instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'In order to study genes involved in whirling disease response, resistant and susceptible rainbow trout strains were exposed to M. cerebralis and RNA from skin tissue was converted to cDNA and hybridized onto microarrays.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; m. cerebralis]
<Options>: A: neurocallis
B: cranidium
C: salmo mykiss (aka oncorhynchus mykiss)
D: golden trout (aka oncorhynchus mykiss aguabonita)
E: micronisus
F: black sea salmon (aka salmo labrax)
G: glomus cerebriforme
H: encephalartos
I: salmo keta (aka oncorhynchus keta)
J: brook trout (aka salvelinus fontinalis)
K: None of the above. | [C; K] |
<Instruct>: Given the context 'In order to study genes involved in whirling disease response, resistant and susceptible rainbow trout strains were exposed to M. cerebralis and RNA from skin tissue was converted to cDNA and hybridized onto microarrays.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; m. cerebralis]
<Options>: A: encephalartos
B: neurocallis
C: cranidium
D: brook trout (aka salvelinus fontinalis)
E: salmo keta (aka oncorhynchus keta)
F: black sea salmon (aka salmo labrax)
G: micronisus
H: golden trout (aka oncorhynchus mykiss aguabonita)
I: glomus cerebriforme
J: None of the above. | [J; J] |
<Instruct>: Given the context 'A combined total of 17 genes or features (14 annotated genes, 3 unknown features) were differentially expressed in one or both strains following pathogen exposure and are involved with rainbow trout infection response to whirling disease exposure.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: river trout (aka salmo trutta fario)
B: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
C: brook trout (aka salvelinus fontinalis)
D: rainbow trout (aka oncorhynchus mykiss)
E: trouts, salmons & chars (aka salmoninae)
F: None of the above. | [D] |
<Instruct>: Given the context 'It is our hope that future genome sequencing will enable the construction of more comprehensive microarray platforms for economically important aquaculture species, such as Atlantic salmon and rainbow trout.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: salmo mykiss (aka oncorhynchus mykiss)
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: salmons and trouts (aka salmoniformes)
D: salmo gilae (aka oncorhynchus gilae)
E: trouts, salmons & chars (aka salmoninae)
F: pink salmon (aka oncorhynchus gorbuscha)
G: atlantic salmon (aka salmo salar)
H: salmo trutta (river trout) (aka salmo trutta)
I: japanese salmon (aka oncorhynchus masou)
J: None of the above. | [G; A] |
<Instruct>: Given the context 'It is our hope that future genome sequencing will enable the construction of more comprehensive microarray platforms for economically important aquaculture species, such as Atlantic salmon and rainbow trout.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: salmo trutta (river trout) (aka salmo trutta)
B: salmo salar (atlantic salmon) (aka salmo salar)
C: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
D: gila trout (aka oncorhynchus gilae)
E: salmons and trouts (aka salmoniformes)
F: coho salmon (aka oncorhynchus kisutch)
G: salmoneus
H: sockeye salmon (aka oncorhynchus nerka)
I: black sea salmon (aka salmo labrax)
J: salmon trout (aka oncorhynchus masou)
K: None of the above. | [B; C] |
<Instruct>: Given the context 'Additionally, the comparison of two rainbow trout strains (i.e., resistant versus susceptible) added another layer of complexity to the analysis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo gilae gilae (aka oncorhynchus gilae gilae)
B: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
C: brook trout (aka salvelinus fontinalis)
D: salmons and trouts (aka salmoniformes)
E: rainbow trout (aka oncorhynchus mykiss)
F: None of the above. | [E] |
<Instruct>: Given the context 'Viral Hemorrhagic Septicemia Virus (VHSV) induced protein and neighbor of COX-4 are the only annotated genes without known molecular functions.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [viral hemorrhagic septicemia virus; vhsv]
<Options>: A: viral hemorrhagic septicemia virus ia (viral hemorrhagic septicemia virus genotype ia) (aka viral hemorrhagic septicemia virus ia)
B: his1v (aka his 1 virus)
C: vibrio phage vhml (vibrio harveyi bacteriophage vhml) (aka vibrio phage vhml)
D: infectious hemorrhagic syndrome virus
E: harvey murine sarcoma virus
F: crimean-congo hemorrhagic virus (aka orthonairovirus haemorrhagiae)
G: vibrio phage vb_vhas-vhb1
H: haemorrhagic kidney syndrome virus
I: viral hemorrhagic septicemia virus vhsv (aka viral hemorrhagic septicemia virus)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'Viral Hemorrhagic Septicemia Virus (VHSV) induced protein and neighbor of COX-4 are the only annotated genes without known molecular functions.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [viral hemorrhagic septicemia virus; vhsv]
<Options>: A: infectious hemorrhagic syndrome virus
B: viral hemorrhagic septicemia virus (strain 07-71) (aka viral hemorrhagic septicemia virus 07-71)
C: vhmlvirus (vhml-like phages) (aka vhmlvirus)
D: shfv (aka simian hemorrhagic fever virus) (aka simian hemorrhagic fever virus)
E: vhev (aka vilyuisk human encephalomyelitis virus) (aka vilyuisk human encephalomyelitis virus)
F: vector vhb
G: viral hemorrhagic septicemia virus ia (viral hemorrhagic septicemia virus genotype ia) (aka viral hemorrhagic septicemia virus ia)
H: harvey murine sarcoma virus
I: hemorrhagic septicemia virus (aka viral hemorrhagic septicemia virus)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'Viral Hemorrhagic Septicemia Virus (VHSV) induced protein and neighbor of COX-4 are the only annotated genes without known molecular functions.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [viral hemorrhagic septicemia virus; vhsv]
