reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 2 380 | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 357
values | new_affinity stringlengths 3 193 ⌀ |
|---|---|---|---|---|---|---|---|---|---|
Yu Mao, Jimmy Gu, Dingran Chang, Lei Wang, Lili Yao, Qihui Ma, Zhaofeng Luo, Hao Qu, Yingfu Li, Lei Zheng, Evolution of a highly functional circular DNA aptamer in serum, Nucleic Acids Research, Volume 48, Issue 19, 4 November 2020, Pages 10680–10690Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CTBA4 (ID# 8059) | Thrombin | ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTGGCTGACAATACTCGTTTTTGGTGTCTCGGAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.15 nM |
Maradani, B.S., Parameswaran, S. & Subramanian, K. Development and characterization of DNA aptamer against Retinoblastoma by Cell-SELEX. Sci Rep 12, 16178 (2022). https://doi.org/10.1038/s41598-022-20660-3https://www.nature.com/articles/s41598-022-20660-3#citeasMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | VRF-CSRB-01 (ID# 8234) | Retinoblastoma (RB) (Weri-RB1 cells) | TAGGGAAGAGAAGGACATATGATTCAAAGTAACTCTGTCACAGTACAATAGATTCTCATTATCATTGACTAGTACATGACCACTTGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 49.41\u2009±\u20097.87 nM |
Shangguan et al. ƒ??Aptamers evolved from live cells as effective molecular probes for cancer study.ƒ? Proceedings of the National Academy of Sciences of the United States of America, 103 (2006): 11838-43. Sequence was given in: Shangguan et al. "Optimization and Modifications of Aptamers Selected from Live Cancer Cell Lines." Chem. Biochem., 8, (2007): 603-6. Target protein identification: D Shangguan et al. Cell-specific aptamer probes for membrane protein elucidation in cancer cells. J. Proteome Res. 7:2133-2139.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CCRF-CEM (sgc8) (ID# 7479) | Acute lymphoblastic leukemia (CCRF-CEM) | ATACCAGCTTATTCAATTAGTCACACTTAGAGTTCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Cells | null | null | 0.8 nM |
Cao et al. "Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus." Nucleic Acids Research, 37(2009): 1-8Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Staphylococcus aureus (SA23) (ID# 7562) | Staphylococcus aureus | GCAATGGTACGGTACTTCCGGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCACAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Cells | null | null | 61.5 nM |
Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Flavin Mononucleotide (AR5) (ID# 7599) | FMN | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUAGGAUAUGCAUGAUGCAGAAGGACGUCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Haraguchi, Y. Et al. Characterization of RNA aptamers against SRP19 protein having sequences different from SRP RNA. Nucleic Acids Symposium Series, 2009, 53, 265-266.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Signal Recognition Particle 19 (SRP19) (ID# 7817) | Signal Recognition Particle 19 (SRP19) | GGGAGACAAGAAUAAACGCUCAACACAGAACGCGGUCCCCACACAGGACAGGAGCCAGCCCCGGUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.6 nM |
Hye-Min Woo. Single-stranded DNA aptamer that specifically binds to the influenza Virus NS1 protein suppresses interferon antagonismMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Influenza NS1 protein (ID# 7868) | NS1 | GCAATGGTACGGTACTTCCGCGGTCCGGGGTGGGTGGGTGGTGGGGGGTGCGGGGGGGCGGCCGCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 19.91 nM |
Mitsuma et al. Promising New Assays and Technologies for the Diagnosis and Management of Infectious Diseases(Clinical Infectious Diseases)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Staphylococcus aureus (SA20) (ID# 7869) | Staphylococcus aureus (S.Aureus) | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Cells | null | null | 70.86 nM |
Woo, H., Kim, K., Lee, J., Shim, H., Cho, S., Lee, W., Ko, H., Keum, Y., Kim, S., Pathinayake, P., Kim, C., and Jeong, Y. "Single-stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism." Antiviral Research 100.2(2013): 337-345.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | NS-1 Aptamer (ID# 7878) | Influenza A virus (IAV) non-stuctural protein (NS1) | GCAATGGTACGGTACTTCCGCGGTCCGGGGTGGGTGGGTGGTGGGGGGTGCGGGGGGGCGGCCGCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 18.91 nM |
Priyanka, M. S., et al. "Nanobioprobe mediated DNA aptamers for explosive detection." Chem. Commun., 2014, 50, 1080 - 1082.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Nanobioprobe mediated DNA aptamer (ID# 7894) | Trinitrotoluene (TNT) | ATACCAGCTTATTCAATTGGGACAGTCGATGGGACGGCAAACGGACCAGTGTGTGGCGGTAGATAGTAAGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Other | null | null | 100 nM |
Seung Ryul Han & Seong-Wook Lee, (2014). In vitro selection of RNA aptamer specific to Staphylococcus aureus. Ann Microbiol 64:883-885 DOI 10.1007/s13213-013-0720-zMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Staphylococcus Aureus RNA Aptamer (ID# 7945) | Staphylococcus Aureus | GGGAGAGCGGAAGCGUGCUGGGCCGGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAUCAUAACCCAGAGGUCGAUGGAUCCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | See Reference nM |
