image listlengths 1 1 | messages listlengths 2 2 | task_name stringclasses 5 values | dataset_name stringclasses 17 values | rvl_cdip_class stringclasses 12 values |
|---|---|---|---|---|
[
"./val_imgs/PubTabNet/val/PMC3284868_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the figure into Markdown language."
},
{
"role": "assistant",
"content": "<md> | 1. | Have you ever heard of Vitamin D? (If you answered 'No', please go to Q9) | \n | --- | --- | \n | 2. | Do you think vitamin D is important for your health? | \n | 3. | Have you ever been told that you have vitamin D deficiency (not enough vitamin D)? | \n | 4. | Do you take vitamin D supplements (tablets)? | \n | 5. | Do you include vitamin D rich foods such as milk, fish oil or eggs in your meal? | \n | 6. | Have you been out in the sun within the last year with exposed face, arms or legs whenever possible? | \n | 7. | Do you know that vitamin D deficiency causes tiredness, low mood as well as muscle and bone pain? | \n | 8. | Where did you hear about vitamin D? | \n | 9. | Which sex are you? (If you are male, please go to Q11) | \n | 10. | Are you pregnant or breast feeding? | \n | 11. | What is your age? | \n | 12. | How do you think we can make patients of this surgery know more about vitamin D? | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3229614_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Render the illustration in Markdown format."
},
{
"role": "assistant",
"content": "<md> | ICF components and domains | All (N = 433) | Men (N = 166) | Women (N = 267) | Gender difference, p-value | \n | --- | --- | --- | --- | --- | \n | Body functions | 361 (83.4) | 138 (83,1) | 223 (83,5) | 1 | \n | 1. Mental functions | 219 (50.6) | 73 (44) | 146 (54.7) | .03* | \n | Body structures | 83 (19.2) | 39 (23.5) | 44 (16.8) | .07 | \n | 1. Structures of the nervous system | 6 (1.4) | 5 (3) | 1 (0.4) | .03* | \n | 7. Structures related to Movements | 61 (14.1) | 32(19.3) | 29 (10.9) | .01* | \n | Activities and participation | 152 (35.1) | 54 (32.5) | 98 (36.7) | .38 | \n | 2. General tasks and demands | 65 (15) | 16 (9.6) | 50 (18.7) | .01* | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4493946_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | <COLSPAN=5> ICSI Q3 score | \n | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Baseline frequency | <ROWSPAN=2> N | <COLSPAN=3> End point (week 14) | \n | 1 | 2 | 3 | \n | 2 | 7 | 1 | 6 | - | \n | 3 | 10 |"
},
{
"role": "assistant",
"content": "1 | 7 | 2 | \n | 4 | 0 | - | - | - | \n | ≥5 | 1 | - | - | 1 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5508608_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Variables | Response | Number | % | \n | --- | --- | --- | --- | \n | <ROWSPAN=2> Drank chlorine treated water | No | 132 | 73.3 | \n | Yes | 48 | 26.7 | \n | <ROWSPAN=2> Had latrine | No | 84 | 46.7 | \n | Yes | 96 | 53.3 | \n | <ROWSPAN=2> Hand wash after toilet | No | 148 | 82.2 | \n | Yes | 32 | 17.8 | \n | <ROWSPAN=2> Walking barefoot | No | 40 | 22.2 | \n | Yes | 140 | 77.8 | \n | <ROWSPAN=2> Took deworming from the last 1 month to the last 1 year | No | 134 | 74.4 | \n | Yes | 46 | 25.6 | \n | <ROWSPAN=2> Iron supplementation | No | 110 | 61.1 | \n | Yes | 70 | 38.9 | \n | <ROWSPAN=2> Open field defecation | No | 18 | 10.0 | \n | Yes | 162 | 90.0 | \n | <ROWSPAN=2> Water contact | No | 30 | 16.7 | \n | Yes | 150 | 83.3 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4534048_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the photo in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | | <COLSPAN=3> Pre | <COLSPAN=3> 2 week | <COLSPAN=3> 4 week | <COLSPAN=3> 6 week | \n | | | <COLSPAN=3> (%) | <COLSPAN=3> (%) | <COLSPAN=3> (%) | <COLSPAN=3> (%) | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=6> Control (n = 4) | C16:0 | 10.7 | ± | 1.1 | 9.5 | ± | 0.9 | 9.8 | ± | 1.1 | 10.5 | ± | 0.6 | \n | C16:1n-7 | 6.6 | ± | 1.3 | 7.3 | ± | 0.3 | 7.1 | ± | 0.5 | 7.2 | ± | 0.4 | \n | C18:0 | 14.8 | ± | 0.9 | 16.1 | ± | 1.3 | 15.6 | ± | 1.1 | 14.5 | ± | 0.3a | \n | C18:1n-9 | 20.6 | ± | 3.2 | 20.8 | ± | 3.1 | 20.0 | ± | 2.4b | 19.8 | ± | 0.8c | \n | C18:2n-6 | 38.6 | ± | 2.3 | 38.5 | ± | 3.1 | 39.4 | ± | 4.2d | 40.5 | ± | 1.4e | \n | C20:4n-6 | 7.7 | ± | 0.3 | 7.3 | ± | 0.8 | 8.5 | ± | 2.1 | 6.7 | ± | 0.7f | \n | <ROWSPAN=6> HF (n = 8) | C16:0 | 10.5 | ± | 0.6 | 10.1 | ± | 0.8 | 10.2 | ± | 0.8 | 10.8 | ± | 1.1 | \n | C16:1n-7 | 5.9 | ± | 1.4 | 7.7 | ± | 2.7 | 6.4 | ± | 2.0 | 6.4 | ± | 1.7 | \n | C18:0 | 14.7 | ± | 1.0 | 14.9 | ± | 1.1 | 15.5 | ± | 0.7 | 15.5 | ± | 0.9*a | \n | C18:1n-9 | 18.8 | ± | 2.0 | 28.1 | ± | 3.4** | 25.1 | ± | 1.0**b | 24.6 | ± | 1.6**c | \n | C18:2n-6 | 34.4 | ± | 3.8 | 31.3 | ± | 4.7* | 32.0 | ± | 2.9*d | 31.0 | ± | 2.8**e | \n | C20:4n-6 | 12.2 | ± | 4.6 | 8.7 | ± | 1.4** | 11.2 | ± | 1.6 | 10.5 | ± | 2.0f | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4407105_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | | Non-BSCM | BSCM | Significancep-value | \n | ---"
},
{
"role": "assistant",
"content": "| --- | --- | --- | \n | n | 125 | 125 | | \n | Score | -12.26 | -12.34 | 2.40E-003 | \n | Improved Score | 75/125 | 50/125 | 9.84E-003 | \n | Mean p-value | 0.129 | 0.109 | 2.20E-016 | \n | cMonkey Version | 4.8.2 | 4.8.2 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2464585_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | Type of Health Facility | <COLSPAN=2> Peshawar | <COLSPAN=2> Faisalabad | \n | | Total Number | Number included in study | Total Number | Number included in study | \n | --- | --- | --- | --- | --- | \n | District headquarter Hospital | 01 | 01 | 01 | 01 | \n | Taluka headquarter Hospital | 0 | 0 | 04 |"
},
{
"role": "assistant",
"content": "04 | \n | Rural Health Centre | 04 | 03 | 11 | 00 | \n | Basic Health Unit | 56 | 14 | 168 | 03 | \n | Maternal & Child Health Centre | 01 | 01 | 06 | 02 | \n | Dispensaries | 12 | 3 | 108 | 10 | \n | Total | 74 | 22 | 298 | 20 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2768985_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | GO pathways* | Number of genes | Number of TFs† | Number of TF/Number of genes‡ | Number of FFLs§ | \n | --- | --- | --- | --- | --- | \n | Top five with the highest total number of TFs | | | | | \n | Response to other organisms | 296 | 2,249 | 7.6 | 9,865 | \n | Secondary metabolic process | 284 | 1,964 | 6.9 | 3,321 | \n | Response to temperature stimulus | 238 | 1,650 | 6.9 | 10,151 | \n | Anatomical structure morphogenesis | 291 | 1,537 | 5.3 | 13,275 | \n | Response to radiation | 250 | 1,524 | 6.1 | 6,233 | \n | Top five with the lowest total number of TFs | | | | | \n | Glycerophospholipid metabolic process | 21 | 38 | 1.8 | 69 | \n | Sulfur amino acid biosynthetic process | 24 | 60 | 2.5 | 13 | \n | Gametophyte development | 24 | 62 | 2.6 | 1 | \n | Cellular morphogenesis in differentiation | 25 | 68 | 2.7"
},
{
"role": "assistant",
"content": "| 78 | \n | Indole and derivative metabolic process | 22 | 71 | 3.2 | 46 | \n | Top five with the highest relative number of TFs | | | | | \n | Defense response to fungus | 26 | 355 | 13.7 | 4,353 | \n | Photosynthesis | 80 | 1,064 | 13.3 | 2,459 | \n | Response to light intensity | 26 | 334 | 12.8 | 2,652 | \n | Chlorophyll biosynthetic process | 22 | 243 | 11.0 | 443 | \n | Porphyrin biosynthetic process | 39 | 421 | 10.8 | 754 | \n | Top five with the lowest relative number of TFs | | | | | \n | Glycerophospolipic metabolic process | 21 | 38 | 1.8 | 0 | \n | Membrane lipid biosynthetic process | 48 | 111 | 2.3 | 121 | \n | Sulfur compound biosynthetic process | 32 | 75 | 2.3 | 98 | \n | Golgi vesicle transport | 44 | 104 | 2.4 | 47 | \n | Biogenic amine metabolic process | 32 | 76 | 2.4 | 53 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3722882_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | | SVR (n = 75) | Non-SVR (n = 34) | P value* | OR for non-SVR (95% CI) | \n | --- | --- | --- | --- | --- | \n | Male sex, n (%) | 41 (55%) | 19 (56%) | 1 | 1.05 (0.46–2.37) | \n | Age, years (median) | 56 | 60 | 0.19 | 1.02 (0.99–1.07) | \n | BMI > 25, n (%) | 24 (32%) | 15 (44%) | 0.29 | 1.66 (0.73–3.86) | \n | HCV-1a, n (%) | 13 (18%) | 2 (6%) | 0.13 | 0.29 (0.06–1.40) | \n | High viral load, n (%)° | 44 (59%) | 25 (85%) | 0.2 | 1.95 (0.80–4.76) | \n | Cirrhosis, n (%) | 16 (21%)"
},
{
"role": "assistant",
"content": "| 14 (41%) | 0.03 | 2.58 (1.07–6.21) | \n | PegIFN alfa-2a, n (%) | 38 (51%) | 12 (41%) | 0.15 | 0.53 (0.23–1.22) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4458991_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | ASKAS | Variables | Coefficient | p value | R2* | \n | --- | --- | --- | --- | --- | \n | Knowledge |"
},
{
"role": "assistant",
"content": "Male x Female | -4.81 | <0.0001 | 0.1436 | \n | | Employed x Unemployed | -1.96 | 0.0359 | | \n | Attitudes | Education x illiterate | -2.82 | 0.0066 | 0.0638 | \n | | Age (55-59 years old x ≥60 years old) | -2.15 | 0.0374 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5759267_007_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | Total An. sundaicus captured | Mean catch per night | Trap efficacy (compared to HLC) | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Indoor traps | \n | HLC in | 827 | 51.7 | – | \n | CDC-LT | 41 | 2.6 | 0.05 | \n | Resting box in | 2 | 0.1 | 0.00 | \n | Resting jar in | 3 | 0.2 | 0.00 | \n | <COLSPAN=4> Outdoor traps | \n | HLC out | 1277 | 79.8 | – | \n | Large tent | 104 | 6.5 | 0.08 | \n | Small tent | 82 | 5.1 | 0.06 | \n | ITT | 13 | 0.8 | 0.01 | \n | Resting box out | 2 | 0.1 | 0.00 | \n | Resting jar out | 2 | 0.1 | 0.00 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3660179_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the diagram in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | β | SE | z value | p | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Daily data | \n | Intercept | −22.3142 | 0.5200 | −42.9118 | < 0.0001 | \n | D0,0 | 1.0901 | 0.0281 | 38.8183 | < 0.0001 | \n | D85,85 | 0.6453 | 0.0216 | 29.8125 | < 0.0001 | \n | T0,0 | 0.0441 | 0.0037 | 11.8177 | < 0.0001 | \n | T12,1 | −0.0751 | 0.0065 | −11.5170 | < 0.0001 | \n | P0,0 | 0.0044 | 0.0013 | 3.4509 | 0.0006 | \n | P51,16 | 0.0990 | 0.0081 | 12.2828 | < 0.0001 | \n | H0,0 | −0.0131 | 0.0013 | −10.2594 | < 0.0001 | \n | H38,1 | 0.0453 | 0.0027 | 17.0574 | < 0.0001 | \n | W119,86 | −0.5238 | 0.0325 | −16.1039 | < 0.0001 | \n | <COLSPAN=5> Weekly data | \n | Intercept | −22.4553 | 1.4451 | −15.5389 | < 0.0001 | \n | D0,0 | 1.1318 | 0.0820 | 13.8066 | < 0.0001 | \n | D13,13 | 0.6034 | 0.0551 | 10.9537 | < 0.0001 | \n | T0,0 | 0.0386 | 0.0150 | 2.5816 | 0.0098 | \n | T1,1 | −0.0612 | 0.0148 | −4.1208 | < 0.0001 | \n | P7,3 | 0.1036 | 0.0208 | 4.9686 | < 0.0001 | \n | H4,1 | 0.0354 | 0.0061 | 5.7550 | < 0.0001 | \n | W17,12 | −0.5573 | 0.0940 | −5.9315 | < 0.0001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5084016_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | Foods | EPA + DHA (g/100g) | EPA (g/100g) | DHA (g/100g) | \n | --- | --- | --- | --- | \n | Salmon | 1.95 | 1.01 | 0.94 | \n | Herring | 1.66 | 0.97 | 0.69 | \n | Anchovy | 1.45 | 0.54 | 0.91 | \n | Mackerel | 1.30 | 0.90 | 1.40 | \n | Trout"
},
{
"role": "assistant",
"content": "| 0.73 | 0.20 | 0.53 | \n | Swordfish | 0.76 | 0.11 | 0.65 | \n | Sea bass | 0.60 | 0.24 | 0.36 | \n | Squid | 0.49 | 0.15 | 0.34 | \n | Mussel | 0.44 | 0.19 | 0.25 | \n | Sole | 0.25 | 0.14 | 0.11 | \n | Cod | 0.18 | 0.06 | 0.12 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4947833_009_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | Subscale | Minimum | Maximum | Mean | SD | Skewness | Kurtosis | \n | --- | --- | --- | --- | --- | --- | --- | \n | Living conditions and lifestyle (7 items) | | | | | | | \n | Raw and unscaled | 7 | 35 | 25.31 | 5.24 | −0.73 | 3.56 | \n | Rescaled but unweighted for importance | 0 | 100 | 65.41 | 18.74 | 0.73 | 3.56 | \n | Rescaled and weighted for importance | 0 | 100 | 53.82 | 16.46 | 0.16 | 2.84 | \n | Social relationships (5 items) | | | | | | | \n | Raw"
},
{
"role": "assistant",
"content": "and unscaled | 5 | 25 | 19.19 | 3.66 | −1.16 | 5.11 | \n | Rescaled but unweighted for importance | 0 | 100 | 70.94 | 18.31 | −1.16 | 5.11 | \n | Rescaled and weighted for importance | 0 | 100 | 64.00 | 15.92 | −0.17 | 3.56 | \n | Personal independence (5 items) | | | | | | | \n | Raw and unscaled | 5 | 25 | 15.47 | 4.37 | −0.29 | 2.59 | \n | Rescaled but unweighted for importance | 0 | 100 | 52.33 | 21.86 | −0.29 | 2.59 | \n | Rescaled and weighted for importance | 0 | 100 | 58.97 | 17.95 | −0.02 | 2.96 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3632493_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Contrast | gSAD (n = 29) | HC (n = 27) | t (df = 56) | p | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Accuracy | \n | Attend Angry vs. Shapes | 85.6 ± 11.8 | 86.6 ± 10.9 | 0.31 | 0.76 | \n | Attend Fear vs. Shapes | 92.7 ± 9.1 | 90.7 ± 10.1 | 0.75 | 0.46 | \n | Attend Happy vs. Shapes | 90.8 ± 11.0 | 86.3 ± 14.2 | 1.34 | 0.19 | \n | Attend Shapes vs. Angry (distractor) | 94.1 ± 8.1 | 93.7 ± 8.0 | 0.20 | 0.84 | \n | Attend Shapes vs. Fear (distractor) | 90.1 ± 14.4 | 95.5 ± 7.6 | 1.75 | 0.09 | \n | Attend Shapes vs. Happy (distractor) | 91.2 ± 11.5 | 93.4 ± 7.5 | 0.81 | 0.42 | \n | <COLSPAN=5> Reaction Times | \n | Attend Angry vs. Shapes | 1479.6 ± 405.8 | 1419.9 ± 219.5 | 0.68 | 0.50 | \n | Attend Fear vs."