<Options>: A: viral hemorrhagic septicemia virus ia (viral hemorrhagic septicemia virus genotype ia) (aka viral hemorrhagic septicemia virus ia)
B: viral hemorrhagic septicemia virus (strain 07-71) (aka viral hemorrhagic septicemia virus 07-71)
C: infectious hemorrhagic syndrome virus
D: vector vhb
E: vhev (aka vilyuisk human encephalomyelitis virus) (aka vilyuisk human encephalomyelitis virus)
F: harvey murine sarcoma virus
G: shfv (aka simian hemorrhagic fever virus) (aka simian hemorrhagic fever virus)
H: vhmlvirus (vhml-like phages) (aka vhmlvirus)
I: None of the above. | [I; I] |
<Instruct>: Given the context 'The interferon system is one of the first lines of host defense against invading pathogens for vertebrates (for review see [26]), including teleost fish (for review see [27]).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [teleost fish]
<Options>: A: fish (aka chondrichthyes) (aka chondrichthyes)
B: teleostean fish (aka teleost fish)
C: vertebrates (aka vertebrata <vertebrates>)
D: salmonid fish
E: fishes (aka actinopterygii)
F: None of the above. | [B] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: trouts, salmons & chars (aka salmoninae)
B: infectious pancreatic necrosis virus - sp (infectious pancreatic necrosis virus (serotype sp)) (aka infectious pancreatic necrosis virus - sp)
C: atlantic salmon (aka salmo salar)
D: sockeye salmon (aka oncorhynchus nerka)
E: infectious pancreatic necrosis virus ipnv (aka infectious pancreatic necrosis virus)
F: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
G: infectious spleen and kidney necrosis virus (isolate nanhai)
H: salmonivirus
I: isavirus salaris (salmon isavirus) (aka isavirus salaris)
J: sala virus
K: pin virus
L: aquabirnavirus salmonidae
M: japanese salmon (aka oncorhynchus masou)
N: king salmon (aka oncorhynchus tshawytscha)
O: atlantic salmon respirovirus
P: None of the above. | [E; I; C] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: infectious pancreatic necrosis virus (ipnv (aka infectious pancreatic necrosis virus))
B: salmonivirus
C: aquareovirus a (aka aquareovirus salmonis)
D: salmonidae (salmonids) (aka salmonidae)
E: salmo salar (atlantic salmon) (aka salmo salar)
F: japanese salmon (aka oncorhynchus masou)
G: salmon river virus
H: infectious pancreatic necrosis virus - mexico
I: nienokoue virus
J: infectious spleen and kidney necrosis virus (isolate nanhai)
K: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
L: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
M: isavirus salaris (salmon isavirus) (aka isavirus salaris)
N: salmondvirus
O: king salmon (aka oncorhynchus tshawytscha)
P: None of the above. | [A; M; E] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: aquabirnavirus salmonidae
B: pink salmon (aka oncorhynchus gorbuscha)
C: novirhabdovirus salmonid (salmonid novirhabdovirus) (aka novirhabdovirus salmonid)
D: infectious pancreatic necrosis virus (serotype jasper) (aka infectious pancreatic necrosis virus - jasper)
E: sala virus
F: infectious pancreatic necrosis virus - he
G: atlantic salmon (aka salmo salar)
H: salmonids (aka salmonidae)
I: ipnv (aka infectious pancreatic necrosis virus) (aka infectious pancreatic necrosis virus)
J: infectious pancreatic necrosis virus (serotype a5) (aka infectious pancreatic necrosis virus serotype a5)
K: isavirus salaris (salmon isavirus) (aka isavirus salaris)
L: infectious pancreatic necrosis virus - n1 (infectious pancreatic necrosis virus (strain n1)) (aka infectious pancreatic necrosis virus - n1)
M: atlantic salmon respirovirus
N: salmo mykiss (aka oncorhynchus mykiss)
O: chum salmon (aka oncorhynchus keta)
P: None of the above. | [I; K; G] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: infectious pancreatic necrosis virus (serotype jasper) (aka infectious pancreatic necrosis virus - jasper)
B: aquabirnavirus salmonidae
C: chum salmon (aka oncorhynchus keta)
D: infectious pancreatic necrosis virus (serotype a5) (aka infectious pancreatic necrosis virus serotype a5)
E: salmo mykiss (aka oncorhynchus mykiss)
F: salmonids (aka salmonidae)
G: atlantic salmon (aka salmo salar)
H: sala virus
I: novirhabdovirus salmonid (salmonid novirhabdovirus) (aka novirhabdovirus salmonid)
J: infectious pancreatic necrosis virus - he
K: infectious pancreatic necrosis virus - n1 (infectious pancreatic necrosis virus (strain n1)) (aka infectious pancreatic necrosis virus - n1)
L: atlantic salmon respirovirus
M: pink salmon (aka oncorhynchus gorbuscha)
N: ipnv (aka infectious pancreatic necrosis virus) (aka infectious pancreatic necrosis virus)
O: None of the above. | [N; O; G] |
<Instruct>: Given the context 'The PPAR-α-interacting complex protein 285 is a transcriptional co-activator with helicase activity [48] and has sequence similarity to a rainbow trout VHSV-induced protein.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; vhsv]
<Options>: A: vhmlvirus (vhml-like phages) (aka vhmlvirus)
B: salmo gilae gilae (aka oncorhynchus gilae gilae)
C: rainbow trout (aka oncorhynchus mykiss)
D: trouts, salmons & chars (aka salmoninae)
E: vhsv (aka viral hemorrhagic septicemia virus) (aka viral hemorrhagic septicemia virus)
F: brook trout (aka salvelinus fontinalis)
G: harvey murine sarcoma virus
H: vibrio phage vhml (vibrio harveyi bacteriophage vhml) (aka vibrio phage vhml)
I: vibrio phage vb_vhas-vhb1
J: salmon trout (aka oncorhynchus masou)
K: None of the above. | [C; E] |
<Instruct>: Given the context 'The PPAR-α-interacting complex protein 285 is a transcriptional co-activator with helicase activity [48] and has sequence similarity to a rainbow trout VHSV-induced protein.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; vhsv]
<Options>: A: vibrio harveyi bacteriophage vhml (aka vibrio phage vhml)
B: rainbow trout (aka oncorhynchus mykiss)
C: harvey murine sarcoma virus
D: salmo gilae gilae (aka oncorhynchus gilae gilae)
E: vhulanivirus
F: golden trout (aka oncorhynchus mykiss aguabonita)
