apply , and good adherence to the intervention has been reported [ 1 , 25 ] .
we therefore asked whether laterally wedged insoles would result in reduction of pain and improvement in womac function scores compared with valgus bracing in patients with symptomatic medial compartmental knee
. we also asked whether both treatments would correct knee malalignment in the frontal plane .
we conducted a prospective open - label ( completely unblinded ) parallel rct in patients with symptomatic medial compartmental knee oa .
all patients had been treated initially according to the practice guidelines by the dutch college of general practitioners ; including patient education , physical therapy and , if needed , analgesic use .
we diagnosed the oa as medial when pain and tenderness in combination with osteoarthritic signs according to the kellgren - lawrence system of grade 1 or higher were located over the medial tibiofemoral compartment of the knee .
the radiographic score was measured on digitalized standard short posteroanterior radiographs taken of the patient in the standing position .
patients with symptoms not related to medial compartmental oa , younger than 35 years , an insufficient command of the dutch language , or no varus malalignment were excluded .
the degree of knee alignment was assessed by the hip - knee - ankle ( hka ) angle and measured on a digitalized whole - leg radiograph taken with the patient in the standing position .
earlier we reported high intraobserver ( icc = 0.98 ; 95% ci = 0.940.99 ) and interobserver ( icc = 0.97 ; 95% ci = 0.940.99 ) agreement for measurement of the hka angle using this technique .
the hka angle was defined as the angle between two prolonged lines : one line of the center of the femur head to the top of the femoral notch and a second line from the center of the ankle to the center of the tibial spines .
a positive value represented varus direction ; patients with an hka angle of 0 or less were excluded .
the sample size calculation was based on the baseline mean visual analog scale ( vas ) score for pain of 6.0 and sd of 2.2 in the study of brouwer et al . who included patients according to similar criteria .
we estimated a 1-point difference in vas between the two groups would represent a clinically relevant difference , being 15% of the baseline score .
to detect such a difference with two - sided testing ( = 0.05 and power of 80% ) , we needed 40 patients in each group . with the assumption of 15% rate of loss of followup
therefore between january 2006 and september 2007 , we recruited 92 patients meeting our criteria ; one investigator ( tmr ) enrolled all participants .
one patient with medial compartment oa and clinical varus alignment was excluded because of valgus alignment assessed on the whole - leg radiograph , resulting in a total sample of 91 patients .
there were 45 patients in the insole group and 46 in the bracing group ( table 1 ) ; four patients in the insole group and four in the bracing group were lost to followup .
four patients in the insole group and six in the bracing group changed their initial treatment during the 6-month followup to other nonoperative or surgical treatment ( fig . 1 ) .
the primary reason was no effect of treatment ( four of four patients in the insole group , and three of six patients in the brace group ) ; but other reasons included bad fit , reduction of symptoms , and increased crepitus at the knee.table 1baseline characteristics of the study population and for the two intervention groupscharacteristicstudy population ( n = 91)insole group ( n = 45)brace group ( n = 46)age ( years)*54.7 ( 7.0)54.4 ( 6.5)54.9 ( 7.4)gender ( % female)496535body mass index ( kg / m)29.2 ( 4.5)29.4 ( 4.9)29.0 ( 4.2)osteoarthritis medial grade ( % ) 1413248 2192315 3394237 4130osteoarthritis lateral grade ( % ) 0747672 1242226 2222analgesic use ( % ) none484552 when needed232422 daily293126pain severity ( vas , 010)*5.6 ( 2.6)5.7 ( 3.0)5.6 ( 2.2)function ( womac , 0100)*46.6 ( 18.4)46.5 ( 18.9)46.8 ( 18.2)hka angle ( )*6.9 ( 3.6)6.9 ( 3.6)7.0 ( 3.6 ) * values are expressed as means , with sds in parentheses ; positive angle represents varus alignment ; vas = visual analog scale ; hka = hip - knee - ankle angle.fig .
baseline characteristics of the study population and for the two intervention groups * values are expressed as means , with sds in parentheses ; positive angle represents varus alignment ; vas = visual analog scale ; hka = hip - knee - ankle angle .
participants were randomized according to a computer - generated procedure ( block randomization , with variable sizes of the blocks ) ; the randomization codes were held by an independent observer ( mr ) to ensure masked blocking .
the participants were randomly allocated to their groups after informed consent had been obtained and all baseline measurements were completed . at baseline , we recorded age , gender , body mass index , severity of radiographic oa , varus alignment , analgesic use during the previous month , estimated average for pain severity during the previous week on a vas ( 010 , with a lower score representing less pain ) , and knee function using the womac score ( 0100 , with a higher score representing better outcome )
. participants were assigned either to an intervention group receiving a shoe - inserted leather sole with a lateral - wedge cork elevation of 10 mm along the entire length of the foot ( fig .
the shoe - inserted sole was custom made and fitted by a specialized orthopaedic shoe technician .
the valgus knee brace was commercially available for the right / left leg in four sizes ( mos genu ; bauerfeind ag , kempen , germany ) and consisted of a thigh shell and a calf shell connected by coated aluminum hinges on the medial and lateral sides ( fig .
the degree of valgization depended on the degree of malalignment and the acceptance of the patient .
participants were instructed to wear the insole or brace as much as tolerated , and they were asked to register the number of hours per week they wore the insole or brace.fig .
2an image of a left foot shows the leather sole and a laterally wedged cork elevation of 10 mm ( 6 wedge).fig .
an image of a left foot shows the leather sole and a laterally wedged cork elevation of 10 mm ( 6 wedge ) .
an image of a left knee shows the mos genu knee brace . at 6 months , one nonblinded investigator ( tmr ) , a trained orthopaedic surgeon , assessed the followup measurements including vas and womac scores , physical examination , analgesic use , and the mean number of hours per week
secondary outcome measures were knee function using the womac subscale and varus alignment correction in the frontal plane using the hka angle .
the difference in degrees between the hka angles assessed on a whole - leg radiograph with and without wearing the insole or brace was used .
responders to the treatment were defined as having an improvement of 20% or more compared with the baseline score for pain ( vas ) and function ( womac function subscale score ) in accordance with the omeract - oarsi set of responder criteria . the optimal amount of time to wear an insole or brace during the day has not been determined , and compliance remains arbitrary .
patients who were compliant were defined a priori as patients using the insole or brace more than 42 hours a week ( 7 days times 6 hours , which represents 75% of the working day ) .
we established whether the variables had a normal distribution using the normality shapiro - wilk test .
linear regression for continuous outcome measures ( vas pain , womac function , and hka angle ) and logistic regression for binary outcome measures ( responder yes or no ) were used to analyze the treatment effect . because we did not standardize medication use , we adjusted all analyses for medication use during the study .
the last - value - carried - forward method was used for the missing data of patients lost to followup .
the primary analysis was by intention to treat in that all participants properly randomized were included in the analysis even if they did not receive the treatment they were allocated to receive .
a secondary analysis was limited to the 73 participants who received ( or were compliant with ) the treatment to which they were randomized ( per protocol analysis ) .
subgroup analysis was performed for patients with medial knee oa lower than kellgren - lawrence grade 2 versus grade 2 or higher because it has been suggested laterally wedged insoles are more effective in early medial compartment knee oa .
the effect size was calculated as the difference in mean outcomes of the insole group and brace group , divided by the sd of the outcome in the brace group .
we used spss version 15.0 ( spss inc , chicago , il ) for statistical analysis .
after 6 months , we observed no differences between the insole group and the brace group for vas pain scores ( mean , 0.06 ; 95% confidence interval [ ci ] , 1.05 , 0.93 ; effect size , 0.03 ) and womac function scores ( mean , 0.15 ; 95% ci , 7.95 , 7.65 , effect size , 0.008 ) . compared with baseline , the pain severity and womac function scores improved in both groups ( table 2 ) . the intention - to - treat and per - protocol analyses showed no differences in percentages of responders ( improvement of 20% compared with the baseline scores for vas pain and womac function ) between the insole and the brace groups ( 13% versus 20% and 14% versus 18% , respectively).table 2primary and secondary outcomes changes compared with baselineoutcomeinsole group ( n = 45)brace group ( n = 46)difference between groupseffect sizepain severity ( vas , 010)0.9 ( 2.4)1.0 ( 2.2)0.06 ( 1.05 , 0.93)0.03function ( womac , 0100)4.2 ( 16.9)4.0 ( 18.9)0.15 ( 7.95 , 7.65)0.008hka angle ( )0 ( 0.9)0.3 ( 1.0)0.22 ( 0.68 , 0.25)0.22 * values are expressed as means , with sds in parentheses ; four patients were lost to followup ; values are expressed as means , with 95% confidence intervals in parentheses , and are corrected for gender and use of pain medication at baseline and followup ; vas = visual analog scale ; hka = hip - knee - ankle angle .
primary and secondary outcomes changes compared with baseline * values are expressed as means , with sds in parentheses ; four patients were lost to followup ; values are expressed as means , with 95% confidence intervals in parentheses , and are corrected for gender and use of pain medication at baseline and followup ; vas = visual analog scale ; hka = hip - knee - ankle angle .
varus alignment correction when wearing the insole or brace was similar in the two groups ( 0.22 ; 95% ci , 0.68 , 0.25 ; effect size , 0.22 ) .
the mean varus alignment ( hka angle ) for the insole group ( 6.9 ; sd , 3.6 ) was similar ( p = 0.8 ) at baseline compared with when wearing the wedge ( 6.9 ; sd , 4.1 ) .
the mean hka angle for the bracing group was similar ( p = 0.3 ) with ( 7.0 ; sd , 3.6 ) and without the brace ( 6.7 ; sd , 3.2 ) . at 6 months , 71% of patients in the insole group complied with the treatment , which was greater ( p = 0.015 ) than 45% for the brace group .
the laterally wedged insole was worn longer ( p = 0.006 ) during the week , with a mean of 57.8 hours ( sd , 28.8 hours ) in comparison to a mean of 38.8 hours ( sd , 32.2 hours ) for the knee brace .
subgroup analysis stratified for patients with mild oa ( kellgren - lawrence grade 1 ) showed a slightly greater ( p = 0.068 ) percentage of responders in the insole group ( 46% ) than in the brace group ( 15% ) .
skin irritation was the main complaint in the brace group ( n = 10 ) , and two patients had small blisters develop that had no clinical consequences .
there is controversial evidence regarding whether foot orthoses or knee braces improve pain and function or correct malalignment in selected patients with oa of the medial knee compartment .
insoles may represent a substantial treatment potential because they are safe and generate fewer costs than knee bracing .
we asked whether laterally wedged insoles or valgus braces would reduce pain , enhance functional scores , and correct varus malalignment .
first , the assessor was also the caregiver , and the one who informed the patient about the aims of the study .
although the kind of interventions did not allow blinding of patients , the study would have been stronger by blinding the assessor for the functional outcome measurement ( clinical knee score ) , eg , by using an independent assessor .
we used an exploratory approach but realize we did not determine our sample size to test for subgroup interactions .
interaction tests have high false - negative risks , and results should be translated into practice with caution .
third , our power permitted us to detect a 15% difference in pain reduction from baseline between the two groups .
in hindsight , this may have been too optimistic because a recent crossover study failed to show changes greater than 10% between a neutral and a laterally wedged insole .
these small effects for the insole and brace groups probably prevented us from observing differences between the two treatments .
fourth , this study had a comparative effectiveness design , and the lack of a true control group may mean the changes observed in both groups are not real .
fifth , the study was conducted in a tertiary referral university medical center that may affect the external validity of the study . however , the eligibility criteria were not highly selective and we believed the potential recruits were representative of patients in the local community .
we found no differences in pain reduction and knee function improvement for laterally wedged insoles compared with valgus knee bracing for treatment of medial compartment knee oa after 6 months . according to the omeract - oarsi set of responder criteria for clinical trials in oa , 13% and 20% of our patients benefited from either the insole or brace treatment .
the compliance in the insole group was greater compared with that for brace therapy , and the laterally wedged insole was worn longer during the day with a mean of 8 hours compared with 5.5 hours for the brace .
subgroup analysis showed a better effect for the insole compared with the brace for patients with mild medial oa .
described improvement on the womac pain scale of 9% in 41 patients treated with an unloader valgus brace , which was better than a nonbraced control group .
brouwer et al . noted a better knee function score ( an improvement of 4 units of 100 ) after valgus bracing compared with nonbracing in a group of 95 patients with medial knee
a recent crossover rct concluded wedged shoe insoles were not efficacious in patients with medial knee
they compared laterally wedged insoles with neutral insoles , which may act as shock absorbers and relieve symptoms .
we found a laterally wedged insole and a knee brace improved pain by a mean of 1 unit ( of 10 ) and function by a mean of 4 units ( of 100 ) from baseline .
the omeract - oarsi defines a response to the treatment as having an improvement of 20% or greater for pain and function compared with baseline .
we found no difference in percentage of responders ( 13% and 20% ; respectively ) between treatments after 6 months of followup .
pham et al . also reported low percentages of responders for pain ( 27% ) and function ( 29% ) in patients treated with a laterally wedged insole after 12 months .
it may be too ambitious to expect a 20% or greater improvement in function , especially when one bears in mind established operative treatments such as valgus - producing high tibial osteotomy in patients with adequate correction achieved only 12% improvement on a 100-point hospital for special surgery scale 1 year postoperatively .
some authors have suggested lateral - wedge foot orthoses and braces unload the diseased medial compartment and improve symptoms by providing valgus stress [ 10 , 25 ] .
we used a 10-mm cork elevation , which represents a 6 lateral wedge , because more elevation is uncomfortable to wear .
a specialized orthopaedic technician applied the noncustom - made knee brace and adjusted valgus alignment as tolerated .
our analysis showed no reduction in varus malalignment with the use of a laterally wedged insole or a knee brace .
alignment only provides a static impression , and correction in the frontal plane may not affect clinical outcomes in the short term .
reported that when knees with medial compartment oa are braced , neutral alignment performs as well as or better than valgus alignment .
studies on the gait of a small number of patients suggest insoles and knee braces reduce the adduction moment about the knee [ 16 , 24 ] .
the improvement in knee pain we observed in both groups may be attributed to unloading of the diseased compartment during gait . the optimal amount of time to wear an insole or brace during the day has not been determined .
shoe inlays potentially may reduce knee stresses by acting as a shock absorber whereas proprioception may play a major role in the working mechanism of a brace .
we defined compliance rather arbitrarily as occurring in patients wearing the insole or the brace 6 hours a day .
although compliance was greater in the insole group than in the brace group , no differences in clinical outcomes could be detected after 6 months .
reduction of muscle cocontractions may continue even after removing the insole or brace , which would result in a lasting effect .
perhaps there is a threshold in time after which wearing the insole or brace does not contribute to the effectiveness .
ogata et al . suggested laterally wedged insoles are most effective in patients with low - grade oa . based on explorative subgroup analysis
, we found almost of our patients with medial oa ( < kellgren - lawrence grade 2 ) responded to the laterally wedged insole after 6 months .
we found a 10-mm laterally wedged insole was well tolerated and provided a borderline better response than valgus bracing in patients with kellgren - lawrence grade 1 oa . especially for patients who do not want to undergo surgery
, this may provide an alternative treatment option , which may be the focus of future research .
few good clinical studies have been published on orthoses or bracing for treatment of medial compartment knee
based on our data we conclude laterally wedged insoles may be an alternative to knee bracing for noninvasively treating the symptoms of medial knee oa . | background there is controversial evidence regarding whether foot orthoses or knee braces improve pain and function or correct malalignment in selected patients with osteoarthritis ( oa ) of the medial knee compartment .
however , insoles are safe and less costly than knee bracing if they relieve pain or improve function.questions/purposeswe therefore asked whether laterally wedged insoles or valgus braces would reduce pain , enhance functional scores , and correct varus malalignment comparable to knee braces.patients and methodswe prospectively enrolled 91 patients with symptomatic medial compartmental knee oa and randomized to treatment with either a 10-mm laterally wedged insole ( index group , n = 45 ) or a valgus brace ( control group , n = 46 ) .
all patients were assessed at 6 months .
the primary outcome measure was pain severity as measured on a visual analog scale .
secondary outcome measures were knee function score using womac and correction of varus alignment on ap whole - leg radiographs taken with the patient in the standing position . additionally , we compared the percentage of responders according to the omeract - oarsi criteria for both groups.resultswe observed no differences in pain or womac scores between the two groups .
neither device achieved correction of knee varus malalignment in the frontal plane . according to the omeract - oarsi criteria , 17% of our patients responded to the allocated intervention .
patients in the insole group complied better with their intervention .
although subgroup analysis results should be translated into practice cautiously , we observed a slightly higher percentage of responders for the insole compared with bracing for patients with mild medial oa.conclusionsour data suggest a laterally wedged insole may be an alternative to valgus bracing for noninvasively treating symptoms of medial knee oa.level of evidence level i , therapeutic study .
see the guidelines for authors for a complete description of level of evidence . |
adverse events ( aes ) caused by medication errors ( mes ) continue to be one of the great challenges in acute care settings .
recent data suggest that each year more than 1.5 million patients are harmed by me in the united states .
according to the report preventing medication errors , me affect approximately 5% to 10% of patients in the united states and cause more than 7000 deaths annually .
the definition of me remains inconsistent although attempts to develop an international definition have been made .
the national coordinating council for medication error reporting and prevention ( ncc merp ) states that a medication error is any preventable event that may cause or lead to inappropriate medication use or patient harm while the medication is in the control of the health care professional , patient , or consumer .
such events may be related to professional practice , health care products , procedures , and systems , including prescribing ; order communication ; product labeling , packaging , and nomenclature ; compounding ; dispensing ; distribution ; administration ; education ; monitoring ; use .
studies conducted in various healthcare settings report medication error rates between 1970% , depending on research methodology [ 7 , 913 ] .
high rates continue to exist despite increased levels of awareness about me in healthcare over the past decade and new developments in technology designed to reduce such errors .
one large study analysing when in the medication process me occurred found that 39% of errors occurred during ordering , 38% during medication administration , 12% during order transcription , and 11% during medication dispensing .
barker and colleagues reported that every fifth medication dose administered resulted in an error , including the wrong time of administration ( 43% ) , omission of a dose ( 30% ) , wrong dosage ( 17% ) , and other errors ( 10% ) .
cardiovascular medications have been cited as one of the most common classes of drugs associated with me [ 2 , 4 , 15 , 17 ] .
lapointe and jollis detected a medication error prevalence rate of 32% in cardiovascular patients . in more than 40% of those mes ,
the adverse drug event prevention study group reported 2.4 odds of severe adverse drug events from cardiovascular medications compared to other medications [ 2 , 4 , 15 ] .
hence , me in cardiovascular settings need special attention , and it can be assumed that cardiovascular patients are at an increased risk for negative consequences from me . however , the exact rate of me is difficult to determine due to varying methods of error reporting and calculating error rates .
the information used to decide whether errors occurred depends strongly on the way in which the information is gathered , and many different methods have been used [ 1821 ] .
examples of methods utilized to collect data on medication errors include critical incidence reporting systems ( cirss ) , generally anonymous self - reporting tools used for me reporting and analysis ; incidence reports which typically involve health care providers actively recording information on events ; direct observation ; trigger tools ; chart review ; surveys of from health professionals or patients regarding drug related events .
these methods can be complementary , and a combination may be useful [ 19 , 20 ] . however , currently used methods like incident reports or chart reviews are known to underestimate the incidence of me . furthermore , most existing tools are not specifically designed to measure me and may therefore miss certain types of me .
since no data about pragmatic , easy to use , and low price me reporting tools exist , new me reporting approaches focussing just on me reporting are ardently needed . after an exhausting literature search , no studies utilizing a specific me self reporting tool aiming to report me anonymously could be identified . to close this gap
, we conducted the first me reporting study according to a novel method in a swiss cardiovascular surgery department .
the purpose of this study was to examine me events in a cardiovascular surgery department of a tertiary level hospital using a new medication error reporting method .
the specific aims of the study were ( 1 ) to determine frequency and type of me , ( 2 ) to assess the number of mes prevented by registered nurses , ( 3 ) to assess the consequences of me for patients , and ( 4 ) to compare the number of mes reported by a newly developed medication error self reporting tool to the number reported by the traditional incident reporting system .
the study was conducted in the cardiovascular surgery department of the university hospital of bern , switzerland .
a convenience sample of registered nurses ( rns ) involved in direct patient care was recruited .
all rns ( n = 119 ) working on the units during the data collection period were eligible to participate in the study .
the mean work experience was 9.5 years ( sd 9.0 ) , and the mean work experience in the cardiovascular surgery setting was 5.6 years ( sd 5.0 ) .
the outcome variables of interest in this study were ( 1 ) me frequency and type , ( 2 ) me prevention by rns , and ( 3 ) me consequences for patients .
to calculate the incidence of me during the one - month study period the unit of analysis in this study was the number of administered medication doses .
the amount of administered doses during the data collection period was calculated retrospectively by medical chart review . according to aspden ,
the medication process is a five - step process that encompasses ordering , transcribing , preparing , administering , and monitoring .
the clinical medication use process in the study department is in line with this five - step process , and the rns in our department are responsible in all steps but the ordering . after a physician ordered a medication regime for a patient
, nurses proofread the prescription , transcribe the handwritten medication orders into a separate medical chart , prepare the medication , according to the written information , administer the medication and monitor the effects after the patient receives the medication . in our study
, we have considered mes as errors that occurred during ordering , transcription of the order , and during medication administration .
categories of medication errors were further defined as follows : wrong order : any order that was illegible , incomplete ( missing of dosage , medication name , and intended administration method ) , or wrong ( wrong prescription in terms of medication name , dosage , or administration method ) .
if an rn detects an ordering error , the nurse needs to clarify the order with the physician who was involved ; wrong transcription : any medication order that was transcribed incorrectly from the physician 's ordering sheet to a patient 's medical chart by an rn;wrong administration : any medication administration that deviates from at least one of the five rights ( right patient , right medication , right dose , right route , and right time ) .
wrong order : any order that was illegible , incomplete ( missing of dosage , medication name , and intended administration method ) , or wrong ( wrong prescription in terms of medication name , dosage , or administration method ) .
if an rn detects an ordering error , the nurse needs to clarify the order with the physician who was involved ; wrong transcription : any medication order that was transcribed incorrectly from the physician 's ordering sheet to a patient 's medical chart by an rn ; wrong administration : any medication administration that deviates from at least one of the five rights ( right patient , right medication , right dose , right route , and right time ) . to report me events
, we developed a specific medication error self reporting tool ( mesrt ) according the study purposes .
this tool was composed of 13 items that collected specific data on me frequency and type ( such as errors during the ordering , transcribing , preparing , administering , and monitoring phases ) , me prevented by rns , and patient consequences attributable to me events ( table 1 ) .
this mesrt is a unique reporting method focussing specifically on me events rather than addressing a variety of adverse events which might occur in hospitals .
moreover , we developed the mesrt as a pocket size booklet with 50 sheets ( with instructions to complete one for me event or if there were no errors to complete one at the end of the shift ) each .
every registered nurse received a booklet and was instructed to report all mes after they occurred .
prior to the study , the mesrt was pilot tested with a focus group of 10 randomly selected rns from the participating cardiovascular surgery units to evaluate its content validity .
we calculated the content validity index ( cvi ) , a method used to quantify content validity of multi - item scales .
a cvi can be computed for each item ( i - cvi ) on a given scale as well as for the entire scale ( s - cvi ) .
to calculate the i - cvi , all participating rns were asked to rate the relevance of each mesrt item , using a 4-point likert scale ( 1 = not relevant , 2 = somewhat relevant , 3 = quite relevant , and 4 = highly relevant ) .
then , for each item , the i - cvi was computed as the number of nurses giving a rating of either 3 or 4 , divided by the number of nurses rating the item .
the average s - cvi was computed by adding all i - cvis and dividing this sum by the total number of items ( n = 13 ) .
an average s - cvi of 0.90 or higher is considered to indicate excellent content validity .
our pretest resulted in an average s - cvi of 0.93 , reflecting an excellent content validity .
rns were informed about the purpose of the study and how to use the mesrt to report me events .
the principle investigator reviewed the 13 items included in the mesrt and how to respond to them with each of the participating rns to minimize reporting bias .
nurses were informed by the principle investigator during information rounds one week before the data collection phase . during the data collection period ,
prior to data collection , each rn received a standardized pocket size booklet with 50 mesrt reporting sheets .
rns were instructed to complete mesrt after each medication error and , if there were no errors during their shift , to complete one indicating that there had been no errors at the end of their shift .
consequently , each rn completed a mesrt at the end of their shift regardless of whether an me occurred or not .
if more than one me event occurred during the shift , the rn completed a mesrt for each event .
the mesrt was used in addition to the hospital 's critical incident reporting system ( cirs ) which is used to voluntarily report aes including those in the cardiovascular department . in the cardiovascular surgery department , cirs was implemented in 2006 .
all rns were informed that their cirs reporting practice was not to be interrupted during the one - month study period and that all aes should be reported through cirs as usual , independently of completing the mesrt .
collected mesrt data were entered into spss for windows ( v16.0 , spss , inc . ,
chicago , il ) by the principle investigator . to determine me frequency and type , number of mes prevented by rns , and patient consequences attributable to me
, data were analyzed using descriptive statistic methods ( frequencies , percentages , means , and standard deviations ) . as voluntary reporting and disclosure of me
may pose a highly sensitive issue among health care professionals , identity protection and confidential use of data were guaranteed .
participants provided written informed consent prior to the data collection , and self - reporting was voluntary during data collection .
during the one - month study period , a total of 24 , 617 medication doses were administered to cardiovascular patients . during this timeframe , 288 mes were reported on mesrts .
the incidence of me in this study was 1.2% based on reported me in relation to the total administered medication doses .
in fact , 650 ( 66% ) rns reported that no me occurred during their shift .
of the 288 reported mes , eight ( 2.8% ) revealed information that me had a consequence for a patient such as extra patient monitoring and increased surveillance frequency .
however , no patient experienced harmful or life threatening me consequences during the study period .
the most frequently reported type of me in our study was administering the medication at the wrong time ( 48.3% ) .
mes were categorized as errors that occurred when the medication was ordered , during transcription of the order , and during medication administration ( table 2 ) .
twenty - nine percent of mes occurred during ordering , 13% during transcription , and 58% during medication administration .
comparatively , during the study period , seven me events were reported in the cirs of the cardiovascular surgery department .
the reported cirs cases were transcription and administration errors and were categorized as follows : transcription errors ( n = 2 ) , wrong dose ( n = 3 ) , wrong time ( n = 1 ) , and wrong medication ( n = 1 ) .
in this study , we successfully implemented a novel reporting method a medication error self reporting tool ( mesrt)to examine the frequency and type of me , their consequences for patients and the number of mes prevented by rns .
me incidence was calculated based on number of reported mes relative to the total number of medication doses administered during the study period .
if the patient had been the unit of analysis , me frequency would probably be significantly higher .
most mes reported with the mesrt were medication administration errors ( 58% ) followed by ordering errors ( 29% ) and transcription errors ( 13% ) .
our results on me types are similar to results of leape and colleagues who indicated that 49% of mes occurred during administration of medications , 39% occurred during physician ordering , and 12% during the transcription phase .
bates and colleagues reported that 56% of mes occurred during the ordering stage , 6% during transcription , and 34% during medication administration .
one effective strategy to reduce ordering and transcription errors may be the use of a computerized physician ordering entry system combined with barcode medication administration record [ 3 , 2528 ] . among all medication administration errors ,
for the purpose of this study , a time error was defined as administering a medication more than 30 minutes before or after its scheduled administration time .
hence , the high rate of time errors may be related to the timeframe used .
unfortunately , there is no broad agreement in the literature regarding what constitutes early or late medication administration [ 16 , 28 , 29 ] . according to all analyzed mesrts ,
this is surprising since rns could be seen as last barriers before a medication reach a patient .
however , the reason for this relatively low rate may be the self reporting method utilized in this study . no me reported in our study had a negative impact on patients ' health .
hence , no patients experienced an adverse drug event ( ade ) , although cardiovascular patient are at high risk for negative consequences from me . in contrast , bates et al . reported an ade rate of 6.5% , with 7% of me judged to be associated with potential ades .
similarly , hardmeier and colleagues reported that 7.5% of patients experienced an me - associated ade during hospitalisation . during the timeframe of this study ,
many more mes were reported with the mesrt ( n = 288 ) than with the traditional cirs ( n = 7 ) .
our findings are similar to the findings of other studies and support the argument that reporting attitudes may vary greatly , depending on the me assessment methods used [ 7 , 18 , 20 , 31 , 32 ] . moreover , the findings suggest that cirs may not reliably measure the prevalence of me
. however , various other factors such as disparities in me definition , terminology , and unequal reporting tools may influence me reporting [ 7 , 13 , 19 , 33 ] . the remarkable disparity between the mes captured with the mesrt and those reported by cirs
might be a crucial finding concerning error reporting accuracy and should be considered when designing me reporting methods in the future .
our data show that it is important to use simple reporting tools which facilitate me reporting .
clearly defined me reporting standards and measurement tools are needed to facilitate me reporting and to ensure data accuracy [ 15 , 31 , 34 ] .
the mesrt we developed is easy to use , and it is clear for rns what to report as an me .
some rns may have been concerned that by requiring computer login to report an me through cirs , reporting was not truly anonymous .
the standardized pocket size booklet allows an rn to anonymously report an me right after its occurrence . by reporting the me anonymously ,
this is pivotal because one of the overriding barriers to report adverse events is fear of blame and punishment , depending on the existing safety culture in an institution [ 3539 ] .
although this was the first study to systematically report me in a swiss cardiovascular hospital setting with a new me reporting method , potential limitations have to be considered .
first , the study was conducted over a short period of time which may not have been representative of usual medication error events .
second , the reporting of me with a customized mesrt may represent some degree of underreporting due to the fact that not all mes are consciously detected by rns .
in addition , medication omission errors and administering unauthorized drugs were not captured by the mesrt .
however , our study does provide a snapshot of me within a given period of time and suggests that rates are probably much higher than those detected by cirs .
this study should be replicated within a larger sample and over a longer period of time in acute care settings . despite its limitations
, this study demonstrated the successful use of a novel me reporting method that could provide insights into the occurrence of me and provide a basis for reviewing medication safety procedures .
the results of this study are a novelty for switzerland since data on me are sparsely available in switzerland , and data from cardiovascular departments are to our knowledge nonexistent so far .
therefore , this is the first swiss study that utilized a specific mesrt to collect me data . during a one - month data collection period ,
relative to the total number of doses on medication administered during the time period of this study , the incidence of me was 1.2% .
surprisingly , our novel approach had the potential to detect significantly more mes than the hospital cirs .
the high response rate suggests that this new me reporting tool , for at least short - term monitoring , may be a very effective approach to detect , report , and describe me .
the mesrt we developed is a simple tool for rns that appears to be an acceptable method of reporting medication error events .
future studies should examine its utility in a larger sample of nurses conducted over a longer period of time in multiple hospitals and in combination with other medication assessment methods such as direct observation .
with respect to further studies , it will be of great value to expand the mesrt with more items asking about , for example , omission errors and administration of unauthorized drugs . | the purpose of this study was ( 1 ) to determine frequency and type of medication errors ( mes ) , ( 2 ) to assess the number of mes prevented by registered nurses , ( 3 ) to assess the consequences of me for patients , and ( 4 ) to compare the number of mes reported by a newly developed medication error self - reporting tool to the number reported by the traditional incident reporting system .
we conducted a cross - sectional study on me in the cardiovascular surgery department of bern university hospital in switzerland .
eligible registered nurses ( n = 119 ) involving in the medication process were included .
data on me were collected using an investigator - developed medication error self reporting tool ( mesrt ) that asked about the occurrence and characteristics of me .
registered nurses were instructed to complete a mesrt at the end of each shift even if there was no me .
all mesrts were completed anonymously . during the one - month study period ,
a total of 987 mesrts were returned .
of the 987 completed mesrts , 288 ( 29% ) indicated that there had been an me .
registered nurses reported preventing 49 ( 5% ) mes .
overall , eight ( 2.8% ) mes had patient consequences .
the high response rate suggests that this new method may be a very effective approach to detect , report , and describe me in hospitals . |
vitamin d is important for human health , and lower serum 25-hydroxyvitamin d [ 25(oh)d ] has been associated with increased mortality .
moreover , a high prevalence of vitamin d deficiency has been identified worldwide in recent years .