},
{
"role": "assistant",
"content": "Shapes | 1337.9 ± 371.9 | 1285.7 ± 218.5 | 0.63 | 0.53 | \n | Attend Happy vs. Shapes | 1303.7 ± 340.4 | 1231.0 ± 207.4 | 0.96 | 0.34 | \n | Attend Shapes vs. Angry (distractor) | 1021.1 ± 273.5 | 957.8 ± 122.4 | 1.11 | 0.27 | \n | Attend Shapes vs. Fear (distractor) | 985.4 ± 239.9 | 946.2 ± 144.4 | 0.74 | 0.47 | \n | Attend Shapes vs. Happy (distractor) | 975.6 ± 236.4 | 944.3 ± 157.7 | 0.58 | 0.57 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5937825_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | Family assessment form (n = 159) | Patients (n = 136) | \n | --- | --- | --- | \n | Yes | 13 (8%) | 11 (8%) | \n | No | 79 (50%) | 70 (52%) | \n | Not registered | 67 (42%) | 55 (40%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4429592_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | | <COLSPAN=2> Saline control | <COLSPAN=2> Bevacizumab treatment | \n | | Pre | Post | Pre | Post | \n | --- | --- | --- | --- | --- | \n | Tumor volume, range (mm3) | 7.34–36.9 | 9.20–58.2 | 6.96–46.8 | 8.13–44.5 | \n | Tumor volume, mean ± sd (mm3) | 14.7 ± 9.4 | 22.7 ± 15.7 | 16.1 ± 13.2 | 17.8 ± 12.3 | \n | R1, range (ms–1) | 0.45–0.54 | 0.42–0.55 | 0.45–0.57 | 0.49–0.59 | \n | R1, mean ±"
},
{
"role": "assistant",
"content": "sd (ms–1) | 0.53 ± 0.03 | 0.50 ± 0.04 | 0.53 ± 0.04 | 0.54 ± 0.04 | \n | Steady-state rCBV, range | 0.76–2.89 | 0.63–1.63 | 0.92–1.61 | 0.63–1.55 | \n | Steady-state rCBV, mean ± sd | 1.45 ± 0.83 | 1.17 ± 0.45 | 1.20 ± 0.26 | 0.93 ± 0.26 | \n | Ktrans, range (min–1) | 0.027–0.084 | 0.026–0.084 | 0.016–0.064 | 0.014–0.054 | \n | Ktrans, mean ± sd (min–1) | 0.047 ± 0.018 | 0.056 ± 0.018 | 0.043 ± 0.016 | 0.031 ± 0.014 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5676636_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Vaccine | Estimated annual deaths (95% CI) [A] | Estimated vaccine effectiveness (range) [B] | Estimated annual deaths preventable by vaccination (95% CI) [C]* | Estimated vaccine coverage in Haiti (%) [D]5 | Estimated vaccine preventable deaths in Haiti (range) [E]† | \n | --- | --- | --- | --- | --- | --- | \n | Hib | 1,56526 (906–2,203) | 95%30 | 1,487 (861–2,093) | 75 | 1,115 (646–1,570) | \n | Hepatitis B | 3,48027 | 95%27 | 3,306 | 75 | 2,480 | \n | Rotavirus | 800 (710–889)28 | 60% (50–70%)31 | 480 (426–533) | 60 | 288 (256–320) | \n | PCV | 2,98726 (2,061–3,287) | 60% (50–70%)32 | 1,792 (1,237–1,972) | 75 | 1,344 (928–1,479) | \n | Total | 8,832 | – | 7,065 | – | 5,227 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3777717_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | Characteristic | Schizophrenia (n = 43) | Healthy control (n = 54) | \n | --- | --- | --- | \n | Years of education: mean ± SD (range) | 12.67 ± 1.91 (9–17) | 14.09 ± 2.02 (10–20)⁎ | \n | Years of parental education: mean ± SD (range) | 14.87 ± 2.30 (10–19) | 14.28 ± 2.44 (8–20) | \n | Gender: n males (%) | 34 (79%) | 35 (65%) | \n | Ethnicity: n Caucasian (%) | 22 (51%) | 28 (52%) | \n | Handedness: n left-handed (%) | 0 (0%) | 4 (7%) | \n | WASI IQ: mean ± SD (range) | 102.12 ± 13.10 (78–131) | 113.63 ± 10.67 (85–135)⁎ | \n | Diagnosis: n (%) | | | \n | Schizophrenia | 41 (96%) | – | \n | Schizoaffective | 1 (2%) | – | \n | Schizophreniform | 1 (2%) | – | \n | Medication status: n (%) | | | \n | Unmedicated | 15 (35%) | – | \n | Atypical antipsychotic | 27 (63%) | – | \n | Typical and atypical antipsychotic | 1 (2%) | – | \n | Symptom scores: mean ± SD (range) | | | \n | Disorganization symptoms | 7.03 ± 3.53 (3–16) | – | \n |"
},
{
"role": "assistant",
"content": "Reality distortion symptoms | 16.07 ± 6.18 (4–29) | – | \n | Poverty symptoms | 13.49 ± 5.69 (3–26) | – | \n | Behavioral data | | | \n | AX-CPT accuracy: mean ± SD | | | \n | AX | .94 ± .08 | .98 ± .03 | \n | AY | .82 ± .21 | .84 ± .19 | \n | BX | .86 ± .14 | .94 ± .08 | \n | BY | .98 ± .04 | .99 ± .03 | \n | AX-CPT reaction time: mean (ms) ± SD | | | \n | AX | 613 ± 184 | 545 ± 122 | \n | AY | 774 ± 180 | 711 ± 148 | \n | BX | 761 ± 302 | 625 ± 219 | \n | BY | 664 ± 224 | 560 ± 164 | \n | Stroop accuracy: mean ± SD | | | \n | Congruent | .97 ± .03 | .99 ± .02 | \n | Incongruent | .92 ± .11 | .95 ± .06 | \n | Stroop reaction time: mean (ms) ± SD | | | \n | Congruent | 685 ± 131 | 622 ± 85 | \n | Incongruent | 785 ± 158 | 717 ± 120 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4131426_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the image as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Gene | Forward primer | Reverse primer | \n | --- | --- | --- | \n | GAPDH | CAAGCTCATTTCCTGGTATGACA | GCCTCTCTTGCTCAGTGTCC | \n | ACC | CCAGCAGATTGCCAACATC | ACTTCGGTACCTCTGCACCA | \n | TLR4 | TCCAGCCACTGAAGTTCT | CAGCAAAGTCCCTGATGA | \n | TNF-α | TCTACTGAACTTCGGGGTGA | GATCTGAGTGTGAGGGTCTGG | \n | IL-1Ra | GCAAGATGCAAGCCTTCAGA | CCTTGTAAGTACCCAGCAATGA | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4172841_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Enrolled (N = 63) baseline | Dropouts (N = 21) baseline | COmpleters (N = 42) baseline | Completers (N = 42) 1 year follow-up | \n | --- | --- | --- | --- | --- | \n | Days with headaches per month | 22.2 (6.5) | 23.1 (6.9) | 21.7 (6.4) | 11.2 (7.4) | \n | Tablets per month | 33.0 (23.2) | 38.8 (25.1) | 30.1 (21.9) | 15.0 (16.6) | \n | MIDAS total score | 68.9 (49.9) | 79.0 (58.3) | 68.8 (45.0) | 38.6 (38.9) | \n | Intensity of headache on VAS | 7.7 (1.6) | 8.1 (1.4) | 7.6 (1.7) | 6.5 (1.7) | \n | HAM-A Score | 12.8 (7.6) | 13.3 (8.8) | 12.6 (7.1) | 11.6 (6.9) | \n | HAM-D Score | 12.4 (7.2) | 12.4 (7.1) | 12.4 (7.4) | 9.8 (5.9) | \n | SDS Score | 8.6 (2.2) | 8.8 (2.3) | 8.6 (2.1) | 5.7 (3.2) | \n | SCI-SUBS total score | 12.2 (9.1) | 11.1 (7.5) | 5.6 (3.3) | 7.9 (7.9) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6027327_012_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | pH | Average | Standard Deviation |"
},
{
"role": "assistant",
"content": "\n | --- | --- | --- | \n | 3.04 | −1.42 | 0.87 | \n | 5.25 | −11.40 | 4.35 | \n | 6.99 | −16.83 | 1.40 | \n | 10.12 | −35.07 | 2.74 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2720977_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | Subgroup | RR all Antibody Prophyaxis | # of Studies | # in Treatment Groups | \n | --- | --- | --- | --- | \n | Premature <35 weeks GA[11,12,15] | 0.29 (0.16,"
},
{
"role": "assistant",
"content": "0.54) | 3 | 624 | \n | Chronic Lung Disease (CLD)[11,12,15] | 0.55 (0.38, 0.80) | 3 | 696 | \n | Congenital Heart Disease (CHD)[11,12,16] | 0.56 (0.40, 0.79) | 3 | 865 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6022296_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Univariable | <COLSPAN=2> Multivariable | \n | Characteristic | OR (95% CI) | P-value* | OR (95% CI) | P-value* | \n | --- | --- | --- | --- | --- | \n | History of STI during pregnancy | 1.5 (0.7–3.3) | 0.29 | 4.0 (1.7–9.6) | 0.002 | \n | Cesarean delivery | 4.8 (3.3–7.0) | < 0.001 | 2.9 (1.8–4.8) | < 0.001 | \n | Number of days admitted to hospital | 1.4 (1.3–1.5) | < 0.001 | 1.2 (1.1–1.4) | < 0.001 | \n | Formal employment | 0.5 (0.3–0.7) | < 0.001 | 0.5 (0.3–0.8) | 0.002 | \n | Multiparous | 0.6 (0.4–0.7) | < 0.001 | 0.5 (0.3–0.7) | 0.001 | \n | Residence in Mbarara municipality | 0.6 (0.4–0.8) | 0.001 | 0.7 (0.5–1.1) | 0.11 | \n | Number of vaginal exams in labor | 1.0 (0.9–1.1) | 1.0 | 0.9 (0.8–1.0) | 0.06 | \n | HIV-infected | 1.0 (0.6–1.6) | 1.0 | 1.0 (0.5–1.9) | 0.94 | \n | Age | 0.9 (0.9–1.0) | < 0.001 | 1.0 (0.9–1.0) | 0.40 | \n | Number of hours in labor | 1.0 (1.0–1.0) | 0.08 | 1.0 (1.0–1.0) | 0.95 | \n | Referred from an outside facility | 2.6 (1.8–3.7) | < 0.001 | 1.5 (0.9–2.4) | 0.10 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4297392_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the picture in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Treatment phase | Adverse event | No. of patients | \n | --- | --- | --- | \n | <ROWSPAN=6> T1 | Swelling | 1 | \n | Itching | 1 | \n | Fever | 4 | \n | Throat infection | 1 | \n | Chest Congestion | 2 | \n | Total | 9 | \n | <ROWSPAN=3> T2 | Diarrhea | 1 | \n | Body Pain | 1 | \n | Total | 2 | \n | <ROWSPAN=2> T3 | Diarrhea | 1 | \n | Total | 1 | \n | T4 | Nil | - | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4082866_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | <ROWSPAN=2> Standard level | <ROWSPAN=2> Mass of mix stock (g) | <ROWSPAN=2> Final mass (g) | <COLSPAN=2> Concentration (ppm) | \n | GL | DGuA | \n | --- | --- | --- | --- | --- | \n | SL1 | NA | NA | 0 | 0 | \n | SL2 | 0.117 | 10.019 | 1.3 | 3.58 | \n | SL3 | 0.229 | 10.592 | 2.39 | 6.62 | \n | SL4 | 0.518 | 10.037"
},
{
"role": "assistant",
"content": "| 5.71 | 15.81 | \n | SL5 | 1.006 | 10.027 | 11.11 | 30.75 | \n | SL6 | 2.011 | 10.072 | 22.12 | 61.19 | \n | SL7 | 4.033 | 10.001 | 44.62 | 123.47 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5769998_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Selected variables | Categories | P | OR | 95%CI | \n | --- | --- | --- | --- | --- | \n | Education | Continuous variable (years) | < 0.001 | 0.410 | 0.356-0.473 | \n | <ROWSPAN=2> Gender | Male (Ref.) | --- | 1.00 | --- | \n | Female | < 0.001 | 2.43 | 1.51-3.89 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3514199_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the figure in markdown code: <md> | | <COLSPAN=7> Phenotype and functionality of the infusion products | <COLSPAN=3> Clinical outcome | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Patient number | Infused cells | CD8+ | CD45RO+ | CCR7+ | CD27+ | Reactivitya | Total number of responding CD8+T cells infused | Response | TTP | OS | \n | | (x 1010) | (%) | (%) | (%) | (% of CD8) | (%) | (x 106) | (RECIST) | (mo) | (mo) | \n | 1 | 2.9 | 94 | 99.7 | 7.5 | 6.1 | 28.8# | 6460 | CR | 30+ | 30+ | \n | 2 | 1.8 | 92 | 97.4 | 4.9 | 5.2 | 1.0# | 175 | PD | 2 | 7 | \n | 3 | 2.0 | 95 | 99.4 | 6.1 | 0.5 |"
},
{
"role": "assistant",
"content": "0.0# | 7 | SD | 4 | 11.5 | \n | 6 | 0.3 | 47 | 98.4 | 3.9 | 1.2 | 0.9* | 41 | PD | 2 | 4.6 | \n | 7 | 1.3 | 88 | 89 | 31.8 | 3.4 | 0.4# | 44 | SD | 5 | 11 | \n | 11 | 7.5 | 95 | 99 | 0.6 | 8.1 | 6.0* | 4377 | CR | 10+ | 10+ | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5028010_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration into Markdown language."