Cho, S. et al. "Novel system for detecting SARS coronavirus nucleocapsid protein using an ssDNA aptamer". Journal of Bioscience and Bioengineering, 112(2011):535-540.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | aptamer 1 (ID# 8019) | SARS-CoV nucleocapsid, SARS-CoV-2 nucleocapsid | GCAATGGTACGGTACTTCCGGATGCGGAAACTGGCTAATTGGTGAGGCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.93±0.30 nM |
Sattari R, Palizban A, Khanahmad H. Single-Strand DNA-Like Oligonucleotide Aptamer Against Proprotein Convertase Subtilisin/Kexin 9 Using CE-SELEX: PCSK9 Targeting Selection. Cardiovasc Drugs Ther. 2020 Aug;34(4):475-485. doi: 10.1007/s10557-020-06986-y. PMID: 32415571.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AP-1 (ID# 8111) | Proprotein Convertase Subtilisin/Kexin 9 | ATACCAGCTTATTCAATTGACCCGTTTCGTTCCCTCTGGGAAGTTTAGCCCAGTTGCCTGGGCGATACCAAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 294 nM |
Li, K., Qi, L., Gao, L. M., Shi, M., Li, J., Liu, Z. W., & Zhao, L. (2019). Selection and preliminary application of a single stranded DNA aptamer targeting colorectal cancer serum. RSC Advances, 9(66), 38867–38876. https://doi.org/10.1039/c9ra04777hMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Seq-2 (ID# 8189) | Unknown tumor marker - colorectal cancer | CTATAGCAATGGTACGGTACTTCCTAACTCGTCCCTACCGAGCCTCTCTCTGGTCCTTGCAACTCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 11.31 nM |
Hoffman, H., et al. "Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair." RNA Journal, 3 (1997): 1289-1300.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Nickel (N1) (ID# 7504) | Nickel | GGGAGAGGAUACUACACGUGGAAAAACCAACAAAUUGGGAAAAAUGUUAAGGGUCCACUUCAUGCCAUUGCAUGUAGCAGAAGCUUCCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 800 nM |
Graham JC, Zarbl H (2012) Use of Cell-SELEX to Generate DNA Aptamers as Molecular Probes of HPV-Associated Cervical Cancer Cells. PLoS ONE 7(4): e36103. doi:10.1371/journal.pone.0036103Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HPV-HF cell line (14) (ID# 7700) | HPV-nontumorigenic HF cell line | ATACCAGCTTATTCAATTGGGCGGGGAGTAGGGAGAGGGGTTTCCATCGGCGACAGAGGAGTTATGTGTGTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Cells | null | null | 7.1 nM |
Yang, M. et al. "Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery." Journal of Hematology & Oncology 2014, 7:5.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | JH19 (ID# 7880) | NB4 AML cell line | GACGCTTACTCAGGTGTGACTCGAGGTGTGACTCGATCTGTGGGGGTTGGGGGGTGGTTTTTCGGAACGAAGGACGCAGATGAAGTCTC | https://www.aptagen.com/apta-index/ | Cells | null | null | 7.57 nM |
Kim et al. "Generation of Antagonistic RNA Aptamers Specific to Proinflammatory Cytokine Interleukin-32." Bulletin of the Korean Chemical Society, 31 (2010): 3561-3566.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Interleukin 32 (IL-32) (AC3-3) (ID# 7524) | Interleukin-32 (IL-32) | GGGUUCACUGCAGACUUGACGAAGCUUCCGGAGAGAAGGGUCAAAGUUGUGCGGGAGUGUGUUGUGGAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 78 nM |
Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Cyclic Guanosine Monophosphate (AR2) (ID# 7588) | cGMP | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCCUGCGAUGCAGAAAGGUGCUGACGACACAUCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Seetharaman et al. "Immbolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Cyclic Adenosine Monophosphate (AR4) (ID# 7591) | cAMP | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUGUGGAAACAGACGUGGCACAUGACUACGUCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Cyclic Cytidine Monophosphate (AR3) (ID# 7592) | cCMP | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUUAGGGCCAAGUGUGGUGAAAGACACACUCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Minyong Li, Na Lin, Zhen Huang, Lupei Du, Craig Altier, Hao Fang and Binghe Wang. "Selecting Aptamers for a Glycoprotein through the Incorporation of the Boronic Acid Moiety." J. Am. Chem. Soc., 2008, 130 (38), pp 12636ƒ??12638.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Fibrinogen (85A/Ap90) (ID# 7609) | Fibrinogen | CCTTCGTTGTCTGCCTTCGTAGGACCGCAGACATCGACGCAGGGAAATTCCGCAAGTCCAGCCAAATGCCACCCTTCAGAATTCGCACCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 63.8 nM |
Park et al. "Selection of an Antiviral RNA Aptamer Against Hemagglutinin of the Subtype H5 Avian Influenza Virus." Nucleic Acid Therapeutics, 21(2011): 395-402.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | H5 Avian Influenza Virus (HAS15-5) (ID# 7617) | Hemagglutinin of the Subtype H5 Avian Influenza Virus | GGGUUCACUGCAGACUUGACGAAGCUUACAAACAAGAGCAAAAAGGGAGUUGACGUAGACUGUGCGGAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Hyeon, J. et al. Development of RNA Aptamers for Detection of Salmonellas Enteritidis. Journal of Microbiological Methods, 89(2012), 79-82.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Salmonella Enteritidis (S25) (ID# 7674) | Salmonella Enteritidis | GGGUUCACUGCAGACUUGACGAAGCUUGAGAGAUGCCCCCUGAUGUGCAUUCUUGUUGUGUUGCGGCAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Cells | null | null | Not Mentioned in Database |