. as vitamin d is liposoluble , its oral absorption could increase if ingested with a fat - rich meal .
although there are several studies about the effect of different ways to supply vitamin d in its serum levels [ 59 ] or in serum 25(oh)d levels [ 1014 ] , only a few of these studies describe the amount of fat ingested with vitamin d [ 7 , 9 , 11 ] .
therefore , the aim of this study was to compare serum 25(oh)d levels after the oral intake of cholecalciferol with a high- or low - fat meal in young adults .
this single - blind parallel randomized trial included 32 healthy resident physicians in porto alegre , latitude 30 , brazil .
height and weight were measured to calculate body mass index ( bmi : weight ( kg)/height ( m ) ) .
two different groups were formed with 16 individuals , each according to sex and bmi , and randomly assigned to a high-(group 1 : g1 ) or low - fat meal ( group 2 : g2 ) .
the exclusion criteria were not drinking milk ; bmi 30 kg / m or < 18.5 kg / m ; known liver , kidney or endocrine disease ; use of supplements of calcium and/or vitamin d ; use of anticonvulsants , barbiturates , or glucocorticoids , and travel outside the brazilian south region during the previous 120 days .
the low - fat meal contained skim milk , white bread with fruit jelly , and fruit salad .
the high - fat meal contained whole milk , white bread with bologna , and vegetable oil margarine .
all participants came to the research unit on the same day at 7:00 am , after overnight fasting .
a blood sample was collected to measure 25(oh)d , parathyroid hormone ( pth ) , total calcium , albumin , magnesium , and creatinine , and a urine sample was collected to measure creatinine , calcium , and magnesium .
then , 50,000 iu of cholecalciferol in a capsule were administered by the oral route to each subject during a meal with high- or low - fat content ( table 1 ) .
the subjects ingested the whole content of the meal , and then were advised to avoid sun exposure and changes in their usual eating pattern for the next two weeks .
overnight fasting blood samples were collected after 7 days for measurement of 25(oh)d and 14 days for measurement of 25(oh)d , pth , and total calcium .
all samples were analyzed in the same run : 25(oh)d by chemiluminescence ( liaison , diasorin inc . , stillwater / mn , usa , intra - assay coefficient of variation = 5.5% ) and pth by electrochemiluminescence ( roche diagnostics , indianapolis / in , usa , intra - assay coefficient of variation = 2.8% ) . the number of subjects , calculated to detect a 30% difference in mean serum 25(oh)d levels between groups , with a standard deviation of 7.7 ng / ml , power of 80% , and p < 0.05 , was 15 per group .
all data were analyzed with spssv.16.0 , and differences were considered significant when p < 0.05 .
cholecalciferol in powder ( taizhou hisound chemical co. ltd , taizhou , zhejiang , china ) was provided by deg ativando princpios company , so paulo , sp , brazil , which evaluated its content through hplc ( 99.9% ) .
all of the vitamin d capsules contained lactose ( 82 mg ) and crystalline micro cellulose ( 18 mg ) .
one international unit ( 1 iu ) of vitamin d is equal to 0.025 micrograms .
the study was approved by the ethics committee of hcpa , and participants were included after written informed consent .
seven were excluded because they had traveled to regions with high uvb incidence in the last 120 days , and one was excluded for having bmi > 30
two participants , one from each group , did not enter the protocol , for missing the first appointment : one forgot and the other was acutely ill .
< 50 nmol / l in 21 subjects , and < 25 nmol / l in 5 subjects .
after cholecalciferol , mean serum 25(oh)d levels and mean variation of serum 25(oh)d levels were higher in g1 ( p < 0.001 ) , and the differences were significant at day 14 ( figures 2(a ) and 2(b ) ) . at day 14 , no one had hypercalcemia , and mean serum total calcium ( g1 : 2.3 0.1 mmol / l and g2 : 2.2 0.1
mmol / l ; p = 0.11 ) and pth ( g1 : 33.1 11.0 ng / l ; g2 : 36.4 9.0 ng / l , p = 0.37 ) were similar in both groups ; the mean change in serum pth was negative in g1 ( 1.8 7.2
ng / l ) and positive ( 5.5 7.1 ng / l ) in g2 ( p < 0.01 ) . in all participants , serum pth and 25(oh)d levels were negatively correlated at baseline and 14 days after the intake of vitamin d , as shown in figure 3 .
the intake of 50,000 iu of cholecalciferol with a fat - rich meal increased mean serum 25(oh)d levels , in young adults .
a change in mean serum 25(oh)d levels was not observed in the group that received vitamin d along with low - fat food , and its increase in the group that received the high - fat meal was small . as a placebo group
was not studied , it is possible that serum 25(oh)d levels were decreasing in the sample studied due to the season .
the improved bioavailability of cholecalciferol when administered with fat - rich food could be due to a higher release of bile , allowing an increased incorporation of fat in the bile salt micelle , and its absorption .
few studies have evaluated the effect of dietary fat in the absorption of vitamin d. in a clinical trial that compared the effect of 25,000 iu of vitamin d2 intake with whole milk ( 8.4 g of fat / serving ) , skimmed milk ( 2.4 g of fat / serving ) , or toast with 0.1 ml of corn oil , there was no difference in mean serum vitamin d2 levels , which suggested that its absorption is not dependent on fat . nevertheless , the content of fat ingested was small in all groups , so serum vitamin d levels could have been higher if the vitamin had been ingested with more fat . in another study ,
normal individuals consumed low - fat cheese ( 3 g of fat / serving ) or high - fat cheese ( 11 g of fat / serving ) , fortified with 28,000 iu of vitamin d , or the same amount of vitamin d dissolved in ethanol , with or without food , per week , for 8 weeks . mean serum 25(oh)d were similar in all groups treated with vitamin d and higher than placebo .
however , in these studies , the difference in the amount of fat provided by the meals for different groups was smaller than the one in the present study , and the total amount of fat offered in the meals was also smaller .
moreover , dissolving vitamin d in ethanol could have made its absorption easier . in another study ,
higher mean serum vitamin d2 levels , in young and older adults , were observed when the vitamin was ingested with cheese ( 20 g of fat / serving ) when compared to water , suggesting that food facilitates its absorption , and is not affected by age . in this study ,
a recent uncontrolled study found higher mean serum 25(oh)d levels when vitamin d supplements were ingested during the largest meal of the day ; however , the content of these meals was not described .
although baseline mean serum 25(oh)d level was low in all subjects and 5/30 subjects had serum 25(oh)d level < 25 nmol / l , serum pth levels were within the normal range in all subjects .
however , it is possible that at least part of the subjects had secondary hyperparathyroidism , as there was a negative correlation between serum pth and 25(oh)d levels .
it is known that serum pth levels increase with age , bmi , and low serum 25(oh)d levels [ 21 , 22 ] .
this study was made in spring , when lower serum 25(oh)d levels are expected in this region .
the absorption of vitamin d was evaluated with only two meals with highly different fat content ; however , these are not unusual dietary patterns in everyday life . moreover , as the two meals were different also in other components , to offer a similar amount of calories , it can not be excluded that vitamin d3 absorption was decreased in the low - fat meal group , due to its higher fiber content .
also , it can not be excluded that different amounts of vitamin d were ingested by the subjects , as the amount of vitamin d in food was not evaluated .
nevertheless , it is very improbable that dietary vitamin d influenced the results , because natural food contains only small amounts of vitamin d. in addition , the participants were advised to keep their usual dietary patterns until completing the study .
another limitation was the measurement of serum 25(oh)d levels as a surrogate for serum vitamin d levels .
nonetheless , this metabolite increases rapidly after vitamin d supplementation , and it is measured to evaluate vitamin d status and the effect of vitamin d supplementation [ 17 , 23 ] . as vitamin d absorption could explain in part the variability in serum 25(oh)d levels after the oral supplementation of this vitamin , other studies should be designed to clarify the role of food and dietary fat in vitamin d absorption , allowing us to determine the most effective way to improve vitamin d nutrition . in conclusion ,
the results of this small randomized controlled trial show that vitamin d supplementation is more effective when given with fat - containing food . | background / aims .
vitamin d3 is liposoluble , so dietary fat could increase its oral absorption .
our aim was to compare serum 25-hydroxyvitamin d [ 25(oh)d ] after the oral intake of cholecalciferol with a high- or low - fat meal .
methods . in a single - blind , parallel clinical trial ,
32 healthy physicians were divided into two groups . in the same day
, they ingested 50,000 iu ( 1.25 mg ) of vitamin d3 with food : group 1 ( g1 ) : lipids : 25.6 g and group 2 ( g2 ) lipids : 1.7 g. serum 25(oh)d ( 0 , 7 , and 14 days ) , and parathyroid hormone ( pth ) , and calcium ( 0 and 14 days ) were measured .
results .
baseline mean serum 25(oh)d levels were 42.7 19.0 nmol / l in g1 and 36.4 19.0 nmol / l in g2 ( p = 0.38 ) .
after cholecalciferol , mean serum 25(oh)d was higher in g1 ( p < 0.001 ) : 7 days : g1 = 46.2 ( 38.453.9 )
nmol / l and g2 = 33.7 ( 25.440.1 ) nmol / l ; 14 days : g1 = 53.7 ( 45.262.1 ) nmol / l and g2 = 33.7 ( 25.242.2 ) nmol / l .
serum pth and 25(oh)d were negatively correlated before and after the intake of vitamin d3 , respectively , r = 0.42 ( p = 0.02 ) and r = 0.52 ( p = 0.003 ) . conclusions .
a high - fat meal increased the absorption of vitamin d3 , as measured by serum 25(oh)d . |
post - activation potentiation ( pap ) is a neuromuscular phenomenon in which the force and power output of a muscle is immediately enhanced after heavy resistance exercise ( 9 ) .
the underlying principle of the ability of pap to increase force and power output of muscle is theorized to be a result of phosphorylation of myosin regulatory light chains ( 21 ) .
it has been hypothesized that the phosphorylation of myosin regulatory light chains cause the interaction between actin and myosin to become more sensitive to ca released from the sarcoplasmic reticulum , resulting in an increased level of myosin cross bridge activity in response to submaximal resistance exercise ( 20 , 21 ) .
the majority of pap research has investigated a practice referred to as complex training , in which a heavy resistance training exercise is executed prior to performing an explosive bodyweight movement with similar biomechanical characteristics ( 12 ) .
the heavy resistance exercise is hypothesized to induce pap , thus increasing the acute performance of the bodyweight exercise , with the prospect of superior chronic neuromuscular adaptations ( 9,12 ) .
this increase in central nervous system stimulation causes greater motor unit recruitment and force production that may last from 5 to 30 minutes ( 18 ) . to date , pap research has shown a few general trends .
first , trained individuals appear to respond more favorably to eliciting the pap response than do untrained subjects ( 15,18 ) .
second , moderate to heavy intensity of resistance exercise elicits the most favorable pap response ( 4,16,18 ) .
third , there appears to be a critical window of time for power output due to pap , as an initial decrease in power is observed immediately after heavy resistance exercise , followed by an optimal time of pap where peak power can be harnessed ( 11,16,24 ) , followed by gradual diminishing power output ( 3,4,6,7,11 ) . collectively , a recent meta - analysis by wilson et al .
( 25 ) suggested the optimization of the pap effect would utilize a combination of multiple sets , moderate intensity ( 6084% 1rm ) , and moderate rest periods ( 710 minutes ) . whereas the majority of previous pap research has examined male subjects within athletic or recreationally trained populations , minimal research exists as to how females respond to pap , with even fewer studies in regards to female athletes ( 8) .
previous studies on females have found evidence of a pap response , albeit with small effect sizes ( es=.20 ) ( 13,14,25 ) , yet the pap response in female athletes is largely unknown .
common limitations in previous pap studies that have examined female responses are small sample sizes leading to underpowered studies , and often no differentiation between male and female responses in statistical analysis ( 5,13,14,18 ) . according to national collegiate athletic association ( ncaa ) data ,
nearly 204,000 females participated in college and university sponsored athletics in 20122013 ( 17 ) .
the paucity of research concerning female athletes should be a top priority for sport scientists to address , providing strength and conditioning coaches who work with female athletes evidence - based recommendations on best practices .
therefore , the purpose of this study was to investigate the acute pap response of back squats on static squat jump performance among ncaa division ii female athletes .
ncaa division ii female collegiate athletes from a midwestern university were recruited for this study .
inclusion criteria sought healthy female athletes in the off - season of their respective training macrocycle .
subjects with any musculoskeletal injuries or other health problems that would inhibit the ability to jump and/or squat were excluded from the study .
female athletes who volunteered for this study ( n=29 , age 19.9 1.0 years ) were current roster members from the university s basketball ( n=11 ) , softball ( n=10 ) , and volleyball ( n=8 ) teams .
all subjects signed informed consent documents and completed a physical activity readiness - questionnaire ( par - q ) before participation .
this study was approved by the university s institutional review board , and all participants completed the study with no injuries reported . additionally , all testing of athletes was coordinated with the strength and conditioning staff of each team to minimize any potential disruption in off - season workouts . upon reporting for testing , subjects prepared for 1rm testing by performing a light 3-minute bicycle warm - up at a self selected pace .
next , subjects performed a 3-minute dynamic warm - up consisting of a series of dynamic stretches spanning 15 meters . following the warm - up , back squat 1rm
subjects were instructed to descend to a depth in which the femur was parallel to the ground . a certified strength and conditioning specialist ( cscs ) and experienced spotters were present at all times to ensure safety of subjects and appropriate exercise technique execution .
in addition , the spotters visually inspected and confirmed the depth of the squat and provided verbal feedback when needed . upon determination of 1rm
, subjects were familiarized with the squat jump technique . a static squat jump ( ssj )
was used to increase consistency and minimize variability of jumping form ( 22 ) . in accordance with proper ssj technique identified by sayers et al .
( 22 ) , subjects assumed a squat position , feet shoulder width apart , knees bent at approximately a 90-degree angle , with arms back and ready to be swung upward ( figure 1 ) .
subjects were instructed to refrain from performing any cardiovascular or strength training 24 hours prior to pap testing .
subjects prepared for pap testing by performing the same bike and dynamic stretching warm - ups as performed on day 1 in which 1rm was tested . after the 6-minute warm - up ,
subjects performed 3 ssj s for maximal height , as measured by a vertec ( sports imports , hilliard , oh ) .
each subject performed 3 jumps in which the highest jump height was recorded , with 30 seconds of rest separating each jump attempt .
the pre - pap jumps served as a control for examining the influence of the resistive loads on jump performance .
after the pre - pap vertical jumps , the subjects rested for 3-minutes before performing the following 4-stage squat warm - up : 1 ) 5 repetitions at 50% 1rm , 2 ) 5 reps at 60% 1rm , 3 ) 3 repetitions at 75% 1rm , and 4 ) a final pap inducing set of 3 repetitions at 90% 1rm .
after the final pap set at 90% 1rm , each subject rested for 5 minutes while height and body mass were recorded .
height was measured to the nearest 0.1 cm using a stadiometer ( seca 213 , chino , ca ) and body mass was measured to the nearest 0.1 kg using a calibrated scale ( befour , saukville , wi ) . once the 5-minute rest period was complete , the subject performed 3 ssj s utilizing the same procedure as the pre - pap jumps .
all 3-jump heights were recorded with the highest number being used for subsequent data analysis .
maximal jump height was determined by calculating the difference between the highest jump and the subject s reach height .
this calculation was used for both pre - pap jump height and post - pap jump height .
peak power of each subject s pre - pap highest jump and post - pap highest jump were calculated using the sayers equation in which peak power ( w ) = 60.7 ( jump height [ cm ] ) + 45.3 ( body mass [ kg ] ) 2055 ( 22 ) .
a mixed between - within repeated measures anova was performed to determine main effects for time ( pre vs. post power ) and team ( volleyball vs. basketball vs. softball ) , as well the interaction effect ( time team ) . in the presence of significant interaction effects
, follow - up contrasts were used to evaluate the simple - effects of time within levels of team . to maintain global = 0.05 , the level of significance was set at p < 0.0167 for each of the 3 simple effects contrasts ( pre vs. post for each team ) .
ncaa division ii female collegiate athletes from a midwestern university were recruited for this study .
inclusion criteria sought healthy female athletes in the off - season of their respective training macrocycle .
subjects with any musculoskeletal injuries or other health problems that would inhibit the ability to jump and/or squat were excluded from the study .
female athletes who volunteered for this study ( n=29 , age 19.9 1.0 years ) were current roster members from the university s basketball ( n=11 ) , softball ( n=10 ) , and volleyball ( n=8 ) teams .
all subjects signed informed consent documents and completed a physical activity readiness - questionnaire ( par - q ) before participation .
this study was approved by the university s institutional review board , and all participants completed the study with no injuries reported . additionally , all testing of athletes was coordinated with the strength and conditioning staff of each team to minimize any potential disruption in off - season workouts .
upon reporting for testing , subjects prepared for 1rm testing by performing a light 3-minute bicycle warm - up at a self selected pace .
next , subjects performed a 3-minute dynamic warm - up consisting of a series of dynamic stretches spanning 15 meters . following the warm - up , back squat 1rm
subjects were instructed to descend to a depth in which the femur was parallel to the ground . a certified strength and conditioning specialist ( cscs ) and experienced spotters were present at all times to ensure safety of subjects and appropriate exercise technique execution .
in addition , the spotters visually inspected and confirmed the depth of the squat and provided verbal feedback when needed . upon determination of 1rm
, subjects were familiarized with the squat jump technique . a static squat jump ( ssj )
was used to increase consistency and minimize variability of jumping form ( 22 ) . in accordance with proper ssj technique identified by sayers et al . ( 22 ) , subjects assumed a squat position , feet shoulder width apart , knees bent at approximately a 90-degree angle , with arms back and ready to be swung upward ( figure 1 ) .
subjects were instructed to refrain from performing any cardiovascular or strength training 24 hours prior to pap testing .
subjects prepared for pap testing by performing the same bike and dynamic stretching warm - ups as performed on day 1 in which 1rm was tested . after the 6-minute warm - up , subjects performed 3 ssj s for maximal height , as measured by a vertec ( sports imports , hilliard , oh ) .
each subject performed 3 jumps in which the highest jump height was recorded , with 30 seconds of rest separating each jump attempt .
the pre - pap jumps served as a control for examining the influence of the resistive loads on jump performance .
after the pre - pap vertical jumps , the subjects rested for 3-minutes before performing the following 4-stage squat warm - up : 1 ) 5 repetitions at 50% 1rm , 2 ) 5 reps at 60% 1rm , 3 ) 3 repetitions at 75% 1rm , and 4 ) a final pap inducing set of 3 repetitions at 90% 1rm .
after the final pap set at 90% 1rm , each subject rested for 5 minutes while height and body mass were recorded .
height was measured to the nearest 0.1 cm using a stadiometer ( seca 213 , chino , ca ) and body mass was measured to the nearest 0.1 kg using a calibrated scale ( befour , saukville , wi ) . once the 5-minute rest period was complete , the subject performed 3 ssj s utilizing the same procedure as the pre - pap jumps .
all 3-jump heights were recorded with the highest number being used for subsequent data analysis .
maximal jump height was determined by calculating the difference between the highest jump and the subject s reach height .
this calculation was used for both pre - pap jump height and post - pap jump height .
peak power of each subject s pre - pap highest jump and post - pap highest jump were calculated using the sayers equation in which peak power ( w ) = 60.7 ( jump height [ cm ] ) + 45.3 ( body mass [ kg ] ) 2055 ( 22 ) .
a mixed between - within repeated measures anova was performed to determine main effects for time ( pre vs. post power ) and team ( volleyball vs. basketball vs. softball ) , as well the interaction effect ( time team ) . in the presence of significant interaction effects
, follow - up contrasts were used to evaluate the simple - effects of time within levels of team . to maintain global = 0.05 , the level of significance was set at p < 0.0167 for each of the 3 simple effects contrasts ( pre vs. post for each team ) .
post - activation potentiation results by athletic team are presented in table 2 with all data as mean sd . there was a significant interaction effect observed between time and team , f(2,26)=4.5 , p=.022 .
post - hoc tests indicated that the volleyball team had a significant decrease in power output from pre to post , 96.454.5 w , p=.008 . the main effect for time
( pre vs. post power ) was not significant , f(1,26)=1.2 , p=.279 , indicating for the group as a whole , there was no evidence of a pap effect .
the main effect for team was also non - significant , f(2,26)=1.8 , p=.173 , indicating no difference in power outputs by team .
the purpose of this study was to determine the acute effect of back squats on static squat jump performance in ncaa division ii female athletes .
the results of this study found that a pap set of 3 reps at 90% of 1rm followed by a 5-minute rest period did not potentiate subsequent jump height in this cohort of female athletes . whereas a small subset of athletes did successfully potentiate , these differences were not observed for the cohort as a whole , or when examined by each of the three athletic teams .
additionally , this study provided descriptive data on absolute strength ( 1rm ~ 92 kg ) and relative strength ( 1rm / body mass ~1.3 ) back squat levels in female athletes , which are noticeably lacking within the strength and conditioning literature .
previous studies have found the pap response to be highly individualized ( 5,10,14 ) thus the results of our study clearly mirror this trend .
the challenge to consistently elicit the pap response stems from a careful balance of the training status of the athlete , the level of strength attained by the athlete , the intensity of the conditioning activity , and the period of time following the potentiating activity ( 20,23,25 ) . whereas our study consisted of trained female athletes , the absolute and relative strength levels of our subjects
may provide clues as to why the majority failed to potentiate . within our study , of the athletes above the 80th percentile for 1rm / body mass ( > 1.44 , n=5 ) , 4 of the 5 did successfully potentiate .
previous research provides evidence that stronger athletes have a greater potential to potentiate ( 2,26 ) , which is hypothesized to be due to an ability to become more fatigue resistant as strength levels increase ( 25 ) .
additionally , emerging research suggests that individuals who have the strength to squat twice their body mass are able to display both earlier and greater pap responses than weaker individuals ( 19,23 ) . given that our subjects average 1rm / body mass ratio was 1.3 , it is thus very plausible that the combination of low levels of absolute and relative strength , in conjunction with 90% 1rm pap load , and 5-minute rest period , was too fatiguing to successfully potentiate with a protocol commonly used within several previous pap research studies within an athletic population ( 5,23 ) .
as previously stated , minimal research exists on female athletes as a whole ( 8) , let alone the pap response , therefore comparisons and potential conclusions are somewhat limited .
nonetheless , our results are similar to those of jensen and ebben , in which ncaa division i anaerobic female athletes utilized a pap protocol consisting of 5rm back squats followed by countermovement vertical jumps at 10 sec , 1 min , 2 min , 3 min , and 4 min post - squat jumps , respectively , which resulted in no significant effect on subsequent jump heights or ground reaction forces ( 13 ) .
however , our results contrast those of mccann and flanagan , who in a study of ncaa division i female volleyball athletes , found that a pap protocol of 5rm back squats followed by 4 min rest , resulted in significant increases in vertical jump height ( 14 ) . likewise , in a study of national and international hockey and softball female athletes , duthie et al . found a pap protocol of 3rm half squats followed by 5 min rest , resulted in significant increases in both peak power and maximal force for athletes with a 1rm > 139 kg ( 10 ) .
are in stark contrast to the female athletes in our study ( 91.8 kg ) , providing additional evidence on the impact of maximum strength on the ability to successfully potentiate . additionally ,
when comparing ncaa division ii , ncaa division i , and international caliber female athletes , the inherent difference in athleticism , genetic potential , and skill at each level of competition , does warrant serious consideration when contrasting previous findings .
first , the subjects in this study were from a select population of healthy , exercise ready , off - season ncaa division ii female athletes .
thus , care should be taken if attempting to extrapolate our findings to other populations of athletes .
therefore , the results of this study are best generalized to female athletes with a similar strength profile as observed in our subjects .
second , this study used a single pap protocol of 90% 1rm followed by a 5 min rest period . in order to create minimum disruption to the athlete s training cycle , the above protocol was deemed acceptable by the university s strength staff when consulting with our research team as per how and when to best gain access to the athletes limited availability .
additional manipulation of pap load , rest period , or combination of each , could have certainly resulted in a different temporal pattern of pap responses among our subjects , and is duly noted as a limitation .
however , we feel the inclusion of trained female athletes , albeit with limited access , provides a much more valuable understanding to the pap response than had we utilized recreationally trained females .
finally , whereas jump height was objectively measured via the use of a vertec , peak power measurements were determined by utilizing the sayers equation , and are thus noted as estimates .
when the use of a force plate is impractical , the sayers equation has been cross - validated to be an accurate estimate of peak power for both r and see ( 22 ) . in conclusion
, the results of this study found that a pap set consisting of 90% 1rm followed by 5 min rest , failed to potentiate static squat jump performance in a cohort of ncaa division ii female athletes .
strength and conditioning coaches who work with female athletes should be aware that the successful implementation of pap complexes within this population appears to be highly individualized .
therefore , the use of pap complexes in female athletes should consider both the relative strength of each athlete and the length of the rest period when attempting to optimize the pap response . based on the findings of our study ,
we recommend that future research that investigates the pap response in female athletes to consider the following : 1 ) the absolute strength of the athlete , 2 ) the relative strength of the athlete , 3 ) the level of competition that the athlete is at , and 4 ) for athletes who are unable to squat twice their body mass , the utility of pursuing such pap complexes . | post - activation potentiation ( pap ) is a phenomenon in which the power output of a muscle is immediately enhanced after heavy resistance exercise . whereas the majority of pap research has examined males , minimal research exists as to how female athletes respond
.
therefore , the purpose of this study was to investigate the acute pap response of back squats on static squat jump ( ssj ) performance among ncaa division ii female athletes .
female athletes ( n=29 ) who were current roster members from basketball , softball , and volleyball , performed 3 ssj prior to 3 repetitions of the back squat exercise at 90% 1rm . after a 5-min rest
, athletes once again performed 3 ssj for maximal height , with peak power calculated using the sayers equation .
there was a significant interaction effect observed between time and team , p=0.022 ; post - hoc tests indicated that the volleyball team had a significant decrease in power , p=0.008 .
the main effect for time was not significant , p=0.279 , indicating for the group as a whole , there was no evidence of a pap response .
the main effect for team was also non - significant , p=0.173 , indicating no difference in power outputs by team .
strength and conditioning coaches who work with female athletes should be aware that the successful implementation of pap complexes within this population appears to be highly individualized .
therefore , the use of pap complexes in female athletes should consider both the absolute and relative strength of each athlete in conjunction with the length of the rest period when attempting to optimize the pap response . |
5-amp - activated protein kinase ( ampk ) , a key regulator of cellular energy homeostasis , is activated in response to various metabolic stresses including starvation , hypoxia , and ischemia .
ampk is a heterotrimeric enzyme , which is activated by phosphorylation of thr172 on its subunit .
several upstream kinases can modify thr172 , including liver kinase b1 ( lkb1 ) , calcium / calmodulin - dependent protein kinase kinase 2 ( camkk2 ) , and transforming growth factor activated kinase-1 ( fig .
master switch that regulates intracellular processes such as the cellular uptake of glucose , -oxidation of fatty acids , biogenesis of glucose transporter 4 , and mitochondrial biogenesis [ 1 - 4 ] . upon activation ,
ampk increases cellular energy levels by inhibiting anabolic energy - consuming pathways ( including fatty acid synthesis and protein synthesis ) and stimulating energy - producing catabolic pathways ( including fatty acid oxidation and glucose transport ) ( fig .
2 ) . because it is a major regulator of both lipid and glucose metabolism , ampk has been considered as a potential therapeutic target for the treatment of diabetes , obesity , and cancer .
recently , however , many reports show that ampk actually plays a critical role in tumor survival and growth [ 5 - 8 ] .
the metabolism reprogramming triggered by the activation of ampk is important for the survival of cells in the tumor microenvironment .
thus , it would not be surprising if , in some cases , ampk acts as a tumor promoter .
in contrast to normal cells , which produce energy through a relatively low rate of glycolysis and oxidation of pyruvate in the mitochondria , the energy production of most cancer cells relies on a high rate of glycolysis followed by lactic acid fermentation in the cytosol ; this phenomenon is known as the warburg effect [ 9 - 11 ] .
rapidly growing cancer cells achieve glycolytic rates that are up to 200 folds higher than those of normal cells , even when oxygen is plentiful
. the warburg effect may reflect adaptation to low - oxygen environments within tumors , mitochondrial damage , or oncogene - mediated shutdown of mitochondria , which would otherwise induce apoptosis in cancerous cells . on the other hand , the effect
might also be associated with rapid cell proliferation . because glycolysis provides most of the building blocks required for cell proliferation
, cancer cells may need to activate glycolysis despite the availability of oxygen ( fig .
3 ) . in several types of cancer , genetic defects in the enzymes of the tricarboxylic acid cycle
are involved in tumorigenesis , whereas oncogenic h - ras transformation damages mitochondrial function . upon initiation of the warburg effect ,
cells depend on aerobic glycolysis with lactate production , rather than oxidative phosphorylation , to maintain adenosine triphosphate ( atp ) levels .
pfkfb3 is overexpressed and its phosphorylation is elevated in several types of cancer ( including colon and breast cancers ) as a consequence of ampk activation .
various stress signals , such as hypoxia and nutrient depletion , can drive pfkfb3 expression , and ampk contributes to the elevation of pfkfb3 levels and glycolytic flux in response to reduced ph .
in addition , expression of pfkfb2 , a phosphorylation target of both akt and ampk , is elevated in human cancers .
ampk can act as a negative regulator of the warburg effect under nutrient- and growth factor - rich conditions .
ampk depletion further increases mammalian target of rapamycin complex 1 ( mtorc1 ) activation , hypoxia - inducible factor 1 ( hif1 ) levels , and aerobic glycolysis in myc over - expressing cells .
depletion of ampk leads to increased lactate production , promoting the use of nonglucose carbon sources for anabolism , maintenance of bioenergetics , and lactate production .
the role of lactate production in proliferating tumor cells , the primary characteristic of the warburg effect , remains poorly understood .
the key glycolysis enzyme phosphofructokinase-1 is inhibited by o - glcnacylation , which is necessary for optimum tumor growth , suggesting that suppression of lactate - producing glycolysis can also confer survival and growth advantages on cancer cells , depending on the genetic background and cellular context .
although the ampk signaling pathway was originally characterized as a tumor - suppressive pathway , recent studies have demonstrated that many factors in the tumor microenvironment , as well as some oncogenic signals , are ampk activators .
the oncogene src ( proto - oncogene tyrosine - protein kinase ) , which is overexpressed and activated in many cancers , activates ampk through the activation of the protein kinase c -lkb1 pathway in ovcar3 and a431 cells .
similarly , the expression of myc and h - ras activates ampk in some cancers .
moreover , androgen receptor ( ar ) signaling activates ampk through the transactivation of camkk2 in prostate cancer [ 22 - 24 ] .
in addition to the activation of oncogenes , the loss of tumor suppressor gene folliculin ( flcn ) , which is associated with birt - hogg - dub syndrome , also activates ampk .
initially , two groups reported that lkb1 and ampk play protumorigenic roles in the context of oncogene - induced transformation of mouse embryonic fibroblasts ( mefs ) .
they showed that both lkb1-null mefs and ampk1/2-null ( ampk knockout ) mefs are resistant to oncogenic effects such as h - ras / sv40t - induced anchorage - independent growth and solid tumor growth in vivo .
remarkably , several studies demonstrated that ampk is also essential for other types of oncogene - induced tumorigenesis , such as mycinduced development of hepatocellular carcinoma ( hcc ) , h - raspten deletioninduced astrocytic tumor cell proliferation , and kinase suppressor of ras 2-induced anoikis resistance in mefs .
depletion of ampk activity in breast and pancreatic cancer cells hampers anchorage - independent growth and tumor formation in vivo [ 30 - 32 ] .
the lkb1-ampk signaling pathway is also essential for glioma cell survival under low - glucose conditions .
two recent approaches have identified the ampk1 and ampk1 subunits as essential protumorigenic genes in melanoma and prostate cancer , respectively .
activation of ampk following loss of the tumor suppressor flcn increases mitochondrial biogenesis by inducing peroxisome proliferator - activated receptor ( ppar ) coactivator 1 ( pgc1 ) expression , which in turn results in the production of reactive oxygen species ( ros ) .