},
{
"role": "assistant",
"content": "<md> | | EEG frequency matched mean Fisher's r (SEM) | EEG frequency different mean Fisher's r (SEM) | P value | \n | --- | --- | --- | --- | \n | SICI | 1.388 (0.135) | 0.615 (0.199) | 0.01 | \n | ICF | 0.961 (0.168) | 1.177 (0.401) | 0.583 | \n | Single pulse | 0.227 (0.262) | 0.544 (0.214) | 0.730 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2612647_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Variable | Estimate (mo) | SE | 95% CI | p-value | \n | --- | --- | --- | --- | --- | \n | Gender (female) | 15.7 | 0.56 | 14.6–16.8 | 0.28 | \n | Age (< 60) | 15.0"
},
{
"role": "assistant",
"content": "| 0.62 | 13.8–16.2 | 0.15 | \n | Histology (epidermoid) | 16.6 | 0.58 | 15.4–17.7 | 0.16 | \n | T-stage (3–4) | 16.9 | 0.63 | 15.6–18.4 | 0.92 | \n | N-stage (2–3) | 16.2 | 0.65 | 15.0–17.5 | 0.07 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4970044_016_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Gaussian-Like | Triangle | Multi-Label with Equal Description Degrees | \n | --- | --- | --- | --- | \n | MAE (Ori) | 5.320 | 5.366 | 5.69 | \n | MAE (Str 1) | 5.159 | 5.170 | 5.137 | \n | MAE (Str 2) | 5.127 | 5.148 | 5.127 | \n | MAE (Str 3) | 5.112 | 5.178 | 5.530 | \n | MAE (Str 4) | 5.089 | 5.229 | 5.528 | \n | MAE (Str 5) | 4.920 | 4.925 | 5.002 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4452326_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Number | Gender/age (y) | Organ involvement | SLEDAI | Site of CVST occlusion | Treatment | Outcome | \n | --- | --- | --- | --- | --- | --- | --- | \n | 1 | F/16 | F, K, H | 21 | SSS, (B) TS, (B) SS | GC (pulse) + CTX | Lost | \n | 2 | F/18 | F, K, H, C | 25 | (L) TS | GC (pulse) + CTX | Died | \n | 3 | F/17 | F, R, A, K | 22 | (R) TS, (R) SS | GC + CTX | Died | \n | 4 | F/20 | F, H | 15 | SSS | GC (pulse) + CTX | Survived | \n | 5 | M/38 | H, K | 20 | SSS, (B) TS, (B) SS | GC (pulse) + CTX + FK506 | Survived | \n | 6 | F/36 | R, A, H, C, P | 17 | (L) TS, (L) SS | GC + CTX | Survived | \n | 7 | F/43 | R, A, S | 18 | SSS, (L) TS | GC + CTX | Survived | \n | 8 | F/52 | A, K, S | 19 | (R) ISS, (L) TS | GC (pulse) + CTX | Survived | \n | 9 | F/30 | F, K, P | 24 | (R) SS, (R) TS | GC (pulse) + CTX | Survived | \n | 10 | F/20 | S, K, H, TTP | 30 | SSS, (L) TS | GC (pulse) + CTX + MMF + plasmapheresis | Survived | \n | 11 | M/30 | None | 16 | SSS, (B) TS | GC (pulse) + CTX | Survived | \n | 12 | M/14 | F, GI, K | 20 | (R) SS | GC (pulse) + CTX | Survived | \n | 13 | F/41 | R, A, K | 18 | (B) TS, (B) SS | GC (pulse) + CTX | Died | \n | 14 | M/28 | K, A | 20 | (L) SS, (L) TS | GC (pulse) + CTX | Survived | \n | 15 | F/30 | R, H | 17 | (R) TS | GC + CTX | Survived | \n | 16 | M/34 | K | 20 | (L) SS | GC (pulse) + CTX | Survived | \n | 17 | F/15 | K, CAPS | 19 | SSS | GC (pulse) + CTX | Survived | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3157408_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | | | <COLSPAN=4> ActiGraph activity levels and measurements | \n | | | ActiGraph-min (moderate min) | ActiGraph-min (vigorous min) | ActiGraph-min | ActiGraph-count | \n | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=2> Respondent characteristics\\IPAQ activity level | Moderate | Vigorous | Total MET | Total MET | \n | Sex | | | | | | \n | | Male | 0.10* | 0.23*** | 0.14*** | 0.18*** | \n | | Female | 0.09* | 0.09* | 0.09* | 0.15*** | \n | Age, years | | | | | | \n"
},
{
"role": "assistant",
"content": "| | ≤29 | 0.05 | 0.21*** | 0.06 | 0.04 | \n | | 30-49 | 0.09* | 0.12** | 0.12** | 0.19*** | \n | | ≥ 50 | 0.12* | 0.14** | 0.15** | 0.25*** | \n | Full-time worker | | | | | | \n | | Yes - high PD | 0.19* | 0.25** | 0.18* | 0.16 | \n | | Yes - low PD | 0.10* | 0.10** | 0.12** | 0.20*** | \n | | Not full-time | 0.06 | 0.21*** | 0.07 | 0.08 | \n | Tertiary education | | | | | | \n | | Yes | 0.03 | 0.17** | 0.09 | 0.08 | \n | | No | 0.11*** | 0.17*** | 0.12*** | 0.18*** | \n | BMI | | | | | | \n | | Overweight (≥ 25) | 0.10 | 0.22*** | 0.14** | 0.21*** | \n | | Normal (< 25) | 0.09** | 0.14*** | 0.10** | 0.14*** | \n | VFL, % | | | | | | \n | | Overweight (≥ 10) | 0.18*** | 0.23*** | 0.24*** | 0.31*** | \n | | Normal (< 10) | 0.08* | 0.10** | 0.09* | 0.14*** | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2669053_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the image with markdown style: <md> | | No transfection | Control plasmid | siRNA | \n | --- | --- | --- | --- | \n | End1/E6E7 cells | M1:3.26 ± 0.12 | 5.12 ± 0.18 | 5.32 ± 0.16 | \n | | M2:72.68 ± 3.52 | 71.96 ± 3.26 |"
},
{
"role": "assistant",
"content": "72.38 ± 3.45 | \n | | M3:11.32 ± 0.68 | 10.84 ± 0.62 | 11.24 ± 0.63 | \n | | M4:12.74 ± 0.72 | 12.08 ± 0.70 | 11.06 ± 0.66 | \n | HeLa cells | M1:4.07 ± 0.16 | 4.62 ± 0.23 | 5.57 ± 0.21 | \n | | M2:54.24 ± 2.36 | 55.36 ± 2.75 | 69.02 ± 2.98 | \n | | M3:15.71 ± 0.78 | 15.84 ± 0.81 | 15.93 ± 0.84 | \n | | M4:25.98 ± 1.24 | 24.18 ± 1.16 | 9.48 ± 0.56 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3170701_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | <ROWSPAN=2> Plant species | <COLSPAN=4> aIC50 (μg/mL) | \n | DPPH scavenging activity | Inhibitory activity against lipid peroxidation | Metal chelating activity | Hydroxyl radical scavenging activity | \n | --- | --- | --- | --- | --- | \n | Methanol extract | 34.45 ± 1.15 | 35.36 ± 1.68 | 45.91 ± 0.88 | 89.11 ± 0.29 | \n | Chloroform extract | 31.34 ± 1.10 | 29.31 ± 0.65 |"
},
{
"role": "assistant",
"content": "39.46 ± 0.78 | 83.34 ± 0.35 | \n | Gallic acid | 3.79 ± 0.69 | 255.43 ± 11.68 | — | 59.14 ± 1.10 | \n | Ascorbic acid | 6.05 ± 0.34 | >1000 | — | 160.55 ± 2.31 | \n | BHT | 15.61 ± 1.26 | 1.00 ± 0.23 | — | 33.92 ± 0.79 | \n | α-Tocopherol | — | 0.48 ± 0.05 | — | — | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5316349_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the image in markdown code: <md> | <ROWSPAN=2> Case no. | <COLSPAN=2> Recurrence or metastasis after pancreatic resection | <ROWSPAN=2> Postoperative observation period (months) | \n | Location"
},
{
"role": "assistant",
"content": "| Treatment | \n | --- | --- | --- | --- | \n | 1 | Bilateral lung | None (BSC) | 131a | \n | 2 | Bilateral lung | IFN + IL-2 + UFT | 108a | \n | 3 | – | – | 138 | \n | 4 | – | – | 49 | \n | 5 | Bilateral lung | Sunitinib | 8 | \n | 6 | – | – | 8 | \n | 7 | – | – | 3 | \n | 8 | – | – | 39 | \n | 9 | Bilateral lung, bone | Dacarbazine | 4a | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3071784_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | | normal n = 14 | hypertrophic n = 14 | p | \n | --- | --- | --- | --- | \n | LW/BW ratio | 5.534 ± 0.08274 | 5.396 ±"
},
{
"role": "assistant",
"content": "0.04775 | 0.190 | \n | LiW/BW ratio | 44.13 ± 0.3586 | 44.02 ± 0.3085 | 0.8272 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5831578_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following illustration content in markdown style: <md> | Participant Demographics (N = 151) | %a | \n | --- | --- | \n | <COLSPAN=2> Age | \n | 16–17 years | 18.83 | \n | 25–54 years | 54.54 | \n | 55–64 years | 25.97 | \n | <COLSPAN=2> Gender | \n | Male | 44.16 | \n | Female | 53.9 | \n | Transgender | 1.3 | \n | Canadian born | 61.04 | \n | <COLSPAN=2> Education |"
},
{
"role": "assistant",
"content": "\n | Some high school | 26.62 | \n | High school graduate or equivalent | 16.23 | \n | Some college/university | 24.03 | \n | Bachelor’s degree | 20.13 | \n | Graduate degree | 9.74 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4515700_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the photo in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Head | Eye/Ear/Face | Chest/Back | Upper Limb | Lower Limb | Other | Total | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Abrasions | 0.8 | 0.8 | 0.8 | 2.5 | 5 | 0.8 | 10.7 | \n | Lacerations | 5.8 | 3.3 | 0.8 | 28.1 | 18.2 | 0.8 | 57.0 | \n | Puncture wounds | 2.5 | 0.8 | 0.8 | 3.3 | 5 | 0.8 | 13.2 | \n | Amputations | 0 | 0 | 0 | 2.5 | 0 | 0 | 2.5 | \n | Dislocations | 0 | 0.8 | 0 | 0 | 3.3 | 0.8 | 4.9 | \n | Fractures | 0 | 0 | 0.8 | 0.8 | 0 | 0.8 | 2.4 | \n | Other | 0 | 2.5 | 2.5 | 0.8 | 0 | 3.3 | 9.1 | \n | Total | 9.1 | 8.2 | 5.7 | 38 | 31.5 | 7.3 | 100 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4797930_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Variable | Group | DFB | DFBstderr | Probt | \n | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> SIDa(mEq/L) | Octanoate | -2.157 | 0.927 | P < 0.001 | \n | Normal saline | -6.413 | 0.948 | P < 0.001 | \n | <ROWSPAN=2> SIDe(mEq/L) | Octanoate | -0.288 | 0.409 | P < 0.001 | \n | Normal saline |"
},
{
"role": "assistant",
"content": "-3.242 | 0.422 | P < 0.001 | \n | <ROWSPAN=2> SIG(mEq/L) | Octanoate | -1.866 | 0.996 | P = 0.068 | \n | Normal saline | -3.167 | 1.019 | P = 0.068 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5039908_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Species | Testing pairs | <COLSPAN=6> ACC(%) | \n | | | MMI + NMBAC | MMI | NMBAC | You’s work [18] | Huang’s work [19] | Zhou’s work [14] | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | E.coli | 6954 | 92.80 | 89.01 | 90.13 | 89.30 | 66.08 | 71.24 | \n | C.elegans | 4013 | 92.16 | 88.54 | 86.72 | 87.71 | 81.19 | 75.73 | \n | human1412 | 1412 | 94.33 | 91.31 | 90.23 | 94.19 | 82.22 | 76.27 | \n | H.pylori | 1420 | 91.13 | 90.28 | 90.34 | 90.99 | 82.18 | N/A a | \n | M.musculus | 313 | 95.85 | 92.01 | 91.37 | 91.96 | 79.87 | 76.68 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2796464_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | Controls | UC | CD | Allergy colitis | P | \n | --- | --- | --- | --- | --- | --- | \n | pANCA (+) (%) | — | 25 | 10.5 | 17.6 | .04* | \n | cANCA (+) (%) | — | 10 | — | — | .04** | \n |"
},
{
"role": "assistant",
"content": "IgA ASCA (+) (%) | 4.3 | 7.5 | 57.9 | 17.6 | <.00001*** | \n | IgG ASCA (+) (%) | 4.3 | 17.5 | 71.1 | 29.4 | <.00001**** | \n | ASCA IgG and/or IgA (%) | 8.7 | 17.5 | 73.7 | 29.4 | <.00001***** | \n | Combinations ANCA and ASCA (%) | | | | | <.00001****** | \n | pANCA(+)ASCA(+) | 0 | 2.5 | 5.3 | 0 | | \n | pANCA(+)ASCA(−) | 0 | 22.5 | 5.3 | 17.7 | | \n | pANCA(−)ASCA(+) | 8.7 | 15 | 68.4 | 29.4 | | \n | pANCA(−)ASCA(−) | 91.3 | 60 | 21.1 | 52.9 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5882328_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | Author | Year | Sample size | Male/female | age | Results | \n | --- | --- | --- | --- | --- | --- | \n | Sumiko [27] | 2016 | 82 | 50/32 | 64.6 | OS LFS | \n | Joji [28] | 2017 | 42 | 23/19 | 73 | OS | \n | Paola [20] | 2015 | 86 | 49/37 | NA | OS LFS | \n | Hideto [26] | 2010 | 80 | 53/27 | 70 | OS LFS | \n | Jae-Ho [37] | 2015 | 82 | 53/29 |"
},
{
"role": "assistant",