D. Proske et al. A Y2 receptor mimetic aptamer directed against neuropeptide Y. J. Biol. Chem. 277(2002):11416-11422.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Neuropeptide Y (DP3) (ID# 7806) | Neuropeptide Y (NPY) | GGGAGAAAGGGAAGCUUGAGCAGCAGGAGGGCCGGCGUUAGGGUUAGCGAGCCGAUUGAAAGAAGAAGGAACGAGCGUACGGAUCCGAUC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 370 nM |
Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704dMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 1G8-14 (ID# 7947) | Ebola Virus VP35 | GGGAGACAAGAAUAAACGCUCAAGGCAUUUCUGCUAGUCUGGUUGUAAGAUAUUCAACACGUGAGUUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.7 nM |
Yu, Qing et al. “Generation and characterization of aptamers against grass carp reovirus infection for the development of rapid detection assay.” Journal of fish diseases vol. 44,1 (2021): 33-44. doi:10.1111/jfd.13265Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GVI-1 (ID# 8081) | GCRV-infected CIK | GTCTGAAGTAGACGCAGGAGGGGTGTAGCTCGTTATGATTCGGACAAGACTTACCTTGCGCCTCTGGGATAGTCACACCTGAGTAAGCGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 220.86 nM |
Yu, Qing et al. “Generation and characterization of aptamers against grass carp reovirus infection for the development of rapid detection assay.” Journal of fish diseases vol. 44,1 (2021): 33-44. doi:10.1111/jfd.13265Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GVI-7 (ID# 8083) | GCRV-infected CIK | GTCTGAAGTAGACGCAGGAGTGAACCCACCTCAGGGCATCTTACATTTCTTCTAAGTTGTTACCATGTTTAGTCACACCTGAGTAAGCGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 176.63 nM |
Discovery of indole-modified aptamers for highly specific recognition of protein glycoformsAlex M. Yoshikawa, Alexandra Rangel, Trevor Feagin, Elizabeth M. Chun, Leighton Wan, Anping Li, Leonhard Moekl, Michael Eisenstein, Sharon Pitteri, H. Tom SohbioRxiv 2021.03.13.435263; doi: https://doi.org/10.1101/2021.03.13.435263Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | i-6 (ID# 8154) | Glycan modification | AGCAGCACAGAGGTCAGATGATCTCGTGTGTTTGGTTTTAGATTTTTGGAAATTATGATTCCTGTTGGTCCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Other | null | null | 29.5 µM |
Tabb, Joel S., et al. “An Antigen-Targeting Assay for Lyme Disease: Combining Aptamers and SERS to Detect the OSPA Protein.” Nanomedicine: Nanotechnology, Biology and Medicine, vol. 41, 2022, p. 102528., https://doi.org/10.1016/j.nano.2022.102528.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ion-OspA-59 (ID# 8239) | Outer Surface Protein A (OspA) | TGCTTTTCGTGCGCGCATAAAATACCTTGATACTGTGCCGTATGAAAGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.18 nM |
Meli, M., et al. "Adenine-aptamer complexes: a bipartite RNA site that binds the adenine nucleic base." Journal of Biological Chemistry, 227 (2001): 2104-2111.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Adenine (12E4) (ID# 7507) | Adenine | GGGAGAGGAUACUACACGUGAUAGGACGAUUAUCGAAAAUCACCAGAUUGGACCCUGGUUAACGAUCCAUUGCAUGUAGCAGAAGCUUCCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 10 nM |
Chen, et al. "Inhibitory RNA Ligand to Reverse Transcriptase from Feline Immunodeficiency Virus." Journal of Biochemistry, 35(1996): 6923-6930.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Feline Immunodeficiency Virus (F1a) (ID# 7573) | Feline Immunodeficiency Virus (FIV) | GGGAGGAUAUUUUCUCAGACCGUAAGUACCGAAUGUGCUUUUGGCCGAUUUUUGGCCCCUGCAGUUGCAGCAUCGUGAACUAGGAUCCGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.9 nM |
Biroccio et al. "Selection of RNA Aptamers That Are Specific and High-Affinity Ligands of the Hepatitis C Virus RNA-Dependent RNA Polymerase." J. Virol>, 76 (2002):3688-3696.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Hepatitis C Virus Dependent RNA Polymerase (B.2) (ID# 7571) | Hepatitis C Virus Dependent RNA Polymerase | GGGAUGCUUCGGCAUCCCCGAAGCCGCUAUGGACCAGUGGCGCGGCUUCGGCCCGACGGAGUGGUACCGCUUCGGCGGUACGUAAGCUUGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.5 nM |
Hwang et al. "5'-Triphosphate-RNA-independent activation of RIG-1 via RNA aptamer with enhanced antiviral activity." Nucleic Acids Research 40(2011): 2724 - 2733Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | RIG-I (CL9) (ID# 7610) | RIG-I | GGGAGAGCGGAAGCGUGCUGGGCCACCAUCCGUAACUAGCUAAUACUUGUUAUCUUUUUAUUUUCAUAACCCAGAGGUCGAUGGAUCCCCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 37.2 nM |
Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704dMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 2F11-14 (ID# 7946) | Ebola Virus VP35 | GGGAGACAAGAAUAAACGCUCAACGUUCAGUAUAACAGUCCGAGUCUAACACACAAUGGGACACUGAAUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.1 nM |
Shum, K. T., & Tanner, J. A. (2008). Differential Inhibitory Activities and Stabilisation of DNA Aptamers against the SARS Coronavirus Helicase. ChemBioChem, 9(18), 3037-3045. doi:10.1002/cbic.200800491Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SARS-CoV-1 3′-inverted Thymidine Aptamer NG8 (ID# 8029) | SARS-CoV-1 Helicase | CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTCATGTTGGTAGTTGGCTTGTGTTCGTGTGTTAAGCTTTCAGAGAGGATCCTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 26.8 nM |