. also demonstrated that high levels of ros activate hif1 transcriptional activity , resulting in elevated expression of glycolytic enzymes , which induce atp production .
the ar - camkk2-ampk axis in prostate cancer increases aerobic glycolysis and anabolic metabolism partly through pgc1-mediated mitochondrial biogenesis , which can provide both the energy and the building blocks required for rapid cell growth .
recently , mechanisms associated with the metabolic functions of ampk , other than those involved in the production of energy or building blocks , have attracted increasing attention .
jeon et al . showed that in the absence of ampk activity , oxidative stress is the major cause of cancer cell death during glucose deprivation and matrix detachment . under such stressful metabolic conditions ,
maintenance of nadph levels rather than atp levels is crucial for ampk - induced solid tumor formation in vivo , tumor cell survival , and anchorage - independent growth .
acetyl - coa carboxylase ( acc ) 1 and acc2 decrease nadph consumption by inhibiting fatty acid synthesis and increase nadph production by activation of fatty acid oxidation , respectively .
they both need to be inhibited to maintain the glutathione / oxidized glutathione ratio and to reduce h2o2 levels , thereby protecting against oxidative stress - induced cell death . in osteosarcoma
loss of flcn results in the constitutive activation of ampk , which in turn induces autophagy , inhibits apoptosis , improves cellular bioenergetics , and confers resistance to energy - depleting stresses such as oxidative stress , heat , anoxia , and serum deprivation .
despite accumulating evidence highlighting the oncogenic role of ampk , this enzyme was originally identified as a tumor suppressor following the discovery of lkb1 and mtorc1 [ 38 - 41 ] .
germline mutations in the gene encoding ampk were detected in peutz - jeghers syndrome . additionally , somatic mutations in the tumor suppressor lkb1 were observed in lung and cervical cancers .
mtorc1 , which is inactivated by the lkb1-ampk axis , is an important regulator of growth factor and nutrient signaling that controls protein synthesis and cell growth , and is over - activated in most human cancers . since lkb1 activates ampk and ampk inhibits mtorc1 , it is reasonable to classify ampk as a tumor suppressor .
although lkb1 deletion alone is not sufficient to cause lung cancer , it elevates mtorc1 and src activity , which enhances lung cancer induced by k - ras activation or pten deletion [ 44 - 46 ] .
conversely , in the endometrium , lkb1 deletion alone is sufficient for the development of invasive endometrial cancer , which can be effectively treated by rapamycin , an mtorc1 inhibitor , suggesting that mtorc1 activation is the major downstream target of lkb1 inhibition [ 48 - 50 ] .
notably , lkb1 also plays an ampk / mtorc1-independent role in tumor suppression that depends on microtubule affinity - regulating kinase - mediated regulation of snail or hippo signaling .
deletion of prkaa1 , the gene that encodes ampk1 , accelerates development of myc - induced lymphoma .
this observation contradicts the findings of liu et al . , who showed that ampk plays an important role in the development of myc - induced hcc .
. also demonstrated that deletion of either lkb1 or prkaa1 induces mtorc1/hif1-dependent metabolic reprogramming that helps cancer cells meet their energetic and anabolic demands .
this observation also conflicts with the findings of yan et al . , who suggested that ampk activates aerobic glycolysis through the pgc1-ros - hif1 axis in the absence of flcn .
although this discrepancy could be due to tissue - specific and context - dependent functions of ampk , further research is needed to obtain an unequivocal interpretation of these seemingly contradictory findings .
several additional studies have reported conflicting pharmacological evidence regarding the role of ampk in cancer .
the antidiabetic drug metformin , which indirectly activates ampk by inhibiting mitochondrial metabolism , decreases the incidence and mortality rate of breast cancer .
moreover , several lines of evidence support the idea that ampk activators , such as 5-aminoimidazole-4-carboxamide-1-b - d - ribofuranoside ( aicar ) , metformin , and phenformin , suppress cancer cell growth and proliferation [ 56 - 59 ] .
however , in contradiction to these findings , liu et al . showed that aicar and metformin reduce glioblastoma proliferation and viability .
furthermore , the direct ampk activator a769662 has no effect on proliferation , suggesting that the antitumor effects of aicar and metformin are ampk - independent .
shackelford et al . also demonstrated that phenformin selectively kills lkb1-deficient lung tumor cells in vivo , suggesting that the antitumor effect of phenformin is not dependent on activation of ampk .
notably , vincent et al . showed that all these nonspecific and indirect ampk activators strongly inhibit cell proliferation and viability in the absence of ampk , whereas such cytotoxic effects are reduced in the presence of ampk , suggesting that the activation of ampk actually opposes the cytotoxic effect of the indirect ampk activators .
along these lines , vincent et al . demonstrated that the direct ampk agonist a769662 promoted cell proliferation under metabolically stressful conditions , supporting the idea that ampk plays an oncogenic role in the tumor microenvironment .
therefore , we must consider the effects of organ , cancer type , and acute vs. long - term ampk activation and inactivation when investigating the mechanistic contribution of ampk to cancer [ 63 - 65 ] .
non muscle - invasive bladder cancer ( nmibc ) and muscle - invasive bladder cancer ( mibc ) are associated with distinct molecular pathways .
nmibc is characterized by activation of the ras pathway through mutations in h - ras , fgfr-3 , and pi3k , while mibc is associated with a loss of tumor suppressor genes , including p53 , rb , and pten [ 66 - 72 ] .
activation of the ras pathway occurs in approximately 80% of all nmibcs , whereas more than 50% of mibcs exhibit loss of p53 function [ 70 - 72 ] .
importantly , there is crosstalk between these pathways and the mtor pathway , which means that alterations in either pathway are predicted to influence mtor activity .
reported that intravesical rapamycin instillation exerts striking inhibitory effects on tumor progression in a bladder - specific pten and p53 double knockout transgenic mouse model , which develops carcinoma in situ lesions that progress to mibc .
in addition to the h - ras , p53 , and pten pathways , diverse upstream signals such as ampk and insulin can affect the mtor pathway .
although no direct evidence about the role of the ampk pathway in bladder cancer is currently available , several studies support the idea that the ampk pathway might influence both bladder cancer development and progression .
liu et al . reported that rhodiola rosea extract and salidroside inhibit the mtor pathway and translational initiation via activation of ampk in umuc-3 bladder cancer cells .
metformin inhibits the growth of bladder cancer cells via indirect activation of ampk , which in turn suppresses the mtor / p70 s6 kinase-1 ( s6k1 ) pathway in 253j and rt4 bladder cancer cell lines .
. demonstrated that troglitazone ( a synthetic ligand of ppar ) activates autophagy concurrent with the activation of ampk and suppression of the mtor signaling pathway in t24 cells .
activation of mtor occurs via a multistep process including upstream pi3k and ras activation , or inactivation of ampk , leading to phosphorylation and inactivation of the tuberous sclerosis complex 1 and 2 ( tsc1/tsc2 ) heterodimer .
inactivation of tsc1/tsc2 results in release of rheb inhibition and subsequent mtor activation through rheb - gtpase activity .
finally , mtor activity regulates the effects of a number of downstream molecules , including s6k and elongation - initiation factor 4e binding protein-1 . in mibc
, pten loss appears to correlate with an increased mtor activity , suggesting that it exerts a direct effect on downstream signaling components in bladder cancer .
thirty - nine percent of mibc cases exhibit either loss - of - heterozygosity ( loh ) or homozygous deletion of the pten locus , and occasionally , mutations in the pten coding region occur .
additionally , loss of p53 function appears to synergize with pten loss to promote activation of the mtor signaling pathway .
finally , loh of tsc1 has been reported in approximately 50% of bladder cancer cases . taken together
, the deregulation of components upstream of the mtor pathway may occur in bladder tumors , suggesting that mtor signaling may be elevated in this type of cancer .
the results of our analysis revealed that patients with bladder cancer have elevated levels of urinary acetyl - coa and carnitine . because carnitine is crucial for the entry of fatty acids into the mitochondria for oxidation , and acetyl - coa is the final product of this oxidation event , we speculate that -oxidation of fatty acids might be an important factor in the development of bladder cancer .
when we examined the gene expression levels of the enzymes involved in fatty acid oxidation using our published microarray data , we found that bladder cancer specimens expressed significantly higher levels of carnitine palmitoyl transferase 1a ( cpt1a ) than normal bladder mucosae .
cpt is a key enzyme that uses carnitine to transfer fatty acids to the mitochondria for oxidation . in particular ,
our microarray data also showed that bladder cancers express carnitine acylcarnitine translocase - like protein ( cacl ) , another enzyme involved in fatty acid transport to mitochondria , at higher levels than normal bladder mucosae .
although cacl has not been studied as extensively as cpt1a , strategies that target it may also have therapeutic potential in bladder cancer .
thus , in line with other studies implicating fatty acid oxidation in various types of tumorigenesis , our metabolomics study and microarray analysis indicated that -oxidation of fatty acid plays an important role in bladder tumorigenesis and aggressiveness .
the level of acetyl - coa , another molecule associated with -oxidation , can be influenced by input from pyruvate through the pyruvate dehydrogenase complex .
we also found that the level of a third component of the complex , dihydrolipoyl dehydrogenase , is significantly reduced in bladder cancer .
this observation suggests that the higher acetyl - coa levels in bladder cancer are largely due to elevated -oxidation , rather than conversion from pyruvate .
our speculation is concordant with the warburg effect in cancer cells , in which pyruvate is converted to lactate rather than acetyl - coa .
although the ampk - fatty acid -oxidation pathway has not been completely characterized in the context of bladder cancer , fatty acid -oxidation is mainly controlled by the ampk pathway , suggesting that ampk acts as an oncogenic regulator of bladder cancer .
the pathways related to ampk - fatty acid -oxidation that are putatively affected by bladder cancer , based on data from our two studies , are summarized in fig .
4 . several lines of evidence suggest that activation of the mtor pathway and stimulation of the fatty acid -oxidation pathway might be important in the development of bladder cancer .
, no study to date has described the connection between the ampk , mtor , and -oxidation pathways .
additional research into the missing link between mtor and -oxidation of fatty acids following ampk activation may reveal novel mechanisms underlying the roles of ampk in bladder cancer .
although ampk activation ( resulting in torc1 inhibition ) is considered to be a reasonable anticancer tactic , ampk may in fact exert very complex effects in tumor cells .
the antidiabetic drug metformin , which inhibits mitochondrial metabolism , inhibits mtorc1 in both an ampk - dependent and ampk - independent manner .
compound c , a selective ampk inhibitor , binds to the ampk subunit and acts as an atp - competitive inhibitor .
however , several studies have demonstrated that compound c can also inhibit many other kinases as well as the bone morphogenetic protein receptor , and this promiscuity raises doubts about whether its effects are mediated by ampk inhibition .
sunitinib , a multiple tyrosine kinase inhibitor that is used clinically against advanced clear - cell renal cell carcinoma , can directly inhibit ampk by binding the ampk subunit .
table 1 summarizes how ampk activity can be affected not only in vitro , but also in growing cells , organs , or whole organisms .
these data were collected from several publications describing the molecular mechanisms and tissue - specific effects of ampk activity .
currently , several lines of evidence suggest that ampk could act as a tumor promoter rather than tumor suppressor .
notably , secondary activation of ampk by many metabolic inhibitors actually induces resistance to apoptosis , suggesting that inhibition of ampk with concurrent induction of metabolic stress represents a more reasonable anticancer therapeutic strategy than activating ampk .
such an approach might provide an effective way to investigate the synergistic anticancer effects of combination therapy using current treatment modalities in conjunction with the relevant ampk inhibitors .
although ampk was originally considered a tumor suppressor that acted via mtorc1 inhibition , today the consensus is that ampk might in fact be a tumor promoter .
this suggests that inhibition of ampk is a more reasonable strategy for treating cancers than activating the enzyme .
although activation of the mtor pathway and elevated fatty acid -oxidation are closely associated with the ampk pathway , no publication has described the connection between the ampk , mtor , and -oxidation pathways . therefore , further research aimed at identifying the missing link between mtor and -oxidation of fatty acid following ampk activation will provide better insight into the role of ampk in bladder cancer . | the 5-amp - activated protein kinase ( ampk ) is a key regulator of cellular metabolism and energy homeostasis in mammalian tissues .
metabolic adaptation is a critical step in ensuring cell survival during metabolic stress . because of its critical role in the regulation of glucose homeostasis and carbohydrate , lipid , and protein metabolism ,
ampk is involved in many human diseases , including cancers .
although ampk signaling was originally characterized as a tumor - suppressive signaling pathway , several lines of evidence suggest that ampk plays a much broader role and can not simply be defined as either an oncogenic regulator or tumor suppressor .
notably , several recent studies demonstrated that the antitumorigenic effects of many indirect ampk activators , such as metformin , do not depend on ampk .
conversely , activation of ampk induces the progression of cancers , emphasizing its oncogenic effect .
bladder cancer can be divided into two groups : non muscle - invasive bladder cancer ( nmibc ) and muscle - invasive bladder cancer ( mibc ) .
the molecular mechanisms underlying these two types of cancer are distinct : nmibc is associated with activation of the ras pathway , whereas mibc is characterized by loss of major tumor suppressors .
importantly , both pathways are connected to the mammalian target of rapamycin ( mtor ) pathway .
in addition , our recent metabolomic findings suggest that -oxidation of fatty acids is an important factor in the development of bladder cancer .
both mtor and -oxidation are tightly associated with the ampk pathway .
here , i summarize and discuss the recent findings on the two distinct roles of ampk in cancer , as well as the relationship between bladder cancer and ampk . |
hiv / aids has been recognized as one of the most important public health problems in the recent past , especially in asian countries such as malaysia , china , thailand , and iran . according to the world health organization 's ( who 's ) report of hiv
, iran is categorized as one among the countries with gradually accumulating levels of infection .
preventing hiv infection is one of the top priorities in 2010 to lead a healthy life .
three transmission ways have been identified for the disease : sexual activity with an infected person , contact with infected blood through sharing injection needles , and mother - to - infant infection . in order to prevent hiv transmission through sexual activities , which accounts for 85% of the disease ,
the three following options have been recommended : abstinence , faithfulness , and condom use , among which the first one is the safest . due to the lack of global access to aids treatment and also based on the fact that hiv / aids transmission requires a behavioral process , behavioral change interventions are the best approach to prevent the spread of the disease . since most health problems are closely related to human behavior , behavioral theories and models can provide insights into finding ways to prevent health problems such as hiv / aids .
most of the studies conducted have been based on cognitive - behavioral , health belief models , and theories such as social cognitive theory ( sct ) and theory of reasoned action ( tra ) .
considering the results , and in order to increase the efficiency of the models , a selective mixture of aforementioned theories has been employed in the present study . in his survey of aids - behavior change theories , noar ( 2007 ) mentioned 13 theories used in the studies , including belief- and intervention - based , message - driven , and aids - related theories , and other common hygienic behavior changes .
some researchers used a questionnaire based on behavior change theories or models such as motivation - behavioral skills model ( imb ) , social cognitive theory ( sct ) , and the theory of reasoned action ( tra ) .
furthermore , the constructs such as knowledge , attitude , self - efficacy ( se ) , behavioral intention ( bi ) , and high - risk sexual behavior were used in some studies .
therefore , given the cultural differences between the western countries and iran and the sensitive nature of the disease , the hiv / aids behavior change questionnaires derived from the previous studies conducted in non - islamic countries can not be applied here .
although the validity and reliability of the questionnaire has been confirmed in a previous study , this study was conducted only with male students . however , to our knowledge , no study has been carried out with female students so far . as females , in comparison with males ,
are physiologically more vulnerable to hiv / aids , female students were selected as the target group . considering the lack of appropriate tools and questionnaires , the study focused on designing and validating a culturally suitable sexual abstinence questionnaire among unmarried iranian female students .
the study was cross - sectional in design and was conducted from february to june 2010 .
the criteria based on which the participants were selected were as follows : age range of 15 - 25 years , single status , living alone , and residing in tehran for at least 1 year at the time of the study .
those with physical disability and those reluctant to participate in the study were excluded . for achieving an appropriate score maximum fitness and predicting the number of students , the participants were randomly selected from the three areas of humanities , engineering , and science at the university of tehran .
then , the participants were selected through cluster systematic sampling ( with each class as one cluster ) . for each question ,
a minimum of 10 samples were used according to munro 's method , and 348 female students were randomly selected to reach construct validity .
descriptive ( mean , standard deviation , and cronbach 's alpha ) and inductive statistics ( exploratory and confirmatory factor analysis ) functions of spss and amos ver . 16 were used to analyze the data .
a self - administered questionnaire was used which comprised the following four parts : socio - demographic characteristics , se regarding sexual abstinence , perceived benefits ( pb ) toward sexual abstinence , and behavioral intention ( bi ) .
the demographic information included age , residency region , family income , parents education , and previous knowledge about hiv .
there were four se questions about individual restraint , avoidance of risky situations , and the behavioral skills of saying no .
for unifying the results and facilitating analysis , the questions were designed with five options ranging from strongly agree to strongly disagree . for each item ,
a typical 5-point likert scale ranging from strongly disagree ( 1 ) to strongly agree ( 5 ) was used .
the scale of pb consisted of six items measuring individual and social benefits of abstinence , risky behavior avoidance , negative answer to risky offers , and high - risk situation avoidance .
furthermore , one question with regard to the features of female students in the studied society was added to the aforementioned questions .
bi questions consisted of four items based on the dual behavior theory of gibbons and gerrard and a domestic questionnaire designed by ghaffari et al .
these questions were about the bi of abstinence , a negative answer to risky advances , and avoidance of highly risky situations .
also , given the fact that the participants were young and prone to highly risky situations , one of the questions required them to give their own opinions about their willingness to avoid high - risk situations .
descriptive statistics , cronbach 's alpha , and exploratory and confirmatory factor analysis functions of spss and amos ver .
the study was approved by the ethics committee of tehran university and ethical principles were adhered to throughout the study . after the researchers explained the purpose and procedures of the study to the participants , they consented to participate in the study .
the study was cross - sectional in design and was conducted from february to june 2010 .
the criteria based on which the participants were selected were as follows : age range of 15 - 25 years , single status , living alone , and residing in tehran for at least 1 year at the time of the study .
those with physical disability and those reluctant to participate in the study were excluded . for achieving an appropriate score maximum fitness and predicting the number of students , the participants were randomly selected from the three areas of humanities , engineering , and science at the university of tehran .
then , the participants were selected through cluster systematic sampling ( with each class as one cluster ) . for each question ,
a minimum of 10 samples were used according to munro 's method , and 348 female students were randomly selected to reach construct validity .
descriptive ( mean , standard deviation , and cronbach 's alpha ) and inductive statistics ( exploratory and confirmatory factor analysis ) functions of spss and amos ver . 16 were used to analyze the data .
a self - administered questionnaire was used which comprised the following four parts : socio - demographic characteristics , se regarding sexual abstinence , perceived benefits ( pb ) toward sexual abstinence , and behavioral intention ( bi ) .
the demographic information included age , residency region , family income , parents education , and previous knowledge about hiv .
there were four se questions about individual restraint , avoidance of risky situations , and the behavioral skills of saying no .
these questions were also designed according to the iranian standardized general se questionnaire . for unifying the results and facilitating analysis ,
the questions were designed with five options ranging from strongly agree to strongly disagree . for each item ,
a typical 5-point likert scale ranging from strongly disagree ( 1 ) to strongly agree ( 5 ) was used .
the scale of pb consisted of six items measuring individual and social benefits of abstinence , risky behavior avoidance , negative answer to risky offers , and high - risk situation avoidance .
furthermore , one question with regard to the features of female students in the studied society was added to the aforementioned questions .
bi questions consisted of four items based on the dual behavior theory of gibbons and gerrard and a domestic questionnaire designed by ghaffari et al .
these questions were about the bi of abstinence , a negative answer to risky advances , and avoidance of highly risky situations .
also , given the fact that the participants were young and prone to highly risky situations , one of the questions required them to give their own opinions about their willingness to avoid high - risk situations .
descriptive statistics , cronbach 's alpha , and exploratory and confirmatory factor analysis functions of spss and amos ver .
the study was approved by the ethics committee of tehran university and ethical principles were adhered to throughout the study . after the researchers explained the purpose and procedures of the study to the participants , they consented to participate in the study .
in order to determine the face validity , the questionnaire was distributed to 30 students with similar characteristics .
they were asked to pinpoint the weaknesses and ambiguities of the questionnaire , comment on its clarity , rationality , brevity , and appropriateness , and finally , improve it .
content validity ratio ( cvr ) was applied to assess the extent of experts comment upon the clarity , rationality , brevity and appropriateness of itthen , the questionnaire was given to 20 specialists in the fields of health education , nursing , medicine , and psychology to take the experts ideas into account .
content validity was assessed by each panel member with a 3-item likert scale ( the items were necessary , useful but not necessary , and unnecessary ) . in case
the number of questions was reduced to 50 after measuring the cvr . in order to verify the reliability of the questionnaire ,
cronbach 's alpha or the internal consistency for pb , bi , and se variables was found to be 0.87 , 0.77 , and 0.85 , respectively .
all these values indicate the desirable level of the scales . in order to determine the construct validity of the questionnaire ,
one way of investigating construct validity is by running a factor analysis for identifying clusters of questions related to the instruments .
this method helps the researcher to determine whether the available tool measures one construct or several ones .
the exploratory factor analysis using principal components analysis with varimax rotation was used to determine compliance and naming of the extracted factors . using all observations ( n = 348 ) , the factor analysis helped in identifying three decisive factors with a variance greater than 61% and 88% of kaiser meyer
olkin ( kmo ) , both of which are appropriate indicators of factor analysis . after inserting three retention factors in the orthogonal varimax rotation , each of the factors was given a name and estimated using the probability method .
based on the loadings , and also the content of questions , the three factors were identified as se , bi , and pb , respectively .
as presented in the chart , only the first three values have eigen values more than one .
six pb questions were omitted , and four se and four bi questions were used in the model ; at the final stage and after determining factor analysis , one se question was deleted .
the results of the exploratory factor analysis with varimax rotation after running exploratory factor analysis , in order to confirm the supposed factor structure of the measure as well as the contribution of each question in measuring the components of self - efficacy , bi and pb were analyzed using amos software .
the insignificance of the statistics indicated the model 's fitness with the data , but the pitfall of the statistics is that it is sensitive to the sample size , which means that with larger sample sizes , the possibility of the statistics being insignificant t decreases .
values less than 0.05 for the index root mean square error of approximation ( rmsea ) , values above 0.9 for goodness of fitness index ( gfi ) , and adjusted goodness of fitness index ( agfi ) were used as the criteria for model compliance with the observed data [ table 3 ]
. as it was stated , the model 's of the goodness of fitness indexes are all acceptable .
therefore , the confirmatory factor analysis also approved the construct validity of the questionnaire [ figure 1 ] .
structural equation fitness to model on the whole , 348 female students participated in the study
the characteristics of the study sample goodness fitness indexes of the sexual abstinence behavior of hiv / aids questionnaire the average of cvr for the entire questionnaire was 0.85 .
the cvr for the subscales of pb , bi , and se was calculated to be 0.83 , 0.84 , and 0.89 , respectively . the time needed for completing the questionnaire was about 6 min .
in order to verify the reliability of the questionnaire , cronbach 's alpha score was calculated .
cronbach 's alpha or the internal consistency for pb , bi , and se variables was found to be 0.87 , 0.77 , and 0.85 , respectively .
all these values indicate the desirable level of the scales . in order to determine the construct validity of the questionnaire ,
one way of investigating construct validity is by running a factor analysis for identifying clusters of questions related to the instruments .
this method helps the researcher to determine whether the available tool measures one construct or several ones .
the exploratory factor analysis using principal components analysis with varimax rotation was used to determine compliance and naming of the extracted factors . using all observations ( n = 348 ) , the factor analysis helped in identifying three decisive factors with a variance greater than 61% and 88% of kaiser meyer
olkin ( kmo ) , both of which are appropriate indicators of factor analysis . after inserting three retention factors in the orthogonal varimax rotation , each of the factors was given a name and estimated using the probability method .
based on the loadings , and also the content of questions , the three factors were identified as se , bi , and pb , respectively .
as presented in the chart , only the first three values have eigen values more than one .
six pb questions were omitted , and four se and four bi questions were used in the model ; at the final stage and after determining factor analysis , one se question was deleted .
the results of the exploratory factor analysis with varimax rotation after running exploratory factor analysis , in order to confirm the supposed factor structure of the measure as well as the contribution of each question in measuring the components of self - efficacy , bi and pb were analyzed using amos software .
the insignificance of the statistics indicated the model 's fitness with the data , but the pitfall of the statistics is that it is sensitive to the sample size , which means that with larger sample sizes , the possibility of the statistics being insignificant t decreases .
values less than 0.05 for the index root mean square error of approximation ( rmsea ) , values above 0.9 for goodness of fitness index ( gfi ) , and adjusted goodness of fitness index ( agfi ) were used as the criteria for model compliance with the observed data [ table 3 ] .
as it was stated , the model 's of the goodness of fitness indexes are all acceptable .
therefore , the confirmatory factor analysis also approved the construct validity of the questionnaire [ figure 1 ] .
the characteristics of the study sample goodness fitness indexes of the sexual abstinence behavior of hiv / aids questionnaire the average of cvr for the entire questionnaire was 0.85 .
the cvr for the subscales of pb , bi , and se was calculated to be 0.83 , 0.84 , and 0.89 , respectively . the time needed for completing the questionnaire was about 6 min .
considering that there is lack of valid and reliable questionnaire on the behavioral changes of hiv / aids among iranian females , we aimed to design an appropriate abstinence questionnaire and determine its validity and reliability .
this point has been taken into account to a lesser extent in the questionnaires developed in the western countries .
for example , some iranians believe that avoiding unsafe sexual encounters would give them better chances of getting married in the future .
other studies on the validity and reliability of domestic questionnaires have mainly investigated the knowledge of people and their behaviors and attitudes toward hiv , and reported the reliability of the scales .
for instance , in a study by khatoni et al . , face - to - face web - based training was employed to verify the content validity of nurses knowledge questionnaire by the experts , and also , the reliability of the questionnaire was confirmed through test retest ( 0.9 ) .
furthermore , the cronbach 's alpha for the hiv / aids knowledge and attitude questionnaire developed by diclemente et al . was reported to be 0.72 . in the study conducted by nije - carr on hiv / aids knowledge , attitudes , and beliefs patient questionnaire ( hakabpq ) ,
also , the internal consistency of hiv - related knowledge , attitudes , and sexual risk - taking behaviors was reported to be 0.073 in the study by ugarte et al . in the study of koopman et al .