"content": "49 | OS CIR | \n | Mo XD [36] | 2016 | 78 | 48/30 | 38 | CIR | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4825493_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Express the image as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Item | Baseline | Week 2 | Week 4 | Week 8 | P (2,0) | P (4,0) | P (8.0) | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Pain severity | | | | | | | | \n | With tenderness | 7.60 ± 1.14 | 3.60 ± 1.14 | 5.00 ± 0.71 | 5.60 ± 1.14 | < 0.001 | < 0.001 | < 0.001 | \n | Without tenderness | 7.21 ± 1.03 | 3.47 ± 1.43 | 4.63 ± 1.38 | 5.21 ± 1.03 | < 0.001 | < 0.001 | < 0.001 | \n | p-value | 0.515 | 0.840 | 0.425 | 0.515 | < 0.001 | < 0.001 | < 0.001 | \n | Pain frequency | | | | | < 0.001 | < 0.001 | < 0.001 | \n | With tenderness | 14.40 ± 1.34 | 7.40 ± 2.41 | 9.00 ± 2.12 | 1.00 ± 1.58 | < 0.001 | < 0.001 | < 0.001 | \n | Without tenderness | 11.58 ± 3.73 | 6.26 ± 1.63 | 7.21 ± 1.96 | 9.47 ± 3.70 | < 0.001 | < 0.001 | < 0.001 | \n | p-value | 0.067 | 0.364 | 0.140 | 0.242 | < 0.001 | < 0.001 | < 0.001 | \n | Drug use | | | | | < 0.001 | < 0.001 | < 0.001 | \n | With tenderness | 14.60 ± 1.34 | 7.00 ± 1.22 | 9.00 ± 1.22 | 12.60 ± 1.34 | < 0.001 | < 0.001 | < 0.001 | \n | Without tenderness | 12.21 ± 3.10 | 6.05 ± 1.93 | 7.47 ± 2.34 | 10.21 ± 3.10 | < 0.001 | < 0.001 | < 0.001 | \n | p-value | 0.111 | 0.208 | 0.069 | 0.111 | < 0.001 | < 0.001 | < 0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2612017_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Gender | <COLSPAN=2> Age group | \n | | Girls(N = 67) | Boys(N = 68) | 6-years-old(N = 71) | 7-years-old(N = 62) | \n | --- | --- | --- | --- | --- | \n | Food responsiveness | 1.8 (0.5) | 2.0 (0.6) | 1.8 (0.5) | 2.0 (0.6) | \n | Enjoyment of food | 3.5 (0.6) | 3.3 (0.7) | 3.4 (0.7) | 3.4 (0.7) | \n | Emotional overeating | 1.3 (0.4) | 1.6 (0.5) | 1.4 (0.5) | 1.5 (0.5) | \n | Desire to drink | 2.3 (0.8) | 2.5 (0.7) | 2.3 (0.7) | 2.5 (0.8) | \n | Satiety responsiveness | 2.8 (0.6) | 2.8 (0.7) | 2.8 (0.7) | 2.8 (0.6) | \n | Slowness in eating | 2.6 (0.6) | 2.8 (0.8) | 2.8 (0.7) | 2.6 (0.7) | \n | Emotional undereating | 2.2 (0.8) | 2.3 (0.8) | 2.2 (0.8) | 2.3 (0.8) | \n | Food fussiness | 2.6 (0.9) | 3.1 (0.9) | 2.9 (0.9) | 2.8 (0.9) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4190283_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration into Markdown language."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Flexion phase | <COLSPAN=2> Extension phase | \n | | ANOVA | Post-hoc comparisons | ANOVA | Post-hoc comparisons | \n | | P value | (Tuckey-Kramer) | P value | (Tuckey-Kramer) | \n | --- | --- | --- | --- | --- | \n | Interval* | | Between conditions | | Between conditions | \n | 1 | <0.001 | 1 > all; 2 > 3,4; 5 > 4 | <0.001 | 1,5 > 3,4; 2 > 4 | \n | 2 | <0.001 | 1 > all; 2,3,5 > 4 | 0.011 | 1 > 4 | \n | 3 | 0.009 | 1 > 2,4,5 | 0.004 | 1 > 2,4,5 | \n | 4 | 0.084 | / | 0.135 | / | \n | Condition† | | Between intervals | | Between intervals | \n | 1 | <0.001 | 1,2 > 3 > 4 | <0.001 | 1,2 > 3 > 4 | \n | 2 | <0.001 | 1 > 3,4; 2 > 4 | <0.001 | 1,2 > 3 > 4 | \n | 3 | <0.001 | 1,2,3 > 4 | <0.001 | 1,2 > 3 > 4 | \n | 4 | 0.027 | 1 > 4 | <0.001 | 1,2 > 3 > 4 | \n | 5 | <0.001 | 1 > 3,4; 2 > 4 | <0.001 | 1 > 2 > 3 > 4 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3751553_004_02.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following picture content in markdown style: <md> | Variable | BL | BLF | Ramadan | \n | --- | --- | --- | --- | \n | Total sleep time (min) | 6.2 ± 0.8 | 6.1 ± 1.0 | 5.9 ± 0.7 | \n | Sleep Latency | 29.6 ± 24.2 | 33.7 ± 33.6 | 32.8 ± 29.3 | \n | REM Latency | 80.6 ± 26.9 | 108.9 ± 47.8 | 73.5 ± 40.1 | \n | Stage N1% | 5.2 ± 2.6 | 6.2 ± 3.7 | 5.5 ± 2.4 | \n | Stage N2% | 58.7 ± 4.6 | 65.1 ± 5.3 | 65.2 ± 6.1 | \n | Stage N3% | 10.7 ± 6.3 | 11.0 ± 6.1 | 10.7 ± 7.1 | \n | Stage REM% | 25.6 ± 4.8 | 17.7 ± 8.1* | 18.6 ± 10.7* | \n | REM cycles | 4.1 ± 1 | 3.9 ± 0.9 | 3.8 ± 1.3 | \n |"
},
{
"role": "assistant",
"content": "Stage shifts | 69.3 ± 14.8 | 73.5 ± 19.5 | 69.1 ± 16.3 | \n | Arousal Index | 8.5 ± 3.9 | 9.1 ± 3.8 | 8.9 ± 3.6 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5697352_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the picture as Markdown code."
},
{
"role": "assistant",
"content": "<md> | <COLSPAN=2> | Number | Percent | \n | --- | --- | --- | --- | \n | <ROWSPAN=2> Gender | Female | 15 | 57.69 | \n | Male | 11 | 42.31 | \n | <ROWSPAN=2> Age group | 65–74 | 10 | 38.46 | \n | 75+ | 16 | 61.54 | \n | <ROWSPAN=3> Prescribed medicines | ≤6 | 7 | 26.92 | \n | 7–10 | 8 | 30.77 | \n | 11+ | 11 | 42.31 | \n | <ROWSPAN=3> Long-term conditions | 2–3 | 7 | 26.92 | \n | 4–5 | 7 | 26.92 | \n | 6+ | 12 | 46.15 | \n | <ROWSPAN=2> Requires mobility aid | Yes | 9 | 34.62 | \n | No | 17 | 65.38 | \n | <ROWSPAN=3> Living status | Alone | 7 | 26.92 | \n | With partner | 16 | 61.54 | \n | With family member | 3 | 11.54 | \n | <ROWSPAN=3> Index of Multiple Deprivation (IMD) Decilea | 1–2 | 9 | 34.62 | \n | 3–4 | 12 | 46.15 | \n | 5+ | 4 | 15.38 | \n | <COLSPAN=2> Total number of patients | 26 | 100.00 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3671570_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the diagram content behind with markdown code: <md> | Region | Hemisphere | Cluster size | Peak voxel (x) | Peak voxel (y) | Peak voxel (z) | Maximum Z-value | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=7> HABITUATION EFFECT OF THE STRESSFUL TASK"
},
{
"role": "assistant",
"content": "| \n | Cerebellum crus I | R | 13957 | 28 | −80 | −22 | 4.36 | \n | amygdala | L | | −28 | −6 | −14 | 3.74 | \n | hippocampus | L | | −32 | −26 | −11 | 3.01 | \n | temporal pole | L | | −42 | −12 | −30 | 4 | \n | | R | | 40 | 0 | −36 | 3.92 | \n | cerebellum vermis | L | | −6 | −49 | −23 | 3.28 | \n | fusiform gyrus | L | | −28 | −56 | −6 | 3.52 | \n | | R | | 36 | −36 | 19 | 2.87 | \n | Lateral parietal cortex | R | 1801 | 32 | −70 | 54 | 3.47 | \n | <COLSPAN=7> HABITUATION EFFECT OF THE MINDFUL BREATHING TASK | \n | Midbrain | L | 1862 | −6 | −16 | −16 | 4.7 | \n | midbrain | R | | 6 | −10 | −12 | 3.7 | \n | pons | R | | 2 | −20 | −24 | 4.25 | \n | thalamus | L | | −20 | −20 | −10 | 3.71 | \n | hippocampus | L | | −40 | −20 | −16 | 3.73 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3148547_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | | <COLSPAN=3> Hazard Ratio | \n | | Estimate | 95% CI | p value** | \n | --- | --- | --- | --- | \n | Treatment Groups | | | | \n | SRS* | <COLSPAN=3> reference | \n | Surgery + SRS | 0.68 | 0.49-0.94 | 0.020 | \n | WBRT + SRS | 0.99 | 0.93-1.05 | 0.660 | \n | Surgery + WBRT + SRS | 0.79 | 0.61-1.02 | 0.070 | \n | WBRT | 1.94 | 1.37-2.73 | <0.001 | \n | Surgery + WBRT | 1.04 | 0.76-1.43 | 0.800 | \n | Age at diagnosis | | | | \n | <65* | <COLSPAN=3> reference | \n"
},
{
"role": "assistant",
"content": "| ≥65 | 1.21 | 0.91-1.62 | 0.190 | \n | ECOG-PS | | | | \n | 0* | <COLSPAN=3> reference | \n | 1 | 1.07 | 0.58-1.95 | 0.830 | \n | 2 | 1.67 | 1.02-2.72 | 0.040 | \n | 3 | 4.58 | 4.28-4.91 | <0.001 | \n | 4 | 11.26 | 5.98-21.2 | <0.001 | \n | Primary Tumor Histology | | | | \n | NSCLC* | <COLSPAN=3> reference | \n | SCLC | 1.11 | 0.97-1.26 | 0.130 | \n | Breast | 0.87 | 0.78-0.96 | <0.001 | \n | Melanoma and Renal-cell | 1.17 | 1.06-1.3 | <0.001 | \n | Other | 1.41 | 0.95-2.1 | 0.080 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5432995_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Theme | Quotationsa | \n | --- | --- | \n | Perceived risks of APOSTEL VI study | HCP06, gynaecologist-in-training: A pessary is low risk, because you don’t have the connection with the child.HCP03, gynaecologist-in-training:"
},
{
"role": "assistant",
"content": "We insert a device that is foreign to the body of which we know that it gives a local reaction, and if that is an inflammatory reaction it might just as well result in premature birth. So therefore it could also actually be a higher risk.HCP04, gynaecologist-in-training: Why would you do an intervention, why would we do something that has not been proven? I also wonder what the working mechanism of the pessary is, nobody can tell me, not even the big advocates.HCP14, gynaecologist: I don’t believe in the intervention at all, and luckily I don’t have to counsel for the study, but I do think that if you don’t know if something works the best way to find out is to conduct a study.PW03, participating in APOSTEL VI: They just don’t know if it [the pessary] results in an extended gestational time. But real risks, no I don’t think those were described.PW14, participating in APOSTEL VI: It’s very clear in the study that the risks are really very low, and that it won’t result in a premature birth which is the most important thing. | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4087283_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the image content behind with markdown code: <md> | Maternal characteristics | r value4 | P value | \n | --- | --- | --- | \n | Age (years) | 0.17 | 0.04 | \n | Weight (kg) | −0.11 | 0.18 | \n | Phytate : calcium1,2 | −0.11 | 0.18 | \n | Calcium (mg/d)1 | 0.09 | 0.25 | \n | Phosphorus (mg/d) | 0.10 | 0.20 | \n | Sun exposure index1,3 | 0.35 | <0.001 | \n | Time of day (24 hours) | −0.11 | 0.18 | \n | | Mean (95% CI)5 | P value | \n | Hospital | | | \n | Private nursing home (n"
},
{
"role": "assistant",
"content": "= 68) | 11.8 (10.8, 12.9) | <ROWSPAN=2> 0.002 | \n | Government (n = 82) | 9.8 (9.1, 10.6) | \n | Parity | | | \n | First pregnancy (n = 118) | 10.6 (9.9, 11.3) | <ROWSPAN=2> 0.71 | \n | >1 pregnancy (n = 32) | 10.9 (9.5, 12.5) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4570258_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | Characteristic | Category 1 | Category 2 | Category 3 | Total | \n | --- | --- | --- | --- | --- | \n | Preventiona | n = 34 | n = 862 | n = 1,485 | n = 2,381 | \n | Slept under ordinary net | 18(52.9) | 319(37.0) | 653(44.0) | 990(41.6) | \n | Slept under treated bed net | 17(50.0) | 549(63.7) | 749(50.4) | 1,315(55.2) | \n | Repellants | 5(14.7) | 128(14.8) | 152(10.2) | 285(12.0) | \n | Treated clothes | 1(2.9) | 70(8.1) | 97(6.5) | 168(7.1) | \n | Treated hammock | 0(0.0) | 75(8.7) | 84(5.7) | 159(6.7) | \n | Herbal decoctions | 1(2.9) | 48(5.6) | 74(5.0) | 123(5.2) | \n | Indigenous medicine | 2(5.9) | 77(8.9) | 96(6.5) | 175(7.3) | \n | <COLSPAN=5> Preferred measure a | \n | Slept under ordinary net | 14(41.2) | 116(13.5) | 263(17.7) | 393(16.5) | \n | Slept under treated net | 18(52.9) | 605(70.2) | 973(65.5) | 1,596(67.0) | \n | Repellants | 1(2.9) | 13(1.5) | 48(3.2) | 62(2.6) | \n | Treated clothes | 0(0.0) | 8(0.9) | 26(1.8) |"
},
{
"role": "assistant",
"content": "34(1.4) | \n | Treated hammock | 0(0.0) | 14(1.6) | 11(0.7) | 25(1.0) | \n | Herbal decoctions | 0(0.0) | 6(0.7) | 16(1.1) | 22(0.9) | \n | Indigenous medicine | 0(0.0) | 20(2.3) | 59(4.0) | 79(3.3) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4317703_011_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the table in Markdown format."