Huang, M., Li, T., Xu, Y., Wei, X., Song, J., Lin, B., … Yang, C. J. (2020). Activation of Aptamers with Gain‐of‐Function by Small‐Molecule‐Clipping of Intramolecular Motifs. Angewandte Chemie International Edition. doi:10.1002/anie.202013570Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | XMU3 (ID# 8092) | epithelial cell adhesion molecule (EpCAM) | TCCAGCACTCCACGCATAACCCCGTCCTCGGAAAGAGCGCGGGCCTGGGACGGCTACTGCCCGGATTTATGTGTTATGCGTGCGACGGTGAA | https://www.aptagen.com/apta-index/ | Cells | null | null | 9.3 ± 1.3 nM |
Mannironi, C., et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Dopamine (dopa2/c.1) (ID# 7506) | Dopamine | GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.6 µM |
N. Li et al. "Inhibition of Cell Proliferation by an Anti-EGFR Aptamer." PLoS One 6(2011): e20299.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Anti-EGFR (E07) (ID# 7710) | hEGFR and mEGFR | GGCGCUCCGACCUUAGUCUCUGUGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAACCGUGUAGCACAGCAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.4 nM |
N. Li et al. "Inhibition of Cell Proliferation by an Anti-EGFR Aptamer." PLoS One 6(2011): e20299.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Anti-EGFR (E03) (ID# 7723) | mEGFR and hEGFR | GGCGCUCCGACCUUAGUCUCUGUGCUAGUAUAUCGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAACCGUGUAGCACAGCAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 29 nM |
P Nadal et al. DNA aptamers against the Lup an 1 food allergen. PLoS One 7(2012):e35253.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lup an 1 allergen, ??-Conglutin (#40) (ID# 7784) | ??-Conglutin | AGCTGACACAGCAGGTTGGTGGGGGTGGCTTCCAGTTGGGTTGACAATACGTAGGGACACGAAGTCCAACCACGAGTCGAGCAATCTCGAAAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 360 nM |
Chang, T., Blank, M., Janardhanan, P., Singh, B., Mello, C., Blind, M., Cai, S. "In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin." Biochemical and Biophysical Research Communications 396(2010): 854-860.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Botulinum neurotoxin type A (BoNT A) Aptamer (S132B-C22) (ID# 7888) | BoNT A Light Chain | GGGAGGAGGAGAGATGTGAACTTGACAGCGTGCCTAGAAGTCCAAGCTTAAATAACCACGCTCGACAAGCAGAAACTCTACACTGGACTGGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 87 nM |
Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HA12-16 (ID# 7904) | gHA1 protein | GGGUUCACUGCAGACUUGACGAAGCUUGCUUGACGGAGAUCAAGGGCGAGUCUCAUACCAAGUUGUGGGGAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Protein | null | null | "- nM (reported value)", |
Liu, Zhixia, et al. "Evolved polymerases facilitate selection of fully 2'-OMe-modified aptamers" Royal Society of Chemistry, 8 (2017): 8179-8182Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 2mHNE-5 (ID# 8031) | HNE | CCCUGUUCGCUAUCCCCCAUCCCCCGAUUGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 480 nM |
Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Theophylline (AR6) (ID# 7598) | Theophylline | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Kwon, H. et al. "An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells." PLOS One 2014, 9 1-9.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HA 12-16 (ID# 7893) | HA protein (gHA1) | GGGTTCACTGCAGACTTGACGAAGCTTGCTTGACGGAGATCAAGGGCGAGTCTCATACCAAGTTGATGGGGAATGGATCCACATCTACGAATTC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HA12-16 (ID# 7944) | Avian Influenza Glycoprotein Hemagglutinin (gHA1) | GGGUUCACUGCAGACUUGACGAAGCUUGCUUGACGGAGAUCAAGGGCGAGUCUCAUACCAAGUUGAUGGGGAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Protein | null | null | See Source (Non-Kd) nM |
Ciesiolka et al., "Selection of an RNA domain that binds Zn2+." Journal of RNA, 1(1995): 538-550.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Zinc (ID# 7550) | Zinc | GGGAGAGGAUACUACUGUCAUACGUUAGGCUGUAGGCGAGGUGAAAUGAGCGGUAAUAGCCUCAGCGUAGCAUAUGCAUGAAUUCGAAGCUUCGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.2 mM |
Robertson and Ellington. "In vitro selection of nucleoprotein enzymes." Nature Biotechnology, 19(2001): 650-655. Hesselberth et al. "Simultaneous detection of diverse analytes with an aptazyme ligase array." Analytical Biochemistry, 312(2003): 106-112.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Hen Egg White Lysozyme (cyt7-2) (ID# 7650) | Hen Egg White Lysozyme | GGACCUCGGCGAAAGCUAACGUCUCAUGGCUAAAUUGCCAUGUUGCUACAAAUGAUAUGACUAGAGAGGUUAGGUGCCUCGUGAUGUCCAGUCGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.5 µM |