( 1990 ) , both the knowledge and belief instruments were indicated to have a high internal consistency , test retest reliability , and successfully avoided ceiling effects .
the highest reported figure was 0.96 for the validity of st andrews sexual knowledge and attitudes instrument ( saskai ) , which was conducted among female employees by kappa test .
of course , the high internal consistency is a result of high level of similarity among the questions . in the study of hughes and admiraal
entitled systematic review of hiv / aids knowledge measures , the results showed low reliability and a validity rate of hiv knowledge questionnaire .
in general , the measuring instruments of knowledge , attitudes , and beliefs about hiv do not have a high level of internal consistency and have rarely been tested by factor analysis .
lux and petoza designed a questionnaire based on which the cronbach 's alpha was estimated to be 0.64 and 0.79 for healthy sexual bi and se of sexual discussion , respectively . in another study conducted by mahoney thombs and ford , the cronbach 's alpha se subscale for using condoms
the scale of mukoma et al . , which was applied to evaluate school - based hiv / aids intervention in south african courtiers and tanzania , reported a cronbach 's alpha of higher than 0.5 .
regarding sexual behaviors , the cronbach 's alpha was lower than 0.5 , based on which the author verified the utility of the scales . in a similar study conducted by ghafari et al . , the alpha values for a 10-scale instrument about hiv / aids prevention were 0.69 , 0.78 , and 0.74 for se , pb , and bi , respectively , which were lower than those of the present instrument
. it is worth noting that the alpha values between 0.8 and 0.9 show a high internal consistency and the alpha values of 0.7 and higher present a good internal stability . in the present study ,
the cronbach 's alpha was between 0.77 and 0.87 , indicating a good internal correlation of the instrument . also , the reliability coefficient of the scale was approximately 0.85 , which is satisfactory when seen in the light of the studies listed .
there were three main measures of sexual behaviors : abstinence , number of sexual partners , and condom use , which were measured in some articles , the psychological measures of sexual abstinence instrument have not been mentioned .
one of the strengths of the study was using different methods of testing reliability and validity and exploratory and confirmatory factor analysis .
it should be noted that the questionnaire was optimal in terms of structure validity and scale clustering and the goodness of fitness indexes .
other researchers are suggested to work on the construction of theories of behavior change scale in islamic contexts as well as to research into different groups of adolescents , youth , and occupations with the risk of hiv / aids infection .
this study have showed that the sexual behavioral abstinence , and avoidance of high - risk situation questionnaire ( sbahaq ) questionnaire can be used as a valid and reliable tool to measure abstinence and avoidance of high - risk situations regarding hiv / aids infection .
however , it is recommended to test the validity of the tool in various communities such as students , scholars , etc . | background : this study was designed to assess the validity and reliability of the designed sexual , behavioral abstinence , and avoidance of high - risk situation questionnaire ( sbahaq ) , with an aim to construct an appropriate development tool in the iranian population.materials and methods : a descriptive analytic study was conducted among female undergraduate students of tehran university , who were selected through cluster random sampling . after reviewing the questionnaires and investigating face and content validity , internal consistency of the questionnaire was assessed by cronbach 's alpha .
explanatory and confirmatory factor analysis was conducted using spss and amos 16 software , respectively.results:the sample consisted of 348 female university students with a mean age of 20.69 1.63 years .
the content validity ratio ( cvr ) coefficient was 0.85 and the reliability of each section of the questionnaire was as follows : perceived benefit ( pb ; 0.87 ) , behavioral intention ( bi ; 0.77 ) , and self - efficacy ( se ; 0.85 ) ( cronbach 's alpha totally was 0.83 ) .
explanatory factor analysis showed three factors , including se , pb , and bi , with the total variance of 61% and kaiser meyer olkin ( kmo ) index of 88% .
these factors were also confirmed by confirmatory factor analysis [ adjusted goodness of fitness index ( agfi ) = 0.939 , root mean square error of approximation ( rmsea ) = 0.039].conclusion : this study showed the designed questionnaire provided adequate construct validity and reliability , and could be adequately used to measure sexual abstinence and avoidance of high - risk situations among female students . |
diabetes is a major cause of health concern in the world and is growing in epidemic proportions .
it is assumed that in the next ten years it will become number one disease of the world1 .
type-1 diabetes mellitus ( t1 dm ) is an autoimmune disease while type 2 is mostly a lifestyle disease .
majority of people suffer mainly due to type-2 diabetes and is responsible for the current diabetes explosion .
the detection early markers for the disease and its prevention is an active area of research to develop target based novel drugs .
insulin , a key polypeptide hormone secreted by the pancreas , targets several tissues for the utilization of glucose and thus maintains the glucose homeostasis .
type 2 diabetes mellitus ( t2 dm ) develops from a combination of genetic and acquired factors ( such as changes in metabolic homeostasis ) that impair -cell function on one side , and tissue insulin sensitivity on the other23 .
recurrence of these changes in metabolism creates a stress on pancreas often predating the on - set of t2 dm by many years .
this pancreatic stress causes -cell mass expansion , through enhanced proliferation and neogenesis . the progression from this stress condition to a state of diabetes
this -cell loss arises due to an increase in -cell apoptosis , which clearly outweighs replication and neogenesis .
the war against diabetes through the development of new drugs is an ongoing continuous process5 . with the technological advancement
pancreatic rejuvenation can happen either due to proliferation of existing -cells or differentiation of progenitor cells to -cells6 ( figure ) , or due to decrease in -cell apoptosis .
new -cells can arise from ( 1 ) replication of pre - existing -cells ( 2 ) differentiaition of stem / progenitors or transdifferentiation of acinar cells ( 3 ) prevention of apoptosis ( not shown in figure ) also contributes for regeneration of pancreas in which gene / gene products play in conjunction either with ( 1 ) or ( 2 ) . all these mechanism may contribute synergistically for the regeneration of pancreas .
see tables 1 , 2 and 3 for gene / gene products involved in the above processes for pancreatic rejuvenation . reproduced with permission from nature publishing group , london , uk6 .
islets regeneration refers to an increase in -cell mass by proliferation and replication of existing islet cells .
several mouse studies789 here shown that -cells do not proliferate , however , lineage tracing studies1011121314 have confirmed that human -cells proliferate and give rise to a population of progenitor / stem cell . various genes and transcription factors
reg ( regenerating islets derived proteins ) , sox9 , hnf-6 , neurod1 , neurogenin-3 and netrin-1 ( table i ) .
besides these genes , certain peptides or their analogues such as glucagon like peptide-1/exendin-4 are also involved in islet regeneration .
these observations are confirmed by using dipeptidyl peptidase ( dpp ) iv inhibitor sitagliptin in mice15 .
genes involved in beta cell proliferation so far , five reg proteins have been reported in humans that belong to reg gene family .
some of the members of this family have been implicated in -cell replication and/or neogenesis as shown in in vivo studies using transgenic and knockout mice16 .
this reg family of genes are expressed in both young and old mice that were subjected to partial pancreatectomy18 . in isolated rat islets , reg1 mrna levels
were significantly increased by glucose , amino acids , foetal serum or specific growth factors such as insulin , growth hormone and platelet - derived growth factors ( pdgf)19 .
pdgf receptor signalling controls age - dependent -cell proliferation in mouse and human pancreatic islet cells20 .
disruption of regi gene resulted in a significantly decreased rate of dna synthesis and diminished -cell hyperplasia in response to obesity , confirming the role of endogenous regi in islets cell growth21 . a study conducted by huszarik
et al22 showed upregulation of regii during diabetogenic process and also after adjuvant therapy in nod mice .
while all reg family mrnas can be detected from total pancreas , regii and regiii genes have been detected in pancreatic islet cells as confirmed by immunofluorescence23 and regiii expression was remarkably increased during pregnancy in rats24 .
regiii , another member of reg family of genes is also found to be involved in regeneration of pancreas .
reg iii protein was found to be expressed only in regenerating islets and not in normal rat pancreas26 and its gene expression level induced 10 - 100 folds on day 3 of pancreatectomy27 .
these data suggest that there is a strong link between reg gene family and rejuvenation of pancreatic islets .
certain transcription factors ( sox9 , hnf-6 , ngn-3 and neurod1 ) are also found to be involved in the proliferation of -cells .
sox9 is the first specific marker and maintenance factor of multi - potential progenitors during pancreatic organogenesis .
sox9 , in the embryonic pancreas stimulates proliferation and prevents apoptosis of pluripotent progenitor cells .
the phenotypic alterations in the sox9-deficient pancreas shows a striking resemblance to the pancreatic defects associated with mutations in components of the notch signalling pathway , thus establishing a possible link between sox9 and the notch signal transduction pathway for stem cell maintenance28 .
the hepatocyte nuclear factor 6 ( hnf-6 ) , homeodomain - containing transcription factor , is an important regulator of endocrine development .
hnf6 is expressed in early pancreatogenesis in all endodermally derived cells , but is not detected in differentiated endocrine cells at late - gestation29 .
in addition to defects in endocrine development , hnf-6 null embryos showed defects in duct development31 .
loss of hnf-6 from ngn-3 expressing cells did not affect -cell function or glucose homeostasis suggesting that hnf-6 is dispensable for later events of endocrine differentiation .
these data confirm that hnf6 has both early and late functions in the developing pancreas and is essential for maintenance of ngn-3 expression and proper pancreatic duct morphology32 .
neurod1 , a downstream target of ngn-3 , carries on the endocrine differentiation programme initiated by ngn3 and participates in the maintenance of the differentiated phenotype of the mature islet cells33 . during pancreatic endocrine development ,
ngn-3 acts early to determine endocrine cell fate , while neurod1 directs endocrine cell differentiation34 . at early stage of life , mice lacking a functional neurod1 ( also called as beta2 ) gene exhibit a striking reduction in the number of insulin - producing -cells and failed to develop mature islets with a marked hyperglycaemia .
attempts to rescue the diabetic phenotype by administration of insulin were unsuccessful , suggesting that the mutant animals were unable to respond to insulin , have become insulin resistant , or perhaps contained additional defects35 .
thus beta-2 is required for the expansion of the pancreatic -cells population , as well as other islet cell types which are involved in the development of endocrine cells into islets of langerhans34 .
netrins are laminin - like diffusible chemotactic proteins involved in pancreatic morphogenesis and play a role in the regulation of duct - cell and foetal islet cell migration . in adult rat pancreas ,
after duct ligation , its expression was very low in the head part of the pancreas whereas it was strongly upregulated in the tail part at 3 , 5 and 7 day of post - ligation with the maximum expression on day 536 .
netrin-1 mrna was found to be expressed by islet cells and exocrine cells with ductal characteristics .
these observations suggest that netrin-1 plays a role in pancreatic morphogenesis , both prenatally and in the regenerating adult rat pancreas .
islet neogenesis specifically refers to an increase in -cell mass via transdifferentiation of adult pancreatic stem cells , putatively found in the ductal epithelium or acinar tissue .
trans - differentiation involves in the conversion of alpha or delta cells of the pancreas into insulin producing -cells .
these include ingap , gastrin , mafa , pdx-1 , foxa2 , nkx2.2 , nkx6.1 , pax4 , etc .
genes involved in pancreatic neogenesis ingap ( islets neogenesis associated protein ) is a member of the c - lectin protein family that serves as the initiator of a cascade of events that culminates in islet neogenesis and can reverse diabetes in streptozotocin - induced diabetic c57bl/6j mice37 . these studies were further confirmed in beagle dogs38 .
there was also a significant increase in insulin gene expression in the ingap treated animals .
ingap is also found in human pancreas during pathological states involving islet neogenesis which further suggests that ingap is of primary importance in the process of islet neogenesis39 .
gastrin , a classical gut hormone secreted by g cells in the stomach lining is found to stimulate pancreatic -cell neogenesis .
intravenous infusion of gastrin into the ligated duct cells , resulted in a doubling of the -cell mass in rats40 , due to high expression of gastrin / cholecystokinin ( cck ) b receptors in duct ligated cells41 .
these observations were confirmed using egf plus gastrin combinatorial therapy , which showed an increase in insulin positive cells in human islet42 . in another study using glp-1 and gastrin in nod mice , there was a significant reduction in blood glucose due to increase in pancreatic -cell mass and insulin content43 .
mafa a member of maf subfamily of leucine zippers is capable of strongly activating the insulin promoter .
mafa is restricted to -cells and known to be important in the embryonic development of pancreas45 .
however , it is not clear whether these work alone or in combination with other transcription factors in a coordinated manner .
the list of the transcription factors and their role in transdifferentiation is summarized in table ii .
pancreatic duodenal homeobox-1 ( pdx-1 ) , a homeobox transcription factor , besides being involved as a regulator of pancreatic development ( the differentiation and gene expression in the -cell)47 , pdx1 also turns out to be a major player in the maintenance of an adequate pool of healthy -cells in adults4849 .
it maintains the homeostasis between -cell neogenesis and apoptosis . in mice with a 50 per cent reduction in pdx1
, the 0isolated islets showed more susceptibility to apoptosis at basal glucose concentrations along with impaired ability to maintain -cell mass with age .
the survival functions of pdx1 may be mediated by insulin / igf signaling acting through the forkhead transcription factor foxo1 ( forkhead / winged helix transcription factor ) .
foxa2 ( formerly known as hnf-3 ) is a key regulator of foregut development that plays an essential role in the cell type - specific transcription of the pdx-1 gene in the pancreas51 . on deletion of foxa2 in mice
this shows that foxa2 is an essential upstream factor that regulates pdx-1 mrna levels in -cells .
nkx2.2 is another essential pancreatic transcription factor that affects the expression of ghrelin during pancreatic development53 .
nkx2.2-null mice lose all -cells and the majority of the -cells ; and the islet is predominantly populated by gherlin expressing cells .
the discovery that ghrelin cells often replace the other endocrine populations in the pancreas54 suggests a lineage relationship between the ghrelin producing epsilon cells and other hormone - producing populations55 . in another study ,
disruption of the nkx2.2 gene has shown to lead to the accumulation of incomplete differentiated -cells that express some -cell markers , but not insulin56 .
the phenotypic effects of nkx2.2 mutant mice may in part result from the loss of other homeodomain transcription factor nkx6.1 . in pancreas
, nkx6.1 also follows an expression pattern similar to that of nkx2.2 ; but restricted to the -cells alone57 .
in the same study , with the double knockout animal model ( nkx2.2/nkx6.1 ) showed the same phenotype as of nkx2.2 single mutant58 .
the paired homeobox transcription factor pax4 appears to be a strong candidate for specifying -cell lineages .
mice deficient in pax4 fail to develop beta and delta cells within the pancreas suggesting that pax4 expression commits selected endocrine precursors towards the beta and delta cell lineage59 .
the pax4 genes are expressed during the embryonic pancreatic development , but later on these are restricted to -cells alone .
this indicates the role of pax4 0 in the maintenance of progenitors and in maturation of -cells .
under normal circumstances , apoptosis is highly regulated to maintain normal physiological function of the cells . in diabetes , during excess stress , the pancreatic cells not only undergo apoptosis but also become necrotic and are unable to secrete insulin . a study conducted by butler
et al61 indicated that increased apoptosis rather than decreased neogenesis / proliferation might be the main mechanism leading to reduced -cell mass in t2 dm .
thus , decrease in the rate of apoptosis itself , may increase the -cell mass via proliferation .
several genes / proteins are involved in pancreatic apoptosis and their functions are summarized in table iii .
genes involved in inhibition of beta cell apoptosis perforin ( pore forming protein ) is a cytolytic protein , initiating apoptosis by inducing minimal cell membrane damage while effectively releasing granzymes from the endosomal compartment into the cytosol62 . of the granzyme family ,
granzyme a and b are the most common in human and mouse63 . granzyme a induces single - strand dna breaks , while granzyme b cleaves specific substrates including caspases and the pro - apoptotic molecule bid64 .
activated bid is targeted to the mitochondria where it sequesters anti - apoptotic members of the bcl-2 family , allowing the oligomerization of bax and/or bak which mediates loss of mitochondrial outer membrane potential , release of cytochrome c and causes irreversible apoptosis65 . during hyperglycaemic condition its expression is elevated in -cells , thus increasing the rate of apoptosis51 .
caspase-3 has been extensively studied in various tissues due to its role as the principal executioner of apoptosis68 . as such
caspase-3 null ( casp3-/- ) mice were found to be protected from developing diabetes in a multiple - low - dose streptozotocin autoimmune diabetic model70 .
this illustrates the importance of caspase-3 in -cell death and its activity is found to be increased during the diabetic conditions .
this protein blocks the functions of caspases in the mitochondria - dependent cell death pathway , protecting cells from apoptosis71 .
deletion of survivin within the mice endocrine pancreas results in diabetes manifested by hyperglycaemia and polyuria .
thus , it may play a role in the replication and/or survival of matured -cells73 .
surprisingly it is modestly upregulated in diabetic patients74 which may help to assuage diabetes . beside survivin , there are other proteins present in pancreas which prevent apoptosis .
bcl - xl , an anti - apoptotic protein coded by the survival gene , is involved in the inhibition of apoptosis .
marked overexpression of bcl - xl , resulted in a severe defect in insulin secretion and hyperglycaemia in transgenic mice75 .
under conditions of stress , -cells require bcl - xl to maintain their survival in vivo48 .
myc sensitizes cells to a variety of apoptotic triggers rather than directly inducing apoptosis by itself77 .
sustained myc activation leads to initial hyperplasia and increased apoptosis later on , suggesting that apoptosis ultimately predominates over proliferation78 . in chronic hyperglycemia ,
a thioredoxin - interacting protein ( txnip ) , a regulatory protein , is involved in the inhibition of thioredoxin and thereby modulates the cellular redox state and promotes oxidative stress80 .
its overexpression in -cells is found to induce apoptosis81 , and the process involves the activation of intrinsic mitochondrial pathway , while the endoplasmic reticulum ( er)-mediated cell death remains unaffected .
it was demonstrated that their mrna expression levels are elevated during the diabetic conditions82 . in a recent study ,
huntingtin - interacting protein 14 ( hip-14 ) is found to posses anti - apoptotic property of -cells .
bace2 ( beta site amyloid precursor protein cleaving enzyme 2 ) , a proteolytic enzyme acts as a negative regulator of -cell mass via inhibiting tmem27 expression .
overexpression of tmem27 or ablation of bace2 leads to an increased -cell mass by inhibiting apoptosis84 .
it has been predicted that in near future diabetes will overtake all the current infectious and non - infectious diseases . in spite of rapid progress in our understanding regarding the pathophysiology of diabetes ,
challenges remain high due to increased complexity of the disease contributed by genetic and environmental factors . in future , there need to be more emphasis on the prognosis and better treatment for diabetes associated diseases , and on the discovery of reliable biomarker(s ) for its early detection . development of new technologies i.e. rejuvenation of the pancreas by small molecules or gene targeted drug delivery , pancreatic transplantation , stem cell therapy and creating artificial pancreas , etc . will be the mainstay of the diabetes research .
thus , it becomes essential to have better understanding of the various pathways at the molecular level that are involved in pancreatic islet cell rejuvenation . | pancreas plays an important role in maintaining the glucose homeostasis .
the deterioration of -cells in the pancreas is a crucial factor in the progression of diabetes mellitus ; therefore , the restoration of -cell mass and its function is of vital importance for effective therapeutic strategies .
the precise mechanism for increase in functional -cell mass is still unknown .
this review focuses on the importance of certain genes which are involved in the rejuvenation of pancreas .
these genes are divided according to their functions into three categories : participate either in proliferation ( mitotic division of differentiated -cells ) , neogenesis / transdifferentiation ( development from precursor cells ) or inhibition of -cell apoptosis ( programmed cell death ) .
the rate of -cell rejuvenation is the balance among the rates of -cell proliferation , neogenesis and apoptosis .
understanding these genes and their pathways may lead to the discovery of new drugs , target based gene delivery and development of safer antidiabetic drugs . |
tremor is the most common movement disorder which is defined as a compulsively , rhythmic , shaking movement of a body part .
one of the most general reasons for tremor is idiopathic parkinson 's disease ( pd ) , a progressive neurodegenerative disease .
the core clinical features of idiopathic pd include bradykinesia , followed by resting tremor , rigidity , and problems with stance stability .
these symptoms will become evident after a loss of 5070% dopaminergic cells in the substantia . however , the differential diagnosis of idiopathic pd is difficult in the early stage due to the atypical and ambiguous symptoms and signs , especially when tremor is the solely obvious symptom .
monosymptomatic resting tremor ( mrt ) is a descriptive term for resting tremor persisting for more than 2 years without other cardinal signs of pd .
some reports demonstrated that mrt is characterized by a presynaptic dopaminergic deficit with the evidence of dopamine transporter positron emission tomography ( dat - pet ) and supported that mrt represents a phenotype of pd .
most of these patients end up in the tremor - dominant variant of pd , but this may last more than a decade
. however , in clinical practice , dopaminergic functional imaging revealed some patients with mrt to be scans without evidence of dopaminergic deficits ( swedds ) .
few studies have been reported to reveal the prevalence of swedds in mrt patients and to illuminate the clinical and electrophysiological characteristics of mrt patients grouped by the dat - pet results .
this study aimed to investigate the presynaptic dopamine function by dat - pet in a prospective mrt group and to evaluate the role of clinical features and electrophysiological characteristics in the differential diagnosis .
we prospectively enrolled 43 consecutive patients with mrt who visited movement disorder clinics in beijing tiantan hospital from april 2011 to december 2013 .
the diagnosis of mrt was confirmed by movement disorder specialists according to consensus statement of the movement disorder society on tremor .
the mrt patients must meet the following criteria : ( 1 ) pure or predominant resting tremor ; ( 2 ) no sign of bradykinesia , rigidity , or abnormal gait and posture ; and ( 3 ) tremor 2 years .
patients were excluded if they had : ( 1 ) specific etiologies for the asymmetric resting tremor ( e.g. , psychogeny , medication - induced , stroke , and multiple sclerosis ) ; ( 2 ) a clear history of pd or essential tremor ( et ) in the family ; ( 3 ) an obvious lesions of intracephalic structure on head computed tomography ( ct)/magnetic resonance imaging ( mri ) scans .
information regarding demographics , medical and family history , disease course , and treatment were collected during a face - to - face interview in all patients .
the unified parkinson 's disease rating scale ( updrs ) was tested by well - trained neurologists before dat - pet examination , thus there was a blindness between clinical data and dat - pet .
the study was approved by the institutional review board ( committee for medical ethics ) of beijing tiantan hospital , capital medical university .
surface electromyographic ( emg ) recordings of the most involved limbs in all positions were performed on all patients .
the tremor frequency ( hz ) , mean amplitude ( mv ) , and pattern ( synchronous or alternating ) were assessed .
the amplitude was measured peak to the valley for each burst , and the duration was measured peak to peak for each burst .
the recording session included 5 min test and 5 min rest subsequently in each definite limb position .
the examination was performed in a room where the patients had the opportunity to be familiar with the circumstances and felt relax before the test .
c--cft , used as the dat radioligand for pet tracer , was synthesized at department of nuclear medicine , pla general hospital .
c--cft was prepared by reaction of [ c ] methyl triflate with the n - desmethyl precursor , nor - p - cft ( rbi , natick , ma , usa ) . a high - resolution pet / ct scanner ( datscan
; gemini gxl-16 , philips , the netherlands ) was used for each patient at nuclear medicine center of the second hospital of armed police beijing office .
anti - parkinsonism drugs must not be taken at least 12 h before pet , and dat agonists 72 h before the pet .
the head of the caudate and putamen on the two consecutive planes with best articulation were selected to be the regions of interest ( rois ) on bilateral hemispheres .
striatal asymmetry index ( sai ) was used to describe the asymmetry of the radioactivity uptake in the bilateral striatum .
risp and rcon represent the uptake value of dat tracer in the striatum ipsilateral or contralateral to the clinically affected body side , respectively .
continuous parameters and absolute counts were shown as mean standard deviation ( sd ) , and categorical parameters were shown as percentage .
the differences in clinical and electrophysiological features between swedds and pd patients were calculated using the unpaired , two - tailed t - test for continuous variables and chi - square test or fisher exact test for categorical variables by spss 17.0 ( spss inc . ,
we prospectively enrolled 43 consecutive patients with mrt who visited movement disorder clinics in beijing tiantan hospital from april 2011 to december 2013 .
the diagnosis of mrt was confirmed by movement disorder specialists according to consensus statement of the movement disorder society on tremor .
the mrt patients must meet the following criteria : ( 1 ) pure or predominant resting tremor ; ( 2 ) no sign of bradykinesia , rigidity , or abnormal gait and posture ; and ( 3 ) tremor 2 years .
patients were excluded if they had : ( 1 ) specific etiologies for the asymmetric resting tremor ( e.g. , psychogeny , medication - induced , stroke , and multiple sclerosis ) ; ( 2 ) a clear history of pd or essential tremor ( et ) in the family ; ( 3 ) an obvious lesions of intracephalic structure on head computed tomography ( ct)/magnetic resonance imaging ( mri ) scans .
information regarding demographics , medical and family history , disease course , and treatment were collected during a face - to - face interview in all patients .
the unified parkinson 's disease rating scale ( updrs ) was tested by well - trained neurologists before dat - pet examination , thus there was a blindness between clinical data and dat - pet .
the study was approved by the institutional review board ( committee for medical ethics ) of beijing tiantan hospital , capital medical university .
surface electromyographic ( emg ) recordings of the most involved limbs in all positions were performed on all patients .
the tremor frequency ( hz ) , mean amplitude ( mv ) , and pattern ( synchronous or alternating ) were assessed .
the amplitude was measured peak to the valley for each burst , and the duration was measured peak to peak for each burst .
the recording session included 5 min test and 5 min rest subsequently in each definite limb position .
the examination was performed in a room where the patients had the opportunity to be familiar with the circumstances and felt relax before the test .
c--cft , used as the dat radioligand for pet tracer , was synthesized at department of nuclear medicine , pla general hospital .
c--cft was prepared by reaction of [ c ] methyl triflate with the n - desmethyl precursor , nor - p - cft ( rbi , natick , ma , usa ) . a high - resolution pet / ct scanner ( datscan
; gemini gxl-16 , philips , the netherlands ) was used for each patient at nuclear medicine center of the second hospital of armed police beijing office .
anti - parkinsonism drugs must not be taken at least 12 h before pet , and dat agonists 72 h before the pet .
the head of the caudate and putamen on the two consecutive planes with best articulation were selected to be the regions of interest ( rois ) on bilateral hemispheres .
striatal asymmetry index ( sai ) was used to describe the asymmetry of the radioactivity uptake in the bilateral striatum .
risp and rcon represent the uptake value of dat tracer in the striatum ipsilateral or contralateral to the clinically affected body side , respectively .
continuous parameters and absolute counts were shown as mean standard deviation ( sd ) , and categorical parameters were shown as percentage .
the differences in clinical and electrophysiological features between swedds and pd patients were calculated using the unpaired , two - tailed t - test for continuous variables and chi - square test or fisher exact test for categorical variables by spss 17.0 ( spss inc . ,
eight patients were not involved in the present analyses for their symptoms of tremor lasting < 2 years and two patients were excluded due to incomplete documents of clinical features or electrophysiological measurements .
a total of 33 patients with definite mrt ( mean age 55.3 11.6 years , 45.5% men ) constituted the final sample [ table 1 ] .
pd were diagnosed in 84.8% ( n = 28 ) and sweeds in 15.2% ( n = 5 ) of cases , respectively .
there were no significant differences in age , gender , and age at onset of tremor between swedds and pd groups .
the duration of disease was longer in the sweeds group than in the pd group ( 13.0 years vs. 3.0 years , p < 0.05 ) .
the percentage of hoehn - yahr score 1 was similar among two groups ( 20% vs. 25% , p >
demographic and clinical characteristics of swedds and pd patients * these values were calculated by test ; others without star mark were calculated by t - test ; nonparametric test ; : not applicable , calculated by fisher exact test .
sd : standard deviation ; swedds : scans without evidence of dopaminergic deficits ; updrs : unified parkinson s disease rating scale ; pd : parkinson s disease .
according to the pet comparison with the norm values in the center , subjects were divided into two groups
. a normal symmetrical uptake of c--cft in the bilateral striatum was seen in all five patients ( swedds group ) [ figures 1 and 2 ] .
an asymmetrical reduced uptake in the striatum was seen in 28 patients ( pd group ) [ figures 1 and 3 ] .
positron emission tomography ( pet ) to distinguish scans without evidence of dopaminergic deficits ( swedds ) from parkinson 's disease ( pd ) and tremor analysis between groups .
transaxial slices of pet / tremor analysis of a patient with swedds ( left ) and another patient with right - sided pd ( right ) .
dopamine transporter positron emission tomography help to distinguish scans without evidence of dopaminergic deficits from parkinson 's disease in monosymptomatic resting tremor patients .
dopamine transporter positron emission tomography help to identify parkinson 's disease in the early age in monosymptomatic resting tremor patients . for nonmotor aspects of experiences of daily
living ( part i of updrs ) , there were no significant differences in cognitive impairment and depression between two groups [ table 1 ] . for motor experiences of daily
living ( part ii of updrs ) , pd patients were more likely to have difficulties in dressing and hygiene ( p < 0.05 ) .
more patients in pd group tended to have difficulties in walking ( 67.9% in pd group and 20.0% in swedds group , p > 0.05 ) , although the difference was of no statistical significance .
the two groups were similar in speech and freezing of gait . for motor examination ( part iii of updrs ) , the score was much lower in the sweeds group than in the pd patient group , and the difference was statistically significant ( 11.0 2.0 vs. 23.2 12.5 , p < 0.01 ) . eighteen ( 64.3% ) pd patients had a resting tremor , and 25 ( 89.3% ) had a postural tremor . a resting tremor was recorded in 3 ( 60.0% ) swedds patients and postural tremor was recorded in all 5 ( 100% ) swedds patients . the difference in tremor distribution ( resting tremor or postural tremor ) between two groups was not statistically significant .
but the proportion of bilateral tremor was much higher in swedds group than in the pd group ( 100% vs. 32.1% , p < 0.05 ) [ table 2 ] . tremor analysis in patients with swedds and pd * these values were calculated by test ; others without star mark were calculated by t - test ; nonparametric test ; : not applicable , calculated by fisher exact test .
swedds : scans without evidence of dopaminergic deficits ; pd : parkinson s disease ; sd : standard deviation .
electrophysiological study the electrophysiological findings in 2 different conditions ( resting or postural tremor ) in studying group are shown in table 2 . no subject had a kinetic tremor in either of the two groups . there were no significant differences in the frequency and amplitude of resting or postural tremor between two groups . tremor analysis : frequency and amplitude table 2 shows the results of emg measurements in both resting and postural tremors .
the frequency of resting tremor in swedds group tended to be higher than in the pd group , but without significant difference ( p = 0.08 ) .
the amplitude of postural tremor tended to be higher in swedds group than in pd group , but the difference was of no significance ( p = 0.05 ) .
tremor patterns analysis table 2 also shows the results of tremor patterns in resting or postural tremors . in resting tremor patterns analysis ,
the percentage of synchronous pattern was 60.0% in swedds group and 57.1% in pd group ( p > 0.05 ) , while the percentage of alternating pattern of resting tremor was 80.0% in swedds group and 78.6% in pd group ( p > 0.05 ) .
in postural tremor patterns analysis , synchronous pattern was 80.0% in the swedds group and 56.7% in pd group , while alternating pattern was 60.0% in the swedds group and 75.0% in pd group ( p > 0.05 ) .
eight patients were not involved in the present analyses for their symptoms of tremor lasting < 2 years and two patients were excluded due to incomplete documents of clinical features or electrophysiological measurements .
a total of 33 patients with definite mrt ( mean age 55.3 11.6 years , 45.5% men ) constituted the final sample [ table 1 ] .
pd were diagnosed in 84.8% ( n = 28 ) and sweeds in 15.2% ( n = 5 ) of cases , respectively .
there were no significant differences in age , gender , and age at onset of tremor between swedds and pd groups .
the duration of disease was longer in the sweeds group than in the pd group ( 13.0 years vs. 3.0 years , p < 0.05 ) .
the percentage of hoehn - yahr score 1 was similar among two groups ( 20% vs. 25% , p >
demographic and clinical characteristics of swedds and pd patients * these values were calculated by test ; others without star mark were calculated by t - test ; nonparametric test ; : not applicable , calculated by fisher exact test .
sd : standard deviation ; swedds : scans without evidence of dopaminergic deficits ; updrs : unified parkinson s disease rating scale ; pd : parkinson s disease .
according to the pet comparison with the norm values in the center , subjects were divided into two groups . a normal symmetrical uptake of c--cft in the bilateral striatum was seen in all five patients ( swedds group ) [ figures 1 and 2 ] .
an asymmetrical reduced uptake in the striatum was seen in 28 patients ( pd group ) [ figures 1 and 3 ] .
positron emission tomography ( pet ) to distinguish scans without evidence of dopaminergic deficits ( swedds ) from parkinson 's disease ( pd ) and tremor analysis between groups .
transaxial slices of pet / tremor analysis of a patient with swedds ( left ) and another patient with right - sided pd ( right ) .
dopamine transporter positron emission tomography help to distinguish scans without evidence of dopaminergic deficits from parkinson 's disease in monosymptomatic resting tremor patients .
dopamine transporter positron emission tomography help to identify parkinson 's disease in the early age in monosymptomatic resting tremor patients .
for nonmotor aspects of experiences of daily living ( part i of updrs ) , there were no significant differences in cognitive impairment and depression between two groups [ table 1 ] . for motor experiences of daily
living ( part ii of updrs ) , pd patients were more likely to have difficulties in dressing and hygiene ( p < 0.05 ) .
more patients in pd group tended to have difficulties in walking ( 67.9% in pd group and 20.0% in swedds group , p > 0.05 ) , although the difference was of no statistical significance .
the two groups were similar in speech and freezing of gait . for motor examination ( part iii of updrs ) , the score was much lower in the sweeds group than in the pd patient group , and the difference was statistically significant ( 11.0 2.0 vs. 23.2 12.5 , p < 0.01 ) .
eighteen ( 64.3% ) pd patients had a resting tremor , and 25 ( 89.3% ) had a postural tremor .
a resting tremor was recorded in 3 ( 60.0% ) swedds patients and postural tremor was recorded in all 5 ( 100% ) swedds patients . the difference in tremor distribution ( resting tremor or postural tremor ) between two groups was not statistically significant .
but the proportion of bilateral tremor was much higher in swedds group than in the pd group ( 100% vs. 32.1% , p < 0.05 ) [ table 2 ] . tremor analysis in patients with swedds and pd * these values were calculated by test ; others without star mark were calculated by t - test ; nonparametric test ; : not applicable , calculated by fisher exact test .
swedds : scans without evidence of dopaminergic deficits ; pd : parkinson s disease ; sd : standard deviation .
electrophysiological study the electrophysiological findings in 2 different conditions ( resting or postural tremor ) in studying group are shown in table 2 .
there were no significant differences in the frequency and amplitude of resting or postural tremor between two groups .
tremor analysis : frequency and amplitude table 2 shows the results of emg measurements in both resting and postural tremors .
the frequency of resting tremor in swedds group tended to be higher than in the pd group , but without significant difference ( p = 0.08 ) .
the amplitude of postural tremor tended to be higher in swedds group than in pd group , but the difference was of no significance ( p = 0.05 ) .