},
{
"role": "assistant",
"content": "<md> | Gene | Direction | Sequence (5′–3′) | Amplicon size (bp) | \n | --- | --- | --- | --- | \n | Agactin | Forward | CTTCCTGCCATATATGATTGG | 210 | \n | | Reverse | GCCAGCACCTCGATCTTCATG | | \n | AgPAL | Forward | AATAGACTTGAGGCATTTGGAGG | 121 | \n | | Reverse | ACAGAATCTTGAGGGATGGAGTT | | \n | AgC4H | Forward | TCCTGATTTGGCTAAAGATGT | 137 | \n | | Reverse | TCTTCCTCCAATGCTCACTAT | | \n | AgC3H | Forward | AAGAGGAGCTGGACCGGGTAA | 148 | \n | | Reverse | TTGGCACTGGCTTTGTGAGGG | | \n | AgF5H | Forward | CTTCATTCTTCCGCTGCTTAGTT | 136 | \n | | Reverse | TTTAGCCAGTCCACGATGAGATA | | \n | Ag4CL | Forward | GGCAACTTCTGAAACATTGGTAG | 131 | \n | | Reverse | GGACCTGGTATCCCTTGTACTTTAT | | \n | AgHCT | Forward | TTACTTCCTCCACTCCCACCA | 146 | \n | | Reverse | TAATCATTGTCCATCCGTGCC | | \n | AgCOMT | Forward | GATGAGGGAAAGGTAGTTGTTGC | 93 | \n | | Reverse | ATAGGCGTCTAACTGAAGGACAG | | \n | AgCCoAOMT | Forward | GGCTTCTAATGCTGAATCCAAAC | 129 | \n | | Reverse | CTAAGCTCTTTCATTGCCTCTGG | | \n | AgCCR | Forward | GCTGGGCTTTCTGGCTATTCT | 82 | \n | | Reverse | TTGCTGCACATGCCTCGATTA | | \n | AgCAD | Forward | GGCTACATAGCATCATGGCTTGT | 134 | \n | | Reverse | TGAAGTCTATCCTTGGCTCCCTC | | \n | AgPOD | Forward | TGTTGCTTTGGCGAATGGTCC | 98 | \n | | Reverse | TAACATCCGGCATATCCTCTG | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3847173_001_01.png"
] | [
{
"role": "user",
"content": "<|image|>Render the photo in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | General population | Bedouin | \n | --- | --- | --- | \n | Female | 36.55±10.82* | 42.97±15.57* | \n | Male | 35.75 ±12.66& | 44.35±14.12& | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4271345_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Predictor | β | 95% CI | P-value | \n | --- | --- | --- | --- | \n | Constant | −0.17 | −0.21, −0.13 | <0.01 | \n | Maternal Blood Lead (MBL) | 0.92 | 0.82, 1.03 | <0.01 | \n | Maternal TF P570S | 0.04 | −0.03, 0.11 | 0.28 | \n | MBL × Maternal TF P570S | −0.13 | −0.35, 0.09 | 0.24 | \n | Maternal HFE H63D | −0.07 | −0.14, 0.01 | 0.08 | \n | MBL × Maternal HFE H63D | −0.12 | −0.34, 0.11 | 0.32 | \n | Maternal HFE C282Y | −0.002 | −0.09, 0.09 | 0.97 | \n | MBL × Maternal HFE C282Y | −0.27 | −0.52, −0.01 | 0.04 | \n | Infant TF P570S | −0.06 | −0.13, 0.003 | 0.06 | \n | MBL × Infant TF P570S | −0.03 | −0.24, 0.18 | 0.81 | \n | Infant HFE H63D | 0.01 | −0.06, 0.08 | 0.77 | \n | MBL × Infant HFE H63D"
},
{
"role": "assistant",
"content": "| 0.10 | −0.11, 0.32 | 0.34 | \n | Infant HFE C282Y | −0.02 | −0.11, 0.07 | 0.65 | \n | MBL × Infant HFE C282Y | −0.05 | −0.28, 0.17 | 0.64 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5937539_019_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the image content behind with markdown code: <md> | Participants, N and location | Interview type | Core areas explored | \n | --- | --- | --- | \n | Sample 1. Depressed pregnant adolescents, (N = 8 from Kariobangi site) | Key informant interviews | Their personal/emotional experiences, relationships, and circumstances of pregnancy, family and social support available, interface with health facility, plans for future | \n | Sample 2. Caregivers of pregnant adolescents (N = 6 from both sites) | Key informant interviews | Their reaction to the pregnancy, resources available to support the adolescent, plans for future for adolescent and the baby, support from community and CHWs | \n | Sample 3. (i) Follow-up from sample 1: new adolescent mothers who gave birth,"
},
{
"role": "assistant",
"content": "(N = 9 from both sites); (ii) new adolescent mothers: (N = 13 from Kariobangi site) | (i) Key informant interviews(ii) One focused group discussion | Reflecting on their experience of pregnancy, evaluation of support available from family, partner, health facility, and CHWs. Knowledge about adolescent pregnancy, their mental health problems, referrals and support available to them and their caregivers, challenges in working with this group | \n | Sample 4. HW, CHWs, MCH staff/medical staff, (N = 20 from both sites) | Two focused group discussions | Experience and knowledge about adolescent pregnancy and their mental health problems, referrals and health facility support and engagement, challenges in being a bridge between families and the health care system | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2831022_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Render the illustration in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Investigator 1(analysis 1) | Investigator 1(analysis 2) | Investigator 2 | \n | --- | --- | --- | --- | \n | Inflow | 68 ± 11 | 71 ± 9 | 72 ± 12 | \n | Outflow | 67 ± 13 | 69 ± 13 | 70 ± 15 | \n | P-value | NS | NS | NS | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3218888_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | Reduced joint score | Joints, tendons and bursae included | \n | --- | --- | \n | 7-joint score [9] | On the clinically dominant side:Wrist, MCP 2 and 3, PIP 2 and 3, MTP 2 and 5Dorsal, ulnar and palmar tendon sheaths of the wrist, flexor tendon sheaths of 2 and 3 finger, paratendonitis dorsal 2 and 3 finger | \n | 12-joint score [10] | Bilateral examination of:Elbow, wrist, MCP 2 and 3, knee and ankleMedial and lateral tendon sheaths of the ankle | \n | 28-joint score [12] | Bilateral examination of:Shoulder (glenohumeral), elbow, wrist, MCP 1 to 5, PIP 1 to 5 and knee"
},
{
"role": "assistant",
"content": "| \n | 44-joint score [10] | Bilateral examination of:Shoulder (glenohumeral), elbow, wrist, MCP 1 to 5, PIP 1 to 5, hip, knee, ankle, mid-tarsal, MTP 1 to 5Biceps tendon sheath, extensor and flexor tendons sheaths of the wrist, flexor tendons sheaths of the fingers, anterior, medial and lateral tendon sheaths of the ankleSubdeltoid bursa | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4930982_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Locus | <COLSPAN=2> Tajima's D | <COLSPAN=2> Fu and Li's F* | <COLSPAN=2> Ramos‐Onsins and Rozas R2 | \n | I. spurius | I. fuertesi | I. spurius | I. fuertesi | I. spurius | I. fuertesi | \n | --- | --- | --- | --- | --- | --- | --- | \n | CR‐ mtDNA | −1.965* | −1.349 | −2.271 | −1.351 | 0.054 | 0.166 | \n | GADPH11 | −0.046 | 1.0921 | −0.637 | 1.375 | 0.101 | 0.177 | \n | TGFB2 | −1.276 | −1.008 | −2.264 | −2.098 | 0.067 | 0.091 | \n | RDP2 | −0.052 | −0.059 | −0.471 | 0.354 | 0.109 | 0.124 | \n | SLC9 | −1.965 | 1.014 | 0.152 | 1.309 | 0.087 | 0.186 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3126777_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the image in markdown code: <md> | | | | <COLSPAN=2> Cell Viability | \n | --- | --- | --- | --- | --- | \n | "
},
{
"role": "assistant",
"content": "| Compound | Dose | Human Non-small Cell Lung Cancer | Normal Diploid Fibroblasts | \n | XVI. (THR53) | Cyc-[FPPRGPRPVKLALKLALK] | 200 μM | _ _ _ | + + + | \n | XVII. (THR53C) | Cyc-[FPPRRPGPVKLALKLALK] | 200 μM | + + + | + + + | \n | XVIII. (THR54) | Cyc-[PRGPRPVALKLALKLAL] | 100 μM | _ _ _ | + + + | \n | XIX. (THR79) | Cyc-[PRGPRPvalklalklal] | 50 μM | _ _ _ | + + + | \n | XX. | Cyc-[PR(Me)GPRPVALKLALKLAL] | 200 μM | + +/- | N/D | \n | XXI. | Cyc-[PRGPR(Me)PVALKLALKLAL] | 200 μM | ++ + | N/D | \n | XII. | Cyc-[PR(Me)GPR(Me)PVALKLALKLAL] | 200 μM | + + + | N/D | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3108287_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following diagram content in markdown style: <md> | Item | Patients | \n | --- | --- | \n | Age (y) | 69.7 ± 9.4 | \n | Male/Female | 31/9 | \n | Weight (Kg) | 77 ± 9.5 | \n | BMI (Kg/m2) | 47.1 ± 4.8 | \n | Obesity (BMI > 30 Kg/m2) | 27 (67.5%) | \n | Hypertension | 27 (67.5%) | \n |"
},
{
"role": "assistant",
"content": "Diabetes | 14 (35%) | \n | Smoking | 10 (25%) | \n | Hypothyroidism | 2 (5%) | \n | Chronic Renal Failure | 11 (27.5%) | \n | COPD | 8 (20%) | \n | PVD | 1 (2.5%) | \n | Corticosteroid use | 1 (2.5%) | \n | CHF | 10 (25%) | \n | Re-operation | 3 (7.5%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4714535_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | | <COLSPAN=2> Model 1 | <COLSPAN=2> Model 2 | <COLSPAN=2> Model 3 | \n | | OR (95 % CI) | P | OR (95 % CI) | P | OR (95 % CI) | P | \n | --- | --- | --- | --- | --- | --- | --- | \n | Snoring status | | | | | | | \n | Non-snorers | 1.000 (reference) | | 1.000 (reference) | | 1.000 (reference) | | \n | Snorers | 1.734 (1.522–1.976) | <0.001 | 1.709 (1.495–1.953) | <0.001 | 1.371 (1.147–1.637) | <0.001 | \n"
},
{
"role": "assistant",
"content": "| Snoring intensity | | | | | | | \n | Non-snorers | 1.000 (reference) | | 1.000 (reference) | | 1.000 (reference) | | \n | Low | 1.352 (1.111–1.644) | 0.003 | 1.381 (1.131–1.687) | 0.002 | 1.094 (0.834–1.434) | 0.518 | \n | Normal | 1.767 (1.477–2.115) | <0.001 | 1.774 (1.476–2.133) | <0.001 | 1.436 (1.126–1.832) | 0.004 | \n | Strong | 2.025 (1.666–2.460) | <0.001 | 1.886 (1.545–2.302) | <0.001 | 1.462 (1.124–1.902) | <0.001 | \n | Very strong | 2.344 (1.745–3.149) | <0.001 | 2.199 (1.624–2.977) | <0.001 | 1.813 (1.273–2.684) | <0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3573897_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following illustration content in markdown style: <md> | | Casein diet | Chungkookjang (CKJ) diet | Jerusalem artichoke (HTL) diet | CKJ+HTL diet | \n | --- | --- | --- | --- | --- | \n | Casein (g) | 200 | 183 | 197 | 183 | \n | Methionine (g) | 3 | 3 | 3 | 3 | \n | Corn starch (g) | 300 | 295 | 273 | 260 | \n | Sucrose (g) | 200 | 200 | 200 | 200 | \n | Cellulose (g) | 34 | 14 | 14 | 0 | \n | Corn oil (g) | 50 | 44 | 50 | 43 | \n | Shortening (g) | 150 |"
},
{
"role": "assistant",
"content": "150 | 150 | 150 | \n | Mineral (g) | 35 | 33 | 35 | 33 | \n | Vitamin (g) | 10 | 10 | 10 | 10 | \n | Choline (g) | 2 | 2 | 2 | 2 | \n | Powder of CKJ (g) | 0 | 50 | 0 | 50 | \n | Powder of HTL (g) | 0 | 0 | 50 | 50 | \n | Total isoflavonoids (%) | - | 0.013 | - | 0.013 | \n | Isoflavonoid aglycones (%) | - | 0.012 | - | 0.012 | \n | Fructooligossaccharides including inulin (%) | | | 1.5 | 1.5 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5190975_012_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the diagram as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Test Enrollment | Conventional | EDoF | EdoF with Wiener | \n | --- | --- | --- | --- | \n | <ROWSPAN=4> Conventional | DoF = 6 cm | DoF = 18.4 cm | DoF = 0 cm | \n | SI = 4.3 | SI = 4.5 | SI = 3.3 | \n | FRR = 4.7% | FRR = 17.5% | FRR = 53.3% | \n | EER = 1.0% | EER = 2.9% | EER = 7.0% | \n | <ROWSPAN=4> EdoF | <ROWSPAN=4> | DoF = 22.2 cm | DoF = 4.5 cm | \n | SI = 4.0 | SI = 2.8 | \n | FRR = 23.0% | FRR = 18.3% | \n | EER = 3.3% | EER = 3.3% | \n | <ROWSPAN=4> EdoF with Wiener | <ROWSPAN=4> | <ROWSPAN=4> | DoF = 18.6 cm | \n | SI = 3.9 | \n | FRR = 23.3% | \n | EER = 3.3% | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3505747_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Crude associations | <COLSPAN=2> Model 2.1 | <COLSPAN=2> Model 2.2 | <COLSPAN=2> Model 2.3 | \n | | OR | 95% CI | OR | 95% CI | OR | 95% CI | OR | | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Gender: female | 1.169 | (0.705; 1.938) | 1.130 | (0.658; 1.942) | 1.291 | (0.742; 2.246) | 1.238 | (0.707; 2.170) | \n | Age | 1.045 | (0.986; 1.108) | 1.056 | (0.993; 1.124) | 1.058 | (0.993; 1.127) | 1.072* | (1.004; 1.144) | \n | Low educational level | 1.658* | (1.008; 2.728) | 1.577 | (0.931; 2.672) | 1.543 | (0.907; 2.624) | 1.640 | (0.943; 2.852) | \n | Health-related behaviour | 0.686** | (0.524; 0.898) | | | 0.678** | (0.511; 0.901) | 0.678** | (0.507; 0.905) | \n | Physical demands | 1.141 | (0.993; 1.312) | | | | | 1.007 | (0.856; 1.185) | \n | Psychological job demands | 1.673*** | (1.268; 2.207) | | | | | 1.438* | (1.017; 2.033) | \n | Job control | 0.565** | (0.383; 0.834) | | | | | 0.590* | (0.391; 0.892) | \n | ERI: ER ratio > 1 | 3.197*** | (1.800; 5.678) | 3.374*** | (1.881; 6.051) | 3.334*** | (1.852; 6.002) | 2.093* | (1.047; 4.183) | \n | N-R2 | | | 0.063 | | 0.084 | | 0.117 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5485471_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram into Markdown language."