Vaish et al. "Monitoring post-translational modifications of proteins with allosteric ribozymes." Nature Biotechnology, 20(2002): 810-815.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Phosphorylated ERK2 (ID# 7654) | Phosphorylated ERK2 | GGCGUGACCUGAUGAGUCACGCAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUGUGUUACGAAACGUUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Zhou L, Wang S, Yu Q, et al. Characterization of Novel Aptamers Specifically Directed to Red-Spotted Grouper Nervous Necrosis Virus (RGNNV)-Infected Cells for Mediating Targeted siRNA Delivery. Front Microbiol. 2020;11:660. Published 2020 Apr 30. doi:10.3389/fmicb.2020.00660Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GBN2 (ID# 8110) | Nervous necrosis virus (NNV) | GACGCTTACTCAGGTGTGACTCGCTCCACTGGTCCGGATCACTTGATATGTCGTGCGGCAGTCGTTTACATCCCGAAGGACGCAGATGAAGTCTC | https://www.aptagen.com/apta-index/ | Other | null | null | 27.96 nM |
Mann, Doerthe, et al. "In vitro selection of DNA aptamers binding ethanolamine." Biochemical and Biophysical Research Communication, 338 (2005): 1928-1934. Tradmarked in patent, "New DNA aptamers specific for compunds that contain the ethylamino group, useful for diagnosis, prevention and treatment of ethanolaminosis, schizophrenia and neurodegeneration (Original document: DE 102005052275 (B4))"Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ethanolamine (14.3) (ID# 7456) | Ethanolamine | ATACCAGCTTATTCAATTTGAGGCGGGTGGGTGGGTTGAATATGCTGATTACCCCATCGGAGAACGTTAAGGCGCTTCAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 6 nM |
Stoltenburg et al. "FluMag-SELEX as an advantageous method for DNA aptamer selection." Analytical and Bioanalytical Chemistry, 383 (2005): 83-91.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Streptavidin (31) (ID# 7471) | Streptavidin | ATACCAGCTTATTCAATTCTATACTCCACTTTGCTATTTCTCGGTTCCTTCACGCGCCGATCGCAGGCTGATGAATTGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 56.7 nM |
Blank et al. "Systematic Evolution of a DNA Aptamer Binding to Rat Brain Tumor Microvessels." The Journal of Biological Chemistry, >b>276(2001): 16464-16468.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | YPEN-1 Endothelial Cells (III.1) (ID# 7605) | YPEN-1 Endothelial Cells | ATACCAGCTTATTCAATTAGGCGGTGCATTGTGGTTGGTAGTATACATGAGGTTTGGTTGAGACTAGTCGCAAGATATAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Cells | null | null | Not Mentioned in Database |
J. O. McNamara II et al.. Multivalent 4-1BB binding aptamers costimulate CD8+ T cells and inhibit tumor growth in mice. J. Clin. Invest. 118(2008):376-386.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | 4-1BB ligand (M12-23) (ID# 7724) | 4-1BB ligand on CD8+ T Cells | GGGAGAGAGGAAGAGGGAUGGGCGACCGAACGUGCCCUUCAAAGCCGUUCACUAACCAGUGGCAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 40 nM |
Mckeague et al. Screening and Initial Binding Assessment of Fumonisin B1 Aptamers: International Journal of Molecular SciencesMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Fumonsin B1 Toxin (ID# 7870) | Fumonsin Toxin B1 | ATACCAGCTTATTCAATTAATCGCATTACCTTATACCAGCTTATTCAATTACGTCTGCACATACCAGCTTATTCAATTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 100 nM |
Geiger, Albert, et al. "RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity." Nucleic Acid Research, 24 (1996): 1029-1036.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | L-Arginine (ag.06) (ID# 7460) | L-Arginine | GGAGCUCAGCCUUCACUGCAUGAUAAACCGAUGCUGGGCGAUUCUCCUGAAGUAGGGGAAGAGUUGUCAUGUAUGGGGGCACCACGGUCGGAUCCUG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 330 nM |
Lebriska and Maher. "Selection and Characterization of an RNA Decoy for Transcription Factor NF- B." Journal of Biochemistry, 38(1999): 3168-3174.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | NF-kappa B (Aptamer 3) (ID# 7544) | NF-kappa B | GGGAUAUCCUCGAGCAUAAGAAACAAGAUAGAUCCUGAAACUGUUUUAAGGUUGGCCGAUCUUCUGCUCGAGAAUGCAUGAAGCGUUCCAUAUUUUU | https://www.aptagen.com/apta-index/ | Protein | null | null | 1 nM |
Fan et al. "Aptamer from whole-bacterium SELEX as new theraputic reagent against virulent Mycobacterium Tuberculosis." Biochem. Bioph. Res. Co., 357, (2007): 743-748. Fan et al. "Aptamer Inhibits Mycobacterium Tuberculosis (H37Rv) Invasion of Macrophage." Mol. Biol. Rep., 39, (2012): 2157-2162.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Mycobacterium tuberculosis (strain H37Rv) (aptamer NK2) (ID# 7788) | Virulent mycobacterium tuberculosis (H37Rv) | GCGGGATCCTATGACGCATTGACCCACAACACACTACTGTCGCTCGGTTCGAACTTCGTGCGACTGTTCCCTATAGTGAGTCGTATTAGAATTCCGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 31 nM |
Yu, Qing et al. “Generation and characterization of aptamers against grass carp reovirus infection for the development of rapid detection assay.” Journal of fish diseases vol. 44,1 (2021): 33-44. doi:10.1111/jfd.13265Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GVI-11 (ID# 8084) | GCRV-infected CIK | GTCTGAAGTAGACGCAGGAGTCCGTCGGTTCGCCTTGCGAGTGCACGCCGCCAGCCGTTACATAAAGTCTGCCCACTAGTCACACCTGAGTAAGCGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 278.66 nM |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Co2+ (AR1) (ID# 7589) | Co2+ | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~100 µM |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Cd2+ (AR1) (ID# 7600) | Cd2+ | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~100 µM |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Ni2+ (AR1) (ID# 7601) | Ni2+ | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~100 µM |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Zn2+ (AR1) (ID# 7602) | Zn2+ | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~100 µM |
Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Mn2+ (AR1) (ID# 7603) | Mn2+ | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~1 mM |
Kang, H. (2009). Isolation of RNA aptamers targeting Her-2-overexpressing breast cancer cells using cell-selex. Bull. Korean Chem. Soc., 30(8), 182-1831.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HER-2 (S6) (ID# 7670) | HER-2 (SK-BR-3 cell line) | GGGAGAUACCAGCUUAUUCAAUUUGGAUGGGGAGAUCCGUUGAGUAAGCGGGCGUGUCUCUCUGCCGCCUUGCUAUGGGGAGAUAGUAAGUGCAAUCU | https://www.aptagen.com/apta-index/ | Cells | null | null | 94.6 nM |
Stoltenburg R, Nikolaus N, Strehlitz B.(2012) Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics. J Anal Methods Chem. 2012:doi:10.1155/2012/415697Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Kanamycin A (#13_82) (ID# 7862) | Kanamycin A | ATACCAGCTTATTCAATTCAGGGCGGTATGAGGCTCGATCAAGGTCGGAGCGAGAATTTTTTCGCGGAGTCGGCTGGATCAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5.1 nM |
Gal, S., et al. "Selection of a RNA aptamer that binds to human activated protein C and inhibits its protease function." European Journal of Biochemistry, 252(1998): 553-562.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Activated Protein C (APC 99) (ID# 7539) | Human Activated Protein C | GUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Ferguson et al. "A novel strategy for selection of allosteric ribozymes yields RiboReporter TM sensors for caffeine and aspartame." Nucleic Acids Research, 32(2004): 1756-1766.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Caffeine (S2.caf.D11) (ID# 7651) | Caffeine | GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCGCGAAACGGUGAAAGCCGUAGGUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Ferguson et al. "A novel strategy for selection of allosteric ribozymes yields RiboReporter TM sensors for caffeine and aspartame." Nucleic Acids Research, 32(2004): 1756-1766.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Aspartame (ID# 7652) | Aspartame | GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGCGGUGCUAGUUAGUUGCAGUUUCGGUUGUUACGCGAAACGGUGAAAGCCGUAGGUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Prabu, S. S., Ch’ng, E. S., Woon, P. Y., Chen, J.-H., Tang, T.-H., & Citartan, M. (2020). Unravelling the diagnostic and therapeutic potentialities of a novel RNA aptamer isolated against human pituitary tumour transforming gene 1 (PTTG1) protein. Analytica Chimica Acta. doi:10.1016/j.aca.2020.09.038Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | SECURA-3 (ID# 8082) | Pituitary tumour transforming gene 1 (PTTG1) | GGAGCUCAGCCUUCACUGCGAUCACCGUGUCGGUGGCUAGUCGAUGUAUCCCGAUCACCAUUGGGGGCAAGUUUAGACAGGCACCACGGUCGGAUCCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 16.41 ± 6.4 nM |
Kato, T., et al. "In vitro selection of DNA aptamers which bind to cholic acid." Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression, 1493 (2000):Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cholic Acid (9) (ID# 7505) | Cholic Acid | GTACCAGCTTATTCAATTACCGCGAAGAAGTGTCATTGTTTTGGAGATTCGAAGCGCTGTACACAGGTAATGAAGCCTTCTAAGATAGTATGTTCATCAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 50 pM |
Kim, et al. "Arsenic Removal from Vietnamese Groundwater Using the Arsenic-Binding DNA Aptamer." Environ. Sci. Technol., 43 (2009): 9335-9340. Wu et al. "Ultrasensitive Aptamer Biosensor for Arsenic(III) Detection in Aqueous Solution Based on Surfactant-Induced Aggregation of Gold Particles." Analyst, 137 (2012): 4171-4178.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Arsenic(III) (Ars-3) (ID# 7825) | Arsenic(III) | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4.95 nM |
Tickner, Zachary J et al. “Selection of High-Affinity RNA Aptamers That Distinguish between Doxycycline and Tetracycline.” Biochemistry vol. 59,37 (2020): 3473-3486. doi:10.1021/acs.biochem.0c00586Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | P2MC (ID# 8117) | Doxycycline | GGGAGACCGCTTAAGCTTAAAGGAGCGGTTACGAATGCGATGACTTAGGTACCATTGCACTACGGTACCTAAACAGTTCCTTTGGATCCGAATTCGCCGC | https://www.aptagen.com/apta-index/ | Other | null | null | 0.780 ± 1.76 nM |
Saito, Takesh et al. "Generation of Inhibitory DNA Aptamers Against Human Hepatocyte Growth Factor." DNA and Cell Biology, 24 (2005): 624-633.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HGF (H38-15) (ID# 7464) | Human Hepatocyte Growth Factor | AGATGCCTGTCCAGCATCGAGCGCCAGCTTTGCTGATGGGTGGCCACCCTTGCCCTGGGTTTGAATTTCGATCCTATCGGTAGCTAGACTGCTTTGTCCTCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 19 nM |