G: salmo keta (aka oncorhynchus keta)
H: vhsv (aka viral hemorrhagic septicemia virus) (aka viral hemorrhagic septicemia virus)
I: salmon trout (aka oncorhynchus masou)
J: vhmlvirus vhml (vibrio virus vhml) (aka vhmlvirus vhml)
K: None of the above. | [B; H] |
<Instruct>: Given the context 'A critical phase in the early stages of M. cerebralis infection in trout is invasion and intracellular replication, processes that begin as early as one hour post exposure to triactinomyxons [16].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis]
<Options>: A: micronisus
B: encephalartos
C: striatula
D: mesopeplum
E: encephalus
F: None of the above. | [F] |
<Instruct>: Given the context 'A role for accumulated ubiquinated proteins in the lysosome in the killing of Mycobacterium tuberculosis has recently been described that has implications for a range of intracellular infections [58] and some similar responses to infection may be occurring for both resistant and susceptible strains.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mycobacterium tuberculosis]
<Options>: A: mycobacterium tuberculosis complex (mycobacterium complex) (aka mycobacterium tuberculosis complex)
B: mycobacterium lehmann and neumann 1896 (approved lists 1980) (aka mycobacterium)
C: mycobacterium tuberculosis bc (mycobacterium tuberculosis strain bc) (aka mycobacterium tuberculosis bc)
D: mycobacterium tuberculosis avium (aka mycobacterium avium)
E: mycobacterium tuberculosis (zopf 1883) lehmann and neumann 1896 (approved lists 1980) (aka mycobacterium tuberculosis)
F: None of the above. | [E] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: somniosus
B: mesopeplum
C: golden trout (aka oncorhynchus mykiss aguabonita)
D: salmo keta (aka oncorhynchus keta)
E: micronisus
F: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
G: black sea salmon (aka salmo labrax)
H: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
I: paregle
J: striatula
K: None of the above. | [K; H] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: river trout (aka salmo trutta fario)
B: cerebratulus
C: falco tinnunculus interstinctus (falco interstinctus) (aka falco tinnunculus interstinctus)
D: cranidium
E: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
F: salmons and trouts (aka salmoniformes)
G: glomus cerebriforme
H: cranistus
I: salmo keta (aka oncorhynchus keta)
J: rainbow trout (aka oncorhynchus mykiss)
K: None of the above. | [K; J] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: river trout (aka salmo trutta fario)
B: cranistus
C: glomus cerebriforme
D: cranidium
E: salmo keta (aka oncorhynchus keta)
F: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
G: cerebratulus
H: falco tinnunculus interstinctus (falco interstinctus) (aka falco tinnunculus interstinctus)
I: salmons and trouts (aka salmoniformes)
J: None of the above. | [J; J] |
<Instruct>: Given the context 'A role for host immune factors in the elimination of invading parasites, even in susceptible rainbow trout strains, is suggested by several prior light and electron microscopy studies that demonstrate an increase in degenerative stages in the skin beginning as early as 12 h and then their elimination by 24 h post-exposure to triactinomyxons [12,16,63].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: rainbow trout (aka oncorhynchus mykiss)
B: salmo gilae gilae (aka oncorhynchus gilae gilae)
C: river trout (aka salmo trutta)
D: sea trout (aka salmo trutta trutta)
E: japanese salmon (aka oncorhynchus masou)
F: None of the above. | [A] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: trouts, salmons & chars (aka salmoninae)
B: salmo mykiss (aka oncorhynchus mykiss)
C: salmo trutta (river trout) (aka salmo trutta)
D: black sea salmon (aka salmo labrax)
E: sea trout (aka salmo trutta trutta)
F: None of the above. | [B] |
<Instruct>: Given the context 'Given the high degree of statistical support and biological relevance of the candidate genes, we believe this study provides initial insight into rainbow trout genes and pathways responding to whirling disease infection and identifies the first candidate genes for whirling disease resistance.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo gilae gilae (aka oncorhynchus gilae gilae)
B: salmo mykiss (aka oncorhynchus mykiss)
C: salmo trutta (river trout) (aka salmo trutta)
D: black sea salmon (aka salmo labrax)
E: sea trout (aka salmo trutta trutta)
F: None of the above. | [B] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmons and trouts (aka salmoniformes)
B: rainbow trout (aka oncorhynchus mykiss)
C: salmo gilae gilae (aka oncorhynchus gilae gilae)
D: sea trout (aka salmo trutta trutta)
E: salmo keta (aka oncorhynchus keta)
F: None of the above. | [B] |
<Instruct>: Given the context 'Conclusion
The present study has provided the first examination into the genetic basis underlying rainbow trout's immune response and resistance to the whirling disease pathogen.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: river trout (aka salmo trutta)
B: black sea salmon (aka salmo labrax)
C: salmo keta (aka oncorhynchus keta)
D: river trout (aka salmo trutta fario)
E: salmo mykiss (aka oncorhynchus mykiss)
F: None of the above. | [E] |
<Instruct>: Given the context 'Several genes were significantly up-regulated in skin following pathogen exposure for both the resistant Hofer and susceptible Trout Lodge rainbow trout strains.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo mykiss (aka oncorhynchus mykiss)
B: black sea salmon (aka salmo labrax)
C: salmo keta (aka oncorhynchus keta)
D: salmo trutta (river trout) (aka salmo trutta)
E: brook trout (aka salvelinus fontinalis)
F: None of the above. | [A] |
<Instruct>: Given the context 'Methods
Animal care, pathogen exposure, and RNA preparation