},
{
"role": "assistant",
"content": "<md> | Substrate | Enzyme Added (ng) | Specific Activity μmol/min/mg a | \n | --- | --- | --- | \n | 2-Oxoglutaramate (2-OGM) b | 72.8 | 3.0 ± 0.9 (3) | \n | Succinamate c | 146 | 3.4 ± 0.3 (3) | \n | l-2-Hydroxyglutaramate (l-2-HGM) c | 291 | 1.4 ± 0.1 (7) | \n | l-2-Hydroxysuccinamate (l-2-HSM) d | 146 | 0.51 ± 0.18 (5) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5682903_003_02.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Group | HR/min | MAP (mmHg) | +dP/dtmax | −dP/dtmax | \n | --- | --- | --- | --- | --- | \n | Sham operated | 420.31 ± 17.41 | 134.44 ± 4.91 | 6145.63 ± 348.09 | 4903.41 ± 278.45 | \n | CA model | 336.63 ± 20.31∗∗ | 94.62 ± 7.64∗∗ | 3533.01 ± 135.81∗∗ | 2698.25 ± 199.32∗∗ | \n | CA + low dose | 391.34 ± 18.76‡ | 103.71 ± 4.92 | 3865.41 ± 219.76† | 2937.49 ± 301.76† | \n | CA + medium dose | 394.20 ± 17.76‡ | 105.29 ± 6.29 | 3904.03 ± 178.62‡§ | 3231.01 ± 210.93‡§ | \n | CA + high dose | 408.54 ± 16.29‡ | 114.94 ± 7.09‡§†† | 4376.29 ± 185.73‡¶‡‡ | 3813.13 ± 108.82‡¶‡‡ | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5027622_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | | Receiver | Male | Female | Chi square | P | \n | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=6> Female giver | Father/mother | 15 | 75 | 40 | <0.001 | \n | Brother/sister | 42 | 63 | 4.2 | 0.04 | \n | Son/daughter | 46 |"
},
{
"role": "assistant",
"content": "50 | 0.167 | 0.683 | \n | Brother’s/sister’s children | 4 | 22 | 12.462 | <0.001 | \n | Son’s/daughter’s children | 1 | 13 | 10.286 | 0.001 | \n | Other males/females | 95 | 220 | 49.603 | <0.001 | \n | <ROWSPAN=6> Male giver | Father/mother | 10 | 38 | 16.333 | <0.001 | \n | Brother/sister | 19 | 35 | 4.741 | 0.029 | \n | Son/daughter | 15 | 20 | 0.741 | 0.398 | \n | Brother’s/sister’s children | 3 | 17 | 9.8 | 0.002 | \n | Son’s/daughter’s children | 0 | 2 | n/a | n/a | \n | Other males/females | 172 | 109 | 14.125 | <0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4815075_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | | IL-26 (ng/ml) Uncontrolled asthma | n | IL-26 (ng/ml) Controlled asthma | n | p-value* | \n | --- | --- | --- | --- | --- | --- | \n | All patients | 4.4 (1.9–14) | 48 | 2.4 (1.3–4.5) | 28 | 0.077 | \n | Low B-EOS (≤ 0.3×109/L) | 4.6 (2.3–13) | 27 | 2.3 (1.3–4.5) | 22 | 0.038* | \n | High B-EOS (>0.3×109/L) | 4.1 (1.7–16) | 21 | 2.9 (1–31) |"
},
{
"role": "assistant",
"content": "5 | 0.61 | \n | Low FENO (≤18.3 p.p.b.) | 4.1 (2.2–16) | 23 | 2.0 (1.2–3.6) | 13 | 0.055 | \n | High FENO (>18.3 p.p.b) | 5.0 (1.8–13) | 25 | 2.7 (1.4–24) | 15 | 0.54 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5800055_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | | BC4CHEMD | BC2GM | AnatEM | JNLPBA | \n | --- | --- | --- | --- | --- | \n | UMN-rel | -0.15 | -0.14 | -0.08 | -0.07 | \n | UMN-sim | -0.38 | -0.34 | -0.34 | -0.3 | \n | MayoSRS | 0.08 | 0.04 | 0.18 | 0.12 | \n | Bio-SimVerb | 0.2 | 0.18 | 0.29 |"
},
{
"role": "assistant",
"content": "0.24 | \n | Bio-SimLex | 0.53 | 0.6 | 0.46 | 0.48 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5568054_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | Characteristic | n | <COLSPAN=3> Radiotherapy | p | \n | | | No (%) | Preoperative (%) | Postoperative (%) | | \n | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=6> Sex | \n | Male | 198 | 35 (66.0) | 89 (64.5) | 74 (73.3) | 0.341 | \n | Female | 94 | 18 (34.0) | 49 (35.5) | <COLSPAN=2> 27 (26.7) | \n | <COLSPAN=6> Age | \n | Mean ± SD (years) | 57 ± 16.8 | 67 ± 17.2 | 54 ± 16.3 | 55 ± 15.2 | <0.001 | \n | Race | | | | | | \n | White | 224"
},
{
"role": "assistant",
"content": "| 40 (75.5) | 99 (71.7) | 85 (84.2) | 0.095 | \n | Black | 23 | 5 (9.4) | 10 (7.2) | 8 (7.9) | | \n | Other and unknown | 45 | 8 (15.1) | 29 (21.0) | 8 (7.9) | | \n | <COLSPAN=6> Tumor grade | \n | G1–2 | 20 | 3 (5.7) | 7 (5.1) | 10 (9.9) | 0.118 | \n | G3–4 | 237 | 47 (88.7) | 108 (78.3) | 82 (81.2) | | \n | Unknown | 35 | 3 (5.7) | 23 (16.7) | 9 (8.9) | | \n | <COLSPAN=6> Tumor size (mm) | \n | Mean ± SD | 53.5 ± 25.1 | 55.4 ± 26.6 | 53.3 ± 25.6 | 52.8 ± 23.9 | 0.835 | \n | Number of RLNs (n) | | | | | | \n | Mean ± SD | 14.8 ± 11.6 | 13.3 ± 10.0 | 13.9 ± 10.1 | 16.9 ± 13.9 | 0.080 | \n | Number of PLNs (n) | | | | | | \n | Mean ± SD | 6.7 ± 7.2 | 8.3 ± 9.2 | 5.2 ± 5.8 | 7.9 ± 7.2 | 0.003 | \n | <COLSPAN=6> Tumor stage | \n | II | 51 | 11 (20.8) | 29 (21.0) | 11 (10.9) | 0.099 | \n | III | 241 | 42 (79.2) | 109 (79.0) | <COLSPAN=2> 90 (89.1) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1797029_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Method | Cohen's kappa | Sensitivity | Specificity | \n | --- | --- | --- | --- | \n | FISH versus CB11 | 83.0% (SE 5.3%) | 97% | 93% | \n | HercepTest versus FISH | | | | \n | (0–1 versus 2–3) versus FISH | 72.0% (SE 6.2%) | 92% | 87%"
},
{
"role": "assistant",
"content": "| \n | (0–2 versus 3) versus FISH | 79.2% (SE 6.0%) | 78% | 97% | \n | HercepTest versus CB11 | | | | \n | (0–1 versus 2–3) versus CB11 | 70.0% (SE 6.3%) | 100% | 85% | \n | (0–2 versus 3) versus CB11 | 84.2% (SE 5.4%) | 90% | 96% | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5494040_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | <ROWSPAN=2> Variable | <COLSPAN=2> Urinary tract infection | <ROWSPAN=2> Odds ratio | <ROWSPAN=2> Confidence interval | <ROWSPAN=2> P-value | \n | yes | No | \n | --- | --- | --- | --- | --- | --- | \n | Age | 64.503±18.66 | 61.26±19.47 | - | 0.619-5.857 | 0.015 | \n | Time of catheterization | 11.67 ± 17.65 |"
},
{
"role": "assistant",
"content": "7.69 ± 7.29 | - | 1.739-6.218 | 0.001 | \n | Gender | | | | | | \n | MaleFemale | 116(14.7%)140(22.7%) | 675(47.9%)478(33.9%) | 0.587 | 0.447–0.771 | 0.001 | \n | Perineal care | | | | | | \n | YesNo | 229(18.3%)11(0.9%) | 875(69.4%)145(11.5%) | 3.450 | 1.837–6.477 | 0.001 | \n | History of underlying disease | | | | | | \n | YesNo | 131(10.5%)106(805%) | 476(38.2%)534(42.4%) | 11.386 | 1.043–1.842 | 0.004 | \n | Antibiotic therapy before catheterization | | | | | | \n | YesNo | 126(9.7%)115(8.9%) | 577(44.5%)478(36.9%) | 0.908 | 0.686-1.201 | 0.004 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5985617_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <COLSPAN=2> Characteristic | Thyroid gland invasion | No thyroid gland invasion | P-value | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=2> Age (mean±SD) | 61.00±9.69 | 60.97±8.71 | 0.99 | \n | <ROWSPAN=2> Gender (n,%) | Male | 10 (83.3%) | 43 (89.5%) | <ROWSPAN=2> 0.61 | \n | Female | 2 (16.7%) | 5 (10.5%) | \n | <ROWSPAN=2> T subtype (n,%) | T3 | 11 (91.7%) | 29 (60.5%) | <ROWSPAN=2> 0.04 | \n | T4 | 1 (8.3%) | 19 (39.5%) | \n | <ROWSPAN=2> Grade (n,%) | Well differentiated | 11 (91.7%) | 25 (52%) | <ROWSPAN=2> 0.01 | \n | Moderately well differentiated | 1 (8.3%) | 23 (48%) | \n | <COLSPAN=2> Largest dimension of the tumor (mean±SD) | 6.50±1.69 | 4.96±1.36 | 0.004 | \n | <ROWSPAN=3> Site of laryngeal tumor (n, %) | Transglottic | 6 (50%) | 40 (83.4%) | <ROWSPAN=3> 0.008 | \n | Supraglottic | 4 (33.4%) | 4 (8.3%) | \n | Glottic | 2 (16.6%) | 4 (8.3%) | \n | <ROWSPAN=3> Thyroid surgery | TT | 4 (33.4%) | 20 (41.5%) | <ROWSPAN=3> 0.86 | \n | L | 7 (58.3%) | 23 (48%) | \n | PL | 1 (8.3%) | 5 (10.5%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5887190_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | Movement disorder | Treatment category | Treatment specifics | N | Positive effect (n) | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Dystonia | \n | | Pharmacological | | | | \n | | | Clonazepam | 1 | 1 |"
},
{
"role": "assistant",
"content": "\n | | | Gabapentin | 3 | 3 | \n | | | L-dopa | 2 | 1 | \n | | | Trihexyphenidyl | 8 | 3 | \n | | | Cessation of drug | 1 | 1 | \n | | Botulinum toxin | | 5 | 5 | \n | | Deep brain stimulation | | 5 | 4 | \n | | Paramedical | | 2 | 2 | \n | | Total dystonia | | 27 | 20 | \n | <COLSPAN=5> Myoclonus | \n | | Pharmacological | Clonazepam | 10 | 10 | \n | | Ketogenic diet | | 4 | 1 | \n | | Paramedical | | 4 | 2 | \n | | Total myoclonus | | 18 | 12 | \n | <COLSPAN=5> Other | \n | | Pharmacological | | | | \n | | | L-dopa | 4 | 4 | \n | | | Acetozolamide | 1 | 1 | \n | | | Cessation of drug | 4 | 2 | \n | | Botulinum toxin | | 1 | 1 | \n | | Paramedical | | 3 | 2 | \n | | Total other | | 13 | 10 | \n | <ROWSPAN=2> Difficult to classify | | | 2 | | \n | Pharmacological | L-dopa | 2 | 1 | \n | Total | | | 60 | 43 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5796577_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | Angle’s malocclusion | N (%) | P-value (Chi-Square) | \n | --- | --- | --- | \n | <COLSPAN=2> Occlusal traits | | \n | Angle’s Class 1 | 264 (52.8%) | <ROWSPAN=3> < 0.001 | \n | Angle’s Class 2 | 159 (31.8%) | \n | Angle’s Class 3 | 77 (15.4%) | \n | <COLSPAN=2> Overjet | | \n | Normal | 332 (66.4%) | <ROWSPAN=3> < 0.001 | \n | Excessive | 111 (22.2%) | \n | Reduced | 57 (11.4%) | \n | <COLSPAN=2> Overbite | | \n | Normal | 322 (64.4%) | <ROWSPAN=3> < 0.001 | \n | Excessive | 117 (23.4%) | \n | Reduced | 61 (12.2%) | \n | <COLSPAN=2> Crowding | | \n | Present | 236 (47.2%) | <ROWSPAN=2> 0.8944 | \n |"