Masud, M, et al. "Sialyllactose-binding modified DNA aptamer bearing additional functionality by SELEX." Bioorganic & Medicinal Chemistry, 12 (2004): 1111-1120.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Sialyllactose (Sl-11) (ID# 7501) | Sialyllactose | GTACGAATTCACGAGGTTGCCAGCGGGGCCAGCCACTTCTGTCAGTGAATTCCTGCTCGTATATCTACTCGCCCGCCTGCGAGCATGGAGTCGGATCCTCTA | https://www.aptagen.com/apta-index/ | Other | null | null | 4.9 µM |
A Okazawa, A Kobayashi, et al. (2000) In vitro selection of hematoporphyrin binding DNA aptamers. Bioorg Med Chem Lett. 10:2653-2656.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Hematoporphyrin IX (ID# 7503) | Hematoporphyrin IX (HPIX) | TAGGGAATTCGTCGACGGATCCCAATGGGGTCGGGCGGGCCGGGTGTCATGGTGGACGGAGATGGGACGTAGAGGGCGGTCTGCAGGTCGACGCATGCGCCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.6 µM |
Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Trypanosoma cruzi-Thrombospondin Parasite Receptor (T6) (ID# 7568) | Trypanosoma cruzi-Thrombospondin Parasite Receptor | ACCGAGUCCAGAAGCUUGUAGUACUCAAUACUCAAGCAAGCCCAGCCCUACCAACCCCGGAGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 400 nM |
Morse, Daniel. "Direct selection of RNA beacon aptamers." Biochemical and Biophysical Research Communications, 359 (2007): 94ƒ??101.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | RNA Tobramycin Molecular Beacon (BA 14-2) (ID# 7462) | Tobramycin | GGAAUGGAUCCACAUCUACGAAGGCUUUGAAGGUGAGACCGUGCAAAUGAGGAUGGUGUGGAUGAUUAGGGUUGUCGGUUUUCACUGCAGACUUGACGAAGCUU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 16 µM |
Majerfeld and Yarus. "A diminutive and specific RNA binding site for L-tryptophan." Nucleic Acids Research, 33(2005): 5482-5493.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | L-tryptophan(Trp 70-727) (ID# 7590) | L-tryptophan | GGGAUCCUAAGCUCUAUCGGCUGGACGACGGGGACGCCACUGGACUAGGUAAGCCAGGACCGUACGUCGGGAGCCGUCAGAAUAAAAGCGGCCUAGCGAUCGAU | https://www.aptagen.com/apta-index/ | Protein | null | null | 15 nM |
N Orito, Y Kikuchi, et al. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection. J. Phys. Conf. Ser. 352(2012): 012042. doi:10.1088/1742-6596/352/1/012042.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | C-Reactive Protein (CRP1-1) (ID# 7818) | C-Reactive Protein (CRP) | GGGCGAAUUCGGGACUUCGAUCCGUAGUACCCACCAGGCAUACACCAGCACGCGGAGCCAAGGAAAAAUAGUAAACUAGCACUCAGUGCUCGUAUGCGGAAGCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.25 nM |
Weill L., Louis D., and Sargueil B., 2004.Selection and Evolution of NTP-Specific Aptamers. Nucleic Acids Research, 2004 Vol. 32 No. 17, 5045-5058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP C32 (ID# 7925) | ATP | GGUUGGCAGCAGAAGAUAGCAGUACACGGGAGCACUACCAUAAAGAAUGAUGAGUGCACUACAAGCGAGUUAUCUCCUUGAUGUCGGUCAAGGGAGGGAUCCUA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 27 µM |
Fukusaki E, Kobayashi A, et al. (2000) DNA aptamers that bind to chitin. Bioorg. Med. Chem. Lett. 10:423-425.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Chitin (Chi#52) (ID# 7844) | Chitin | TAGGGAATTCGTCGACGGATCCCCTAAGGGGGGACTCAGCATTTTGTGCGGGCGGCGCTAACACAATCAGATAGAGCGGGGTTCTCCAGGTCGACGCATGCGCCG | https://www.aptagen.com/apta-index/ | Other | null | null | Not Mentioned in Database |
Higashimoto, Y., et al. "In vitro selection of DNA aptamers that block toxic effects of AGE on cultured retinal pericytes." Microvascular Research, 74 (2007): 65-69.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Advanced Glycation End Products (Clone 9) (ID# 7533) | Advanced Glycation End products (AGE) | AGCTCAGAATGGATCCAAACGCTCATAACTCACTCCATACTCACTTGCTGATTCGCCAACAACACACCCTTAAACAGTCCCTTCGACATGAGAATTCGGCCGGATC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1 pM |
Meyer C, U Hahn, et al. (2012) Interleukin-6 Receptor specific RNA aptamers for cargo delivery into target cells. RNA BiolMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Interleukin-6 receptor (AIR-3) (ID# 7838) | Soluable interleukin-6 receptor (sIL-6R) | GGAAGAAAGAGGUCUGAGACAUUCUCUUAUAGGGGAGGCUGUGGUGAGGGAAUAUUAAGAGAAUUAACGGUCUAGUUCACCUCGACUUCUGGAGUUGACGUUGCUU | https://www.aptagen.com/apta-index/ | Protein | null | null | 19.7 nM |
Weill L., Louis D., and Sargueil B., 2004.Selection and Evolution of NTP-Specific Aptamers. Nucleic Acids Research, 2004 Vol. 32 No. 17, 5045-5058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP C27 (ID# 7927) | ATP | GGUUGGCAGCAGAAGAUAGCAGAACAAGCAGAUCGGCAAGGGUUUCAUUCGGGAUCGAAGGUAACUUGAAUCGUGCGCUGAAUCGUCGGUCAAGGGAGGGAUCCUA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 21 µM |
Ylera, Francisco, et al. "Selection of RNA Aptamers to the Alzheimer's Disease Amyloid Peptide." Biochemical and Biophysical Research Communities, 290 (2002): 1583-1588.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Amyloid Peptide BetaA4(1ƒ?? 40) (B55) (ID# 7485) | Amyloid Peptide BetaA4(1ƒ?? 40) | GGGAAUUCGAGCUCGGUACCUUUACCGUAAGGCCUGUCUUCGUUUGACAGCGGCUUGUUGACCCUCACACUUUGUACCUGCUGCCAACUGCAGGCAUGCAAGCUUGG | https://www.aptagen.com/apta-index/ | Peptide | null | null | 29 nM |