Hofer and Trout Lodge rainbow trout strains were reared in 35 gallon aquaria with 15°C flow-through well water for nine weeks post-hatch, with each fish weighing approximately 6.5 grams prior to pathogen exposure.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: japanese salmon (aka oncorhynchus masou)
B: salmons and trouts (aka salmoniformes)
C: rainbow trout (aka oncorhynchus mykiss)
D: river trout (aka salmo trutta fario)
E: black sea salmon (aka salmo labrax)
F: None of the above. | [C] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
B: salmonidae (salmonids) (aka salmonidae)
C: river trout (aka salmo trutta)
D: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
E: salmo salar (atlantic salmon) (aka salmo salar)
F: salmon trout (aka oncorhynchus masou)
G: black sea salmon (aka salmo labrax)
H: king salmon (aka oncorhynchus tshawytscha)
I: chum salmon (aka oncorhynchus keta)
J: trouts, salmons & chars (aka salmoninae)
K: None of the above. | [E; D] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: coho salmon (aka oncorhynchus kisutch)
B: black sea salmon (aka salmo labrax)
C: salmons and trouts (aka salmoniformes)
D: salmo salar (atlantic salmon) (aka salmo salar)
E: sockeye salmon (aka oncorhynchus nerka)
F: salmo gilae gilae (aka oncorhynchus gilae gilae)
G: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
H: golden trout (aka oncorhynchus mykiss aguabonita)
I: salmoneus
J: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
K: None of the above. | [D; J] |
<Instruct>: Given the context 'For each rainbow trout strain, competitive hybridization was conducted on every array using equal amounts (8 μg) of differentially labeled aRNA from one control fish and one exposed fish.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: golden trout (aka oncorhynchus mykiss aguabonita)
B: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
C: black sea salmon (aka salmo labrax)
D: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
E: salmo gilae gilae (aka oncorhynchus gilae gilae)
F: None of the above. | [B] |
<Instruct>: Given the context 'The Significance Analysis of Microarrays (SAM) software package [75] was used to identify differentially expressed genes between exposed and unexposed control fish for each rainbow trout strain.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: rainbow trout (aka oncorhynchus mykiss)
B: brook trout (aka salvelinus fontinalis)
C: salmons and trouts (aka salmoniformes)
D: river trout (aka salmo trutta fario)
E: trouts, salmons & chars (aka salmoninae)
F: None of the above. | [A] |
<Instruct>: Given the context 'In situ hybridization indicates the photoreceptor layer has the highest level of P2Y2 receptor of any region in the rabbit retina, although staining was not pronounced in monkey', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: cattle (aka bos)
B: swamp rabbit (aka sylvilagus aquaticus)
C: rabbits (aka oryctolagus cuniculus)
D: european hare (aka lepus europaeus)
E: bovidae
F: None of the above. | [C] |
<Instruct>: Given the context 'A2 receptors have been recognized on cultured and fresh RPE cells for some time [26, 27], with in situ hybridization confirming the presence of A2A receptors in rat RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus rattoides (aka rattus pyctoris)
B: rattus sp. (rats (aka rattus sp.))
C: rattus norvegicus albus
D: rat (aka rattus) (aka rattus)
E: mus norvegicus (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Although adenosine alone does not increase intracellular Ca2+ levels [31], adenosine acts synergistically with ATP to elevate Ca2+ levels in human RPE cells by stimulating both A1 and A2A receptors', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: genus
B: macrobiotus sapiens
C: homo (humans) (aka homo)
D: probles
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'The P2Y2 receptor was initially characterized in cultured human RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: humans (aka homo)
C: animals (aka metazoa)
D: eutherian mammals (aka eutheria)
E: suborder
F: None of the above. | [A] |
<Instruct>: Given the context '[31], with subsequent reports localizing transcript for P2Y1, P2Y2, P2Y4, and P2Y6 in the rat RPE/choroid', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus sp. (rats (aka rattus sp.))
B: rattus norvegicus albus
C: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
D: black rat (aka rattus rattus)
E: norway rat (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context '[40], and functionally identifying a P2X receptor in rat RPE cells [41].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: house rat (aka rattus rattus)
C: rats (aka rattus sp.) (aka rattus sp.)
D: brown rat (aka rattus norvegicus)
E: rattus rattoides (aka rattus pyctoris)
F: None of the above. | [D] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bovidae
B: bos indicus (bos primigenius indicus) (aka bos indicus)
C: boveria
D: bovinae
E: bos bovis (aka bos taurus)
F: None of the above. | [E] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bovinae
B: boveria
C: bovidae
D: bos indicus (bos primigenius indicus) (aka bos indicus)
E: None of the above. | [E] |
<Instruct>: Given the context 'ATP, UTP, and the P2Y2 receptor agonist INS37217 decrease the size of subretinal fluid blebs when injected into subretinal space of rats [44].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rats]
<Options>: A: rattus norvegicus albus
B: rattus sp. (rats (aka rattus sp.))
C: rattus rattoides (aka rattus pyctoris)
D: house rat (aka rattus rattus)
E: norway rat (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context 'In both normal and rds +/- mice with experimentally induced detachment, INS31217 improves the ERG recovery and decreased cell death [45].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: western european house mouse (aka mus musculus domesticus)
B: mus musculus (house mouse) (aka mus musculus)
C: mus sp. (mice (aka mus sp.))