tremor patterns analysis table 2 also shows the results of tremor patterns in resting or postural tremors . in resting tremor patterns analysis ,
the percentage of synchronous pattern was 60.0% in swedds group and 57.1% in pd group ( p > 0.05 ) , while the percentage of alternating pattern of resting tremor was 80.0% in swedds group and 78.6% in pd group ( p > 0.05 ) .
in postural tremor patterns analysis , synchronous pattern was 80.0% in the swedds group and 56.7% in pd group , while alternating pattern was 60.0% in the swedds group and 75.0% in pd group ( p > 0.05 ) .
there is still a debate on the etiology of mrt and its relation to pd . in this present study
normal c - cft uptake in the striatum by dat - pet was found in 15.2% ( 5/33 ) of patients with mrt , who were diagnosed as the swedds , while reduced uptake in the striatum was found in 84.8% ( 28/33 ) of the patients , thus the corresponding diagnosis were pd .
there were some differences in the clinical characteristics between pd and swedds groups in our study .
we found that more patients in the pd group had difficulties in walking and balance .
similar result was seen in a former study focusing on the gaits and posture of the patients .
swedds patients were found to had a normal trunk and elbow posture , normal stride length variability , and normal bilateral step phase coordination , all of which were abnormal in pd patients .
in addition , we found that dressing and hygiene were more likely to be difficult in pd group .
we also found that the score in motor examination in updrs ( part iii ) was higher in pd group than in swedds group , which indicated dyskinesia was remarkably severe in the former group .
thus , we concluded that the updrs might help to make a differential diagnosis between pd and sweeds .
there are few studies on the difference in tremor patterns between pd and swedd patients .
the basic tremor parameters overlapped between swedds , pd , segmental dystonia and et in previous electrophysiological studies .
recent study found that pd feature re - emergent tremor coexisted with the highest amplitude in the resting tremor , while swedds , dystonia , and et subjects had the highest amplitude during action tremor .
similarly , we found in our study that the action tremor amplitude tended to be higher in swedds group , although the difference was not significant .
different tremor types have been separated in pd , including classic parkinsonian tremor at rest , postural and kinetic tremors of different frequencies , pure postural or kinetic tremor .
the heterogeneity in swedds , which means dystonic tremors may be responsible for a number of swedds subjects as well as et , might explain partly that the tremor patterns were similar in the two groups .
unfortunately , in the comprehensive analysis , when the tremor patterns were divided into different groups according to its features , we found there was no significant difference between pd and swedds groups .
the diagnosis of mrt is made when the tremor syndrome persists for more than 2 years without bradykinesia , rigidity or postural dysfunction .
the resting tremor in mrt differs obviously from the postural tremor or action tremor in et .
the mrt patient has rarely family history and is nonresponsive to beta blockers when comparing to ets .
ninety percent of the mrt patients can be thought to be subclinical pd with the evidence of presynaptic dopamine neuronal dysfunction by pet .
besides careful clinical examination and electrophysiological test , functional imaging plays an important role in the differential diagnosis in patients with isolated tremor symptoms .
recent studies found that when faced a diagnostic challenge in early pd , cardiac i - mibg scans alone or combined with dat - pet , may help to differentiate patients with swedds from patients with pd . in the present study , sweeds were diagnosed in 15.2% ( n = 5 ) of cases and the result was consistent with previous study , in which approximately 1115% of early pd patients showed normal dopaminergic functional imaging ( swedds ) .
various ligands had been proved to provide identical data regardless of the kinetics and specificity for the dat . in light of i - fp - cit ( 123i - n - v - fluoropropyl-2b - carbomethoxy-3b-(4-iodophenyl )
nortropane ) , a widely used dat ligand in single photon emission computed tomography ( spect ) is difficult to prepare and expensive ; however , dat - pet is reasonable to detect presynaptic dopamine neuronal dysfunction .
dat - pet is also an independent factor associated with the long - term motor and nonmotor outcomes when adjusted for age , gender , pd duration , baseline pd severity , and pd medications at the time of assessment .
dat imaging has an important role in the differential diagnosis , management decision , and prognostic prediction in early pd and clinical uncertain parkinsonian syndrome .
there are many other causes for tremor , such as physiological tremor , psychogenic tremor , et , and myoclonus - dystonia .
differential diagnosis of tremor should base on history taking , physical examination , electrophysiological test , mri , and nuclear imaging of dat when the diagnosis remains uncertain .
dat density in corpus striatum decreased 10% every year in the pd group , while 0.5% every year in the control group .
we found that the patients with negative dat - pet results had no pd symptoms or signs in the next years while the patients with positive dat - pet results had some pd symptoms or signs in the following years .
first , the findings of our study should be interpreted with caution considering the sample size .
however , our prospective cohort is reasonable when compared with other researches focused on swedds , in which the sample size was generally small , varied from 8 to 33 .
second , whether swedds patients had signs of dystonia was not recorded in our study .
thus , we can not support the hypothesis that adult onset dystonia is the underlying diagnosis in this sub - group of patients with swedds .
finally , transcranial sonography and susceptibility - weighted imaging can aid the differentiation in previous studies .
these tests were not included in the analysis due to the integrity constraint and will be added in the further studies . in summary ,
dat - pet brain imaging can facilitate early and accurate diagnosis and help guide prognosis and treatment decisions . it can also help to avoid inappropriate dopaminergic drug therapy , as well as the long - term financial burden . | background : the relationship between monosymptomatic resting tremor ( mrt ) and parkinson 's disease ( pd ) remains controversial . in this study , we aimed to assess the function of presynaptic dopaminergic neurons in patients with mrt by dopamine transporter positron emission tomography ( dat - pet ) and to evaluate the utility of clinical features or electrophysiological studies in differential diagnosis.methods:thirty-three consecutive patients with mrt were enrolled prospectively . the unified parkinson 's disease rating scale and electromyography were tested before dat - pet .
striatal asymmetry index ( sai ) was calculated , and a normal dat - pet was defined as a sai of < 15% .
scans without evidence of dopaminergic deficits ( swedds ) were diagnosed in patients with a subsequent normal dat - pet and structural magnetic resonance imaging.results:twenty-eight mrt patients with a significant reduction in uptake of dat binding in the striatum were diagnosed with pd , while the remained 5 with a normal dat - pet scan were swedds . as for uprds ,
the dressing and hygiene score , walking in motor experiences of daily living ( part ii ) and motor examination ( part iii ) were significant different between two groups ( p < 0.05 and p < 0.01 , respectively ) .
bilateral tremor was more frequent in the swedds group ( p < 0.05 ) .
the frequency of resting tremor and the amplitude of postural tremor tend to be higher in the swedds group ( p = 0.08 and p = 0.05 , respectively).conclusions : mrt is heterogeneous in presynaptic nigrostriatal dopaminergic degeneration , which can be determined by dat - pet brain imaging . clinical and electrophysiological features may provide clues to distinguish pd from swedds . |
in 2002 , the national institute for health and clinical excellence ( nice ) recommended that provided choice was offered to all those clinically suitable , up to 15% of dialysis patients might choose to undertake hhd .
this seemed an attractive option , offering the potential to supplement a declining uk peritoneal dialysis ( pd ) population . at that stage , only a handful of uk units had hhd patients and uk hhd prevalence was at an historical low of 1% .
this , coupled with disappearing home training programmes , made nice recommendations look ambitious and served notice of the challenges ahead . in 2004 , the department of health published part one of the national service framework ( nsf ) for renal services .
this document followed on from similar documents addressing cardiovascular disease and diabetes care in the nhs .
unlike its predecessors , however , the renal nsf carried no specified additional funding resources .
it set out five standards for dialysis and transplantation to be delivered by the nhs by 2014 .
standard 4 stipulated that the delivery of high quality clinically appropriate forms of dialysis care should be designed around individual patient needs and preferences .
the renal nsf also stated that nice hhd guidance should be implemented ahead of the 2014 target .
the challenge was to provide improved patient choice for all approaching end - stage renal disease ( esrd ) and greater involvement in the decision - making process .
based on the concepts of value - based medicine where value for health care is addressed from a patient s perspective and across the full cycle of care the renal nsf also advocated timely preparation for esrd treatment ( standard 3 ) to complement patient choice . despite the lack of funding ,
the renal community has responded enthusiastically and successfully to the renal nsf , in particular through local clinical leadership and innovation , resulting in some tangible examples of improved care for kidney patients .
the last 3 years has seen the most significant change , with greater interest in hhd , from clinicians and especially from patients .
this was ramified by the remarks of the secretary of state in 2010 , supporting the choice of patients to go home on dialysis and fully consonant with the thrust of lord darzi s report for care closer to home .
nhs kidney care was formed in 2008 as an improvement agency for the nhs , under the leadership of beverley matthews , to advance implementation of nsf standards .
it has been at the forefront of recent developments , engaging the renal community , providing tools to improve choice for all kidney patients and holding the aspiration that home therapies represent a genuine option for all suitable patients .
in addition , the uk renal association has produced guidelines highlighting 10 drivers necessary for change .
the uk practices in hhd have been captured through the renal registry and more recently in the centre for evidence - based purchasing ( cep ) report , which provides for the first time an overview of the hhd landscape and its provision .
forty - four units were surveyed through questionnaires ( 70% response ) , which provided information on practice patterns and service delivery . the uneven prevalence which emerged in many regions
transplantation ( 60.5% ) , death ( 18.3% ) , treatment failure ( 5.6% ) and carer issues ( 4.2% ) were the top four reasons for patients switching from hhd .
fear of cannulation seems to be a dominant factor in patients not choosing hhd therapy .
the carers week organized by nhs kidney care is an example of the quest for solutions to such important issues .
the nhs in england is currently divided into 10 geographical strategic health authorities ( shas ) , with further divisions into 152 primary care trusts .
nhs kidney care has supported the formation of kidney care networks for each sha , promoting local control while absorbing national learning .
renal services are commissioned for each sha by their corresponding specialized commissioning group ( scg ) . in 2010 , nhs kidney care and the department of health engaged directly with local patients , commissioners and clinical staff in each sha , through these networks , organizing 1 day workshops entitled improving choice for kidney patients. these aimed to influence and empower local service redesign , to promote home therapies , bringing together key partners to address perceived barriers to change and identify collaborative strategic approaches to increasing home therapies provision . drawing on work from several home therapy programme visits , patient stories , interviews and workshops at the annual home dialysis conference in manchester , presentations , ideas and local issues were shared .
the most influential and compelling elements were always the patient stories . in total , > 300 delegates attended from 83 different nhs trusts and 10 scgs . following each event ,
core themes identified include reducing inequity in treatment options , the need for integrated hhd pathways , availability of high - quality patient training and education , support for carers , the need to develop financial incentives and sustainability challenges .
a consistent theme is the need to challenge long held beliefs about who might be suitable for hhd .
a recent analysis of outcomes for hhd patients in the uk between 1997 and 2005 demonstrated that hhd patients were more likely to be white , more likely to be wait - listed for transplantation ( a surrogate marker for better health ) , less likely to be socially deprived and less likely to have diabetic or hypertensive nephropathy .
yet , we know that now many uk hhd programmes have patients who do not conform to the study population , including those who are successfully performing hhd with or without a carer and well into their 7th or 8th decade of life .
a subsequent carers and patients workshop in january 2011 confirmed this need to challenge traditional views .
the true value of these initiatives will not be apparent for several years , but some regions have already made great strides .
it seems apparent that where there is clear strong clinical leadership , progress is quicker .
in the uk , by 2008 , a reversal of the declining hhd trend appeared to have been achieved and hhd patient numbers have risen marginally since .
the top three challenges in local units are : implementing a cultural change in the approach to dialysis care , creating explicit care pathways and encouraging the adoption of self - cannulation ( 3cs model ) .
it has seen continued annual growth of hhd , having successfully trained 180 patients , with > 70 prevalent patients at the end of 2010 ( figure 1 ) , using a recruitment strategy inclusive of the whole spectrum of esrd and by incorporating innovative solutions e.g. solo dialysis .
hhd has been recognized by policy makers and health care organizations as a health care service innovation with great potential .
many uk dialysis programmes show small but consistent increases in their hhd populations ( table 1 ) encompassing the establishment of new centres and the revitalization of mature programmes . demonstrating renal units with highest percentage of dialysis patients on hhd .
[ source : uk renal registry , 11th and 12th annual reports 2008 and 2009 , respectively ] change in point prevalence for manchester hhd programme ( as percentage of all dialysis ) during the period 200410 .
an epidemiological approach would suggest that a cost - effective intervention with health gain but a low uptake is a health improvement opportunity .
an intervention yielding marginal gain in effectiveness at a high cost should be rejected ; while one yielding high improvements in effectiveness at low cost should be readily adopted .
adoption , however , is typically a non - economic phenomenon and depends on time investment and bi - directional strategy , for patients and services .
hhd is a complex care bundle that requires many ingredients for success , some clinical but others user - defined . to widen scope and opportunity ,
it is important to push boundaries recognizing that a more innovative approach to dialysis provision is necessary .
progress has been made , but much more needs to change , and this will require sustained effort from us all . | improvement in dialysis outcomes requires a paradigm shift in haemodialysis provision and service design .
haemodialysis at home , recommended by the national institute for health and clinical excellence , can lead to outcome benefits but has a range of implementation barriers .
this article describes the various initiatives in the uk at local , regional and national levels , to provide greater patient choice and autonomy , overcome adoption barriers and enable greater uptake of this modality . |
eukaryotic cell membranes
are rich in cholesterol . because this
sterol is thought to play a major role in
determining the structure and function of these life - sustaining enclosures ,
it has been the subject of numerous investigations .
one of the long - standing issues surrounding cholesterol relates
to its two - faced character , where the presence of two methyl groups
on its -face creates a roughness that is distinct from its
smooth -face ( chart 1 ) .
whether this
combination of a rough and smooth face has any influence on the interactions
between cholesterol and neighboring lipids has remained as a matter
of debate .
previous experiments and molecular dynamics simulations
suggest
that the interactions of saturated phospholipid chains with the smooth
face of chol are stronger than with the rough face .
however , recent
atomic - scale molecular dynamics simulations that compared membranes
made from chol and dppc with ones made from dchol ( 18,19-dinorcholesterol )
plus dppc have led to the hypothesis that the presence of these two
different faces adds to cholesterol s condensing power . specifically , it was proposed that a lower degree of tilt by cholesterol
allows it to lie in a more upright position and parallel to the acyl
chains of neighboring phospholipids .
alternatively , one can imagine
that dchol may have a greater condensing power because of better contact
between the saturated acyl chains and two smooth faces , affording
stronger van der waals interactions . owing to the recent synthesis of dchol , we have now been
able to
address this issue experimentally using a combination of nearest - neighbor
recognition , fluorescence , and monolayer measurements ( scheme 1 ) .
we have also compared
the action of chol and dchol on the melting behavior of dppc by the
use of high - sensitivity differential scanning calorimetry ( dsc ) .
all methods
that were used in carrying out monolayer measurements
at the air / water interface and fluorescence and nearest - neighbor recognition
measurements in liposomal membranes ( 200 nm , prepared via extrusion )
were similar to those previously reported .
differential scanning calorimetry ( dsc ) was performed in multilamellar
( mlvs ) and large unilamellar vesicles ( luvs , 0.1 m size ) as
previously described .
to compare the condensing power of chol and dchol , we first carried
out nearest - neighbor recognition ( nnr ) measurements using the exchangeable
lipids , 1 and 2 ( chart 2 ) .
such measurements reveal the thermodynamic tendency of
these exchangeable monomers to become nearest neighbors and can be
used to quantify the compactness of a lipid bilayer .
thus , we measured the nearest - neighbor preferences of 1 and 2 in host membranes made from dppc plus
chol as well as ones made from dppc and dchol . in each case , monomer
exchange was carried out via thiolate
equilibrium constants , k , were calculated from the concentrations of the homodimers ,
{ 1 - 1 } and { 2 - 2 } , and the heterodimer , { 1 - 2 } , that were
present .
specifically , the equilibrium constant , k , is equal to { 1 - 2}/({1 - 1})({2 - 2 } ) .
if one takes statistical considerations
into account , a nearest - neighbor interaction free energy , 1 - 2 , can then be calculated
from 1 - 2 = /2rt ln(/4 ) .
using experimental
procedures similar to those previously described ,
we made nnr measurements using sterol - rich liposomes derived from
dppc ( table 1 ) . in the absence of added sterol ,
these dppc - based membranes exist in the liquid - disordered state , and
the mixing of 1 with 2 is random .
in contrast , the incorporation of 40 mol % chol leads to a strong
preference for 1 and 2 becoming nearest
neighbors .
as is evident from table 1 , the substitution of chol with dchol produces a
similar condensing effect , where chol is stronger by a few tens of
calories per mole . as a further test of the relative condensing
power of chol and
dchol
, we examined their influence on the compactness of liposomal
membranes made from dppc using a fluorescence assay .
specifically ,
we incorporated phase - sensitive probe laurdan into each membrane and
measured its generalized polarization ( gp ) value as a function of
temperature . here , gp = ( i440 i490)/(i440 + i490 ) , and i440 and i490 are the fluorescence emission intensities
at the indicated wavelengths .
as discussed elsewhere , gp values reflect
the polarity surrounding the laurdan molecule in a lipid bilayer and
are very sensitive to changes in the phase of the membrane . to ensure that each of these dispersions was
stable , a small amount ( 2.5 mol % ) of 1,2-dipalmitoyl - sn - glycero-3-phospho-(1-rac - glycerol )
measurements were
made at 45 c
in host membranes derived from dppc and the indicated sterol(s ) . in
each case , 2.5 mol % 1 and 2.5 mol % 2 were
present .
chol refers to
cholesterol . in the presence of a low concentration
of cholesterol ( 2.5 mol
% ) , a well - defined gel to liquid - crystalline phase transition
when a high cholesterol
concentration is included in the bilayer ( i.e. , 40 mol % ) , which forms
the liquid - ordered phase over this entire temperature range , the gp
values decrease modestly with increasing temperature . when cholesterol is fully replaced by dchol , a more pronounced
decrease in the gp values is apparent , especially above 41 c .
similar liposomes containing 20 mol % cholesterol and 20 mol % dchol
produced an intermediate profile .
these results are consistent with
the conclusion that dchol is a weaker condensing agent than cholesterol
and that this difference in condensing power is very small . to test further for possible differences in the interaction between
chol and dchol with phospholipids , we measured their effects on the
melting behavior of dppc bilayers by dsc .
plot of general polarization vs temperature in liposomes made from
dppc / dppg / chol / dchol with the following molar percentages : ( )
57.5/2.5/40/0 , ( ) 57.5/2.5/20/20 , ( ) 57.5/2.5/0/40 ,
and ( ) 95/2.5/2.5/0 . data for ( ) and ( ) have previously
been reported .
( a ) dppc / chol mlv , ( b ) dppc / dchol
mlv , ( c ) dppc / chol luv , and ( d ) dppc / dchol luv .
pure dppc ( black )
and mixtures containing 5 ( red ) , 10 ( green ) , and 20 ( blue ) mol % sterol
are shown .
the curves are corrected for phospholipid concentration ,
determined by phosphate assay on the luv , and corrected by baseline
subtraction .
tm is
defined as the position of the maximum in the heat capacity curve .
the values shown correspond to means and standard deviations ( sd )
of more than 20 determinations in dppc and dppc / chol mixtures ( except
for dppc / chol ( 95:5 ) , which had only 4 determinations ) and 2 to 3
determinations for dppc / dchol .
these sd values do not explicitly take
into account the errors associated with baseline corrections and phosphate
analyses needed to calculate h .
we estimate
that the inclusion of those sources of error results in a relative
error of 1015% in h .
see refs ( 17 ) and ( 24 ) and references cited therein . at low concentrations ( 510 mol % ) , chol and
dchol cause
a slight freezing - point depression that is similar in magnitude ( ca .
this finding , by itself , suggests that both sterols have
a similar preference for the liquid over the gel phase and that they
have similar interactions with gel and liquid - disordered phospholipids .
however , an inspection of the excess heat capacity ( cp ) endotherms reveals that
chol affects the dppc phase transition more than dchol , indicating
that there are , in fact , some differences in sterol
the values of the enthalpy change ( h ) that are shown in table 2 also support weaker
dchol dppc interactions compared to chol dppc interactions .
because of the limited quantity of dchol that was available for this
study , which required a 27-step synthesis , only a few repeat experiments
were possible .
for this reason , the standard deviations listed for
mixtures containing dchol should not be overinterpreted .
although
we believe that the differences in h between
dppc mixtures of chol and dchol are real , they must be regarded as
tentative at the present time . finally , we have compared the
condensing effects of dchol versus
chol via classic monolayer experiments .
figure 3 shows a series of surface pressure area
isotherms that were obtained for monolayers made from 1,2-dimyristoyl - sn - glycero-3-phosphocholine ( dmpc ) and cholesterol , and
also dmpc and dchol , at the air / water interface as a function of the
mole fraction of dmpc . for these measurements ,
dmpc was used instead
of dppc for convenience because of its lower gel to liquid - crystalline
phase - transition temperature ( tm = 24
c ) .
additivity
curves that were derived from these data at 10 mn / m , along with ideal
additivity lines , are shown in figure 4 .
two
features of the latter are noteworthy : ( i ) the maximum condensing
effect by both sterols occurs when the sterol / phospholipid ratio is
1 and ( ii ) the condensing effect of these sterols is very
similar , with cholesterol appearing to be slightly stronger than dchol .
surface
pressure area isotherms for ( a ) dmpc / dchol and ( b )
dmpc / chol over a tris buffer ( ph 7.4 ) at 25 c using the following
mole fractions of dmpc : ( a ) 0.0 , ( b ) 0.1 , ( c ) 0.2 , ( d ) 0.5 , ( e ) 0.6 ,
( f ) 0.8 , ( g ) 0.9 , and ( h ) 1.0 .
additivity curves for ( ) dmpc / dchol
and ( ) dmpc / chol with a surface pressure of 10 mn / m .
the affinity that chol and dchol have toward
ordered phospholipid
chains has been compared using a combination of nearest - neighbor recognition ,
calorimetry , fluorescence , and monolayer measurements .
we have found
that the two sterols have very similar interactions with the phospholipid
but the condensing power of chol is slightly stronger , i.e. , its interaction
with liquid - ordered dppc is more favorable by a few tens of calories
per mole . within experimental error , dsc analysis has revealed no
difference between the effects of chol and dchol on the melting temperature
of dppc . however , the shape of the excess heat capacity ( cp ) endotherms at low sterol
concentrations is different .
the decrease in h that is induced by chol appears to be slightly greater than that
caused by dchol . taken together ,
these results indicate that the combination
of a rough and a smooth face found in cholesterol leads to slightly
stronger interactions with ordered phospholipids as compared to dchol ,
which has two smooth faces . in other words , chol is slightly better
in inducing the liquid - ordered state than is dchol . thus , our results
are consistent with the hypothesis that the presence of a rough and
a smooth face in chol is important for sterol orientation in the bilayer ,
which in turn leads to improved interactions with the phospholipids .
the hypothesis that the elimination of roughness in cholesterol s
-face , by itself , will result in stronger interactions with
phospholipids seems to be incorrect .
rather , it appears that sterol
orientation and smoothness may be working together synergistically .
previous monte carlo simulations have shown that differences
in
nearest - neighbor interaction free energies on the order of tens of
calories per mole can lead to significant changes in domain size distributions . on the basis of the differences that we have
found between chol and dchol , one can imagine that the combination
of a rough and smooth face in cholesterol could play a role in defining
the structure and function of lipid domains thought to exist in eukaryotic
cell membranes .
in eukaryotic membranes , most phospholipids contain a saturated
acyl chain in the sn-1 position and an unsaturated
chain with a cis double bond in the sn-2 position .
it has been suggested that these hybrid lipids , having
an ordered and a disordered chain , might be responsible for the breakdown
of large rafts into nanodomains because they could act as 2d surfactants ,
placing themselves at the interface between cholesterol - rich , liquid - ordered
domains and liquid - disordered regions .
it is tempting to speculate
that the rough and smooth faces of chol might be playing a similar
role .
however , recent experimental evidence argues against this concept ,
at least in the case of hybrid lipids .
specifically , it has been shown that a hybrid lipid ( popc ) behaves
no differently from a low - melting , saturated phospholipid ( dlpc ) in
affecting the size of liquid - ordered domains .
thus , hybrid lipids
do not seem to be capable of promoting a 2d micellization of lipid
rafts .
our results show that the difference in the interactions of
chol and dchol with dppc is very small but significant .
although a
comparison of the interactions of chol and dchol with hybrid lipids
remains to be carried out , we believe that their difference is likely
to be of the same magnitude on the order of tens of calories
per mole . whether such small differences in energy can significantly
affect domain size distributions
whether this two - faced character of cholesterol has any influence
on the structure , lateral organization , and functioning of these proteins
is a separate but important issue that remains to be clarified . | one of the long - standing issues surrounding
cholesterol ( chol )
relates to its two - faced character . in particular , the consequences
of its having a rough -face and a smooth -face on its
structural influence in cell membranes has remained elusive . in this
study , direct comparisons have been made between cholesterol and a
smoothened analog , dchol ( i.e. , 18,19-dinorcholesterol )
using model membranes and a combination of nearest - neighbor recognition ,
differential scanning calorimetry , fluorescence , and monolayer measurements .
taken together ,
these results indicate that subtle differences exist
between the interaction of these two sterols with the different states
of 1,2-dipalmitoyl - sn - glycero-3-phosphocholine ( dppc ) .
chol has a greater condensing power than dchol , but only slightly
so , i.e. , on the order of a few tens of calories per mole . |
malignant tumors metastatic to the oral cavity are uncommon , comprising about 1% of newly diagnosed oral malignancies .
the mandible is affected more frequently than the maxilla , with a predilection for the areas distal to the canines , including the body and ramus .
cancers from almost any primary site can metastasize to the jaws , but those from the breast , lung , kidney and prostate do so most frequently . in males ,
primary cancer of the lung most commonly metastasize to the jaws followed in frequency by prostatic and renal cancers . in females , jaw metastasis most commonly originates from breast primaries followed by primaries of the adrenal and genitalia .
patients with metastatic jaw disease demonstrate various clinical signs and symptoms that include pain , swelling , paresthesia of the lip , loose or extruded teeth , halitosis , regional lymphadenopathy , mandibular nerve involvement and numb - chin syndrome , cortical expansion of the jawbones , ulceration , trismus , exophytic growth and rarely pathological fracture . the disease might be totally asymptomatic as well
. these symptoms may not draw attention to a potential malignancy at the time of the initial presentation .
in addition , sometimes these lesions might be mistaken with inflammatory or infectious diseases of the jaws and adjacent structures as a result of clinical and radiographic similarities .
therefore , early diagnosis requires a high degree of astuteness and histopathologic evaluation . in spite of their rarity ,
metastatic diseases of the jaw must be considered in the differential diagnosis of unknown jaw lesions especially in patients with a history of malignancy elsewhere in the body . in this report , a metastatic tumor of the mandible originating from a breast carcinoma , with atypical clinical and radiographic presentation is discussed .
the present case report is about a 40-year - old female patient with the complaints of a swelling in the mandibular angle region of 5 months duration she was referred to our department by her oncologist with the differential diagnosis of osteomyelitis or osteogenic sarcoma .
on palpation a hard , non - tender , localized , round swelling of size 4 cm 3 cm on left angle - ramus region was felt [ figure 1 ] .
oral cavity examination did not reveal the existence of any ulcer , fistula or wound except missing lower left first molar .
swelling on left mandibular angle region her medical history revealed a modified radical mastectomy 2 years back for invasive ductal carcinoma of the left breast .
the tumor was positive for c - erbb-2(her-2/neu ) assay with score 3 plus in immunohistochemistry .
a panoramic radiograph showed a retained root remnant of left mandibular first molar , carious second molar and an area of rarefaction on left angle region with indistinguishable margin [ figure 2 ] .
orthopantomogram shows an area of rarefaction on left angle region with indistinguishable margin serial axial and coronal computed tomography ( ct ) scan of mandible ( 1 mm - thick slice ) showed destructive lesion on left angle of mandible extending in to the ramus [ figure 3 ] .
features like codman triangle and sunray appearance were seen in the margins of the lesion and minimum soft - tissue component were seen adjacent to it [ figure 4 axial view , figure 5 coronal view ] .
3d computed tomography scan shows destructive lesion on left angle of mandible extending in to the ramus axial computed tomography scan showing destructive lesion on left angle of mandible extending into the ramus .
codman triangle and sunray appearance seen in the margin of the lesion coronal computed tomography scan showing destructive lesion on left angle of mandible extending into the ramus .
codman triangle and sunray appearance seen in the margin of the lesion the ct scan differential diagnosis included chronic osteomyelitis , osteogenic sarcoma and secondary metastasis . a fine - needle aspiration cytology ( fnac ) revealed loosely cohesive group of epithelial cell having increased n : c ratio and hyperchromatic nuclei in adenoid pattern [ figure 6 ] .
it was diagnosed as infiltration from poorly differentiated adenocarcinoma , possibly of mammary ductal origin .
photomicrograph of fine - needle aspiration cytology ( 40)-poorly differentiated adenocarcinoma , possibly of mammary ductal origin a full body radionuclide scan was carried out and it was suggestive of skeletal metastases . a technetium-99m - methylene diphosphonate bone scan located a region of increased radioisotope uptake in the ramus of mandible on the left side as well as in the t-2 and t-10 vertebrae [ figure 7 ] .
skeletal scintigraphy showing abnormally increased focal trace uptake of technetium-99 m isotope in the ramus of mandible on the left side and t1 , t10 vertebrae the patient was referred back to her oncologist for further treatment since it was not amenable to surgical management .
patients often have vague or innocuous symptoms that can mimic dental infections and sometimes it might be asymptomatic . in a review of 114 cases of metastatic jaw tumors by dsilva
other signs and symptoms included swelling , presence of intraoral mass , loose or extruded teeth , cortical expansion , regional lymphadenopathy , gum irritation , ulceration , exophytic growth , halitosis , numbness or paresthesia of the lower lip and trismus . in the present case
the classical radiographic appearance of metastatic disease in the jaws varies from well - circumscribed to poorly circumscribed radiolucency , often described as a moth - eaten appearance .
metastatic carcinomas from the breast and prostate might stimulate bone formation ; hence these might appear as mixed radiopaque radiolucent lesions .
interestingly , in a study of 673 cases by hirshberg et al . , in 2008 reported that approximately 5% of the cases did not show any radiographic changes . in the present case
the radiographic findings were that of a destructive lesion on the ramus region and a sunray appearance in the margin of the lesion [ figures 4 and 5 ] .
as the clinical and radiographic presentation of a metastatic lesion can often be deceiving there lies the possibility of a misdiagnosis of a benign or malignant process .
therefore in such cases , especially in patients with a history of a malignant disease , biopsy is mandatory .
taking a thorough medical history along with proper clinical and laboratory investigation including immunohistochemical staining might facilitate the diagnosis . in the present case , history of breast cancer
in addition , the pathologic slides of the breast tumor were requested and compared with the jaw lesion [ figures 6 and 8 ] , which confirmed the final diagnosis .
photomicrograph of radical mastectomy specimen ( 40)-invasive ductal carcinoma of breast with metastasis most patients with a metastatic tumor in the oral cavity also develop metastases at other sites , often leaving no other option other than palliation . in this case , the bone scan at the time of diagnosis revealed additional metastasis in vertebrae . regardless of the site of origin , oral cavity metastases are reported as the first clinical symptom of a primary malignancy in 22 - 33% of patients .
several authors have reported that adenocarcinoma is the most common histologic type and that breast adenocarcinoma is the most common malignancy that metastasizes to the mandible or maxilla .
pain relief and avoidance of possible infections , fractures or hemorrhage should be the major goals in the management .
the management of metastatic breast carcinomas of the oral cavity is primarily palliative and may include radiotherapy , chemotherapy , hormone therapy and rarely surgical intervention .
despite their rarity , metastatic tumors should be considered in the differential diagnosis of inflammatory and reactive lesions of the jaws .
this case emphasizes the importance of a complete and careful work - up with particular attention to detailed medical history as well as careful clinical , radiographic and histopathologic examination .
as these lesions are associated with a poor prognosis , early detection is of extreme importance . | oral cavity metastases are considered rare and represent approximately 1% of all oral malignancies . due to their rarity and atypical clinical and radiographic appearance ,
metastatic lesions are considered a diagnostic challenge .
this article presents a rare case of breast carcinoma with metastasis to mandible and vertebrae .
a case is presented of a 40-year - old female patient with a history of breast carcinoma which was surgically treated approximately 2 years back .
the diagnosis of metastatic breast carcinoma was confirmed by radiographic examination , bone scan and histopathologic findings .
she was referred to radiotherapy department since it was not amenable to surgery due to metastasis in vertebrae .
a high index of clinical suspicion of metastatic cancer is necessary when evaluating patients who complaint of jaw pain and swelling with a history of non - head and neck carcinoma . |
palmaris longus ( pl ) is a thin , tendinous superficial flexor of forearm , functionally more active in non - human primates . in humans
, pl is a weak flexor of the hand at wrist , tenses the palmar aponeurosis and is one of the most variable muscles in the body .
the variation includes unilateral or bilateral agenesis , duplication or in the site of insertion .
although the function is very less , pl receives the attraction of the surgeons for its use in reconstructive plastic and hand surgery as tendon graft , in lip augmentation or escalation , ptosis correction and also in some facial paralysis management . according to classical textbooks of anatomy and surgery ,
the agenesis of pl was seen in 15% of general population , but it is not applicable to all populations and varies among ethnic groups .
the incidence of pl agenesis in different ethnic groups shows significance in association with the sex and side of the limb ; however , some remain controversial .
the aim of this study is to determine the incidence of unilateral and bilateral agenesis of pl and its association with sex and side of the limb in the andhra population of india .
a group of 942 first and second year medical , dental and paramedical students ( 450 boys and 492 girls ) of age group 18 - 23 years from narayana group of medical institutions , nellore , andhra pradesh , india were randomly used for this study .
those who are having any deformities or injury in the upper extremity were strictly excluded from the present study . in this present study ,
the prevalence of presence or absence of pl was determined by series of tendon examination techniques described by schaeffer 's test , thompson 's fist , mishra 's 1 test , pushpakumar 's two finger sign [ figure 1a d ] and our modified schaeffer 's technique [ figure 2 ] .