},
{
"role": "assistant",
"content": "Absent | 264 (52.8%) | \n | <COLSPAN=2> Spacing | | \n | Present | 136 (27.2%) | <ROWSPAN=2> < 0.001 | \n | Absent | 364 (72.8%) | \n | <COLSPAN=2> Anterior crossbite | | \n | Present | 24 (4.8%) | <ROWSPAN=2> < 0.001 | \n | Absent | 476 (95.2%) | \n | <COLSPAN=2> Posterior crossbite | | \n | Present | 47 (9.4%) | <ROWSPAN=2> < 0.001 | \n | Absent | 453 (90.6%) | \n | <COLSPAN=2> Open bite | | \n | Present | 23 (4.6%) | <ROWSPAN=2> < 0.001 | \n | Absent | 477 (95.4%) | \n | <COLSPAN=2> Facial Profile | | \n | Straight | 246 (49.2%) | <ROWSPAN=3> < 0.001 | \n | Convex | 213 (42.6%) | \n | Concave | 41 (8.2%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1260023_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Oldest third (n = 2219) | Middle third (n = 2160) | Youngest third (n = 2373) | \n | --- | --- | --- | --- | \n | Year of birth | | | | \n | 1984 cohort | 45.1 | 48.1 | 47.3 | \n | 1985 cohort | 50.8 | 49.9 | 49.0 | \n | Gender | | | | \n | Female | 49.9 | 51.9 | 49.9 | \n | Ethnicity | | | | \n | Minority groups | 22.8 | 24.4 | 25.4 | \n | Parental educational level | | | | \n | Higher university | 16.9 | 17.7 | 17.8 | \n | Lower university | 26.6 | 26.0 | 27.9 | \n | Secondary | 37.4 | 37.9 | 36.5 | \n | Missing | 19.0 | 18.5 | 17.8 | \n | Social support | | | | \n | Family low | 43.8 | 41.5 | 41.6 | \n | Class low | 36.5 | 36.0 | 35.5 | \n | Teachers low | 41.5 | 41.4 | 39.2 | \n | Friends low | 43.1 | 41.5 | 40.9 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3570329_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the photo with markdown style: <md> | | n = 1681 | \n | --- | --- | \n | Age group, y, n (%) | | \n | · <20 | 60 (3.6) | \n | · 20–39 | 287 (17.0) | \n | · 40–59 | 516 (30.7) | \n | · 60–79 | 734 (43.7) | \n | · 80+ | 84 (5.0)"
},
{
"role": "assistant",
"content": "| \n | Mean age (SD) | 55.3 (17.8) | \n | Male/Female, n (%) | 729 (43.4)/952(56.6) | \n | Rate of comorbidities, n (%) | | \n | · Hypertension | 842 (50.1) | \n | · Heart disease | 695 (41.3) | \n | · Respiratory illness | 570 (33.9) | \n | · Diabetes | 549 (32.7) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3759960_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Regulators | Target genes | Anti-cancer drugs | Cell or tissue types | Function | Effect | References | \n | --- | --- | --- | --- | --- | --- | --- | \n | HuR | ER | Tamoxifen | Breast cancer cell | mRNA stability ↑ | Resistance ↑ | [13] | \n | HuR | COX-2 | Lapatinib | Breast cancer cell | mRNA stability ↑ | Invasion ↑Metastasis ↑ | [19] | \n | HuR | TGIF | ATO | Hepatocellular carcinoma cell | mRNA stability ↑ | Cell death ↓ | [16] | \n | HuR | dCK | Gemcitabine | Pancreatic cancer | Translation ↑ | Sensitivity ↑ | [17] | \n | HuR | BCL2 | Etoposide, Topotecan, Cisplatin | Glioma cell | Translation ↑ | Resistance ↑ | [21] | \n | HuR | TOP2A | Doxorubicin | Hela cell | Translation ↑ | Sensitivity ↑ | [25] | \n | HuR | Several targets | Doxorubicin | Breast cancer cell | Translation ↑ | Sensitivity ↑ | [24] | \n | HuR | Beta-tubulin | Cisplatin | Ovarian cancer cells | Translation ↑ | Resistance ↑ | [22] | \n | RBM3 | Unknown | Cisplatin | Epithelial ovarian cancer | Unknown | Sensitivity ↑ | [28] | \n | RBM5 | Unknown | Cisplatin | Non-small cell lung cancer | Unknown | Sensitivity ↑ | [29] | \n | IMP3 | BCRP | Doxorubicin, Mtoxantrone | Breast cancer cell | mRNA stability ↑ | Resistance ↑ | [30] | \n | CUG-BP1 | Survivin | Camptothecin | Oesophageal cancer | mRNA stability ↑ | Resistance ↑ | [31] | \n | BRF1 | cIAP2 | Cisplatin | Head and neck squamousCarcinoma cell lines | mRNA degradation | Sensitivity ↑ | [33] | \n | HnRNPs H1/H2 | TYMP | 5′-deoxyfluorouridine | Histiocytic lymphoma cell | Splicing | Resistance ↑ | [34] | \n | MTDH | Several targets | Mitomycin C, BIBF1120 | Endometrial cancer cell line | Stress granule formation? | Resistance ↑ | [38] | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5985109_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Average ± SD vitamin E levels (μg/mg HDL) | % change versus Hp 1-1 | \n | --- | --- | --- | \n | Hp 1-1 | 1.18 ± 0.62 | — | \n | Hp 2-1 | 0.99 ± 0.63 | −17% | \n | Hp 2-2 | 0.67 ± 0.62 | −43% | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6092497_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the diagram content behind with markdown code: <md> | | Placebo (n = 8) | β-alanine (n = 8) | \n | --- | --- | --- | \n | Age (years) | 30.3 ± 4.5 | 28.5 ± 3.2 | \n | Height (cm) | 173 ± 0.1 | 172 ± 0.1 | \n | Weight (kg) | 79.5 ± 11.2 | 73.4 ± 12.5 | \n |"
},
{
"role": "assistant",
"content": "Body mass index (kg/m2) | 25.6 ± 1.5 | 24.6 ± 2.2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3943370_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | Category | Reference level | Low exposure | Medium exposure | High exposure | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Cumulative tetrachloroethylene (for >1 μg/L –months: mean = 402.6, median = 269.5) | \n | Level* | ≤ 1 | >1 - 155 | >155 - 380 | >380 – 8,585 | \n | Number (%) | 66, 582 (43.0%) | 28,230 (18.2%) | 27,255 (17.6%) | 32,865 (21.2%) | \n | <COLSPAN=5> Cumulative trichloroethylene (for >1 μg/L –months: mean = 6,369.3, median = 5,289.0) | \n | Level* | ≤ 1 | >1 – 3,100 | >3,100 – 7,700 | >7,700 – 39,745 | \n | Number (%) | 64, 584 (41.7%) | 31,069 (20.1%) | 27,638 (17.8%) | 31,641 (20.4%) | \n | <COLSPAN=5> Cumulative vinyl chloride (for >1 μg/L –months: mean = 458.9,"
},
{
"role": "assistant",
"content": "median = 360.6) | \n | Level* | ≤ 1 | >1 - 205 | >205 - 500 | >500 – 2,800 | \n | Number (%) | 66, 470 (42.9%) | 27,651 (17.8%) | 28,063 (18.1%) | 32,748 (21.1%) | \n | <COLSPAN=5> Cumulative benzene (for ≥2 μg/L –months: mean = 104.7, median = 83.2) | \n | Level* | < 2 | 2 - 45 | >45 - 110 | >110 - 601 | \n | Number (%) | 64, 580 (41.7%) | 24,579 (15.9%) | 31,838 (20.5%) | 33,935 (21.9%) | \n | <COLSPAN=5> Cumulative TVOC (for >1 μg/L –months: mean = 9,605.1, median = 7,652.8) | \n | Level* | ≤ 1 | >1 – 4,600 | >4,600 – 12,250 | >12,250 - 64,016 | \n | Number (%) | 57, 328 (37.0%) | 35,432 (22.9%) | 29,687 (19.2%) | 32,485 (21.0%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5713219_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the picture in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | Residue | WT | R135K | Energy Difference b | \n | --- | --- | --- | --- | --- | \n | <ROWSPAN=6> NS1 | D29 | −3.25 (2.59) | −1.56 (2.39) | 1.69 | \n | Y30 | −3.02 (0.48) | −2.05 (0.77) | 0.97 | \n | K44 | 1.24 (0.65) | 1.62 (1.39) | 0.38 | \n | W72 | −6.02 (0.68) | −5.32 (0.73) | 0.70 | \n | W74 | −2.11 (0.91) | −1.52 (0.88) | 0.59 | \n | Y79 | −8.96 (0.87) | −8.04 (1.07) | 0.92 | \n | <ROWSPAN=5> H-Ras–GDP | R128 | −3.40 (2.33) | −1.15 (2.38) | 2.25 | \n | Q131 | −2.68 (1.36) | −2.01 (1.21) | 0.67 | \n | R135K | −10.56 (1.94) | −2.75 (3.27) | 7.81 | \n | I142 | −2.65 (0.76) | −2.34 (0.76) | 0.31 | \n | E143 | −1.70 (1.09) | −0.94 (1.29) | 0.76 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5759398_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the diagram as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Quadrant | Cases | Controls | p Value | \n | --- | --- | --- | --- | \n | Superior | 122.30±20.26 | 129.2±16.69 | 0.005 | \n | Inferior | 126.55±20.77 | 135.41±18.40 | 0.002 | \n | Nasal | 83.50±16.81 | 87.46±16.06 | 0.081 | \n | Temporal | 61.30±15.95 | 69.84±11.76 | 0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3167647_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | Vaccination | Baseline peak time | <COLSPAN=4> Relative reduction of peak attack rate (%) | <COLSPAN=4> Relative reduction of epidemic size (%) | \n | Country | | 15 Oc 30% cov | 15 Oct 60% cov | 15 Nov 30%"
},
{
"role": "assistant",
"content": "cov | 15 Nov 60% cov | 15 Oct 30% cov | 15 Oct 60% cov | 15 Nov 30% cov | 15 Nov 60% cov | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | US | (23 Sep–09 Nov) | (1–15) | (1–15) | (0–2) | (0–2) | (5–25) | (5–25) | (1–2) | (1–2) | \n | UK | (10 Oct–19 Nov) | (1–29) | (1–29) | 0 | (0–1) | (11–30) | (11–31) | (1–4) | (1–4) | \n | Canada | (04 Oct–14 Nov) | (1–21) | (1–21) | (0–1) | (0–1) | (10–30) | (10–32) | (1–5) | (1–5) | \n | France | (11 Oct–21 Nov) | (2–32) | (2–32) | (0–2) | (0–2) | (12–32) | (12–33) | (1–5) | (1–5) | \n | Italy | (17 Oct–23 Nov) | (5–38) | (5–38) | (0–1) | (0–1) | (13–35) | (13–36) | (1–5) | (1–5) | \n | Spain | (09 Oct–19 Nov) | (1–30) | (1–30) | (0–1) | (0–1) | (11–32) | (11–33) | (1–4) | (1–4) | \n | Germany | (11 Oct–20 Nov) | (2–34) | (2–34) | (0–1) | (0–1) | (12–33) | (12–34) | (1–4) | (1–4) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4517636_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the picture into Markdown language."