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mouse (aka mus <genus>)
F: None of the above. | [B] |
<Instruct>: Given the context 'INS37217 also reduces subretinal blebs in rabbits [46].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbits]
<Options>: A: european hare (aka lepus europaeus)
B: lepus cuniculus (aka oryctolagus cuniculus)
C: hares (aka lepus)
D: leporidae (rabbits and hares) (aka leporidae)
E: swamp rabbit (aka sylvilagus aquaticus)
F: None of the above. | [B] |
<Instruct>: Given the context 'NMDA also triggers a release of ATP when applied to the intact bovine RPE eyecup [51].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos (cattle) (aka bos)
B: bos sp.
C: dairy cow (aka bos taurus)
D: bovidae
E: boveria
F: None of the above. | [C] |
<Instruct>: Given the context 'The NMDA receptors and the ATP release sites have been functionally identified to the apical membrane of the bovine RPE, suggesting the neurotransmitter interactions could amplify the signal from any glutamate reaching subretinal space.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos sp.
B: bovinae
C: bos bovis (aka bos taurus)
D: bos (cattle) (aka bos)
E: bos bubalis (aka bubalus bubalis)
F: None of the above. | [C] |
<Instruct>: Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: western european house mouse (aka mus musculus domesticus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus (aka mus <genus>) (aka mus <genus>)
F: None of the above. | [D] |
<Instruct>: Given the context 'Degradation of ATP by the apical membrane of the fresh bovine eyecup and by ARPE-19 cells is inhibited by ARL67156 or βγmATP.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis bubalis (aka bubalus bubalis bubalis)
B: bos sp.
C: bos primigenius taurus (aka bos taurus)
D: boveria
E: bovinae
F: None of the above. | [C] |
<Instruct>: Given the context 'The production of adenosine from ATP at the apical membrane of the bovine RPE eyecup is inhibited by the ecto-5′-nucleotidase inhibitor αβmADP, confirming a role for this enzyme [63].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: boveria
B: bos indicus (bos primigenius indicus) (aka bos indicus)
C: cow (aka bos taurus) (aka bos taurus)
D: bovinae
E: bos taurus x bos indicus (aka bos indicus x bos taurus)
F: None of the above. | [C] |
<Instruct>: Given the context 'The enzyme is localized to rat RPE and ARPE-19 cells immunohistochemically.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rat (aka rattus norvegicus) (aka rattus norvegicus)
B: roof rat (aka rattus rattus)
C: rattus (rats (aka rattus))
D: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
E: rattus sp. (rats (aka rattus sp.))
F: None of the above. | [A] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: house rat (aka rattus rattus)
B: mus norvegicus (aka rattus norvegicus)
C: rattus norvegicus albus
D: rats (aka rattus sp.) (aka rattus sp.)
E: rattus rattoides (aka rattus pyctoris)
F: None of the above. | [B] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus sp.) (aka rattus sp.)
B: rattus rattoides (aka rattus pyctoris)
C: house rat (aka rattus rattus)
D: rattus norvegicus albus
E: None of the above. | [E] |
<Instruct>: Given the context '[63], although localization in mouse indicated larger amounts of ecto-5′-nucleotidase at the tips of adjacent Müller cells', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus cricetus (aka cricetus cricetus)
C: eastern european house mouse (aka mus musculus musculus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: potato (aka solanum tuberosum)
B: triticum aegilops (aka aegilops tauschii)
C: triticum aestivum subsp. aestivum (aka triticum aestivum)
D: solanum glabratum
E: tuberaria
F: solanum
G: triticum
H: triticum aethiopicum (aka triticum turgidum)
I: solanum giganteum
J: sweet potato (aka ipomoea batatas)
K: triticum x secale (aka x triticosecale)
L: solanum barbisetum
M: solanum rugosum
N: None of the above. | [A; A; C] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: chaco potato (aka solanum chacoense)
C: triticum tauschii (aka aegilops tauschii)
D: solanum trifolium
E: potato (aka solanum tuberosum)
F: solanum ipomoeoides
G: solanum arboreum
H: wild emmer wheat (aka triticum dicoccoides)
I: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
J: solanum crispum (chilean potato-tree) (aka solanum crispum)
K: sweet potato (aka ipomoea batatas)
L: triticum durum (aka triticum turgidum subsp. durum)
M: solanum annuum
N: solanum acuminatum
O: None of the above. | [E; E; I] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: potatoes (aka solanum tuberosum)
B: solanum vicinum
C: chaco potato (aka solanum chacoense)
D: triticum x secale (aka x triticosecale)
E: triticum strictum (aka secale strictum)
F: chinese-potato (aka dioscorea polystachya)
G: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
H: sweet potato (aka ipomoea batatas)
I: triticum
J: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
K: solanum barbisetum
L: triticum tauschii (aka aegilops tauschii)
M: solanum crispum (chilean potato-tree) (aka solanum crispum)
N: solanum canense
O: None of the above. | [A; A; J] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: triticum tauschii (aka aegilops tauschii)
B: chaco potato (aka solanum chacoense)
C: solanum crispum (chilean potato-tree) (aka solanum crispum)
D: solanum vicinum
E: triticum
F: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
G: triticum strictum (aka secale strictum)
H: triticum x secale (aka x triticosecale)
I: sweet potato (aka ipomoea batatas)
J: chinese-potato (aka dioscorea polystachya)
K: solanum canense
L: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
M: solanum barbisetum
N: None of the above. | [N; N; L] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: triticum
B: solanum
C: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