( a ) schaeffer 's test opposition of thumb to little finger with flexion at wrist . arrow
( b ) thompson 's test opposed thumb over clenched fist with flexion at wrist .
arrow n- palmaris longus tendon , ( c ) mishra 's 1st test hyperextension of fingers at metacarpo - phalangeal joint with flexion at wrist .
palmaris longus tendon , arrow head flexor carpi radialis tendon , ( d ) pushpakumar 's test extension of index and middle finger with opposed thumb over medial two fingers .
palmaris longus tendon modified schaeffer 's test opposed thumb against little finger with flexion at wrist and extending pressure applied to middle three fingers .
palmaris longus tendon , arrow head flexor carpi radialis tendon in our modified schaffer 's technique , the subjects were asked to oppose the thumb against the little finger and simultaneously flex the hand at wrist joint . if present , pl appears as a prominent tendon medial to tendon of flexor carpi radialis ( fcr ) in the middle of the lower part of the front of forearm , just above the wrist .
if not clearly seen , a slight extending / resistance force was applied to the middle three fingers . still if it is not visible it was taken as absent in that subject .
in a sample of 942 students ( 450 males and 492 females ) , a total of 264 pl agenesis was seen of which 198 were females ( 40.2% ) and 66 were males ( 14.7% ) .
unilateral agenesis was seen in 186 ( 70.5% ) and bilateral in 78 ( 29.5% ) subjects .
the left - side agenesis was seen in 72 females ( 52.2% ) and 24 males ( 50.0% ) with the total of 96 ( 51.6% ) subjects .
the right - side agenesis was observed in 90 ( 48.4% ) subjects ; of which 66 ( 47.8% ) were females and 24 ( 50.0% ) were males .
out of 78 ( 29.5% ) bilateral agenesis , 60 ( 30.3% ) were females and 18 ( 27.3% ) were males [ table 1 ] .
palmaris longus is an active muscle in non - human primates used for prehensile progression from tree to tree .
pl is found to be present in orangutan , but is variably absent in chimpanzee and gorilla .
phylogenitically , pl is classified as a retrogressive muscle in the human body i.e. , a short muscle belly proximally with long tendon distally . subjected to numerous evolutionary influences , the muscle may be absent , double or with anomalous insertions .
the agenesis of pl in human appears to be hereditary but its genetic transmission is not clear .
identification of pl is very important to clinicians for its tendon to be used as a graft in various surgical procedures and during administration of medicine / corticosteroids in carpal tunnel to relieve pain due to carpal tunnel syndrome / arthritis and in median nerve wrist block . according to the literature
there are various methods to identify the tendon of pl , each having its own identifying techniques .
next to schaffer 's test , mishra 's 1 test is widely supported because of its appliance in those patients with median nerve palsy also , in whom the opposition of thumb is not possible .
the techniques of schaeffer 's test , thompson 's fist , mishra 's 1 test , pushpakumar 's two finger sign have been used in this study to demonstrate the presence or absence of pl . even though these clinical tests mentioned mostly provides correct information of the presence or absence of the tendon ,
sometimes a weakly developed tendon which is present can be mistaken as absent . to avoid this ,
a final confirmation of the presence or absence of the muscle was made with a slightly modified form of the schaffer 's test in the present study .
this method is more specific than the mishra 's 1 test in all the subjects , that even in obese subjects especially women we could identify and palpate the tendons of pl and fcr successfully .
the overall prevalence of unilateral and bilateral agenesis of pl irrespective of the gender was found to be 28% in this study which is a higher when compared to other studies [ table 2 ] .
cehyan and mavt reported 63% in gaziantan turkish population seems to be the highest incidence of pl agenesis but recent investigation in turkish population the agenesis was found to be only 26% .
distribution of agenesis of palmaris longus ( pl ) on different populations of the world the present study was undertaken to evaluate the incidence of pl agenesis and to impart for any association with the sex and side of the subjects according to the results obtained . from the literature , pl agenesis in different races and ethnic groups was found to be more common in females , predominantly on the left side . however , controversial findings have also been reported that pl agenesis is more frequent on right side and more in males than females . in the present study ,
incidence of agenesis of pl was more in females ( 40.2% ) , frequently seen on left side ( 52.2% ) and the overall incidence in relation to gender and body side was statistically not significant which coincides with most of the previous reports .
the long tendon of pl is the first choice of the surgeons frequently been grafted because of its length , diameter and easy availability , which when harvested does not produce any functional deformity . as evolutionary changes made pl a retrogressive degenerating muscle , its position and size can be altered or completely may be absent .
even though there are several techniques of tendon examination physically , fallacy of presence of the muscle as absent may happen rarely . to avoid this ,
ultrasonography or mri methods may be used for examination which gives accurate confirmation of pl agenesis . but investigation in huge population it may not be applicable and the only feasible way of evaluating the presence or absence of pl is the clinical testing as used in many previous studies .
in summary of the present study , the clinical examination of pl agenesis in ap population using our modified schaeffer 's test and other tests in a total of 942 subjects revealed an overall incidence of 28.0% .
the present investigation adds to the literature and reaffirms with the other studies that the agenesis is race dependent and not usually significant with the side and gender . | background : the knowledge of palmaris longus ( pl ) is a growing interest for its wide role in reconstructive plastic surgeries as a donor tendon for transfer or transplant . the prevalence of the pl agenesis has been well - documented by many authors in different ethnic groups or populations .
many conventional tests for determining the presence of the pl has been described , but lamentably there are many discrepancies in confirming its presence or absence .
slight modifications of the prevailing methods can still give authenticate results.aim:this prospective study was conducted to determine the incidence of unilateral and bilateral agenesis of pl and its association with sex and side of the limb in the andhra population of india.materials and methods : a total of 942 subjects of both sexes belonging to 18 - 23 years were used to access the pl using various tendon examination techniques including our modified schaeffer 's test .
the data collected were analyzed by pearsons 2 test using spss software.results:overall agenesis of muscle in both sexes was 264 ( 28.0% ) , out of which 40.2% was seen in females and 14.7% in males with the ratio of 3:1 .
the unilateral agenesis was seen in 70.5% and bilateral agenesis in 29.5% subjects .
the left side agenesis was seen in 51.6% and right side in 48.4% subjects.conclusions:the prevalence of bilateral and unilateral agenesis was more common on left side with a greater likelihood in the female subjects .
the proposed technique could bring better results in all subjects and can be implemented in manual examination of pl . |
breast cancer rates are increasing in developing countries , including egypt , and are largely attributed to aging of the population , delay in time of first pregnancy , decrease in number of children and in breastfeeding , and a move toward high - calorie western diets [ 14 ] .
although breast cancer incidence rates in egypt are substantially lower than the rates in the united states and other developed countries [ 57 ] , breast cancer is the most common cancer among women in egypt .
furthermore , the current demographic trends favor the likelihood that breast cancer will become an even greater public health concern in egypt in the future .
trends in the stage at diagnosis of breast cancer in the gharbiah registry have not been reported , and this information is critical for evaluation of downstaging efforts .
detailed information on trends of breast cancer by stage of diagnosis may promote the reduction of disparities in the presentation of disease by focusing limited resources on the susceptible populations and can aid in our overall understanding of the etiology of breast cancer in a setting that differs in regard to its risk factor profile as compared to many developed countries .
the specific aim of this study was to examine trends in breast cancer incidence by age , stage , and hormone receptor status in the gharbiah registry from 1999 to 2008 .
further , we evaluated the effect of possible changes in the population structure in order to make projections for breast cancer occurrence in egypt for the years 20092015 .
the gharbiah population - based cancer registry is located in tanta , the capital city of the gharbiah province .
the population of gharbiah is about 3.4 million and the registry was founded in 1998 as part of the middle east cancer consortium ( mecc ) .
data on cancer cases are actively collected from various sources throughout the province of gharbiah .
breast cancer cases for this study came from hospitals , clinics , and pathology labs incorporating a comprehensive collection of all breast cancer cases in the gharbiah region covered by this registry .
strict quality control checks are adhered to and data are entered using the international agency for research on cancer ( iarc ) software canreg4 .
registrars are routinely trained in data extraction and entry methods and are periodically monitored by faculty of emory school of public health , iarc , and mecc .
coding of cancer is based on the international classification of diseases for oncology 10th edition .
a total of 7,049 cases of female breast cancer diagnoses were entered in the gharbiah population - based cancer registry from 1999 to 2008 .
we excluded 52 cases with tumor behavior coded as uncertain or in situ , leaving 6,997 invasive cases for our study sample .
for each case , the following information from routinely collected registry data was obtained for this analysis : age at diagnosis , estrogen receptor ( er ) status , progesterone receptor ( pr ) status , summary stage at diagnosis , laterality of tumor , and basis for diagnosis .
er and pr status were determined by immunohistochemical results from the centers providing cases to the registry .
we restricted our analysis on er and pr status to the years 20012008 , when this information was more routinely collected in the registry .
the surveillance , epidemiology , and end results ( seer ) summary staging system was used to code stage at diagnosis .
localized tumors were defined as those confined entirely to the organ of origin ; regional tumors were those that extended into surrounding organs , tissues , or regional lymph nodes ; and distant tumors were those that had spread to distant organs or lymph nodes .
breast cancer incidence data from 1999 to 2008 were obtained from the gharbiah cancer registry .
the average annual percent change ( aapc ) in breast cancer rates was calculated using joinpoint regression for the age - specific incidence rates of breast cancer overall and by stage at diagnosis .
the aapc over the fixed interval of 19992008 is a weighted average of the slope coefficients of the underlying joinpoint regression line with the weights equal to the length of each segment over the interval .
census data for female population in gharbiah were obtained from the 1996 and 2006 central agency for public mobilization and statistics ( capmas ) census , and constant growth of the population was assumed to predict population estimates for the noncensal years using a linear regression model .
the projected population numbers were multiplied by the most recent age - specific breast cancer incidence rates available from 2008 to estimate projected breast cancer caseloads by age group in gharbiah , egypt , from 2009 through 2015 accounting for population changes .
joinpoint regression models were fit to the predicted caseloads and aapcs were utilized to describe trends in the projected future breast cancer cases .
data analysis was performed using joinpoint regression program and sas version 9.0 ( sas institute inc , cary , nc ) ; p 0.05 was used to determine statistical significance .
the study was approved by the university of michigan institutional review board and the gharbiah cancer center ethics committee .
the majority of breast cancer cases during the study period were diagnosed among women aged 4049 years ( 31.8% ) and among women aged 5059 years ( 29.8% ) ( table 1 ) .
most breast cancers were er positive ( 36.9% ) and pr positive ( 25.7% ) ( table 1 ) . based on the limited hormonal receptor data
, we found that the percentage of er positive tumors decreased from 34.7% in 2001 to 27.2% in 2008 and the percentage of er negative tumors increased from 11.0% in 2001 to 15.9% in 2008 ( table 1 ) .
the percentage of localized breast tumors increased over the study period , from 14.8% of tumors in 1999 to 21.4% of breast tumors in 2008 ( table 1 ) .
women aged 5059 years had the highest overall breast cancer incidence rates through the years 19992008 ( figure 1 ) .
the overall breast cancer incidence rates increased in gharbiah , egypt , from 1999 to 2008 by an aapc of 2.3% ( 95% ci = 1.5% , 3.0% ) ( table 2 ) . a significant increase in breast cancer incidence was evident among women aged 50 years and older , and the highest aapc of 5.1% ( 95% ci = 1.2% , 9.2% ) was noted among women aged 70 years and older ( table 2 ) .
we expect a significant increase in the breast cancer caseloads from 2009 to 2015 among women aged 3039 years ( aapc = 1.0% , 95% ci 0.9% , 1.1% ) and among women aged 4049 years ( aapc = 1.8% , 95% ci = 1.0% , 2.6% ) ( table 2 ) .
the aapc in the overall breast cancer incidence rates increased for localized tumors by 5.5% ( 95% ci = 3.1% , 8.0% ) and for regional tumors by 2.6% ( 95% ci = 1.0% , 4.3% ) , and there was a significant decrease in distant tumors among women aged 3049 years ( table 3 ) .
the greatest significant increase in the incidence of localized tumors was evident among women aged 6069 years with an aapc of 9.4% ( 95% ci = 3.5% , 15.7% ) ( table 3 ) .
the incidence of breast tumors diagnosed at a distant stage of disease decreased among women aged 3039 years ( aapc = 11.3% , 95% ci = 19.6% , 2.1% ) and among women aged 4049 years ( aapc = 5.4% , 95% ci = 10.2% , 0.2% ) ( table 3 ) . the greatest expected increase in breast cancer caseloads are among women aged 5059 years for localized ( aapc = 2.9% , 95% ci = 2.5% , 3.2% ) , regional ( aapc = 2.7% , 95% ci = 2.6% , 2.8% ) , and distant tumors ( aapc = 2.4% , 95% ci = 1.7% , 3.2% ) ( table 3 ) .
this study demonstrated a considerable increase in breast cancer incidence rates in gharbiah , egypt , from 1999 to 2008 , particularly among women aged 50 years and older .
while breast cancer incidence rates are increasing among older women , we found that the greatest expected increase in breast cancer caseloads from 2009 to 2015 is among women aged 3049 years due to population changes .
further , our study noted a general decline in the incidence of distant tumors in gharbiah , egypt , from 1999 to 2008 .
trends in reproductive factors and obesity associated with breast cancer favor the increase in breast cancer incidence in egypt .
for example , the fertility rate in egypt is declining and obesity is on the rise [ 14 , 15 ] .
furthermore , in egypt urban residence is clearly related to obesity risk [ 1618 ] and the rate of urbanization from 2010 to 2015 is estimated at 2.1% annual rate of change .
thus , the increasing urbanization of the population in egypt could have implications on breast cancer trends through its effect on obesity .
we found little information on physical activity trends in egypt , although one report suggested that a large proportion of the population in egypt is quite sedentary , particularly in urban areas .
alcohol use is unlikely to account for the increase in breast cancer incidence in egypt , where the majority of the population adheres to the muslim religion , which prohibits use of alcohol . in summary ,
changes in the prevalence of established risk factors for breast cancer in egypt may partially explain the increased incidence reported in this study , although future research should investigate other contributing factors .
the latent period between exposure to risk factors and the manifestation of disease may account to some extent for the observed trend of a statistically significant increase in breast cancer incidence only among women 50 years and older . for example , the effects of the westernization of the egyptian population may take several decades to develop into a detectable breast cancer increase .
therefore , the ill effects of the relatively recent adoption of a western lifestyle may not have yet emerged in the younger age groups .
furthermore , there may be something inherent in the breast tissue of older women , which makes them more susceptible to the changing risk factor profile for breast cancer .
these findings may also be attributed to the larger number of cases in the older women , providing greater power to demonstrate a statistically significant measure .
our finding of the greatest expected increase in breast cancer caseloads among younger women aged 3049 largely reflects the increase in the population size among this age group ; these results do not necessarily imply that screening efforts should target this age group .
the incidence among younger age groups is very low and many women would have to be screened to find the cases .
therefore , in our opinion , awareness among younger women and education on breast self - exam may be the best approach to accomplish early detection among the younger age groups .
our finding of a general decline in incidence of distant tumors is encouraging given the emphasis on early detection and the screening efforts that have been occurring in egypt over the study period .
however , because of the overall population growth in egypt , we can still expect a significant increase in breast tumors of all stages from 2009 to 2015 .
therefore , while downstaging efforts are likely to be effective in reducing the incidence of breast tumors diagnosed at an advanced stage , egypt must still be prepared to cope with the increased burden of diagnosing and treating breast tumors at all stages of disease .
there is evidence to suggest that hormonal subtypes of cancer differ in developing and developed countries , with er positive tumors being more common in developed countries .
hormonal receptor subtypes of breast cancer are important to consider due to their differential response to therapy , with better prognosis overall for er positive tumors [ 21 , 22 ] .
little information is available on recent trends of breast cancer by hormonal subtype in egypt , though our previous study demonstrated higher incidence of er positive tumors in urban areas as compared to rural areas in egypt .
we were limited in our ability to evaluate trends in breast cancer by hormonal receptor status as part of this analysis due to missing data . however , our preliminary analysis suggested a significant increase in the incidence of er negative tumors over this study period , with the greatest increase evident among women aged 5059 years .
furthermore , we can expect an increase in er negative tumor caseloads among women aged 70 + .
most of the increase in breast cancer incidence in the united states has been due to an increase in er positive breast cancer .
reproductive factors that increase women 's lifetime exposure to endogenous estrogens result in er positive cancers , while smoking , radiation , and genetic risks are thought to give rise to er negative cancers [ 2527 ] .
alcohol consumption and family history of breast cancer has been shown to be associated with breast cancer regardless of er status .
thus , established risk factors for breast cancer associated with the westernization of the population in egypt would be more likely to explain an increase in er positive tumors .
however , this study suggests that a significant increase in the incidence of er negative tumors is likely in egypt , with the greatest expected increase in er negative tumors from 2009 to 2015 among women 70 years and older .
future research should focus on risk factors that may illuminate the increasing trends of er negative tumors in egypt , especially among older women .
this information is critical to cancer treatment planning and may also provide insight into the etiology of the hormonal subtypes of breast cancer .
most importantly , the stage at diagnosis and hormonal receptor status information was missing for a large proportion of the breast cancer cases in our analysis .
the persistence of unknown stage and hormonal receptor status throughout the study years is disconcerting .
stage at diagnosis and hormonal receptor status information are critical metrics for treatment planning and for evaluation of cancer control programs .
we believe that reporting of this information must be prioritized and that the specific challenges in reporting this information should be identified and ameliorated with urgency .
furthermore , we found statistically significant differences in the percentage of missing stage data across age groups and regions contributing cancer cases to the gharbiah registry , with the greatest percentage of missing stage data coming from nonspecialized hospitals and clinics , pathology labs , and cases registered via death certificates only .
missing stage data was most notable among women aged 70 + ( data not shown ) and this may be due to the higher likelihood of diagnosis by fine needle aspirate ( fna ) without tissue pathology available for staging among this age group .
the incidence of breast cancer cases with unknown hormonal receptor status was previously shown to be similar from 1999 to 2006 , and cases with unknown hormonal receptor status were similar to the overall breast cancer cases in the gharbiah registry in regard to important baseline factors like age and stage at diagnosis .
however , we found that er and pr information was more likely to be missing among women aged 70 + and among tumors diagnosed at a distant stage of disease ( data not shown ) .
diagnosis by fna among older women and those diagnosed at a distant stage of disease may explain this trend , as tissue would be unavailable for pathological staging or hormonal assays .
the missing stage and hormonal status information could have limited our ability to demonstrate a significant measure of trend and could produce bias in our estimates of the trends in breast cancer occurrence in egypt .
for example , one study of seer data documented that between 1992 and 2007 , 17% of cases had missing er data and that the likelihood of missing data increased with increasing age at diagnosis and increasing stage of disease . in summary , we must be extremely cautious in making inferences based on the observed trends in light of the fact that there was a significant amount of missing data for stage and hormonal receptor status that could have biased results .
a further limitation of this study is the fact that the breast cancer projections reported in this study assume stable screening practices , risk factor profiles , and constant incidence rates from 2008 .
future predictions are affected by population growth and by aging and changing risk factors , which may be difficult to predict .
thus , while the projections reported in this study are based on statistical models , they should be interpreted with some caution . moreover
, the population figures for the years between the census were determined using linear interpolation , which assumes constant growth over these years .
the accuracy of the calculated incidence rates would be affected if the actual population figures differ from our predicted values .
finally , registry - specific statistics are based on small numbers of cases per year observed in young women , with an inevitable high degree of variability .
strengths of this study include the use of a well - characterized and validated population - based registry data from a 10-year period .
in addition , this study provides predictions for future trends , which are critical to cancer control and planning efforts in egypt .
finally , this study provides important information on the progress of downstaging efforts in egypt and also details trends in hormonal receptor status of tumors , which is critical for cancer treatment planning , especially in developing countries with limited treatment resources .
breast cancer in egypt is a growing public health concern and significant efforts should be directed to addressing the increasing burden of breast cancer in this part of the world .
however , it is important to note that the breast cancer incidence rates we report for all age groups in egypt are lower than what is reported for these age groups in the united states , including among younger women .
moreover , breast cancer rates in egyptian women over 50 years are higher than the rates in egyptian women under 50 years of age ( figure 1 ) .
therefore , any impression that breast cancer is a disease of younger women in egypt arises from the age distribution of the population . in this respect , egypt is typical of many low- and middle - income countries . in conclusion
, this study demonstrated that the breast cancer burden in egypt will likely increase given the current population trends .
the observed breast cancer incidence trends are generally consistent with the aging and westernization of the population in egypt .
our results have important implications for allocating limited resources , managing treatment needs , and exploring the consequences of prior interventions and/or changing risk factors in egypt and other developing countries at the same stages of demographic and health transitions . | background .
this study was undertaken to evaluate trends in breast cancer incidence in egypt from 1999 to 2008 and to make projections for breast cancer occurrence for the years 20092015 .
patients and methods .
we utilized joinpoint regression and average annual percent change ( aapc ) measures with 95% confidence intervals ( ci ) to describe the trends in breast cancer incidence rates from the gharbiah cancer registry by age and stage at diagnosis and to estimate expected breast cancer caseloads for 20092015 .
results . from 1999 to 2008 , the aapc in breast cancer incidence rates in gharbiah significantly increased among women 50 years and older and among localized tumors ( aapc % , 95% ci , 3.1% to 8.0% ) .
our results predict a significant increase in breast cancer caseloads from 2009 to 2015 among women aged 3039 ( aapc % , 95% ci , 0.9% to 1.1% ) and among women aged 4049 years ( aapc % , 95% ci , 1.0% to 2.6% ) . conclusion .
these results have important implications for allocating limited resources , managing treatment needs , and exploring the consequences of prior interventions and/or changing risk factors in egypt and other developing countries at the same stages of demographic and health transitions . |
a 65-year - old male who was a chronic smoker for the last 30 years presented with generalized weakness , breathlessness , occasional hemoptysis , and multiple cutaneous nodules ( 8 in number ) all over the body since two months .
the nodules were present over the chest ( 2 ) , abdomen ( 1 ) , back ( 2 ) , face ( 1 ) , and both the extremities ( 2 ) .
they were of varying sizes , ranging from 2 to 6 cm and were firm , nontender , and mobile .
a clinical diagnosis of chronic obstructive pulmonary disease ( copd ) with cutaneous lymphoma or soft tissue tumor was made .
clinical photograph showing nodule over abdominal wall hematological investigations revealed the following : hb ( hemoglobin ) : 14.4 gm% ; tlc ( total leukocyte count ) : 19,100/cmm ; dlc ( differential leukocyte count ) : p87l10e0m03 .
esr ( erythrocyte sedimentation rate ) : 28 mm at the end of one hour .
chest x - ray ( cxr ) and computed tomography ( ct ) showed neoplastic right lung and bronchial mass with secondary cavitation .
excision biopsy of the noninfected nodule from the back was done and the specimen was received by the department of pathology . on gross examination ,
it was an irregular tissue measuring 63.51 cm with a nodule 3 cm in diameter which was surrounded by adipose tissue and muscle .
the histopathological sections from the nodule showed metastatic deposits from squamous cell carcinoma , moderately differentiated ( grade ii ) [ figures 2 and 3 ] .
photomicrograph showing metastatic deposits from squamous cell carcinoma ( grade ii ) [ h & e , 10x ] photomicrograph showing pleomorphic tumor cells infiltrating muscle fibers [ h & e , 40x ]
cutaneous metastasis refers to the growth of cancer cells in the skin originating from internal cancer . in most cases ,
cutaneous metastasis develops after initial diagnosis of the primary internal malignancy and late in the course of the disease . in very rare cases ,
skin metastasis may occur at the same time or before the primary cancer has been detected . in the present case
the most frequent source of metastases in men are the lung ( 24% ) , colon ( 19% ) , melanoma ( 13% ) , and oral cavity ( 12% ) . in women , they are the breast ( 69% ) , colon ( 9% ) , melanoma ( 5% ) , ovaries ( 4% ) , and lung ( 4% ) . in men younger than
40 years , the most common source of cutaneous metastases is melanoma , whereas in males older than 40 years , the most common source is carcinoma of the lung . our case was a 65-year - old male and the source of cutaneous metastases was carcinoma of the lung . the percentage of patients with lung cancer who develop cutaneous metastases ranges from 1 to 12% .
commonly , the skin metastases are seen over the chest , abdomen , followed by the scalp , head and neck , extremities , and back .
clinically , the common presentation of cutaneous metastases is in the form of solitary or multiple nodules .
other morphological patterns include carcinoma erysipeloides , carcinoma en cuirrase , carcinoma telangiectaticum , sister mary joseph 's nodule , alopecia neoplastica , and cicatricial and bullous forms .
usually they present as fast - growing solitary or multiple nodules with a diameter of 5 mm10 cm and are firm , mobile , and covered with normal skin .
sometimes exudative or ulcerative lesions are also seen . in the present case , the nodules varied in size from 2 to 5 cm in diameter , and were firm and mobile .
the most common histologic type of carcinoma of the lung that metastasizes to skin is adenocarcinoma followed by squamous cell carcinoma , and small - cell and large - cell carcinoma .
carcinoma of the breast and carcinoma of the oral cavity spread via lymphatics , whereas the rest of the cancers spread mainly via a hematogenous route .
lymphatic dissemination may explain why skin metastases tend to be close to the primary site of the tumor .
however , in our case , the metastatic nodules were seen all over the body , suggesting lymphatic as well as hematogenous spread .
the combination of radiotherapy and chemotherapy , patients with lung cancer with cutaneous metastases have a poor prognosis ; median survival of patients with lung cancer metastases is 36 months . | a 65-year - old male with a history of smoking since 30 years presented with breathlessness , hemoptysis , multiple swellings all over the body , and weakness in september 2010 at our hospital .
clinically , a diagnosis of chronic obstructive pulmonary disease ( copd ) with cutaneous lymphoma or soft tissue tumor was made .
chest x - ray ( cxr ) and computed tomography ( ct ) scan revealed a neoplastic lesion in the right lung with secondary cavitation .
biopsy of the cutaneous nodules showed metastatic deposits from squamous cell carcinoma .
metastatic skin cancer is a relatively rare complication of internal malignancy .
the clinical features of metastatic skin disease vary enormously
. they may present as erysipeloid , sclerodermoid , alopecia neoplastica or in an inflammatory or bullous form or as multiple nodules as in our case .
a high index of suspicion for metastatic deposits is required in an elderly male patient who is a known case of lung cancer or even one who is a chronic smoker and presents with such cutaneous lesions . |
a 70-years - old woman visited the department with a complaint of discomfort on the left preauricular area during mastication and mouth opening , which had occurred 3 or 4 months before . on the clinical examination
additionally , a well - formed , impacted tooth was found in the right condylar head of the mandible .
1 ) . the patient had no experience of extraction of third molars , and any associated pathologic sign was not observed .
according to the orientation and location of the impacted tooth , it was considered as an ectopic impaction of a mandibular third molar .
cone beam ct scans were performed to evaluate the position and direction of the impacted tooth in the mandibular condyle .