},
{
"role": "assistant",
"content": "<md> | | | <COLSPAN=3> Is TB communicable disease? | | | \n | Variables | Group | Yes, 432 (51.5 %) | No, 283 (33.7 %) | No idea, 124 (14.8 %) | χ2-value | p-value | \n | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Religion | Muslim | 383 (50.9 %) | 255 (33.9 %) | 114 (15.2 %) | <ROWSPAN=2> 1.218 | <ROWSPAN=2> 0.544 | \n | Hindu | 49 (56.32 %) | 28(33.7 %) | 10(12.0 %) | \n | <ROWSPAN=2> Gender | Male | 307 (53.7 %) | 178 (31.1 %) | 87 (15.2 %) | <ROWSPAN=2> 5.52 | <ROWSPAN=2> 0.043 | \n | Female | 125 (46.8 %) | 105 (39.3 %) | 37 (13.9 %) | \n | <ROWSPAN=4> Parents’ education | No Education | 71(53.8 %) | 38(28.8 %) | 23(17.4 %) | <ROWSPAN=4> 7.25 | <ROWSPAN=4> 0.298 | \n | Primary | 69(50.4 %) | 45(32.8 %) | 23(16.8 %) | \n | Secondary | 105(52.5 %) | 61(30.5 %) | 34(17.0 %) | \n | Higher | 187(50.5 %) | 139(37.6 %) | 44(11.9 %) | \n | <ROWSPAN=2> Residence | Rural | 314(53.1 %) | 182(30.8 %) | 95(16.1 %) | <ROWSPAN=2> 8.42 | <ROWSPAN=2> 0.015 | \n | Urban | 118(47.6 %) | 101(40.7 %) | 29(11.7 %) | \n | <ROWSPAN=2> Type of family | Single Family | 349(52.2 %) | 231(34.5 %) | 89(13.3 %) | <ROWSPAN=2> 5.79 | <ROWSPAN=2> 0.045 | \n | Joint Family | 83(48.8 %) | 52(30.6 %) | 35(20.6 %) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5596860_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the figure in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | OR | 95% CI | p | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Mortality related risk factors | \n | Mechanical ventilation | 2.4 | 0.933–6.211 | 0.069 | \n | Use of combined antibiotics | 4.22 | 1.293–13.791 | 0.017 | \n | <COLSPAN=4> Risk factors that lengthen total stay in hospital (days) | \n | Polymicrobial bacteremia | 117.148 | 73.634–160.663 | 0.00 | \n | Prior glycopeptide use | 41.96 | 12.697–71.223 | 0.05 | \n | Presence of central venous catheter | 32.970 | 3.871–62.069 | 0.027 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2649163_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | | FA1090* | CREE?† | NCCP11945‡ | CREE?† | \n | --- | --- | --- | --- | --- | \n"
},
{
"role": "assistant",
"content": "| previously reported: | | | | | \n | NMA2121 | not present | n/a | NGK_1900 | Yes | \n | NMB0397 | NGO1564** | no | NGK_1865/7 | Yes | \n | cvaB | unannotated†† | yes | NGK_0171 | Yes | \n | NMA0059 | unannotated | yes | NGK_2501 | Yes | \n | NMA0530 | NGO2162 | no | NGK_2641 | No | \n | new from this study: | | | | | \n | | NGO0243 | yes | NGK_0377 | Yes | \n | | NGO2104 | yes | NGK_2573 | Yes | \n | | NGO1597 | yes | NGK_1901‡‡ | No | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3900473_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the photo in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Code | ART regimenb | Time on ART | PVLc | | Mutations | Subtype | \n | | | (months) | | PR | RT | | \n | --- | --- | --- | --- | --- | --- | --- | \n | 0053 | 1a/1c | 40 | 13945 | M36I, H69K, T74S, L89M | - | C | \n | 1959 | 1c | 26 | 598 | M36I, H69K, T74S, L89M | - | C | \n | 3438 | 1d | 13 | 495 | M36I, H69K, L89M | - | C | \n | 1739 | 1b | 25 | 18239 | M36I, H69K, L89M | K103N | C | \n | 2369 | 1c | 19 | 25678 | M36I, H69K, L89M | M41L, L210W | C | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5353898_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the image into Markdown language."
},
{
"role": "assistant",
"content": "<md> | Positive | Negative | \n | --- | --- | \n | “Psychiatry will become the most in demand speciality in the future”“I am interested in the conditions and I think psychiatric patients are some of the most in need yet stigmatised” | “It’s slow paced; I think you generally have to wait a long time to see improvement”“Little hand-on skills”“Higher rates of depression in psychiatrists”“Listening to someone’s problems every day and not getting affected by it would be difficult for me” | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5486128_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the image with markdown style: <md> | <ROWSPAN=2> Compound | <ROWSPAN=2> RI | Peppermint Oil | Clove oil | \n | <COLSPAN=2> Content (%) | \n | --- | --- | --- | --- | \n | α-Pinene | 934 | 0.6 | – | \n | Sabinene | 968 | 0.2 | – | \n | β-Pinene | 974 | 1.0 | – | \n | p-Cymene | 1016 | 0.3 | – | \n | 1,8-Cineole | 1020 | 6.6 | – | \n | Limonene | 1025 | 2.4 | – | \n | trans-Sabinene hydrate | 1060 | 0.2 | – | \n | 2-Methylbutyl 2-methylbutanoate | 1094 | 0.1 | – | \n | Menthone | 1138 | 23.1 | – | \n | Isomenthone | 1145 | 3.8 | – | \n | Menthofuran | 1154 | 2.2 | – | \n | Neomenthol | 1155 | 3.3 | – | \n"
},
{
"role": "assistant",
"content": "| Menthol | 1163 | 43.9 | – | \n | Neoisomenthol | 1173 | 1.0 | – | \n | α-Terpineol | 1178 | 0.6 | – | \n | Isomenthol | 1179 | 0.2 | – | \n | Pulegone | 1218 | 1.2 | – | \n | Piperitone | 1237 | 0.4 | – | \n | Menthyl acetate | 1279 | 4.9 | – | \n | Eugenol | 1342 | – | 85.2 | \n | β-Burbonene | 1381 | 0.1 | – | \n | Methyleugenol | 1386 | – | 0.2 | \n | (E)-β-Caryophyllene | 1421 | 1.6 | 9.9 | \n | α-Humulene | 1453 | 0.1 | 1.9 | \n | Germacrene D | 1474 | 0.3 | – | \n | δ-Cadinene | 1513 | – | 0.4 | \n | (E)-β-Caryophyllene oxide | 1573 | 0.2 | 0.4 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3166733_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | Payload | CCD | IRMSS | WFI | \n | --- | --- | --- | --- | \n"
},
{
"role": "assistant",
"content": "| Sensor Type | Push-broom | Electro-mechanic | Push-broom | \n | Visible and near infrared bands (μm) | 1: 0.45–0.522: 0.52–0.593: 0.63–0.694: 0.77–0.895: 0.51–0.73 | 6: 0.50–0.90 | 10: 0.63–0.6911: 0.77–0.89 | \n | Shortwave infrared bands (μm) | | 7: 1.55–1.758: 2.08–2.35 | | \n | Thermal infrared bands (μm) | | 9: 10.4–12.5 | | \n | Resolution (m) | 19.5 | Band 6–8: 78Band 9: 156 | 258 | \n | View angle | 8.32° | 8.80° | 59.6° | \n | Swath wide (km) | 113 | 119.5 | 890 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3499390_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the picture to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Variables | N (%) | Ebp1 expression | + | ++ | +++ | p-value | \n | | | - | | | | | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=7> MMP9 | \n | - | 1 | 1 | 0 | 0 | 0 | <ROWSPAN=4> 0.0002 | \n | + | 1 | 0 | 0 | 1 | 0 | \n | ++ | 23 | 3 | 1 | 3 | 16 | \n | +++ | 41 | 6 | 8 | 20 | 7 | \n | <COLSPAN=7> ICAM-1 | \n | - | 50 | 8 | 8 | 16 | 18 | <ROWSPAN=4> 0.6192 | \n | + | 16 | 2 | 1 | 8 | 5 | \n | ++ | 0 | 0 | 0 | 0 | 0 | \n | +++ | 0 | 0 | 0 | 0 | 0 | \n | <COLSPAN=7> E-Cadherin | \n | - | 1 | 1 | 0 | 0 | 0 | <.0001 | \n | + | 24 | 8 | 6 | 10 | 0 | | \n | ++ | 18 | 1 | 3 | 13 | 1 | | \n | +++ | 22 | 0 | 0 | 1 | 21 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5129366_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Variable | <ROWSPAN=2> % >14 Days | <ROWSPAN=2> Crudep-Value | <COLSPAN=3> Received Mammogram Results ≤14 Days vs. >14 Days | \n | Adjusted Odds Ratio 1 | 95% CI | p-Value | \n | --- | --- | --- | --- | --- | --- | \n | Age | | 0.65 | | | 0.2 | \n | <50 years (n = 239) | 18.4 | <ROWSPAN=2> | 1.29 | <ROWSPAN=2> 0.87,1.90 | <ROWSPAN=2> | \n | 50–79 years (n = 1403) | 19.7 | ref | \n | Residential location | | <0.001 | | | <0.001 | \n | Major city (n = 910) | 11.0 | <ROWSPAN=4> | ref | | <ROWSPAN=4> | \n | Inner regional (n = 380) | 20.5 | 1.71 | 1.20, 2.44 | \n | Outer regional (n = 291) | 40.6 | 4.17 | 2.95, 5.91 | \n | Remote/very remote (n = 61) | 39.3 | 3.62 | 2.00, 6.54 | \n | Area-level disadvantage | | <0.001 | | | 0.07 | \n | Least disadvantaged (n = 707) | 12.3 | <ROWSPAN=3> | ref | | <ROWSPAN=3> | \n | Middle socioeconomic status (n = 329) | 19.2 | 1.38 | 0.94, 2.02 | \n | Most disadvantaged (n = 606) | 28.1 | 1.45 | 1.04, 2.01 | \n | Type of screening facility | | <0.001 | | | <0.001 | \n | BreastScreen (n = 1233) | 25.0 | <ROWSPAN=2> | 9.51 | <ROWSPAN=2> 5.21, 17.36 | <ROWSPAN=2> | \n | Private (n = 409) | 2.9 | ref | \n | Tumour size | | 0.06 | | | 0.01 | \n | <1.0 cm (n = 625) | 21.1 | <ROWSPAN=4> | ref | | <ROWSPAN=4> | \n | ≥1.0 cm to <2 cm (n = 694) | 18.6 | 0.66 | 0.49, 0.88 | \n | ≥2.0 cm (n = 316) | 18.0 | 0.63 | 0.44, 0.92 | \n | Missing (n = 7) | 28.6 | 3.15 | 0.41, 24.01 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1687200_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Stimulant | n | Nil (Basal level) | <COLSPAN=6> fMLP | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Time | | | 10 s | 30 s | 60 s | Calcium ionophore | EGTA | MnCl2 | \n | Normal | 25 | 291.24 ± 53.95 | 472.15# ± 106.93 | 466.93# ± 158.45 | 339.34# ± 69.58 | 728.07# ± 155.05 | 601.76# ± 155.55 | 193.14$ ± 39.20 | \n | CML | 27 | 236.69 ± 22.33 | 412.31# ± 106.52 | 384.76# ± 88.21 | 248.15# ±64.75 | 610.28# ± 158.6 | 601.84# ± 164.83 | 240.32# ± 75.77 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4917982_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | Electrical variable | Frequency (Hz) | Sensitivity score | r2 | \n | --- | --- | --- | --- | \n | Cp | 116 | 0.49 | 0.542 | \n | | 1250 | 0.46 | 0.524 | \n | | 13,458 | 0.50 | 0.605 | \n | Cs | 116 | 0.10 | 0.119 | \n | | 1250 | 0.29 | 0.331 | \n | | 13,458 | 0.38 | 0.436 | \n | Rp | 116 | 0.40 | 0.584** | \n | | 1250 | 0.45 | 0.635** | \n | | 13,458 | 0.38 | 0.599** | \n | Rs | 116 | 0.39 | 0.563** | \n | | 1250 | 0.44 | 0.615** | \n | | 13,458 | 0.44 | 0.639** | \n | G | 116 | 0.28 | 0.317 | \n | | 1250 | 0.35 | 0.394 | \n | | 13,458 | 0.45 | 0.502 | \n | Z | 116 | 0.39 | 0.574** | \n | | 1250 | 0.44 | 0.628** | \n | | 13,458 | 0.41 | 0.622** | \n | X | 116 | 0.18 | 0.281 | \n | | 1250 |"
},
{
"role": "assistant",
"content": "0.42 | 0.595** | \n | | 13,458 | 0.46 | 0.650** | \n | Θ | 116 | 0.00 | 0.197 | \n | | 1250 | 0.00 | 0.214 | \n | | 13,458 | 0.03 | 0.267 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3287911_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | Covariate | <COLSPAN=4> Case group (N = 209) | <COLSPAN=4> Control group (N = 488) | \n | | % | N | Mean | SD | % | N | Mean | SD | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Sex = male | 45.0 | 94 | | | 47.8 | 233 | | | \n | Smoking | 35.9 | 75 | | | 21.7 | 106 | | | \n | Q1 | | | 0.91 | 0.80 | | | −0.39 | 0.81 | \n | Q2 | | | 0.59 | 0.99 | "
},
{
"role": "assistant",
"content": "| | −0.25 | 0.89 | \n | Q4 | | | −0.80 | 0.99 | | | 0.34 | 0.78 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4848444_008_03.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <COLSPAN=2> Classifier | <COLSPAN=4> SVM | <COLSPAN=4> RF | \n | <COLSPAN=2> Features selection | None | SURF [28] | Fisher | RF Gini | None | SURF [28] | Fisher | RF Gini | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 12_3_4 | Acc. | 0.466 | 0.464 | 0.529 | 0.557 | 0.607 | 0.493 | 0.571 | 0.586 | \n | 1_23_4 | Acc. | 0.550 | 0.550 | 0.550 | 0.550 | 0.643 | 0.329 | 0.557 | 0.693 | \n | 1_2_3_4 | Acc. | 0.207 | 0.300 | 0.450 | 0.507 | 0.486 | 0.350 | 0.393 | 0.521 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3039950_012_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the picture in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | Bound | Unbound | Model | \n | --- | --- | --- | --- | \n | R1 | 1.9 | 4.9 | 2.0 | \n | R2 | 3.0 | 4.2 | 1.3 | \n | R3 | 2.5 | 3.7 | 1.4 | \n | R4 | 2.4 | 3.7 | 2.1 | \n | R5 | 2.1 | 3.2 | 1.8 | \n | R6 | 1.6 | 3.8 | 1.5 | \n | R7 | 1.0 | 3.9 | 1.8 | \n | R8 | 2.6 | 3.6 | 2.6 | \n | R9 | 2.4 | 3.7 | 1.2 | \n | R10 | 2.1 | 4.1 | 1.6 | \n | PIGS | 5.8 | 6.9 | 6.8 | \n | Bound | 2.0 | 1.9 | 1.1 | </md>"
}
] | mp_sft | PubTabNet | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.