D: bread wheat (aka triticum aestivum)
E: triticum strictum (aka secale strictum)
F: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
G: chaco potato (aka solanum chacoense)
H: wild emmer wheat (aka triticum dicoccoides)
I: triticum x secale (aka x triticosecale)
J: solanum rugosum
K: None of the above. | [F; D] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: triticum
B: triticum aegilops (aka aegilops tauschii)
C: solanum
D: wild emmer wheat (aka triticum dicoccoides)
E: english wheat (aka triticum turgidum)
F: solanum rugosum
G: triticum sativum (aka triticum aestivum)
H: solanum giganteum
I: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
J: potato (aka solanum tuberosum)
K: None of the above. | [J; G] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: durum wheat (aka triticum turgidum subsp. durum)
B: solanum nutans
C: wild emmer wheat (aka triticum dicoccoides)
D: solanum glutinosum
E: solanum annuum
F: common wheat (aka triticum aestivum)
G: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
H: rivet wheat (aka triticum turgidum)
I: potato yam (aka dioscorea bulbifera)
J: one-grained wheat (aka triticum monococcum)
K: None of the above. | [F; G] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
B: triticum aethiopicum (aka triticum turgidum)
C: solanum ipomoeoides
D: triticum durum (aka triticum turgidum subsp. durum)
E: triticum strictum (aka secale strictum)
F: one-grained wheat (aka triticum monococcum)
G: solanum nutans
H: wheat (aka triticum aestivum)
I: solanum glutinosum
J: chilean potato-tree (aka solanum crispum)
K: None of the above. | [H; A] |
<Instruct>: Given the context 'For this purpose, conditions for electroporating isolated potato mitochondria were established.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: tuberaria
B: solanum
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: sweet potato (aka ipomoea batatas)
E: chaco potato (aka solanum chacoense)
F: None of the above. | [C] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: solanum
C: solanum glutinosum
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: triticum
F: triticum sativum (aka triticum aestivum)
G: solanum rugosum
H: potatoes (aka solanum tuberosum)
I: triticum aethiopicum (aka triticum turgidum)
J: one-grained wheat (aka triticum monococcum)
K: None of the above. | [H; F] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum glutinosum
B: triticum durum (aka triticum turgidum subsp. durum)
C: triticum
D: chaco potato (aka solanum chacoense)
E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
F: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
G: rivet wheat (aka triticum turgidum)
H: wild emmer wheat (aka triticum dicoccoides)
I: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
J: chilean potato-tree (aka solanum crispum)
K: None of the above. | [I; F] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: potato (aka solanum tuberosum)
B: chilean potato-tree (aka solanum crispum)
C: triticum
D: common wheat (aka triticum aestivum)
E: triticum tauschii (aka aegilops tauschii)
F: solanum nutans
G: tuberaria
H: one-grained wheat (aka triticum monococcum)
I: durum wheat (aka triticum turgidum subsp. durum)
J: air-potato (aka dioscorea bulbifera)
K: None of the above. | [D; A] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: wheat (aka triticum aestivum)
B: one-grained wheat (aka triticum monococcum)
C: english wheat (aka triticum turgidum)
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: sweet potato (aka ipomoea batatas)
F: triticum x secale (aka x triticosecale)
G: triticum strictum (aka secale strictum)
H: potato (aka solanum tuberosum)
I: solanum rugosum
J: solanum annuum
K: None of the above. | [A; H] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum
B: one-grained wheat (aka triticum monococcum)
C: solanum nutans
D: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
E: potatoes (aka solanum tuberosum)
F: triticum x secale (aka x triticosecale)
G: solanum rugosum
H: wheat (aka triticum aestivum)
I: english wheat (aka triticum turgidum)
J: tuberaria
K: None of the above. | [H; E] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: potato yam (aka dioscorea bulbifera)
B: solanum glutinosum
C: triticum x secale (aka x triticosecale)
D: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
E: solanum
F: potatoes (aka solanum tuberosum)
G: triticum durum (aka triticum turgidum subsp. durum)
H: one-grained wheat (aka triticum monococcum)
I: triticum tauschii (aka aegilops tauschii)
J: solanum ipomoeoides
K: None of the above. | [D; F] |
<Instruct>: Given the context 'In Arabidopsis thaliana 456 C-to-U editing events have been described (6).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [arabidopsis thaliana]
<Options>: A: arabidopsis thaliana x arabidopsis lyrata
B: arabidopsis thaliana x arabidopsis arenosa
C: fabiana
D: arabidopsis (cardaminopsis) (aka arabidopsis)
E: arabis thaliana (aka arabidopsis thaliana)
F: None of the above. | [E] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: sorghum sudanense (aka sorghum bicolor subsp. drummondii)
B: arabidopsis thaliana x arabidopsis arenosa
C: zea mays subsp. mays x zea perennis
D: zea mays var. japonica (aka zea mays)
E: sorghum bicolor var. virgatum (aka sorghum virgatum)
F: thale-cress (aka arabidopsis thaliana)
G: zea mays subsp. mays x zea mays subsp. parviglumis
H: arabidopsis thaliana x arabidopsis halleri
I: zea mays subsp. mays x zea mays subsp. mexicana
J: zea mexicana (aka zea mays subsp. mexicana)
K: arabidopsis thaliana x arabidopsis lyrata
L: vascular plants (aka tracheophyta)
M: sorghum hybrid cultivar
N: sorghum australiense
O: broomcorn (aka sorghum bicolor)
P: None of the above. | [F; O; D] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: ansola
B: zea mays subsp. mays x zea mays subsp. parviglumis