2 ) . there was no pathologic sign such as cystic change around the impacted tooth . on the axial image ,
an impacted tooth was found in close proximity to the front cortical bone and in the middle portion of the mandibular condyle ( fig .
sagittal image showed a well developed impacted tooth with proximity to the outer cortical bone of the mandibular condyle ( fig .
the follicular space and lamina dura of the tooth were not distinguished . on the frontal view of 3d volumetric image ,
final diagnosis was an ectopic impaction of the mandibular third molar in the mandibular condyle .
several theories have been suggested to explain the ectopic eruption , including aberrant eruption , trauma , and ectopic formation of the germs of the teeth.2 it has been suggested that an aberrant eruption pattern occurred when the tooth has been displaced by a lesion , usually an odontogenic cyst.3 wang et al3 in 2008 reported a similar case and reviewed the literatures from 1978 to 2003 .
they found 13 case reports of the ectopic third molars in the subcondylar area , including 1 case of a dry skull and 1 of a cadaveric mandible .
the management for these conditions was described as no treatment or as surgical removal via extraoral or intraoral access .
salmern et al2 in 2008 reported 2 cases of third molars in the subcondylar area , which were associated with odontogenic cysts and treated through the extraoral approach , indicating that the treatment was primarily determined by the experience of the surgeon or physician .
wang et al3 reviewed that eight of the 11 cases included the description of a radiolucent image around the ectopic molar on the radiograph , including 5 with the diagnosis of a dentigerous cyst .
the expansion of a cyst might put pressure on the crown of a tooth and displace it in the opposite direction to the path of eruption .
several teeth had an upward whereas the others had a downward inclination or even an inverted crown position . in this case , the abnormal position of the tooth germ might be the most likely causative factor because the impacted tooth was positioned in the mandibular condyle with an upward crown position without any pathologic change which resulted in such unusual movement .
the surgical removal of an ectopic mandibular third molar with acute inflammation or cystic lesion is recommended to prevent further complications such as diffuse osteolysis , condylar process deformity , or bone absorption.4,5 in cases of symptom - free highly aberrant wisdom teeth or without urgent necessity , annual follow - up visits to monitor the growth of the lesion is appropriate.6,7 in this case , the impacted tooth was not removed because of the absence of the associated symptom or lesion unlike other reports2,4 - 6 and the patient 's age . | impaction of third molar is a common developmental abnormality .
however , ectopic impaction of the mandibular third molar in condylar region is an extremely rare condition .
this report describes a case of impacted tooth in the mandibular condyle without any associated pathologic condition .
also , this report presents the spatial relationship of the impacted mandibular third molar to the surrounding anatomic structures using cone beam computed tomography . |
in contrast to crohn s disease , the immunopathogenesis of ulcerative colitis ( uc ) has been a more difficult disease to ascertain . this owing to the fact that it did not fit neatly into a niche of the th1/th2 paradigm . in particular , it was evident that cells from this disease produced neither excessive ifn- ( th1 ) , nor il-4 , the major th2 cytokine ( 1 ) . indeed
, il-4 production was found to be decreased in cells extracted from ulcerative colitis tissue and only the increased presence of an additional th2 cytokine il-5 , gave reason that the disease may be th2 mediated .
to understand better the immune responses that may play a role in the pathogenesis of human uc , initial investigations turned to the analysis of murine models of intestinal inflammation .
one such model is that of the hapten - induced oxazolone colitis . in initial studies
, it was found that administration of oxazolone led to a short - lived colitis ( lasting less than 5 days in duration ) which had features of human uc -- in particular superficial inflammation of the gut wall , associated with edema , ulceration of the epithelial cell layer and neutrophil accumulation ( 2 ) .
this pathological picture differed greatly from the other type of hapten induced colitis ( tnbs - colitis ) which was characterized by a densely packed , transmural lesion .
a second difference between tnbs - colitis and oxazolone - colitis also emerged from the studies of the cytokine secretion patterns in these inflammations .
these studies revealed that cd4 + t cells present in oxazolone - colitis lesions produce initially a large amounts of th2 type cytokines ( il-4 and il-5 ) ( 2 ) in contrast to the increased amount of th1 cytokines ( ifn- ) found in tnbs - colitis .
furthermore , it was evident that this th2 cytokine response played an initial role in the immune pathogenesis of oxazolone - colitis since administration of anti - il-4 to mice at the time of disease induction prevented the development of colitis . however , as this form of oxazolone colitis was short - lived in nature , further studies investigating a more prolonged form of oxazolone - colitis , lasting 12 weeks was examined ( 3 ) .
this was accomplished using a pre - sensitization regimen in which the abdomen was pre - coated with oxazolone 1 week prior to the administration of a low dose intra - rectal oxazolone challenge .
this more chronic model demonstrated that the initial il-4 response was superceded after about 45 days with an increasing il-13 response .
this latter response was intrinsic to disease pathogenesis since the colitis could be prevented by administration of il-13r2-fc , a soluble receptor for il-13 that blocks il-13 interaction with its signaling receptor .
the next question to be addressed was the cellular origin of the cytokine response , particularly il-13 production and its targets .
interestingly , this turned out to be a natural killer t cell ( nk t cell ) , i.e. , a cd4 + t cell bearing nk markers that take part in innate immune responses through their capacity to function as cytotoxic cells that can produce either th1 ( ifn- ) or th2 ( il-4/il-13 ) cytokines under various circumstances . in order to understand the significance of how nk t cells may be intrinsic to the inflammation of oxazolone - colitis
an nk t cell has characteristics of both an nk cell and a cell with t cell receptors ( tcrs ) that nevertheless bears surface nk markers ( such as nk1.1 ) .
in addition to its distinctive surface markers , the nk t cell can be defined by the fact that it recognizes glycolipid antigens presented to it by a highly conserved mhc class i - like molecule , ( cd1 in mice and cd1d in humans ) and in most cases it expresses an invariant tcr that is made up of a particular tcr chain ( v14-j281 in mice and v24-j18 in humans ) linked to a restricted repertoire of v chains , hence the fact that it can be stimulated by a particular prototype glycolipid , -galactosyl - ceramide ( 4 ) .
however , it is important to recognize that while the great majority of nk t cells have these attributes , a minority of nk t cells ( non - classical nk t cells ) , while still recognizing antigen restricted by cd1 , bear non - invariant tcrs ( 5 ) .
an additional characteristic of nk t cells is their ability to act as cytotoxic t cells and it is this property that accounts for the fact that nk t cells have anti - tumor cell activity and act as effector cells in certain inflammatory states such as experimental hepatitis ( 6 ) . in the latter regard , it has been shown that nk t cells in hepatic lesions secrete perforin and granzymes that mediate cellular injury ( 7 ) . finally , it is important to emphasize that nk t can be activated by cd1-bearing antigen presenting cells in the absence of added antigen ( 8) . this latter point indicates that nk t cells probably recognize self - antigens present in the groove of cd1 derived antigen - presenting cells ; in other words , nk t cells can be self - antigen specific .
thus , nk t cells are important components of the innate immune system since they do not require exogenous antigens to begin secreting cytokines .
evidence for the identification of the nk t cell as the source of il-13 in oxazolone - colitis drew on these nk t cell characteristics and included the fact that administration of anti - nk t cell antibodies to mice prevented development of oxazolone - colitis .
in addition , the latter could not be induced in mice deficient in cd1 ( 3 ) .
finally and perhaps most importantly , stimulation of lamina propria t cells extracted from oxazolone - colitis tissue with antigen - presenting cells bearing cd1 resulted in il-13 secretion .
therefore , these studies of a murine model of uc strongly suggested that the pathogenesis of the colitis was due to the generation of nk t cells that secrete il-13 . from these data
it was inferred that oxazolone - colitis could be due to either a direct effect of il-13 on epithelial cells or a ( cytolytic ) effect of nk t cells on epithelial cells .
taken together , this information concerning nk t cells , it is possible to construct a mechanism of how these cells mediate oxazolone - colitis ( see figure 1 ) .
first , oxazolone may act as a unique kind of haptenating agent that has the particular ability to induce nk t cell development , presumably by giving rise to a lipid moiety that is presented to a small but expandable population of nk t cells in the context of cd1 on antigen presenting cells . in the intestinal tract ,
the latter would include not only antigen presenting cells , but also gut epithelial cells , which have been shown to express cd1 ( 9 ) .
initially , they begin to produce il-4 and il-13 , the latter a cytokine which may act as an autocrine factor that causes the nk t cells to become cytotoxic effector cells with the capacity to cause tissue injury . the immediate target of possible nk t cell activity in oxazolone colitis may in fact be the epithelial cell since , as mentioned , this cell bears cd1 and can present antigens to nk t cells .
such cytotoxicity could be responsible for the ulceration of the mucosa and observed alteration of the epithelial barrier .
third , once this occurs , there is the possibility of penetration of the mucosa by bacteria in the mucosal microflora and thus further nk t cell stimulation by antigens in the flora that are cross - reactive with self antigens .
however , these latter points concerning changes in epithelial barrier function may be brought about not only by nk t cells but by il-13 itself . in further studies , investigating the role of il-13 and epithelial barrier function , heller et al . demonstrated that il-13 can have a direct effect on epithelial barrier function in a multitude of ways ( 10 ) . concerning effects on epithelial cells , when il-13 was added in vitro , a dose - dependent decrease in electrical resistance of ht-29
these changes in epithelial cell function both could give rise to a change in barrier function .
furthermore , the addition of il-13 in vitro to these monolayer cultures led to an increased expression of the pore - forming tight junction protein claudin-2 .
more significantly , examination of the lamina propria tissue from human ulcerative colitis patients also demonstrated similar changes in claudin-2 expression .
these results suggest that the changes in barrier function in human uc may not only be due to cytolytic destruction of the epithelial layer by nk t cells but concomitantly due to a more subtle alteration secondary to effects from il-13 .
one directly affecting epithelial cells and a second as a stimulant of nk t cell cytotoxicity .
given the above findings , the next series of studies focused on the human disease counterpart , ulcerative colitis ( uc ) to ascertain if similar mechanisms played a significant role .
here it was found that lamina propria cells isolated from inflamed uc tissue stimulated in vitro did indeed produce increased amounts of il-13 as compared to cells from both control individuals and patients with crohn s disease ( 11 ) .
moreover , depletion of cells bearing a marker found on nk t cells ( cd161 ) from the lamina propria cell population extracted from uc tissue , followed by stimulation in vitro led to greatly decreased il-13 production .
further studies investigating the link between nk t cells and il-13 production in uc came from flow cytometric analysis that revealed that whereas both uc and cd lamina propria mononuclear cells contained increased numbers of cells bearing a surface marker found on nk t cells ( cd161 ) , those from uc specimens were producing il-13 whereas those from crohn s disease specimens were producing ifn- ( 11 ) .
perhaps more importantly , it was observed that antigen presenting cells bearing a cd1d construct ( and thus expressing cd1d on its surface ) could only induce lamina propria mononuclear cells from uc patients but not that of crohn s disease to produce any cytokine ( in particular , il-13 ) .
thereby , establishing that , in fact , the cytokine secretion profile seen in uc was produced from a non - classical cd1 dependent nk t cell whereas the cytokines produced in crohn s disease were from that of an activated classical th1 cd4 + t cell .
one final important finding in the study of uc patients only hinted in the animal studies , was that lamina propria cells enriched for nk t cells from the patients could be shown to be cytotoxic for epithelial cells and such cytotoxicity was further enhanced by il-13 ( 11 ) , suggesting an associated link between il-13 and nk t cells in the pathogenic mechanisms of this inflammation . on this basis ,
an additional possibility for the immunopathologic mechanism operating in uc is that antigens in the mucosal microflora activate nk t cells due to aforementioned changes in barrier function that , in turn , cause cytolysis of epithelial cells and the characteristic ulcerations associated with the disease .
however , additional factors other than that of the mucosal flora may activate nk t cells . as suggested , enhancement of cytolytic activity was observed in vitro in the presence of il-13 .
il-13 , therefore , may play an autocrine role in the activation of these cells .
how il-13 may function in this capacity may be inferred from a recent study ( 12 ) .
these studies demonstrated that tgf- transcription was dependent upon il-13 acting through a receptor previously thought to function as a decoy ( il-13r2 ) .
whether il-13 can indeed induce transcription of other cytokines ( namely itself ) or activation of nk t cells through a similar manner remains to be determined . in summary , these considerations bring us back to the opening comments of this discussion .
the point to make is that we have made many inroads to the understanding of inflammatory bowel disease in all its complexity .
however , the final proof that il-13 and nk t cells play a significant role in human uc awaits study in a human trial in which these components may be blocked or depleted . | recent studies that have evaluated the immunologic factors which mediate the development of the two forms of ibd , namely crohn s disease and ulcerative colitis , have suggested that these diseases are due to disparate immune responses .
while crohn s disease has been characterized as a dysregulation of the th1/th17 pathways more recent evidence has emerged that ulcerative colitis pathogenesis is associated with a nonclassical nk t cell producing an atypical th2 ( il-13 ) response . in the following review
the insights gained from both animal models and human studies as to the role that il-13 and nk t cells play in the pathogenesis of uc will be discussed . |
the incidence and prevalence
rates for these tumors are double in men than in women .
cancers of the oral
cavity rank as the eighth most common cancer among men , being responsible for
3% of the cancers diagnosed in this gender .
mortality rates are
substantially lower than incidence rates . according to the world health
organization ( who ) data , the standardized mortality rate for 2002 was 2.2
deaths per 100 000 population .
tobacco and alcohol
are the main risk factors for oral and pharyngeal cancers . in usa and europe
,
they are responsible for 7580% of these
tumors [ 2 , 3 ] .
epidemiologic studies performed in all continents have found an
increased risk in smokers , which seems to rise with daily consumption and
duration [ 47 ] .
there is also
sufficient evidence to conclude that excessive consumption of alcoholic
beverages is associated with oral and pharyngeal cancers , causing in some cases risks higher than those found for smokers [ 810 ] .
the reason why some
individuals develop cancer and others do not can be attributed , at least partly ,
to variations in genetic polymorphisms responsible for metabolizing
carcinogenic substances found in tobacco and alcohol .
although many genes have
been associated with metabolism of these compounds , some with the highest
rational of those being
involved are cyp1a1 , meh , and gstm1 .
the cyp1a1 gene
belongs to the cyp1 subfamily and encodes for the enzyme aryl hydrocarbon
hydrolase , which is involved in the activation of many polycyclic aromatic
hydrocarbons and aromatic amines and is present in oral tissue .
this
enzyme is implicated in the metabolism of benzo[a]pyrene , a potent tobacco
carcinogen .
various studies have shown that cyp1a1 catalyzes the initial
conversion of benzo[a]pyrene to 7,8 dihydrodiol-9,10-oxide [ 13 , 14 ] .
two cyp1a1
polymorphisms have been related to different tumors , including head and neck
cancers .
one of these is a single - base substitution of adenine to guanine at
position 2455 in the heme - binding region of exon 7 , which induces an amino acid change in
isoleucine to valine at codon 462 , known as the ile / val or exon 7 polymorphism
( ile 462 val ) or cyp1a1 * 2c .
the ile / ile genotype corresponds to the wild type , and ile - val and val - val
to the heterozygous and homozygous genotypes for the mutant allele ,
respectively .
this mutation is rare in caucasians , and is in complete
linkage disequilibrium with the cyp1a1 mspi mutation ( cyp1a1 * 2b ) . the microsomal form
of epoxide hydrolase is primarily associated with the metabolism of exogenous
xenobiotic compounds .
its interest in oral and pharyngeal cancers comes from
the fact that it has been detected in all
tissues including the aerodigestive tract and catalyzes the hydrolosis of arene , alkene , and aliphatic epoxides from
polycyclic aromatic hydrocarbons and aromatic amines .
enzymatically , meh catalyzes the hydrolysis of
epoxides to trans - dihydrodiols [ 18 , 19 ] .
two polymorphisms in the meh gene have been reported [ 20 , 21 ] .
the first polymorphism is produced as a
consequence of a substitution of c t
within exon 3 of the gene and results in a substitution of his to tyr in amino acid
position 113 .
this polymorphism is known as the slow allele since in vitro
studies show a 4060% decrease in
enzyme activity in comparison to the wild type .
, g substitutes a in exon 4 , leading to an
emplacement of histidine for arginine in the amino acid position 139 ( 139 arg his ) .
this polymorphism is known as the fast allele hyl*3
since it produces a 25% increase in enzyme activity in vitro .
tyr is the
predominant amino acid at the 113 position in caucasian populations , and his is
the most predominant at position 139 .
the glutathione s
transferase ( gst ) comprises a family of phase ii detoxifying enzymes that
catalyze a great number of detoxification reactions that take place between the
cytosolic glutathione and compounds containing an electrofilic centre .
the
gst substrates include acetaldehyde and several polycyclic aromatic
hydrocarbons found in tobacco smoke .
metabolism of this
carcinogen involves a balance between the activation steps mediated by the
epoxide hydrolase and the cytochrome system and the detoxification steps ,
involving gstm1 , that inhibit the activity of the dna binding intermediates and
catalyze the conversion of the reactive electrophiles to inactive , water - soluble
conjugates that can be easily removed .
even though frequencies of gstm1
null genotypes vary among different ethnic groups , in white caucasians , it is
deleted in approximately 50% of the population [ 2433 ] . in the present case - control
study
, we aimed to examine the relationship between the cyp1a1 ile / val , exon 4 meh
( 139 arg his ) , and gstm1 null
genetic polymorphism and the risk of oral and pharyngeal cancers , investigating
also the association with smoking , drinking , and the gene - gene interactions .
the present
hospital - based case - control study was conducted at the santiago de compostela
university hospital complex ( galicia ,
nw spain ) between january 1996 and january 2000 .
data was collected on a total
of 92 incident caucasian male cases with histopathologically confirmed
diagnosis of primary oral or pharyngeal cancers .
the study was restricted to
newly diagnosed patients over 20 years of age without a prior history of
cancer . for study purposes , tumors of the lip
a total of 130 consecutive
controls were included from patients attending the hospital complex
preoperative unit for nonsmoking- and nonalcohol - related trivial surgery .
the types of surgical procedures controls were scheduled to undergo mainly
comprised inguinal hernias , cataracts , and orthopedic surgery .
informed consent
was obtained from all study subjects prior to the interview and the extraction
of total blood . only 1 case and 6 controls refused to participate in the study .
all study subjects
were interviewed by a person purpose - trained to administer a structured
questionnaire addressing various aspects of lifestyle , with special emphasis on
smoking habit , alcohol consumption , occupation , and other activities related to the development of
oral and pharyngeal cancers . for cases ,
the interview was done as soon as
possible after cancer was detected and always within 15 days from diagnosis .
the questionnaire used was previously applied to a group of individuals
fulfilling the characteristics of the subjects going to be included and all
questions with difficult interpretation were duly amended .
after cases and
controls were identified , whole blood samples of 6 ml were collected from each
subject in heparin - containing tubes .
the samples were stored at 4c and centrifuged at 2800 rpm
for at least 10 minutes within the next 24 hours .
the cells were washed with
te ( 10x ) and centrifuged at 3000 rpm during 10 minutes several times until they
were cleaned .
the pellet was then treated with lysis buffer and proteinase k in
1% sds previous to the extraction of dna with phenol - chloroform and ethanol
precipitation similarly as previously described .
the dna was precipitated in the presence of high
concentrations of ammonium acetate ( to further purify the dna ) and resuspended
in te to approximately 300 g / ml .
the genotyping
assays were performed at the molecular medicine unit of the santiago de
compostela university hospital complex .
genotyping for gstm1
was carried out in the whole sample using a modified pcr method described
previously .
reactions were carried out in a final volume of 12.5 l containing 20 mm tris - hcl ( ph 8.4 ) , 50 mm kcl , 3 mm mgcl2 , 0.25 m
of each gstm1 primer , 0.25 m of each -globin primer ( internal control ) , 1 u taq dna
polymerase ( promega ) , 2 m
each dntps , and 600900 ng of dna .
the gstm1 primers were 5-gaactccctgaaaagctaagc and 5-gttgggctcaaatatacggtgg .
the pcr conditions were 94 for 3 minutes , followed by 35 cycles
of 94c for 30 seconds , 58c for 30 seconds , 72c for 45 seconds , and a
final extension of 72c for 7 minutes . to analyse the exon
4 meh polymorphism ( eh )
the pcr was performed in all subjects
using the sense primer 5-ggggtgccagagcctgaccgt-3 and the antisense primer
5-aacaccgggcccacccttggc-3 ( sigma - genosys ) .
the pcr cycling conditions were 95c for 2 minutes , followed by 35 cycles at 95c for 30 seconds , 60c for 30 seconds , 72c for 30 seconds , with a
final step at 72c for 7 minutes .
after pcr amplification , 10 l of
the pcr product was digested overnight at 37c with 10u of rsai ( invitrogen ) .
the wild - type
genotype ( aa ) produced 295-bp and 62-bp bands , the heterozygous genotype ( ag )
yielded 295-bp , 174-bp , 121-bp , 62-bp ; and the rare allele ( gg ) gave 174-bp ,
121-bp , and 62-bp bands .
the ile - val
polymorphism was analysed in only 158 of the 222 individuals included using an allele - specific
oligonucleotide - pcr procedure previously described by hayashi et al . .
in
the same reaction mix , two primers with different terminal bases ( 1a1a or 1a1 g ) ,
which contained the polymorphic site at the 3end , were added ( 1a1 g :
5-gaactgccacttcagctgtct-3 and 1a1a : 5-aagacctcccagcgggcaat-3 ) in
conjunction with another strand of primer ( 1a1.1 : 5-gaactgccacttcagctgtct-3 ) .
two amplification reactions were necessary for each one of the subjects analysed ,
one with the primers 1a1.1/1a1a which recognize the ile462 allele and another
with the primers 1a1.1/1a1 g which recognize the val462 allele .
pcr was carried
out at 30 cycles under the following conditions : 30 seconds at 95 for
denaturing , 1 minute at 60c for primer annealing , and 1 minute at 72c for primer extension .
all the products
were electrophoresed on a 2% agarose gel stained with ethidium bromide and
visualized under uv light .
logistic regression
was employed to analyse the effect of each of the genes studied .
the wild type
gene was considered as the reference category for each gene in each analysis .
all the regressions were adjusted for age , tobacco consumption in pack - years ,
and alcohol consumption in grams / week .
for analyzing the effect of the
different polymorphisms across different categories of tobacco and alcohol
consumption , the cutpoint was established on the median creating two
categories , low and high consumption in order to achieve a higher statistical
power . in all analyses ,
the dependent variable was the status of case or
control and the risks were expressed as ors with ci 95% .
the study population
covered a total of 222 subjects , comprising 92 cases and 130 controls .
a
description of the sample characteristics is presented in table 1 . the mean age
of the controls ( 59.4 years ; ci 95% 5761.8 ) was
slightly higher than that of cases ( 55 years ; ci 95% 52.757.3 ) .
the 57.6% of
the tumors were located in the oral cavity ( tongue 27 , oral floor 7 , palate 6 , and
other parts 12 ) and 96.7% were squamous cell carcinomas .
smoking and alcohol
consumption were more
frequent among cancer cases than controls . a percentage of 98% of the cases
were smokers and 46.7% of these ( n = 43 ) were considered as heavy drinkers ( more
than six glasses of wine / beers or two liquors a day ) , whilst in the control
group 62% of the individuals smoked and 10.8% ( n = 14 ) were heavy drinkers .
the frequency of
gstm1 null genotype was 51.1% among oral and pharyngeal cancer patients and 47.7%
among controls .
the exon 4 meh ( 139 arg his ) heterozygous
polymorphism ( his / arg ) was present in 31.5% of the control group and in 27.2%
of the case group .
only 4 subjects ( 4.3% ) in the case group and 1 subject in
the control group ( 0.8% ) presented homozygous mutations . there were no
differences in the frequency of mutations for the cyp1a1 exon 7 polymorphism .
the mutant alleles ( ile / val , val / val ) were observed in only 2 cases ( 3% ) and 2
controls ( 2.2% ) .
table 2 shows the odds
ratio estimates for combined oral and pharyngeal cancers associated with the gstm1 ,
cyp1a1 , and exon 4 meh polymorphisms . to determine the effect of these
polymorphisms on different cancer sites , oral cavity and pharyngeal tumors
no statistically significant effect was observed for any
of the polymorphisms studied for any of the anatomic subtypes .
the limited
number of subjects with mutant cyp1a1 alleles did not allow for a calculation
of the or for oral cavity tumors . to assess dose - response
relationship , we have calculated pack - years of smoking ( 1 pack ( 20
cigarettes / day ) years of smoking ) .
smokers were classified as non - to - light / moderate
smokers ( 35 pack - years ) and heavy smokers ( > 35 pack - years ) .
non smokers were analysed
together with light / moderate smokers because there were only 2 nonsmokers among
the cases and this did not allow for a separate analysis .
the odds ratios associated
with tobacco consumption by the different genotypes analysed are shown in table 3 .
this analysis was not performed for cyp1a1 due to the limited number of patients
with mutated alleles and the same happened for alcohol consumption . for the his / arg
genotype of exon 4 meh
, it could be observed that the risk was slightly lower
for heavy smokers ( or 0.68 ; 95% ci 0.251.86 ) than for
light smokers ( or 1.08 ; 95% ci 0.373.13 ) but the
associations were not significant for any of the categories of tobacco
consumption .
the gstm1 null genotype revealed an inverse pattern , showing an or
of 0.88 ( 95% ci 0.342.34 ) for light
smokers and an or of 1.40 ( 95% ci 0.573.43 ) for heavy
smokers . to examine the interaction between these genotypes and
the drinking status
those that consumed 280 gm / week
of alcohol or less ( 2
glasses of wine / beers or 2 liquors a day ) were considered as light drinkers ,
and those that exceeded those values as heavy drinkers . once again , due to the
low number of nondrinkers among the cases ( n = 2 ) , these subjects were analysed
in combination with light drinkers .
the risks for the two different categories
of alcohol consumption , light and heavy drinkers , are displayed in table 4 .
there seems to be a very slight nonsignificant negative association for the his / arg
genotype of exon 4 meh for both categories of alcohol consumption .
the gstm1
gene has a different effect , with its absence posing a slightly higher association
for light drinkers ( or 1.97% ci 0.735.35 ) than for moderate / heavy
drinkers ( or 0.69 ; 95% ci 0.281.72 ) .
no significant effect was
detected for the interaction although the estimated risk was higher for those
subjects with the wild - type meh gene and the null gstm1 genotype ( or 1.45 ; 95%
ci 0.663.17 ) .
there was
no any apparent effect when both genes were mutated or absent ( or 1.07 ; 95% ci
0.392.92 ) .
even though previous
studies have been undertaken to examine the association between cyp1a1 ile / val ,
meh , and gstm1 null polymorphisms , as well as oral and pharyngeal cancers , few
investigated the modification of risk associated with tobacco and alcohol
consumption , and to our knowledge , this is the first to analyse the gene - gene
interactions between these polymorphisms .
our results support the view that there is no significant association
for any of these polymorphisms in caucasians but our data suggest that exon 4 meh ( 139 arg his ) and gstm1 null
polymorphism might modify the risk related to tobacco and alcohol consumption .
we observed that the
exon meh polymorphism 139 arg his was mutated
in a very similar proportion in cases and controls and the frequencies found ( 32,3%
in controls versus 31,5% in cases ) were consistent with the results of the
previous investigations that assessed the association between this polymorphism
in head and neck tumors in both sexes [ 32 , 3741 ] . in these
studies , mutated alleles were present in 29.739.8% of the
control population and in 28.939% of the cancer
patients . in the present analysis ,
the estimated risks were not significant for any of the
tobacco or alcohol consumption levels but the results were in agreement with
those of wenghoefer et al .
that showed that the heterozygous allele ( his / arg )
of exon 4 meh could modulate the risk of head and neck cancer in smokers ( or 0.57 ;
ci 95% 0.340.95 ) . in our
study , the risk was lower in heavy smokers ( or 0.68 ; 95% ci 0.251.86 ) than in
light smokers ( or 1.08 ; 95% ci 0.373.13 ) but not
significant , maybe influenced by the small sample size .
enzymaticaly , meh
catalyzes the hydrolysis of arene , alkene , and
aliphatic epoxides from polycyclic aromatic hydrocarbons and aromatic amines to
trans - dihydrodiols .
this reaction is usually regarded as a detoxifying
pathway because the majority of metabolites produced are less reactive and can
be easily excreted , but , in some instances , these initial trans - dihydrodiol
metabolites can be further activated by subsequent p450 catalysis to form
highly carcinogenic electrofilic intermediates that can bind covalently to dna .
such is the case of the 7,8-diol-9,10-epoxide , which is more carcinogenic than
the other benzo[a]pyrene diol epoxide formed .
whilst the results of some
studies , including the present one , are compatible with the fact that a high or
intermediate activity might exert a protective effect in subjects exposed to
tobacco products [ 39 , 43 , 44 ] , others carried out in various
aerodigestive tract cancers find no association or a significantly higher risk
for smokers with the exon 4 meh variant allele [ 32 , 36 , 38 , 39 ] ; reasons for
these inconsistencies are unclear .
it could be argued that high activity should
be assessed taking into account both the exon 3 and exon 4 meh polymorphisms .
some authors predicted meh activity as
low , intermediate , or high based on the presence or absence of the two
polymorphisms but the results are also contradictory [ 37 , 38 , 40 , 41 , 45 , 46 ] .
the
study undertaken by wenghoefer et al . found an association for the single
genotypes in head and neck cancers but not the combination genotypes , raising
uncertainties in categorizing enzymes . given the
dual role of meh on the bioactivation / detoxification of carcinogens , it is
highly probable that other polymorphisms might influence the formation of
carcinogenic metabolites and that gene - gene interactions might exist . in this
investigation , we did not find a significant interaction between the gstm1 and exon
4 meh polymorphism .
the frequency of the
gstm1 null allele polymorphisms in oral and pharyngeal
cancers has been reported to vary greatly depending on the geographical regions
[ 47 , 48 ] .
whilst in europe and usa
the frequencies reported in control populations range from around 4955.6% [ 2432 ] in asian and
south american countries , this allele is frequently present in less than 49% of
the control subjects [ 4960 ] . in the
present study ,
this is slightly lower than the values found in other caucasian
studies and could be partly due to the fact that only males were included .
our
study , like other previous reports on caucasians [ 2426 , 2832 ] , failed to
find a significant association between the gstm1 null polymorphism and oral and
pharyngeal cancers .
several studies undertaken in asian populations showed contradictory results [ 49 , 5660 ] . in a very
recent meta- and pooled analysis
, it was observed that the gstm1 null
polymorphism was significantly associated with risk in asian and
african - american populations in the meta- ( or 1.5 ; 95% ci 1.31.8 ) and pooled
( adjusted or 2.4 , 95% ci 1.15.5 ) analysis ,
respectively , but not in caucasians .
this discrepancy might be attributed to differences in
lifestyle , environmental risk factors , and variations in the activity of other metabolizing
enzymes , which often displays
genetic polymorphisms that might differ in caucasians and in other ethnic
groups [ 11 , 41 , 59 , 61 ] .
we did not find a
significant interaction between the gstm1 null polymorphism and tobacco smoking ,
but we did observe that the risk was slightly higher in heavy smokers than in
light / moderate smokers . to verify that these differences were not due to the
fact that nonsmokers were analysed together with light / moderate smokers , we
carried out a separate analysis leaving out these subjects and found that the
variations in the odds ratios were minimum ( data not shown ) .
it has been hypothesised
that lack of gstm1 enzyme activity increases cancer susceptibility as a result
of a decreased ability to detoxify reactive intermediates of tobacco
carcinogens such as benzo[a]pyrene-7,8-diol epoxide , the activated form of
benzo[a]pyrene but the results of previous studies undertaken in oral and
pharyngeal cancers are inconsistent [ 26 , 54 , 56 , 57 ] .
some authors find a lower
difference in risk among the genotypes at high dose levels and suggest a
dose - response relationship of the enzymatic reaction [ 48 , 57 ] . in the present
study ,
the relationship between tobacco exposure and these polymorphisms is
difficult to assess because there were only 2 nonsmokers among the cases and 6 subjects
that smoked for less than 20 years , forcing us to create a category that was
light / moderate smokers .
studies with larger number of patients are needed to
properly assess this dose response relationship taking into account that ethnic
and geographical differences might exist due to the different forms of tobacco
consumption and diet intake . in asian and south american
countries
bidis and the carcinogenic substances
found in this form of preparation are different to that in cigarettes , implying
that other enzymes different than
gstm1 and cyp1a1 might be involved in the detoxification .
our study suggests
that the effect of the gstm1 null polymorphism is more noticeable among light
drinkers , although this association was nonsignificant .
this relationship was
maintained when we took out the nondrinkers from the analysis ( data not shown ) .
this differential effect could be explained by the fact that the gstm1
isoenzyme , together with the alcohol dehydrogenase , is involved in the
oxidation of ethanol to acetaldehyde . even though the exact mechanisms by
which ethanol may exert an influence in oral cancer is still unknown , it has
been suggested that acetaldehyde , a known carcinogenic agent , could be
responsible for some dna changes that could lead to cancer .
individuals
with a null gstm1 and high drinkers would not convert ethanol in acetaldehyde
and then the absence of the gene would confer them a protective effect for
oropharyngeal cancer .
another explanation for these finding could be that
ethanol increases the permeability of tobacco carcinogens , such as
nitrosonornicotine , across the oral membrane when it is present at low
concentrations . at concentrations higher than 50% ,
no further permeabilization
is noted , probably due to the fixative effect of ethanol on the mucosa .
it
should be highlighted that the alcohol consumption in the galician population is
very high , as other studies have reported , and this is a limitation that does
not allow for a proper analysis of the interaction .
even though the
cyp1a1 mutation has been shown to increase microsomal activity for converting
procarcinogens , including pah aromatic amines , the results of various reports
on smoking - related cancers are inconsistent [ 11 , 32 , 47 , 6670 ] .
it has
been suggested that the dna damage may depend on the link of cyp1a1 to other
polymorphisms that can affect the cyp1a1 transcription levels , such as
polymorphisms for promoter genes , ahr ( ah receptor ) genes , or metabolic genes
such as gstm1 [ 69 , 70 ] . in our study , only 4 of the analysed subjects showed an
ile / val mutation .
although these frequencies are in accordance with those found
by hahn et al . in a caucasian population , it made it impossible to draw
any conclusion for this polymorphism .
confidence intervals obtained were very
wide and the distribution of this polymorphism was very similar between cases
and controls . in any case , neither the previous meta- and pooled analysis on
cyp1a1 and risk of head and neck cancer nor the recently published meta
and pooled analysis on oral and pharyngeal cancer found
a significant association between cyp1a1
( ile / val ) polymorphism and oral and pharyngeal cancer .
this is especially
important when analyzing polymorphisms that have a very low frequency in the
population , such as cyp1a1 ile / val , but also limits the power to identify
gene - environmental and gene - gene interactions in any polymorphisms
investigated .
nevertheless , it has to be taken into account that for cancers
with a low incidence such as oral and pharyngeal ones , 92 cases can be a
relatively good number .
another limitation could be the fact that our study was
hospital - based and this could result in selection bias . even though it has been
suggested that studies with hospital controls can provide lower risk estimates ,
since diseases of controls could be associated with the polymorphisms under
study , previous meta- and pooled analysis that assessed these polymorphisms on
head and neck cancers found no differences for hospital - based studies in
relation to population - based studies [ 47 , 66 ] .
the fact that not all the sample
was analysed for cyp1a1 polymorphisms limited the power to detect a significant
risk .
one of them is that the participation of cases and
controls was very high .
all the cases belonged to the same catchment area ,
which has a unique reference hospital , and were collected consecutively , making
them representative of the cases in that area .
the controls also belonged to
the same area and did not have any symptom or disease related to alcohol or tobacco
consumption .
another advantage is the fact that the genes analysed here were of
phase i and phase ii , which adds value to the results obtained . when studying
susceptibility genes in many occasions , both types of genes are not studied and
individuals can have susceptibility in type i compensated with the activity of the other type such
as it was shown in park et al .