Jang, K., et al. "Isolation of inhibitory RNA aptamers against severe acute respiratory syndrome (SARS) coronavirus NTPase/Helicase." Biochemical and Biophysical Research Communications, 366(2008): 738-744.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | SARS Coronavirus NTPase/Helicase (ES15-1) (ID# 7531) | SARS Coronavirus NTPase/Helicase | GAUAAUACGACUCACUAUAGGGUUCACUGCAGACUUGACGAAGCUUGCAGAAAAGGGGGAAGAAGAGGGUGAUUCAGGCGAGAGAAUGGAUCCACAUCUACGAAUUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.2 nM |
Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Trypanosoma cruzi-Laminin Parasite Receptor (L28) (ID# 7566) | Trypanosoma cruz-Laminin Parasite Receptor | ACCGAGUCCAGAAGCUUGUAGUACUUAUGUCCCAUCGAACGCAGUGUAUCUUGCACCGACUCUCUGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 209 nM |
Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Trypanosoma cruzi-Fibronectin Parasite Receptor (F4) (ID# 7567) | Trypanosoma cruzi-Fibronectin Parasite Receptor | ACCGAGUCCAGAAGCUUGUAGUACUGACCCUUCCCGACGCACGGACCAGUGAUGCCAACCCACCCGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 124 nM |
Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Trypanosoma cruzi-Heparan Parasite Receptor (HS6) (ID# 7570) | Trypanosoma cruzi-Heparan Parasite Receptor | ACCGAGUCCAGAAGCUUGUAGUACUACCGCAACGUUGGCGUUCGGCGUUGGCCGCGUCAUCGCUAGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 40 nM |
Wu et al. "Identification, Characterization and Amplification of a G-Quadruplex Structured DNA Aptamer Against Cancer Biomarker Protein Anterior Gradient Homolog 2." PLOS, 9 (2012):e46393.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anterior Gradient Homolog 2 (C14B0) (ID# 7842) | Anterior Gradient Homolog 2 (AGR2) | TCTCGGACGCGTGTGGTCGGCGGGTGGGAGTTGTGGGGGGGGGTGGGAGGGTTCTTTGTTTGATCTTTCTCGCTGCCTGGCCCTAGAGTGTCGCTGCCTGGCAGAGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 8.5 nM |
Wang, Yong, et al. "Specific binding of aminoglycoside antibiotics to RNA." Chemistry & Biology 2 (1995): 281-290Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Tobramycin (J6) (ID# 7458) | Tobramycin | GGGAGAAUUCCGACCAGAAGCUUAGUAUAGCGAGGUUUAGCUACACUCGUGCUGAUCGUUUGGUACGGGACCUGCGUGUAGCCCAUAUGUGCGUCUACAUGGAUCCUCA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2 nM |
Scarabino, Daniela, et al. "tRNA prefers to kiss." EMBO Journal 18 (1999): 4571-4578Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Yeast phenylalanine tRNA (B2) (ID# 7459) | Yeast phenylalanine tRNA | GGGAAUUCCGCGUGUGCUACGUAUCUUCAGGCGGUAACUAACUGUGCUGAGUCUAAUCUUUGUGAGGGACGGUAACAUAUGGUUCCCGCGUGGUCCGUUCGGGAUCCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 12 nM |
Seiwert, S., et al. "RNA aptamers as pathway-specific MAP kinase inhibitors." Chemistry & Biology, 7(2000): 833-834.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ERK 1/ ERK2 (Family II) (ID# 7546) | Extracellular Regulated Kinase 1 and 2 (ERK 1 and ERK2) | GGGAGAGCCAUACCUGACAAAGACGCUAGCGAAUUGGUUCCUCACUCAAAAGUAGGGGAAAGCGUUAUUAAGAAACCAAAAUUUGACAGGUUACGCAUCCUGCAUCCUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.7 nM |
Jo et al. "Development of Single-Stranded DNA Aptamers for Specific Bisphenol A Detection." Oligonucleotides, 21(2011): 85-91.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Bisphenol A(#3) (ID# 7578) | Bisphenol A(BPA) | GGGCCGTTCGAACACGAGCATGCCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGCACCAGGACAGTACTCAGGTCATCCTAGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 8.3 nM |
Wilson et al. "Functional Requirements for Specific Ligand Recognition by a Biotin-Binding RNA Pseudoknot." Journal of Biochemistry, 37(1998): 14410-14419.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Biotin (ID# 7553) | Biotin | GGAACACUAUCCGAUGGCACCGACCAUAGGCUCGGGUUGCCAGAGGUUCCACACUUUCAUCGAAAAGCCUAUGCUAGGCAAUGACAUGGACUCCUUGGUCAUUAGGAUCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5.7 µM |
Kwon et al., "In Vitro Selection of RNA against Kanamycin B." Molecules and Cells, 11 (2001): 303-311.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Kanamycin B (K8) (ID# 7523) | Kanamycin B | GGGAGCUCGGUACCGAAUUCUCGCCCUAUAGGGGUGUUGAGGGAAAUGUGUGCGACAAGGUGCGGUGGCCAGAACUUUUCGUUCUCAUCAAAAGCUUUGCAGAGGAUCCUU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 180 nM |
Bell, S., et al. "RNA Molecules That Bind to and Inhibit the Active Site of a Tyrosine Phosphatase." The Journal of Biological Chemistry, 273(1998):14309-14314.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Protein Tyrosine Phosphatase (N71yc16) (ID# 7541) | Protein tyrosine phosphatase (PTPase) | GGGAGAUACCAGCUUAUUCAAUUCUGGCAAUGGGCUAUCCCAAGUGCUAGGCUUCAGGGAGCGAGGACCAGACGACGUACCUAACCCUAAGGUGAGAUAGUAAGUGCAAUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 18 nM |
Khati, M., et al. "Neutralization of Infectivity of Diverse R5 Clinical Isolates of Human Immunodeficiency Virus Type 1 by gp120-Binding 2'F-RNA Aptamers." Journal of Virology, 77(2003): 12692-12698.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | HIV-1 R5 Glycoprotein gp120 (B4) (ID# 7530) | HIV-1 R5 SU Glycoprotein | AAUUAACCCUCACUAAAGGGAACUGUUGUGAGUCUCAUGUCGAAGAGCGGUUAAGGGAGAUUUAGGCAGCAGCUUGGACAGUGUAUCGGCUGAGUUGAGCGUCUAGUCUUGUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 5 nM |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.