C: zea mays subsp. mays x zea mays subsp. mexicana
D: zea mays subsp. mays x zea perennis
E: euphyia
F: sorghum brachypodum
G: vascular plants (aka tracheophyta)
H: maize (aka zea mays)
I: common wild sorghum (aka sorghum arundinaceum)
J: annea
K: thale-cress (aka arabidopsis thaliana)
L: zea mexicana (aka zea mays subsp. mexicana)
M: sorghum bicolor x saccharum hybrid cultivar
N: sorghum bicolor var. virgatum (aka sorghum virgatum)
O: sorghum bicolor subsp. bicolor (aka sorghum bicolor)
P: None of the above. | [K; O; H] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: land plants (aka embryophyta)
B: thale-cress (aka arabidopsis thaliana)
C: common wild sorghum (aka sorghum arundinaceum)
D: zea mays subsp. ceratina (aka zea mays subsp. mays)
E: zea mexicana (aka zea mays subsp. mexicana)
F: annea
G: sorghum (hemisorghum) (aka sorghum)
H: zea mays var. japonica (aka zea mays)
I: australytta
J: sorghum bicolor x saccharum hybrid cultivar
K: saccharum x sorghum
L: zea mays subsp. mays x zea mays subsp. mexicana
M: avian (aka aves)
N: zea mays subsp. mays x zea perennis
O: sorghum bicolor (sorghum bicolor subsp. bicolor) (aka sorghum bicolor)
P: None of the above. | [B; O; H] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: solanum hirtum
B: potato (aka solanum tuberosum)
C: triticum aethiopicum (aka triticum turgidum)
D: solanum barbisetum
E: triticum x secale (aka x triticosecale)
F: solanum
G: triticum tauschii (aka aegilops tauschii)
H: one-grained wheat (aka triticum monococcum)
I: solanum giganteum
J: common wheat (aka triticum aestivum)
K: None of the above. | [B; J] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: triticum aestivum subsp. aestivum (aka triticum aestivum)
B: solanum florulentum
C: wild emmer wheat (aka triticum dicoccoides)
D: potatoes (aka solanum tuberosum)
E: solanum barbisetum
F: triticum tauschii (aka aegilops tauschii)
G: triticum durum (aka triticum turgidum subsp. durum)
H: solanum canense
I: solanum trifolium
J: one-grained wheat (aka triticum monococcum)
K: None of the above. | [D; A] |
<Instruct>: Given the context 'Using this model, we found that editing and splicing of cox2 transcripts were not linked in wheat mitochondria (15).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: triticum x secale (aka x triticosecale)
C: common wheat (aka triticum aestivum)
D: triticum
E: triticum strictum (aka secale strictum)
F: None of the above. | [C] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum strictum (aka secale strictum)
B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
C: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
D: solanum hirtum
E: potato (aka solanum tuberosum)
F: one-grained wheat (aka triticum monococcum)
G: triticum aegilops (aka aegilops tauschii)
H: triticum
I: tuberosum group
J: solanum pallidum
K: None of the above. | [E; C] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum luteum (aka solanum villosum)
B: triticum strictum (aka secale strictum)
C: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
D: solanum pallidum
E: solanum florulentum
F: triticum durum (aka triticum turgidum subsp. durum)
G: english wheat (aka triticum turgidum)
H: solanum esculentum (aka solanum lycopersicum)
I: potato (aka solanum tuberosum)
J: wild emmer wheat (aka triticum dicoccoides)
K: None of the above. | [I; C] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: english wheat (aka triticum turgidum)
B: triticum strictum (aka secale strictum)
C: wild emmer wheat (aka triticum dicoccoides)
D: triticum durum (aka triticum turgidum subsp. durum)
E: solanum florulentum
F: solanum luteum (aka solanum villosum)
G: solanum pallidum
H: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
I: solanum esculentum (aka solanum lycopersicum)
J: None of the above. | [J; H] |
<Instruct>: Given the context 'Five C residues are changed to U in potato mitochondria rps10 transcripts by editing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum glutinosum
B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
C: solanum crispum (chilean potato-tree) (aka solanum crispum)
D: solanum
E: tuberaria
F: None of the above. | [B] |
<Instruct>: Given the context 'To test this hypothesis, it was necessary to set up the conditions for electroporation of foreign DNA into S.tuberosum mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: potato (aka solanum tuberosum)
B: solanum florulentum
C: tuberosum group
D: solanum pallidum
E: solanum trifolium
F: None of the above. | [A] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: bread wheat (aka triticum aestivum)
B: triticum x secale (aka x triticosecale)
C: tuberaria
D: english wheat (aka triticum turgidum)
E: triticum
F: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
G: air-potato (aka dioscorea bulbifera)
H: wild emmer wheat (aka triticum dicoccoides)
I: sweet potato (aka ipomoea batatas)
J: solanum nutans
K: None of the above. | [F; A] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum nutans
B: sweet potato (aka ipomoea batatas)
C: solanum
D: wild emmer wheat (aka triticum dicoccoides)
E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
F: poulard wheat (aka triticum turgidum)
G: triticum aegilops (aka aegilops tauschii)
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: triticum sativum (aka triticum aestivum)
J: triticum strictum (aka secale strictum)
K: None of the above. | [E; I] |
<Instruct>: Given the context 'In contrast, a rps10 construct is correctly expressed and processed in cognate potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
B: chaco potato (aka solanum chacoense)
C: solanum nutans
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: solanum
F: None of the above. | [A] |
<Instruct>: Given the context 'This is the first report on DNA electroporation into potato mitochondria.