, it
seems that even though none of the three genotypes analysed have a significant
association with the risk of oral and pharyngeal cancer in this population , the
risks of tobacco and alcohol consumption might be modified by gstm1 null and
exon 4 meh polymorphisms .
the small number of nonsmoking and nondrinking subjects
in our population limited our analysis , so we propose that further studies are carried
out to clarify this question .
even though we found no significant interaction
between the gstm1null genotype and the exon 4 meh genotype , the gstm1 absence
did show a slight rise in risk so this should also be investigated taking into
account other polymorphisms including the cyp1a1 . | background .
genetic polymorphisms of drug metabolizing enzymes involved in the detoxification pathways of carcinogenic substances may influence cancer risk .
methods .
case - control study that investigates the relationship between cyp1a1 ile / val , exon 4 meh , and gstm1 null genetic polymorphism and the risk of oral and pharyngeal cancer examining the interaction between these genes , tobacco , and alcohol .
92 incident cases and 130 consecutive hospital - based controls have been included . results .
no significant associations were found for any of the genotypes assessed .
the estimated risk was slightly elevated in subjects with the wild type of the meh gene and the null gstm1 genotype . for exon 4 meh heterozygous polymorphism ,
the risk was slightly lower for heavy smokers than for light smokers .
the inverse association was observed for the gstm1 null genotype .
conclusions .
the results suggest that exon 4 meh and gstm1 null polymorphisms might influence oral and pharyngeal cancer . |
skeletal muscle atrophy results from a variety of conditions such as hindlimb unloading [ 1 , 2 ] , joint immobilization [ 3 , 4 ] , denervation [ 5 , 6 ] , and spinal cord injury [ 79 ] . generally resistance exercise training is performed as an effective therapeutic intervention to prevent muscle atrophy induced by these diverse conditions .
the effect of resistance exercise is known to be dependent on the intensity of muscle loading .
isometric contraction exercise confers greater protection against muscle atrophy because isometric contraction is a higher - intensity activity than isotonic contraction [ 11 , 12 ] .
additionally , muscle contraction using electrical stimulation has also been performed in cases in which it was impossible to perform voluntary limb movement such as denervation and spinal cord injury . similarly to resistance exercise , the effectiveness of electrically stimulated muscle contraction is influenced by the intensity , including frequency [ 13 , 14 ] , number of contractions [ 5 , 15 ] , and chronaxie . in performing different types of muscle contraction ,
it is reported that electrical stimulation in isometric contraction is more effective in preventing muscle atrophy than that in isotonic contraction [ 7 , 16 ] .
we have investigated the effect of electrical stimulation on muscle atrophy and confirmed that electrical stimulation in isometric contraction can attenuate the decreases in muscle mass and muscle fiber cross - sectional area compared with electrical stimulation in isotonic contraction .
although electrical stimulation in isometric contraction was effective in preventing muscle atrophy , it is still unclear what mechanisms underlie the beneficial effects of electrical stimulation .
three major protein degradation pathways are known to be implicated in muscle atrophy : ( 1 ) the lysosomal protease pathway involving cathepsins , which were found to have increased activity in atrophied muscle ; ( 2 ) the calpain pathway involving calpain 1 and calpain 2 , which are cytosolic calcium - dependent protease that are known to be increased in atrophied muscle ; ( 3 ) the ubiquitin - proteasome pathway , which involves 2 steps : conjugation of multiubiquitin moieties to the substrate and degradation of the tagged protein by the 26s proteasome .
muscle - specific ubiquitin ligases , atrogin-1/mafbx ( atrogin-1 ) and muscle ring finger 1 ( murf-1 ) , were found to be overexpressed in atrophied muscle .
if the relative contributions of the above - mentioned 3 major pathways to enhanced effectiveness of electrical stimulation on muscle atrophy by combined high - load isometric contraction can be verified , this will help establish muscle - specific therapeutic system .
the purpose of the present study was to investigate the combined effect of electrical stimulation and high - load isometric contraction to prevent muscle atrophy with a focus on the 3 major protein degradation pathways .
twenty - one adult male wistar rats ( japan slc , shizuoka , japan ) , weighing 282301 g , were used in the present study .
the animals were randomly divided into 4 groups : ( 1 ) control ( cont , n = 7 ) , ( 2 ) hindlimb unloading ( hu , n = 7 ) , ( 3 ) hindlimb unloading plus electrical stimulation ( es , n = 7 ) , and ( 4 ) hindlimb unloading plus the combination of electrical stimulation and high - load isometric contraction ( es + i m , n = 7 ) groups .
this study was approved by the institutional animal care and use committee and carried out according to the kobe university animal experimentation regulation .
all experiments were conducted in accordance with the national institute of health ( nih ) guidelines for the care and use of laboratory animals ( national research council , 1996 ) .
hindlimb unloading was induced in animals by suspending their tails for 14 days , according to the method described by morey et al . .
briefly , each animal in the hu , es , and es + i m groups was fitted with a tail harness and was suspended by a string just high enough to prevent the hindlimbs from bearing weight on the floor or sides of the cage .
the forelimbs were allowed to maintain contact with the floor of the cage , and the animals had full access to food and water .
the animals in each group were housed in an isolated and environmental controlled room at 22 2c in a 12 h : 12 h light - dark cycle .
the animals in the es and es + i m groups were anesthetized by an intraperitoneal injection of pentobarbital sodium , 40 mg / kg body weight , during electrical stimulation .
the animals in the cont and hu groups were anesthetized at the same frequency as the es and es + i m groups to exclude the influence of the anesthetic .
electrical stimulation equipment ( sen-3301 ; nihon kohden , tokyo , japan ) that permitted changes in the electrical parameters was used to treat the tibialis anterior muscle percutaneously .
one electrode ( 5 cm in diameter ) was positioned on the animal 's back , and the other active electrode ( 3 mm in diameter ) was adhered on the motor point of the tibialis anterior muscle . during the electrical stimulation ,
the active electrode was maintained in contact with the skin overlying the tibialis anterior muscle perpendicular to the muscle fibers .
the stimulation was a positive square wave with a pulse width of 0.1 ms , and the stimulation pulse amplitude was maintained at 4 ma .
each pulse was delivered at a frequency of 100 hz . during the electrical stimulation ,
1 s pulses were delivered every 3 s ( time on : 1 s ; time off : 2 s ) for 1 min , followed by 5 min of rest .
six consecutive stimulation sessions were performed twice in a day , separated by a 9 h interval .
this resulted in a total stimulation duration of 240 s in a day . in animals that underwent electrical stimulation ,
that is , es group , the right tibialis anterior muscle was stimulated without ankle joint fixation to cause an isotonic contraction .
conversely , in the es + i m group , the left ankle joint was fixed at 90 in a removable plaster cast during the electrical stimulation to cause high - load isometric contraction . in the rest time between sessions , the plaster cast was removed from the limb .
twelve hours after the last stimulation , all animals were deeply anesthetized by an intraperitoneal injection of sodium pentobarbital , 50 mg / kg body weight , and then the tibialis anterior muscle was removed and weighed .
isolated parts from the muscle sample ( ~15 mg ) were kept in rnalater solution ( ambion , austin , tex , usa ) for total rna isolation .
the remaining muscle samples were immediately frozen in acetone , cooled in dry ice , and stored at 80c until histological and western blot analysis .
serial transverse sections of 10 m thickness were cut on a cryostat ( cm-1510s ; leica microsystems , mannheim , germany ) from the middle part of the muscle belly in the tibialis anterior muscle at 25c and mounted on glass slides .
the sections were then stained for myofibrillar adenosine triphosphatase ( atpase ) at ph 4.4 preincubation to categorize the muscle fiber as type i , iia , or iib on the basis of a previous study .
the sections stained by atpase were used to determine the composition of muscle fiber types and to measure cross - sectional areas of each muscle fiber type .
each muscle fiber was matched for atpase and sdh stains , and fibers found to be lightly stained with atpase and those darkly stained with sdh were omitted from the measurement of muscle fiber cross - sectional area .
a measuring field was set over the entire muscle cross - section for the determination of muscle fiber type composition .
at least 100 randomly selected cross - sectional areas of each muscle fiber type were investigated .
the sections were measured using the imagej software program ( nih , maryland , usa ) .
the frozen muscle samples were homogenized in ice - cold homogenizing buffer containing 20 mm tris - hcl , ph 7.4 , 25 mm kcl , 5 mm edta , 5 mm egta , 1 mm dithiothreitol , and protease inhibitor cocktail ( nacalai tesque , kyoto , japan ) .
total protein concentration was determined by the use of a protein determination kit ( biorad , calif , usa ) .
the homogenates were solubilized in sample loading buffer containing 50 mm tris - hcl , ph 6.8 , 2% sodium dodecyl sulfate , 10% glycerol , 5% -mercaptoethanol , and 0.005% bromophenol blue .
twenty micrograms of sample protein was subjected to sds - page and then transferred to pvdf membrane .
following overnight blocking step in 0.3% skimmed milk in pbst , the membranes were incubated with anticathepsin l ( abcam , tokyo , japan ) , anticalpain 1 ( cell signaling , danvers , mass , usa ) , anticalpain 2 ( cell signaling , danvers , mass , usa ) , and antiubiquitin ( stressgen , plymouth meeting , pa , usa ) at 4c . following overnight incubation
, the membranes were incubated for 60 min at room temperature with anti - rabbit or anti - mouse igg conjugated to horseradish peroxidase ( ge healthcare , amersham , nj , usa ) .
the signals were detected using a chemiluminescent ( ecl plus , ge healthcare , amersham , nj , usa ) and analyzed with an image reader ( las-1000 , fujifilm , tokyo , japan ) .
total rna was extracted from ~10 mg of each muscle using an extraction kit ( quickgene rna tissue kit sii ; fujifilm , tokyo , japan ) .
reverse transcription was carried out using the high capacity cdna archive kit ( applied biosystems , foster city , calif , usa ) , and then cdna samples were stored at 20c .
expression levels of cathepsin l ( rn00565793_m1 ) , calpain 1 ( rn00569689_m1 ) , calpain 2 ( rn00567422_m1 ) , atrogin-1 ( rn00591730_m1 ) , and murf-1 ( rn00590197_m1 ) mrna were quantified by taqman gene expression assays ( applied biosystems ) .
each taqman probe and primer set was validated by performing qpcr with a series of cdna template dilutions to obtain standard curves of threshold cycle time against relative concentration using the normalization gene 18s .
qpcr was performed using pcr fast universal master mix ( applied biosystems ) in a microamp 96-well reaction plate .
each well contained 1 l cdna template , 10 l pcr fast master mix , 8 l rnase - free water , and 1 l taqman gene expression assays in a reaction volume of 20 l . all samples and nontemplate control reactions were performed in a 7500 fast sequence detection system ( applied biosystems ) at 50c for 2 min , 95c for 10 min , followed by 40 cycles at 95c for 15 s and 60c for 1 min .
significant differences between the 4 experimental groups were analyzed using one - way analysis of variance followed by tukey hsd post hoc test .
body weight , muscle wet weight , and ratio of muscle wet weight to body weight are shown in table 1 .
the values of body weight in the hu , es , and hu + i m groups were significantly lower than that in the cont group .
the values of muscle wet weight in the hu , es , and es + i m groups were significantly lower than that in the cont group .
the value of muscle wet weight in the es + i m group was significantly larger than that in the hu group , whereas there was no significant difference between the es and hu groups .
the value of muscle wet weight in the es + i m group was significantly larger than that in the es group .
for the ratio of muscle wet weight to body weight , the value in the es + i m group was significantly larger than that in the hu and es groups .
atpase staining revealed that the tibialis anterior muscles were composed of type i ( 0.32.2% ) , type iia ( 3.45.8% ) , and type iib ( 92.496.2% ) fibers ( figure 1 ) , and there were no significant differences between the 4 groups .
the sections in the es and es + i m groups did not have any histological signs of skeletal muscle injury .
the mean values of the cross - sectional area of the type i fibers in the hu and es groups were significantly less than that in the cont group , whereas there were no significant differences between the cont and es + i m groups ( figure 2(a ) ) .
the values in the es and es + i m groups were significantly larger than that in the hu group .
the value in the es + i m group was significantly larger than that in the es group . in both the type iia ( figure 2(b ) ) and iib ( figure 2(c ) ) fibers , the mean fiber cross - sectional area values in the hu , es , and es +
the mean values in the es and es + i m groups were significantly larger than that in the hu group , and the mean value in the es + i m group was significantly larger than in the es group .
for the expression level of cathepsin l protein , there were no significant differences between the 4 groups ( figure 3(a ) ) .
however , the expression level of cathepsin l mrna in the hu group was increased by 2.25 0.19-fold compared with the cont group ( figure 4(a ) ) .
in contrast , the value in the es + i m group was significantly less than that in the hu and es groups and was maintained at the control group level . for the expression level of calpain 1 ( figure 3(b ) ) and calpain 2 ( figure 3(c ) ) proteins , the values in the hu group
the values in the es and es + i m groups were significantly less than that in the hu group .
however , there were no significant differences between the es and es + i m groups .
the expression levels of calpain 1 ( figure 4(b ) ) and calpain 2 ( figure 4(c ) ) mrna in the hu group increased by 1.28 0.09-fold and 2.5 0.21-fold compared with the cont group , respectively .
the levels of both calpain 1 and calpain 2 mrna in the es and es + i m groups were significantly less than that in the hu .
there were no significant differences between the es and es + i m groups . for the expression level of ubiquitinated proteins ,
the value in the hu group was significantly higher than that in the cont group ( figure 3(d ) ) .
although there were no significant differences between the es and hu groups , the value in the es + i m group was significantly less than that in the hu group .
the expression level of atrogin-1 mrna in the hu group increased by 2.71 0.37-fold compared with the cont group ( figure 4(d ) ) . although there were no significant differences between the es and hu groups , the value in the es + i m group was significantly less than that in the hu group .
the value in the es + i m group appeared to be less than that in the es group ( p = 0.0514 ) and was maintained at the control group level .
the expression level of murf-1 ( figure 4(e ) ) mrna in the hu group increased by 1.83 0.29-fold compared with the cont group .
the values in the es and es + i m groups were significantly less than that in the hu group .
there were no significant differences among the cont , es , and es + i m groups .
in the present study , hindlimb unloading resulted in muscle atrophy of the tibialis anterior .
the decrease in protein synthesis reaches a peak within a few days after the start of unloading , whereas the increase in protein degradation reaches a peak 14 days after unloading .
because hindlimb unloading was applied for 14 days in the present study , it was hypothesized that the increase in protein degradation was related closely rather than the decrease in protein synthesis to the atrophied tibialis anterior muscle .
three major protein degradation pathways are implicated in skeletal muscle atrophy resulting from a variety of disuse conditions ( e.g. , hindlimb unloading , immobilization , denervation , and spinal cord injury ) : the lysosomal protease pathway , the cytosolic calcium - dependent calpain pathway , and the ubiquitin - proteasome pathway . in the present study , the expression level of cathepsin l mrna , one of the lysosomal proteases induced by hindlimb unloading , was increased by 2.25-fold in the hu group .
furthermore , hindlimb unloading evoked the overexpression of calpain 1 ( 1.28-fold ) and calpain 2 ( 2.5-fold ) mrna .
as for skeletal muscle atrophy - related ubiquitin ligases , the levels of atrogin-1 and murf-1 mrna were increased by 2.71-fold and 1.83-fold , respectively , with hindlimb unloading .
therefore , it can be postulated that the decreases in muscle mass and muscle fiber cross - sectional areas in all types in the hu group were due to the activation of the 3 major protein degradation pathways . electrical stimulation in isotonic contraction in the es group
attenuated the decrease in the cross - sectional areas in all muscle fiber types induced by hindlimb unloading .
almost all results in the present study were consistent with those of boonyarom et al . .
in the present study , the electrical stimulation in isotonic contraction was performed percutaneously during hindlimb unloading for 14 days .
the inhibition of overexpression of calpain 1 , calpain 2 , and murf-1 mrna in the es group may have contributed to the attenuation of muscle atrophy observed .
however , the preventive effect of electrical stimulation on muscle atrophy in the es group was not enough compared with the es + i m group .
have reported that the inhibition of the calpain pathway failed to suppress protein degradation in atrophied muscle by unloading .
in addition , the assembly and scaffolding of myofibrillar proteins such as nebulin , titin , and vinculin is known as calpains substrates , and the calpains are unable to degrade actin and myosin .
because the most abundant proteins in muscle fiber are actin and myosin , the inhibition of calpains in atrophied muscle may have only a very little effect on the cross - sectional area of muscle fiber . therefore , though this is just our speculation , the effect of electrical stimulation on muscle atrophy in the es group was likely not based on the diminished expression of calpains mrna , but that of murf-1 .
the combination of electrical stimulation and high - load isometric contraction in the es + i m group was more effective in preventing muscle atrophy than electrical stimulation in isotonic contraction in the es group .
although the expression of ubiquitinated proteins in the es group was of the same level as the hu group , the value in the es + i m group was significantly less than that in the hu group . in the es + i m group ,
there was inhibition of overexpression of cathepsin l and atrogin-1 mrna in addition to calpain 1 , calpain 2 , and murf-1 . collectively , these results were contributive to the enhanced effect of electrical stimulation on muscle atrophy . however , it is reported that cathepsins are unable to degrade myofibrillar proteins ; their major substrates are membrane proteins such as receptors , ligands , channels , and transporters . additionally , some studies have reported that , when lysosomal activity is inhibited , myofibrillar protein degradation rates are only slightly reduced [ 27 , 28 ] .
therefore , the major factor underlying the enhanced preventive effect on muscle atrophy in the es + i m group might not be diminished cathepsin l mrna expression .
many previous studies have indicated that protein degradation during unloading occurs principally through the ubiquitin - proteasome pathway [ 18 , 29 , 30 ] ; with respect to the ubiquitin - proteasome pathway in the es + i m group , not only overexpression of murf-1 mrna but also that of atrogin-1 was inhibited .
previous studies with murf-1 knockout mice have shown that the decrease in the muscle fiber cross - sectional area induced by hindlimb unloading and denervation were unable to prevent completely .
furthermore , bodine et al . compared atrogin-1 knockout and murf-1 knockout mice to show that the preventive effect on muscle atrophy is prominent in atrogin-1 knockout rather than in murf-1 knockout .
therefore , there is a possibility that the differences between the es and es + i m groups are due to whether overexpression of both atrogin-1 and murf-1 mrna was inhibited .
however , this is just speculation , so there is a need for further study to show the evidence supporting this speculation .
although electrical stimulation in isotonic contraction slightly attenuated muscle atrophy induced by hindlimb unloading , the combination of electrical stimulation and high - load isometric contraction inhibited increases in all 3 protein degradation pathways linked to muscle atrophy and enhanced the effect of electrical stimulation to prevent muscle atrophy .
electrical stimulation in isotonic contraction attenuated only murf-1 mrna overexpression , whereas the combination of electrical stimulation and high - load isometric contraction inhibited both atrogin-1 and murf-1 mrna overexpression .
the result of the electrical stimulation in isotonic contraction in this study is consistent with that of a previous study .
macpherson et al . investigated the effect of electrical stimulation in isotonic contraction on expression of the ubiquitin ligases in denervated muscle and showed that overexpression of murf-1 mrna is relatively more inhibited than that of atrogin-1 .
therefore , the findings of the present study suggest that when high - load isometric contraction is added to electrical stimulation , overexpression of not only murf-1 mrna but also atrogin-1 is inhibited during unloading . it is still unknown what the differences are between the roles of atrogin-1 and murf-1 in the ubiquitin - proteasome pathway , and this requires further study .
however , the combination of electrical stimulation and high - load isometric contraction is promising as an effective therapeutic intervention . | high - load isometric exercise is considered an effective countermeasure against muscle atrophy , but therapeutic electrical stimulation for muscle atrophy is often performed without loading . in the present study , we investigated the combined effectiveness of electrical stimulation and high - load isometric contraction in preventing muscle atrophy induced by hindlimb unloading .
electrical stimulation without loading resulted in slight attenuation of muscle atrophy .
moreover , combining electrical stimulation with high - load isometric contraction enhanced this effect . in electrical stimulation without loading , inhibition of the overexpression of calpain 1 , calpain 2 , and murf-1 mrna
was confirmed . on the other hand , in electrical stimulation with high - load isometric contraction , inhibition of the overexpression of cathepsin l and atrogin-1 mrna in addition to calpain 1 , calpain 2 , and murf-1 mrna was confirmed .
these findings suggest that the combination of electrical stimulation and high - load isometric contraction is effective as a countermeasure against muscle atrophy . |
venous ulcers are the most common form of leg ulcers which has a significant impact on quality of life and work productivity .
in addition , the costs associated with the long - term care of these chronic wounds are substantial
. conventional therapies such as dressings , surgical debridement , compression bandage and even skin grafting can not provide satisfactory healing since these treatments are not able to provide necessary growth factors that can modulate healing processes .
autologous platelet rich plasma ( prp ) is a safe , simple , affordable and less expensive procedure in the treatment of chronic ulcers with reportedly good results . since , it is an autologous method , it is biocompatible and safe .
the aim of the study was to evaluate the efficacy of platelet rich plasma in the management of chronic venous ulcers .
in the study , 12 patients with 17 ulcers were included with the following inclusion and exclusion criteria from january 2011 to june 2012 .
ulcers more than 6 weeks duration and patients who had received conventional therapies for at least 6 weeks .
patients with a bleeding disorder , uncontrolled sugar levels and ulcers with active infection and saphenofemoral incompetency were excluded .
procedure : patients were thoroughly examined and ulcer size ( length , breadth and depth ) was measured .
10 patients had perforator incompetency and 2 patients had superficial vein incompetency . under aseptic precautions 20 ml of venous blood was drawn and added to a test tube containing acid citrate dextrose in a ratio of 9:1 ( blood : acid citrate dextrose ) , centrifuged at 5000 rpm for 15 min to separate the red blood cells from the platelets and plasma . then the supernatant and the buffy coat composed of platelets and plasma was collected and centrifuged again at 2000 rpm for 5 - 10 min .
the bottom layer about 1.5 ml was taken and 10% calcium chloride was added ( 0.3 ml for 1 ml of prp ) .
the mean platelet count was 3.8 lakhs / cumm ( sd 0.95 ) and the mean final concentration of platelets in prp was 6.05 lakhs / cumm ( sd 1.25 ) . thus the activated prp was applied onto the wound after proper surgical debridement and was dressed with a non - absorbent dressing ( paraffin gauze ) .
this process was repeated once weekly for 6 weeks . at every week the ulcer area and volume was calculated and photographs were taken .
wound area was calculated using the formula for an ellipse : length width 0.7854 ( an ellipse is closer to a wound shape than a square or rectangle that would be described by simple length width ) .
the use of an ellipse for calculating wound measurement has been used in rcts in wound healing literature .
volume was calculated using the formula ( length width 0.7854 ) depth .
the treatment outcome was defined as a percentage change of the area and volume , which was calculated as initial measurement minus assessment day measurement divided by initial measurement .
ulcers more than 6 weeks duration and patients who had received conventional therapies for at least 6 weeks . patients with a bleeding disorder , uncontrolled sugar levels and ulcers with active infection and saphenofemoral incompetency were excluded .
procedure : patients were thoroughly examined and ulcer size ( length , breadth and depth ) was measured .
10 patients had perforator incompetency and 2 patients had superficial vein incompetency . under aseptic precautions 20 ml of venous blood was drawn and added to a test tube containing acid citrate dextrose in a ratio of 9:1 ( blood : acid citrate dextrose ) , centrifuged at 5000 rpm for 15 min to separate the red blood cells from the platelets and plasma .
then the supernatant and the buffy coat composed of platelets and plasma was collected and centrifuged again at 2000 rpm for 5 - 10 min .
the bottom layer about 1.5 ml was taken and 10% calcium chloride was added ( 0.3 ml for 1 ml of prp ) . the mean platelet count was 3.8 lakhs / cumm ( sd 0.95 ) and the mean final concentration of platelets in prp was 6.05 lakhs / cumm ( sd 1.25 ) . thus the activated prp was applied onto the wound after proper surgical debridement and was dressed with a non - absorbent dressing ( paraffin gauze ) .
this process was repeated once weekly for 6 weeks . at every week the ulcer area and volume was calculated and photographs were taken .
wound area was calculated using the formula for an ellipse : length width 0.7854 ( an ellipse is closer to a wound shape than a square or rectangle that would be described by simple length width ) .
the use of an ellipse for calculating wound measurement has been used in rcts in wound healing literature .
volume was calculated using the formula ( length width 0.7854 ) depth .
the treatment outcome was defined as a percentage change of the area and volume , which was calculated as initial measurement minus assessment day measurement divided by initial measurement .
the mean age of the patients was 33.5 years ( sd 9.82 ) . 6 ( 50% )
patients were in the age group 3040 years , 4 ( 34% ) between 20 years and 30 years , 1 ( 8% ) between 50 years and 60 years and 1 ( 8% )
< 20 years 10 ( 83.33% ) were males and 2 ( 16.66% ) were females .
the duration of ulcer ranged from 2 months to 1 year with a mean of 5.35 months .
the mean duration of the healing of the ulcers was in 5.1 weeks ( sd 3.1 ) .
100% improvement in the area of the ulcers was seen in 13 ( 76% ) [ table 1 ] .
100% improvement in volume of the ulcer was seen in 14 ( 82% ) [ table 2 ] .
the baseline mean area of the ulcer was 10.08 cm ( sd 6.91 ) and baseline volume was 6.45 cm ( sd 5.35 ) .
the final area of the ulcer at the end of 6 weeks was 1.13 cm ( sd 2.56 ) and final volume of the ulcer was 0.76 cm ( sd 1.91 ) . the mean percentage improvement in the area and volume of the ulcer was 94.7% ( sd 11.12 ) and 95.6% ( sd 10.19 ) respectively [ figures 1 and 2 ] .
there were no side effects and there was a decrease in pain associated with the ulcers .
five patients had undergone sclerotherapy and three patients had undergone surgery for varicose veins with little improvement in the healing of ulcers .
improvement of the area of the ulcer in percentage at the end of 6 sitting improvement of volume in percentage at the end of 6 sitting ( a ) a patient of venous ulcer of duration 3 months , ( b ) after one sitting of platelet rich plasma , ( c ) ulcer at 4 week and ( d ) ulcer being healed at 6 week a patient with venous ulcer of 2 months duration healed at 5 week requiring four sittings of platelet rich plasma
venous leg ulcers are responsible for more than half of lower extremity ulcerations , with overall prevalence ranging from 0.06% to 2% .
the most popular form of therapy for venous leg ulcers is virtually identical to the compression bandage introduced by unna in 1885 .
however , even though limb compression is considered to be standard care for venous leg ulcers , the use of lower - limb compression is not always feasible and successful .
prp is a volume of autologous plasma that has a platelet concentration above baseline i.e. , five times more than normal platelet counts .
prp enhances wound healing by promoting the healing process by seven growth factors present in it .
they are platelet derived growth factor ( , , ) , fibroblast growth factor , vascular endothelial growth factor , epidermal growth factor , transforming growth factor .
these growth factors are important in modulating mesenchymal cell recruitment , proliferation and extra - cellular matrix synthesis during the healing process . a study conducted by frykberg et al . on 49 patients with 65 non healing ulcers showed that 63 of 65 ulcers responded with reduction in area , volume and undermining of the ulcers in a mean of 2.8 weeks with 3.2 treatments .
the mean percentage of volume and area reduction of venous ulcers were 56.1% ( sd 35.2 ) and 43.1% ( sd 32.4 ) with a mean of 2.3 weeks treatment time .
in our study , the mean percentage of volume and area reduction was 95% ( sd 10.2 ) and 94.14% ( sd 11.18 ) with a mean of 5.1 weeks treatment .
, prp is found to be useful in enhancing the wound healing in chronic venous leg ulcers without any adverse events . since , there is no standardization of the procedure , more randomized control studies are needed to make a standard protocol for the preparation of prp . | background : venous ulcers are wounds that are thought to occur due to improper functioning of venous valves , usually of the legs .
they are the major cause of chronic wounds , occurring in 70% to 90% of chronic wound cases .
the treatment of venous ulcers also entails substantial costs .
autologous platelet rich plasma ( prp ) is a simple office based procedure which helps in enhancing the wound healing by releasing many growth factors like platelet derived growth factors , fibroblast derived growth factors and epidermal growth factors.aim:to study the efficacy of autologous platelet rich plasma in the management of chronic venous ulcer.methodology:12 patients with 17 venous ulcers were treated with prp and treatment outcome was measured by percentage of improvement in area and volume of the ulcer.results:12 patients with 17 ulcers were treated with prp .
the mean age of the patients was 33.5 years ( sd 9.82 ) .
10 were males and 2 were females .
the mean duration of the healing of the ulcers was in 5.1 weeks ( sd 3.1 ) .
the mean percentage improvement in the area and volume of the ulcer was 94.7% ( sd 11.12 ) and 95.6% ( sd 10.19 ) respectively.conclusions:prp is safe , simple and effective procedure in treating chronic venous ulcers |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.