MATERIALS AND METHODS
Plasmids
All plasmids used in this study are based on the previously described pCOXII vector (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum
B: potato yam (aka dioscorea bulbifera)
C: solanum glutinosum
D: potato (aka solanum tuberosum)
E: chaco potato (aka solanum chacoense)
F: None of the above. | [D] |
<Instruct>: Given the context 'An NsiI restriction site was introduced at the initiation codon of the wheat cox2 open reading frame (ORF).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum
B: one-grained wheat (aka triticum monococcum)
C: triticum tauschii (aka aegilops tauschii)
D: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
E: wild emmer wheat (aka triticum dicoccoides)
F: None of the above. | [D] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum tuberosum var. boreale (aka solanum stoloniferum)
B: solanum esculentum (aka solanum lycopersicum)
C: potato (aka solanum tuberosum)
D: solanum paludosum
E: solanum glutinosum
F: None of the above. | [C] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum glutinosum
B: solanum tuberosum var. boreale (aka solanum stoloniferum)
C: solanum paludosum
D: solanum esculentum (aka solanum lycopersicum)
E: None of the above. | [E] |
<Instruct>: Given the context 'accession no. AF096321, containing the KpnI restriction sequence, and primer B derived from Triticum timopheevi cox2 (AF336134).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [triticum timopheevi]
<Options>: A: triticum timopheevii var. viticulosum
B: triticum timopheevii (triticum timonovum) (aka triticum timopheevii)
C: triticum militinae (aka triticum timopheevii subsp. timopheevii)
D: triticum aestivum var. subhostinflatum
E: triticum dicoccoides (triticum turgidum subsp. dicoccoides) (aka triticum dicoccoides)
F: None of the above. | [B] |
<Instruct>: Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum luteum (aka solanum villosum)
B: solanum succosum
C: tuberosum group
D: potato (aka solanum tuberosum)
E: solanum pallidum
F: None of the above. | [D] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum
B: solanum florulentum
C: solanum glutinosum
D: triticum aegilops (aka aegilops tauschii)
E: solanum ruvu
F: bread wheat (aka triticum aestivum)
G: one-grained wheat (aka triticum monococcum)
H: triticum strictum (aka secale strictum)
I: potatoes (aka solanum tuberosum)
J: solanum trifolium
K: None of the above. | [I; F] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum aestivum subsp. aestivum (aka triticum aestivum)
B: durum wheat (aka triticum turgidum subsp. durum)
C: solanum ruvu
D: solanum glabratum
E: potatoes (aka solanum tuberosum)
F: wild emmer wheat (aka triticum dicoccoides)
G: triticum tauschii (aka aegilops tauschii)
H: triticum strictum (aka secale strictum)
I: tuberosum group
J: solanum barbisetum
K: None of the above. | [E; A] |
<Instruct>: Given the context 'This 23 bp insertion provides a specific sequence allowing isolation of potato cox2 transcripts originating from the introduced DNA by RT–PCR.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum crispum (chilean potato-tree) (aka solanum crispum)
B: tuberaria
C: potato (aka solanum tuberosum)
D: solanum nutans
E: sweet potato (aka ipomoea batatas)
F: None of the above. | [C] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum giganteum
B: triticum x secale (aka x triticosecale)
C: triticum tauschii (aka aegilops tauschii)
D: triticum
E: one-grained wheat (aka triticum monococcum)
F: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
G: potato yam (aka dioscorea bulbifera)
H: chinese-potato (aka dioscorea polystachya)
I: solanum glutinosum
J: potato (aka solanum tuberosum)
K: None of the above. | [F; J] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum sativum (aka triticum aestivum)
B: triticum x secale (aka x triticosecale)
C: triticum durum (aka triticum turgidum subsp. durum)
D: solanum annuum
E: solanum ipomoeoides
F: potato (aka solanum tuberosum)
G: solanum
H: triticum tauschii (aka aegilops tauschii)
I: triticum aethiopicum (aka triticum turgidum)
J: solanum rugosum
K: None of the above. | [A; F] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum ipomoeoides
B: wild emmer wheat (aka triticum dicoccoides)
C: solanum
D: triticum aegilops (aka aegilops tauschii)
E: common wheat (aka triticum aestivum)
F: tuberaria
G: poulard wheat (aka triticum turgidum)
H: potatoes (aka solanum tuberosum)
I: solanum rugosum
J: triticum
K: None of the above. | [E; H] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: wheat (aka triticum aestivum)
B: triticum durum (aka triticum turgidum subsp. durum)
C: solanum ipomoeoides
D: wild emmer wheat (aka triticum dicoccoides)
E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
F: solanum
G: one-grained wheat (aka triticum monococcum)
H: solanum crispum (chilean potato-tree) (aka solanum crispum)
I: solanum glutinosum
J: english wheat (aka triticum turgidum)
K: None of the above. | [A; E] |
<Instruct>: Given the context 'The coding region was isolated from total S.tuberosum DNA by PCR using primers D1 and D2 containing the restriction sites NsiI and SpeI, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum hirtum
B: solanum glutinosum
C: solanum barbisetum
D: solanum paludosum
E: potato (aka solanum tuberosum)
F: None of the above. | [E] |
<Instruct>: Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: common wheat (aka triticum aestivum)
B: poulard wheat (aka triticum turgidum)
C: wild emmer wheat (aka triticum dicoccoides)
D: triticum x secale (aka x triticosecale)
E: triticum aegilops (aka aegilops tauschii)
F: None of the above. | [A] |
<Instruct>: Given the context 'For constructs MA and MAB containing the wheat cox2 C259 editing site, two consecutive insertions were carried out using primers: GGAAGATTGGATTACTATCGAAATTGCCCTGAATCA and TACTATCGAAATTATTCGGACCATGCCCTGAATCA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum sativum (aka triticum aestivum)
B: triticum tauschii (aka aegilops tauschii)
C: triticum strictum (aka secale strictum)
D: one-grained wheat (aka triticum monococcum)
E: wild emmer wheat (aka triticum dicoccoides)
F: None of the above. | [A] |
<Instruct>: Given the context 'Mitochondria purification
S.tuberosum cv.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum barbisetum
B: solanum succosum
C: solanum tuberosum var. boreale (aka solanum stoloniferum)
D: solanum trifolium
E: potato (aka solanum tuberosum)
F: None of the above. | [E] |
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum ipomoeoides
B: solanum annuum
C: tuberaria
D: potatoes (aka solanum tuberosum)
E: solanum nutans
F: None of the above. | [D] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.